#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VPS13D	55187	hgsc.bcm.edu	37	1	12336579	12336579	+	Silent	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:12336579C>T	ENST00000358136.3	+	19	3064	c.2934C>T	c.(2932-2934)ctC>ctT	p.L978L	VPS13D_ENST00000356315.4_Silent_p.L978L	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TTTCTGTGCTCAAGGTGTTTG	0.502											OREG0013110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L978L		Atlas-SNP	.											.	VPS13D	316	.	0			c.C2934T						.						124.0	116.0	119.0					1																	12336579		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon19			TGTGCTCAAGGTG	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.2934C>T	chr1.hg19:g.12336579C>T		92.0	0.0	679	38.0	19.0	NM_015378		Silent	SNP	ENST00000358136.3	hg19	CCDS30588.1																																																																																			.	.		0.502	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
TMCO4	255104	hgsc.bcm.edu	37	1	20009838	20009838	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:20009838C>T	ENST00000294543.6	-	16	1841	c.1600G>A	c.(1600-1602)Gcc>Acc	p.A534T	TMCO4_ENST00000375127.1_Missense_Mutation_p.A534T|TMCO4_ENST00000375122.2_Missense_Mutation_p.A494T|TMCO4_ENST00000489814.1_5'UTR	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	534						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CAGCCTGGGGCCAGCAAGAGC	0.672																																					p.A534T		Atlas-SNP	.											.	TMCO4	46	.	0			c.G1600A						.						30.0	33.0	32.0					1																	20009838		2203	4300	6503	SO:0001583	missense	255104	exon16			CTGGGGCCAGCAA		CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.1600G>A	chr1.hg19:g.20009838C>T	ENSP00000294543:p.Ala534Thr	192.0	0.0		93.0	48.0	NM_181719	Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Missense_Mutation	SNP	ENST00000294543.6	hg19	CCDS198.1	.	.	.	.	.	.	.	.	.	.	C	13.23	2.175506	0.38413	.	.	ENSG00000162542	ENST00000294543;ENST00000375127;ENST00000375122	T;T;T	0.33654	1.43;1.45;1.4	5.11	4.13	0.48395	.	0.134780	0.33959	N	0.004400	T	0.24005	0.0581	L	0.32530	0.975	0.30657	N	0.754778	P;P;B	0.39480	0.675;0.664;0.42	B;B;B	0.35353	0.145;0.201;0.099	T	0.11131	-1.0600	10	0.20046	T	0.44	-0.7187	11.776	0.51985	0.1755:0.8245:0.0:0.0	.	118;534;494	Q6ZSC6;Q5TGY1;Q5TGY1-2	.;TMCO4_HUMAN;.	T	534;534;494	ENSP00000294543:A534T;ENSP00000364269:A534T;ENSP00000364264:A494T	ENSP00000294543:A534T	A	-	1	0	TMCO4	19882425	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	2.562000	0.45914	2.532000	0.85374	0.563000	0.77884	GCC	.	.		0.672	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007658.1	NM_181719	
ASB17	127247	hgsc.bcm.edu	37	1	76397825	76397825	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:76397825A>T	ENST00000284142.6	-	1	291	c.152T>A	c.(151-153)cTg>cAg	p.L51Q		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	51					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						AATTTTTGCCAGTGATCTGTA	0.393																																					p.L51Q		Atlas-SNP	.											.	ASB17	53	.	0			c.T152A						.						148.0	138.0	142.0					1																	76397825		2203	4300	6503	SO:0001583	missense	127247	exon1			TTTGCCAGTGATC	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.152T>A	chr1.hg19:g.76397825A>T	ENSP00000284142:p.Leu51Gln	170.0	0.0		110.0	43.0	NM_080868	B1APB8|Q8N0X5	Missense_Mutation	SNP	ENST00000284142.6	hg19	CCDS671.1	.	.	.	.	.	.	.	.	.	.	A	18.48	3.634132	0.67130	.	.	ENSG00000154007	ENST00000284142	T	0.47869	0.83	6.08	6.08	0.98989	.	0.000000	0.45606	D	0.000348	T	0.46852	0.1414	L	0.27053	0.805	0.42010	D	0.990938	D	0.76494	0.999	D	0.85130	0.997	T	0.55872	-0.8072	10	0.87932	D	0	.	13.0348	0.58864	1.0:0.0:0.0:0.0	.	51	Q8WXJ9	ASB17_HUMAN	Q	51	ENSP00000284142:L51Q	ENSP00000284142:L51Q	L	-	2	0	ASB17	76170413	1.000000	0.71417	1.000000	0.80357	0.614000	0.37383	4.816000	0.62642	2.330000	0.79161	0.533000	0.62120	CTG	.	.		0.393	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868	
ABCA4	24	hgsc.bcm.edu	37	1	94548954	94548954	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:94548954C>A	ENST00000370225.3	-	7	898	c.812G>T	c.(811-813)aGa>aTa	p.R271I	ABCA4_ENST00000535735.1_Missense_Mutation_p.R271I	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	271					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCCCCAAGATCTCAGATTGAT	0.343																																					p.R271I		Atlas-SNP	.											.	ABCA4	275	.	0			c.G812T						.						187.0	206.0	199.0					1																	94548954		2203	4300	6503	SO:0001583	missense	24	exon7			CAAGATCTCAGAT	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.812G>T	chr1.hg19:g.94548954C>A	ENSP00000359245:p.Arg271Ile	70.0	0.0		49.0	11.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700008	0.48307	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.91351	-2.72;-2.83	5.59	3.71	0.42584	.	0.621054	0.16066	N	0.231250	D	0.86669	0.5988	M	0.72894	2.215	0.53688	D	0.999978	P;B	0.38745	0.645;0.237	B;B	0.44163	0.443;0.054	D	0.84529	0.0632	10	0.31617	T	0.26	.	10.2021	0.43089	0.0:0.7506:0.0:0.2494	.	271;271	F5H6E5;P78363	.;ABCA4_HUMAN	I	271	ENSP00000359245:R271I;ENSP00000437682:R271I	ENSP00000359245:R271I	R	-	2	0	ABCA4	94321542	0.981000	0.34729	1.000000	0.80357	0.967000	0.64934	0.860000	0.27871	1.499000	0.48617	0.655000	0.94253	AGA	.	.		0.343	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
PAPPA2	60676	hgsc.bcm.edu	37	1	176762782	176762782	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:176762782T>C	ENST00000367662.3	+	20	6271	c.5107T>C	c.(5107-5109)Tgg>Cgg	p.W1703R		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1703	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						TCTGGAGCACTGGATGGAACC	0.478																																					p.W1703R		Atlas-SNP	.											.	PAPPA2	665	.	0			c.T5107C						.						136.0	133.0	134.0					1																	176762782		2001	4161	6162	SO:0001583	missense	60676	exon20			GAGCACTGGATGG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.5107T>C	chr1.hg19:g.176762782T>C	ENSP00000356634:p.Trp1703Arg	117.0	0.0		146.0	27.0	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	hg19	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	T	14.63	2.591357	0.46214	.	.	ENSG00000116183	ENST00000367662	T	0.01804	4.63	5.17	5.17	0.71159	.	0.072004	0.64402	D	0.000009	T	0.03305	0.0096	L	0.53561	1.675	0.80722	D	1	B	0.32653	0.379	B	0.40165	0.321	T	0.50233	-0.8852	10	0.46703	T	0.11	-10.78	8.4751	0.33007	0.1733:0.0:0.0:0.8267	.	1703	Q9BXP8	PAPP2_HUMAN	R	1703	ENSP00000356634:W1703R	ENSP00000356634:W1703R	W	+	1	0	PAPPA2	175029405	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.871000	0.48459	1.946000	0.56461	0.533000	0.62120	TGG	.	.		0.478	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
COLGALT2	23127	hgsc.bcm.edu	37	1	183942764	183942764	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:183942764C>T	ENST00000361927.4	-	4	984	c.613G>A	c.(613-615)Gga>Aga	p.G205R	COLGALT2_ENST00000546159.1_Missense_Mutation_p.G205R	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	205					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)	p.G205*(1)									GGGGTGATTCCGCACCAGAAA	0.453																																					p.G205R		Atlas-SNP	.											.	.	.	.	1	Substitution - Nonsense(1)	lung(1)	c.G613A						.						123.0	140.0	134.0					1																	183942764		2203	4300	6503	SO:0001583	missense	23127	exon4			TGATTCCGCACCA	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.613G>A	chr1.hg19:g.183942764C>T	ENSP00000354960:p.Gly205Arg	81.0	0.0		112.0	7.0	NM_015101	O60327|Q9BZR0	Missense_Mutation	SNP	ENST00000361927.4	hg19	CCDS1360.1	.	.	.	.	.	.	.	.	.	.	C	32	5.118350	0.94385	.	.	ENSG00000198756	ENST00000546159;ENST00000361927	T;T	0.23348	1.91;1.91	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.62307	0.2417	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71593	-0.4546	10	0.87932	D	0	.	19.2163	0.93780	0.0:1.0:0.0:0.0	.	205;205	F5H3T5;Q8IYK4	.;GT252_HUMAN	R	205	ENSP00000439112:G205R;ENSP00000354960:G205R	ENSP00000354960:G205R	G	-	1	0	GLT25D2	182209387	1.000000	0.71417	0.992000	0.48379	0.987000	0.75469	7.556000	0.82233	2.535000	0.85469	0.585000	0.79938	GGA	.	.		0.453	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
HMCN1	83872	hgsc.bcm.edu	37	1	186076063	186076063	+	Silent	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:186076063A>T	ENST00000271588.4	+	70	11047	c.10818A>T	c.(10816-10818)ggA>ggT	p.G3606G	HMCN1_ENST00000367492.2_Silent_p.G3606G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3606	Ig-like C2-type 34.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTCCTGCAGGAGATGATGATA	0.363																																					p.G3606G		Atlas-SNP	.											.	HMCN1	797	.	0			c.A10818T						.						179.0	178.0	179.0					1																	186076063		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon70			TGCAGGAGATGAT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.10818A>T	chr1.hg19:g.186076063A>T		61.0	0.0		113.0	31.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.363	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
PLA2G4A	5321	hgsc.bcm.edu	37	1	186880396	186880396	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:186880396C>T	ENST00000367466.3	+	7	585	c.433C>T	c.(433-435)Cga>Tga	p.R145*	PLA2G4A_ENST00000442353.2_Intron|PLA2G4A_ENST00000466600.1_3'UTR	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	145	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.|Phospholipid binding. {ECO:0000305}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	CCCAGACCTACGATTTAGTAT	0.458																																					p.R145X		Atlas-SNP	.											.	PLA2G4A	125	.	0			c.C433T						.						165.0	170.0	169.0					1																	186880396		2203	4300	6503	SO:0001587	stop_gained	5321	exon7			GACCTACGATTTA	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.433C>T	chr1.hg19:g.186880396C>T	ENSP00000356436:p.Arg145*	112.0	0.0		177.0	61.0	NM_024420	B1AKG4|Q29R80	Nonsense_Mutation	SNP	ENST00000367466.3	hg19	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	C	37	6.620513	0.97709	.	.	ENSG00000116711	ENST00000367466	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.1102	11.4285	0.50025	0.1803:0.8196:0.0:0.0	.	.	.	.	X	145	.	ENSP00000356436:R145X	R	+	1	2	PLA2G4A	185147019	1.000000	0.71417	0.979000	0.43373	0.997000	0.91878	2.752000	0.47516	2.437000	0.82529	0.650000	0.86243	CGA	.	.		0.458	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	
EXO1	9156	hgsc.bcm.edu	37	1	242042426	242042426	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:242042426G>A	ENST00000366548.3	+	13	2483	c.1890G>A	c.(1888-1890)ttG>ttA	p.L630L	EXO1_ENST00000518483.1_Silent_p.L630L|EXO1_ENST00000348581.5_Silent_p.L630L	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	630	Interaction with MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			GCACAGCATTGCAGCAGTTCC	0.483								Editing and processing nucleases																													p.L630L		Atlas-SNP	.											.	EXO1	103	.	0			c.G1890A						.						89.0	84.0	85.0					1																	242042426		2203	4300	6503	SO:0001819	synonymous_variant	9156	exon13			AGCATTGCAGCAG	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.1890G>A	chr1.hg19:g.242042426G>A		160.0	0.0		205.0	15.0	NM_130398	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Silent	SNP	ENST00000366548.3	hg19	CCDS1620.1	.	.	.	.	.	.	.	.	.	.	G	2.775	-0.254860	0.05829	.	.	ENSG00000174371	ENST00000521202	.	.	.	5.72	2.71	0.32032	.	.	.	.	.	T	0.47563	0.1452	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34129	-0.9841	4	.	.	.	-6.3969	4.5686	0.12198	0.2555:0.1618:0.5827:0.0	.	.	.	.	T	29	.	.	A	+	1	0	EXO1	240109049	0.986000	0.35501	0.912000	0.35992	0.227000	0.25037	1.359000	0.34113	0.793000	0.33875	-0.145000	0.13849	GCA	.	.		0.483	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027	
HEATR5B	54497	hgsc.bcm.edu	37	2	37280689	37280689	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr2:37280689C>A	ENST00000233099.5	-	17	2556	c.2461G>T	c.(2461-2463)Gct>Tct	p.A821S	HEATR5B_ENST00000354531.2_Missense_Mutation_p.A821S	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	821						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				AGCTGCACAGCCTGCTGGCGG	0.299																																					p.A821S		Atlas-SNP	.											.	HEATR5B	185	.	0			c.G2461T						.						57.0	59.0	58.0					2																	37280689		2203	4300	6503	SO:0001583	missense	54497	exon17			GCACAGCCTGCTG	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2461G>T	chr2.hg19:g.37280689C>A	ENSP00000233099:p.Ala821Ser	523.0	0.0		376.0	155.0	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	ENST00000233099.5	hg19	CCDS33181.1	.	.	.	.	.	.	.	.	.	.	C	33	5.199134	0.94997	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.09255	3.0;3.0	5.85	5.85	0.93711	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	M	0.68317	2.08	0.80722	D	1	P	0.49185	0.92	P	0.49561	0.615	T	0.00106	-1.2055	10	0.52906	T	0.07	-22.1987	20.1736	0.98170	0.0:1.0:0.0:0.0	.	821	Q9P2D3	HTR5B_HUMAN	S	821	ENSP00000233099:A821S;ENSP00000346531:A821S	ENSP00000233099:A821S	A	-	1	0	HEATR5B	37134193	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.771000	0.85420	2.767000	0.95098	0.557000	0.71058	GCT	.	.		0.299	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
GYPC	2995	hgsc.bcm.edu	37	2	127453545	127453545	+	Missense_Mutation	SNP	G	G	A	rs200879714		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr2:127453545G>A	ENST00000259254.4	+	4	545	c.214G>A	c.(214-216)Gtc>Atc	p.V72I	GYPC_ENST00000464053.1_3'UTR|GYPC_ENST00000356887.7_Missense_Mutation_p.V51I|GYPC_ENST00000409836.3_Missense_Mutation_p.V53I	NM_002101.4	NP_002092.1	P04921	GLPC_HUMAN	glycophorin C (Gerbich blood group)	72						cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|prostate(2)|urinary_tract(1)	13	Colorectal(110;0.0533)			BRCA - Breast invasive adenocarcinoma(221;0.075)		TGTGGCCATCGTCCTAGTCTC	0.607																																					p.V72I	Melanoma(110;806 1600 6704 9981 33404)	Atlas-SNP	.											GYPC,right_upper_lobe,carcinoma,0,1	GYPC	27	.	0			c.G214A						.	G	ILE/VAL,ILE/VAL	0,4406		0,0,2203	196.0	153.0	167.0		214,157	2.4	0.3	2		167	3,8597	3.0+/-9.4	0,3,4297	yes	missense,missense	GYPC	NM_002101.3,NM_016815.2	29,29	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging,possibly-damaging	72/129,53/110	127453545	3,13003	2203	4300	6503	SO:0001583	missense	2995	exon4			GCCATCGTCCTAG		CCDS2136.1, CCDS46402.1, CCDS58724.1	2q14-q21	2014-07-19			ENSG00000136732	ENSG00000136732		"""CD molecules"", ""Blood group antigens"""	4704	protein-coding gene	gene with protein product		110750					Standard	NM_016815		Approved	GPC, GYPD, Ge, CD236, CD236R	uc002tnq.4	P04921	OTTHUMG00000131464	ENST00000259254.4:c.214G>A	chr2.hg19:g.127453545G>A	ENSP00000259254:p.Val72Ile	85.0	0.0		68.0	7.0	NM_002101	B2R522|Q53SV9|Q92642	Missense_Mutation	SNP	ENST00000259254.4	hg19	CCDS2136.1	.	.	.	.	.	.	.	.	.	.	G	11.53	1.666058	0.29604	0.0	3.49E-4	ENSG00000136732	ENST00000259254;ENST00000356887;ENST00000409836	T;T;T	0.17854	2.7;2.25;2.74	5.22	2.41	0.29592	.	.	.	.	.	T	0.11067	0.0270	L	0.47190	1.495	0.31909	N	0.6149	P;P	0.47545	0.597;0.897	B;B	0.31290	0.041;0.127	T	0.18840	-1.0324	9	0.44086	T	0.13	-5.7083	6.9613	0.24599	0.1526:0.0:0.7071:0.1403	.	51;72	P04921-2;P04921	.;GLPC_HUMAN	I	72;51;53	ENSP00000259254:V72I;ENSP00000349354:V51I;ENSP00000386904:V53I	ENSP00000259254:V72I	V	+	1	0	GYPC	127170015	0.995000	0.38212	0.285000	0.24819	0.020000	0.10135	2.361000	0.44160	0.201000	0.20466	0.561000	0.74099	GTC	.	.		0.607	GYPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254297.1	NM_002101	
DNAJB2	3300	hgsc.bcm.edu	37	2	220147607	220147607	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr2:220147607C>T	ENST00000336576.5	+	6	689	c.401C>T	c.(400-402)tCa>tTa	p.S134L	DNAJB2_ENST00000392086.4_Missense_Mutation_p.S134L|DNAJB2_ENST00000463463.1_3'UTR	NM_006736.5	NP_006727.2	P25686	DNJB2_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 2	134					cell death (GO:0008219)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of inclusion body assembly (GO:0090084)|negative regulation of protein deubiquitination (GO:0090086)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein folding (GO:0006457)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|inclusion body (GO:0016234)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14		Renal(207;0.0474)		Epithelial(149;1.97e-06)|all cancers(144;0.00028)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TCCCGACACTCAGGCCCCTTC	0.542																																					p.S134L		Atlas-SNP	.											.	DNAJB2	31	.	0			c.C401T						.						126.0	121.0	122.0					2																	220147607		2203	4300	6503	SO:0001583	missense	3300	exon6			GACACTCAGGCCC		CCDS2439.1, CCDS46519.1	2q32-q34	2011-09-02			ENSG00000135924	ENSG00000135924		"""Heat shock proteins / DNAJ (HSP40)"""	5228	protein-coding gene	gene with protein product		604139		HSJ1		1599432, 10516435	Standard	NM_006736		Approved	HSPF3	uc002vkx.1	P25686	OTTHUMG00000133134	ENST00000336576.5:c.401C>T	chr2.hg19:g.220147607C>T	ENSP00000338019:p.Ser134Leu	91.0	0.0		60.0	14.0	NM_006736	A8K9P6|Q8IUK1|Q8IUK2|Q96F52	Missense_Mutation	SNP	ENST00000336576.5	hg19	CCDS2439.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505689	0.26949	.	.	ENSG00000135924	ENST00000336576;ENST00000425450;ENST00000392086;ENST00000439026	T;T;T;T	0.71461	0.93;0.93;0.93;-0.57	5.37	4.49	0.54785	.	4.344530	0.00735	N	0.000971	T	0.58963	0.2159	N	0.20574	0.59	0.09310	N	1	B;B	0.28713	0.22;0.013	B;B	0.21708	0.036;0.015	T	0.49021	-0.8982	10	0.42905	T	0.14	.	8.563	0.33523	0.1496:0.7692:0.0:0.0812	.	134;134	P25686;P25686-2	DNJB2_HUMAN;.	L	134	ENSP00000338019:S134L;ENSP00000414796:S134L;ENSP00000375936:S134L;ENSP00000387951:S134L	ENSP00000338019:S134L	S	+	2	0	DNAJB2	219855851	0.013000	0.17824	0.088000	0.20740	0.534000	0.34807	1.944000	0.40263	2.500000	0.84329	0.563000	0.77884	TCA	.	.		0.542	DNAJB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256823.2		
SLC4A3	6508	hgsc.bcm.edu	37	2	220500183	220500183	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr2:220500183T>A	ENST00000358055.3	+	13	2449	c.1937T>A	c.(1936-1938)aTg>aAg	p.M646K	SLC4A3_ENST00000373762.3_Missense_Mutation_p.M673K|SLC4A3_ENST00000273063.6_Missense_Mutation_p.M673K|SLC4A3_ENST00000317151.3_Missense_Mutation_p.M646K|SLC4A3_ENST00000373760.2_Missense_Mutation_p.M646K			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	646					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AAAGTCGAGATGACCACACGG	0.642																																					p.M673K		Atlas-SNP	.											.	SLC4A3	144	.	0			c.T2018A						.						52.0	49.0	50.0					2																	220500183		2203	4300	6503	SO:0001583	missense	6508	exon13			TCGAGATGACCAC		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1937T>A	chr2.hg19:g.220500183T>A	ENSP00000350756:p.Met646Lys	365.0	0.0		288.0	74.0	NM_201574	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Missense_Mutation	SNP	ENST00000358055.3	hg19	CCDS2445.1	.	.	.	.	.	.	.	.	.	.	T	7.739	0.700922	0.15172	.	.	ENSG00000114923	ENST00000358055;ENST00000373760;ENST00000273063;ENST00000373762;ENST00000317151	T;T;T;T;T	0.72282	-0.63;-0.63;-0.64;-0.64;-0.63	4.92	-0.481	0.12082	.	0.504928	0.21041	N	0.081162	T	0.29491	0.0735	N	0.01352	-0.895	0.22317	N	0.999205	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.35500	-0.9786	10	0.05620	T	0.96	.	4.3829	0.11302	0.1417:0.2965:0.0:0.5617	.	350;646;673	P48751-2;P48751;P48751-3	.;B3A3_HUMAN;.	K	646;646;673;673;646	ENSP00000350756:M646K;ENSP00000362865:M646K;ENSP00000273063:M673K;ENSP00000362867:M673K;ENSP00000314006:M646K	ENSP00000273063:M673K	M	+	2	0	SLC4A3	220208427	0.859000	0.29813	0.943000	0.38184	0.693000	0.40251	0.215000	0.17562	-0.016000	0.14127	0.523000	0.50628	ATG	.	.		0.642	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
RFTN1	23180	hgsc.bcm.edu	37	3	16411777	16411777	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:16411777A>G	ENST00000334133.4	-	6	1108	c.836T>C	c.(835-837)aTc>aCc	p.I279T	RFTN1_ENST00000483671.1_5'UTR|RFTN1_ENST00000432519.1_Missense_Mutation_p.I243T	NM_015150.1	NP_055965.1	Q14699	RFTN1_HUMAN	raftlin, lipid raft linker 1	279					B cell receptor signaling pathway (GO:0050853)|dsRNA transport (GO:0033227)|growth (GO:0040007)|interleukin-17 production (GO:0032620)|membrane raft assembly (GO:0001765)|protein localization to membrane raft (GO:1903044)|protein transport into membrane raft (GO:0032596)|response to exogenous dsRNA (GO:0043330)|T cell antigen processing and presentation (GO:0002457)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 3 signaling pathway (GO:0034138)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	double-stranded RNA binding (GO:0003725)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(8)|lung(8)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	38						AAGGGTGAAGATCTCCATTTC	0.468																																					p.I279T		Atlas-SNP	.											.	RFTN1	79	.	0			c.T836C						.						180.0	180.0	180.0					3																	16411777		2203	4300	6503	SO:0001583	missense	23180	exon6			GTGAAGATCTCCA	D42043	CCDS33712.1	3p24.3	2010-04-09			ENSG00000131378	ENSG00000131378			30278	protein-coding gene	gene with protein product	"""raft-linking protein"""					7788527, 12805216	Standard	NM_015150		Approved	MIG2, KIAA0084, FLJ23866, Raftlin	uc003cay.3	Q14699	OTTHUMG00000156973	ENST00000334133.4:c.836T>C	chr3.hg19:g.16411777A>G	ENSP00000334153:p.Ile279Thr	158.0	0.0		100.0	14.0	NM_015150	Q0D2G0|Q496Y2|Q4QQI7|Q5JB48|Q7Z7P2	Missense_Mutation	SNP	ENST00000334133.4	hg19	CCDS33712.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.987470	0.74589	.	.	ENSG00000131378	ENST00000432519;ENST00000334133	T;T	0.35605	1.3;1.3	5.68	5.68	0.88126	.	0.191940	0.49916	D	0.000134	T	0.55609	0.1931	M	0.63428	1.95	0.46954	D	0.999261	D;D	0.67145	0.996;0.996	P;P	0.62298	0.9;0.9	T	0.59139	-0.7510	10	0.87932	D	0	-34.2325	15.9355	0.79704	1.0:0.0:0.0:0.0	.	243;279	G3XAJ6;Q14699	.;RFTN1_HUMAN	T	243;279	ENSP00000403926:I243T;ENSP00000334153:I279T	ENSP00000334153:I279T	I	-	2	0	RFTN1	16386781	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.315000	0.78998	2.179000	0.69175	0.459000	0.35465	ATC	.	.		0.468	RFTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346908.1	NM_015150	
CCDC13	152206	hgsc.bcm.edu	37	3	42799704	42799704	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:42799704T>C	ENST00000310232.6	-	2	217	c.134A>G	c.(133-135)gAc>gGc	p.D45G	CCDC13_ENST00000435327.2_5'UTR	NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	45										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						CTCTTGGTCGTCAGCTCTGCT	0.498																																					p.D45G		Atlas-SNP	.											.	CCDC13	71	.	0			c.A134G						.						243.0	199.0	214.0					3																	42799704		2203	4300	6503	SO:0001583	missense	152206	exon2			TGGTCGTCAGCTC	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.134A>G	chr3.hg19:g.42799704T>C	ENSP00000309836:p.Asp45Gly	125.0	0.0		104.0	24.0	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	hg19	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	T	7.593	0.671158	0.14776	.	.	ENSG00000244607	ENST00000310232	T	0.23950	1.88	4.59	3.44	0.39384	.	0.686270	0.14217	N	0.333638	T	0.17831	0.0428	L	0.29908	0.895	0.20074	N	0.999932	B;P;B	0.36909	0.206;0.573;0.073	B;B;B	0.36666	0.124;0.23;0.088	T	0.11567	-1.0582	10	0.30854	T	0.27	.	8.0515	0.30581	0.0:0.0972:0.0:0.9028	.	45;45;45	B4DZD2;Q96LI1;Q8IYE1	.;.;CCD13_HUMAN	G	45	ENSP00000309836:D45G	ENSP00000309836:D45G	D	-	2	0	CCDC13	42774708	0.000000	0.05858	0.005000	0.12908	0.006000	0.05464	0.118000	0.15605	0.793000	0.33875	0.533000	0.62120	GAC	.	.		0.498	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
BAP1	8314	hgsc.bcm.edu	37	3	52437795	52437795	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:52437795G>A	ENST00000460680.1	-	13	1837	c.1366C>T	c.(1366-1368)Cag>Tag	p.Q456*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.Q438*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGGTCCTTCTGGGACTCTTTG	0.597			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.Q456X	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	.	BAP1	371	.	0			c.C1366T						.						77.0	79.0	78.0					3																	52437795		2203	4300	6503	SO:0001587	stop_gained	8314	exon13			CCTTCTGGGACTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.1366C>T	chr3.hg19:g.52437795G>A	ENSP00000417132:p.Gln456*	42.0	0.0		41.0	19.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	36	5.670842	0.96754	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	6.05	6.05	0.98169	.	0.054436	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	20.6086	0.99469	0.0:0.0:1.0:0.0	.	.	.	.	X	456;438	.	ENSP00000296288:Q438X	Q	-	1	0	BAP1	52412835	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.862000	0.92283	2.880000	0.98712	0.655000	0.94253	CAG	.	.		0.597	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
BAP1	8314	hgsc.bcm.edu	37	3	52441304	52441304	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:52441304G>A	ENST00000460680.1	-	7	937	c.466C>T	c.(466-468)Cag>Tag	p.Q156*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.Q156*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	0	Interaction with HIP2.				anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q156*(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		AGGCCATTCTGCTTCTCAGGG	0.577			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.Q156X	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,NS,carcinoma,0,1	BAP1	371	.	1	Substitution - Nonsense(1)	kidney(1)	c.C466T						.						79.0	81.0	80.0					3																	52441304		2203	4300	6503	SO:0001587	stop_gained	8314	exon7			CATTCTGCTTCTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.466C>T	chr3.hg19:g.52441304G>A	ENSP00000417132:p.Gln156*	182.0	0.0		134.0	50.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	40	8.080308	0.98643	.	.	ENSG00000163930	ENST00000460680;ENST00000296288;ENST00000470173	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-6.3818	20.3927	0.98949	0.0:0.0:1.0:0.0	.	.	.	.	X	156;156;77	.	ENSP00000296288:Q156X	Q	-	1	0	BAP1	52416344	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.824000	0.99380	2.833000	0.97629	0.655000	0.94253	CAG	.	.		0.577	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
ROBO1	6091	hgsc.bcm.edu	37	3	78701075	78701075	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:78701075G>A	ENST00000464233.1	-	19	2732	c.2619C>T	c.(2617-2619)gcC>gcT	p.A873A	ROBO1_ENST00000436010.2_Silent_p.A834A|ROBO1_ENST00000467549.1_Silent_p.A837A|ROBO1_ENST00000495273.1_Silent_p.A837A	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	873	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GGTTTCCATGGGCATCTGAAA	0.468																																					p.A873A		Atlas-SNP	.											.	ROBO1	833	.	0			c.C2619T						.						127.0	125.0	126.0					3																	78701075		2000	4170	6170	SO:0001819	synonymous_variant	6091	exon19			TCCATGGGCATCT	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.2619C>T	chr3.hg19:g.78701075G>A		113.0	0.0		103.0	35.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	hg19	CCDS54611.1																																																																																			.	.		0.468	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
OR5K1	26339	hgsc.bcm.edu	37	3	98189208	98189208	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:98189208A>C	ENST00000332650.5	+	1	885	c.788A>C	c.(787-789)aAt>aCt	p.N263T		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	263						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GTTAGACCAAATTTGCTTGAA	0.363																																					p.N263T		Atlas-SNP	.											.	OR5K1	51	.	0			c.A788C						.						86.0	90.0	89.0					3																	98189208		2163	4289	6452	SO:0001583	missense	26339	exon1			GACCAAATTTGCT	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.788A>C	chr3.hg19:g.98189208A>C	ENSP00000373193:p.Asn263Thr	204.0	0.0		121.0	36.0	NM_001004736	B9EGY5|Q6IF46	Missense_Mutation	SNP	ENST00000332650.5	hg19	CCDS43115.1	.	.	.	.	.	.	.	.	.	.	A	10.65	1.411050	0.25465	.	.	ENSG00000232382	ENST00000332650	T	0.00076	8.76	4.47	1.97	0.26223	GPCR, rhodopsin-like superfamily (1);	0.326457	0.22045	N	0.065386	T	0.00109	0.0003	N	0.12831	0.26	0.09310	N	1	P	0.41848	0.763	P	0.49421	0.61	T	0.40117	-0.9580	10	0.38643	T	0.18	-17.0415	5.2294	0.15414	0.6584:0.0:0.3416:0.0	.	263	Q8NHB7	OR5K1_HUMAN	T	263	ENSP00000373193:N263T	ENSP00000373193:N263T	N	+	2	0	OR5K1	99671898	0.000000	0.05858	0.998000	0.56505	0.977000	0.68977	-0.293000	0.08320	0.690000	0.31570	0.496000	0.49642	AAT	.	.		0.363	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1		
POLQ	10721	hgsc.bcm.edu	37	3	121228964	121228964	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:121228964C>T	ENST00000264233.5	-	11	1866	c.1738G>A	c.(1738-1740)Gga>Aga	p.G580R		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	580					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		TCAATCGCTCCAAGCTGAACA	0.433								DNA polymerases (catalytic subunits)																													p.G580R	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.G1738A						.						207.0	177.0	187.0					3																	121228964		2203	4300	6503	SO:0001583	missense	10721	exon11			TCGCTCCAAGCTG	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.1738G>A	chr3.hg19:g.121228964C>T	ENSP00000264233:p.Gly580Arg	138.0	0.0		78.0	25.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686392	0.88639	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.40756	1.02	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.44435	0.1293	L	0.57536	1.79	0.58432	D	0.999999	B	0.15719	0.014	B	0.17098	0.017	T	0.44190	-0.9344	10	0.66056	D	0.02	.	17.9923	0.89172	0.0:1.0:0.0:0.0	.	580	O75417	DPOLQ_HUMAN	R	203;580;716	ENSP00000264233:G580R	ENSP00000264233:G580R	G	-	1	0	POLQ	122711654	1.000000	0.71417	0.998000	0.56505	0.872000	0.50106	7.368000	0.79567	2.236000	0.73375	0.460000	0.39030	GGA	.	.		0.433	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
WDR49	151790	hgsc.bcm.edu	37	3	167293897	167293897	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:167293897T>A	ENST00000308378.3	-	4	600	c.295A>T	c.(295-297)Agg>Tgg	p.R99W	WDR49_ENST00000453925.2_Missense_Mutation_p.R152W|WDR49_ENST00000479765.1_Missense_Mutation_p.R440W|WDR49_ENST00000476376.1_5'Flank	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	99										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						CAAGCTATCCTCTGGATGGAC	0.393																																					p.R99W		Atlas-SNP	.											.	WDR49	188	.	0			c.A295T						.						86.0	83.0	84.0					3																	167293897		2203	4300	6503	SO:0001583	missense	151790	exon4			CTATCCTCTGGAT	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.295A>T	chr3.hg19:g.167293897T>A	ENSP00000311343:p.Arg99Trp	152.0	0.0		95.0	14.0	NM_178824	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	hg19	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.99|19.99	3.928693|3.928693	0.73327|0.73327	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000472600|ENST00000308378;ENST00000479765;ENST00000453925	.|T;T;T	.|0.46819	.|1.52;1.79;0.86	5.76|5.76	5.76|5.76	0.90799|0.90799	.|WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.099203|0.099203	0.64402|0.64402	D|D	0.000002|0.000002	T|T	0.64316|0.64316	0.2587|0.2587	M|M	0.67953|0.67953	2.075|2.075	0.25331|0.25331	N|N	0.989037|0.989037	.|D;D;D	.|0.89917	.|1.0;1.0;0.999	.|D;D;D	.|0.85130	.|0.997;0.997;0.987	T|T	0.60712|0.60712	-0.7209|-0.7209	6|10	.|0.62326	.|D	.|0.03	.|.	9.852|9.852	0.41061|0.41061	0.0:0.0784:0.0:0.9216|0.0:0.0784:0.0:0.9216	.|.	.|152;440;99	.|E7EQK3;E9PDB0;Q8IV35	.|.;.;WDR49_HUMAN	S|W	163|99;440;152	.|ENSP00000311343:R99W;ENSP00000419749:R440W;ENSP00000410863:R152W	.|ENSP00000311343:R99W	R|R	-|-	3|1	2|2	WDR49|WDR49	168776591|168776591	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	2.448000|2.448000	0.44926|0.44926	2.219000|2.219000	0.72066|0.72066	0.529000|0.529000	0.55759|0.55759	AGA|AGG	.	.		0.393	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
TMEM41A	90407	hgsc.bcm.edu	37	3	185213096	185213096	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:185213096A>G	ENST00000421852.1	-	3	376	c.281T>C	c.(280-282)tTa>tCa	p.L94S	TMEM41A_ENST00000296254.3_Intron|TMEM41A_ENST00000475480.1_5'UTR	NM_080652.3	NP_542383.1	Q96HV5	TM41A_HUMAN	transmembrane protein 41A	94						integral component of membrane (GO:0016021)				large_intestine(1)|lung(2)|skin(1)	4	all_cancers(143;7.78e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			GGCACCAGCTAAAACATTCTG	0.527																																					p.L94S		Atlas-SNP	.											.	TMEM41A	18	.	0			c.T281C						.						62.0	58.0	59.0					3																	185213096		2203	4300	6503	SO:0001583	missense	90407	exon3			CCAGCTAAAACAT	BC019884	CCDS3271.1	3q27.2	2006-04-12			ENSG00000163900	ENSG00000163900			30544	protein-coding gene	gene with protein product						12975309	Standard	NM_080652		Approved	MGC15397	uc003fpj.2	Q96HV5	OTTHUMG00000156660	ENST00000421852.1:c.281T>C	chr3.hg19:g.185213096A>G	ENSP00000406885:p.Leu94Ser	112.0	0.0		118.0	38.0	NM_080652	A8K4B3|D3DNU2|Q6ZMJ0	Missense_Mutation	SNP	ENST00000421852.1	hg19	CCDS3271.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.937362	0.92458	.	.	ENSG00000163900	ENST00000421852	.	.	.	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000001	D	0.84593	0.5506	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.86809	0.1997	9	0.54805	T	0.06	-1.0592	16.1973	0.82040	1.0:0.0:0.0:0.0	.	94	Q96HV5	TM41A_HUMAN	S	94	.	ENSP00000406885:L94S	L	-	2	0	TMEM41A	186695790	0.994000	0.37717	0.998000	0.56505	0.994000	0.84299	9.231000	0.95317	2.222000	0.72286	0.533000	0.62120	TTA	.	.		0.527	TMEM41A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345174.1	NM_080652	
GNPDA2	132789	hgsc.bcm.edu	37	4	44713036	44713036	+	Silent	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr4:44713036T>A	ENST00000295448.3	-	5	684	c.528A>T	c.(526-528)ggA>ggT	p.G176G	GNPDA2_ENST00000511187.1_Intron|GNPDA2_ENST00000507534.1_Silent_p.G106G|GNPDA2_ENST00000509756.1_Silent_p.G176G|GNPDA2_ENST00000507917.1_Silent_p.G142G	NM_138335.2	NP_612208.1	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	176					carbohydrate metabolic process (GO:0005975)|N-acetylglucosamine metabolic process (GO:0006044)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	glucosamine-6-phosphate deaminase activity (GO:0004342)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(1)|lung(7)|ovary(1)	11						TTGATAAATCTCCATCAAAAT	0.383																																					p.G176G	Colon(54;743 1010 7604 16453 19544)	Atlas-SNP	.											.	GNPDA2	28	.	0			c.A528T						.						123.0	116.0	119.0					4																	44713036		2203	4300	6503	SO:0001819	synonymous_variant	132789	exon5			TAAATCTCCATCA	AF247786	CCDS3469.1, CCDS59472.1, CCDS59473.1	4p13	2006-04-12			ENSG00000163281	ENSG00000163281	3.5.99.6		21526	protein-coding gene	gene with protein product	"""glucosamine-6-phosphate isomerase"""	613222				12965206	Standard	NM_001270880		Approved	SB52	uc003gwy.4	Q8TDQ7	OTTHUMG00000099415	ENST00000295448.3:c.528A>T	chr4.hg19:g.44713036T>A		109.0	0.0		84.0	20.0	NM_138335	B4DJF3|Q2VYF1|Q59EA7|Q8NCZ8|Q96BJ4|Q96NC6	Silent	SNP	ENST00000295448.3	hg19	CCDS3469.1																																																																																			.	.		0.383	GNPDA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216874.3	NM_138335	
QRFPR	84109	hgsc.bcm.edu	37	4	122251606	122251606	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr4:122251606A>T	ENST00000394427.2	-	5	1281	c.870T>A	c.(868-870)caT>caA	p.H290Q	QRFPR_ENST00000334383.5_Missense_Mutation_p.C253S|Y_RNA_ENST00000384419.1_RNA	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	290					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						TATGGACAACATGGAATGGTG	0.393																																					p.H290Q		Atlas-SNP	.											.	QRFPR	65	.	0			c.T870A						.						144.0	134.0	138.0					4																	122251606		2203	4300	6503	SO:0001583	missense	84109	exon5			GACAACATGGAAT	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.870T>A	chr4.hg19:g.122251606A>T	ENSP00000377948:p.His290Gln	71.0	0.0		48.0	10.0	NM_198179		Missense_Mutation	SNP	ENST00000394427.2	hg19	CCDS3719.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.80|15.80	2.940031|2.940031	0.52972|0.52972	.|.	.|.	ENSG00000186867|ENSG00000186867	ENST00000334383|ENST00000394427	T|T	0.69806|0.39229	-0.43|1.09	5.81|5.81	-5.91|-5.91	0.02269|0.02269	.|GPCR, rhodopsin-like superfamily (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.55625|0.55625	0.1932|0.1932	M|M	0.69463|0.69463	2.115|2.115	0.09310|0.09310	N|N	0.999997|0.999997	.|D	.|0.89917	.|1.0	.|D	.|0.85130	.|0.997	T|T	0.56763|0.56763	-0.7925|-0.7925	7|10	0.87932|0.31617	D|T	0|0.26	.|.	17.1154|17.1154	0.86687|0.86687	0.4553:0.0:0.5447:0.0|0.4553:0.0:0.5447:0.0	.|.	.|290	.|Q96P65	.|QRFPR_HUMAN	S|Q	253|290	ENSP00000335610:C253S|ENSP00000377948:H290Q	ENSP00000335610:C253S|ENSP00000377948:H290Q	C|H	-|-	1|3	0|2	QRFPR|QRFPR	122471056|122471056	0.000000|0.000000	0.05858|0.05858	0.011000|0.011000	0.14972|0.14972	0.961000|0.961000	0.63080|0.63080	-0.361000|-0.361000	0.07612|0.07612	-1.457000|-1.457000	0.01919|0.01919	0.533000|0.533000	0.62120|0.62120	TGT|CAT	.	.		0.393	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
FAT4	79633	hgsc.bcm.edu	37	4	126398471	126398471	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr4:126398471C>T	ENST00000394329.3	+	13	12468	c.12455C>T	c.(12454-12456)gCa>gTa	p.A4152V	FAT4_ENST00000335110.5_Missense_Mutation_p.A2415V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4152	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GCTTTGGCAGCACAAGGCATC	0.398																																					p.A4152V		Atlas-SNP	.											.	FAT4	1752	.	0			c.C12455T						.						133.0	131.0	132.0					4																	126398471		2203	4300	6503	SO:0001583	missense	79633	exon13			TGGCAGCACAAGG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.12455C>T	chr4.hg19:g.126398471C>T	ENSP00000377862:p.Ala4152Val	97.0	0.0		78.0	14.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	18.00	3.525397	0.64747	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.78364	-1.17;-1.17	5.54	4.69	0.59074	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.34110	U	0.004257	T	0.61009	0.2313	N	0.08118	0	0.45354	D	0.998349	B;B;B	0.14805	0.004;0.002;0.011	B;B;B	0.14023	0.01;0.003;0.01	T	0.57225	-0.7848	10	0.46703	T	0.11	.	14.2117	0.65769	0.0:0.9282:0.0:0.0718	.	2415;4152;4152	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	V	4152;2415	ENSP00000377862:A4152V;ENSP00000335169:A2415V	ENSP00000335169:A2415V	A	+	2	0	FAT4	126617921	1.000000	0.71417	0.865000	0.33974	0.790000	0.44656	5.943000	0.70211	1.328000	0.45358	0.650000	0.86243	GCA	.	.		0.398	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
JADE1	79960	hgsc.bcm.edu	37	4	129792936	129792936	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr4:129792936A>G	ENST00000226319.6	+	11	2328	c.2048A>G	c.(2047-2049)aAg>aGg	p.K683R	PHF17_ENST00000512960.1_Missense_Mutation_p.K683R|PHF17_ENST00000452328.2_Missense_Mutation_p.K671R	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						CAGAGTCACAAGCCTCTCAGG	0.498																																					p.K683R		Atlas-SNP	.											.	PHF17	63	.	0			c.A2048G						.						52.0	52.0	52.0					4																	129792936		2203	4300	6503	SO:0001583	missense	79960	exon11			GTCACAAGCCTCT																												ENST00000226319.6:c.2048A>G	chr4.hg19:g.129792936A>G	ENSP00000226319:p.Lys683Arg	236.0	0.0		184.0	24.0	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	hg19	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	A	12.69	2.014073	0.35511	.	.	ENSG00000077684	ENST00000226319;ENST00000452328;ENST00000512960;ENST00000535321	T;T;T	0.44881	0.91;0.93;0.91	4.59	4.59	0.56863	.	0.341890	0.32578	N	0.005914	T	0.22166	0.0534	N	0.12746	0.255	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.06405	0.001;0.002	T	0.08764	-1.0706	9	.	.	.	.	9.0514	0.36378	0.9179:0.0:0.0821:0.0	.	671;683	Q6IE81-2;Q6IE81	.;JADE1_HUMAN	R	683;671;683;683	ENSP00000226319:K683R;ENSP00000388015:K671R;ENSP00000425730:K683R	.	K	+	2	0	PHF17	130012386	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.163000	0.58183	2.058000	0.61347	0.533000	0.62120	AAG	.	.		0.498	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
CLCN3	1182	hgsc.bcm.edu	37	4	170618374	170618374	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr4:170618374G>T	ENST00000513761.1	+	9	1611	c.1052G>T	c.(1051-1053)aGa>aTa	p.R351I	CLCN3_ENST00000504131.2_Missense_Mutation_p.R334I|CLCN3_ENST00000347613.4_Missense_Mutation_p.R351I|CLCN3_ENST00000360642.3_Missense_Mutation_p.R324I	NM_001829.3	NP_001820.2	P51790	CLCN3_HUMAN	chloride channel, voltage-sensitive 3	351					chloride transmembrane transport (GO:1902476)|endosomal lumen acidification (GO:0048388)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|voltage-gated chloride channel activity (GO:0005247)			breast(5)|endometrium(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	29		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0233)|LUSC - Lung squamous cell carcinoma(193;0.131)		ACTTTATGGAGATCATTTTTT	0.308																																					p.R351I		Atlas-SNP	.											.	CLCN3	85	.	0			c.G1052T						.						78.0	79.0	79.0					4																	170618374		2203	4300	6503	SO:0001583	missense	1182	exon9			TATGGAGATCATT	X78520	CCDS34100.1, CCDS34101.1, CCDS58932.1, CCDS75208.1	4q	2012-09-26	2012-02-23		ENSG00000109572	ENSG00000109572		"""Ion channels / Chloride channels : Voltage-sensitive"""	2021	protein-coding gene	gene with protein product		600580	"""chloride channel 3"""				Standard	NM_001243374		Approved	CLC3, ClC-3	uc003ish.3	P51790	OTTHUMG00000160973	ENST00000513761.1:c.1052G>T	chr4.hg19:g.170618374G>T	ENSP00000424603:p.Arg351Ile	206.0	0.0		139.0	35.0	NM_001829	B7Z932|B9EGJ9|D3DP34|E9PB97|O14918|Q86Z21	Missense_Mutation	SNP	ENST00000513761.1	hg19	CCDS34101.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.6|28.6	4.932780|4.932780	0.92458|0.92458	.|.	.|.	ENSG00000109572|ENSG00000109572	ENST00000515420|ENST00000513761;ENST00000347613;ENST00000360642;ENST00000504131;ENST00000507875	.|D;D;D;D;D	.|0.93076	.|-3.16;-3.16;-3.16;-3.16;-3.16	5.84|5.84	5.84|5.84	0.93424|0.93424	.|Chloride channel, core (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.98204|0.98204	0.9406|0.9406	H|H	0.97415|0.97415	4|4	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;0.994;1.0;1.0;0.999	.|D;D;D;D;D	.|0.91635	.|0.999;0.987;0.992;0.992;0.993	D|D	0.98883|0.98883	1.0770|1.0770	5|10	.|0.87932	.|D	.|0	-11.6385|-11.6385	20.1392|20.1392	0.98050|0.98050	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|324;334;324;351;351	.|B7Z932;B9EGJ9;E9PE15;P51790;P51790-2	.|.;.;.;CLCN3_HUMAN;.	Y|I	33|351;351;324;334;324	.|ENSP00000424603:R351I;ENSP00000261514:R351I;ENSP00000353857:R324I;ENSP00000424540:R334I;ENSP00000425323:R324I	.|ENSP00000261514:R351I	D|R	+|+	1|2	0|0	CLCN3|CLCN3	170854949|170854949	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	9.869000|9.869000	0.99810|0.99810	2.765000|2.765000	0.95021|0.95021	0.557000|0.557000	0.71058|0.71058	GAT|AGA	.	.		0.308	CLCN3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363210.2		
NNT	23530	hgsc.bcm.edu	37	5	43649288	43649288	+	Missense_Mutation	SNP	A	A	G	rs199609080		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr5:43649288A>G	ENST00000264663.5	+	11	1705	c.1484A>G	c.(1483-1485)aAt>aGt	p.N495S	NNT_ENST00000512996.2_Missense_Mutation_p.N364S|NNT_ENST00000344920.4_Missense_Mutation_p.N495S	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	495					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					GCGGCTCCCAATCTAGCCTTT	0.493																																					p.N495S		Atlas-SNP	.											.	NNT	92	.	0			c.A1484G						.						351.0	326.0	335.0					5																	43649288		2203	4300	6503	SO:0001583	missense	23530	exon11			CTCCCAATCTAGC	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.1484A>G	chr5.hg19:g.43649288A>G	ENSP00000264663:p.Asn495Ser	161.0	0.0		120.0	40.0	NM_182977	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	hg19	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	A	12.56	1.973580	0.34848	.	.	ENSG00000112992	ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.95377	-3.69;-3.69;-3.56	5.24	4.0	0.46444	.	0.180348	0.64402	D	0.000018	D	0.85097	0.5619	N	0.01809	-0.71	0.43959	D	0.996634	B	0.29085	0.232	B	0.26614	0.071	D	0.83414	0.0029	10	0.27082	T	0.32	-8.9477	11.8269	0.52271	0.8536:0.1464:0.0:0.0	.	495	Q13423	NNTM_HUMAN	S	495;495;364	ENSP00000264663:N495S;ENSP00000343873:N495S;ENSP00000426343:N364S	ENSP00000264663:N495S	N	+	2	0	NNT	43685045	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	4.861000	0.62969	1.993000	0.58246	0.524000	0.50904	AAT	.	A|0.999;G|0.001		0.493	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
ARHGEF28	64283	hgsc.bcm.edu	37	5	73048892	73048892	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr5:73048892A>T	ENST00000426542.2	+	3	360	c.340A>T	c.(340-342)Agc>Tgc	p.S114C	ARHGEF28_ENST00000545377.1_Missense_Mutation_p.S114C|ARHGEF28_ENST00000513042.2_Missense_Mutation_p.S114C|ARHGEF28_ENST00000287898.5_Missense_Mutation_p.S114C|ARHGEF28_ENST00000296794.6_Missense_Mutation_p.S114C|ARHGEF28_ENST00000437974.1_Missense_Mutation_p.S114C			Q8N1W1	ARG28_HUMAN	Rho guanine nucleotide exchange factor (GEF) 28	114					central nervous system neuron axonogenesis (GO:0021955)|intracellular signal transduction (GO:0035556)|neurofilament cytoskeleton organization (GO:0060052)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|RNA binding (GO:0003723)										CACAGCCTGCAGCCACCAGAC	0.617																																					p.S114C		Atlas-SNP	.											.	.	.	.	0			c.A340T						.						37.0	40.0	39.0					5																	73048892		2150	4260	6410	SO:0001583	missense	64283	exon4			GCCTGCAGCCACC		CCDS47231.1, CCDS47231.2, CCDS54870.1, CCDS58957.1	5q13.2	2012-08-08			ENSG00000214944	ENSG00000214944			30322	protein-coding gene	gene with protein product		612790				9199174, 11058585	Standard	NM_001177693		Approved	RGNEF, p190RhoGEF, RIP2	uc010izf.3	Q8N1W1	OTTHUMG00000162454	ENST00000426542.2:c.340A>T	chr5.hg19:g.73048892A>T	ENSP00000412175:p.Ser114Cys	81.0	0.0		57.0	18.0	NM_001080479	B2RXG7|B4E3K4|B5MDA3|B7ZW32|E9PC75|Q8NCM7|Q96E37|Q9H6L3|Q9H6W0	Missense_Mutation	SNP	ENST00000426542.2	hg19	CCDS54870.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990050	0.74589	.	.	ENSG00000214944	ENST00000296794;ENST00000545377;ENST00000513042;ENST00000287898;ENST00000437974;ENST00000426542	T;T;T;T;T;T	0.11385	3.02;3.02;3.02;2.78;3.02;3.02	5.82	5.82	0.92795	.	.	.	.	.	T	0.30448	0.0765	L	0.57536	1.79	0.34904	D	0.746801	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.987;0.987;0.999;0.991	T	0.36138	-0.9760	9	0.87932	D	0	.	15.1644	0.72811	1.0:0.0:0.0:0.0	.	114;114;114;114	Q8N1W1;E9PC75;Q8N1W1-2;Q8N1W1-4	RGNEF_HUMAN;.;.;.	C	114	ENSP00000296794:S114C;ENSP00000441913:S114C;ENSP00000441436:S114C;ENSP00000287898:S114C;ENSP00000411459:S114C;ENSP00000412175:S114C	ENSP00000287898:S114C	S	+	1	0	RP11-428C6.1	73084648	1.000000	0.71417	0.956000	0.39512	0.549000	0.35272	6.112000	0.71547	2.225000	0.72522	0.459000	0.35465	AGC	.	.		0.617	ARHGEF28-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000368975.1		
LVRN	206338	hgsc.bcm.edu	37	5	115298661	115298661	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr5:115298661G>A	ENST00000357872.4	+	1	471	c.347G>A	c.(346-348)aGg>aAg	p.R116K	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		116						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										CCGCAGCTGAGGCCCGACGAG	0.697																																					p.R116K		Atlas-SNP	.											.	.	.	.	0			c.G347A						.						41.0	47.0	45.0					5																	115298661		2202	4298	6500	SO:0001583	missense	0	exon1			AGCTGAGGCCCGA																												ENST00000357872.4:c.347G>A	chr5.hg19:g.115298661G>A	ENSP00000350541:p.Arg116Lys	133.0	0.0		77.0	15.0	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	hg19	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	G	0.066	-1.213682	0.01555	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.03982	3.74	4.71	-1.58	0.08479	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.399189	0.18435	N	0.141301	T	0.01940	0.0061	N	0.02865	-0.47	0.29511	N	0.854174	P	0.34462	0.454	B	0.38156	0.266	T	0.47289	-0.9129	10	0.09843	T	0.71	.	8.7081	0.34367	0.5983:0.0:0.4017:0.0	.	116	Q6Q4G3	AMPQ_HUMAN	K	116	ENSP00000350541:R116K	ENSP00000350541:R116K	R	+	2	0	AC010282.1	115326560	0.000000	0.05858	0.439000	0.26833	0.070000	0.16714	-0.523000	0.06230	-0.152000	0.11156	0.650000	0.86243	AGG	.	.		0.697	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
SPOCK1	6695	hgsc.bcm.edu	37	5	136476319	136476319	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr5:136476319G>A	ENST00000394945.1	-	4	466	c.297C>T	c.(295-297)acC>acT	p.T99T	SPOCK1_ENST00000282223.7_Silent_p.T99T	NM_004598.3	NP_004589.1	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 1	99					cell adhesion (GO:0007155)|central nervous system neuron differentiation (GO:0021953)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron projection development (GO:0010977)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|neuron migration (GO:0001764)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|postsynaptic density (GO:0014069)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasm (GO:0016528)	calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(2)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGTAGTCCTGGGTCACACACA	0.612																																					p.T99T		Atlas-SNP	.											.	SPOCK1	58	.	0			c.C297T						.						75.0	61.0	66.0					5																	136476319		2203	4300	6503	SO:0001819	synonymous_variant	6695	exon4			GTCCTGGGTCACA	AF231124	CCDS4191.1	5q31.2	2008-02-05	2005-11-04	2005-11-04	ENSG00000152377	ENSG00000152377			11251	protein-coding gene	gene with protein product		602264	"""sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican)"""	TIC1, SPOCK		9545645	Standard	NM_004598		Approved	testican-1	uc003lbp.3	Q08629	OTTHUMG00000129157	ENST00000394945.1:c.297C>T	chr5.hg19:g.136476319G>A		115.0	0.0		91.0	11.0	NM_004598	B3KSW3|Q59EW0|Q8N630|Q9UCL8	Silent	SNP	ENST00000394945.1	hg19	CCDS4191.1																																																																																			.	.		0.612	SPOCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251222.1	NM_004598	
PCDHA2	56146	hgsc.bcm.edu	37	5	140176112	140176112	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr5:140176112G>T	ENST00000526136.1	+	1	1563	c.1563G>T	c.(1561-1563)caG>caT	p.Q521H	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000378132.1_Missense_Mutation_p.Q521H|PCDHA2_ENST00000520672.2_Missense_Mutation_p.Q521H	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	521	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCGCTGCAGCCGCTGGACC	0.692																																					p.Q521H		Atlas-SNP	.											.	PCDHA2	404	.	0			c.G1563T						.						58.0	63.0	62.0					5																	140176112		2203	4293	6496	SO:0001583	missense	56146	exon1			GCTGCAGCCGCTG	AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.1563G>T	chr5.hg19:g.140176112G>T	ENSP00000431748:p.Gln521His	110.0	0.0		101.0	26.0	NM_031495	O75287|Q9BTV3	Missense_Mutation	SNP	ENST00000526136.1	hg19	CCDS54914.1	.	.	.	.	.	.	.	.	.	.	g	15.35	2.808775	0.50421	.	.	ENSG00000204969	ENST00000520672;ENST00000378132;ENST00000526136	T;T;T	0.52754	0.65;0.65;0.65	3.88	3.0	0.34707	Cadherin (5);Cadherin-like (1);	0.000000	0.37955	U	0.001876	T	0.50939	0.1645	L	0.35341	1.055	0.22620	N	0.998924	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.993;0.998;0.993	T	0.30446	-0.9978	10	0.56958	D	0.05	.	5.228	0.15406	0.0845:0.1409:0.6294:0.1451	.	521;521;521	Q9Y5H9-3;Q9Y5H9;Q9Y5H9-2	.;PCDA2_HUMAN;.	H	521	ENSP00000430584:Q521H;ENSP00000367372:Q521H;ENSP00000431748:Q521H	ENSP00000367372:Q521H	Q	+	3	2	PCDHA2	140156296	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.411000	0.07142	0.767000	0.33267	0.644000	0.83932	CAG	.	.		0.692	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372877.3	NM_018905	
PCDHB1	29930	hgsc.bcm.edu	37	5	140432819	140432819	+	Silent	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr5:140432819C>A	ENST00000306549.3	+	1	1841	c.1764C>A	c.(1762-1764)acC>acA	p.T588T		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	588	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.T588T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACCTAGTGACCAAAGTGGTGG	0.483																																					p.T588T		Atlas-SNP	.											PCDHB1,NS,haematopoietic_neoplasm,0,1	PCDHB1	148	.	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1764A						.						85.0	76.0	79.0					5																	140432819		2203	4300	6503	SO:0001819	synonymous_variant	29930	exon1			AGTGACCAAAGTG	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1764C>A	chr5.hg19:g.140432819C>A		130.0	1.0		88.0	31.0	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	hg19	CCDS4243.1																																																																																			.	.		0.483	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
PDE6A	5145	hgsc.bcm.edu	37	5	149323845	149323845	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr5:149323845T>A	ENST00000255266.5	-	1	511	c.392A>T	c.(391-393)gAg>gTg	p.E131V		NM_000440.2	NP_000431.2	P16499	PDE6A_HUMAN	phosphodiesterase 6A, cGMP-specific, rod, alpha	131	GAF 1.				cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	44			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Caffeine(DB00201)	GAAGACGATCTCTTGGTCGGG	0.557																																					p.E131V		Atlas-SNP	.											.	PDE6A	98	.	0			c.A392T						.						139.0	121.0	127.0					5																	149323845		2203	4300	6503	SO:0001583	missense	5145	exon1			ACGATCTCTTGGT		CCDS4299.1	5q31.2-q34	2013-02-14			ENSG00000132915	ENSG00000132915	3.1.4.17	"""Phosphodiesterases"""	8785	protein-coding gene	gene with protein product		180071		PDEA		2155175	Standard	NM_000440		Approved	RP43	uc003lrg.4	P16499	OTTHUMG00000130047	ENST00000255266.5:c.392A>T	chr5.hg19:g.149323845T>A	ENSP00000255266:p.Glu131Val	102.0	0.0		84.0	31.0	NM_000440	Q0P638	Missense_Mutation	SNP	ENST00000255266.5	hg19	CCDS4299.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.618201	0.87359	.	.	ENSG00000132915	ENST00000255266	T	0.70045	-0.45	5.26	5.26	0.73747	GAF (2);	0.000000	0.85682	D	0.000000	T	0.82259	0.4998	M	0.83118	2.625	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	D	0.84959	0.0876	10	0.72032	D	0.01	.	13.4185	0.60982	0.0:0.0:0.0:1.0	.	131	P16499	PDE6A_HUMAN	V	131	ENSP00000255266:E131V	ENSP00000255266:E131V	E	-	2	0	PDE6A	149304038	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	7.993000	0.88291	2.114000	0.64651	0.459000	0.35465	GAG	.	.		0.557	PDE6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252326.2		
LRRC16A	55604	hgsc.bcm.edu	37	6	25594713	25594713	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr6:25594713T>C	ENST00000329474.6	+	32	3445	c.3077T>C	c.(3076-3078)gTa>gCa	p.V1026A		NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	1026	Inhibits capping activity of CAPZA2. {ECO:0000250}.				actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						GATGAAGGTGTAGATGAATTT	0.358																																					p.V1026A		Atlas-SNP	.											.	LRRC16A	168	.	0			c.T3077C						.						145.0	135.0	138.0					6																	25594713		1881	4121	6002	SO:0001583	missense	55604	exon32			AAGGTGTAGATGA	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.3077T>C	chr6.hg19:g.25594713T>C	ENSP00000331983:p.Val1026Ala	172.0	0.0		172.0	74.0	NM_001173977	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Missense_Mutation	SNP	ENST00000329474.6	hg19	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.689294	0.88735	.	.	ENSG00000079691	ENST00000329474;ENST00000399313	T	0.58358	0.34	5.26	5.26	0.73747	.	0.060906	0.64402	D	0.000003	T	0.57740	0.2074	M	0.65975	2.015	0.80722	D	1	D;D;D	0.67145	0.992;0.996;0.989	P;P;P	0.58077	0.764;0.764;0.832	T	0.60475	-0.7256	10	0.45353	T	0.12	.	15.4642	0.75387	0.0:0.0:0.0:1.0	.	1026;1026;1026	Q5VZK9;B2RTQ5;Q5VZK9-2	LR16A_HUMAN;.;.	A	1026	ENSP00000331983:V1026A	ENSP00000331983:V1026A	V	+	2	0	LRRC16A	25702692	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.272000	0.78516	2.104000	0.64026	0.455000	0.32223	GTA	.	.		0.358	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	
ZBTB12	221527	hgsc.bcm.edu	37	6	31868735	31868735	+	Silent	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr6:31868735C>T	ENST00000375527.2	-	2	523	c.348G>A	c.(346-348)gtG>gtA	p.V116V	C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	116					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						GGCATTTCTCCACCACGTGCT	0.562																																					p.V116V		Atlas-SNP	.											.	ZBTB12	25	.	0			c.G348A						.						78.0	74.0	75.0					6																	31868735		2203	4300	6503	SO:0001819	synonymous_variant	221527	exon2			TTTCTCCACCACG	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.348G>A	chr6.hg19:g.31868735C>T		110.0	0.0		129.0	24.0	NM_181842	B0UY00|Q5JQ98	Silent	SNP	ENST00000375527.2	hg19	CCDS4727.1																																																																																			.	.		0.562	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076315.2	NM_181842	
LRFN2	57497	hgsc.bcm.edu	37	6	40399807	40399807	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr6:40399807G>T	ENST00000338305.6	-	2	1588	c.1046C>A	c.(1045-1047)aCc>aAc	p.T349N		NM_020737.1	NP_065788.1	Q9ULH4	LRFN2_HUMAN	leucine rich repeat and fibronectin type III domain containing 2	349	Ig-like.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	58	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGAGATGTGGTGATGAAGAT	0.607																																					p.T349N		Atlas-SNP	.											.	LRFN2	133	.	0			c.C1046A						.						63.0	46.0	52.0					6																	40399807		2202	4299	6501	SO:0001583	missense	57497	exon2			GATGTGGTGATGA	AB033072	CCDS34443.1	6p21.2-p21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000156564	ENSG00000156564		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	21226	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 2"""	612808	"""KIAA1246"""	KIAA1246, SALM1		16495444, 16828986	Standard	NM_020737		Approved	FIGLER2	uc003oph.1	Q9ULH4	OTTHUMG00000014662	ENST00000338305.6:c.1046C>A	chr6.hg19:g.40399807G>T	ENSP00000345985:p.Thr349Asn	79.0	0.0		89.0	38.0	NM_020737	A5PKU3|Q5SYP9	Missense_Mutation	SNP	ENST00000338305.6	hg19	CCDS34443.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.946224	0.73672	.	.	ENSG00000156564	ENST00000338305	T	0.67345	-0.26	5.43	5.43	0.79202	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.090535	0.85682	D	0.000000	T	0.81711	0.4880	M	0.87381	2.88	0.80722	D	1	D	0.63880	0.993	D	0.68621	0.959	D	0.84802	0.0785	10	0.87932	D	0	.	17.8027	0.88592	0.0:0.0:1.0:0.0	.	349	Q9ULH4	LRFN2_HUMAN	N	349	ENSP00000345985:T349N	ENSP00000345985:T349N	T	-	2	0	LRFN2	40507785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.853000	0.99521	2.555000	0.86185	0.655000	0.94253	ACC	.	.		0.607	LRFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040488.1	XM_166372	
AIM1	202	hgsc.bcm.edu	37	6	106967348	106967348	+	Silent	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr6:106967348C>A	ENST00000369066.3	+	2	1528	c.1041C>A	c.(1039-1041)gtC>gtA	p.V347V		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AAGTTACCGTCTCGGAAGAAG	0.443																																					p.V347V		Atlas-SNP	.											.	AIM1	161	.	0			c.C1041A						.						82.0	89.0	86.0					6																	106967348		2203	4300	6503	SO:0001819	synonymous_variant	202	exon2			TACCGTCTCGGAA	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1041C>A	chr6.hg19:g.106967348C>A		232.0	0.0		172.0	51.0	NM_001624	Q6P2P0|Q9BTM3	Silent	SNP	ENST00000369066.3	hg19	CCDS34506.1																																																																																			.	.		0.443	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
FRK	2444	hgsc.bcm.edu	37	6	116263781	116263781	+	Silent	SNP	T	T	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr6:116263781T>C	ENST00000606080.1	-	8	1760	c.1314A>G	c.(1312-1314)acA>acG	p.T438T	FRK_ENST00000538210.1_Silent_p.T296T	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	438	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	CCTGGGCACCTGTCATACCTT	0.383																																					p.T438T		Atlas-SNP	.											.	FRK	78	.	0			c.A1314G						.						97.0	91.0	93.0					6																	116263781		2203	4300	6503	SO:0001819	synonymous_variant	2444	exon8			GGCACCTGTCATA	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.1314A>G	chr6.hg19:g.116263781T>C		166.0	0.0		106.0	14.0	NM_002031	B4DY49|Q13128|Q9NTR5	Silent	SNP	ENST00000606080.1	hg19	CCDS5103.1																																																																																			.	.		0.383	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031	
PTPRK	5796	hgsc.bcm.edu	37	6	128388924	128388924	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr6:128388924C>A	ENST00000368215.3	-	12	1896	c.1897G>T	c.(1897-1899)Gtt>Ttt	p.V633F	PTPRK_ENST00000368213.5_Missense_Mutation_p.V633F|PTPRK_ENST00000368210.3_Missense_Mutation_p.V633F|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368227.3_Missense_Mutation_p.V633F|PTPRK_ENST00000368207.3_Missense_Mutation_p.V633F|PTPRK_ENST00000532331.1_Missense_Mutation_p.V633F|PTPRK_ENST00000368226.4_Missense_Mutation_p.V633F			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	633	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		TCTTCCACAACAATCTGATAA	0.413																																					p.V633F		Atlas-SNP	.											.	PTPRK	330	.	0			c.G1897T						.						58.0	63.0	61.0					6																	128388924		2203	4300	6503	SO:0001583	missense	5796	exon12			CCACAACAATCTG	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1897G>T	chr6.hg19:g.128388924C>A	ENSP00000357198:p.Val633Phe	73.0	0.0		61.0	15.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Missense_Mutation	SNP	ENST00000368215.3	hg19		.	.	.	.	.	.	.	.	.	.	C	24.4	4.526193	0.85600	.	.	ENSG00000152894	ENST00000368226;ENST00000368227;ENST00000532331;ENST00000368213;ENST00000368210;ENST00000368215;ENST00000368207;ENST00000427676	T;T;T;T;T;T;T	0.10099	2.92;2.91;2.93;2.92;2.91;2.92;2.91	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.31734	0.0806	M	0.80422	2.495	0.80722	D	1	D;D;D;P;D;D	0.71674	0.998;0.985;0.991;0.92;0.99;0.994	D;P;D;P;D;D	0.78314	0.991;0.89;0.949;0.761;0.969;0.986	T	0.04593	-1.0940	10	0.87932	D	0	.	20.3409	0.98764	0.0:1.0:0.0:0.0	.	633;633;633;490;633;633	B4DHC3;B7ZMG0;Q15262-3;F5GWP2;Q15262;Q15262-2	.;.;.;.;PTPRK_HUMAN;.	F	633;633;633;633;633;633;633;490	ENSP00000357209:V633F;ENSP00000357210:V633F;ENSP00000432973:V633F;ENSP00000357196:V633F;ENSP00000357193:V633F;ENSP00000357198:V633F;ENSP00000357190:V633F	ENSP00000357190:V633F	V	-	1	0	PTPRK	128430617	1.000000	0.71417	0.979000	0.43373	0.978000	0.69477	7.487000	0.81328	2.814000	0.96858	0.655000	0.94253	GTT	.	.		0.413	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
VWDE	221806	hgsc.bcm.edu	37	7	12414847	12414847	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr7:12414847T>C	ENST00000275358.3	-	8	1219	c.1031A>G	c.(1030-1032)gAg>gGg	p.E344G		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	344						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						GCCTAGGTGCTCTCTACCTAT	0.353																																					p.E344G		Atlas-SNP	.											.	VWDE	123	.	0			c.A1031G						.						56.0	48.0	50.0					7																	12414847		692	1590	2282	SO:0001583	missense	221806	exon8			AGGTGCTCTCTAC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.1031A>G	chr7.hg19:g.12414847T>C	ENSP00000275358:p.Glu344Gly	84.0	0.0		64.0	11.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	T	9.569	1.120522	0.20877	.	.	ENSG00000146530	ENST00000275358	D	0.83335	-1.71	4.68	3.5	0.40072	.	.	.	.	.	T	0.80417	0.4619	M	0.62723	1.935	0.09310	N	1	B	0.19073	0.033	B	0.18561	0.022	T	0.71457	-0.4587	9	0.62326	D	0.03	.	10.5522	0.45095	0.1449:0.0:0.0:0.8551	.	344	Q8N2E2	VWDE_HUMAN	G	344	ENSP00000275358:E344G	ENSP00000275358:E344G	E	-	2	0	VWDE	12381372	0.984000	0.35163	0.004000	0.12327	0.018000	0.09664	1.699000	0.37804	0.792000	0.33850	0.477000	0.44152	GAG	.	.		0.353	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
PRPS1L1	221823	hgsc.bcm.edu	37	7	18066745	18066745	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr7:18066745C>A	ENST00000506618.2	-	1	741	c.661G>T	c.(661-663)Gac>Tac	p.D221Y		NM_175886.2	NP_787082	P21108	PRPS3_HUMAN	phosphoribosyl pyrophosphate synthetase 1-like 1	221	Binding of phosphoribosylpyrophosphate. {ECO:0000255}.				5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|nucleotide biosynthetic process (GO:0009165)|ribonucleoside monophosphate biosynthetic process (GO:0009156)		ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(3)	18	Lung NSC(10;0.0385)|all_lung(11;0.0736)					TCTGCCATGTCATCTACAAGG	0.448																																					p.D221Y		Atlas-SNP	.											.	PRPS1L1	90	.	0			c.G661T						.						118.0	114.0	115.0					7																	18066745		2203	4300	6503	SO:0001583	missense	221823	exon1			CCATGTCATCTAC	M57423	CCDS47552.1	7p21.1	2010-12-10			ENSG00000229937	ENSG00000229937			9463	protein-coding gene	gene with protein product		611566		PRPSL		2168892	Standard	NM_175886		Approved	PRPS3	uc003stz.3	P21108	OTTHUMG00000152742	ENST00000506618.2:c.661G>T	chr7.hg19:g.18066745C>A	ENSP00000424595:p.Asp221Tyr	175.0	0.0		110.0	42.0	NM_175886	Q6P5P6	Missense_Mutation	SNP	ENST00000506618.2	hg19	CCDS47552.1	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346231	0.61073	.	.	ENSG00000229937	ENST00000506618	D	0.95622	-3.76	4.4	3.51	0.40186	Phosphoribosyltransferase (1);	.	.	.	.	D	0.98469	0.9490	H	0.98295	4.195	.	.	.	D	0.89917	1.0	D	0.97110	1.0	D	0.99907	1.1183	8	0.87932	D	0	.	10.5365	0.45007	0.0:0.9039:0.0:0.0961	.	221	P21108	PRPS3_HUMAN	Y	221	ENSP00000424595:D221Y	ENSP00000424595:D221Y	D	-	1	0	PRPS1L1	18033270	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.124000	0.57924	1.210000	0.43336	0.650000	0.86243	GAC	.	.		0.448	PRPS1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327667.1	NM_175886	
NPC1L1	29881	hgsc.bcm.edu	37	7	44555418	44555418	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr7:44555418G>A	ENST00000289547.4	-	19	3916	c.3861C>T	c.(3859-3861)gtC>gtT	p.V1287V	NPC1L1_ENST00000381160.3_Silent_p.V1260V|NPC1L1_ENST00000546276.1_Silent_p.V1214V	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1287					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	AGCTGAGGATGACGGGCAGGA	0.557																																					p.V1287V		Atlas-SNP	.											.	NPC1L1	141	.	0			c.C3861T						.						82.0	79.0	80.0					7																	44555418		2203	4300	6503	SO:0001819	synonymous_variant	29881	exon19			GAGGATGACGGGC		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3861C>T	chr7.hg19:g.44555418G>A		138.0	0.0		114.0	16.0	NM_013389	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Silent	SNP	ENST00000289547.4	hg19	CCDS5491.1																																																																																			.	.		0.557	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
MAGI2	9863	hgsc.bcm.edu	37	7	77797303	77797303	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr7:77797303G>A	ENST00000354212.4	-	15	2779	c.2526C>T	c.(2524-2526)atC>atT	p.I842I	MAGI2_ENST00000522391.1_Silent_p.I842I|MAGI2_ENST00000419488.1_Silent_p.I828I	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	842	PDZ 4. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GCATGAGGTCGATGACATAGC	0.567																																					p.I842I		Atlas-SNP	.											.	MAGI2	246	.	0			c.C2526T						.						198.0	177.0	184.0					7																	77797303		2203	4300	6503	SO:0001819	synonymous_variant	9863	exon15			GAGGTCGATGACA	AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2526C>T	chr7.hg19:g.77797303G>A		196.0	0.0		123.0	23.0	NM_012301	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	ENST00000354212.4	hg19	CCDS5594.1																																																																																			.	.		0.567	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253197.3	NM_012301	
EPHB6	2051	hgsc.bcm.edu	37	7	142564355	142564355	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr7:142564355G>A	ENST00000392957.2	+	10	2366	c.1579G>A	c.(1579-1581)Gac>Aac	p.D527N	EPHB6_ENST00000411471.2_Missense_Mutation_p.D250N|EPHB6_ENST00000442129.1_Missense_Mutation_p.D527N	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	527	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					CCGCTACTATGACCAGGTGCG	0.627																																					p.D527N		Atlas-SNP	.											.	EPHB6	168	.	0			c.G1579A						.						73.0	74.0	74.0					7																	142564355		2203	4300	6503	SO:0001583	missense	2051	exon10			TACTATGACCAGG	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.1579G>A	chr7.hg19:g.142564355G>A	ENSP00000376684:p.Asp527Asn	80.0	0.0		56.0	21.0	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Missense_Mutation	SNP	ENST00000392957.2	hg19	CCDS5873.2	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686363	0.88639	.	.	ENSG00000106123	ENST00000392957;ENST00000442129;ENST00000411471	T;T;T	0.56941	0.43;0.43;0.43	4.8	4.8	0.61643	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.49916	D	0.000137	T	0.63343	0.2503	L	0.41356	1.27	0.46823	D	0.999219	D	0.89917	1.0	D	0.87578	0.998	T	0.66139	-0.5998	10	0.87932	D	0	.	13.0794	0.59104	0.0:0.1615:0.8385:0.0	.	527	O15197	EPHB6_HUMAN	N	527;527;250	ENSP00000376684:D527N;ENSP00000410789:D527N;ENSP00000409061:D250N	ENSP00000376684:D527N	D	+	1	0	EPHB6	142274477	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.475000	0.73582	2.370000	0.80446	0.556000	0.70494	GAC	.	.		0.627	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
PAXIP1	22976	hgsc.bcm.edu	37	7	154759569	154759569	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr7:154759569G>T	ENST00000404141.1	-	8	2004	c.1850C>A	c.(1849-1851)cCa>cAa	p.P617Q	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.P617Q			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	617	BRCT 3. {ECO:0000255|PROSITE- ProRule:PRU00033}.|Gln-rich.|Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		CATCTGCTCTGGATAATCCGC	0.398																																					p.P617Q		Atlas-SNP	.											.	PAXIP1	150	.	0			c.C1850A						.						73.0	72.0	73.0					7																	154759569		1948	4133	6081	SO:0001583	missense	22976	exon8			TGCTCTGGATAAT	U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1850C>A	chr7.hg19:g.154759569G>T	ENSP00000384048:p.Pro617Gln	95.0	0.0		101.0	5.0	NM_007349	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	ENST00000404141.1	hg19	CCDS47753.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910448	0.52439	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.79141	-1.24;-1.24	5.17	5.17	0.71159	BRCT (4);	0.000000	0.56097	U	0.000037	T	0.82199	0.4985	L	0.36672	1.1	0.58432	D	0.999996	P;D;D;D	0.89917	0.677;1.0;1.0;1.0	B;D;D;D	0.97110	0.418;0.999;0.999;1.0	T	0.76838	-0.2811	10	0.12766	T	0.61	-21.4467	18.6938	0.91593	0.0:0.0:1.0:0.0	.	570;526;583;617	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	Q	617;617;441;570	ENSP00000384048:P617Q;ENSP00000380376:P617Q	ENSP00000319149:P570Q	P	-	2	0	PAXIP1	154390502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.769000	0.91742	2.403000	0.81681	0.655000	0.94253	CCA	.	.		0.398	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322223.1	NM_007349	
CYP11B1	1584	hgsc.bcm.edu	37	8	143957288	143957288	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr8:143957288A>T	ENST00000292427.4	-	6	993	c.961T>A	c.(961-963)Ttt>Att	p.F321I	CYP11B1_ENST00000517471.1_Missense_Mutation_p.F321I|CYP11B1_ENST00000377675.3_Missense_Mutation_p.F392I	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	321					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	AGCAAGGGAAACACCGTCTGC	0.647									Familial Hyperaldosteronism type I																												p.F321I		Atlas-SNP	.											.	CYP11B1	128	.	0			c.T961A	GRCh37	HM972175	CYP11B1	M		.						89.0	85.0	87.0					8																	143957288		2203	4300	6503	SO:0001583	missense	1584	exon6	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	AGGGAAACACCGT	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.961T>A	chr8.hg19:g.143957288A>T	ENSP00000292427:p.Phe321Ile	277.0	0.0		255.0	64.0	NM_000497	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	hg19	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	.	0.798	-0.756407	0.03019	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.67345	-0.26;-0.26;-0.26	4.31	0.207	0.15214	.	0.801024	0.10849	N	0.627347	T	0.42988	0.1227	N	0.13140	0.3	0.09310	N	1	B;B;B;P	0.45176	0.016;0.009;0.027;0.852	B;B;B;B	0.42462	0.021;0.021;0.007;0.388	T	0.25433	-1.0132	10	0.21540	T	0.41	.	2.6093	0.04886	0.4147:0.0:0.229:0.3562	.	392;321;321;37	Q4VAR0;Q4VAQ9;P15538;Q8N9P8	.;.;C11B1_HUMAN;.	I	321;321;392	ENSP00000292427:F321I;ENSP00000428043:F321I;ENSP00000366903:F392I	ENSP00000292427:F321I	F	-	1	0	CYP11B1	143954290	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	0.053000	0.14184	-0.149000	0.11215	0.454000	0.30748	TTT	.	.		0.647	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
ARHGAP39	80728	hgsc.bcm.edu	37	8	145759534	145759534	+	Silent	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr8:145759534T>A	ENST00000276826.5	-	6	2775	c.2574A>T	c.(2572-2574)gcA>gcT	p.A858A	ARHGAP39_ENST00000540274.1_Silent_p.A858A|ARHGAP39_ENST00000377307.2_Silent_p.A889A			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	858	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CGGTCAGGGCTGCCTTCTGTA	0.647																																					p.A889A		Atlas-SNP	.											.	ARHGAP39	80	.	0			c.A2667T						.						100.0	95.0	97.0					8																	145759534		2202	4300	6502	SO:0001819	synonymous_variant	80728	exon9			CAGGGCTGCCTTC		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2574A>T	chr8.hg19:g.145759534T>A		47.0	0.0		49.0	9.0	NM_025251	B4E1I1	Silent	SNP	ENST00000276826.5	hg19																																																																																				.	.		0.647	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
KCNV2	169522	hgsc.bcm.edu	37	9	2718411	2718411	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr9:2718411G>A	ENST00000382082.3	+	1	910	c.672G>A	c.(670-672)gcG>gcA	p.A224A		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	224					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		GCGCGCAGGCGCAGGTCGAGG	0.672																																					p.A224A		Atlas-SNP	.											.	KCNV2	72	.	0			c.G672A						.						9.0	9.0	9.0					9																	2718411		2141	4185	6326	SO:0001819	synonymous_variant	169522	exon1			GCAGGCGCAGGTC	AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.672G>A	chr9.hg19:g.2718411G>A		134.0	0.0		81.0	36.0	NM_133497	Q5T6X0	Silent	SNP	ENST00000382082.3	hg19	CCDS6447.1																																																																																			.	.		0.672	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051528.1	NM_133497	
RIC1	57589	hgsc.bcm.edu	37	9	5770152	5770152	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr9:5770152A>G	ENST00000414202.2	+	23	3681	c.3490A>G	c.(3490-3492)Atc>Gtc	p.I1164V	KIAA1432_ENST00000418622.3_Missense_Mutation_p.I1085V|KIAA1432_ENST00000449720.2_Missense_Mutation_p.I1048V	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2														breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GGATGCTGGCATCTCCAACAT	0.493																																					p.I1164V		Atlas-SNP	.											.	KIAA1432	97	.	0			c.A3490G						.						112.0	92.0	99.0					9																	5770152		2203	4300	6503	SO:0001583	missense	57589	exon23			GCTGGCATCTCCA																												ENST00000414202.2:c.3490A>G	chr9.hg19:g.5770152A>G	ENSP00000416696:p.Ile1164Val	78.0	0.0		68.0	15.0	NM_020829		Missense_Mutation	SNP	ENST00000414202.2	hg19	CCDS34982.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.330|7.330	0.618774|0.618774	0.14129|0.14129	.|.	.|.	ENSG00000107036|ENSG00000107036	ENST00000545641|ENST00000414202;ENST00000418622;ENST00000449720	.|.	.|.	.|.	5.56|5.56	-7.87|-7.87	0.01183|0.01183	.|.	.|0.647764	.|0.17225	.|N	.|0.182178	T|T	0.18923|0.18923	0.0454|0.0454	N|N	0.02011|0.02011	-0.69|-0.69	0.37765|0.37765	D|D	0.926486|0.926486	.|B;B	.|0.02656	.|0.0;0.0	.|B;B	.|0.01281	.|0.0;0.0	T|T	0.18023|0.18023	-1.0350|-1.0350	5|9	.|0.16420	.|T	.|0.52	-0.6967|-0.6967	13.6987|13.6987	0.62595|0.62595	0.3506:0.0867:0.5627:0.0|0.3506:0.0867:0.5627:0.0	.|.	.|1048;1164	.|B7ZM67;Q4ADV7	.|.;RIC1_HUMAN	R|V	1055|1164;1085;1048	.|.	.|ENSP00000416696:I1164V	H|I	+|+	2|1	0|0	KIAA1432|KIAA1432	5760152|5760152	0.000000|0.000000	0.05858|0.05858	0.030000|0.030000	0.17652|0.17652	0.944000|0.944000	0.59088|0.59088	-0.162000|-0.162000	0.10012|0.10012	-1.439000|-1.439000	0.01962|0.01962	0.459000|0.459000	0.35465|0.35465	CAT|ATC	.	.		0.493	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051636.3		
PRUNE2	158471	hgsc.bcm.edu	37	9	79319835	79319835	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr9:79319835C>A	ENST00000376718.3	-	8	7478	c.7355G>T	c.(7354-7356)gGa>gTa	p.G2452V	PRUNE2_ENST00000428286.1_Missense_Mutation_p.G2093V	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2452					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CAGCTGGGATCCAGGCAGTCT	0.507											OREG0019258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G2452V		Atlas-SNP	.											.	PRUNE2	331	.	0			c.G7355T						.						61.0	53.0	55.0					9																	79319835		1568	3582	5150	SO:0001583	missense	158471	exon8			TGGGATCCAGGCA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7355G>T	chr9.hg19:g.79319835C>A	ENSP00000365908:p.Gly2452Val	153.0	0.0	1190	114.0	21.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.591|9.591	1.126120|1.126120	0.20959|0.20959	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.46819|.	0.86;0.87|.	5.93|5.93	0.369|0.369	0.16151|0.16151	.|.	0.568251|.	0.17238|.	N|.	0.181650|.	T|T	0.37156|0.37156	0.0993|0.0993	L|L	0.56769|0.56769	1.78|1.78	0.09310|0.09310	N|N	0.999999|0.999999	P|.	0.35077|.	0.483|.	B|.	0.33392|.	0.163|.	T|T	0.33394|0.33394	-0.9870|-0.9870	10|5	0.66056|.	D|.	0.02|.	-8.9788|-8.9788	1.9445|1.9445	0.03354|0.03354	0.1238:0.2525:0.3626:0.2611|0.1238:0.2525:0.3626:0.2611	.|.	2452|.	Q8WUY3|.	PRUN2_HUMAN|.	V|C	2452;2093;2451|1773	ENSP00000365908:G2452V;ENSP00000397425:G2093V|.	ENSP00000365908:G2452V|.	G|W	-|-	2|3	0|0	PRUNE2|PRUNE2	78509655|78509655	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.156000|0.156000	0.22039|0.22039	-0.087000|-0.087000	0.11215|0.11215	0.065000|0.065000	0.16485|0.16485	-0.127000|-0.127000	0.14921|0.14921	GGA|TGG	.	.		0.507	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
TRAF1	7185	hgsc.bcm.edu	37	9	123675664	123675664	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr9:123675664G>A	ENST00000373887.3	-	5	3092	c.647C>T	c.(646-648)gCc>gTc	p.A216V	TRAF1_ENST00000546084.1_Missense_Mutation_p.A94V|TRAF1_ENST00000540010.1_Missense_Mutation_p.A216V	NM_005658.4	NP_005649.1	Q13077	TRAF1_HUMAN	TNF receptor-associated factor 1	216					apoptotic process (GO:0006915)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein complex assembly (GO:0006461)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|ovary(4)|pancreas(1)|skin(2)	22						GATAGAGGTGGCCAGGGCCAG	0.607																																					p.A216V		Atlas-SNP	.											.	TRAF1	42	.	0			c.C647T						.						50.0	42.0	44.0					9																	123675664		2203	4300	6503	SO:0001583	missense	7185	exon5			GAGGTGGCCAGGG	AK090468	CCDS6825.1, CCDS55335.1	9q33-q34	2008-02-05			ENSG00000056558	ENSG00000056558			12031	protein-coding gene	gene with protein product		601711				8069916	Standard	NM_001190945		Approved	EBI6	uc010mvl.2	Q13077	OTTHUMG00000020578	ENST00000373887.3:c.647C>T	chr9.hg19:g.123675664G>A	ENSP00000362994:p.Ala216Val	214.0	0.0		163.0	19.0	NM_005658	B4DJ77|Q658U1|Q8NF13	Missense_Mutation	SNP	ENST00000373887.3	hg19	CCDS6825.1	.	.	.	.	.	.	.	.	.	.	G	15.49	2.850101	0.51270	.	.	ENSG00000056558	ENST00000373887;ENST00000540010;ENST00000546084	T;T;T	0.45276	1.44;1.44;0.9	4.99	4.99	0.66335	.	0.159146	0.41500	D	0.000866	T	0.30854	0.0778	L	0.31664	0.95	0.37459	D	0.915149	B	0.30146	0.27	B	0.27715	0.082	T	0.22800	-1.0206	10	0.27785	T	0.31	-23.5276	13.855	0.63522	0.0:0.0:0.8469:0.1531	.	216	Q13077	TRAF1_HUMAN	V	216;216;94	ENSP00000362994:A216V;ENSP00000443183:A216V;ENSP00000438583:A94V	ENSP00000362994:A216V	A	-	2	0	TRAF1	122715485	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.364000	0.59479	2.301000	0.77427	0.563000	0.77884	GCC	.	.		0.607	TRAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053843.1	NM_005658	
GRIN1	2902	hgsc.bcm.edu	37	9	140040236	140040236	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr9:140040236G>T	ENST00000371561.3	+	3	1549	c.452G>T	c.(451-453)tGg>tTg	p.W151L	GRIN1_ENST00000315048.3_Missense_Mutation_p.W151L|GRIN1_ENST00000371559.4_Missense_Mutation_p.W151L|GRIN1_ENST00000371553.3_Missense_Mutation_p.W151L|GRIN1_ENST00000371555.4_Missense_Mutation_p.W151L|GRIN1_ENST00000371550.4_Missense_Mutation_p.W151L|GRIN1_ENST00000371546.4_Missense_Mutation_p.W151L|GRIN1_ENST00000371560.3_Missense_Mutation_p.W151L|GRIN1_ENST00000350902.5_Missense_Mutation_p.W151L|GRIN1_ENST00000471122.1_3'UTR	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	151					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCCAGCGTGTGGTTTGAGATG	0.672																																					p.W151L	NSCLC(113;717 1653 2089 20474 37618)	Atlas-SNP	.											.	GRIN1	51	.	0			c.G452T						.						79.0	51.0	61.0					9																	140040236		2203	4299	6502	SO:0001583	missense	2902	exon3			GCGTGTGGTTTGA		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.452G>T	chr9.hg19:g.140040236G>T	ENSP00000360616:p.Trp151Leu	117.0	0.0		82.0	20.0	NM_000832	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Missense_Mutation	SNP	ENST00000371561.3	hg19	CCDS7031.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.503568	0.85176	.	.	ENSG00000176884	ENST00000371561;ENST00000315048;ENST00000350902;ENST00000371550;ENST00000371546;ENST00000371555;ENST00000371553;ENST00000371559;ENST00000371560	T;T;T;T;T;T;T;T;T	0.80393	-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37;-1.37	4.0	4.0	0.46444	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88202	0.6373	M	0.75777	2.31	0.80722	D	1	D;B;D;D;D;D	0.89917	0.96;0.099;0.999;0.999;0.999;1.0	P;B;D;D;D;D	0.77557	0.893;0.141;0.941;0.956;0.974;0.99	D	0.87847	0.2655	10	0.37606	T	0.19	.	14.6551	0.68828	0.0:0.0:1.0:0.0	.	151;151;151;151;151;151	Q5VSF4;Q5VSF5;Q05586-2;Q05586-3;Q05586;A2AVK2	.;.;.;.;NMDZ1_HUMAN;.	L	151	ENSP00000360616:W151L;ENSP00000316696:W151L;ENSP00000316915:W151L;ENSP00000360605:W151L;ENSP00000360601:W151L;ENSP00000360610:W151L;ENSP00000360608:W151L;ENSP00000360614:W151L;ENSP00000360615:W151L	ENSP00000316696:W151L	W	+	2	0	GRIN1	139160057	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.181000	0.94874	1.787000	0.52448	0.313000	0.20887	TGG	.	.		0.672	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
CACNA1B	774	hgsc.bcm.edu	37	9	140943745	140943745	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr9:140943745G>A	ENST00000371372.1	+	24	3833	c.3688G>A	c.(3688-3690)Gcc>Acc	p.A1230T	CACNA1B_ENST00000371363.1_Missense_Mutation_p.A1230T|CACNA1B_ENST00000371355.4_Missense_Mutation_p.A1231T|CACNA1B_ENST00000371357.1_Missense_Mutation_p.A1231T|CACNA1B_ENST00000277549.5_Missense_Mutation_p.A422T|CACNA1B_ENST00000545473.1_3'UTR|CACNA1B_ENST00000277551.2_Missense_Mutation_p.A1230T	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1230					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	GGTCAGTGGCGCCCTGGTGGC	0.547																																					p.A1230T		Atlas-SNP	.											.	CACNA1B	266	.	0			c.G3688A						.						151.0	147.0	148.0					9																	140943745		2075	4211	6286	SO:0001583	missense	774	exon24			AGTGGCGCCCTGG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.3688G>A	chr9.hg19:g.140943745G>A	ENSP00000360423:p.Ala1230Thr	104.0	0.0		76.0	28.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	G	37	6.483172	0.97603	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0;-5.0;-5.0	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.99045	0.9673	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	0.976;1.0;1.0	P;D;D	0.81914	0.693;0.995;0.995	D	0.99777	1.1026	10	0.87932	D	0	.	18.1658	0.89724	0.0:0.0:1.0:0.0	.	1230;1231;1230	B1AQK4;B1AQK7;B1AQK6	.;.;.	T	1230;1230;422;1230;1231;1231	ENSP00000360423:A1230T;ENSP00000277551:A1230T;ENSP00000277549:A422T;ENSP00000360414:A1230T;ENSP00000360408:A1231T;ENSP00000360406:A1231T	ENSP00000277549:A422T	A	+	1	0	CACNA1B	140063566	1.000000	0.71417	0.994000	0.49952	0.973000	0.67179	9.711000	0.98735	2.386000	0.81285	0.491000	0.48974	GCC	.	.		0.547	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
HELLS	3070	hgsc.bcm.edu	37	10	96350209	96350209	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr10:96350209C>T	ENST00000348459.5	+	14	1633	c.1528C>T	c.(1528-1530)Cga>Tga	p.R510*	HELLS_ENST00000239026.6_3'UTR|HELLS_ENST00000394045.1_Nonsense_Mutation_p.R412*|HELLS_ENST00000371332.4_Nonsense_Mutation_p.R556*|HELLS_ENST00000394036.1_3'UTR|RP11-119K6.6_ENST00000432120.1_RNA	NM_018063.3	NP_060533.2			helicase, lymphoid-specific											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22		Colorectal(252;0.0429)		all cancers(201;2.13e-05)		TCGACCAAAACGACGAACTAG	0.343																																					p.R510X		Atlas-SNP	.											.	HELLS	63	.	0			c.C1528T						.						60.0	61.0	61.0					10																	96350209		2203	4300	6503	SO:0001587	stop_gained	3070	exon14			CCAAAACGACGAA	AF155827	CCDS7434.1, CCDS73162.1, CCDS73163.1, CCDS73164.1, CCDS73165.1	10q24.2	2008-08-01			ENSG00000119969	ENSG00000119969			4861	protein-coding gene	gene with protein product	"""SWI/SNF2-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 6"", ""proliferation-associated SNF2-like protein"""	603946				9878251, 10910076	Standard	NM_018063		Approved	PASG, SMARCA6, LSH, Nbla10143	uc001kjt.3	Q9NRZ9	OTTHUMG00000018793	ENST00000348459.5:c.1528C>T	chr10.hg19:g.96350209C>T	ENSP00000239027:p.Arg510*	325.0	0.0		197.0	8.0	NM_018063		Nonsense_Mutation	SNP	ENST00000348459.5	hg19	CCDS7434.1	.	.	.	.	.	.	.	.	.	.	C	39	7.807766	0.98501	.	.	ENSG00000119969	ENST00000348459;ENST00000394045;ENST00000371332	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4508	16.5016	0.84259	0.0:1.0:0.0:0.0	.	.	.	.	X	510;412;556	.	ENSP00000239027:R510X	R	+	1	2	HELLS	96340199	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.356000	0.73046	2.559000	0.86315	0.655000	0.94253	CGA	.	.		0.343	HELLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049475.1	NM_018063	
WBP1L	54838	hgsc.bcm.edu	37	10	104572770	104572770	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr10:104572770G>C	ENST00000369889.4	+	4	853	c.711G>C	c.(709-711)gaG>gaC	p.E237D	WBP1L_ENST00000448841.1_Missense_Mutation_p.E258D	NM_017787.4	NP_060257.4	Q9NX94	WBP1L_HUMAN	WW domain binding protein 1-like	237						integral component of membrane (GO:0016021)											ACAGCAAAGAGAAGACGCCTG	0.577																																					p.E258D		Atlas-SNP	.											.	.	.	.	0			c.G774C						.						59.0	55.0	56.0					10																	104572770		2203	4300	6503	SO:0001583	missense	54838	exon4			CAAAGAGAAGACG	AK056285	CCDS7540.1, CCDS44473.1	10q24.33	2012-05-02	2012-05-02	2012-05-02	ENSG00000166272	ENSG00000166272			23510	protein-coding gene	gene with protein product	"""outcome predictor in acute leukemia 1"""	611129	"""chromosome 10 open reading frame 26"""	C10orf26			Standard	NM_017787		Approved	FLJ20154, OPAL1	uc001kwf.4	Q9NX94	OTTHUMG00000018968	ENST00000369889.4:c.711G>C	chr10.hg19:g.104572770G>C	ENSP00000358905:p.Glu237Asp	65.0	0.0		47.0	8.0	NM_001083913	B3KPF4|B7Z6S7|D3DR90|Q1EG70|Q2HIY7|Q5F2G6	Missense_Mutation	SNP	ENST00000369889.4	hg19	CCDS7540.1	.	.	.	.	.	.	.	.	.	.	g	0.140	-1.103097	0.01828	.	.	ENSG00000166272	ENST00000448841;ENST00000369889	T;T	0.27402	1.72;1.67	6.05	3.14	0.36123	.	0.252002	0.46145	N	0.000316	T	0.07279	0.0184	N	0.00419	-1.52	0.24192	N	0.995543	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.39313	-0.9620	10	0.02654	T	1	-18.7717	11.4177	0.49962	0.0:0.6649:0.2702:0.0649	.	258;237	Q9NX94-2;Q9NX94	.;OPA1L_HUMAN	D	258;237	ENSP00000414721:E258D;ENSP00000358905:E237D	ENSP00000358905:E237D	E	+	3	2	C10orf26	104562760	1.000000	0.71417	1.000000	0.80357	0.418000	0.31294	1.184000	0.32053	0.406000	0.25560	-0.218000	0.12543	GAG	.	.		0.577	WBP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000050100.1	NM_017787	
SORCS1	114815	hgsc.bcm.edu	37	10	108337267	108337267	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr10:108337267C>T	ENST00000263054.6	-	26	3425	c.3418G>A	c.(3418-3420)Gac>Aac	p.D1140N	SORCS1_ENST00000369698.1_3'UTR|SORCS1_ENST00000344440.6_Intron	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	1140					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGAGATGAGTCACCAGGTTGA	0.502																																					p.D1140N		Atlas-SNP	.											.	SORCS1	534	.	0			c.G3418A						.						97.0	96.0	96.0					10																	108337267		2203	4300	6503	SO:0001583	missense	114815	exon26			ATGAGTCACCAGG	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.3418G>A	chr10.hg19:g.108337267C>T	ENSP00000263054:p.Asp1140Asn	76.0	0.0		55.0	14.0	NM_052918	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Missense_Mutation	SNP	ENST00000263054.6	hg19	CCDS7559.1	.	.	.	.	.	.	.	.	.	.	C	11.86	1.765459	0.31228	.	.	ENSG00000108018	ENST00000263054	T	0.16457	2.34	5.52	5.52	0.82312	.	.	.	.	.	T	0.09158	0.0226	N	0.08118	0	0.80722	D	1	B	0.23058	0.079	B	0.24269	0.052	T	0.32955	-0.9887	8	.	.	.	.	12.3392	0.55085	0.0:0.9223:0.0:0.0777	.	1140	Q8WY21	SORC1_HUMAN	N	1140	ENSP00000263054:D1140N	.	D	-	1	0	SORCS1	108327257	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.135000	0.50546	2.759000	0.94783	0.555000	0.69702	GAC	.	.		0.502	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
APBB1	322	hgsc.bcm.edu	37	11	6424420	6424420	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr11:6424420T>A	ENST00000609360.1	-	6	1158	c.1059A>T	c.(1057-1059)caA>caT	p.Q353H	APBB1_ENST00000609331.1_Missense_Mutation_p.Q118H|APBB1_ENST00000530885.1_Missense_Mutation_p.Q133H|APBB1_ENST00000299402.6_Missense_Mutation_p.Q353H|APBB1_ENST00000529519.1_Intron|APBB1_ENST00000608655.1_Missense_Mutation_p.Q133H|APBB1_ENST00000608394.1_Missense_Mutation_p.Q94H|APBB1_ENST00000608704.1_Missense_Mutation_p.Q94H|APBB1_ENST00000608645.1_Missense_Mutation_p.Q94H|APBB1_ENST00000311051.3_Missense_Mutation_p.Q353H|APBB1_ENST00000389906.2_Missense_Mutation_p.Q353H	NM_001164.3	NP_001155.1	O00213	APBB1_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65)	353					apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|histone H4 acetylation (GO:0043967)|negative regulation of cell growth (GO:0030308)|negative regulation of thymidylate synthase biosynthetic process (GO:0050760)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|proline-rich region binding (GO:0070064)|transcription factor binding (GO:0008134)			breast(4)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|prostate(2)|skin(1)|urinary_tract(1)	24		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;6.49e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		TCTCCTCCTCTTGGGGCAACG	0.547																																					p.Q353H	GBM(147;1810 2556 5672 39622)	Atlas-SNP	.											.	APBB1	73	.	0			c.A1059T						.						113.0	107.0	109.0					11																	6424420		2201	4296	6497	SO:0001583	missense	322	exon6			CTCCTCTTGGGGC	L77864	CCDS31410.1, CCDS58114.1, CCDS66015.1, CCDS66016.1, CCDS66017.1, CCDS66018.1	11p15	2008-02-01				ENSG00000166313			581	protein-coding gene	gene with protein product		602709		RIR		8955346, 8894693	Standard	NM_001164		Approved	Fe65	uc001mcy.1	O00213		ENST00000609360.1:c.1059A>T	chr11.hg19:g.6424420T>A	ENSP00000477213:p.Gln353His	185.0	0.0		151.0	24.0	NM_001164	A1E379|A6NH82|A6NL69|B7Z1J5|B7Z1J6|B7Z2Y0|D3DQT2|Q7Z324|Q96A93|V9GYK0|V9GYT4	Missense_Mutation	SNP	ENST00000609360.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.79	3.220285	0.58560	.	.	ENSG00000166313	ENST00000299402;ENST00000311051;ENST00000389906;ENST00000539758;ENST00000536523;ENST00000544288;ENST00000530885;ENST00000533407	T;T;T;T;T	0.14022	2.54;2.54;2.54;2.54;2.54	4.71	-0.0552	0.13810	.	0.336327	0.27486	N	0.019145	T	0.14830	0.0358	N	0.24115	0.695	0.33336	D	0.56924	P;P;P;D	0.60160	0.952;0.919;0.952;0.987	P;P;B;P	0.60789	0.496;0.503;0.399;0.879	T	0.20338	-1.0278	10	0.36615	T	0.2	-8.2289	6.9674	0.24631	0.0:0.4631:0.0:0.5369	.	202;118;133;353	B7Z1H5;F5H1C5;B7Z2Y0;O00213-2	.;.;.;.	H	353;353;353;202;94;118;133;94	ENSP00000299402:Q353H;ENSP00000311912:Q353H;ENSP00000374556:Q353H;ENSP00000433338:Q133H;ENSP00000437114:Q94H	ENSP00000299402:Q353H	Q	-	3	2	APBB1	6380996	0.993000	0.37304	1.000000	0.80357	0.852000	0.48524	0.031000	0.13710	0.076000	0.16826	0.402000	0.26972	CAA	.	.		0.547	APBB1-023	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471831.1	NM_001164	
OR5D18	219438	hgsc.bcm.edu	37	11	55587664	55587664	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr11:55587664T>A	ENST00000333976.4	+	1	579	c.559T>A	c.(559-561)Tcc>Acc	p.S187T		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				CTCACTACTCTCCCTTTCTTG	0.408																																					p.S187T		Atlas-SNP	.											.	OR5D18	121	.	0			c.T559A						.						211.0	190.0	197.0					11																	55587664		2200	4296	6496	SO:0001583	missense	219438	exon1			CTACTCTCCCTTT	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.559T>A	chr11.hg19:g.55587664T>A	ENSP00000335025:p.Ser187Thr	121.0	0.0		84.0	8.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	hg19	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	4.086	0.014011	0.07959	.	.	ENSG00000186119	ENST00000333976	T	0.00084	8.75	4.85	0.241	0.15494	GPCR, rhodopsin-like superfamily (1);	0.203139	0.24965	N	0.034191	T	0.00109	0.0003	L	0.39467	1.215	0.09310	N	1	B	0.18166	0.026	B	0.31016	0.123	T	0.40459	-0.9562	10	0.46703	T	0.11	-21.2578	1.4149	0.02299	0.4535:0.0935:0.1412:0.3118	.	187	Q8NGL1	OR5DI_HUMAN	T	187	ENSP00000335025:S187T	ENSP00000335025:S187T	S	+	1	0	OR5D18	55344240	0.000000	0.05858	0.005000	0.12908	0.013000	0.08279	-3.137000	0.00588	0.293000	0.22520	0.462000	0.41574	TCC	.	.		0.408	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
OR1S1	219959	hgsc.bcm.edu	37	11	57983133	57983133	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr11:57983133G>A	ENST00000309433.6	+	1	917	c.917G>A	c.(916-918)aGg>aAg	p.R306K		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				TACAGCTTGAGGAATAAGGAT	0.438																																					p.R306K		Atlas-SNP	.											.	OR1S1	139	.	0			c.G917A						.						140.0	138.0	138.0					11																	57983133		2201	4295	6496	SO:0001583	missense	219959	exon1			GCTTGAGGAATAA	BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.917G>A	chr11.hg19:g.57983133G>A	ENSP00000311688:p.Arg306Lys	127.0	0.0		105.0	12.0	NM_001004458	Q6IFG3	Missense_Mutation	SNP	ENST00000309433.6	hg19	CCDS31546.1	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617173	0.66672	.	.	ENSG00000172774	ENST00000309433	T	0.39997	1.05	3.23	3.23	0.37069	.	0.000000	0.49916	D	0.000129	T	0.66237	0.2769	M	0.86097	2.795	0.24505	N	0.994232	D	0.89917	1.0	D	0.83275	0.996	T	0.60915	-0.7168	10	0.66056	D	0.02	.	13.6137	0.62094	0.0:0.0:1.0:0.0	.	306	Q8NH92	OR1S1_HUMAN	K	306	ENSP00000311688:R306K	ENSP00000311688:R306K	R	+	2	0	OR1S1	57739709	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.832000	0.55783	1.647000	0.50633	0.479000	0.44913	AGG	.	.		0.438	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394705.1	NM_001004458	
CPT1A	1374	hgsc.bcm.edu	37	11	68540890	68540890	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr11:68540890T>A	ENST00000265641.5	-	14	1737	c.1583A>T	c.(1582-1584)gAg>gTg	p.E528V	CPT1A_ENST00000540367.1_Missense_Mutation_p.E528V|CPT1A_ENST00000537756.2_5'UTR|CPT1A_ENST00000539743.1_Missense_Mutation_p.E528V|CPT1A_ENST00000376618.2_Missense_Mutation_p.E528V	NM_001876.3	NP_001867.2	P50416	CPT1A_HUMAN	carnitine palmitoyltransferase 1A (liver)	528					carnitine metabolic process (GO:0009437)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|cellular response to fatty acid (GO:0071398)|eating behavior (GO:0042755)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|glucose metabolic process (GO:0006006)|long-chain fatty acid metabolic process (GO:0001676)|positive regulation of fatty acid beta-oxidation (GO:0032000)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	Esophageal squamous(3;3.28e-14)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.142)		Glyburide(DB01016)|L-Carnitine(DB00583)|Perhexiline(DB01074)	CTCTATAACCTCTTGACACTT	0.448																																					p.E528V		Atlas-SNP	.											.	CPT1A	89	.	0			c.A1583T						.						90.0	76.0	81.0					11																	68540890		2200	4294	6494	SO:0001583	missense	1374	exon14			ATAACCTCTTGAC	L39211	CCDS8185.1, CCDS31624.1	11q13.2	2007-07-26				ENSG00000110090	2.3.1.21		2328	protein-coding gene	gene with protein product		600528		CPT1		7892212, 9070950	Standard	NM_001876		Approved	CPT1-L, L-CPT1	uc001oog.4	P50416		ENST00000265641.5:c.1583A>T	chr11.hg19:g.68540890T>A	ENSP00000265641:p.Glu528Val	70.0	0.0		65.0	13.0	NM_001876	Q8TCU0|Q9BWK0	Missense_Mutation	SNP	ENST00000265641.5	hg19	CCDS8185.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.057710	0.36277	.	.	ENSG00000110090	ENST00000540367;ENST00000376618;ENST00000265641;ENST00000538308;ENST00000539743	D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53	4.79	4.79	0.61399	.	0.482483	0.23160	N	0.051247	D	0.89952	0.6864	M	0.69358	2.11	0.33712	D	0.615911	B;B	0.26318	0.146;0.02	B;B	0.39339	0.297;0.049	D	0.91423	0.5160	10	0.33940	T	0.23	.	14.6125	0.68526	0.0:0.0:0.0:1.0	.	528;528	P50416;P50416-2	CPT1A_HUMAN;.	V	528	ENSP00000439084:E528V;ENSP00000365803:E528V;ENSP00000265641:E528V;ENSP00000446108:E528V	ENSP00000265641:E528V	E	-	2	0	CPT1A	68297466	1.000000	0.71417	0.994000	0.49952	0.830000	0.47004	3.676000	0.54612	1.916000	0.55485	0.247000	0.18012	GAG	.	.		0.448	CPT1A-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397457.2	NM_001876	
PDZD3	79849	hgsc.bcm.edu	37	11	119058343	119058343	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr11:119058343G>A	ENST00000531114.1	+	4	1338	c.789G>A	c.(787-789)ggG>ggA	p.G263G	PDZD3_ENST00000355547.5_Silent_p.G197G|PDZD3_ENST00000322712.4_Silent_p.G197G|PDZD3_ENST00000392817.2_Silent_p.G263G|PDZD3_ENST00000525131.1_Silent_p.G184G			Q86UT5	NHRF4_HUMAN	PDZ domain containing 3	263	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cGMP-mediated signaling (GO:0019934)|ion transport (GO:0006811)|negative regulation of cGMP biosynthetic process (GO:0030827)|negative regulation of guanylate cyclase activity (GO:0031283)|receptor guanylyl cyclase signaling pathway (GO:0007168)|response to toxic substance (GO:0009636)|water transport (GO:0006833)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytosol (GO:0005829)|subapical complex (GO:0035003)	guanylate cyclase inhibitor activity (GO:0030251)|ion channel inhibitor activity (GO:0008200)|protein C-terminus binding (GO:0008022)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)	14	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;7.52e-05)		TGCCCCCCGGGGCCCGGCTGC	0.562																																					p.G197G		Atlas-SNP	.											.	PDZD3	42	.	0			c.G591A						.						16.0	20.0	18.0					11																	119058343		2177	4251	6428	SO:0001819	synonymous_variant	79849	exon6			CCCCGGGGCCCGG	AK091966	CCDS8417.1, CCDS53719.1	11q23.3	2008-02-05	2006-01-24	2006-01-24	ENSG00000172367	ENSG00000172367			19891	protein-coding gene	gene with protein product		607146	"""PDZ domain containing 2"""	PDZK2		11950846	Standard	NM_024791		Approved	FLJ22756, IKEPP	uc001pvz.3	Q86UT5	OTTHUMG00000166224	ENST00000531114.1:c.789G>A	chr11.hg19:g.119058343G>A		102.0	0.0		88.0	4.0	NM_001168468	Q8N6R4|Q8NAW7|Q8NEX7|Q9H5Z3	Silent	SNP	ENST00000531114.1	hg19																																																																																				.	.		0.562	PDZD3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000388471.1	NM_024791	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128838980	128838980	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr11:128838980T>C	ENST00000310343.9	-	22	6085	c.6086A>G	c.(6085-6087)tAc>tGc	p.Y2029C	ARHGAP32_ENST00000527272.1_Missense_Mutation_p.Y1680C|ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.Y1680C	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	2029	Interaction with FYN.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						CAGGGAGTGGTAATCTTCCAG	0.587																																					p.Y2029C		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.A6086G						.						85.0	70.0	75.0					11																	128838980		2201	4297	6498	SO:0001583	missense	9743	exon22			GAGTGGTAATCTT	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.6086A>G	chr11.hg19:g.128838980T>C	ENSP00000310561:p.Tyr2029Cys	166.0	0.0		97.0	5.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	hg19	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	T	11.99	1.803923	0.31869	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.18502	2.21;2.21;2.21	5.68	4.56	0.56223	.	0.138816	0.49916	D	0.000129	T	0.18087	0.0434	L	0.54323	1.7	0.46416	D	0.99903	B	0.24533	0.105	B	0.22880	0.042	T	0.03493	-1.1031	10	0.87932	D	0	.	11.1206	0.48287	0.0:0.0717:0.0:0.9283	.	2029	A7KAX9	RHG32_HUMAN	C	2029;1680;1680	ENSP00000310561:Y2029C;ENSP00000376425:Y1680C;ENSP00000432862:Y1680C	ENSP00000310561:Y2029C	Y	-	2	0	ARHGAP32	128344190	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.860000	0.55995	2.176000	0.68965	0.529000	0.55759	TAC	.	.		0.587	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
KRAS	3845	hgsc.bcm.edu	37	12	25398284	25398284	+	Missense_Mutation	SNP	C	C	T	rs121913529		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr12:25398284C>T	ENST00000256078.4	-	2	98	c.35G>A	c.(34-36)gGt>gAt	p.G12D	KRAS_ENST00000311936.3_Missense_Mutation_p.G12D|KRAS_ENST00000557334.1_Missense_Mutation_p.G12D|KRAS_ENST00000556131.1_Missense_Mutation_p.G12D	NM_033360.2	NP_203524.1	P01116	RASK_HUMAN	Kirsten rat sarcoma viral oncogene homolog	12			G -> A (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.|G -> C (in lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:6320174}.|G -> D (in pancreatic carcinoma, GASC and lung carcinoma; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929, ECO:0000269|PubMed:8439212}.|G -> R (in lung cancer and bladder cancer; somatic mutation). {ECO:0000269|PubMed:6695174}.|G -> S (in lung carcinoma and GASC; somatic mutation). {ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7773929}.|G -> V (in lung carcinoma, pancreatic carcinoma, colon cancer and GASC; somatic mutation, constitutively activated). {ECO:0000269|PubMed:14534542, ECO:0000269|PubMed:16533793, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:22711838, ECO:0000269|PubMed:3034404, ECO:0000269|PubMed:6092920, ECO:0000269|PubMed:8439212}.		actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|small GTPase mediated signal transduction (GO:0007264)|social behavior (GO:0035176)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GMP binding (GO:0019002)|GTP binding (GO:0005525)|protein complex binding (GO:0032403)	p.G12D(8562)|p.G12V(5775)|p.G12A(1407)|p.G12F(46)|p.G12L(8)|p.G12I(4)|p.G12E(3)|p.G12W(3)|p.G12Y(2)|p.G12fs*3(1)|p.G12C(1)|p.G12N(1)	UBE2L3/KRAS(2)	NS(6)|adrenal_gland(1)|autonomic_ganglia(3)|biliary_tract(532)|bone(2)|breast(32)|central_nervous_system(14)|cervix(50)|endometrium(411)|eye(4)|gastrointestinal_tract_(site_indeterminate)(7)|genital_tract(1)|haematopoietic_and_lymphoid_tissue(385)|kidney(8)|large_intestine(15267)|liver(29)|lung(3407)|oesophagus(16)|ovary(612)|pancreas(3739)|penis(1)|peritoneum(6)|prostate(96)|salivary_gland(6)|skin(45)|small_intestine(68)|soft_tissue(88)|stomach(207)|testis(17)|thymus(5)|thyroid(159)|upper_aerodigestive_tract(68)|urinary_tract(57)	25349	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			GCCTACGCCACCAGCTCCAAC	0.348	G12A(KMS28BM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(KPNSI9S_AUTONOMIC_GANGLIA)|G12A(MM1S_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(NCIH1573_LUNG)|G12A(NCIH2009_LUNG)|G12A(RERFLCAD1_LUNG)|G12A(RPMI8226_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12A(SW1116_LARGE_INTESTINE)|G12D(AGS_STOMACH)|G12D(ASPC1_PANCREAS)|G12D(COLO678_LARGE_INTESTINE)|G12D(HEC1A_ENDOMETRIUM)|G12D(HEC50B_ENDOMETRIUM)|G12D(HEYA8_OVARY)|G12D(HPAC_PANCREAS)|G12D(HPAFII_PANCREAS)|G12D(KARPAS620_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|G12D(KP4_PANCREAS)|G12D(L33_PANCREAS)|G12D(LS180_LARGE_INTESTINE)|G12D(LS513_LARGE_INTESTINE)|G12D(MCAS_OVARY)|G12D(PANC0203_PANCREAS)|G12D(PANC0403_PANCREAS)|G12D(PANC0504_PANCREAS)|G12D(PANC0813_PANCREAS)|G12D(PANC1_PANCREAS)|G12D(PK1_PANCREAS)|G12D(PK59_PANCREAS)|G12D(SKLU1_LUNG)|G12D(SNUC2A_LARGE_INTESTINE)|G12D(SU8686_PANCREAS)|G12D(SUIT2_PANCREAS)|G12D(SW1990_PANCREAS)|G12V(A498_KIDNEY)|G12V(CAPAN2_PANCREAS)|G12V(CFPAC1_PANCREAS)|G12V(COLO668_LUNG)|G12V(CORL23_LUNG)|G12V(DANG_PANCREAS)|G12V(HCC56_LARGE_INTESTINE)|G12V(HUPT4_PANCREAS)|G12V(KP3_PANCREAS)|G12V(LCLC97TM1_LUNG)|G12V(NCIH2444_LUNG)|G12V(NCIH441_LUNG)|G12V(NCIH727_LUNG)|G12V(PANC0327_PANCREAS)|G12V(PATU8902_PANCREAS)|G12V(PATU8988S_PANCREAS)|G12V(QGP1_PANCREAS)|G12V(RCM1_LARGE_INTESTINE)|G12V(RERFLCAD2_LUNG)|G12V(RKN_OVARY)|G12V(SH10TC_STOMACH)|G12V(SHP77_LUNG)|G12V(SNGM_ENDOMETRIUM)|G12V(SW403_LARGE_INTESTINE)|G12V(SW480_LARGE_INTESTINE)|G12V(SW620_LARGE_INTESTINE)|G12V(SW900_LUNG)|G12V(YAPC_PANCREAS)	119	Mis		"""pancreatic, colorectal, lung, thyroid, AML, others"""				Noonan syndrome;Cardiofaciocutaneous syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)																											p.G12D	Pancreas(8;6 143 191 305 2070 2426 4376 10944 11745 26467 38091 50869)	Atlas-SNP	.		Dom	yes		12	12p12.1	3845	v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog		"""L, E, M, O"""	KRAS_ENST00000256078,NS,adenocarcinoma,0,66	KRAS	30930	.	15813	Substitution - Missense(15812)|Deletion - Frameshift(1)	large_intestine(9453)|pancreas(3002)|lung(1512)|ovary(500)|biliary_tract(369)|endometrium(319)|haematopoietic_and_lymphoid_tissue(163)|stomach(124)|prostate(59)|thyroid(55)|small_intestine(43)|upper_aerodigestive_tract(30)|urinary_tract(30)|soft_tissue(28)|skin(27)|cervix(22)|liver(16)|breast(11)|testis(9)|oesophagus(8)|central_nervous_system(7)|peritoneum(5)|kidney(4)|eye(4)|gastrointestinal_tract_(site_indeterminate)(3)|NS(3)|thymus(3)|autonomic_ganglia(2)|salivary_gland(1)|bone(1)	c.G35A						.						91.0	81.0	85.0					12																	25398284		2203	4300	6503	SO:0001583	missense	3845	exon2	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome;CFC, CFCS	ACGCCACCAGCTC	BC010502	CCDS8702.1, CCDS8703.1	12p12.1	2014-09-17	2013-07-08	2005-01-24	ENSG00000133703	ENSG00000133703			6407	protein-coding gene	gene with protein product		190070	"""v-Ki-ras2 Kirsten rat sarcoma 2 viral oncogene homolog"", ""v-Ki-ras2 Kirsten rat sarcoma viral oncogene homolog"""	KRAS2			Standard	NM_004985		Approved	KRAS1	uc001rgp.1	P01116		ENST00000256078.4:c.35G>A	chr12.hg19:g.25398284C>T	ENSP00000256078:p.Gly12Asp	163.0	0.0		142.0	21.0	NM_004985	A8K8Z5|B0LPF9|P01118|Q96D10	Missense_Mutation	SNP	ENST00000256078.4	hg19	CCDS8703.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409094	0.83340	.	.	ENSG00000133703	ENST00000311936;ENST00000557334;ENST00000256078;ENST00000556131	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	5.68	5.68	0.88126	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.85919	0.5809	M	0.91818	3.245	0.80722	D	1	B;P	0.35714	0.385;0.517	B;B	0.41619	0.257;0.361	D	0.87870	0.2670	10	0.87932	D	0	.	18.3719	0.90409	0.0:1.0:0.0:0.0	.	12;12	P01116-2;P01116	.;RASK_HUMAN	D	12	ENSP00000308495:G12D;ENSP00000452512:G12D;ENSP00000256078:G12D;ENSP00000451856:G12D	ENSP00000256078:G12D	G	-	2	0	KRAS	25289551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.743000	0.85020	2.668000	0.90789	0.563000	0.77884	GGT	.	.		0.348	KRAS-004	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412232.1	NM_033360	
DPY19L2	283417	hgsc.bcm.edu	37	12	63974527	63974527	+	Silent	SNP	G	G	A	rs140003085		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr12:63974527G>A	ENST00000324472.4	-	19	1998	c.1815C>T	c.(1813-1815)ctC>ctT	p.L605L	DPY19L2_ENST00000413230.2_Silent_p.L52L	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	605					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)	p.L605L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		ATTGATTACGGAGGTTTGCAT	0.378																																					p.L605L		Atlas-SNP	.											DPY19L2,colon,carcinoma,-2,1	DPY19L2	97	.	1	Substitution - coding silent(1)	skin(1)	c.C1815T						.						75.0	72.0	73.0					12																	63974527		2203	4300	6503	SO:0001819	synonymous_variant	283417	exon19			ATTACGGAGGTTT		CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.1815C>T	chr12.hg19:g.63974527G>A		247.0	0.0		163.0	50.0	NM_173812	A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Silent	SNP	ENST00000324472.4	hg19	CCDS31851.1																																																																																			.	.		0.378	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400689.2	NM_173812	
LRRIQ1	84125	hgsc.bcm.edu	37	12	85450161	85450161	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr12:85450161A>T	ENST00000393217.2	+	8	1651	c.1590A>T	c.(1588-1590)ttA>ttT	p.L530F		NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	530										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TGCAAGAATTAAAGTCTGATG	0.299																																					p.L530F		Atlas-SNP	.											.	LRRIQ1	512	.	0			c.A1590T						.						45.0	51.0	49.0					12																	85450161		2190	4270	6460	SO:0001583	missense	84125	exon8			AGAATTAAAGTCT	AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.1590A>T	chr12.hg19:g.85450161A>T	ENSP00000376910:p.Leu530Phe	426.0	0.0		269.0	37.0	NM_001079910	Q567P4|Q9BS17|Q9HA36	Missense_Mutation	SNP	ENST00000393217.2	hg19	CCDS41816.1	.	.	.	.	.	.	.	.	.	.	A	15.97	2.990935	0.54041	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	T	0.57107	0.42	4.74	2.33	0.28932	.	1.108610	0.06791	N	0.787046	T	0.44414	0.1292	L	0.48642	1.525	0.09310	N	1	B;B	0.25719	0.079;0.132	B;B	0.25405	0.027;0.06	T	0.38499	-0.9658	10	0.49607	T	0.09	.	3.8399	0.08909	0.6558:0.0:0.1855:0.1587	.	530;505	Q96JM4;C9JI57	LRIQ1_HUMAN;.	F	530;505;530	ENSP00000376910:L530F	ENSP00000256007:L530F	L	+	3	2	LRRIQ1	83974292	0.000000	0.05858	0.381000	0.26106	0.141000	0.21300	-0.178000	0.09782	0.260000	0.21731	0.482000	0.46254	TTA	.	.		0.299	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388249.2	NM_032165	
NCOR2	9612	hgsc.bcm.edu	37	12	124882700	124882700	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr12:124882700C>T	ENST00000405201.1	-	16	1841	c.1841G>A	c.(1840-1842)cGc>cAc	p.R614H	NCOR2_ENST00000429285.2_Missense_Mutation_p.R613H|NCOR2_ENST00000397355.1_Missense_Mutation_p.R614H|NCOR2_ENST00000356219.3_Missense_Mutation_p.R614H|NCOR2_ENST00000404121.2_Missense_Mutation_p.R184H|NCOR2_ENST00000404621.1_Missense_Mutation_p.R613H			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	614	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TTCTGTCCAGCGAGAACTCTC	0.537																																					p.R614H		Atlas-SNP	.											.	NCOR2	475	.	0			c.G1841A						.						156.0	178.0	171.0					12																	124882700		1982	4163	6145	SO:0001583	missense	9612	exon18			GTCCAGCGAGAAC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1841G>A	chr12.hg19:g.124882700C>T	ENSP00000384018:p.Arg614His	106.0	0.0		80.0	8.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	hg19	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899745	0.52227	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69	4.91	4.91	0.64330	.	0.123300	0.56097	D	0.000030	T	0.71350	0.3329	M	0.80746	2.51	0.52099	D	0.99994	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.997	T	0.76677	-0.2871	10	0.87932	D	0	-31.0072	17.7087	0.88316	0.0:1.0:0.0:0.0	.	613;614;614	C9J0Q5;C9J239;C9JFD3	.;.;.	H	614;613;614;614;614;184;613;614	ENSP00000384018:R614H;ENSP00000384202:R613H;ENSP00000348551:R614H;ENSP00000380513:R614H;ENSP00000385618:R184H;ENSP00000400281:R613H;ENSP00000402808:R614H	ENSP00000348551:R614H	R	-	2	0	NCOR2	123448653	1.000000	0.71417	0.998000	0.56505	0.896000	0.52359	6.657000	0.74402	2.282000	0.76494	0.591000	0.81541	CGC	.	.		0.537	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
FREM2	341640	hgsc.bcm.edu	37	13	39262692	39262692	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr13:39262692A>T	ENST00000280481.7	+	1	1427	c.1211A>T	c.(1210-1212)cAg>cTg	p.Q404L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	404					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GACTCTGACCAGGAGCGCCTC	0.542																																					p.Q404L		Atlas-SNP	.											.	FREM2	385	.	0			c.A1211T						.						65.0	72.0	70.0					13																	39262692		2203	4300	6503	SO:0001583	missense	341640	exon1			CTGACCAGGAGCG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1211A>T	chr13.hg19:g.39262692A>T	ENSP00000280481:p.Gln404Leu	99.0	0.0		92.0	14.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	A	0.017	-1.505143	0.00992	.	.	ENSG00000150893	ENST00000280481	T	0.19394	2.15	5.94	0.95	0.19572	.	0.637859	0.15905	N	0.238894	T	0.17195	0.0413	L	0.46157	1.445	0.09310	N	1	B	0.13594	0.008	B	0.14023	0.01	T	0.21827	-1.0234	10	0.30854	T	0.27	.	9.4617	0.38789	0.5591:0.0:0.4409:0.0	.	404	Q5SZK8	FREM2_HUMAN	L	404	ENSP00000280481:Q404L	ENSP00000280481:Q404L	Q	+	2	0	FREM2	38160692	0.000000	0.05858	0.242000	0.24170	0.455000	0.32408	0.003000	0.13083	0.166000	0.19597	0.459000	0.35465	CAG	.	.		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
COG3	83548	hgsc.bcm.edu	37	13	46067592	46067592	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr13:46067592A>T	ENST00000349995.5	+	12	1410	c.1298A>T	c.(1297-1299)gAg>gTg	p.E433V	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	433					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		CTTAAAAATGAGGTGCTTGAA	0.343																																					p.E433V	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-SNP	.											.	COG3	52	.	0			c.A1298T						.						152.0	142.0	145.0					13																	46067592		2203	4300	6503	SO:0001583	missense	83548	exon12			AAAATGAGGTGCT	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1298A>T	chr13.hg19:g.46067592A>T	ENSP00000258654:p.Glu433Val	102.0	0.0		58.0	20.0	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	hg19	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.721587	0.89298	.	.	ENSG00000136152	ENST00000349995	T	0.55052	0.54	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.77485	0.4137	M	0.89968	3.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;0.998	T	0.82214	-0.0568	10	0.62326	D	0.03	-17.5228	15.0147	0.71576	1.0:0.0:0.0:0.0	.	270;433;433	B4E2F3;Q96JB2;Q96JB2-2	.;COG3_HUMAN;.	V	433	ENSP00000258654:E433V	ENSP00000258654:E433V	E	+	2	0	COG3	44965593	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.331000	0.96430	2.138000	0.66242	0.377000	0.23210	GAG	.	.		0.343	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
TEP1	7011	hgsc.bcm.edu	37	14	20847004	20847004	+	Missense_Mutation	SNP	T	T	C	rs111632717		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr14:20847004T>C	ENST00000262715.5	-	37	5301	c.5261A>G	c.(5260-5262)cAg>cGg	p.Q1754R	TEP1_ENST00000545983.1_Missense_Mutation_p.Q92R|TEP1_ENST00000556935.1_Missense_Mutation_p.Q1646R	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1754					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AGCCTTAGTCTGCAGCACCCT	0.562																																					p.Q1754R		Atlas-SNP	.											.	TEP1	224	.	0			c.A5261G						.						76.0	74.0	75.0					14																	20847004		2203	4300	6503	SO:0001583	missense	7011	exon37			TTAGTCTGCAGCA		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.5261A>G	chr14.hg19:g.20847004T>C	ENSP00000262715:p.Gln1754Arg	119.0	0.0		93.0	20.0	NM_007110	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	hg19	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	T	10.09	1.255869	0.22965	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000545983	T;T;T	0.59638	0.25;0.25;0.25	5.76	4.63	0.57726	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.256208	0.37012	N	0.002290	T	0.24314	0.0589	N	0.01297	-0.9	0.35578	D	0.806001	B;P;B;P	0.35714	0.116;0.461;0.347;0.517	B;B;B;B	0.35931	0.057;0.136;0.085;0.214	T	0.33214	-0.9877	10	0.15066	T	0.55	-22.2884	7.7179	0.28715	0.0:0.0915:0.0:0.9085	.	92;1646;1097;1754	B4E0B6;G3V5X7;G3V2A4;Q99973	.;.;.;TEP1_HUMAN	R	1754;1754;1646;92	ENSP00000262715:Q1754R;ENSP00000452574:Q1646R;ENSP00000438849:Q92R	ENSP00000262715:Q1754R	Q	-	2	0	TEP1	19916844	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	1.772000	0.38552	2.200000	0.70718	0.460000	0.39030	CAG	.	T|0.500;C|0.500		0.562	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
KHNYN	23351	hgsc.bcm.edu	37	14	24905674	24905674	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr14:24905674A>T	ENST00000251343.5	+	7	1905	c.1766A>T	c.(1765-1767)gAa>gTa	p.E589V	KHNYN_ENST00000556842.1_Missense_Mutation_p.E589V|KHNYN_ENST00000554268.1_Missense_Mutation_p.E34V|KHNYN_ENST00000553935.1_Missense_Mutation_p.E589V			O15037	KHNYN_HUMAN	KH and NYN domain containing	589							RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						ACCCTGGATGAATTTCTGAAG	0.562											OREG0022628	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E589V		Atlas-SNP	.											.	KHNYN	46	.	0			c.A1766T						.						54.0	49.0	51.0					14																	24905674		2203	4300	6503	SO:0001583	missense	23351	exon7			TGGATGAATTTCT	AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037		ENST00000251343.5:c.1766A>T	chr14.hg19:g.24905674A>T	ENSP00000251343:p.Glu589Val	92.0	0.0	775	60.0	15.0	NM_015299	Q86TZ6|Q8IUQ2|Q96BA9	Missense_Mutation	SNP	ENST00000251343.5	hg19	CCDS32058.1	.	.	.	.	.	.	.	.	.	.	A	18.52	3.641929	0.67244	.	.	ENSG00000100441	ENST00000251343;ENST00000556842;ENST00000553935;ENST00000554268	T;T;T	0.25912	1.77;1.77;1.77	5.54	5.54	0.83059	.	0.352940	0.32231	N	0.006393	T	0.50394	0.1613	M	0.76574	2.34	0.42409	D	0.99259	P;D	0.76494	0.87;0.999	P;D	0.70487	0.475;0.969	T	0.55179	-0.8181	10	0.87932	D	0	.	13.9171	0.63905	1.0:0.0:0.0:0.0	.	630;589	D3DS77;O15037	.;KHNYN_HUMAN	V	589;589;589;34	ENSP00000251343:E589V;ENSP00000451106:E589V;ENSP00000450799:E589V	ENSP00000251343:E589V	E	+	2	0	KHNYN	23975514	0.998000	0.40836	0.999000	0.59377	0.796000	0.44982	3.775000	0.55349	2.234000	0.73211	0.460000	0.39030	GAA	.	.		0.562	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412928.1		
NID2	22795	hgsc.bcm.edu	37	14	52485915	52485915	+	Silent	SNP	G	G	A	rs142814187		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr14:52485915G>A	ENST00000216286.5	-	14	2891	c.2892C>T	c.(2890-2892)gaC>gaT	p.D964D	NID2_ENST00000541773.1_Silent_p.D863D	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	964	Thyroglobulin type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					TGCCCTGCTCGTCGCATTGGG	0.602																																					p.D964D		Atlas-SNP	.											.	NID2	201	.	0			c.C2892T						.	G		1,4405	2.1+/-5.4	0,1,2202	64.0	53.0	57.0		2892	-10.6	0.0	14	dbSNP_134	57	0,8600		0,0,4300	no	coding-synonymous	NID2	NM_007361.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		964/1376	52485915	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	22795	exon14			CTGCTCGTCGCAT	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2892C>T	chr14.hg19:g.52485915G>A		141.0	0.0		86.0	16.0	NM_007361	A8K6I7|B4DU19|O43710	Silent	SNP	ENST00000216286.5	hg19	CCDS9706.1	.	.	.	.	.	.	.	.	.	.	G	0.315	-0.965618	0.02249	2.27E-4	0.0	ENSG00000087303	ENST00000556572	.	.	.	5.32	-10.6	0.00265	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3635	0.98874	0.3054:0.0:0.6946:0.0	.	.	.	.	X	233	.	.	R	-	1	2	NID2	51555665	0.671000	0.27521	0.000000	0.03702	0.083000	0.17756	-0.198000	0.09505	-2.344000	0.00622	-2.070000	0.00385	CGA	.	G|1.000;A|0.000		0.602	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
SLC8A3	6547	hgsc.bcm.edu	37	14	70633575	70633575	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr14:70633575G>A	ENST00000381269.2	-	2	2318	c.1565C>T	c.(1564-1566)aCc>aTc	p.T522I	SLC8A3_ENST00000528359.1_Missense_Mutation_p.T522I|SLC8A3_ENST00000357887.3_Missense_Mutation_p.T522I|SLC8A3_ENST00000534137.1_Missense_Mutation_p.T522I|SLC8A3_ENST00000356921.2_Missense_Mutation_p.T522I	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	522	Calx-beta 2.				blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		ATCCAAGATGGTAACTGTGGC	0.502																																					p.T522I		Atlas-SNP	.											.	SLC8A3	234	.	0			c.C1565T						.						62.0	60.0	61.0					14																	70633575		2203	4300	6503	SO:0001583	missense	6547	exon2			AAGATGGTAACTG	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.1565C>T	chr14.hg19:g.70633575G>A	ENSP00000370669:p.Thr522Ile	107.0	0.0		70.0	9.0	NM_183002	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Missense_Mutation	SNP	ENST00000381269.2	hg19	CCDS35498.1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.945779	0.53079	.	.	ENSG00000100678	ENST00000356921;ENST00000381269;ENST00000357887;ENST00000534137;ENST00000528359	T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98	5.69	5.69	0.88448	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.70298	0.3208	M	0.85945	2.785	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.998;0.999	T	0.71731	-0.4504	10	0.48119	T	0.1	.	19.8067	0.96534	0.0:0.0:1.0:0.0	.	522;522;522;522	P57103-2;P57103;Q96QG2;Q96QG1	.;NAC3_HUMAN;.;.	I	522	ENSP00000349392:T522I;ENSP00000370669:T522I;ENSP00000350560:T522I;ENSP00000436688:T522I;ENSP00000433531:T522I	ENSP00000349392:T522I	T	-	2	0	SLC8A3	69703328	1.000000	0.71417	0.967000	0.41034	0.989000	0.77384	9.869000	0.99810	2.672000	0.90937	0.650000	0.86243	ACC	.	.		0.502	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
EML5	161436	hgsc.bcm.edu	37	14	89094074	89094074	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr14:89094074C>A	ENST00000380664.5	-	32	4422	c.4423G>T	c.(4423-4425)Gtc>Ttc	p.V1475F	EML5_ENST00000352093.5_Missense_Mutation_p.V1437F|EML5_ENST00000554922.1_Missense_Mutation_p.V1483F|EML5_ENST00000553320.1_5'Flank			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	1475						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CTGAAGCTGACTGAACATACT	0.418																																					p.V1483F		Atlas-SNP	.											.	EML5	141	.	0			c.G4447T						.						84.0	81.0	82.0					14																	89094074		1897	4124	6021	SO:0001583	missense	161436	exon33			AGCTGACTGAACA	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.4423G>T	chr14.hg19:g.89094074C>A	ENSP00000370039:p.Val1475Phe	47.0	0.0		69.0	28.0	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963838	0.92791	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.38722	1.12;1.12;1.12	5.29	5.29	0.74685	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.066219	0.64402	D	0.000013	T	0.74520	0.3727	H	0.94306	3.52	0.58432	D	0.999999	D;D	0.61080	0.989;0.975	D;P	0.67103	0.949;0.835	T	0.82045	-0.0652	10	0.87932	D	0	-12.599	19.1314	0.93408	0.0:1.0:0.0:0.0	.	1483;1475	Q05BV3-5;Q05BV3	.;EMAL5_HUMAN	F	1483;1437;1475	ENSP00000451998:V1483F;ENSP00000298315:V1437F;ENSP00000370039:V1475F	ENSP00000298315:V1437F	V	-	1	0	EML5	88163827	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.393000	0.59665	2.751000	0.94390	0.650000	0.86243	GTC	.	.		0.418	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
RFX7	64864	hgsc.bcm.edu	37	15	56386765	56386765	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr15:56386765G>C	ENST00000559447.2	-	9	3141	c.2870C>G	c.(2869-2871)gCc>gGc	p.A957G	RFX7_ENST00000423270.1_Missense_Mutation_p.A1054G|RFX7_ENST00000422057.1_Missense_Mutation_p.A957G|RFX7_ENST00000317318.6_Missense_Mutation_p.A1054G			Q2KHR2	RFX7_HUMAN	regulatory factor X, 7	957					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19						AGGGTGTGTGGCCATGGGTCT	0.458																																					p.A1054G		Atlas-SNP	.											.	RFX7	170	.	0			c.C3161G						.						137.0	126.0	129.0					15																	56386765		1974	4163	6137	SO:0001583	missense	64864	exon9			TGTGTGGCCATGG			15q21.3	2008-08-04	2008-08-04	2008-08-04		ENSG00000181827			25777	protein-coding gene	gene with protein product		612660	"""regulatory factor X domain containing 2"""	RFXDC2			Standard	NM_022841		Approved	FLJ12994	uc010bfn.3	Q2KHR2		ENST00000559447.2:c.2870C>G	chr15.hg19:g.56386765G>C	ENSP00000453281:p.Ala957Gly	102.0	0.0		62.0	21.0	NM_022841	Q6ZRR1|Q6ZTY6|Q8N3J0|Q9H7A9|Q9H956	Missense_Mutation	SNP	ENST00000559447.2	hg19		.	.	.	.	.	.	.	.	.	.	G	18.78	3.697075	0.68386	.	.	ENSG00000181827	ENST00000422057;ENST00000317318;ENST00000423270	T;T;T	0.66280	-0.18;-0.2;-0.18	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.72827	0.3509	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.73914	-0.3832	10	0.87932	D	0	-12.9301	19.583	0.95478	0.0:0.0:1.0:0.0	.	957;957	Q2KHR2;C9JU50	RFX7_HUMAN;.	G	957;1054;1054	ENSP00000387504:A957G;ENSP00000313299:A1054G;ENSP00000397644:A1054G	ENSP00000313299:A1054G	A	-	2	0	RFX7	54174057	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.873000	0.98535	0.563000	0.77884	GCC	.	.		0.458	RFX7-001	KNOWN	non_canonical_U12|basic	protein_coding	protein_coding	OTTHUMT00000418841.3	NM_022841	
MEF2A	4205	hgsc.bcm.edu	37	15	100252723	100252723	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr15:100252723A>C	ENST00000557785.1	+	11	1590	c.1241A>C	c.(1240-1242)cAg>cCg	p.Q414P	MEF2A_ENST00000557942.1_Missense_Mutation_p.Q422P|MEF2A_ENST00000558812.1_Missense_Mutation_p.Q354P|MEF2A_ENST00000453228.2_Missense_Mutation_p.Q414P|MEF2A_ENST00000338042.6_Missense_Mutation_p.Q423P|MEF2A_ENST00000354410.5_Missense_Mutation_p.Q416P|MEF2A_ENST00000449277.2_Missense_Mutation_p.Q346P	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	424					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			cagcagcagcagcagcagcag	0.607																																					p.Q416P		Atlas-SNP	.											.	MEF2A	138	.	0			c.A1247C						.																																			SO:0001583	missense	4205	exon11			AGCAGCAGCAGCA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1241A>C	chr15.hg19:g.100252723A>C	ENSP00000453441:p.Gln414Pro	30.0	0.0		32.0	7.0	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	hg19	CCDS53978.1	.	.	.	.	.	.	.	.	.	.	A	0.066	-1.211925	0.01555	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042;ENST00000449277	T;T;T	0.08282	3.11;3.11;3.11	4.82	2.38	0.29361	.	.	.	.	.	T	0.03520	0.0101	N	0.02539	-0.55	0.24848	N	0.992424	B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.001;0.0	B;B;B;B;B;B	0.06405	0.001;0.001;0.0;0.0;0.002;0.001	T	0.45542	-0.9254	9	0.14252	T	0.57	0.0679	12.4364	0.55602	0.5037:0.4963:0.0:0.0	.	424;354;335;414;416;422	Q02078;B4DFQ7;Q7Z6C9;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.;.;.	P	414;416;423;354	ENSP00000404110:Q414P;ENSP00000346389:Q416P;ENSP00000337202:Q423P	ENSP00000337202:Q423P	Q	+	2	0	MEF2A	98070246	0.868000	0.29978	0.992000	0.48379	0.952000	0.60782	0.779000	0.26746	0.171000	0.19730	0.528000	0.53228	CAG	.	.		0.607	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
MEF2A	4205	hgsc.bcm.edu	37	15	100252726	100252726	+	Missense_Mutation	SNP	A	A	C	rs200861006		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr15:100252726A>C	ENST00000557785.1	+	11	1593	c.1244A>C	c.(1243-1245)cAg>cCg	p.Q415P	MEF2A_ENST00000557942.1_Missense_Mutation_p.Q423P|MEF2A_ENST00000558812.1_Missense_Mutation_p.Q355P|MEF2A_ENST00000453228.2_Missense_Mutation_p.Q415P|MEF2A_ENST00000338042.6_Missense_Mutation_p.Q424P|MEF2A_ENST00000354410.5_Missense_Mutation_p.Q417P|MEF2A_ENST00000449277.2_Missense_Mutation_p.Q347P	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	425					apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)			endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			cagcagcagcagcagcagcag	0.617																																					p.Q417P		Atlas-SNP	.											.	MEF2A	138	.	0			c.A1250C						.						6.0	9.0	8.0					15																	100252726		1716	3457	5173	SO:0001583	missense	4205	exon11			AGCAGCAGCAGCA		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1244A>C	chr15.hg19:g.100252726A>C	ENSP00000453441:p.Gln415Pro	30.0	0.0		32.0	5.0	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	hg19	CCDS53978.1	.	.	.	.	.	.	.	.	.	.	a	5.679	0.309950	0.10733	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042;ENST00000449277	T;T;T	0.08458	3.09;3.09;3.09	4.82	0.944	0.19537	.	.	.	.	.	T	0.03651	0.0104	N	0.02011	-0.69	0.23162	N	0.998192	B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.001;0.0	B;B;B;B;B;B	0.06405	0.001;0.001;0.0;0.0;0.002;0.0	T	0.43310	-0.9399	9	0.37606	T	0.19	-0.1462	12.5533	0.56240	0.604:0.396:0.0:0.0	.	425;355;336;415;417;423	Q02078;B4DFQ7;Q7Z6C9;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.;.;.	P	415;417;424;355	ENSP00000404110:Q415P;ENSP00000346389:Q417P;ENSP00000337202:Q424P	ENSP00000337202:Q424P	Q	+	2	0	MEF2A	98070249	1.000000	0.71417	0.556000	0.28293	0.920000	0.55202	2.975000	0.49281	-0.113000	0.11958	0.528000	0.53228	CAG	.	.		0.617	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
MEFV	4210	hgsc.bcm.edu	37	16	3304621	3304621	+	Silent	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr16:3304621G>A	ENST00000219596.1	-	2	486	c.447C>T	c.(445-447)gcC>gcT	p.A149A	MEFV_ENST00000536379.1_Intron|MEFV_ENST00000541159.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	149					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						GCCCCCTCCCGGCCTCGGGCT	0.736																																					p.A149A		Atlas-SNP	.											.	MEFV	170	.	0			c.C447T						.						10.0	11.0	11.0					16																	3304621		2150	4209	6359	SO:0001819	synonymous_variant	4210	exon2			CCTCCCGGCCTCG	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.447C>T	chr16.hg19:g.3304621G>A		39.0	0.0		20.0	6.0	NM_000243	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	hg19	CCDS10498.1																																																																																			.	.		0.736	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
KCTD13	253980	hgsc.bcm.edu	37	16	29934567	29934567	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr16:29934567C>T	ENST00000568000.1	-	2	1359	c.358G>A	c.(358-360)Gaa>Aaa	p.E120K	KCTD13_ENST00000568721.1_5'UTR|KCTD13_ENST00000561540.1_Missense_Mutation_p.E120K|CTD-2574D22.4_ENST00000567795.1_RNA	NM_178863.3	NP_849194.1	Q8WZ19	BACD1_HUMAN	potassium channel tetramerization domain containing 13	120					cell migration (GO:0016477)|DNA replication (GO:0006260)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)	GTP-Rho binding (GO:0017049)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	7						TAGCGTGCTTCGCCCAGCAGC	0.617																																					p.E120K		Atlas-SNP	.											.	KCTD13	19	.	0			c.G358A						.						51.0	44.0	47.0					16																	29934567		2197	4300	6497	SO:0001583	missense	253980	exon2			GTGCTTCGCCCAG	AF289573	CCDS10661.1	16p11.2	2013-06-20	2013-06-20		ENSG00000174943	ENSG00000174943			22234	protein-coding gene	gene with protein product	"""polymerase delta-interacting protein 1"", ""TNFAIP1-like"""	608947	"""potassium channel tetramerisation domain containing 13"""			11593007	Standard	NM_178863		Approved	PDIP1, FKSG86, POLDIP1	uc002duv.4	Q8WZ19	OTTHUMG00000132120	ENST00000568000.1:c.358G>A	chr16.hg19:g.29934567C>T	ENSP00000455785:p.Glu120Lys	123.0	0.0		85.0	33.0	NM_178863	A8K0R5|Q96P93|Q96SA1	Missense_Mutation	SNP	ENST00000568000.1	hg19	CCDS10661.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.811639	0.90707	.	.	ENSG00000174943	ENST00000308768	D	0.86956	-2.19	5.02	5.02	0.67125	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.64402	D	0.000008	D	0.96327	0.8802	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97907	1.0306	10	0.87932	D	0	.	17.2768	0.87118	0.0:1.0:0.0:0.0	.	120	Q8WZ19	BACD1_HUMAN	K	120	ENSP00000311202:E120K	ENSP00000311202:E120K	E	-	1	0	KCTD13	29842068	1.000000	0.71417	0.993000	0.49108	0.867000	0.49689	7.379000	0.79691	2.596000	0.87737	0.563000	0.77884	GAA	.	.		0.617	KCTD13-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255162.2	NM_178863	
VPS35	55737	hgsc.bcm.edu	37	16	46708524	46708524	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr16:46708524A>C	ENST00000299138.7	-	9	1021	c.963T>G	c.(961-963)gaT>gaG	p.D321E	VPS35_ENST00000568642.1_5'UTR	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	321					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AAAGTTTAATATCCGCTGGGA	0.363																																					p.D321E		Atlas-SNP	.											.	VPS35	49	.	0			c.T963G						.						47.0	46.0	46.0					16																	46708524		2203	4300	6503	SO:0001583	missense	55737	exon9			TTTAATATCCGCT	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.963T>G	chr16.hg19:g.46708524A>C	ENSP00000299138:p.Asp321Glu	137.0	0.0		77.0	11.0	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Missense_Mutation	SNP	ENST00000299138.7	hg19	CCDS10721.1	.	.	.	.	.	.	.	.	.	.	.	10.64	1.407448	0.25378	.	.	ENSG00000069329	ENST00000299138;ENST00000541330	T	0.42900	0.96	5.84	1.12	0.20585	.	0.094662	0.64402	N	0.000001	T	0.20170	0.0485	N	0.20986	0.625	0.38156	D	0.938897	B;B	0.06786	0.0;0.001	B;B	0.13407	0.009;0.004	T	0.26883	-1.0090	10	0.02654	T	1	-20.4863	6.4417	0.21853	0.6121:0.124:0.2639:0.0	.	321;186	Q96QK1;F5GYF5	VPS35_HUMAN;.	E	321;186	ENSP00000299138:D321E	ENSP00000299138:D321E	D	-	3	2	VPS35	45266025	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.073000	0.30691	0.129000	0.18514	0.482000	0.46254	GAT	.	.		0.363	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
CDH1	999	hgsc.bcm.edu	37	16	68849632	68849632	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr16:68849632A>T	ENST00000261769.5	+	10	1726	c.1535A>T	c.(1534-1536)gAg>gTg	p.E512V	CDH1_ENST00000422392.2_Missense_Mutation_p.E451V|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	512	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACTGCCCAGGAGCCAGACACA	0.423			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.E512V		Atlas-SNP	.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	CDH1	535	.	1	Unknown(1)	breast(1)	c.A1535T						.						111.0	101.0	104.0					16																	68849632		2198	4300	6498	SO:0001583	missense	999	exon10	Familial Cancer Database	HDGC	CCCAGGAGCCAGA	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1535A>T	chr16.hg19:g.68849632A>T	ENSP00000261769:p.Glu512Val	170.0	0.0		104.0	27.0	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	ENST00000261769.5	hg19	CCDS10869.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.943810	0.73672	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.62364	0.03;0.03	5.32	5.32	0.75619	Cadherin (4);Cadherin-like (1);	0.759830	0.11540	N	0.553869	T	0.69495	0.3117	L	0.39898	1.24	0.47994	D	0.999564	P;P	0.49862	0.929;0.878	P;P	0.56216	0.794;0.787	T	0.68372	-0.5426	10	0.87932	D	0	.	14.944	0.71016	1.0:0.0:0.0:0.0	.	451;512	Q9UII8;P12830	.;CADH1_HUMAN	V	512;530;512;451	ENSP00000261769:E512V;ENSP00000414946:E451V	ENSP00000261769:E512V	E	+	2	0	CDH1	67407133	1.000000	0.71417	0.305000	0.25099	0.523000	0.34469	8.904000	0.92590	2.012000	0.59069	0.459000	0.35465	GAG	.	.		0.423	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
FAM187A	100528020	hgsc.bcm.edu	37	17	42979763	42979763	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr17:42979763G>A	ENST00000331733.4	+	0	402				CCDC103_ENST00000410027.1_3'UTR|EFTUD2_ENST00000592576.1_5'Flank|CCDC103_ENST00000410006.2_Missense_Mutation_p.A103T|EFTUD2_ENST00000402521.3_5'Flank|FAM187A_ENST00000412523.2_Intron|AC015936.3_ENST00000441312.1_RNA|EFTUD2_ENST00000426333.2_5'Flank|CCDC103_ENST00000417826.2_Missense_Mutation_p.A103T	NM_001258399.1|NM_213607.2	NP_001245328.1|NP_998772.1	A6NFU0	F187A_HUMAN	family with sequence similarity 187, member A							integral component of membrane (GO:0016021)											CGAGACGTCTGCTGACTTCTA	0.597																																					p.C104Y		Atlas-SNP	.											.	CCDC103	15	.	0			c.G311A						.						76.0	79.0	78.0					17																	42979763		2203	4300	6503			388389	exon4			ACGTCTGCTGACT			17q21.31	2013-01-11			ENSG00000214447	ENSG00000214447		"""Immunoglobulin superfamily / V-set domain containing"""	35153	protein-coding gene	gene with protein product							Standard			Approved		uc002ihp.1	A6NFU0	OTTHUMG00000154266		chr17.hg19:g.42979763G>A		109.0	0.0		104.0	38.0	NM_001258399		Missense_Mutation	SNP	ENST00000331733.4	hg19		.	.	.	.	.	.	.	.	.	.	G	6.138	0.393675	0.11638	.	.	ENSG00000167131	ENST00000357776;ENST00000417826;ENST00000410006	T;T;T	0.55413	0.52;0.52;0.52	6.16	5.13	0.70059	.	0.394056	0.19633	U	0.109627	T	0.63815	0.2543	L	0.56769	1.78	0.23198	N	0.998137	D	0.60160	0.987	P	0.58620	0.842	T	0.55490	-0.8133	10	0.22706	T	0.39	-7.9467	16.6975	0.85339	0.0:0.0:0.8626:0.1374	.	103	Q8IW40	CC103_HUMAN	T	103	ENSP00000350420:A103T;ENSP00000391692:A103T;ENSP00000387252:A103T	ENSP00000350420:A103T	A	+	1	0	CCDC103	40335289	0.905000	0.30787	0.960000	0.40013	0.110000	0.19582	2.041000	0.41213	2.937000	0.99478	0.650000	0.86243	GCT	.	.		0.597	FAM187A-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334584.1		
TLK2	11011	hgsc.bcm.edu	37	17	60599622	60599622	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr17:60599622G>A	ENST00000326270.9	+	4	479	c.211G>A	c.(211-213)Gaa>Aaa	p.E71K	TLK2_ENST00000343388.7_Missense_Mutation_p.E71K|TLK2_ENST00000582809.1_5'UTR|TLK2_ENST00000542523.1_Missense_Mutation_p.E71K|TLK2_ENST00000346027.5_Missense_Mutation_p.E71K	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	71					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TGAACCATATGAAACTAGCCA	0.313																																					p.E71K		Atlas-SNP	.											.	TLK2	223	.	0			c.G211A						.						48.0	45.0	46.0					17																	60599622		2203	4300	6503	SO:0001583	missense	11011	exon4			CCATATGAAACTA	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.211G>A	chr17.hg19:g.60599622G>A	ENSP00000316512:p.Glu71Lys	474.0	0.0		373.0	128.0	NM_001112707	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	ENST00000326270.9	hg19		.	.	.	.	.	.	.	.	.	.	G	16.43	3.122393	0.56613	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57	5.39	5.39	0.77823	.	0.096119	0.64402	D	0.000001	T	0.79907	0.4527	L	0.54323	1.7	0.51482	D	0.999925	B;B;B	0.31730	0.037;0.214;0.337	B;B;B	0.29077	0.028;0.098;0.098	T	0.76971	-0.2761	10	0.28530	T	0.3	-7.7637	17.7354	0.88391	0.0:0.0:1.0:0.0	.	71;71;71	Q86UE8;Q86UE8-3;Q86UE8-2	TLK2_HUMAN;.;.	K	71	ENSP00000275780:E71K;ENSP00000340800:E71K;ENSP00000316512:E71K;ENSP00000442311:E71K	ENSP00000316512:E71K	E	+	1	0	TLK2	57953354	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.454000	0.80714	2.516000	0.84829	0.563000	0.77884	GAA	.	.		0.313	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
LAMA1	284217	hgsc.bcm.edu	37	18	6985272	6985272	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr18:6985272G>C	ENST00000389658.3	-	39	5717	c.5624C>G	c.(5623-5625)gCc>gGc	p.A1875G		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1875	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GAACTCAGCGGCATGGTCCTC	0.493																																					p.A1875G		Atlas-SNP	.											.	LAMA1	458	.	0			c.C5624G						.						202.0	164.0	177.0					18																	6985272		2203	4300	6503	SO:0001583	missense	284217	exon39			TCAGCGGCATGGT	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5624C>G	chr18.hg19:g.6985272G>C	ENSP00000374309:p.Ala1875Gly	76.0	0.0		85.0	13.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	hg19	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	15.90	2.969664	0.53614	.	.	ENSG00000101680	ENST00000389658	T	0.40225	1.04	5.58	5.58	0.84498	.	0.000000	0.64402	D	0.000001	T	0.62319	0.2418	M	0.73962	2.25	0.53688	D	0.999975	D	0.59767	0.986	P	0.59115	0.852	T	0.65384	-0.6181	10	0.66056	D	0.02	.	17.741	0.88407	0.0:0.0:1.0:0.0	.	1875	P25391	LAMA1_HUMAN	G	1875	ENSP00000374309:A1875G	ENSP00000374309:A1875G	A	-	2	0	LAMA1	6975272	1.000000	0.71417	0.377000	0.26055	0.015000	0.08874	7.745000	0.85046	2.631000	0.89168	0.655000	0.94253	GCC	.	.		0.493	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
ASXL3	80816	hgsc.bcm.edu	37	18	31323438	31323438	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr18:31323438T>A	ENST00000269197.5	+	12	3626	c.3626T>A	c.(3625-3627)gTg>gAg	p.V1209E		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1209	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AACATACCTGTGTCACATTTA	0.403																																					p.V1209E		Atlas-SNP	.											ASXL3_ENST00000269197,NS,carcinoma,0,2	ASXL3	405	.	0			c.T3626A						.						71.0	66.0	67.0					18																	31323438		1853	4106	5959	SO:0001583	missense	80816	exon12			TACCTGTGTCACA	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.3626T>A	chr18.hg19:g.31323438T>A	ENSP00000269197:p.Val1209Glu	91.0	0.0		68.0	24.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	ENST00000269197.5	hg19	CCDS45847.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.414656	0.42817	.	.	ENSG00000141431	ENST00000269197	T	0.49139	0.79	5.68	3.33	0.38152	.	2.380980	0.01586	N	0.021317	T	0.44052	0.1275	L	0.27053	0.805	0.35528	D	0.801988	P	0.45902	0.868	P	0.44860	0.462	T	0.33471	-0.9867	10	0.38643	T	0.18	.	9.5432	0.39264	0.0:0.1413:0.0:0.8587	.	1209	Q9C0F0	ASXL3_HUMAN	E	1209	ENSP00000269197:V1209E	ENSP00000269197:V1209E	V	+	2	0	ASXL3	29577436	1.000000	0.71417	0.901000	0.35422	0.976000	0.68499	3.241000	0.51376	0.991000	0.38814	0.533000	0.62120	GTG	.	.		0.403	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
CAMSAP3	57662	hgsc.bcm.edu	37	19	7676885	7676885	+	Silent	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:7676885C>T	ENST00000160298.4	+	11	1607	c.1506C>T	c.(1504-1506)ccC>ccT	p.P502P	CAMSAP3_ENST00000446248.2_Silent_p.P529P	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	502	Pro-rich.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						CCTACCTGCCCGAGGGGACCT	0.682																																					p.P529P		Atlas-SNP	.											.	CAMSAP3	131	.	0			c.C1587T						.						40.0	47.0	45.0					19																	7676885		1995	4155	6150	SO:0001819	synonymous_variant	57662	exon13			CCTGCCCGAGGGG	AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1506C>T	chr19.hg19:g.7676885C>T		100.0	0.0		58.0	7.0	NM_001080429	Q8NDF1	Silent	SNP	ENST00000160298.4	hg19	CCDS42489.1																																																																																			.	.		0.682	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000459300.1	XM_048362	
WIZ	58525	hgsc.bcm.edu	37	19	15547669	15547669	+	Silent	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:15547669C>T	ENST00000389282.4	-	4	2757	c.2544G>A	c.(2542-2544)acG>acA	p.T848T	WIZ_ENST00000263381.7_Silent_p.T159T			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	848					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						GAAAGGGCACCGTGAGAGGTA	0.706																																					p.T159T		Atlas-SNP	.											.	WIZ	152	.	0			c.G477A						.						20.0	24.0	23.0					19																	15547669		1880	4104	5984	SO:0001819	synonymous_variant	58525	exon3			GGGCACCGTGAGA	AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.2544G>A	chr19.hg19:g.15547669C>T		190.0	0.0		165.0	21.0	NM_021241	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Silent	SNP	ENST00000389282.4	hg19																																																																																				.	.		0.706	WIZ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021241	
ZNF728	388523	hgsc.bcm.edu	37	19	23159057	23159057	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:23159057A>G	ENST00000594710.1	-	4	1227	c.1082T>C	c.(1081-1083)aTt>aCt	p.I361T		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	361					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TCCAGTATGAATTACCTTATG	0.418																																					p.I361T		Atlas-SNP	.											.	.	.	.	0			c.T1082C						.																																			SO:0001583	missense	388523	exon4			GTATGAATTACCT	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.1082T>C	chr19.hg19:g.23159057A>G	ENSP00000471593:p.Ile361Thr	24.0	0.0		33.0	12.0	NM_001267716		Missense_Mutation	SNP	ENST00000594710.1	hg19	CCDS59370.1																																																																																			.	.		0.418	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465176.1	NM_001267716	
ZNF536	9745	hgsc.bcm.edu	37	19	30936235	30936236	+	Missense_Mutation	DNP	GC	GC	AA			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:30936235_30936236GC>AA	ENST00000355537.3	+	2	1913_1914	c.1766_1767GC>AA	c.(1765-1767)gGC>gAA	p.G589E		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	589					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ACTAAAGTGGGCAGCCAGAGAG	0.515																																					p.G589D|p.G589G		Atlas-SNP	.											.	ZNF536	424	.	0			c.G1766A|c.C1767A						.																																			SO:0001583	missense	9745	exon2			AAGTGGGCAGCCA|AGTGGGCAGCCAG		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		Exception_encountered	chr19.hg19:g.30936235_30936236delinsAA	ENSP00000347730:p.Gly589Glu	129.0	0.0		98.0	35.0	NM_014717	A2RU18	Missense_Mutation|Silent	SNP	ENST00000355537.3	hg19	CCDS32984.1																																																																																			.	.		0.515	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
RYR1	6261	hgsc.bcm.edu	37	19	39034257	39034257	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:39034257C>T	ENST00000359596.3	+	86	11864	c.11864C>T	c.(11863-11865)tCg>tTg	p.S3955L	RYR1_ENST00000360985.3_Missense_Mutation_p.S3950L|RYR1_ENST00000355481.4_Missense_Mutation_p.S3950L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3955					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AAAGCCATGTCGGTGGCTAAG	0.597																																					p.S3955L		Atlas-SNP	.											.	RYR1	708	.	0			c.C11864T						.						93.0	89.0	90.0					19																	39034257		2203	4300	6503	SO:0001583	missense	6261	exon86			CCATGTCGGTGGC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11864C>T	chr19.hg19:g.39034257C>T	ENSP00000352608:p.Ser3955Leu	84.0	0.0		71.0	7.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	15.15	2.748407	0.49257	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.95377	-3.69;-3.69;-3.69	4.3	4.3	0.51218	RyR/IP3R Homology associated domain (1);	0.195140	0.32287	U	0.006309	D	0.92195	0.7525	L	0.48642	1.525	0.41841	D	0.990127	P;P;P	0.38280	0.625;0.473;0.529	B;B;B	0.32465	0.128;0.09;0.146	D	0.91994	0.5605	10	0.33141	T	0.24	.	16.5433	0.84407	0.0:1.0:0.0:0.0	.	3950;3950;3955	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	L	3955;3950;3950	ENSP00000352608:S3955L;ENSP00000347667:S3950L;ENSP00000354254:S3950L	ENSP00000347667:S3950L	S	+	2	0	RYR1	43726097	0.996000	0.38824	0.987000	0.45799	0.975000	0.68041	3.528000	0.53524	2.240000	0.73641	0.486000	0.48141	TCG	.	.		0.597	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
PRX	57716	hgsc.bcm.edu	37	19	40901569	40901569	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:40901569C>T	ENST00000324001.7	-	7	2960	c.2690G>A	c.(2689-2691)cGa>cAa	p.R897Q	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	897					axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGAGGGCACTCGGAAGCCCAC	0.612																																					p.R897Q		Atlas-SNP	.											.	PRX	151	.	0			c.G2690A						.						47.0	56.0	53.0					19																	40901569		2203	4300	6503	SO:0001583	missense	57716	exon7			GGCACTCGGAAGC	AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.2690G>A	chr19.hg19:g.40901569C>T	ENSP00000326018:p.Arg897Gln	95.0	0.0		96.0	17.0	NM_181882	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	ENST00000324001.7	hg19	CCDS33028.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.931525	0.34096	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.01099	5.34	5.3	4.21	0.49690	.	0.354983	0.20353	N	0.094003	T	0.00724	0.0024	N	0.17082	0.46	0.37414	D	0.913344	B	0.33494	0.414	B	0.21360	0.034	T	0.64554	-0.6380	10	0.29301	T	0.29	-8.6739	4.1775	0.10358	0.0:0.6832:0.0:0.3168	.	897	Q9BXM0	PRAX_HUMAN	Q	897	ENSP00000326018:R897Q	ENSP00000326018:R897Q	R	-	2	0	PRX	45593409	0.000000	0.05858	0.928000	0.36995	0.979000	0.70002	0.904000	0.28491	2.496000	0.84212	0.650000	0.86243	CGA	.	.		0.612	PRX-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000462582.1	NM_020956	
ZNF610	162963	hgsc.bcm.edu	37	19	52869167	52869167	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:52869167A>G	ENST00000403906.3	+	6	992	c.536A>G	c.(535-537)tAt>tGt	p.Y179C	ZNF610_ENST00000327920.8_Missense_Mutation_p.Y179C|ZNF610_ENST00000601151.1_Missense_Mutation_p.Y136C|ZNF610_ENST00000321287.8_Missense_Mutation_p.Y179C	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		TTTAATAAATATAGAAATGAT	0.303																																					p.Y179C		Atlas-SNP	.											.	ZNF610	84	.	0			c.A536G						.						43.0	50.0	47.0					19																	52869167		2197	4297	6494	SO:0001583	missense	162963	exon6			ATAAATATAGAAA	AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.536A>G	chr19.hg19:g.52869167A>G	ENSP00000383922:p.Tyr179Cys	165.0	0.0		139.0	48.0	NM_001161426	A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	ENST00000403906.3	hg19	CCDS12851.1	.	.	.	.	.	.	.	.	.	.	A	0.440	-0.898946	0.02472	.	.	ENSG00000167554	ENST00000403906;ENST00000321287;ENST00000327920	T;T	0.05580	3.42;3.42	1.11	0.00455	0.14059	.	.	.	.	.	T	0.03651	0.0104	L	0.37850	1.14	0.09310	N	1	B;B	0.19583	0.037;0.022	B;B	0.12837	0.008;0.003	T	0.46871	-0.9160	9	0.02654	T	1	.	3.1202	0.06388	0.718:0.0:0.282:0.0	.	136;179	Q8N9Z0-2;Q8N9Z0	.;ZN610_HUMAN	C	179;136;179	ENSP00000383922:Y179C;ENSP00000327597:Y179C	ENSP00000324441:Y136C	Y	+	2	0	ZNF610	57560979	0.002000	0.14202	0.002000	0.10522	0.023000	0.10783	-0.085000	0.11250	-0.062000	0.13088	0.260000	0.18958	TAT	.	.		0.303	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462880.1	NM_173530	
EPS8L1	54869	hgsc.bcm.edu	37	19	55593208	55593208	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:55593208C>T	ENST00000201647.6	+	9	898	c.842C>T	c.(841-843)gCg>gTg	p.A281V	EPS8L1_ENST00000592824.1_3'UTR|EPS8L1_ENST00000540810.1_Missense_Mutation_p.A217V|EPS8L1_ENST00000588359.1_Intron|EPS8L1_ENST00000245618.5_Missense_Mutation_p.A154V|EPS8L1_ENST00000586329.1_Missense_Mutation_p.A263V	NM_133180.2	NP_573441.2	Q8TE68	ES8L1_HUMAN	EPS8-like 1	281					positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|T cell receptor binding (GO:0042608)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|prostate(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		TCGGCGGAGGCGGCCAGGGTG	0.687																																					p.A281V	Ovarian(149;255 1863 3636 27051 29647)	Atlas-SNP	.											.	EPS8L1	122	.	0			c.C842T						.						25.0	28.0	27.0					19																	55593208		2203	4298	6501	SO:0001583	missense	54869	exon9			CGGAGGCGGCCAG	AK057052	CCDS12914.1, CCDS12915.1	19q13.42	2008-02-05				ENSG00000131037			21295	protein-coding gene	gene with protein product		614987				12620401	Standard	NM_133180		Approved	FLJ20258, DRC3, MGC23164, MGC4642	uc002qis.4	Q8TE68		ENST00000201647.6:c.842C>T	chr19.hg19:g.55593208C>T	ENSP00000201647:p.Ala281Val	185.0	0.0		168.0	34.0	NM_133180	Q71RE2|Q8NC10|Q96BB7|Q9BSQ2|Q9GZQ2|Q9NXH0	Missense_Mutation	SNP	ENST00000201647.6	hg19	CCDS12914.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654459	0.88056	.	.	ENSG00000131037	ENST00000310075;ENST00000201647;ENST00000540810;ENST00000245618	T;T;T	0.55930	0.49;0.49;0.49	3.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.72285	0.3441	M	0.80847	2.515	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.992;0.996;1.0;0.985	T	0.77397	-0.2603	10	0.72032	D	0.01	-18.9484	13.6195	0.62128	0.0:1.0:0.0:0.0	.	217;263;154;281	B4DKV7;Q8TE68-3;Q8TE68-2;Q8TE68	.;.;.;ES8L1_HUMAN	V	263;281;217;154	ENSP00000201647:A281V;ENSP00000437541:A217V;ENSP00000245618:A154V	ENSP00000201647:A281V	A	+	2	0	EPS8L1	60285020	1.000000	0.71417	0.660000	0.29694	0.406000	0.30931	6.401000	0.73256	1.868000	0.54150	0.313000	0.20887	GCG	.	.		0.687	EPS8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451713.1	NM_017729	
ZNF544	27300	hgsc.bcm.edu	37	19	58772416	58772416	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:58772416G>C	ENST00000596652.1	+	6	678	c.444G>C	c.(442-444)gaG>gaC	p.E148D	ZNF544_ENST00000415203.2_Missense_Mutation_p.E120D|ZNF544_ENST00000596929.1_Intron|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000599953.1_Missense_Mutation_p.E6D|ZNF544_ENST00000595981.1_Intron|ZNF544_ENST00000600044.1_Missense_Mutation_p.E120D|ZNF544_ENST00000600220.1_Missense_Mutation_p.E120D|ZNF544_ENST00000599227.1_3'UTR|ZNF544_ENST00000269829.4_Missense_Mutation_p.E148D|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000596825.1_3'UTR			Q6NX49	ZN544_HUMAN	zinc finger protein 544	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		TCACCTCAGAGAGACTGTTTG	0.448																																					p.E148D		Atlas-SNP	.											.	ZNF544	57	.	0			c.G444C						.						100.0	89.0	93.0					19																	58772416		2203	4300	6503	SO:0001583	missense	27300	exon7			CTCAGAGAGACTG	AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.444G>C	chr19.hg19:g.58772416G>C	ENSP00000469635:p.Glu148Asp	142.0	0.0		128.0	19.0	NM_014480	A8K6J1|Q9UEX4	Missense_Mutation	SNP	ENST00000596652.1	hg19	CCDS12973.1	.	.	.	.	.	.	.	.	.	.	G	9.437	1.087036	0.20390	.	.	ENSG00000198131	ENST00000269829;ENST00000415203	T;T	0.08634	3.13;3.07	3.12	-0.442	0.12253	.	.	.	.	.	T	0.04724	0.0128	N	0.20986	0.625	0.20489	N	0.999897	B;B;B	0.33857	0.024;0.016;0.429	B;B;B	0.33799	0.008;0.003;0.17	T	0.40701	-0.9549	9	0.30078	T	0.28	.	2.8128	0.05446	0.2573:0.0:0.5232:0.2195	.	120;120;148	B7ZAY1;B4DL50;Q6NX49	.;.;ZN544_HUMAN	D	148;120	ENSP00000269829:E148D;ENSP00000394341:E120D	ENSP00000269829:E148D	E	+	3	2	ZNF544	63464228	0.000000	0.05858	0.002000	0.10522	0.019000	0.09904	0.029000	0.13666	-0.096000	0.12329	0.655000	0.94253	GAG	.	.		0.448	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466754.1	NM_014480	
TRPC4AP	26133	hgsc.bcm.edu	37	20	33657145	33657145	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr20:33657145G>C	ENST00000252015.2	-	3	457	c.368C>G	c.(367-369)aCc>aGc	p.T123S	TRPC4AP_ENST00000451813.2_Missense_Mutation_p.T123S|TRPC4AP_ENST00000432634.2_Intron			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	123	Interaction with TNFRSF1A. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGGATAAGTGGTTTCTTGGGT	0.338																																					p.T123S		Atlas-SNP	.											.	TRPC4AP	64	.	0			c.C368G						.						133.0	136.0	135.0					20																	33657145		2203	4300	6503	SO:0001583	missense	26133	exon3			TAAGTGGTTTCTT	AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.368C>G	chr20.hg19:g.33657145G>C	ENSP00000252015:p.Thr123Ser	411.0	0.0		316.0	111.0	NM_199368	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Missense_Mutation	SNP	ENST00000252015.2	hg19	CCDS13246.1	.	.	.	.	.	.	.	.	.	.	G	9.138	1.013121	0.19277	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000541994	T;T	0.26810	1.71;1.71	5.5	5.5	0.81552	.	0.257250	0.46442	D	0.000284	T	0.08714	0.0216	N	0.01576	-0.805	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28459	-1.0043	10	0.07990	T	0.79	.	11.6972	0.51551	0.0809:0.0:0.9191:0.0	.	123;123	E1P5Q0;Q8TEL6	.;TP4AP_HUMAN	S	123;123;108	ENSP00000252015:T123S;ENSP00000400614:T123S	ENSP00000252015:T123S	T	-	2	0	TRPC4AP	33120806	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.893000	0.75649	2.868000	0.98415	0.555000	0.69702	ACC	.	.		0.338	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078832.2	NM_015638	
EMILIN3	90187	hgsc.bcm.edu	37	20	39993687	39993687	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr20:39993687G>T	ENST00000332312.3	-	2	470	c.278C>A	c.(277-279)cCc>cAc	p.P93H		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	93	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				GACTGTCCCGGGGCACTTGGG	0.582																																					p.P93H		Atlas-SNP	.											.	EMILIN3	63	.	0			c.C278A						.						195.0	151.0	166.0					20																	39993687		2203	4300	6503	SO:0001583	missense	90187	exon2			GTCCCGGGGCACT	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.278C>A	chr20.hg19:g.39993687G>T	ENSP00000332806:p.Pro93His	82.0	0.0		51.0	19.0	NM_052846	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	ENST00000332312.3	hg19	CCDS13316.1	.	.	.	.	.	.	.	.	.	.	G	19.93	3.917384	0.73098	.	.	ENSG00000183798	ENST00000332312	T	0.48522	0.81	4.55	3.6	0.41247	EMI domain (2);	0.060359	0.64402	D	0.000002	T	0.67458	0.2895	M	0.84846	2.72	0.45390	D	0.998377	D	0.89917	1.0	D	0.79784	0.993	T	0.69285	-0.5185	9	.	.	.	-17.6768	8.6507	0.34033	0.0812:0.1513:0.7675:0.0	.	93	Q9NT22	EMIL3_HUMAN	H	93	ENSP00000332806:P93H	.	P	-	2	0	EMILIN3	39427101	1.000000	0.71417	0.794000	0.32065	0.950000	0.60333	6.587000	0.74071	1.122000	0.41944	0.655000	0.94253	CCC	.	.		0.582	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741	
JPH2	57158	hgsc.bcm.edu	37	20	42788721	42788721	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr20:42788721G>A	ENST00000372980.3	-	2	1578	c.706C>T	c.(706-708)Cgc>Tgc	p.R236C		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	236					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			ACGGACGTGCGCGACTCTGCG	0.751																																					p.R236C		Atlas-SNP	.											.	JPH2	86	.	0			c.C706T						.						4.0	5.0	4.0					20																	42788721		1976	3837	5813	SO:0001583	missense	57158	exon2			ACGTGCGCGACTC	AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.706C>T	chr20.hg19:g.42788721G>A	ENSP00000362071:p.Arg236Cys	188.0	0.0		114.0	8.0	NM_020433	E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	ENST00000372980.3	hg19	CCDS13325.1	.	.	.	.	.	.	.	.	.	.	g	17.29	3.352142	0.61183	.	.	ENSG00000149596	ENST00000372980	T	0.62498	0.02	3.03	2.05	0.26809	.	0.216427	0.41097	U	0.000941	T	0.65873	0.2733	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	P	0.54706	0.759	T	0.66069	-0.6015	10	0.66056	D	0.02	.	9.3739	0.38270	0.0:0.0:0.3823:0.6177	.	236	Q9BR39	JPH2_HUMAN	C	236	ENSP00000362071:R236C	ENSP00000362071:R236C	R	-	1	0	JPH2	42222135	1.000000	0.71417	0.769000	0.31535	0.783000	0.44284	2.479000	0.45197	0.465000	0.27167	0.298000	0.19748	CGC	.	.		0.751	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080307.1		
SS18L1	26039	hgsc.bcm.edu	37	20	60739279	60739279	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr20:60739279T>G	ENST00000331758.3	+	7	826	c.800T>G	c.(799-801)aTg>aGg	p.M267R	SS18L1_ENST00000421564.1_Missense_Mutation_p.M267R|SS18L1_ENST00000370848.4_Missense_Mutation_p.M270R	NM_198935.1	NP_945173.1	O75177	CREST_HUMAN	synovial sarcoma translocation gene on chromosome 18-like 1	267	Gln-rich.|MFD domain. {ECO:0000250}.				chromatin modification (GO:0016568)|dendrite development (GO:0016358)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of dendrite development (GO:0050773)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|kinetochore (GO:0000776)|nuclear body (GO:0016604)|nucleus (GO:0005634)			SS18L1/SSX1(2)	ovary(2)|skin(1)	3	Breast(26;3.97e-09)		BRCA - Breast invasive adenocarcinoma(19;1.92e-08)			GCGGAGCCCATGGGCCAGCAG	0.682			T	SSX1	synovial sarcoma																																p.M267R		Atlas-SNP	.		Dom	yes		20	20q13.3	26039	synovial sarcoma translocation gene on chromosome 18-like 1		M	.	SS18L1	37	.	0			c.T800G						.						22.0	18.0	19.0					20																	60739279		1887	3651	5538	SO:0001583	missense	26039	exon7			AGCCCATGGGCCA	AB014593	CCDS13491.1	20q13.3	2008-07-28			ENSG00000184402	ENSG00000184402			15592	protein-coding gene	gene with protein product		606472					Standard	XM_005260389		Approved	KIAA0693	uc002ycb.3	O75177	OTTHUMG00000032902	ENST00000331758.3:c.800T>G	chr20.hg19:g.60739279T>G	ENSP00000333012:p.Met267Arg	158.0	0.0		151.0	11.0	NM_198935	A6NNE3|A8K620|B3KWR8|E1P5H7|Q5JXJ3|Q6MZV9|Q6NTH3|Q6XYD9|Q8NE69|Q9BR55|Q9H4K6	Missense_Mutation	SNP	ENST00000331758.3	hg19	CCDS13491.1	.	.	.	.	.	.	.	.	.	.	T	13.10	2.134852	0.37728	.	.	ENSG00000184402	ENST00000421564;ENST00000331758;ENST00000370848	T;T;T	0.31247	1.51;1.51;1.5	5.18	5.18	0.71444	.	0.251770	0.45126	D	0.000389	T	0.30572	0.0769	L	0.48362	1.52	0.35617	D	0.809121	P;P	0.50528	0.936;0.855	B;B	0.41571	0.149;0.36	T	0.49532	-0.8930	10	0.87932	D	0	-8.2397	15.0176	0.71597	0.0:0.0:0.0:1.0	.	267;267	B4DSR7;O75177	.;CREST_HUMAN	R	267;267;270	ENSP00000393999:M267R;ENSP00000333012:M267R;ENSP00000359885:M270R	ENSP00000333012:M267R	M	+	2	0	SS18L1	60172674	1.000000	0.71417	1.000000	0.80357	0.294000	0.27393	5.338000	0.65947	1.960000	0.56953	0.260000	0.18958	ATG	.	.		0.682	SS18L1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080004.2		
COL20A1	57642	hgsc.bcm.edu	37	20	61951458	61951458	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr20:61951458C>T	ENST00000358894.6	+	24	3084	c.2984C>T	c.(2983-2985)cCc>cTc	p.P995L	COL20A1_ENST00000422202.1_Missense_Mutation_p.P1002L|COL20A1_ENST00000326996.6_Missense_Mutation_p.P995L|COL20A1_ENST00000435874.1_Missense_Mutation_p.P1002L	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	995	Laminin G-like.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)		p.P995L(1)		NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					GCTGAGCGGCCCCTTGGGGAG	0.706																																					p.P995L		Atlas-SNP	.											COL20A1,NS,malignant_melanoma,0,1	COL20A1	137	.	1	Substitution - Missense(1)	NS(1)	c.C2984T						.						8.0	9.0	9.0					20																	61951458		1897	4013	5910	SO:0001583	missense	57642	exon24			AGCGGCCCCTTGG	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2984C>T	chr20.hg19:g.61951458C>T	ENSP00000351767:p.Pro995Leu	110.0	0.0		108.0	39.0	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	hg19	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	C	7.009	0.556369	0.13436	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202;ENST00000415763;ENST00000455906	T;T;T;T;T;D	0.90385	4.41;4.41;4.41;4.41;4.41;-2.66	4.07	1.94	0.25998	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.214865	0.39909	N	0.001222	D	0.83640	0.5298	L	0.45137	1.4	0.38549	D	0.949401	B;B	0.26577	0.153;0.095	B;B	0.24155	0.051;0.023	T	0.82568	-0.0392	10	0.66056	D	0.02	.	5.8401	0.18629	0.1949:0.6949:0.0:0.1102	.	1002;995	Q9P218-2;Q9P218	.;COKA1_HUMAN	L	995;995;1002;1002;98;3	ENSP00000351767:P995L;ENSP00000323077:P995L;ENSP00000408690:P1002L;ENSP00000414753:P1002L;ENSP00000410799:P98L;ENSP00000406345:P3L	ENSP00000323077:P995L	P	+	2	0	COL20A1	61421903	0.002000	0.14202	0.932000	0.37286	0.042000	0.13812	0.165000	0.16564	2.002000	0.58637	0.462000	0.41574	CCC	.	.		0.706	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
RCAN1	1827	hgsc.bcm.edu	37	21	35893850	35893850	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr21:35893850G>A	ENST00000313806.4	-	3	663	c.533C>T	c.(532-534)gCg>gTg	p.A178V	RCAN1_ENST00000381135.3_Missense_Mutation_p.A168V|RCAN1_ENST00000492600.1_Missense_Mutation_p.A123V|RCAN1_ENST00000381132.2_Missense_Mutation_p.A123V|RCAN1_ENST00000489903.1_5'UTR|RCAN1_ENST00000482533.1_Missense_Mutation_p.A43V|RCAN1_ENST00000443408.2_Missense_Mutation_p.A43V|RCAN1_ENST00000399272.1_Missense_Mutation_p.A97V|RCAN1_ENST00000481448.1_Missense_Mutation_p.A168V|RCAN1_ENST00000487990.1_Missense_Mutation_p.A43V	NM_004414.5	NP_004405.3	P53805	RCAN1_HUMAN	regulator of calcineurin 1	178					blood circulation (GO:0008015)|calcineurin-NFAT signaling cascade (GO:0033173)|central nervous system development (GO:0007417)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of smooth muscle cell differentiation (GO:0051151)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|response to ischemia (GO:0002931)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|short-term memory (GO:0007614)|signal transduction (GO:0007165)|skeletal muscle fiber development (GO:0048741)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(1)|lung(2)	5						GACTGGGGTCGCATCTTCCAC	0.582																																					p.A178V		Atlas-SNP	.											.	RCAN1	37	.	0			c.C533T						.						93.0	85.0	88.0					21																	35893850		2203	4300	6503	SO:0001583	missense	1827	exon3			GGGGTCGCATCTT		CCDS13637.1, CCDS33551.1, CCDS42921.1, CCDS74788.1, CCDS74790.1	21q22.1-q22.2	2010-08-11	2007-06-26	2007-06-26	ENSG00000159200	ENSG00000159200			3040	protein-coding gene	gene with protein product		602917	"""Down syndrome critical region gene 1"""	DSCR1		8595418	Standard	XM_005260929		Approved		uc002yue.3	P53805	OTTHUMG00000086235	ENST00000313806.4:c.533C>T	chr21.hg19:g.35893850G>A	ENSP00000320768:p.Ala178Val	119.0	0.0		113.0	16.0	NM_004414	D3DSF9|O00582|O00583|Q53XT0|Q6IBC6|Q7Z555|Q96R03|Q9BU69|Q9UF15|Q9UME4	Missense_Mutation	SNP	ENST00000313806.4	hg19	CCDS13637.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513992	0.85389	.	.	ENSG00000159200	ENST00000487990;ENST00000313806;ENST00000381132;ENST00000399272;ENST00000481448;ENST00000482533;ENST00000381135;ENST00000443408	.	.	.	5.61	5.61	0.85477	.	0.048431	0.85682	D	0.000000	T	0.78767	0.4335	M	0.75615	2.305	0.80722	D	1	D;D;P;P	0.89917	1.0;0.998;0.802;0.835	D;D;B;B	0.66602	0.931;0.945;0.152;0.234	T	0.77920	-0.2407	9	0.44086	T	0.13	-8.5056	19.2323	0.93845	0.0:0.0:1.0:0.0	.	123;178;97;123	B7Z1F0;P53805;P53805-3;Q6FGP2	.;RCAN1_HUMAN;.;.	V	43;178;123;97;168;43;168;43	.	ENSP00000320768:A178V	A	-	2	0	RCAN1	34815720	1.000000	0.71417	0.246000	0.24233	0.985000	0.73830	9.435000	0.97529	2.636000	0.89361	0.655000	0.94253	GCG	.	.		0.582	RCAN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000194142.1		
NCF4	4689	hgsc.bcm.edu	37	22	37273743	37273743	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr22:37273743G>T	ENST00000248899.6	+	10	1082	c.898G>T	c.(898-900)Gat>Tat	p.D300Y	NCF4_ENST00000397147.4_3'UTR	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	300	OPR.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	GCTGCTGTCGGATGAGGACGT	0.592																																					p.D300Y		Atlas-SNP	.											.	NCF4	66	.	0			c.G898T						.						59.0	53.0	55.0					22																	37273743		2203	4300	6503	SO:0001583	missense	4689	exon10			CTGTCGGATGAGG	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.898G>T	chr22.hg19:g.37273743G>T	ENSP00000248899:p.Asp300Tyr	86.0	0.0		62.0	20.0	NM_000631	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	ENST00000248899.6	hg19	CCDS13934.1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073046	0.55646	.	.	ENSG00000100365	ENST00000248899	T	0.61859	0.07	5.44	5.44	0.79542	Phox/Bem1p (2);	.	.	.	.	T	0.77377	0.4121	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80091	-0.1527	9	0.87932	D	0	.	17.44	0.87562	0.0:0.0:1.0:0.0	.	300	Q15080	NCF4_HUMAN	Y	300	ENSP00000248899:D300Y	ENSP00000248899:D300Y	D	+	1	0	NCF4	35603689	1.000000	0.71417	0.202000	0.23494	0.165000	0.22458	5.574000	0.67424	2.556000	0.86216	0.650000	0.86243	GAT	.	.		0.592	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631	
ARSH	347527	hgsc.bcm.edu	37	X	2951122	2951122	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chrX:2951122G>T	ENST00000381130.2	+	9	1385	c.1385G>T	c.(1384-1386)tGc>tTc	p.C462F		NM_001011719.1	NP_001011719.1	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	462					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			breast(3)|endometrium(8)|kidney(2)|large_intestine(6)|lung(13)|skin(1)|stomach(1)	34		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				ACAGGTGCCTGCTATGGGAGT	0.453																																					p.C462F		Atlas-SNP	.											.	ARSH	72	.	0			c.G1385T						.						104.0	88.0	93.0					X																	2951122		2203	4300	6503	SO:0001583	missense	347527	exon9			GTGCCTGCTATGG	AY875940	CCDS35198.1	Xp22.33	2013-02-14	2006-03-07		ENSG00000205667	ENSG00000205667		"""Arylsulfatase family"""	32488	protein-coding gene	gene with protein product		300586	"""arylsulfatase H"""			16174644	Standard	NM_001011719		Approved		uc011mhj.2	Q5FYA8	OTTHUMG00000159612	ENST00000381130.2:c.1385G>T	chrX.hg19:g.2951122G>T	ENSP00000370522:p.Cys462Phe	123.0	0.0		92.0	11.0	NM_001011719		Missense_Mutation	SNP	ENST00000381130.2	hg19	CCDS35198.1	.	.	.	.	.	.	.	.	.	.	g	11.80	1.747305	0.30955	.	.	ENSG00000205667	ENST00000381130	D	0.91011	-2.77	3.06	3.06	0.35304	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	U	0.000000	D	0.95664	0.8590	M	0.90705	3.14	0.52099	D	0.99994	D	0.89917	1.0	D	0.91635	0.999	D	0.96076	0.9050	10	0.59425	D	0.04	.	13.8623	0.63569	0.0:0.0:1.0:0.0	.	462	Q5FYA8	ARSH_HUMAN	F	462	ENSP00000370522:C462F	ENSP00000370522:C462F	C	+	2	0	ARSH	2961122	1.000000	0.71417	0.166000	0.22797	0.007000	0.05969	6.259000	0.72494	1.307000	0.44944	0.513000	0.50165	TGC	.	.		0.453	ARSH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356489.1	NM_001011719	
MID1	4281	hgsc.bcm.edu	37	X	10535300	10535300	+	Silent	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chrX:10535300A>T	ENST00000317552.4	-	2	688	c.288T>A	c.(286-288)tcT>tcA	p.S96S	MID1_ENST00000380782.2_Silent_p.S96S|MID1_ENST00000380785.1_Silent_p.S96S|MID1_ENST00000380787.1_Silent_p.S96S|MID1_ENST00000380779.1_Silent_p.S96S|MID1_ENST00000380780.1_Silent_p.S96S|MID1_ENST00000453318.2_Silent_p.S96S	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	96					microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						TCTCGCTGGGAGAGTTGGGCC	0.612																																					p.S96S		Atlas-SNP	.											.	MID1	72	.	0			c.T288A						.						118.0	95.0	103.0					X																	10535300		2203	4300	6503	SO:0001819	synonymous_variant	4281	exon2			GCTGGGAGAGTTG	Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.288T>A	chrX.hg19:g.10535300A>T		157.0	0.0		74.0	14.0	NM_001193277	B2RCG2|O75361|Q9BZX5	Silent	SNP	ENST00000317552.4	hg19	CCDS14138.1																																																																																			.	.		0.612	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055738.1		
MAP3K15	389840	hgsc.bcm.edu	37	X	19413261	19413261	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chrX:19413261T>A	ENST00000338883.4	-	16	2131	c.2132A>T	c.(2131-2133)cAg>cTg	p.Q711L	MAP3K15_ENST00000469203.2_Missense_Mutation_p.Q543L|MAP3K15_ENST00000359173.3_Missense_Mutation_p.Q146L|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	711	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GCCCAGGTACTGAACGATATT	0.488																																					p.Q711L		Atlas-SNP	.											.	MAP3K15	108	.	0			c.A2132T						.						173.0	143.0	153.0					X																	19413261		2203	4300	6503	SO:0001583	missense	389840	exon16			AGGTACTGAACGA	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.2132A>T	chrX.hg19:g.19413261T>A	ENSP00000345629:p.Gln711Leu	144.0	0.0		70.0	16.0	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	ENST00000338883.4	hg19		.	.	.	.	.	.	.	.	.	.	T	22.9	4.350332	0.82132	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	T;T;T	0.25749	1.78;1.78;1.78	5.69	3.32	0.38043	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.051587	0.85682	D	0.000000	T	0.31071	0.0785	L	0.49350	1.555	0.53005	D	0.99996	D;P	0.59767	0.986;0.931	P;P	0.51582	0.674;0.523	T	0.04579	-1.0941	10	0.87932	D	0	.	8.8504	0.35196	0.0:0.1531:0.0:0.8469	.	186;711	Q6ZN16-3;Q6ZN16	.;M3K15_HUMAN	L	711;146;543	ENSP00000345629:Q711L;ENSP00000352093:Q146L;ENSP00000428356:Q543L	ENSP00000345629:Q711L	Q	-	2	0	MAP3K15	19323182	1.000000	0.71417	0.944000	0.38274	0.993000	0.82548	4.777000	0.62361	0.787000	0.33731	0.483000	0.47432	CAG	.	.		0.488	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
PAK3	5063	hgsc.bcm.edu	37	X	110459745	110459745	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chrX:110459745A>T	ENST00000372010.1	+	18	1991	c.1549A>T	c.(1549-1551)Atg>Ttg	p.M517L	PAK3_ENST00000519681.1_Missense_Mutation_p.M523L|PAK3_ENST00000425146.1_Missense_Mutation_p.M502L|PAK3_ENST00000372007.5_Missense_Mutation_p.M502L|PAK3_ENST00000360648.4_Missense_Mutation_p.M538L|PAK3_ENST00000518291.1_Missense_Mutation_p.M538L|PAK3_ENST00000262836.4_Missense_Mutation_p.M517L|PAK3_ENST00000417227.1_Missense_Mutation_p.M523L|PAK3_ENST00000446737.1_Missense_Mutation_p.M502L			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	517	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						CTGTCTTGAGATGGATGTGGA	0.428										TSP Lung(19;0.15)																											p.M538L		Atlas-SNP	.											.	PAK3	179	.	0			c.A1612T						.						138.0	129.0	132.0					X																	110459745		2203	4300	6503	SO:0001583	missense	5063	exon15			CTTGAGATGGATG	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1549A>T	chrX.hg19:g.110459745A>T	ENSP00000361080:p.Met517Leu	119.0	0.0		90.0	8.0	NM_001128168	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	hg19	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	A	17.99	3.522344	0.64747	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69;2.69	5.54	5.54	0.83059	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.10208	0.0250	N	0.11131	0.1	0.58432	D	0.999999	B;B;B;B;B	0.14012	0.002;0.0;0.009;0.0;0.009	B;B;B;B;B	0.26094	0.024;0.001;0.066;0.004;0.066	T	0.14254	-1.0479	10	0.59425	D	0.04	.	14.8035	0.69935	1.0:0.0:0.0:0.0	.	523;538;517;502;517	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	L	502;502;517;523;502;538;538;523;517	ENSP00000410853:M502L;ENSP00000401982:M502L;ENSP00000361080:M517L;ENSP00000429113:M523L;ENSP00000361077:M502L;ENSP00000428921:M538L;ENSP00000353864:M538L;ENSP00000389172:M523L;ENSP00000262836:M517L	ENSP00000262836:M517L	M	+	1	0	PAK3	110346401	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.874000	0.92363	1.877000	0.54381	0.427000	0.28365	ATG	.	.		0.428	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
SAGE1	55511	hgsc.bcm.edu	37	X	134988200	134988200	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chrX:134988200A>T	ENST00000370709.3	+	5	472	c.472A>T	c.(472-474)Aat>Tat	p.N158Y	SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000535938.1_Missense_Mutation_p.N158Y|SAGE1_ENST00000324447.3_Missense_Mutation_p.N158Y			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	158						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					CGTCACTCACAATATCCGTGA	0.458																																					p.N158Y		Atlas-SNP	.											.	SAGE1	160	.	0			c.A472T						.						94.0	82.0	86.0					X																	134988200		2203	4300	6503	SO:0001583	missense	55511	exon6			ACTCACAATATCC	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.472A>T	chrX.hg19:g.134988200A>T	ENSP00000359743:p.Asn158Tyr	127.0	0.0		62.0	11.0	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	hg19	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	A	10.55	1.382634	0.25031	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.36520	1.25;1.25;1.25	1.38	0.437	0.16555	.	0.133595	0.51477	U	0.000093	T	0.37945	0.1022	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.12528	-1.0544	10	0.51188	T	0.08	.	3.3183	0.07041	0.3107:0.0:0.6893:0.0	.	158	Q9NXZ1	SAGE1_HUMAN	Y	158	ENSP00000323191:N158Y;ENSP00000445959:N158Y;ENSP00000359743:N158Y	ENSP00000323191:N158Y	N	+	1	0	SAGE1	134815866	0.001000	0.12720	0.017000	0.16124	0.044000	0.14063	0.024000	0.13555	0.068000	0.16574	0.158000	0.16466	AAT	.	.		0.458	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
MT-CO1	4512	hgsc.bcm.edu	37	M	6993	6993	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chrM:6993G>A	ENST00000361624.2	+	1	1090	c.1090G>A	c.(1090-1092)Gac>Aac	p.D364N	MT-TQ_ENST00000387372.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO2_ENST00000361739.1_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	364					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACTCATCACTAGACATCGTAC	0.443																																					p.D364N		Atlas-SNP	.											.	.	.	.	0			c.G1090A						.																																			SO:0001583	missense	5742	exon1			TCACTAGACATCG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1090G>A	chrM.hg19:g.6993G>A	ENSP00000354499:p.Asp364Asn	33.0	0.0		21.0	7.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.443	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
FEZF2	55079	hgsc.bcm.edu	37	3	62358208	62358209	+	In_Frame_Ins	INS	-	-	CCA			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr3:62358208_62358209insCCA	ENST00000283268.3	-	2	629_630	c.335_336insTGG	c.(334-336)ggc>ggTGGc	p.112_112G>GG	FEZF2_ENST00000475839.1_In_Frame_Ins_p.112_112G>GG|FEZF2_ENST00000486811.1_In_Frame_Ins_p.112_112G>GG	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	112	Gly-rich.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		cgccgccgccgccgccaccgcc	0.733																																					p.G112delinsGG	NSCLC(170;1772 2053 12525 15604 23984)	Atlas-INDEL	.											.	FEZF2	46	.	0			c.336_337insTGG						.																																			SO:0001652	inframe_insertion	55079	exon2			.	AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.335_336insTGG	chr3.hg19:g.62358208_62358209insCCA	ENSP00000283268:p.Gly117dup	58.0	0.0		40.0	12.0	NM_018008	A8K349|Q9BZ91|Q9NWB9	In_Frame_Ins	INS	ENST00000283268.3	hg19	CCDS2897.1																																																																																			.	.		0.733	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
ALB	213	hgsc.bcm.edu	37	4	74279249	74279251	+	In_Frame_Del	DEL	ATG	ATG	-			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	ATG	ATG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr4:74279249_74279251delATG	ENST00000503124.1	+	6	713_715	c.506_508delATG	c.(505-510)aatgat>aat	p.D170del	ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_In_Frame_Del_p.D205del|ALB_ENST00000415165.2_In_Frame_Del_p.D128del|ALB_ENST00000509063.1_In_Frame_Del_p.D320del|ALB_ENST00000295897.4_In_Frame_Del_p.D320del			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			GAAGTGGAAAATGATGAGATGCC	0.409																																					p.319_319del		Atlas-INDEL	.											.	ALB	132	.	0			c.955_957del						.																																			SO:0001651	inframe_deletion	213	exon8			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.506_508delATG	chr4.hg19:g.74279252_74279254delATG	ENSP00000421027:p.Asp170del	180.0	0.0		128.0	37.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	In_Frame_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.409	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
TDRD5	163589	hgsc.bcm.edu	37	1	179599927	179599928	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr1:179599927_179599928insA	ENST00000367614.1	+	7	1357_1358	c.998_999insA	c.(997-1002)ccaaaafs	p.PK333fs	TDRD5_ENST00000444136.1_Frame_Shift_Ins_p.PK333fs|TDRD5_ENST00000294848.8_Frame_Shift_Ins_p.PK333fs	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	333	HTH OST-type 3. {ECO:0000255|PROSITE- ProRule:PRU00975}.				DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						CAACTATCACCAAAAAAATTAG	0.337																																					p.P333fs		Atlas-INDEL	.											.	TDRD5	149	.	0			c.998_999insA						.																																			SO:0001589	frameshift_variant	163589	exon7			.	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.1005dupA	chr1.hg19:g.179599934_179599934dupA	ENSP00000356586:p.Pro333fs	224.0	0.0		308.0	30.0	NM_001199091	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Frame_Shift_Ins	INS	ENST00000367614.1	hg19	CCDS1332.1																																																																																			.	.		0.337	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
PRIMA1	145270	hgsc.bcm.edu	37	14	94245574	94245575	+	Frame_Shift_Ins	INS	-	-	GGGG	rs550883370		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr14:94245574_94245575insGGGG	ENST00000393140.1	-	3	278_279	c.176_177insCCCC	c.(175-177)ccgfs	p.P59fs	PRIMA1_ENST00000393143.1_Frame_Shift_Ins_p.P59fs|PRIMA1_ENST00000316227.3_Frame_Shift_Ins_p.P59fs	NM_178013.3	NP_821092.1	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1	59	PRAD.				establishment of localization in cell (GO:0051649)|neurotransmitter catabolic process (GO:0042135)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|synapse (GO:0045202)				endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		gcgggggcagcgggggaggggg	0.629																																					p.P59fs		Atlas-INDEL	.											.	PRIMA1	21	.	0			c.177_178insCCCC						.																																			SO:0001589	frameshift_variant	145270	exon3			.		CCDS9912.1	14q32.13	2008-08-29			ENSG00000175785	ENSG00000175785			18319	protein-coding gene	gene with protein product	"""membrane anchor of acetylcholinesterase"""	613851				11804574	Standard	NM_178013		Approved	PRIMA	uc001ybw.1	Q86XR5	OTTHUMG00000141313	ENST00000393140.1:c.173_176dupCCCC	chr14.hg19:g.94245575_94245578dupGGGG	ENSP00000376848:p.Pro59fs	105.0	0.0		73.0	24.0	NM_178013	Q86XR6	Frame_Shift_Ins	INS	ENST00000393140.1	hg19	CCDS9912.1																																																																																			.	.		0.629	PRIMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280658.1	NM_178013	
ZNF791	163049	hgsc.bcm.edu	37	19	12739581	12739581	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr19:12739581delA	ENST00000343325.4	+	4	1400	c.1238delA	c.(1237-1239)gagfs	p.E413fs	ZNF791_ENST00000446165.1_3'UTR|ZNF490_ENST00000465656.1_Intron|ZNF791_ENST00000540038.1_Frame_Shift_Del_p.E304fs|AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000458122.3_Frame_Shift_Del_p.E381fs	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						AAACCCTATGAGTGTAAGGAA	0.398																																					p.E413fs		Atlas-INDEL	.											.	ZNF791	53	.	0			c.1237delG						.						102.0	108.0	106.0					19																	12739581		2203	4300	6503	SO:0001589	frameshift_variant	163049	exon4			.	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1238delA	chr19.hg19:g.12739581delA	ENSP00000342974:p.Glu413fs	147.0	0.0		103.0	12.0	NM_153358	B7Z586|Q8NC99	Frame_Shift_Del	DEL	ENST00000343325.4	hg19	CCDS12273.1																																																																																			.	.		0.398	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
MLXIPL	51085	hgsc.bcm.edu	37	7	73020079	73020096	+	In_Frame_Del	DEL	GTCAGCATTGCCGACGTA	GTCAGCATTGCCGACGTA	-	rs548938711|rs150292665|rs140121265|rs368793037		TCGA-DD-AADA-01A-11D-A40R-10	TCGA-DD-AADA-10A-01D-A40U-10	GTCAGCATTGCCGACGTA	GTCAGCATTGCCGACGTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	01012d58-9532-4536-8712-4829e4645133	d5357b31-faf2-4e43-b215-8370741d689f	g.chr7:73020079_73020096delGTCAGCATTGCCGACGTA	ENST00000313375.3	-	7	870_887	c.823_840delTACGTCGGCAATGCTGAC	c.(823-840)tacgtcggcaatgctgacdel	p.YVGNAD275del	MLXIPL_ENST00000434326.1_In_Frame_Del_p.YVGNAD182del|MLXIPL_ENST00000414749.2_In_Frame_Del_p.YVGNAD275del|MLXIPL_ENST00000354613.1_In_Frame_Del_p.YVGNAD275del|MLXIPL_ENST00000429400.2_In_Frame_Del_p.YVGNAD275del|MLXIPL_ENST00000395189.1_In_Frame_Del_p.YVGNAD182del	NM_032951.2|NM_032953.2	NP_116569.1|NP_116571.1	Q9NP71	MLXPL_HUMAN	MLX interacting protein-like	275					anatomical structure morphogenesis (GO:0009653)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|glucose homeostasis (GO:0042593)|glucose mediated signaling pathway (GO:0010255)|intracellular signal transduction (GO:0035556)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of glycolytic process (GO:0045821)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of energy homeostasis (GO:2000505)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride homeostasis (GO:0070328)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	carbohydrate response element binding (GO:0035538)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.D280H(1)		cervix(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13		Lung NSC(55;0.0659)|all_lung(88;0.152)				GCTGGATCATGTCAGCATTGCCGACGTAGGCTGGAGGC	0.661																																					p.275_281del		Atlas-INDEL	.											.	MLXIPL	54	.	1	Substitution - Missense(1)	cervix(1)	c.824_841del						.																																			SO:0001651	inframe_deletion	51085	exon7			.	AK055029	CCDS5553.1, CCDS5554.1, CCDS47605.1, CCDS47606.1	7q11.23	2013-05-21	2005-10-31	2005-10-31	ENSG00000009950	ENSG00000009950			12744	protein-coding gene	gene with protein product	"""carbohydrate response element binding protein"""	605678	"""Williams Beuren syndrome chromosome region 14"""	WBSCR14		9860302	Standard	XM_005250399		Approved	WS-bHLH, MIO, CHREBP, MONDOB, bHLHd14	uc003tyn.1	Q9NP71	OTTHUMG00000129995	ENST00000313375.3:c.823_840delTACGTCGGCAATGCTGAC	chr7.hg19:g.73020079_73020096delGTCAGCATTGCCGACGTA	ENSP00000320886:p.Tyr275_Asp280del	120.0	0.0		79.0	18.0	NM_032953	C5HU02|C5HU03|C5HU04|Q96E48|Q9BY03|Q9BY04|Q9BY05|Q9BY06|Q9Y2P3	In_Frame_Del	DEL	ENST00000313375.3	hg19	CCDS5553.1																																																																																			.	.		0.661	MLXIPL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252262.1	NM_032951	
