#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EDN2	1907	hgsc.bcm.edu	37	1	41948170	41948170	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:41948170G>T	ENST00000372587.4	-	3	380	c.311C>A	c.(310-312)cCc>cAc	p.P104H	EDN2_ENST00000490783.1_5'UTR	NM_001956.3	NP_001947.1	P20800	EDN2_HUMAN	endothelin 2	104	Endothelin-like.				artery smooth muscle contraction (GO:0014824)|calcium-mediated signaling (GO:0019722)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|energy homeostasis (GO:0097009)|hormonal regulation of the force of heart contraction (GO:0003058)|inositol phosphate-mediated signaling (GO:0048016)|lung alveolus development (GO:0048286)|macrophage activation (GO:0042116)|macrophage chemotaxis (GO:0048246)|neutrophil chemotaxis (GO:0030593)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of heart rate (GO:0010460)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of the force of heart contraction by chemical signal (GO:0003099)|prostaglandin biosynthetic process (GO:0001516)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|temperature homeostasis (GO:0001659)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			endometrium(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	8	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGCACAGGCGGGGTCCCTGGC	0.697																																					p.P104H		Atlas-SNP	.											.	EDN2	12	.	0			c.C311A						.						27.0	34.0	31.0					1																	41948170		2203	4298	6501	SO:0001583	missense	1907	exon3			CAGGCGGGGTCCC	M65199	CCDS462.1	1p34	2013-02-26			ENSG00000127129	ENSG00000127129		"""Endogenous ligands"""	3177	protein-coding gene	gene with protein product		131241					Standard	NM_001956		Approved	ET2	uc009vwh.3	P20800	OTTHUMG00000006362	ENST00000372587.4:c.311C>A	chr1.hg19:g.41948170G>T	ENSP00000361668:p.Pro104His	74.0	0.0		88.0	22.0	NM_001956	Q5T1R3	Missense_Mutation	SNP	ENST00000372587.4	hg19	CCDS462.1	.	.	.	.	.	.	.	.	.	.	G	4.494	0.091574	0.08632	.	.	ENSG00000127129	ENST00000372587	D	0.83591	-1.74	5.29	3.25	0.37280	Endothelin-like toxin, conserved site (1);Endothelin-like toxin (1);	0.863580	0.10508	N	0.666512	T	0.76905	0.4053	L	0.48642	1.525	0.09310	N	1	B	0.17852	0.024	B	0.12837	0.008	T	0.66472	-0.5915	10	0.51188	T	0.08	-9.2284	7.9387	0.29946	0.0:0.3082:0.5118:0.18	.	104	P20800	EDN2_HUMAN	H	104	ENSP00000361668:P104H	ENSP00000361668:P104H	P	-	2	0	EDN2	41720757	0.996000	0.38824	0.520000	0.27837	0.049000	0.14656	1.301000	0.33447	1.423000	0.47198	0.655000	0.94253	CCC	.	.		0.697	EDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000016983.1	NM_001956	
FUBP1	8880	hgsc.bcm.edu	37	1	78444594	78444594	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:78444594T>C	ENST00000370768.2	-	1	176	c.95A>G	c.(94-96)aAa>aGa	p.K32R	FUBP1_ENST00000436586.2_Missense_Mutation_p.K32R|FUBP1_ENST00000370767.1_Missense_Mutation_p.K32R	NM_003902.3	NP_003893.2	Q96AE4	FUBP1_HUMAN	far upstream element (FUSE) binding protein 1	32					positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)			central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(3)	17						CAGTGCATCTTTGAAAGCGTC	0.607			"""F, N"""		oligodendroglioma																																p.K32R		Atlas-SNP	.		Rec	yes		1	1p13.1	8880	far upstream element (FUSE) binding protein 1		O	.	FUBP1	112	.	0			c.A95G						.						83.0	92.0	89.0					1																	78444594		2203	4300	6503	SO:0001583	missense	8880	exon1			GCATCTTTGAAAG	U05040	CCDS683.1	1p31.1	2008-02-05			ENSG00000162613	ENSG00000162613			4004	protein-coding gene	gene with protein product		603444		FUBP		8125259	Standard	XM_005271309		Approved	FBP	uc001dii.3	Q96AE4	OTTHUMG00000040799	ENST00000370768.2:c.95A>G	chr1.hg19:g.78444594T>C	ENSP00000359804:p.Lys32Arg	53.0	0.0		63.0	34.0	NM_003902	Q12828	Missense_Mutation	SNP	ENST00000370768.2	hg19	CCDS683.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.256329	0.80246	.	.	ENSG00000162613	ENST00000370773;ENST00000370767;ENST00000370768;ENST00000394922;ENST00000436586;ENST00000421641	T;T;T;T	0.47177	1.51;1.51;1.49;0.85	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.32615	0.0835	L	0.36672	1.1	0.58432	D	0.999998	P;P	0.50156	0.932;0.92	B;P	0.45232	0.326;0.474	T	0.29701	-1.0003	10	0.72032	D	0.01	-15.4291	15.0493	0.71854	0.0:0.0:0.0:1.0	.	32;32	B4DT31;Q96AE4	.;FUBP1_HUMAN	R	32	ENSP00000359803:K32R;ENSP00000359804:K32R;ENSP00000389536:K32R;ENSP00000402630:K32R	ENSP00000294623:K32R	K	-	2	0	FUBP1	78217182	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.625000	0.67770	2.100000	0.63781	0.459000	0.35465	AAA	.	.		0.607	FUBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098030.3	NM_003902	
SLC16A4	9122	hgsc.bcm.edu	37	1	110921555	110921555	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:110921555A>C	ENST00000369779.4	-	6	1199	c.950T>G	c.(949-951)aTc>aGc	p.I317S	SLC16A4_ENST00000472422.2_Missense_Mutation_p.I269S|SLC16A4_ENST00000497687.1_5'Flank|SLC16A4_ENST00000541986.1_Missense_Mutation_p.I255S|SLC16A4_ENST00000369781.4_Intron|SLC16A4_ENST00000437429.2_Missense_Mutation_p.I207S	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	317					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	AAAGGTAGGGATGAAGTATGC	0.428																																					p.I317S		Atlas-SNP	.											.	SLC16A4	47	.	0			c.T950G						.						112.0	107.0	109.0					1																	110921555		2203	4300	6503	SO:0001583	missense	9122	exon6			GTAGGGATGAAGT	U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.950T>G	chr1.hg19:g.110921555A>C	ENSP00000358794:p.Ile317Ser	161.0	0.0		190.0	108.0	NM_004696	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Missense_Mutation	SNP	ENST00000369779.4	hg19	CCDS823.1	.	.	.	.	.	.	.	.	.	.	a	22.2	4.260273	0.80246	.	.	ENSG00000168679	ENST00000369779;ENST00000472422;ENST00000437429;ENST00000541986;ENST00000467986	T;T;T;T;T	0.80480	0.35;0.35;0.35;0.35;-1.38	5.99	4.86	0.63082	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.310233	0.36303	N	0.002677	T	0.81307	0.4795	M	0.81497	2.545	0.40776	D	0.983132	P;P;B;P	0.50369	0.927;0.934;0.386;0.87	P;P;B;P	0.55785	0.601;0.784;0.273;0.688	T	0.80647	-0.1289	10	0.31617	T	0.26	.	10.7058	0.45954	0.9277:0.0:0.0723:0.0	.	207;255;269;317	E7EPY8;B4DJ67;G3V175;O15374	.;.;.;MOT5_HUMAN	S	317;269;207;255;84	ENSP00000358794:I317S;ENSP00000432495:I269S;ENSP00000394790:I207S;ENSP00000446087:I255S;ENSP00000435768:I84S	ENSP00000358794:I317S	I	-	2	0	SLC16A4	110723078	1.000000	0.71417	0.968000	0.41197	0.918000	0.54935	6.976000	0.76135	1.084000	0.41184	0.529000	0.55759	ATC	.	.		0.428	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000031115.3	NM_004696	
WDR77	79084	hgsc.bcm.edu	37	1	111986674	111986674	+	Splice_Site	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:111986674A>C	ENST00000235090.5	-	5	771		c.e5+1		RP11-552M11.4_ENST00000416099.1_RNA|WDR77_ENST00000411751.2_Splice_Site|Y_RNA_ENST00000363020.1_RNA|WDR77_ENST00000497278.1_Splice_Site	NM_024102.2	NP_077007.1	Q9BQA1	MEP50_HUMAN	WD repeat domain 77						gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA metabolic process (GO:0016070)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|methylosome (GO:0034709)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_cancers(81;0.000902)|all_epithelial(167;0.00056)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTATCTCTTACCTCGCTGCA	0.478																																					.		Atlas-SNP	.											.	WDR77	21	.	0			c.564+2T>G						.						139.0	137.0	138.0					1																	111986674		2203	4300	6503	SO:0001630	splice_region_variant	79084	exon6			TCTCTTACCTCGC	BC016946	CCDS835.1	1p13.2	2013-01-09		2005-08-09	ENSG00000116455	ENSG00000116455		"""WD repeat domain containing"""	29652	protein-coding gene	gene with protein product		611734				11756452, 8619474	Standard	NM_024102		Approved	MEP50	uc001ebb.3	Q9BQA1	OTTHUMG00000011748	ENST00000235090.5:c.564+1T>G	chr1.hg19:g.111986674A>C		279.0	0.0		297.0	153.0	NM_024102	B3KMW6|B4DP38|Q3LID2|Q53FU2|Q6JZZ5|Q96GK4|Q9BWY3	Splice_Site	SNP	ENST00000235090.5	hg19	CCDS835.1	.	.	.	.	.	.	.	.	.	.	A	10.90	1.480911	0.26598	.	.	ENSG00000116455	ENST00000235090;ENST00000411751;ENST00000449340	.	.	.	6.06	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8868	0.52606	0.9317:0.0:0.0683:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR77	111788197	1.000000	0.71417	0.963000	0.40424	0.091000	0.18340	7.043000	0.76572	1.110000	0.41699	-0.256000	0.11100	.	.	.		0.478	WDR77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032465.1	NM_024102	Intron
NOTCH2	4853	hgsc.bcm.edu	37	1	120480003	120480003	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:120480003T>C	ENST00000256646.2	-	21	3643	c.3424A>G	c.(3424-3426)Act>Gct	p.T1142A		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1142	EGF-like 29. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAGCTCCCAGTATAGCCCAGG	0.552			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.T1142A		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.A3424G						.						102.0	86.0	92.0					1																	120480003		2203	4300	6503	SO:0001583	missense	4853	exon21	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	TCCCAGTATAGCC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.3424A>G	chr1.hg19:g.120480003T>C	ENSP00000256646:p.Thr1142Ala	115.0	0.0		132.0	61.0	NM_001200001	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	hg19	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	16.85	3.236234	0.58886	.	.	ENSG00000134250	ENST00000256646	D	0.88277	-2.36	5.06	3.88	0.44766	EGF (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.202191	0.24350	U	0.039295	D	0.88385	0.6422	M	0.88105	2.93	0.46011	D	0.998818	B;B	0.32245	0.361;0.076	B;B	0.41332	0.354;0.076	D	0.87407	0.2373	10	0.54805	T	0.06	.	10.4841	0.44711	0.1456:0.0:0.0:0.8544	.	1142;1142	Q6IQ50;Q04721	.;NOTC2_HUMAN	A	1142	ENSP00000256646:T1142A	ENSP00000256646:T1142A	T	-	1	0	NOTCH2	120281526	1.000000	0.71417	0.994000	0.49952	0.597000	0.36814	4.651000	0.61447	0.812000	0.34326	0.482000	0.46254	ACT	.	.		0.552	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
CLK2	1196	hgsc.bcm.edu	37	1	155233082	155233082	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:155233082T>A	ENST00000368361.4	-	13	1742	c.1427A>T	c.(1426-1428)cAt>cTt	p.H476L	SCAMP3_ENST00000472397.1_5'Flank|CLK2_ENST00000536801.1_Missense_Mutation_p.H476L|SCAMP3_ENST00000302631.3_5'Flank|CLK2_ENST00000355560.4_Missense_Mutation_p.H474L|CLK2_ENST00000497188.1_5'UTR|CLK2_ENST00000361168.5_Missense_Mutation_p.H475L|SCAMP3_ENST00000355379.3_5'Flank			P49760	CLK2_HUMAN	CDC-like kinase 2	476	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAAGAAAGGATGCTGAAGGGC	0.582								Other conserved DNA damage response genes																													p.H475L		Atlas-SNP	.											.	CLK2	55	.	0			c.A1424T						.						73.0	67.0	69.0					1																	155233082		2203	4300	6503	SO:0001583	missense	1196	exon13			AAAGGATGCTGAA	L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.1427A>T	chr1.hg19:g.155233082T>A	ENSP00000357345:p.His476Leu	58.0	0.0		101.0	63.0	NM_003993	B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	ENST00000368361.4	hg19		.	.	.	.	.	.	.	.	.	.	.	26.4	4.734389	0.89482	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000424156;ENST00000536801	T;T;T;T	0.29397	1.57;1.57;1.57;1.57	5.11	5.11	0.69529	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045516	0.85682	D	0.000000	T	0.56062	0.1960	M	0.93328	3.405	0.80722	D	1	D;D	0.62365	0.991;0.98	D;P	0.64321	0.924;0.775	T	0.68842	-0.5302	10	0.72032	D	0.01	.	14.1493	0.65373	0.0:0.0:0.0:1.0	.	476;475	P49760;P49760-3	CLK2_HUMAN;.	L	475;476;474;248;476	ENSP00000354856:H475L;ENSP00000357345:H476L;ENSP00000347759:H474L;ENSP00000441023:H476L	ENSP00000347759:H474L	H	-	2	0	CLK2	153499706	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	7.825000	0.86693	2.271000	0.75665	0.459000	0.35465	CAT	.	.		0.582	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000087391.1	NM_003993	
SMG7	9887	hgsc.bcm.edu	37	1	183515342	183515342	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:183515342G>A	ENST00000347615.2	+	17	2731	c.2612G>A	c.(2611-2613)tGg>tAg	p.W871*	SMG7_ENST00000508461.1_Nonsense_Mutation_p.W829*|SMG7_ENST00000367537.3_Nonsense_Mutation_p.W854*|SMG7_ENST00000507469.1_Nonsense_Mutation_p.W825*|SMG7_ENST00000515829.2_Nonsense_Mutation_p.W825*|SMG7_ENST00000456731.2_Nonsense_Mutation_p.W783*	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	871					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)	p.W871L(1)		breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						GAATTCTACTGGGATTCTTCC	0.478																																					p.W871X		Atlas-SNP	.											.	SMG7	165	.	1	Substitution - Missense(1)	lung(1)	c.G2612A						.						77.0	78.0	78.0					1																	183515342		2203	4300	6503	SO:0001587	stop_gained	9887	exon17			TCTACTGGGATTC	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.2612G>A	chr1.hg19:g.183515342G>A	ENSP00000340766:p.Trp871*	203.0	0.0		259.0	124.0	NM_173156	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Nonsense_Mutation	SNP	ENST00000347615.2	hg19	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	G	39	7.489930	0.98316	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000347615;ENST00000507469;ENST00000515829	.	.	.	5.62	5.62	0.85841	.	0.360996	0.31071	N	0.008304	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0255	19.6614	0.95875	0.0:0.0:1.0:0.0	.	.	.	.	X	783;854;829;871;825;825	.	ENSP00000340766:W871X	W	+	2	0	SMG7	181781965	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.741000	0.91583	2.633000	0.89246	0.655000	0.94253	TGG	.	.		0.478	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	
C1orf101	257044	hgsc.bcm.edu	37	1	244735632	244735632	+	Splice_Site	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:244735632A>G	ENST00000366534.4	+	11	1562	c.1508A>G	c.(1507-1509)gAt>gGt	p.D503G	C1orf101_ENST00000366533.4_Splice_Site_p.D503G|C1orf101_ENST00000366531.3_Splice_Site_p.D352G|C1orf101_ENST00000473875.1_3'UTR	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	503						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TTTTTTCCAGATTATTATGGA	0.269																																					p.D503G		Atlas-SNP	.											.	C1orf101	158	.	0			c.A1508G						.						25.0	23.0	23.0					1																	244735632		2179	4252	6431	SO:0001630	splice_region_variant	257044	exon11			TTCCAGATTATTA	BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.1508-1A>G	chr1.hg19:g.244735632A>G		341.0	0.0		375.0	169.0	NM_173807	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	ENST00000366534.4	hg19	CCDS44340.1	.	.	.	.	.	.	.	.	.	.	A	18.68	3.675714	0.67928	.	.	ENSG00000179397	ENST00000391841;ENST00000366534;ENST00000366533;ENST00000428042;ENST00000366531	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.19	5.19	0.71726	.	0.000000	0.56097	D	0.000023	T	0.46112	0.1376	L	0.61218	1.895	0.34120	D	0.663963	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.996;0.999;0.999	T	0.59484	-0.7446	9	.	.	.	.	11.71	0.51620	1.0:0.0:0.0:0.0	.	423;503;503;352	B1AQM6;Q5SY80;Q5SY80-2;B4DZR4	.;CA101_HUMAN;.;.	G	503;503;503;423;352	ENSP00000355492:D503G;ENSP00000355491:D503G;ENSP00000395796:D423G;ENSP00000355489:D352G	.	D	+	2	0	C1orf101	242802255	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	4.993000	0.63895	2.090000	0.63153	0.528000	0.53228	GAT	.	.		0.269	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096701.1	NM_173807	Missense_Mutation
MAPRE3	22924	hgsc.bcm.edu	37	2	27245167	27245167	+	Silent	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr2:27245167C>T	ENST00000233121.2	+	2	279	c.81C>T	c.(79-81)tcC>tcT	p.S27S	MAPRE3_ENST00000405074.3_Silent_p.S27S|MAPRE3_ENST00000491354.1_3'UTR|MAPRE3_ENST00000402218.1_Silent_p.S27S			Q9UPY8	MARE3_HUMAN	microtubule-associated protein, RP/EB family, member 3	27	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				mitotic nuclear division (GO:0007067)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of microtubule plus-end binding (GO:1903033)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|midbody (GO:0030496)|perinuclear region of cytoplasm (GO:0048471)	microtubule binding (GO:0008017)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCAACGACTCCCTGCACCTCA	0.498																																					p.S27S		Atlas-SNP	.											.	MAPRE3	40	.	0			c.C81T						.						147.0	136.0	140.0					2																	27245167		2203	4300	6503	SO:0001819	synonymous_variant	22924	exon2			CGACTCCCTGCAC	Y11174	CCDS1731.1	2p23.3-p23.1	2008-06-04			ENSG00000084764	ENSG00000084764			6892	protein-coding gene	gene with protein product		605788				9233623	Standard	NM_012326		Approved	RP3, EB3	uc002rhw.3	Q9UPY8	OTTHUMG00000097067	ENST00000233121.2:c.81C>T	chr2.hg19:g.27245167C>T		78.0	0.0		70.0	12.0	NM_012326	B7WPK5|O00265|Q6FHB0|Q6FI15|Q9BZP7|Q9BZP8	Silent	SNP	ENST00000233121.2	hg19	CCDS1731.1																																																																																			.	.		0.498	MAPRE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214183.1	NM_012326	
CFAP36	112942	hgsc.bcm.edu	37	2	55750945	55750945	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr2:55750945C>G	ENST00000349456.4	+	3	417	c.269C>G	c.(268-270)aCc>aGc	p.T90S	CCDC104_ENST00000339012.3_Missense_Mutation_p.T115S|CCDC104_ENST00000406691.3_Missense_Mutation_p.T90S|CCDC104_ENST00000407816.3_Missense_Mutation_p.T90S|CCDC104_ENST00000403007.3_Missense_Mutation_p.T90S			Q96G28	CFA36_HUMAN		90										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(2)|lung(1)|ovary(2)	14			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CTTGCAAAGACCCATACATCA	0.338																																					p.T90S		Atlas-SNP	.											.	CCDC104	35	.	0			c.C269G						.						102.0	95.0	97.0					2																	55750945		2203	4299	6502	SO:0001583	missense	112942	exon3			CAAAGACCCATAC																												ENST00000349456.4:c.269C>G	chr2.hg19:g.55750945C>G	ENSP00000295117:p.Thr90Ser	300.0	0.0		259.0	81.0	NM_080667	Q53SF0|Q53ST9|Q6UY34	Missense_Mutation	SNP	ENST00000349456.4	hg19	CCDS1854.2	.	.	.	.	.	.	.	.	.	.	C	8.722	0.914563	0.17907	.	.	ENSG00000163001	ENST00000339012;ENST00000406691;ENST00000349456;ENST00000407816;ENST00000403007	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.7	4.82	0.62117	ADP-ribosylation factor-like 2-binding protein, domain (2);	0.318671	0.38217	N	0.001771	T	0.17534	0.0421	N	0.02011	-0.69	0.33014	D	0.52799	B;B	0.18166	0.0;0.026	B;B	0.12156	0.005;0.007	T	0.14699	-1.0463	10	0.08837	T	0.75	.	14.4807	0.67579	0.0:0.9297:0.0:0.0703	.	90;115	Q96G28;Q96G28-2	CC104_HUMAN;.	S	115;90;90;90;90	ENSP00000342699:T115S;ENSP00000385400:T90S;ENSP00000295117:T90S;ENSP00000385376:T90S;ENSP00000385972:T90S	ENSP00000342699:T115S	T	+	2	0	CCDC104	55604449	0.997000	0.39634	0.872000	0.34217	0.932000	0.56968	4.345000	0.59360	1.425000	0.47237	0.655000	0.94253	ACC	.	.		0.338	CCDC104-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319610.2		
ATP2B2	491	hgsc.bcm.edu	37	3	10384604	10384604	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr3:10384604T>A	ENST00000352432.4	-	18	2818	c.2749A>T	c.(2749-2751)Atg>Ttg	p.M917L	ATP2B2_ENST00000397077.1_Missense_Mutation_p.M872L|ATP2B2_ENST00000383800.4_Missense_Mutation_p.M872L|ATP2B2_ENST00000360273.2_Missense_Mutation_p.M917L|ATP2B2_ENST00000343816.4_Missense_Mutation_p.M903L			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	917					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						AACGTGTCCATGATGAGGTTC	0.647																																					p.M917L	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											.	ATP2B2	304	.	0			c.A2749T						.						102.0	88.0	93.0					3																	10384604		2203	4300	6503	SO:0001583	missense	491	exon19			TGTCCATGATGAG	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2749A>T	chr3.hg19:g.10384604T>A	ENSP00000324172:p.Met917Leu	64.0	0.0		84.0	39.0	NM_001001331	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	hg19	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	t	16.68	3.191706	0.58017	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000429937;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.95918	-3.85;-3.85;-3.85;-3.85;-3.85;-3.85	3.55	3.55	0.40652	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.038560	0.85682	D	0.000000	D	0.97142	0.9066	H	0.95645	3.7	0.80722	D	1	B;B;P	0.38711	0.0;0.152;0.643	B;B;P	0.45310	0.001;0.314;0.476	D	0.98130	1.0430	10	0.72032	D	0.01	-40.4095	12.8286	0.57735	0.0:0.0:0.0:1.0	.	852;884;917	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	L	917;872;872;917;903;852;106;773;917	ENSP00000324172:M917L;ENSP00000373311:M872L;ENSP00000380267:M872L;ENSP00000353414:M917L;ENSP00000344677:M903L;ENSP00000414854:M773L	ENSP00000342954:M917L	M	-	1	0	ATP2B2	10359604	1.000000	0.71417	1.000000	0.80357	0.775000	0.43874	7.738000	0.84966	1.571000	0.49722	0.248000	0.18094	ATG	.	.		0.647	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	A	rs121913416|rs121913400		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr3:41266101C>A	ENST00000349496.5	+	3	378	c.98C>A	c.(97-99)tCt>tAt	p.S33Y	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33Y|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33Y|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33Y	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,359	CTNNB1	4904	.	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98A						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>A	chr3.hg19:g.41266101C>A	ENSP00000344456:p.Ser33Tyr	186.0	0.0		142.0	54.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449496	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	Y	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26Y;ENSP00000385604:S33Y;ENSP00000412219:S33Y;ENSP00000379486:S33Y;ENSP00000344456:S33Y;ENSP00000411226:S26Y;ENSP00000379488:S33Y;ENSP00000409302:S33Y;ENSP00000401599:S33Y	ENSP00000344456:S33Y	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
SETD2	29072	hgsc.bcm.edu	37	3	47161866	47161866	+	Silent	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr3:47161866C>T	ENST00000409792.3	-	3	4302	c.4260G>A	c.(4258-4260)gaG>gaA	p.E1420E		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1420					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		TGTCCTGAAGCTCACCATCAC	0.433			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.E1420E		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.G4260A						.						183.0	176.0	178.0					3																	47161866		2203	4300	6503	SO:0001819	synonymous_variant	29072	exon3			CTGAAGCTCACCA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4260G>A	chr3.hg19:g.47161866C>T		146.0	0.0		116.0	24.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Silent	SNP	ENST00000409792.3	hg19	CCDS2749.2																																																																																			.	.		0.433	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
NIT2	56954	hgsc.bcm.edu	37	3	100059950	100059950	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr3:100059950A>G	ENST00000394140.4	+	4	372	c.281A>G	c.(280-282)tAt>tGt	p.Y94C		NM_020202.4	NP_064587.1	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	94	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				asparagine metabolic process (GO:0006528)|glutamine metabolic process (GO:0006541)|oxaloacetate metabolic process (GO:0006107)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	omega-amidase activity (GO:0050152)			breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)	17						GGGAAATTATATAACACCTGT	0.383																																					p.Y94C		Atlas-SNP	.											.	NIT2	35	.	0			c.A281G						.						130.0	122.0	125.0					3																	100059950		2203	4300	6503	SO:0001583	missense	56954	exon4			AATTATATAACAC	AF284574	CCDS33806.1	3q12.3	2004-07-12			ENSG00000114021	ENSG00000114021			29878	protein-coding gene	gene with protein product						10959838	Standard	NM_020202		Approved		uc003dtv.3	Q9NQR4	OTTHUMG00000159066	ENST00000394140.4:c.281A>G	chr3.hg19:g.100059950A>G	ENSP00000377696:p.Tyr94Cys	92.0	0.0		100.0	40.0	NM_020202	B2R9A3|D3DN47|Q8WUF0	Missense_Mutation	SNP	ENST00000394140.4	hg19	CCDS33806.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.9|22.9	4.352401|4.352401	0.82132|0.82132	.|.	.|.	ENSG00000114021|ENSG00000114021	ENST00000497785|ENST00000394140	.|D	.|0.89485	.|-2.52	5.68|5.68	5.68|5.68	0.88126|0.88126	.|Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	.|0.109437	.|0.64402	.|D	.|0.000004	D|D	0.95937|0.95937	0.8677|0.8677	M|M	0.93678|0.93678	3.445|3.445	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;1.0	D|D	0.96983|0.96983	0.9716|0.9716	5|10	.|0.87932	.|D	.|0	-10.0363|-10.0363	15.934|15.934	0.79688|0.79688	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|94;94	.|B7Z3F9;Q9NQR4	.|.;NIT2_HUMAN	M|C	187|94	.|ENSP00000377696:Y94C	.|ENSP00000377696:Y94C	I|Y	+|+	3|2	3|0	NIT2|NIT2	101542640|101542640	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	6.498000|6.498000	0.73679|0.73679	2.174000|2.174000	0.68829|0.68829	0.523000|0.523000	0.50628|0.50628	ATA|TAT	.	.		0.383	NIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353142.2	NM_020202	
WDR5B	54554	hgsc.bcm.edu	37	3	122133978	122133978	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr3:122133978A>C	ENST00000330689.4	-	1	904	c.398T>G	c.(397-399)tTc>tGc	p.F133C	RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	133										kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		TGGCGGATTGAAGTTACAACA	0.378																																					p.F133C		Atlas-SNP	.											.	WDR5B	36	.	0			c.T398G						.						100.0	96.0	97.0					3																	122133978		2203	4300	6503	SO:0001583	missense	54554	exon1			GGATTGAAGTTAC	AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.398T>G	chr3.hg19:g.122133978A>C	ENSP00000330381:p.Phe133Cys	160.0	0.0		97.0	45.0	NM_019069	B2RCM9|Q9NUL4	Missense_Mutation	SNP	ENST00000330689.4	hg19	CCDS3012.1	.	.	.	.	.	.	.	.	.	.	A	18.08	3.544027	0.65198	.	.	ENSG00000196981	ENST00000330689	T	0.67865	-0.29	4.58	4.58	0.56647	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84051	0.5387	M	0.91459	3.21	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87123	0.2192	10	0.66056	D	0.02	.	12.2375	0.54524	1.0:0.0:0.0:0.0	.	133	Q86VZ2	WDR5B_HUMAN	C	133	ENSP00000330381:F133C	ENSP00000330381:F133C	F	-	2	0	WDR5B	123616668	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	8.137000	0.89612	2.054000	0.61138	0.379000	0.24179	TTC	.	.		0.378	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355753.1	NM_019069	
WDR5B	54554	hgsc.bcm.edu	37	3	122133991	122133991	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr3:122133991A>C	ENST00000330689.4	-	1	891	c.385T>G	c.(385-387)Ttt>Gtt	p.F129V	RP11-299J3.8_ENST00000608465.1_RNA|RP11-299J3.8_ENST00000608756.1_RNA|RP11-299J3.8_ENST00000608015.1_RNA|RP11-299J3.8_ENST00000608346.1_RNA|RP11-299J3.8_ENST00000609469.1_RNA	NM_019069.3	NP_061942.2	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	129										kidney(2)|large_intestine(4)|lung(2)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	13				GBM - Glioblastoma multiforme(114;0.0704)		TTACAACAAAAGACATAATTA	0.383																																					p.F129V		Atlas-SNP	.											.	WDR5B	36	.	0			c.T385G						.						103.0	100.0	101.0					3																	122133991		2203	4300	6503	SO:0001583	missense	54554	exon1			AACAAAAGACATA	AK002149	CCDS3012.1	3q21.1	2013-01-09			ENSG00000196981	ENSG00000196981		"""WD repeat domain containing"""	17826	protein-coding gene	gene with protein product						10369878	Standard	NM_019069		Approved	FLJ11287	uc003efa.1	Q86VZ2	OTTHUMG00000159489	ENST00000330689.4:c.385T>G	chr3.hg19:g.122133991A>C	ENSP00000330381:p.Phe129Val	160.0	0.0		94.0	42.0	NM_019069	B2RCM9|Q9NUL4	Missense_Mutation	SNP	ENST00000330689.4	hg19	CCDS3012.1	.	.	.	.	.	.	.	.	.	.	A	19.95	3.922284	0.73213	.	.	ENSG00000196981	ENST00000330689	T	0.59906	0.23	4.64	4.64	0.57946	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.63838	0.2545	L	0.38838	1.175	0.80722	D	1	D	0.76494	0.999	D	0.68765	0.96	T	0.61884	-0.6971	10	0.35671	T	0.21	.	12.3576	0.55184	1.0:0.0:0.0:0.0	.	129	Q86VZ2	WDR5B_HUMAN	V	129	ENSP00000330381:F129V	ENSP00000330381:F129V	F	-	1	0	WDR5B	123616681	1.000000	0.71417	0.995000	0.50966	0.918000	0.54935	8.137000	0.89612	2.082000	0.62665	0.379000	0.24179	TTT	.	.		0.383	WDR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355753.1	NM_019069	
MYLK	4638	hgsc.bcm.edu	37	3	123452969	123452969	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr3:123452969C>T	ENST00000475616.1	-	7	873	c.874G>A	c.(874-876)Gcc>Acc	p.A292T	MYLK_ENST00000360772.3_Missense_Mutation_p.A292T|MYLK_ENST00000360304.3_Missense_Mutation_p.A292T|MYLK_ENST00000346322.5_Missense_Mutation_p.A292T|MYLK_ENST00000359169.1_Missense_Mutation_p.A292T			Q15746	MYLK_HUMAN	myosin light chain kinase	292					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TTGCTTTTGGCTGCAGCCTCC	0.547																																					p.A292T		Atlas-SNP	.											MYLK,colon,carcinoma,0,1	MYLK	224	.	0			c.G874A						.						63.0	61.0	62.0					3																	123452969		2203	4300	6503	SO:0001583	missense	4638	exon10			TTTTGGCTGCAGC	X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.874G>A	chr3.hg19:g.123452969C>T	ENSP00000418335:p.Ala292Thr	934.0	0.0		823.0	376.0	NM_053025	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	ENST00000475616.1	hg19	CCDS46896.1	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788850	0.31685	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.67171	-0.25;-0.2;-0.25;-0.18;-0.2	5.43	3.6	0.41247	.	.	.	.	.	T	0.46444	0.1393	N	0.17082	0.46	0.23076	N	0.998336	B;B;B;B;B	0.16603	0.007;0.002;0.018;0.002;0.001	B;B;B;B;B	0.14578	0.011;0.01;0.011;0.01;0.002	T	0.22487	-1.0215	9	0.12766	T	0.61	.	9.7159	0.40274	0.0:0.8333:0.0:0.1667	.	292;292;292;292;292	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	T	292	ENSP00000354004:A292T;ENSP00000353452:A292T;ENSP00000352088:A292T;ENSP00000320622:A292T;ENSP00000418335:A292T	ENSP00000320622:A292T	A	-	1	0	MYLK	124935659	0.000000	0.05858	0.115000	0.21578	0.204000	0.24138	0.075000	0.14686	1.515000	0.48885	0.655000	0.94253	GCC	.	.		0.547	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356464.1	NM_053025	
EMCN	51705	hgsc.bcm.edu	37	4	101401107	101401107	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr4:101401107C>T	ENST00000296420.4	-	2	332	c.154G>A	c.(154-156)Gtt>Att	p.V52I	EMCN_ENST00000305864.3_Missense_Mutation_p.V52I|EMCN_ENST00000511970.1_Missense_Mutation_p.V52I|EMCN_ENST00000502327.1_5'UTR	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	52	Thr-rich.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		GGTGTGACAACATTTTTCTGT	0.299																																					p.V52I		Atlas-SNP	.											.	EMCN	37	.	0			c.G154A						.						175.0	163.0	167.0					4																	101401107		2201	4294	6495	SO:0001583	missense	51705	exon2			TGACAACATTTTT	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.154G>A	chr4.hg19:g.101401107C>T	ENSP00000296420:p.Val52Ile	109.0	0.0		82.0	41.0	NM_001159694	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Missense_Mutation	SNP	ENST00000296420.4	hg19	CCDS3655.1	.	.	.	.	.	.	.	.	.	.	C	11.85	1.761439	0.31228	.	.	ENSG00000164035	ENST00000296420;ENST00000305864;ENST00000511970;ENST00000502569	.	.	.	4.1	-3.82	0.04281	.	2.935940	0.01707	N	0.027481	T	0.15739	0.0379	N	0.19112	0.55	0.09310	N	1	P;P;P	0.39862	0.642;0.692;0.692	B;B;B	0.36244	0.14;0.22;0.22	T	0.05886	-1.0858	9	0.40728	T	0.16	1.8157	0.2282	0.00177	0.2474:0.2176:0.2677:0.2673	.	52;52;52	Q9ULC0-2;B4E347;Q9ULC0	.;.;MUCEN_HUMAN	I	52	.	ENSP00000296420:V52I	V	-	1	0	EMCN	101620130	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.041000	0.12084	-0.957000	0.03627	-0.182000	0.12963	GTT	.	.		0.299	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242	
FAT4	79633	hgsc.bcm.edu	37	4	126371527	126371527	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr4:126371527C>T	ENST00000394329.3	+	9	9369	c.9356C>T	c.(9355-9357)gCg>gTg	p.A3119V	FAT4_ENST00000335110.5_Missense_Mutation_p.A1417V	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3119	Cadherin 30. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGAGATGCAGCGATGAATGGC	0.413																																					p.A3119V		Atlas-SNP	.											.	FAT4	1752	.	0			c.C9356T						.						73.0	69.0	70.0					4																	126371527		2203	4300	6503	SO:0001583	missense	79633	exon9			ATGCAGCGATGAA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.9356C>T	chr4.hg19:g.126371527C>T	ENSP00000377862:p.Ala3119Val	118.0	0.0		64.0	15.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303988	0.40795	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.53423	0.62;0.62	5.63	5.63	0.86233	Cadherin (4);Cadherin-like (1);	0.000000	0.34133	U	0.004240	T	0.60715	0.2290	L	0.56199	1.76	0.47065	D	0.999304	P;D;D	0.69078	0.948;0.992;0.997	B;P;P	0.55345	0.301;0.689;0.774	T	0.63065	-0.6720	10	0.87932	D	0	.	19.7096	0.96089	0.0:1.0:0.0:0.0	.	1417;3119;3119	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	V	3119;1417	ENSP00000377862:A3119V;ENSP00000335169:A1417V	ENSP00000335169:A1417V	A	+	2	0	FAT4	126590977	0.997000	0.39634	0.173000	0.22940	0.068000	0.16541	4.202000	0.58446	2.652000	0.90054	0.655000	0.94253	GCG	.	.		0.413	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
RICTOR	253260	hgsc.bcm.edu	37	5	38967502	38967502	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr5:38967502C>T	ENST00000357387.3	-	13	1118	c.1088G>A	c.(1087-1089)aGg>aAg	p.R363K	RICTOR_ENST00000296782.5_Missense_Mutation_p.R363K	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					ATCTGAAAGCCTCCAACTGTC	0.358																																					p.R363K		Atlas-SNP	.											.	RICTOR	182	.	0			c.G1088A						.						65.0	68.0	67.0					5																	38967502		2203	4300	6503	SO:0001583	missense	253260	exon13			GAAAGCCTCCAAC		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.1088G>A	chr5.hg19:g.38967502C>T	ENSP00000349959:p.Arg363Lys	154.0	0.0		100.0	90.0	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	hg19	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468114	0.84533	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.44881	0.92;0.91	5.43	5.43	0.79202	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.55433	0.1920	L	0.31664	0.95	0.80722	D	1	B;D	0.56035	0.066;0.974	B;D	0.70487	0.135;0.969	T	0.58070	-0.7701	10	0.87932	D	0	-12.4873	19.6092	0.95599	0.0:1.0:0.0:0.0	.	363;363	Q6R327;Q6R327-3	RICTR_HUMAN;.	K	363	ENSP00000349959:R363K;ENSP00000296782:R363K	ENSP00000296782:R363K	R	-	2	0	RICTOR	39003259	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.225000	0.78051	2.693000	0.91896	0.655000	0.94253	AGG	.	.		0.358	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
PCDHA10	56139	hgsc.bcm.edu	37	5	140235813	140235813	+	Silent	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr5:140235813G>A	ENST00000307360.5	+	1	180	c.180G>A	c.(178-180)caG>caA	p.Q60Q	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Silent_p.Q60Q|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	60	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGGTGCAGCGCCTGTTCC	0.617																																					p.Q60Q		Atlas-SNP	.											.	PCDHA10	358	.	0			c.G180A						.						56.0	64.0	61.0					5																	140235813		2197	4267	6464	SO:0001819	synonymous_variant	56139	exon1			GGTGCAGCGCCTG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.180G>A	chr5.hg19:g.140235813G>A		182.0	0.0		123.0	104.0	NM_031859	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	hg19	CCDS54921.1																																																																																			.	.		0.617	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
POM121L2	94026	hgsc.bcm.edu	37	6	27277263	27277263	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr6:27277263G>C	ENST00000444565.1	-	1	2686	c.2687C>G	c.(2686-2688)aCc>aGc	p.T896S	POM121L2_ENST00000377451.2_Missense_Mutation_p.T832S	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	896										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						GTCCATAGGGGTCACGAATCC	0.507																																					p.T896S		Atlas-SNP	.											.	POM121L2	61	.	0			c.C2687G						.						43.0	40.0	41.0					6																	27277263		692	1591	2283	SO:0001583	missense	94026	exon1			ATAGGGGTCACGA	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.2687C>G	chr6.hg19:g.27277263G>C	ENSP00000392726:p.Thr896Ser	128.0	0.0		105.0	69.0	NM_033482	C9J1I7	Missense_Mutation	SNP	ENST00000444565.1	hg19	CCDS59497.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987211	0.35036	.	.	ENSG00000158553	ENST00000377451;ENST00000444565	T;T	0.14766	2.49;2.48	3.95	2.11	0.27256	.	0.273128	0.20188	N	0.097369	T	0.04770	0.0129	L	0.55481	1.735	0.26869	N	0.967792	P	0.36144	0.539	B	0.38428	0.273	T	0.33007	-0.9885	10	0.30078	T	0.28	.	6.0212	0.19630	0.1062:0.19:0.7038:0.0	.	896	C9J1I7	.	S	832;896	ENSP00000366671:T832S;ENSP00000392726:T896S	ENSP00000366671:T832S	T	-	2	0	POM121L2	27385242	0.507000	0.26146	0.989000	0.46669	0.334000	0.28698	1.233000	0.32648	0.603000	0.29913	0.305000	0.20034	ACC	.	.		0.507	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
CFB	629	hgsc.bcm.edu	37	6	31918947	31918947	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr6:31918947A>G	ENST00000425368.2	+	15	2395	c.1882A>G	c.(1882-1884)Atc>Gtc	p.I628V	CFB_ENST00000456570.1_Missense_Mutation_p.I1130V|CFB_ENST00000477310.1_Missense_Mutation_p.I979V|CFB_ENST00000556679.1_Missense_Mutation_p.I1130V	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	628	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						TGCACAGGATATCAAAGCTCT	0.512																																					p.I628V		Atlas-SNP	.											.	CFB	33	.	0			c.A1882G						.						101.0	103.0	102.0					6																	31918947		1511	2708	4219	SO:0001583	missense	629	exon15			CAGGATATCAAAG	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.1882A>G	chr6.hg19:g.31918947A>G	ENSP00000416561:p.Ile628Val	76.0	0.0		53.0	31.0	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Missense_Mutation	SNP	ENST00000425368.2	hg19	CCDS4729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.440|0.440	-0.899173|-0.899173	0.02472|0.02472	.|.	.|.	ENSG00000243649|ENSG00000243649;ENSG00000243649;ENSG00000244255;ENSG00000244255	ENST00000483004|ENST00000556679;ENST00000425368;ENST00000456570;ENST00000477310	.|D;D;D;D	.|0.88586	.|-2.4;-2.4;-2.4;-2.4	5.41|5.41	-0.9|-0.9	0.10544|0.10544	.|Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.734237|0.734237	0.11509|0.11509	N|N	0.556869|0.556869	T|T	0.46444|0.46444	0.1393|0.1393	N|N	0.02181|0.02181	-0.65|-0.65	0.18873|0.18873	N|N	0.999988|0.999988	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.14023	.|0.01;0.002	T|T	0.52215|0.52215	-0.8605|-0.8605	6|10	.|0.02654	.|T	.|1	-8.7653|-8.7653	14.2047|14.2047	0.65728|0.65728	0.1148:0.0:0.8852:0.0|0.1148:0.0:0.8852:0.0	.|.	.|1130;628	.|B4E1Z4;P00751	.|.;CFAB_HUMAN	M|V	168|1130;628;1130;979	.|ENSP00000451848:I1130V;ENSP00000416561:I628V;ENSP00000410815:I1130V;ENSP00000418996:I979V	.|ENSP00000416561:I628V	I|I	+|+	3|1	3|0	CFB|CFB;XXbac-BPG116M5.17	32026926|32026926	0.037000|0.037000	0.19845|0.19845	0.039000|0.039000	0.18376|0.18376	0.853000|0.853000	0.48598|0.48598	-0.002000|-0.002000	0.12924|0.12924	-0.577000|-0.577000	0.05967|0.05967	-0.326000|-0.326000	0.08463|0.08463	ATA|ATC	.	.		0.512	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
MDGA1	266727	hgsc.bcm.edu	37	6	37614143	37614143	+	Silent	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr6:37614143C>T	ENST00000434837.3	-	11	3233	c.2055G>A	c.(2053-2055)caG>caA	p.Q685Q	MDGA1_ENST00000510077.1_5'UTR|MDGA1_ENST00000297153.7_Silent_p.Q688Q|MDGA1_ENST00000505425.1_Silent_p.Q685Q	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	685	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						CCGCATTGTGCTGGTTCAACT	0.577																																					p.Q685Q		Atlas-SNP	.											.	MDGA1	104	.	0			c.G2055A						.						40.0	44.0	43.0					6																	37614143		2093	4196	6289	SO:0001819	synonymous_variant	266727	exon11			ATTGTGCTGGTTC	AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2055G>A	chr6.hg19:g.37614143C>T		57.0	0.0		43.0	29.0	NM_153487	A6NHG0|Q8NBE3	Silent	SNP	ENST00000434837.3	hg19	CCDS47417.1	.	.	.	.	.	.	.	.	.	.	C	7.065	0.567126	0.13560	.	.	ENSG00000112139	ENST00000418178	.	.	.	4.85	2.94	0.34122	.	.	.	.	.	T	0.46833	0.1413	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44513	-0.9323	4	.	.	.	.	9.6802	0.40065	0.1393:0.7828:0.0:0.0779	.	.	.	.	N	3	.	.	S	-	2	0	MDGA1	37722121	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	0.678000	0.25277	1.401000	0.46761	0.563000	0.77884	AGC	.	.		0.577	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040419.3		
GLTSCR1L	23506	hgsc.bcm.edu	37	6	42797158	42797158	+	Missense_Mutation	SNP	A	A	T	rs367929984		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr6:42797158A>T	ENST00000314073.5	+	6	1263	c.1087A>T	c.(1087-1089)Att>Ttt	p.I363F	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.I363F			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	363																	GTCTGTGAACATTGTAAACCA	0.507																																					p.I363F		Atlas-SNP	.											.	.	.	.	0			c.A1087T						.						153.0	146.0	148.0					6																	42797158		2203	4300	6503	SO:0001583	missense	23506	exon5			GTGAACATTGTAA	AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1087A>T	chr6.hg19:g.42797158A>T	ENSP00000313933:p.Ile363Phe	95.0	0.0		70.0	12.0	NM_015349	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	ENST00000314073.5	hg19	CCDS34451.1	.	.	.	.	.	.	.	.	.	.	A	16.57	3.160186	0.57368	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.38077	1.16;1.16	5.51	5.51	0.81932	.	0.079666	0.53938	D	0.000054	T	0.41719	0.1171	L	0.44542	1.39	0.47584	D	0.999466	D;D;D	0.69078	0.997;0.958;0.995	D;P;P	0.75484	0.986;0.563;0.77	T	0.24333	-1.0163	10	0.40728	T	0.16	-19.1624	14.502	0.67729	1.0:0.0:0.0:0.0	.	363;363;363	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	F	363	ENSP00000313933:I363F;ENSP00000377723:I363F	ENSP00000313933:I363F	I	+	1	0	KIAA0240	42905136	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.718000	0.61930	2.217000	0.71921	0.482000	0.46254	ATT	.	.		0.507	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040562.3	NM_015349	
PKHD1	5314	hgsc.bcm.edu	37	6	51609283	51609283	+	Silent	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr6:51609283A>G	ENST00000371117.3	-	60	10331	c.10056T>C	c.(10054-10056)taT>taC	p.Y3352Y	PKHD1_ENST00000340994.4_Silent_p.Y3352Y	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3352					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CCTTGAAGAGATATTTTCTTG	0.428																																					p.Y3352Y		Atlas-SNP	.											.	PKHD1	927	.	0			c.T10056C						.						95.0	92.0	93.0					6																	51609283		2203	4300	6503	SO:0001819	synonymous_variant	5314	exon60			GAAGAGATATTTT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10056T>C	chr6.hg19:g.51609283A>G		81.0	0.0		68.0	12.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	ENST00000371117.3	hg19	CCDS4935.1																																																																																			.	.		0.428	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
GRIK2	2898	hgsc.bcm.edu	37	6	102503227	102503227	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr6:102503227T>G	ENST00000421544.1	+	15	2824	c.2334T>G	c.(2332-2334)atT>atG	p.I778M	GRIK2_ENST00000318991.6_Missense_Mutation_p.I778M|GRIK2_ENST00000413795.1_Missense_Mutation_p.I778M|GRIK2_ENST00000369138.1_Missense_Mutation_p.I778M|GRIK2_ENST00000369137.3_Missense_Mutation_p.I702M|GRIK2_ENST00000369134.4_Missense_Mutation_p.I729M	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	778					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GAGACAAAATTACCATAGCAA	0.418																																					p.I778M		Atlas-SNP	.											.	GRIK2	487	.	0			c.T2334G						.						71.0	71.0	71.0					6																	102503227		2203	4300	6503	SO:0001583	missense	2898	exon15			CAAAATTACCATA		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2334T>G	chr6.hg19:g.102503227T>G	ENSP00000397026:p.Ile778Met	135.0	0.0		86.0	9.0	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	hg19	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	T	16.27	3.074598	0.55646	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000369134;ENST00000540076	T;T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5;2.5	5.68	2.93	0.34026	Ionotropic glutamate receptor (2);	0.049050	0.85682	N	0.000000	T	0.18923	0.0454	M	0.69523	2.12	0.41946	D	0.990634	D;D;D	0.56287	0.969;0.975;0.969	D;D;D	0.69824	0.943;0.966;0.943	T	0.01596	-1.1316	10	0.87932	D	0	.	5.7468	0.18124	0.1374:0.6395:0.0:0.2231	.	778;778;778	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	M	778;778;778;702;778;729;553	ENSP00000397026:I778M;ENSP00000405596:I778M;ENSP00000358134:I778M;ENSP00000358133:I702M;ENSP00000313276:I778M;ENSP00000358130:I729M	ENSP00000313276:I778M	I	+	3	3	GRIK2	102609920	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	1.274000	0.33132	0.750000	0.32877	-0.473000	0.04963	ATT	.	.		0.418	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
SYNJ2	8871	hgsc.bcm.edu	37	6	158510898	158510898	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr6:158510898C>T	ENST00000355585.4	+	25	3559	c.3484C>T	c.(3484-3486)Cct>Tct	p.P1162S	SYNJ2_ENST00000367112.1_Missense_Mutation_p.P247S|SYNJ2_ENST00000367122.2_Missense_Mutation_p.P1117S|SYNJ2_ENST00000367121.3_Missense_Mutation_p.P1162S	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	1162					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		AATAAGTAAACCTTATAATGT	0.537																																					p.P1162S		Atlas-SNP	.											.	SYNJ2	111	.	0			c.C3484T						.						71.0	60.0	64.0					6																	158510898		2203	4300	6503	SO:0001583	missense	8871	exon25			AGTAAACCTTATA	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.3484C>T	chr6.hg19:g.158510898C>T	ENSP00000347792:p.Pro1162Ser	102.0	0.0		79.0	18.0	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Missense_Mutation	SNP	ENST00000355585.4	hg19	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.289875	0.80914	.	.	ENSG00000078269	ENST00000367122;ENST00000367121;ENST00000355585;ENST00000367112	D;D;D;T	0.96745	-4.11;-3.42;-3.36;-0.14	5.38	5.38	0.77491	.	0.000000	0.64402	D	0.000018	D	0.96700	0.8923	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	D	0.97540	1.0085	10	0.66056	D	0.02	.	19.1543	0.93504	0.0:1.0:0.0:0.0	.	557;1162;1162	B4DLC4;O15056;O15056-3	.;SYNJ2_HUMAN;.	S	1117;1162;1162;247	ENSP00000356089:P1117S;ENSP00000356088:P1162S;ENSP00000347792:P1162S;ENSP00000356079:P247S	ENSP00000347792:P1162S	P	+	1	0	SYNJ2	158430886	0.998000	0.40836	0.862000	0.33874	0.915000	0.54546	5.022000	0.64078	2.521000	0.84997	0.555000	0.69702	CCT	.	.		0.537	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
MACC1	346389	hgsc.bcm.edu	37	7	20199561	20199561	+	Silent	SNP	T	T	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr7:20199561T>G	ENST00000400331.5	-	5	731	c.423A>C	c.(421-423)tcA>tcC	p.S141S	MACC1_ENST00000589011.1_Silent_p.S141S|MACC1_ENST00000332878.4_Silent_p.S141S	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	141					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						CCAGAAGTTCTGAAACACTTT	0.393																																					p.S141S		Atlas-SNP	.											.	MACC1	99	.	0			c.A423C						.						72.0	67.0	69.0					7																	20199561		2203	4300	6503	SO:0001819	synonymous_variant	346389	exon5			AAGTTCTGAAACA		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.423A>C	chr7.hg19:g.20199561T>G		88.0	0.0		81.0	33.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Silent	SNP	ENST00000400331.5	hg19	CCDS5369.1																																																																																			.	.		0.393	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
HOXA7	3204	hgsc.bcm.edu	37	7	27194719	27194719	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr7:27194719A>C	ENST00000242159.3	-	2	635	c.502T>G	c.(502-504)Tgc>Ggc	p.C168G	RP1-170O19.22_ENST00000467897.2_RNA|HOXA7_ENST00000523796.2_5'UTR|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA-AS3_ENST00000524304.1_RNA|RP1-170O19.23_ENST00000498652.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7	168					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						TCGGTGAGGCAGAGCGCGTGG	0.612																																					p.C168G		Atlas-SNP	.											.	HOXA7	34	.	0			c.T502G						.						92.0	101.0	98.0					7																	27194719		2203	4300	6503	SO:0001583	missense	3204	exon2			TGAGGCAGAGCGC		CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217	ENST00000242159.3:c.502T>G	chr7.hg19:g.27194719A>C	ENSP00000242159:p.Cys168Gly	152.0	0.0		129.0	58.0	NM_006896	A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	Missense_Mutation	SNP	ENST00000242159.3	hg19	CCDS5408.1	.	.	.	.	.	.	.	.	.	.	A	16.86	3.240164	0.58995	.	.	ENSG00000122592	ENST00000242159	D	0.94232	-3.38	4.96	4.96	0.65561	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.77103	0.4081	N	0.00176	-1.92	0.80722	D	1	B	0.14012	0.009	B	0.22601	0.04	T	0.75181	-0.3408	10	0.41790	T	0.15	.	14.6809	0.69017	1.0:0.0:0.0:0.0	.	168	P31268	HXA7_HUMAN	G	168	ENSP00000242159:C168G	ENSP00000242159:C168G	C	-	1	0	HOXA7	27161244	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.782000	0.62396	1.883000	0.54544	0.374000	0.22700	TGC	.	.		0.612	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358695.1		
TBX20	57057	hgsc.bcm.edu	37	7	35293157	35293157	+	Silent	SNP	C	C	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr7:35293157C>G	ENST00000408931.3	-	1	601	c.75G>C	c.(73-75)tcG>tcC	p.S25S		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	25					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						AGCCGCCGCTCGACATGAGCG	0.652																																					p.S25S		Atlas-SNP	.											.	TBX20	96	.	0			c.G75C						.						44.0	43.0	43.0					7																	35293157		2203	4300	6503	SO:0001819	synonymous_variant	57057	exon1			GCCGCTCGACATG	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.75G>C	chr7.hg19:g.35293157C>G		44.0	0.0		52.0	27.0	NM_001077653	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Silent	SNP	ENST00000408931.3	hg19	CCDS43568.1																																																																																			.	.		0.652	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417	
RALA	5898	hgsc.bcm.edu	37	7	39730078	39730078	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr7:39730078G>A	ENST00000005257.2	+	3	592	c.212G>A	c.(211-213)gGg>gAg	p.G71E	RALA_ENST00000468201.1_Intron	NM_005402.3	NP_005393.2	P11233	RALA_HUMAN	v-ral simian leukemia viral oncogene homolog A (ras related)	71					actin cytoskeleton reorganization (GO:0031532)|chemotaxis (GO:0006935)|cytokinesis (GO:0000910)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|membrane raft localization (GO:0051665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of filopodium assembly (GO:0051491)|Ras protein signal transduction (GO:0007265)|regulation of exocytosis (GO:0017157)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(9)|skin(3)	16						GATACAGCTGGGCAGGAGGAC	0.473																																					p.G71E		Atlas-SNP	.											.	RALA	39	.	0			c.G212A						.						98.0	100.0	100.0					7																	39730078		2203	4300	6503	SO:0001583	missense	5898	exon3			CAGCTGGGCAGGA		CCDS5460.1	7p22-p15	2014-05-09			ENSG00000006451	ENSG00000006451			9839	protein-coding gene	gene with protein product	"""RAS-like protein A"", ""Ras-related protein Ral-A"", ""Ras family small GTP binding protein RALA"", ""ras related GTP binding protein A"""	179550		RAL		3292391	Standard	NM_005402		Approved		uc003thd.3	P11233	OTTHUMG00000128775	ENST00000005257.2:c.212G>A	chr7.hg19:g.39730078G>A	ENSP00000005257:p.Gly71Glu	115.0	0.0		110.0	46.0	NM_005402	A4D1W3	Missense_Mutation	SNP	ENST00000005257.2	hg19	CCDS5460.1	.	.	.	.	.	.	.	.	.	.	G	31	5.101048	0.94245	.	.	ENSG00000006451	ENST00000005257;ENST00000436179	D;D	0.93659	-3.26;-3.26	4.91	4.91	0.64330	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.98292	0.9434	H	0.98918	4.37	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99764	1.1022	10	0.87932	D	0	.	18.287	0.90118	0.0:0.0:1.0:0.0	.	71	P11233	RALA_HUMAN	E	71	ENSP00000005257:G71E;ENSP00000388975:G71E	ENSP00000005257:G71E	G	+	2	0	RALA	39696603	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	9.601000	0.98297	2.551000	0.86045	0.467000	0.42956	GGG	.	.		0.473	RALA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250696.2	NM_005402	
CNPY4	245812	hgsc.bcm.edu	37	7	99720107	99720107	+	Silent	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr7:99720107G>A	ENST00000262932.3	+	3	381	c.249G>A	c.(247-249)gaG>gaA	p.E83E	TAF6_ENST00000437822.2_5'Flank|CNPY4_ENST00000480692.1_3'UTR|RP11-506M12.1_ENST00000494221.1_RNA	NM_152755.1	NP_689968.1	Q8N129	CNPY4_HUMAN	canopy FGF signaling regulator 4	83						extracellular region (GO:0005576)				breast(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCCACAGAGAGACAAGGCTGG	0.532																																					p.E83E		Atlas-SNP	.											.	CNPY4	18	.	0			c.G249A						.						119.0	128.0	125.0					7																	99720107		2203	4300	6503	SO:0001819	synonymous_variant	245812	exon3			CAGAGAGACAAGG	AK075537	CCDS34701.1	7q22.1	2013-07-23	2013-07-23		ENSG00000166997	ENSG00000166997			28631	protein-coding gene	gene with protein product	"""protein associated with TLR4"""	610047	"""canopy 4 homolog (zebrafish)"""			12975309	Standard	NM_152755		Approved	MGC40499, PRAT4B	uc003uto.3	Q8N129	OTTHUMG00000154817	ENST00000262932.3:c.249G>A	chr7.hg19:g.99720107G>A		110.0	0.0		103.0	60.0	NM_152755	Q8WUN9	Silent	SNP	ENST00000262932.3	hg19	CCDS34701.1																																																																																			.	.		0.532	CNPY4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337224.4	NM_152755	
RMDN1	51115	hgsc.bcm.edu	37	8	87519286	87519286	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr8:87519286T>C	ENST00000406452.3	-	2	344	c.185A>G	c.(184-186)tAt>tGt	p.Y62C	RMDN1_ENST00000523911.1_Missense_Mutation_p.Y18C|RMDN1_ENST00000519966.1_Missense_Mutation_p.Y62C|CPNE3_ENST00000198765.4_Intron|RMDN1_ENST00000430676.2_Missense_Mutation_p.Y62C|RMDN1_ENST00000518772.1_5'UTR	NM_016033.2	NP_057117.2	Q96DB5	RMD1_HUMAN	regulator of microtubule dynamics 1	62						microtubule (GO:0005874)|mitochondrion (GO:0005739)											AAAACCCAAATACGACAAAGC	0.363																																					p.Y62C		Atlas-SNP	.											.	.	.	.	0			c.A185G						.						126.0	137.0	133.0					8																	87519286		2203	4300	6503	SO:0001583	missense	51115	exon2			CCCAAATACGACA	AK000672	CCDS34918.1, CCDS69509.1, CCDS69510.1	8q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000176623	ENSG00000176623			24285	protein-coding gene	gene with protein product		611871	"""family with sequence similarity 82, member B"""	FAM82B		10810093	Standard	NM_016033		Approved	CGI-90, FLJ20665, RMD1	uc003ydu.3	Q96DB5	OTTHUMG00000163692	ENST00000406452.3:c.185A>G	chr8.hg19:g.87519286T>C	ENSP00000385927:p.Tyr62Cys	224.0	0.0		303.0	172.0	NM_016033	A9UMZ8|B4DNF5|B4DZW6|B5MC61|C9JSC6|E7EVI2|Q9Y398	Missense_Mutation	SNP	ENST00000406452.3	hg19	CCDS34918.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.131869	0.56828	.	.	ENSG00000176623	ENST00000406452;ENST00000523911;ENST00000519966;ENST00000430676;ENST00000521045	T;T;T;T;T	0.51817	1.43;1.48;0.84;0.82;0.69	4.4	4.4	0.53042	.	0.483859	0.22233	N	0.062781	T	0.41373	0.1156	L	0.55481	1.735	0.80722	D	1	B;B;B	0.21821	0.061;0.061;0.012	B;B;B	0.18561	0.022;0.022;0.009	T	0.32693	-0.9897	10	0.38643	T	0.18	-8.922	9.9687	0.41741	0.0:0.0:0.0:1.0	.	62;62;62	B4DZW6;E7EVI2;Q96DB5	.;.;RMD1_HUMAN	C	62;18;62;62;18	ENSP00000385927:Y62C;ENSP00000429899:Y18C;ENSP00000428661:Y62C;ENSP00000409661:Y62C;ENSP00000428743:Y18C	ENSP00000385927:Y62C	Y	-	2	0	FAM82B	87588402	0.935000	0.31712	0.996000	0.52242	0.846000	0.48090	0.981000	0.29526	1.850000	0.53721	0.533000	0.62120	TAT	.	.		0.363	RMDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374770.2	NM_016033	
OXR1	55074	hgsc.bcm.edu	37	8	107531242	107531242	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr8:107531242A>T	ENST00000442977.2	+	2	197	c.98A>T	c.(97-99)cAa>cTa	p.Q33L	OXR1_ENST00000445937.1_Missense_Mutation_p.Q32L|OXR1_ENST00000531443.1_Missense_Mutation_p.Q32L|RP11-649G15.2_ENST00000518591.1_RNA|OXR1_ENST00000517566.2_Missense_Mutation_p.Q32L|OXR1_ENST00000452423.2_5'UTR	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	33					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GCAGGAAAGCAAACACCACAA	0.488																																					p.Q33L		Atlas-SNP	.											.	OXR1	190	.	0			c.A98T						.						63.0	69.0	67.0					8																	107531242		692	1591	2283	SO:0001583	missense	55074	exon2			GAAAGCAAACACC	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.98A>T	chr8.hg19:g.107531242A>T	ENSP00000405424:p.Gln33Leu	271.0	0.0		277.0	127.0	NM_001198532	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Missense_Mutation	SNP	ENST00000442977.2	hg19	CCDS56548.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.434249	0.25813	.	.	ENSG00000164830	ENST00000445937;ENST00000531443;ENST00000517566;ENST00000442977	T;T;T;T	0.11604	2.76;2.76;2.76;2.76	5.2	2.56	0.30785	.	.	.	.	.	T	0.05364	0.0142	N	0.03608	-0.345	0.40803	D	0.983352	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.29518	-1.0009	9	0.62326	D	0.03	.	11.6655	0.51370	0.599:0.401:0.0:0.0	.	33;32	Q8N573;Q8N573-5	OXR1_HUMAN;.	L	32;32;32;33	ENSP00000402918:Q32L;ENSP00000431966:Q32L;ENSP00000429205:Q32L;ENSP00000405424:Q33L	ENSP00000405424:Q33L	Q	+	2	0	OXR1	107600418	0.070000	0.21116	0.683000	0.30040	0.526000	0.34562	0.297000	0.19101	0.884000	0.36064	0.533000	0.62120	CAA	.	.		0.488	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
EIF3E	3646	hgsc.bcm.edu	37	8	109226891	109226891	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr8:109226891C>T	ENST00000220849.5	-	10	1068	c.1006G>A	c.(1006-1008)Gcc>Acc	p.A336T	EIF3E_ENST00000519517.1_5'UTR|EIF3E_ENST00000519030.1_Missense_Mutation_p.A243T	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			AAGAGACGGGCATTTTCAATG	0.358																																					p.A336T	GBM(15;360 410 8460 34179 52246)	Atlas-SNP	.											.	EIF3E	73	.	0			c.G1006A						.						93.0	89.0	90.0					8																	109226891		2203	4300	6503	SO:0001583	missense	3646	exon10			GACGGGCATTTTC	U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.1006G>A	chr8.hg19:g.109226891C>T	ENSP00000220849:p.Ala336Thr	353.0	0.0		362.0	186.0	NM_001568		Missense_Mutation	SNP	ENST00000220849.5	hg19	CCDS6308.1	.	.	.	.	.	.	.	.	.	.	C	36	5.671262	0.96754	.	.	ENSG00000104408	ENST00000220849;ENST00000519030;ENST00000519627	T;T;T	0.59364	1.59;1.59;0.27	5.52	5.52	0.82312	Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	D	0.85017	0.5601	H	0.96633	3.855	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	D	0.89561	0.3806	10	0.87932	D	0	-4.5573	19.8061	0.96532	0.0:1.0:0.0:0.0	.	336	P60228	EIF3E_HUMAN	T	336;243;209	ENSP00000220849:A336T;ENSP00000428796:A243T;ENSP00000430839:A209T	ENSP00000220849:A336T	A	-	1	0	EIF3E	109296067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.772000	0.85439	2.756000	0.94617	0.655000	0.94253	GCC	.	.		0.358	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380612.2	NM_001568	
KIAA0020	9933	hgsc.bcm.edu	37	9	2812219	2812219	+	Splice_Site	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr9:2812219C>T	ENST00000397885.2	-	14	1619		c.e14+1			NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020							endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CTTGGTTTTACCTGTGTGCAT	0.413																																					.		Atlas-SNP	.											.	KIAA0020	56	.	0			c.1412+1G>A						.						237.0	218.0	224.0					9																	2812219		2203	4300	6503	SO:0001630	splice_region_variant	9933	exon15			GTTTTACCTGTGT	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1412+1G>A	chr9.hg19:g.2812219C>T		103.0	0.0		60.0	51.0	NM_014878	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Splice_Site	SNP	ENST00000397885.2	hg19	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462797	0.84425	.	.	ENSG00000080608	ENST00000397885	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7537	0.96281	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA0020	2802219	1.000000	0.71417	0.998000	0.56505	0.891000	0.51852	4.507000	0.60434	2.736000	0.93811	0.591000	0.81541	.	.	.		0.413	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878	Intron
OR2K2	26248	hgsc.bcm.edu	37	9	114089907	114089907	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr9:114089907T>C	ENST00000374428.1	-	1	893	c.894A>G	c.(892-894)atA>atG	p.I298M	OR2K2_ENST00000302681.1_Missense_Mutation_p.I269M			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	298						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						TGATTTTGTCTATTTTTTGTG	0.388																																					p.I269M		Atlas-SNP	.											.	OR2K2	77	.	0			c.A807G						.						132.0	128.0	129.0					9																	114089907		2203	4300	6503	SO:0001583	missense	26248	exon1			TTTGTCTATTTTT	X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.894A>G	chr9.hg19:g.114089907T>C	ENSP00000363550:p.Ile298Met	167.0	0.0		169.0	148.0	NM_205859	Q2TA61|Q5VYK4|Q6IFI5	Missense_Mutation	SNP	ENST00000374428.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.91	1.779142	0.31502	.	.	ENSG00000171133	ENST00000302681;ENST00000374428	T;T	0.00137	8.68;8.68	4.55	2.16	0.27623	GPCR, rhodopsin-like superfamily (1);	0.629960	0.13303	U	0.398057	T	0.00178	0.0005	N	0.17594	0.5	0.09310	N	1	D	0.60575	0.988	P	0.58721	0.844	T	0.56056	-0.8042	10	0.66056	D	0.02	.	6.1858	0.20495	0.159:0.0:0.1658:0.6752	.	298	Q8NGT1	OR2K2_HUMAN	M	269;298	ENSP00000305055:I269M;ENSP00000363550:I298M	ENSP00000305055:I269M	I	-	3	3	OR2K2	113129728	0.000000	0.05858	0.789000	0.31954	0.944000	0.59088	-0.127000	0.10547	0.351000	0.24027	0.482000	0.46254	ATA	.	.		0.388	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		NM_205859	
ARPC5L	81873	hgsc.bcm.edu	37	9	127631658	127631658	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr9:127631658C>A	ENST00000353214.2	+	3	1341	c.89C>A	c.(88-90)gCg>gAg	p.A30E	ARPC5L_ENST00000259477.6_Missense_Mutation_p.A30E			Q9BPX5	ARP5L_HUMAN	actin related protein 2/3 complex, subunit 5-like	30				Missing (in Ref. 1; AAP97155). {ECO:0000305}.	regulation of actin filament polymerization (GO:0030833)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)				large_intestine(2)|lung(1)	3						CAGGAGGAggcggcggcggcg	0.711																																					p.A30E		Atlas-SNP	.											.	ARPC5L	8	.	0			c.C89A						.						6.0	7.0	7.0					9																	127631658		1664	3204	4868	SO:0001583	missense	81873	exon1			AGGAGGCGGCGGC	AF087842	CCDS6859.1	9q34.11	2011-07-06			ENSG00000136950	ENSG00000136950		"""Actin related protein 2/3 complex subunits"""	23366	protein-coding gene	gene with protein product							Standard	NM_030978		Approved	MGC3038, ARC16-2	uc004bpa.4	Q9BPX5	OTTHUMG00000020660	ENST00000353214.2:c.89C>A	chr9.hg19:g.127631658C>A	ENSP00000345361:p.Ala30Glu	117.0	0.0		125.0	5.0	NM_030978	Q7Z523	Missense_Mutation	SNP	ENST00000353214.2	hg19	CCDS6859.1	.	.	.	.	.	.	.	.	.	.	C	10.95	1.494499	0.26774	.	.	ENSG00000136950	ENST00000353214;ENST00000259477	.	.	.	5.0	5.0	0.66597	.	0.069901	0.56097	D	0.000037	T	0.39708	0.1088	N	0.10972	0.075	0.40179	D	0.977265	B	0.02656	0.0	B	0.09377	0.004	T	0.37079	-0.9721	9	0.87932	D	0	-0.4887	13.7282	0.62771	0.0:1.0:0.0:0.0	.	30	Q9BPX5	ARP5L_HUMAN	E	30	.	ENSP00000259477:A30E	A	+	2	0	ARPC5L	126671479	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.335000	0.19806	2.597000	0.87782	0.650000	0.86243	GCG	.	.		0.711	ARPC5L-002	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054041.1	NM_030978	
TDRD1	56165	hgsc.bcm.edu	37	10	115966040	115966040	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr10:115966040T>A	ENST00000369280.1	+	11	1795	c.1335T>A	c.(1333-1335)taT>taA	p.Y445*	TDRD1_ENST00000369281.2_Nonsense_Mutation_p.Y445*|TDRD1_ENST00000251864.2_Nonsense_Mutation_p.Y445*|TDRD1_ENST00000422662.1_Nonsense_Mutation_p.Y106*|TDRD1_ENST00000369282.1_Nonsense_Mutation_p.Y445*			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	445					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		AAATGGGATATGGCTTGAAAC	0.348																																					p.Y445X		Atlas-SNP	.											.	TDRD1	126	.	0			c.T1335A						.						93.0	90.0	91.0					10																	115966040		2203	4300	6503	SO:0001587	stop_gained	56165	exon11			GGGATATGGCTTG	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.1335T>A	chr10.hg19:g.115966040T>A	ENSP00000358286:p.Tyr445*	127.0	0.0		102.0	75.0	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Nonsense_Mutation	SNP	ENST00000369280.1	hg19		.	.	.	.	.	.	.	.	.	.	T	39	7.327152	0.98214	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	.	.	.	5.86	4.73	0.59995	.	0.451948	0.22869	N	0.054648	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.3227	8.561	0.33511	0.0:0.0865:0.0:0.9135	.	.	.	.	X	445;445;445;106;445	.	ENSP00000251864:Y445X	Y	+	3	2	TDRD1	115956030	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.614000	0.46359	1.052000	0.40392	0.482000	0.46254	TAT	.	.		0.348	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
OR51A4	401666	hgsc.bcm.edu	37	11	4967515	4967515	+	Silent	SNP	G	G	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr11:4967515G>C	ENST00000380373.2	-	1	841	c.816C>G	c.(814-816)ctC>ctG	p.L272L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		GAACATTAATGAGGGGAGAGA	0.443																																					p.L272L		Atlas-SNP	.											.	OR51A4	73	.	0			c.C816G						.						169.0	163.0	165.0					11																	4967515		2201	4298	6499	SO:0001819	synonymous_variant	401666	exon1			ATTAATGAGGGGA	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.816C>G	chr11.hg19:g.4967515G>C		571.0	0.0		347.0	26.0	NM_001005329		Silent	SNP	ENST00000380373.2	hg19	CCDS31367.1																																																																																			.	.		0.443	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
RRP8	23378	hgsc.bcm.edu	37	11	6622002	6622002	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr11:6622002G>A	ENST00000254605.6	-	5	1168	c.1051C>T	c.(1051-1053)Cct>Tct	p.P351S	ILK_ENST00000537806.1_5'Flank|ILK_ENST00000420936.2_5'Flank|RRP8_ENST00000534343.1_Missense_Mutation_p.P35S|RP11-732A19.8_ENST00000527191.1_RNA|ILK_ENST00000299421.4_5'Flank	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	351					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						TCCTCCAGAGGAACCTGTGGA	0.498																																					p.P351S		Atlas-SNP	.											.	RRP8	40	.	0			c.C1051T						.						81.0	81.0	81.0					11																	6622002		2201	4296	6497	SO:0001583	missense	23378	exon5			CCAGAGGAACCTG	AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.1051C>T	chr11.hg19:g.6622002G>A	ENSP00000254605:p.Pro351Ser	115.0	0.0		80.0	48.0	NM_015324	Q7KZ78|Q9BVM6	Missense_Mutation	SNP	ENST00000254605.6	hg19	CCDS31411.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.355471	0.82243	.	.	ENSG00000132275	ENST00000254605;ENST00000534343	T;T	0.63913	-0.07;-0.07	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.75737	0.3890	L	0.49571	1.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.76119	-0.3076	10	0.66056	D	0.02	-33.5919	18.1469	0.89661	0.0:0.0:1.0:0.0	.	351	O43159	RRP8_HUMAN	S	351;35	ENSP00000254605:P351S;ENSP00000436960:P35S	ENSP00000254605:P351S	P	-	1	0	RRP8	6578578	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.025000	0.76449	2.861000	0.98227	0.655000	0.94253	CCT	.	.		0.498	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384505.1	NM_015324	
OR5I1	10798	hgsc.bcm.edu	37	11	55703134	55703134	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr11:55703134G>T	ENST00000301532.3	-	1	742	c.743C>A	c.(742-744)aCt>aAt	p.T248N		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	248					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CGTCACTGAAGTCAGGTGAGA	0.433																																					p.T248N		Atlas-SNP	.											.	OR5I1	110	.	0			c.C743A						.						76.0	74.0	75.0					11																	55703134		2201	4295	6496	SO:0001583	missense	10798	exon1			ACTGAAGTCAGGT	BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.743C>A	chr11.hg19:g.55703134G>T	ENSP00000301532:p.Thr248Asn	142.0	0.0		95.0	26.0	NM_006637	Q6IEU4	Missense_Mutation	SNP	ENST00000301532.3	hg19	CCDS7949.1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.400979	0.42613	.	.	ENSG00000167825	ENST00000301532	T	0.39229	1.09	5.16	2.25	0.28309	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000167	T	0.69342	0.3100	H	0.96662	3.86	0.27946	N	0.937343	D	0.69078	0.997	D	0.64776	0.929	T	0.64980	-0.6279	10	0.87932	D	0	.	7.213	0.25945	0.1581:0.14:0.7018:0.0	.	248	Q13606	OR5I1_HUMAN	N	248	ENSP00000301532:T248N	ENSP00000301532:T248N	T	-	2	0	OR5I1	55459710	0.000000	0.05858	0.230000	0.23976	0.506000	0.33950	0.143000	0.16115	0.274000	0.22072	0.643000	0.83706	ACT	.	.		0.433	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391528.1	NM_006637	
DTX4	23220	hgsc.bcm.edu	37	11	58949569	58949569	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr11:58949569C>T	ENST00000227451.3	+	2	673	c.569C>T	c.(568-570)tCc>tTc	p.S190F	DTX4_ENST00000532982.1_Missense_Mutation_p.S84F	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	190					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.S190F(1)|p.S84F(1)		central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				TCCCCCTGCTCCTGTCCCCAG	0.632																																					p.S190F		Atlas-SNP	.											DTX4_ENST00000227451,NS,carcinoma,0,2	DTX4	84	.	2	Substitution - Missense(2)	lung(2)	c.C569T						.						30.0	35.0	33.0					11																	58949569		2074	4187	6261	SO:0001583	missense	23220	exon2			CCTGCTCCTGTCC	AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.569C>T	chr11.hg19:g.58949569C>T	ENSP00000227451:p.Ser190Phe	72.0	0.0		37.0	18.0	NM_015177	Q0VF38	Missense_Mutation	SNP	ENST00000227451.3	hg19	CCDS44612.1	.	.	.	.	.	.	.	.	.	.	C	13.59	2.282873	0.40394	.	.	ENSG00000110042	ENST00000532982;ENST00000227451	T;T	0.16897	2.31;2.69	4.32	4.32	0.51571	.	0.416020	0.24454	N	0.038381	T	0.20170	0.0485	L	0.54323	1.7	0.39963	D	0.974698	B	0.25169	0.119	B	0.25759	0.063	T	0.06162	-1.0842	10	0.48119	T	0.1	.	16.0922	0.81098	0.0:1.0:0.0:0.0	.	190	Q9Y2E6	DTX4_HUMAN	F	84;190	ENSP00000434055:S84F;ENSP00000227451:S190F	ENSP00000227451:S190F	S	+	2	0	DTX4	58706145	0.912000	0.30974	1.000000	0.80357	0.770000	0.43624	2.484000	0.45242	2.410000	0.81850	0.655000	0.94253	TCC	.	.		0.632	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394228.1	XM_166213	
SCYL1	57410	hgsc.bcm.edu	37	11	65302729	65302729	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr11:65302729A>C	ENST00000270176.5	+	10	1339	c.1262A>C	c.(1261-1263)gAg>gCg	p.E421A	SCYL1_ENST00000525364.1_Missense_Mutation_p.E421A|SCYL1_ENST00000420247.2_Missense_Mutation_p.E421A|SCYL1_ENST00000279270.6_Missense_Mutation_p.E421A|SCYL1_ENST00000527009.1_Missense_Mutation_p.E278A|SCYL1_ENST00000524944.1_Missense_Mutation_p.E421A|SCYL1_ENST00000533862.1_Missense_Mutation_p.E421A	NM_020680.3	NP_065731.3	Q96KG9	NTKL_HUMAN	SCY1-like 1 (S. cerevisiae)	421					peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|protein tyrosine kinase activity (GO:0004713)			ovary(1)|skin(1)	2						AAGCTGAACGAGGCCAACCTC	0.597																																					p.E421A		Atlas-SNP	.											.	SCYL1	76	.	0			c.A1262C						.						100.0	103.0	102.0					11																	65302729		2163	4257	6420	SO:0001583	missense	57410	exon10			TGAACGAGGCCAA	AF225424	CCDS41672.1, CCDS44646.1	11q11-q12	2008-07-21	2002-11-26	2002-11-29	ENSG00000142186	ENSG00000142186			14372	protein-coding gene	gene with protein product	"""teratoma-associated tyrosine kinase"", ""telomerase transcriptional elements-interacting factor"", ""telomerase regulation-associated protein"""	607982	"""N-terminal kinase-like"""	NTKL		11118629	Standard	NM_020680		Approved	HT019, P105, GKLP, NKTL, TAPK, TRAP, TEIF, MGC78454	uc001oea.1	Q96KG9	OTTHUMG00000166325	ENST00000270176.5:c.1262A>C	chr11.hg19:g.65302729A>C	ENSP00000270176:p.Glu421Ala	96.0	0.0		50.0	15.0	NM_020680	A6NJF1|Q96G50|Q96KG8|Q96KH1|Q9HAW5|Q9HBL3|Q9NR53	Missense_Mutation	SNP	ENST00000270176.5	hg19	CCDS41672.1	.	.	.	.	.	.	.	.	.	.	A	12.26	1.884833	0.33255	.	.	ENSG00000142186	ENST00000270176;ENST00000525364;ENST00000420247;ENST00000533862;ENST00000527630;ENST00000349495;ENST00000279270;ENST00000524944;ENST00000527009	T;T;T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36;1.36;1.36	4.64	4.64	0.57946	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.48768	0.1518	M	0.75615	2.305	0.80722	D	1	P;P;P;P;P	0.45531	0.63;0.86;0.732;0.567;0.781	B;P;P;P;B	0.51170	0.358;0.661;0.561;0.458;0.254	T	0.48340	-0.9044	10	0.37606	T	0.19	-12.7312	12.0046	0.53251	1.0:0.0:0.0:0.0	.	421;421;421;421;421	E9PS17;Q96KG9-4;Q96KG9-6;Q96KG9-2;Q96KG9	.;.;.;.;NTKL_HUMAN	A	421;421;421;421;421;421;421;421;278	ENSP00000270176:E421A;ENSP00000431635:E421A;ENSP00000408192:E421A;ENSP00000437254:E421A;ENSP00000433450:E421A;ENSP00000279270:E421A;ENSP00000432175:E421A;ENSP00000436993:E278A	ENSP00000270176:E421A	E	+	2	0	SCYL1	65059305	1.000000	0.71417	0.827000	0.32855	0.078000	0.17371	6.397000	0.73239	1.736000	0.51660	0.260000	0.18958	GAG	.	.		0.597	SCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389159.2	NM_020680	
SORL1	6653	hgsc.bcm.edu	37	11	121458790	121458790	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr11:121458790C>A	ENST00000260197.7	+	28	4005	c.3876C>A	c.(3874-3876)caC>caA	p.H1292Q	SORL1_ENST00000532694.1_Missense_Mutation_p.H138Q|SORL1_ENST00000527934.1_5'Flank|SORL1_ENST00000525532.1_Missense_Mutation_p.H236Q|SORL1_ENST00000534286.1_Missense_Mutation_p.H202Q	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1292	LDL-receptor class A 6. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GCCTGTTCCACTCCATGGTCT	0.582																																					p.H1292Q		Atlas-SNP	.											.	SORL1	218	.	0			c.C3876A						.						131.0	106.0	114.0					11																	121458790		2203	4299	6502	SO:0001583	missense	6653	exon28			GTTCCACTCCATG	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.3876C>A	chr11.hg19:g.121458790C>A	ENSP00000260197:p.His1292Gln	52.0	0.0		57.0	29.0	NM_003105	B2RNX7|Q92856	Missense_Mutation	SNP	ENST00000260197.7	hg19	CCDS8436.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778884	0.31502	.	.	ENSG00000137642	ENST00000260197;ENST00000525532;ENST00000532694;ENST00000534286	D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71	5.52	2.6	0.31112	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.303615	0.37095	N	0.002255	D	0.85164	0.5634	N	0.04132	-0.27	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.75252	-0.3383	10	0.13108	T	0.6	.	8.4342	0.32778	0.0:0.6227:0.2433:0.134	.	1292	Q92673	SORL_HUMAN	Q	1292;236;138;202	ENSP00000260197:H1292Q;ENSP00000434634:H236Q;ENSP00000432131:H138Q;ENSP00000436447:H202Q	ENSP00000260197:H1292Q	H	+	3	2	SORL1	120964000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.162000	0.31786	0.694000	0.31654	0.655000	0.94253	CAC	.	.		0.582	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
NFRKB	4798	hgsc.bcm.edu	37	11	129754739	129754739	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr11:129754739G>A	ENST00000446488.3	-	6	746	c.643C>T	c.(643-645)Ctc>Ttc	p.L215F	NFRKB_ENST00000304521.5_Missense_Mutation_p.L215F|NFRKB_ENST00000524746.1_Missense_Mutation_p.L215F|NFRKB_ENST00000524794.1_Missense_Mutation_p.L240F	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	215					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		CATGAGCTGAGATCTTCAAAA	0.512																																					p.L240F		Atlas-SNP	.											.	NFRKB	101	.	0			c.C718T						.						71.0	73.0	72.0					11																	129754739		2201	4297	6498	SO:0001583	missense	4798	exon5			AGCTGAGATCTTC		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.643C>T	chr11.hg19:g.129754739G>A	ENSP00000400476:p.Leu215Phe	73.0	0.0		66.0	18.0	NM_006165	Q12869|Q15312|Q9H048	Missense_Mutation	SNP	ENST00000446488.3	hg19	CCDS44770.1	.	.	.	.	.	.	.	.	.	.	g	17.04	3.288381	0.59976	.	.	ENSG00000170322	ENST00000304521;ENST00000446488;ENST00000524794;ENST00000524746;ENST00000531755	.	.	.	5.45	5.45	0.79879	.	0.210927	0.40908	D	0.000982	T	0.54581	0.1867	N	0.24115	0.695	0.51482	D	0.999926	D;D;D;D	0.76494	0.998;0.998;0.999;0.999	D;D;D;D	0.83275	0.991;0.991;0.996;0.996	T	0.45220	-0.9276	9	0.10902	T	0.67	-16.4776	12.6158	0.56576	0.0756:0.0:0.9244:0.0	.	227;215;215;240	B4DSL1;Q6P4R8;Q6P4R8-3;Q6P4R8-2	.;NFRKB_HUMAN;.;.	F	215;215;240;215;227	.	ENSP00000303800:L215F	L	-	1	0	NFRKB	129259949	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.443000	0.44881	2.558000	0.86282	0.651000	0.88453	CTC	.	.		0.512	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165	
ANO2	57101	hgsc.bcm.edu	37	12	5841762	5841762	+	Missense_Mutation	SNP	C	C	T	rs375457985		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:5841762C>T	ENST00000356134.5	-	16	1543	c.1472G>A	c.(1471-1473)cGa>cAa	p.R491Q	ANO2_ENST00000538154.1_5'UTR|ANO2_ENST00000546188.1_Missense_Mutation_p.R491Q|ANO2_ENST00000327087.8_Missense_Mutation_p.R490Q	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	495					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CATTTTCTCTCGAACTTTGGT	0.448													C|||	1	0.000199681	0.0008	0.0	5008	,	,		23076	0.0		0.0	False		,,,				2504	0.0				p.R490Q		Atlas-SNP	.											.	ANO2	309	.	0			c.G1469A						.	C	GLN/ARG	0,3960		0,0,1980	108.0	103.0	105.0		1469	4.8	1.0	12		105	1,8325		0,1,4162	no	missense	ANO2	NM_020373.2	43	0,1,6142	TT,TC,CC		0.012,0.0,0.0081	benign	490/999	5841762	1,12285	1980	4163	6143	SO:0001583	missense	57101	exon15			TTCTCTCGAACTT	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1472G>A	chr12.hg19:g.5841762C>T	ENSP00000348453:p.Arg491Gln	90.0	0.0		63.0	44.0	NM_020373	C4N787|Q9H847	Missense_Mutation	SNP	ENST00000356134.5	hg19		.	.	.	.	.	.	.	.	.	.	C	12.57	1.976945	0.34848	0.0	1.2E-4	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277;ENST00000545860	T;T;T;T	0.63417	-0.04;-0.04;-0.04;-0.04	4.84	4.84	0.62591	.	0.064980	0.64402	D	0.000006	T	0.47600	0.1454	L	0.34521	1.04	0.32319	N	0.562659	B	0.28900	0.227	B	0.19148	0.024	T	0.51988	-0.8635	10	0.13853	T	0.58	.	15.4822	0.75537	0.0:1.0:0.0:0.0	.	490	Q9NQ90-3	.	Q	490;491;491;495;50	ENSP00000314048:R490Q;ENSP00000348453:R491Q;ENSP00000440981:R491Q;ENSP00000443813:R50Q	ENSP00000314048:R490Q	R	-	2	0	ANO2	5712023	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.866000	0.56040	2.507000	0.84556	0.655000	0.94253	CGA	.	.		0.448	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373	
USP5	8078	hgsc.bcm.edu	37	12	6961443	6961443	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:6961443T>G	ENST00000229268.8	+	1	152	c.100T>G	c.(100-102)Ttc>Gtc	p.F34V	USP5_ENST00000389231.5_Missense_Mutation_p.F34V|CDCA3_ENST00000540683.1_5'Flank|CDCA3_ENST00000538862.2_5'Flank|CDCA3_ENST00000229265.6_5'Flank|CDCA3_ENST00000535406.1_5'Flank|CDCA3_ENST00000422785.3_5'Flank	NM_001098536.1	NP_001092006.1	P45974	UBP5_HUMAN	ubiquitin specific peptidase 5 (isopeptidase T)	34					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	lysosome (GO:0005764)	cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin thiolesterase activity (GO:0004221)|zinc ion binding (GO:0008270)			breast(6)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|skin(2)|urinary_tract(2)	36						CGCCTTCTCCTTCGACACGCC	0.637																																					p.F34V		Atlas-SNP	.											.	USP5	124	.	0			c.T100G						.						100.0	80.0	87.0					12																	6961443		2202	4300	6502	SO:0001583	missense	8078	exon1			TTCTCCTTCGACA	U35116	CCDS31733.1, CCDS41743.1	12p13	2007-03-02	2005-08-08		ENSG00000111667	ENSG00000111667		"""Ubiquitin-specific peptidases"""	12628	protein-coding gene	gene with protein product		601447	"""ubiquitin specific protease 5 (isopeptidase T)"""			12838346, 8723724	Standard	NM_003481		Approved	IsoT	uc001qri.4	P45974	OTTHUMG00000169233	ENST00000229268.8:c.100T>G	chr12.hg19:g.6961443T>G	ENSP00000229268:p.Phe34Val	34.0	0.0		32.0	16.0	NM_003481	D3DUS7|D3DUS8|Q96J22	Missense_Mutation	SNP	ENST00000229268.8	hg19	CCDS41743.1	.	.	.	.	.	.	.	.	.	.	T	35	5.559727	0.96514	.	.	ENSG00000111667	ENST00000229268;ENST00000389231;ENST00000542087	T;T	0.29655	1.56;1.58	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.57725	0.2073	M	0.81942	2.565	0.80722	D	1	P;D	0.71674	0.893;0.998	P;D	0.70016	0.504;0.967	T	0.63457	-0.6633	10	0.72032	D	0.01	.	15.5613	0.76249	0.0:0.0:0.0:1.0	.	34;34	P45974;P45974-2	UBP5_HUMAN;.	V	34	ENSP00000229268:F34V;ENSP00000373883:F34V	ENSP00000229268:F34V	F	+	1	0	USP5	6831704	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.830000	0.69324	2.269000	0.75478	0.533000	0.62120	TTC	.	.		0.637	USP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402982.1		
RIMKLB	57494	hgsc.bcm.edu	37	12	8866531	8866531	+	Silent	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:8866531A>G	ENST00000538135.1	+	2	894	c.69A>G	c.(67-69)caA>caG	p.Q23Q	RIMKLB_ENST00000535829.1_Silent_p.Q23Q|RIMKLB_ENST00000357529.3_Silent_p.Q23Q|RIMKLB_ENST00000299673.5_3'UTR			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	23					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						ACTATCCTCAAAAAGAGATTT	0.468																																					p.Q23Q		Atlas-SNP	.											.	RIMKLB	47	.	0			c.A69G						.						135.0	137.0	136.0					12																	8866531		1977	4148	6125	SO:0001819	synonymous_variant	57494	exon3			TCCTCAAAAAGAG	AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.69A>G	chr12.hg19:g.8866531A>G		108.0	0.0		63.0	5.0	NM_020734	B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Silent	SNP	ENST00000538135.1	hg19	CCDS41748.1																																																																																			.	.		0.468	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398874.1	NM_020734	
KIF21A	55605	hgsc.bcm.edu	37	12	39735325	39735325	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:39735325A>C	ENST00000361418.5	-	14	1918	c.1903T>G	c.(1903-1905)Tct>Gct	p.S635A	KIF21A_ENST00000541463.2_Missense_Mutation_p.S622A|KIF21A_ENST00000544797.2_Missense_Mutation_p.S622A|KIF21A_ENST00000395670.3_Missense_Mutation_p.S635A|KIF21A_ENST00000361961.3_Missense_Mutation_p.S622A			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	635					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				TCTGATTCAGAATCTGATTCA	0.393																																					p.S635A		Atlas-SNP	.											.	KIF21A	238	.	0			c.T1903G						.						120.0	117.0	118.0					12																	39735325		2203	4300	6503	SO:0001583	missense	55605	exon14			ATTCAGAATCTGA	AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.1903T>G	chr12.hg19:g.39735325A>C	ENSP00000354878:p.Ser635Ala	66.0	0.0		44.0	14.0	NM_001173464	A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	ENST00000361418.5	hg19	CCDS53776.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.420819	0.83559	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000544797;ENST00000361418;ENST00000541463	T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34	5.68	5.68	0.88126	.	0.000000	0.49305	D	0.000142	T	0.79604	0.4474	M	0.64404	1.975	0.45747	D	0.998649	D;D;D;P	0.61697	0.974;0.99;0.982;0.872	D;D;D;P	0.72982	0.969;0.979;0.952;0.529	T	0.80407	-0.1395	10	0.52906	T	0.07	.	15.9265	0.79621	1.0:0.0:0.0:0.0	.	622;622;635;622	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2	.;.;KI21A_HUMAN;.	A	622;635;635;622;635;622	ENSP00000354851:S622A;ENSP00000379029:S635A;ENSP00000445606:S622A;ENSP00000354878:S635A;ENSP00000438075:S622A	ENSP00000344501:S635A	S	-	1	0	KIF21A	38021592	1.000000	0.71417	0.996000	0.52242	0.829000	0.46940	8.107000	0.89557	2.159000	0.67721	0.533000	0.62120	TCT	.	.		0.393	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403581.1	NM_017641	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43826591	43826591	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:43826591T>C	ENST00000389420.3	-	20	2743	c.2744A>G	c.(2743-2745)gAa>gGa	p.E915G	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.E915G|ADAMTS20_ENST00000395541.2_Missense_Mutation_p.E69G	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	915	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GGATGAACATTCACTTTTGCC	0.363																																					p.E915G		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.A2744G						.						165.0	150.0	155.0					12																	43826591		2203	4300	6503	SO:0001583	missense	80070	exon20			GAACATTCACTTT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2744A>G	chr12.hg19:g.43826591T>C	ENSP00000374071:p.Glu915Gly	127.0	0.0		108.0	30.0	NM_025003	A6NNC9|J3QT00	Missense_Mutation	SNP	ENST00000389420.3	hg19	CCDS31778.2	.	.	.	.	.	.	.	.	.	.	T	18.69	3.678551	0.68042	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.64618	0.09;0.05;0.05;-0.11	4.43	4.43	0.53597	.	0.251496	0.27473	N	0.019201	T	0.71307	0.3324	M	0.66297	2.02	0.37318	D	0.909439	D;P	0.55385	0.971;0.736	P;B	0.54924	0.764;0.223	T	0.78484	-0.2186	10	0.56958	D	0.05	.	14.4249	0.67207	0.0:0.0:0.0:1.0	.	915;69	P59510;E9PBD5	ATS20_HUMAN;.	G	915;81;69;915;915	ENSP00000374071:E915G;ENSP00000447427:E81G;ENSP00000378911:E69G;ENSP00000448341:E915G	ENSP00000374068:E915G	E	-	2	0	ADAMTS20	42112858	1.000000	0.71417	0.753000	0.31225	0.759000	0.43091	7.558000	0.82253	1.931000	0.55961	0.533000	0.62120	GAA	.	.		0.363	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
PUS7L	83448	hgsc.bcm.edu	37	12	44149046	44149046	+	Start_Codon_SNP	SNP	C	C	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:44149046C>A	ENST00000416848.2	-	2	491	c.3G>T	c.(1-3)atG>atT	p.M1I	PUS7L_ENST00000551923.1_Start_Codon_SNP_p.M1I|PUS7L_ENST00000344862.5_Start_Codon_SNP_p.M1I|PUS7L_ENST00000431332.3_Intron|PUS7L_ENST00000553166.1_Start_Codon_SNP_p.M1I	NM_001098615.1|NM_001271826.1	NP_001092085.1|NP_001258755.1	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S. cerevisiae)-like	1					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(15)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TATCTTCTTCCATTCTTCTAT	0.338																																					p.M1I		Atlas-SNP	.											.	PUS7L	73	.	0			c.G3T						.						19.0	21.0	20.0					12																	44149046		2159	4230	6389	SO:0001582	initiator_codon_variant	83448	exon2			TTCTTCCATTCTT	BX647494	CCDS8743.1, CCDS61104.1	12q12	2006-02-07				ENSG00000129317			25276	protein-coding gene	gene with protein product						11230166	Standard	NM_001098615		Approved	DKFZP434G1415	uc001rnr.5	Q9H0K6	OTTHUMG00000169423	ENST00000416848.2:c.3G>T	chr12.hg19:g.44149046C>A	ENSP00000415899:p.Met1Ile	314.0	0.0		226.0	143.0	NM_001098614	B3KUJ1|Q05CU0|Q6AHZ3|Q6NUP2	Missense_Mutation	SNP	ENST00000416848.2	hg19	CCDS8743.1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.978472	0.53720	.	.	ENSG00000129317	ENST00000416848;ENST00000344862;ENST00000551923;ENST00000553166;ENST00000549868	T;T;T;T;T	0.53640	1.97;1.97;1.97;1.83;0.61	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.45256	0.1333	.	.	.	0.80722	D	1	P	0.47762	0.9	B	0.42214	0.38	T	0.37686	-0.9695	9	0.33940	T	0.23	-24.7243	18.0108	0.89222	0.0:1.0:0.0:0.0	.	1	Q9H0K6	PUS7L_HUMAN	I	1	ENSP00000415899:M1I;ENSP00000343081:M1I;ENSP00000447706:M1I;ENSP00000446865:M1I;ENSP00000449502:M1I	ENSP00000343081:M1I	M	-	3	0	PUS7L	42435313	1.000000	0.71417	1.000000	0.80357	0.672000	0.39443	2.693000	0.47027	2.724000	0.93272	0.561000	0.74099	ATG	.	.		0.338	PUS7L-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403931.1	NM_031292	Missense_Mutation
AQP2	359	hgsc.bcm.edu	37	12	50344682	50344682	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:50344682C>A	ENST00000199280.3	+	1	154	c.69C>A	c.(67-69)ttC>ttA	p.F23L	RP11-469H8.6_ENST00000552379.1_RNA|RP11-469H8.6_ENST00000550530.1_RNA	NM_000486.5	NP_000477.1	P41181	AQP2_HUMAN	aquaporin 2 (collecting duct)	23					actin filament depolymerization (GO:0030042)|aging (GO:0007568)|apoptotic process (GO:0006915)|cell volume homeostasis (GO:0006884)|cellular response to copper ion (GO:0071280)|cellular response to mercury ion (GO:0071288)|cellular response to water deprivation (GO:0042631)|excretion (GO:0007588)|female pregnancy (GO:0007565)|glycerol transport (GO:0015793)|hyperosmotic response (GO:0006972)|metanephric collecting duct development (GO:0072205)|positive regulation of calcium ion transport (GO:0051928)|renal water transport (GO:0003097)|response to calcium ion (GO:0051592)|response to glucagon (GO:0033762)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to salt stress (GO:0009651)|response to starvation (GO:0042594)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|exocytic vesicle (GO:0070382)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|rough endoplasmic reticulum (GO:0005791)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	glycerol transmembrane transporter activity (GO:0015168)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(4)|ovary(2)	10						CACTCCTCTTCGTCTTCTTTG	0.622																																					p.F23L		Atlas-SNP	.											.	AQP2	34	.	0			c.C69A						.						102.0	81.0	88.0					12																	50344682		2203	4300	6503	SO:0001583	missense	359	exon1			CCTCTTCGTCTTC		CCDS8792.1	12q12-q13	2014-09-17				ENSG00000167580		"""Ion channels / Aquaporins"""	634	protein-coding gene	gene with protein product		107777				7512890	Standard	NM_000486		Approved		uc001rvn.3	P41181		ENST00000199280.3:c.69C>A	chr12.hg19:g.50344682C>A	ENSP00000199280:p.Phe23Leu	56.0	0.0		36.0	6.0	NM_000486	Q9UD68	Missense_Mutation	SNP	ENST00000199280.3	hg19	CCDS8792.1	.	.	.	.	.	.	.	.	.	.	C	11.61	1.690040	0.29962	.	.	ENSG00000167580	ENST00000199280;ENST00000550862	D;T	0.90197	-2.63;1.51	4.89	-9.78	0.00496	Aquaporin-like (2);	0.000000	0.64402	D	0.000012	D	0.90978	0.7163	L	0.38733	1.17	0.25314	N	0.989177	D	0.89917	1.0	D	0.78314	0.991	D	0.90248	0.4291	10	0.56958	D	0.05	-15.3635	21.4074	0.99953	0.0:0.2015:0.0:0.7985	.	23	P41181	AQP2_HUMAN	L	23	ENSP00000199280:F23L;ENSP00000450022:F23L	ENSP00000199280:F23L	F	+	3	2	AQP2	48630949	0.000000	0.05858	0.074000	0.20217	0.920000	0.55202	-2.731000	0.00805	-3.379000	0.00175	-1.655000	0.00754	TTC	.	.		0.622	AQP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405540.1	NM_000486	
DIP2B	57609	hgsc.bcm.edu	37	12	51064971	51064971	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:51064971A>G	ENST00000301180.5	+	5	464	c.430A>G	c.(430-432)Aca>Gca	p.T144A		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	144						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CCACACAGACACATCTTCGGC	0.483																																					p.T144A		Atlas-SNP	.											.	DIP2B	167	.	0			c.A430G						.						89.0	78.0	82.0					12																	51064971		2203	4300	6503	SO:0001583	missense	57609	exon5			ACAGACACATCTT	AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.430A>G	chr12.hg19:g.51064971A>G	ENSP00000301180:p.Thr144Ala	50.0	0.0		34.0	10.0	NM_173602	Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	ENST00000301180.5	hg19	CCDS31799.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.021942	0.54576	.	.	ENSG00000066084	ENST00000455310;ENST00000301180	T	0.24723	1.84	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	M	0.61703	1.905	0.58432	D	0.999999	P;P	0.41450	0.701;0.75	B;B	0.39935	0.314;0.236	T	0.05582	-1.0876	10	0.15499	T	0.54	-11.9823	15.4023	0.74852	1.0:0.0:0.0:0.0	.	144;154	Q9P265;E9PHD6	DIP2B_HUMAN;.	A	154;144	ENSP00000301180:T144A	ENSP00000301180:T144A	T	+	1	0	DIP2B	49351238	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.961000	0.70356	2.229000	0.72834	0.533000	0.62120	ACA	.	.		0.483	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404243.1	NM_173602	
GRIP1	23426	hgsc.bcm.edu	37	12	66786264	66786264	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:66786264G>A	ENST00000398016.3	-	18	2200	c.2132C>T	c.(2131-2133)cCc>cTc	p.P711L	GRIP1_ENST00000542021.1_5'Flank|GRIP1_ENST00000359742.4_Missense_Mutation_p.P763L|GRIP1_ENST00000286445.7_Missense_Mutation_p.P763L	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		GAACTTCTTGGGGCTCGATGC	0.463																																					p.P711L		Atlas-SNP	.											.	GRIP1	106	.	0			c.C2132T						.						111.0	108.0	109.0					12																	66786264		1915	4137	6052	SO:0001583	missense	23426	exon18			TTCTTGGGGCTCG	AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2132C>T	chr12.hg19:g.66786264G>A	ENSP00000381098:p.Pro711Leu	142.0	0.0		103.0	64.0	NM_001178074	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Missense_Mutation	SNP	ENST00000398016.3	hg19	CCDS41807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.68|13.68	2.309870|2.309870	0.40895|0.40895	.|.	.|.	ENSG00000155974|ENSG00000155974	ENST00000398016;ENST00000359742;ENST00000286445;ENST00000538211;ENST00000540433;ENST00000536215|ENST00000538164	T;T;T;T;T;T|T	0.24151|0.15139	1.87;1.88;1.89;1.89;1.97;1.98|2.45	4.71|4.71	4.71|4.71	0.59529|0.59529	.|.	0.188887|0.188887	0.45867|0.45867	D|D	0.000336|0.000336	T|T	0.37732|0.37732	0.1014|0.1014	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	B;P;B;P|.	0.40398|.	0.023;0.565;0.004;0.716|.	B;B;B;B|.	0.36134|.	0.028;0.218;0.007;0.21|.	T|T	0.05599|0.05599	-1.0875|-1.0875	9|7	.|.	.|.	.|.	-14.5159|-14.5159	18.2146|18.2146	0.89881|0.89881	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	711;763;711;763|.	F5H4N6;Q9Y3R0;Q9Y3R0-3;Q9Y3R0-2|.	.;GRIP1_HUMAN;.;.|.	L|S	711;763;763;711;655;603|578	ENSP00000381098:P711L;ENSP00000352780:P763L;ENSP00000286445:P763L;ENSP00000446047:P711L;ENSP00000446024:P655L;ENSP00000446011:P603L|ENSP00000439053:P578S	.|.	P|P	-|-	2|1	0|0	GRIP1|GRIP1	65072531|65072531	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	5.802000|5.802000	0.69122|0.69122	2.622000|2.622000	0.88805|0.88805	0.462000|0.462000	0.41574|0.41574	CCC|CCA	.	.		0.463	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401975.2		
TRHDE	29953	hgsc.bcm.edu	37	12	73014936	73014936	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:73014936C>A	ENST00000261180.4	+	14	2479	c.2383C>A	c.(2383-2385)Ccg>Acg	p.P795T		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	795					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GCTTGGGTGGCCGAAAAATAA	0.313																																					p.P795T		Atlas-SNP	.											.	TRHDE	194	.	0			c.C2383A						.						107.0	101.0	103.0					12																	73014936		2203	4300	6503	SO:0001583	missense	29953	exon14			GGGTGGCCGAAAA	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2383C>A	chr12.hg19:g.73014936C>A	ENSP00000261180:p.Pro795Thr	143.0	0.0		110.0	61.0	NM_013381	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	hg19	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	C	9.033	0.987767	0.18966	.	.	ENSG00000072657	ENST00000261180	T	0.05855	3.38	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.03871	0.0109	N	0.02765	-0.5	0.80722	D	1	B	0.26258	0.145	B	0.30105	0.111	T	0.54549	-0.8277	10	0.13470	T	0.59	.	19.1084	0.93307	0.0:1.0:0.0:0.0	.	795	Q9UKU6	TRHDE_HUMAN	T	795	ENSP00000261180:P795T	ENSP00000261180:P795T	P	+	1	0	TRHDE	71301203	1.000000	0.71417	1.000000	0.80357	0.530000	0.34684	6.052000	0.71080	2.820000	0.97059	0.650000	0.86243	CCG	.	.		0.313	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
ZNF10	7556	hgsc.bcm.edu	37	12	133732822	133732822	+	Silent	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:133732822C>T	ENST00000248211.6	+	5	1212	c.990C>T	c.(988-990)ttC>ttT	p.F330F	ZNF268_ENST00000416488.1_Intron|ZNF10_ENST00000426665.2_Silent_p.F330F|CTD-2140B24.4_ENST00000540096.2_Intron|ZNF10_ENST00000402932.2_Silent_p.F196F	NM_015394.4	NP_056209.2	P21506	ZNF10_HUMAN	zinc finger protein 10	330					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(1)|skin(5)|urinary_tract(1)	26	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.00948)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GAAAATCCTTCAGCTGGTTCT	0.423																																					p.F330F		Atlas-SNP	.											.	ZNF10	58	.	0			c.C990T						.						97.0	104.0	102.0					12																	133732822		2203	4300	6503	SO:0001819	synonymous_variant	7556	exon5			ATCCTTCAGCTGG	X52332, BC024182	CCDS9283.1	12q24.33	2013-01-08	2005-05-22		ENSG00000256223	ENSG00000256223		"""Zinc fingers, C2H2-type"", ""-"""	12879	protein-coding gene	gene with protein product		194538	"""zinc finger protein 10 (KOX 1)"""			7865130, 8262519	Standard	NM_015394		Approved	KOX1	uc001ulq.3	P21506	OTTHUMG00000167944	ENST00000248211.6:c.990C>T	chr12.hg19:g.133732822C>T		90.0	0.0		71.0	21.0	NM_015394	B2RBS1|Q8TC91	Silent	SNP	ENST00000248211.6	hg19	CCDS9283.1																																																																																			.	.		0.423	ZNF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397182.1	NM_015394	
PROSER1	80209	hgsc.bcm.edu	37	13	39587547	39587547	+	Silent	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr13:39587547A>G	ENST00000352251.3	-	11	2675	c.1842T>C	c.(1840-1842)ccT>ccC	p.P614P	PROSER1_ENST00000484434.3_Intron|PROSER1_ENST00000350125.3_Silent_p.P592P	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	614	Ser-rich.							p.P614P(1)									CCGAGGGAGTAGGACTTGTGG	0.502																																					p.P614P		Atlas-SNP	.											C13orf23,rectum,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	large_intestine(1)	c.T1842C						.						155.0	164.0	161.0					13																	39587547		2203	4300	6503	SO:0001819	synonymous_variant	80209	exon11			GGGAGTAGGACTT	AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.1842T>C	chr13.hg19:g.39587547A>G		103.0	0.0		50.0	2.0	NM_025138	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Silent	SNP	ENST00000352251.3	hg19	CCDS9368.2																																																																																			.	.		0.502	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044607.5	NM_025138	
CCDC168	643677	hgsc.bcm.edu	37	13	103392098	103392098	+	5'Flank	SNP	T	T	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr13:103392098T>G	ENST00000322527.2	-	0	0					NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168																		ACTTTTAACATTACTTGAGAT	0.313																																					p.N3650T		Atlas-SNP	.											.	.	.	.	0			c.A10949C						.						264.0	194.0	215.0					13																	103392098		692	1591	2283	SO:0001631	upstream_gene_variant	643677	exon4			TTAACATTACTTG		CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287		chr13.hg19:g.103392098T>G	Exception_encountered	66.0	0.0		111.0	19.0	NM_001146197	Q8N800	Missense_Mutation	SNP	ENST00000322527.2	hg19																																																																																				.	.		0.313	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001146197	
LINC00283	100874057	hgsc.bcm.edu	37	13	103392683	103392683	+	RNA	SNP	C	C	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr13:103392683C>G	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		CCATTCTAGTCTATTCTTAGT	0.378																																					p.R3455T		Atlas-SNP	.											.	.	.	.	0			c.G10364C						.						82.0	65.0	70.0					13																	103392683		692	1590	2282			643677	exon4			TCTAGTCTATTCT			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103392683C>G		84.0	0.0		115.0	16.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.378	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
LINC00283	100874057	hgsc.bcm.edu	37	13	103392726	103392726	+	RNA	SNP	C	C	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr13:103392726C>G	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		GAAAACAAGTCTAGTCCTGGT	0.403																																					p.D3441H		Atlas-SNP	.											.	.	.	.	0			c.G10321C						.						78.0	58.0	64.0					13																	103392726		692	1590	2282			643677	exon4			ACAAGTCTAGTCC			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103392726C>G		85.0	0.0		108.0	12.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.403	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
LINC00283	100874057	hgsc.bcm.edu	37	13	103392758	103392758	+	RNA	SNP	C	C	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr13:103392758C>A	ENST00000430111.1	+	0	0									long intergenic non-protein coding RNA 283																		TAAATTACCTCCTTCTGATAA	0.403																																					p.G3430V		Atlas-SNP	.											.	.	.	.	0			c.G10289T						.						55.0	42.0	46.0					13																	103392758		692	1590	2282			643677	exon4			TTACCTCCTTCTG			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103392758C>A		86.0	0.0		103.0	14.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.403	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
COCH	1690	hgsc.bcm.edu	37	14	31355229	31355229	+	Silent	SNP	T	T	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr14:31355229T>G	ENST00000396618.3	+	11	1244	c.1188T>G	c.(1186-1188)acT>acG	p.T396T	COCH_ENST00000216361.4_Silent_p.T396T|COCH_ENST00000460581.2_Silent_p.T284T|RP11-829H16.3_ENST00000556786.1_RNA|RP11-829H16.3_ENST00000468444.2_RNA|RP11-829H16.3_ENST00000555421.1_RNA|RP11-829H16.3_ENST00000555108.1_RNA|COCH_ENST00000382493.4_Silent_p.T247T|COCH_ENST00000475087.1_Silent_p.T396T	NM_004086.2	NP_004077.1	O43405	COCH_HUMAN	cochlin	396	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				defense response to bacterium (GO:0042742)|positive regulation of innate immune response (GO:0045089)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|pancreas(1)|skin(3)	19	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.00645)		TAGCCAAGACTTTTGAAATCT	0.423																																					p.T396T		Atlas-SNP	.											.	COCH	54	.	0			c.T1188G						.						112.0	99.0	103.0					14																	31355229		2203	4300	6503	SO:0001819	synonymous_variant	1690	exon11			CAAGACTTTTGAA		CCDS9640.1	14q11.2-q13	2013-05-01	2013-05-01		ENSG00000100473	ENSG00000100473			2180	protein-coding gene	gene with protein product		603196	"""coagulation factor C (Limulus polyphemus homolog); cochlin"", ""coagulation factor C homolog, cochlin (Limulus polyphemus)"""	DFNA31, DFNA9		9806553	Standard	NM_004086		Approved	COCH-5B2	uc001wqp.2	O43405	OTTHUMG00000029432	ENST00000396618.3:c.1188T>G	chr14.hg19:g.31355229T>G		117.0	0.0		65.0	56.0	NM_004086	A8K9K9|D3DS84|Q96IU6	Silent	SNP	ENST00000396618.3	hg19	CCDS9640.1	.	.	.	.	.	.	.	.	.	.	T	11.95	1.792419	0.31685	.	.	ENSG00000100473	ENST00000468826	.	.	.	6.02	-4.42	0.03579	.	.	.	.	.	T	0.35422	0.0931	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41787	-0.9489	4	.	.	.	-7.0074	0.2487	0.00202	0.2674:0.1948:0.2678:0.2701	.	.	.	.	R	280	.	.	L	+	2	0	COCH	30424980	0.146000	0.22672	0.989000	0.46669	0.986000	0.74619	-0.592000	0.05747	-0.345000	0.08325	-0.267000	0.10333	CTT	.	.		0.423	COCH-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276608.1	NM_004086	
FANCM	57697	hgsc.bcm.edu	37	14	45618114	45618114	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr14:45618114G>T	ENST00000267430.5	+	4	919	c.834G>T	c.(832-834)ttG>ttT	p.L278F	FANCM_ENST00000542564.2_Missense_Mutation_p.L252F|FANCM_ENST00000556036.1_Missense_Mutation_p.L278F	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	278					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CAGATATTTTGACATATTCTC	0.353								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.L278F		Atlas-SNP	.											.	FANCM	225	.	0			c.G834T						.						71.0	71.0	71.0					14																	45618114		2203	4299	6502	SO:0001583	missense	57697	exon4	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TATTTTGACATAT	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.834G>T	chr14.hg19:g.45618114G>T	ENSP00000267430:p.Leu278Phe	106.0	0.0		43.0	37.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.346083	0.41599	.	.	ENSG00000187790	ENST00000556036;ENST00000267430;ENST00000542564	T;T;T	0.06068	3.35;3.35;3.35	5.55	-1.14	0.09741	DEAD-like helicase (1);	0.138112	0.45867	D	0.000324	T	0.10895	0.0266	L	0.57536	1.79	0.27474	N	0.952795	D;D;P	0.61697	0.99;0.99;0.642	P;P;B	0.57679	0.825;0.825;0.397	T	0.10109	-1.0644	10	0.36615	T	0.2	.	5.0477	0.14492	0.3834:0.2611:0.3555:0.0	.	252;278;278	B2RTQ9;Q8IYD8;Q8IYD8-2	.;FANCM_HUMAN;.	F	278;278;252	ENSP00000450596:L278F;ENSP00000267430:L278F;ENSP00000442493:L252F	ENSP00000267430:L278F	L	+	3	2	FANCM	44687864	1.000000	0.71417	0.925000	0.36789	0.556000	0.35491	1.200000	0.32247	-0.101000	0.12219	0.650000	0.86243	TTG	.	.		0.353	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
SMEK1	55671	hgsc.bcm.edu	37	14	91943274	91943274	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr14:91943274A>T	ENST00000554943.1	-	5	1087	c.972T>A	c.(970-972)gaT>gaA	p.D324E	SMEK1_ENST00000337238.4_Missense_Mutation_p.D324E|SMEK1_ENST00000554684.1_Missense_Mutation_p.D324E|SMEK1_ENST00000428424.2_Missense_Mutation_p.D85E|SMEK1_ENST00000555462.1_Missense_Mutation_p.D85E			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	324					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		TTTTTTCCTCATCTGTTGCTT	0.373																																					p.D324E		Atlas-SNP	.											.	SMEK1	94	.	0			c.T972A						.						135.0	124.0	128.0					14																	91943274		2200	4297	6497	SO:0001583	missense	55671	exon6			TTCCTCATCTGTT	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.972T>A	chr14.hg19:g.91943274A>T	ENSP00000450883:p.Asp324Glu	202.0	0.0		110.0	90.0	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.57|17.57	3.421696|3.421696	0.62622|0.62622	.|.	.|.	ENSG00000100796|ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390;ENST00000555029;ENST00000417249|ENST00000555470	T;T;T;T;T;T;T|.	0.35048|.	1.58;1.58;1.33;1.58;1.33;1.58;1.33|.	5.77|5.77	5.77|5.77	0.91146|0.91146	Armadillo-like helical (1);Domain of unknown function DUF625 (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.49304|.	0.1549|.	N|N	0.15975|0.15975	0.35|0.35	0.80722|0.80722	D|D	1|1	D;B;B;B|.	0.61697|.	0.99;0.004;0.025;0.02|.	D;B;B;B|.	0.73380|.	0.98;0.004;0.093;0.02|.	T|.	0.46289|.	-0.9202|.	10|.	0.15952|.	T|.	0.53|.	-19.3695|-19.3695	16.3948|16.3948	0.83586|0.83586	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	85;324;324;324|.	Q6IN85-4;G3V5Z3;Q6IN85;Q6IN85-2|.	.;.;P4R3A_HUMAN;.|.	E|R	324;324;85;324;85;324;85;114|119	ENSP00000450864:D324E;ENSP00000337125:D324E;ENSP00000392704:D85E;ENSP00000450883:D324E;ENSP00000450891:D85E;ENSP00000452596:D324E;ENSP00000452257:D85E|.	ENSP00000337125:D324E|.	D|X	-|-	3|1	2|0	SMEK1|SMEK1	91013027|91013027	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.121000|4.121000	0.57904|0.57904	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	GAT|TGA	.	.		0.373	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	
PPP4R4	57718	hgsc.bcm.edu	37	14	94711989	94711989	+	Silent	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr14:94711989C>T	ENST00000304338.3	+	13	1564	c.1410C>T	c.(1408-1410)agC>agT	p.S470S		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	470					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						GTGGAGAAAGCAGTGTTCAAG	0.338																																					p.S470S		Atlas-SNP	.											.	PPP4R4	107	.	0			c.C1410T						.						98.0	100.0	100.0					14																	94711989		2203	4298	6501	SO:0001819	synonymous_variant	57718	exon13			AGAAAGCAGTGTT	AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.1410C>T	chr14.hg19:g.94711989C>T		276.0	0.0		151.0	7.0	NM_058237	Q9BUF8|Q9HCF0	Silent	SNP	ENST00000304338.3	hg19	CCDS9921.1																																																																																			.	.		0.338	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413056.1	NM_058237	
APBA2	321	hgsc.bcm.edu	37	15	29406146	29406146	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr15:29406146A>G	ENST00000558402.1	+	15	2704	c.2105A>G	c.(2104-2106)gAg>gGg	p.E702G	APBA2_ENST00000411764.1_Missense_Mutation_p.E690G|APBA2_ENST00000561069.1_Missense_Mutation_p.E702G|APBA2_ENST00000558330.1_Missense_Mutation_p.E690G|APBA2_ENST00000558259.1_Missense_Mutation_p.E702G			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	702	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CGCATCATCGAGATCAACGGG	0.597																																					p.E702G		Atlas-SNP	.											.	APBA2	132	.	0			c.A2105G						.						127.0	96.0	107.0					15																	29406146		2203	4300	6503	SO:0001583	missense	321	exon13			TCATCGAGATCAA	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.2105A>G	chr15.hg19:g.29406146A>G	ENSP00000453293:p.Glu702Gly	72.0	0.0		51.0	26.0	NM_005503	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	ENST00000558402.1	hg19	CCDS10022.1	.	.	.	.	.	.	.	.	.	.	A	26.3	4.727396	0.89390	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.57752	0.38	4.36	4.36	0.52297	PDZ/DHR/GLGF (4);	0.174542	0.34484	N	0.003940	T	0.77274	0.4106	M	0.92219	3.285	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.981	T	0.83050	-0.0153	10	0.87932	D	0	.	12.7391	0.57241	1.0:0.0:0.0:0.0	.	690;702	E9PGI4;Q99767	.;APBA2_HUMAN	G	690;702	ENSP00000409312:E690G	ENSP00000219865:E702G	E	+	2	0	APBA2	27193438	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.105000	0.94246	1.595000	0.50050	0.379000	0.24179	GAG	.	.		0.597	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
LPCAT4	254531	hgsc.bcm.edu	37	15	34651465	34651465	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr15:34651465C>T	ENST00000314891.6	-	14	1615	c.1438G>A	c.(1438-1440)Ggg>Agg	p.G480R		NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	480					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						AAGAGTTTCCCATAGAGTGGG	0.537																																					p.G480R		Atlas-SNP	.											.	LPCAT4	36	.	0			c.G1438A						.						87.0	87.0	87.0					15																	34651465		2196	4287	6483	SO:0001583	missense	254531	exon14			GTTTCCCATAGAG	AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.1438G>A	chr15.hg19:g.34651465C>T	ENSP00000317300:p.Gly480Arg	102.0	0.0		105.0	44.0	NM_153613	A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Missense_Mutation	SNP	ENST00000314891.6	hg19	CCDS32191.1	.	.	.	.	.	.	.	.	.	.	C	11.30	1.596583	0.28445	.	.	ENSG00000176454	ENST00000314891	T	0.79749	-1.3	5.3	3.4	0.38934	.	0.434655	0.24912	N	0.034617	T	0.68311	0.2987	L	0.35414	1.06	0.32038	N	0.598591	B	0.02656	0.0	B	0.04013	0.001	T	0.63251	-0.6679	10	0.24483	T	0.36	-8.8618	9.5273	0.39171	0.0:0.8305:0.0:0.1695	.	480	Q643R3	LPCT4_HUMAN	R	480	ENSP00000317300:G480R	ENSP00000317300:G480R	G	-	1	0	LPCAT4	32438757	0.993000	0.37304	0.991000	0.47740	0.994000	0.84299	0.747000	0.26290	0.592000	0.29728	0.491000	0.48974	GGG	.	.		0.537	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418028.2	NM_153613	
TMEM87A	25963	hgsc.bcm.edu	37	15	42536362	42536362	+	Missense_Mutation	SNP	T	T	C	rs145141787		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr15:42536362T>C	ENST00000389834.4	-	7	772	c.508A>G	c.(508-510)Atg>Gtg	p.M170V	TMEM87A_ENST00000448392.1_Missense_Mutation_p.M109V	NM_015497.3	NP_056312.2	Q8NBN3	TM87A_HUMAN	transmembrane protein 87A	170						integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24		all_cancers(109;4.28e-16)|all_epithelial(112;1.04e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;1.03e-06)		GGTTCATGCATTGCCTAGAAA	0.343																																					p.M170V		Atlas-SNP	.											.	TMEM87A	56	.	0			c.A508G						.	T	VAL/MET	0,4406		0,0,2203	78.0	77.0	77.0		508	4.9	1.0	15	dbSNP_134	77	3,8593	3.0+/-9.4	0,3,4295	yes	missense	TMEM87A	NM_015497.3	21	0,3,6498	CC,CT,TT		0.0349,0.0,0.0231	benign	170/556	42536362	3,12999	2203	4298	6501	SO:0001583	missense	25963	exon7			CATGCATTGCCTA	AF132733	CCDS32205.1, CCDS45243.1, CCDS66742.1	15q15.1	2005-10-30				ENSG00000103978			24522	protein-coding gene	gene with protein product						12477932	Standard	XM_005254287		Approved	DKFZP564G2022	uc021sjr.1	Q8NBN3		ENST00000389834.4:c.508A>G	chr15.hg19:g.42536362T>C	ENSP00000374484:p.Met170Val	170.0	0.0		154.0	66.0	NM_015497	Q6NT77|Q8NCA4|Q9BS46|Q9P103|Q9Y3Y7	Missense_Mutation	SNP	ENST00000389834.4	hg19	CCDS32205.1	.	.	.	.	.	.	.	.	.	.	T	14.23	2.473839	0.43942	0.0	3.49E-4	ENSG00000103978	ENST00000389834;ENST00000448392;ENST00000535305	.	.	.	4.93	4.93	0.64822	.	0.144336	0.64402	D	0.000009	T	0.37019	0.0988	N	0.24115	0.695	0.33966	D	0.646276	B;B	0.13594	0.002;0.008	B;B	0.20577	0.002;0.03	T	0.42682	-0.9437	9	0.12430	T	0.62	-18.1446	13.2976	0.60307	0.0:0.0:0.0:1.0	.	170;109	Q8NBN3;Q8NBN3-3	TM87A_HUMAN;.	V	170;109;146	.	ENSP00000374484:M170V	M	-	1	0	TMEM87A	40323654	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.537000	0.36083	2.077000	0.62373	0.477000	0.44152	ATG	.	T|1.000;C|0.000		0.343	TMEM87A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000420482.2	NM_015497	
DUOX1	53905	hgsc.bcm.edu	37	15	45437208	45437208	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr15:45437208T>A	ENST00000321429.4	+	19	2659	c.2252T>A	c.(2251-2253)aTg>aAg	p.M751K	DUOX1_ENST00000561166.1_Missense_Mutation_p.M397K|DUOX1_ENST00000389037.3_Missense_Mutation_p.M751K	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	751					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CAGGAGCTGATGAGAGCAGCT	0.587																																					p.M751K		Atlas-SNP	.											.	DUOX1	125	.	0			c.T2252A						.						100.0	99.0	99.0					15																	45437208		2198	4298	6496	SO:0001583	missense	53905	exon19			AGCTGATGAGAGC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2252T>A	chr15.hg19:g.45437208T>A	ENSP00000317997:p.Met751Lys	110.0	0.0		106.0	52.0	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	ENST00000321429.4	hg19	CCDS32221.1	.	.	.	.	.	.	.	.	.	.	T	14.85	2.659459	0.47467	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.86030	-2.06;-2.06	4.7	4.7	0.59300	.	0.286130	0.40908	D	0.000981	T	0.79257	0.4415	L	0.40543	1.245	0.49213	D	0.99976	B	0.11235	0.004	B	0.09377	0.004	T	0.75972	-0.3129	10	0.49607	T	0.09	-16.6098	12.4113	0.55469	0.0:0.0:0.0:1.0	.	751	Q9NRD9	DUOX1_HUMAN	K	751	ENSP00000317997:M751K;ENSP00000373689:M751K	ENSP00000317997:M751K	M	+	2	0	DUOX1	43224500	1.000000	0.71417	0.974000	0.42286	0.738000	0.42128	7.282000	0.78630	2.096000	0.63516	0.528000	0.53228	ATG	.	.		0.587	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
WDR72	256764	hgsc.bcm.edu	37	15	53992110	53992110	+	Silent	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr15:53992110G>A	ENST00000396328.1	-	13	1841	c.1602C>T	c.(1600-1602)tgC>tgT	p.C534C	WDR72_ENST00000557913.1_Silent_p.C531C|WDR72_ENST00000559418.1_Silent_p.C544C|WDR72_ENST00000360509.5_Silent_p.C534C	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	534								p.C534*(1)		NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		AATGGTCACCGCACACACAGC	0.448																																					p.C534C		Atlas-SNP	.											WDR72,NS,carcinoma,0,2	WDR72	177	.	1	Substitution - Nonsense(1)	endometrium(1)	c.C1602T						.						103.0	108.0	106.0					15																	53992110		2194	4293	6487	SO:0001819	synonymous_variant	256764	exon13			GTCACCGCACACA	BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.1602C>T	chr15.hg19:g.53992110G>A		163.0	0.0		149.0	58.0	NM_182758	Q7Z3I3|Q8N8X2	Silent	SNP	ENST00000396328.1	hg19	CCDS10151.1																																																																																			.	.		0.448	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254893.2	NM_182758	
SCAMP2	10066	hgsc.bcm.edu	37	15	75142867	75142867	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr15:75142867T>C	ENST00000268099.9	-	6	729	c.620A>G	c.(619-621)tAt>tGt	p.Y207C		NM_005697.3	NP_005688.2	O15127	SCAM2_HUMAN	secretory carrier membrane protein 2	207	Interaction with SLC9A7.				post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)|trans-Golgi network membrane (GO:0032588)|transport vesicle (GO:0030133)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	9						AAAGGCCTTATAGATGGGTCG	0.562																																					p.Y207C		Atlas-SNP	.											.	SCAMP2	18	.	0			c.A620G						.						149.0	150.0	149.0					15																	75142867		2197	4295	6492	SO:0001583	missense	10066	exon6			GCCTTATAGATGG	AF005038	CCDS10271.1	15q23-q25	2013-02-21			ENSG00000140497	ENSG00000140497		"""Secretory carrier membrane proteins"""	10564	protein-coding gene	gene with protein product		606912				9378760	Standard	NM_005697		Approved		uc002azb.1	O15127	OTTHUMG00000142817	ENST00000268099.9:c.620A>G	chr15.hg19:g.75142867T>C	ENSP00000268099:p.Tyr207Cys	87.0	0.0		81.0	35.0	NM_005697	B2RDF0|Q9BQE8	Missense_Mutation	SNP	ENST00000268099.9	hg19	CCDS10271.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.189909	0.78789	.	.	ENSG00000140497	ENST00000268099;ENST00000543345	T	0.55413	0.52	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.78039	0.4221	M	0.92649	3.33	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83939	0.0310	10	0.87932	D	0	.	13.7663	0.62997	0.0:0.0:0.0:1.0	.	207;176	O15127;B3KU14	SCAM2_HUMAN;.	C	207;176	ENSP00000268099:Y207C	ENSP00000268099:Y207C	Y	-	2	0	SCAMP2	72929920	1.000000	0.71417	0.998000	0.56505	0.970000	0.65996	7.997000	0.88414	1.915000	0.55452	0.402000	0.26972	TAT	.	.		0.562	SCAMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286403.3	NM_005697	
TP53	7157	hgsc.bcm.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C|TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Y220C	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,1	TP53	33396	.	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	c.A659G	GRCh37	CM015378|CM951227	TP53	M	rs121912666	.						102.0	94.0	97.0					17																	7578190		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GGCTCATAGGGCA	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	chr17.hg19:g.7578190T>C	ENSP00000269305:p.Tyr220Cys	124.0	0.0		54.0	48.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	.	.		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
UTP6	55813	hgsc.bcm.edu	37	17	30207638	30207638	+	Missense_Mutation	SNP	C	C	A	rs139786553		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr17:30207638C>A	ENST00000261708.4	-	11	1058	c.921G>T	c.(919-921)gaG>gaT	p.E307D	CTC-542B22.2_ENST00000583236.1_lincRNA	NM_018428.2	NP_060898.2	Q9NYH9	UTP6_HUMAN	UTP6, small subunit (SSU) processome component, homolog (yeast)	307					rRNA processing (GO:0006364)	nucleolus (GO:0005730)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|skin(1)	21		all_hematologic(16;0.0149)|Ovarian(249;0.021)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|Breast(31;0.231)				CACAGCACCTCTCCTCCTTCC	0.493																																					p.E307D		Atlas-SNP	.											UTP6,NS,carcinoma,0,1	UTP6	46	.	0			c.G921T						.						213.0	184.0	194.0					17																	30207638		2203	4300	6503	SO:0001583	missense	55813	exon11			GCACCTCTCCTCC	AF116631	CCDS11269.1	17q11.2	2010-06-24	2006-05-16	2006-05-16	ENSG00000108651	ENSG00000108651			18279	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated antigen 66"""		"""chromosome 17 open reading frame 40"""	C17orf40		10843809, 16138909	Standard	NM_018428		Approved	HCA66	uc002hgr.3	Q9NYH9	OTTHUMG00000132815	ENST00000261708.4:c.921G>T	chr17.hg19:g.30207638C>A	ENSP00000261708:p.Glu307Asp	83.0	0.0		72.0	32.0	NM_018428	Q8IX96|Q96BL2|Q9NQ91	Missense_Mutation	SNP	ENST00000261708.4	hg19	CCDS11269.1	.	.	.	.	.	.	.	.	.	.	C	9.512	1.105917	0.20632	.	.	ENSG00000108651	ENST00000261708	T	0.40476	1.03	5.16	1.94	0.25998	.	0.046236	0.85682	N	0.000000	T	0.34832	0.0911	M	0.71581	2.175	0.53005	D	0.999968	B;B;B	0.16603	0.018;0.01;0.01	B;B;B	0.16722	0.016;0.014;0.008	T	0.09122	-1.0689	10	0.20046	T	0.44	-15.0264	4.7898	0.13243	0.0:0.4677:0.1651:0.3672	.	307;307;307	B4DSL9;B3KQ21;Q9NYH9	.;.;UTP6_HUMAN	D	307	ENSP00000261708:E307D	ENSP00000261708:E307D	E	-	3	2	UTP6	27231751	0.984000	0.35163	0.998000	0.56505	0.299000	0.27559	0.097000	0.15168	0.239000	0.21243	0.563000	0.77884	GAG	.	C|1.000;G|0.000		0.493	UTP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256265.2	NM_018428	
MOCOS	55034	hgsc.bcm.edu	37	18	33775294	33775294	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr18:33775294A>T	ENST00000261326.5	+	2	238	c.217A>T	c.(217-219)Atg>Ttg	p.M73L		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TAGTGATCTCATGGAAAACAC	0.408																																					p.M73L		Atlas-SNP	.											.	MOCOS	84	.	0			c.A217T						.						112.0	114.0	114.0					18																	33775294		2203	4300	6503	SO:0001583	missense	55034	exon2			GATCTCATGGAAA	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.217A>T	chr18.hg19:g.33775294A>T	ENSP00000261326:p.Met73Leu	114.0	0.0		86.0	44.0	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	hg19	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	A	0.441	-0.898654	0.02472	.	.	ENSG00000075643	ENST00000261326	D	0.84873	-1.91	5.41	-0.141	0.13452	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.365157	0.28847	N	0.013948	T	0.66237	0.2769	N	0.20574	0.59	0.20563	N	0.999884	B	0.02656	0.0	B	0.04013	0.001	T	0.46679	-0.9174	10	0.21540	T	0.41	-10.9763	2.2817	0.04116	0.4034:0.3615:0.0883:0.1468	.	73	Q96EN8	MOCOS_HUMAN	L	73	ENSP00000261326:M73L	ENSP00000261326:M73L	M	+	1	0	MOCOS	32029292	0.549000	0.26481	0.993000	0.49108	0.103000	0.19146	0.384000	0.20668	0.030000	0.15379	0.460000	0.39030	ATG	.	.		0.408	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
PIGN	23556	hgsc.bcm.edu	37	18	59757812	59757812	+	Splice_Site	SNP	C	C	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr18:59757812C>T	ENST00000357637.5	-	24	2596		c.e24-1		PIGN_ENST00000400334.3_Splice_Site	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				AGCTTCATACCTAACAGGTGG	0.318																																					.		Atlas-SNP	.											.	PIGN	62	.	0			c.2181-1G>A						.						65.0	59.0	61.0					18																	59757812		1815	4075	5890	SO:0001630	splice_region_variant	23556	exon24			TCATACCTAACAG	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2181-1G>A	chr18.hg19:g.59757812C>T		88.0	0.0		79.0	23.0	NM_012327	Q7L8F8|Q8TC01|Q9NT05	Splice_Site	SNP	ENST00000357637.5	hg19	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535035	0.45073	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	.	.	.	5.56	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4482	0.61153	0.0:0.9231:0.0:0.0769	.	.	.	.	.	-1	.	.	.	-	.	.	PIGN	57908792	1.000000	0.71417	0.960000	0.40013	0.441000	0.31987	6.668000	0.74457	1.359000	0.45940	0.491000	0.48974	.	.	.		0.318	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	Intron
MUC16	94025	hgsc.bcm.edu	37	19	9026242	9026242	+	Silent	SNP	A	A	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr19:9026242A>T	ENST00000397910.4	-	14	36947	c.36744T>A	c.(36742-36744)cgT>cgA	p.R12248R		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12250	SEA 2. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCCAGTGCGACGCATGTCCT	0.552																																					p.R12248R		Atlas-SNP	.											.	MUC16	4315	.	0			c.T36744A						.						244.0	223.0	230.0					19																	9026242		2078	4214	6292	SO:0001819	synonymous_variant	94025	exon14			AGTGCGACGCATG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36744T>A	chr19.hg19:g.9026242A>T		119.0	0.0		73.0	30.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
NXNL1	115861	hgsc.bcm.edu	37	19	17571605	17571605	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr19:17571605T>G	ENST00000301944.2	-	1	158	c.74A>C	c.(73-75)gAg>gCg	p.E25A	CTD-2521M24.10_ENST00000594663.1_5'UTR	NM_138454.1	NP_612463.1	Q96CM4	NXNL1_HUMAN	nucleoredoxin-like 1	25	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				photoreceptor cell maintenance (GO:0045494)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	6						GCGACTGACCTCAGCCTCCGT	0.607																																					p.E25A		Atlas-SNP	.											.	NXNL1	13	.	0			c.A74C						.						79.0	83.0	82.0					19																	17571605		2203	4300	6503	SO:0001583	missense	115861	exon1			CTGACCTCAGCCT	BC014127	CCDS12360.1	19p13.11	2014-05-21	2007-08-16	2007-08-16	ENSG00000171773	ENSG00000171773			25179	protein-coding gene	gene with protein product		608791	"""thioredoxin-like 6"""	TXNL6		12477932	Standard	NM_138454		Approved	RDCVF	uc002ngs.3	Q96CM4	OTTHUMG00000182798	ENST00000301944.2:c.74A>C	chr19.hg19:g.17571605T>G	ENSP00000305631:p.Glu25Ala	54.0	0.0		25.0	8.0	NM_138454	Q0QD37	Missense_Mutation	SNP	ENST00000301944.2	hg19	CCDS12360.1	.	.	.	.	.	.	.	.	.	.	t	11.62	1.692862	0.30052	.	.	ENSG00000171773	ENST00000301944	D	0.87966	-2.32	3.92	3.92	0.45320	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.88485	0.6449	L	0.43923	1.385	0.58432	D	0.999999	D	0.89917	1.0	D	0.83275	0.996	D	0.84469	0.0598	10	0.13108	T	0.6	-35.3915	10.7434	0.46166	0.0:0.0:0.0:1.0	.	25	Q96CM4	NXNL1_HUMAN	A	25	ENSP00000305631:E25A	ENSP00000305631:E25A	E	-	2	0	NXNL1	17432605	1.000000	0.71417	0.853000	0.33588	0.012000	0.07955	7.548000	0.82154	1.640000	0.50565	0.383000	0.25322	GAG	.	.		0.607	NXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463803.1	NM_138454	
DBP	1628	hgsc.bcm.edu	37	19	49134159	49134159	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr19:49134159G>T	ENST00000222122.5	-	4	1356	c.913C>A	c.(913-915)Cgc>Agc	p.R305S	DBP_ENST00000593500.1_Missense_Mutation_p.R103S|DBP_ENST00000599385.1_Missense_Mutation_p.R103S	NM_001352.3	NP_001343.2	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box) binding protein	305	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				liver development (GO:0001889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		AGCTCCTGGCGCACGGCCACA	0.692																																					p.R305S		Atlas-SNP	.											.	DBP	16	.	0			c.C913A						.						20.0	21.0	21.0					19																	49134159		2202	4299	6501	SO:0001583	missense	1628	exon4			CCTGGCGCACGGC	U06936	CCDS12728.1	19q13.33	2013-09-20			ENSG00000105516	ENSG00000105516			2697	protein-coding gene	gene with protein product		124097				1535333, 7835883	Standard	XR_243907		Approved	DABP	uc002pjx.4	Q10586	OTTHUMG00000183319	ENST00000222122.5:c.913C>A	chr19.hg19:g.49134159G>T	ENSP00000222122:p.Arg305Ser	121.0	0.0		63.0	31.0	NM_001352	A2I2P4	Missense_Mutation	SNP	ENST00000222122.5	hg19	CCDS12728.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434308	0.83776	.	.	ENSG00000105516	ENST00000222122	T	0.41758	0.99	4.28	4.28	0.50868	Basic-leucine zipper (bZIP) transcription factor (2);Basic leucine zipper (1);	0.000000	0.64402	U	0.000001	T	0.63355	0.2504	M	0.74647	2.275	0.80722	D	1	D	0.67145	0.996	D	0.74023	0.982	T	0.68584	-0.5370	10	0.87932	D	0	-9.8868	14.6085	0.68498	0.0:0.0:1.0:0.0	.	305	Q10586	DBP_HUMAN	S	305	ENSP00000222122:R305S	ENSP00000222122:R305S	R	-	1	0	DBP	53825971	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.018000	0.76406	2.364000	0.80123	0.563000	0.77884	CGC	.	.		0.692	DBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466167.1	NM_001352	
TARM1	441864	hgsc.bcm.edu	37	19	54579163	54579163	+	Silent	SNP	G	G	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr19:54579163G>A	ENST00000432826.1	-	2	66	c.42C>T	c.(40-42)tgC>tgT	p.C14C	TARM1_ENST00000446034.2_Silent_p.C22C	NM_001135686.1	NP_001129158.2	B6A8C7	TARM1_HUMAN	T cell-interacting, activating receptor on myeloid cells 1	14						integral component of membrane (GO:0016021)				endometrium(1)|stomach(2)	3						CTTGGCCCACGCACAGTCCTG	0.597																																					p.C14C		Atlas-SNP	.											.	TARM1	10	.	0			c.C42T						.						159.0	176.0	171.0					19																	54579163		692	1591	2283	SO:0001819	synonymous_variant	441864	exon2			GCCCACGCACAGT		CCDS46173.1	19q13.42	2013-01-29			ENSG00000248385	ENSG00000248385		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	37250	protein-coding gene	gene with protein product							Standard	XM_005258952		Approved		uc010yei.1	B6A8C7		ENST00000432826.1:c.42C>T	chr19.hg19:g.54579163G>A		51.0	0.0		59.0	34.0	NM_001135686	B4DWY4	Silent	SNP	ENST00000432826.1	hg19	CCDS46173.1																																																																																			.	.		0.597	TARM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465679.1	NM_001135686	
LAMP5	24141	hgsc.bcm.edu	37	20	9496958	9496958	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr20:9496958A>C	ENST00000246070.2	+	4	917	c.425A>C	c.(424-426)cAg>cCg	p.Q142P	RP5-1119D9.4_ENST00000443469.1_RNA|LAMP5_ENST00000427562.2_Missense_Mutation_p.Q98P	NM_012261.3	NP_036393.1	Q9UJQ1	LAMP5_HUMAN	lysosomal-associated membrane protein family, member 5	142						cytoplasmic vesicle membrane (GO:0030659)|dendrite membrane (GO:0032590)|early endosome membrane (GO:0031901)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|endosome membrane (GO:0010008)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)											AGCAAAGTGCAGTTTGTCTAC	0.592																																					p.Q142P		Atlas-SNP	.											.	.	.	.	0			c.A425C						.						96.0	87.0	90.0					20																	9496958		2203	4300	6503	SO:0001583	missense	24141	exon4			AAGTGCAGTTTGT	AL121740	CCDS13106.1, CCDS56177.1	20p12	2013-03-14	2011-11-25	2011-11-25	ENSG00000125869	ENSG00000125869			16097	protein-coding gene	gene with protein product	"""brain and dendritic cell associated LAMP"""	614641	"""chromosome 20 open reading frame 103"""	C20orf103		11780052, 21642595	Standard	NM_012261		Approved	dJ1119D9.3, BAD-LAMP, UNC-43	uc002wni.2	Q9UJQ1	OTTHUMG00000031851	ENST00000246070.2:c.425A>C	chr20.hg19:g.9496958A>C	ENSP00000246070:p.Gln142Pro	103.0	0.0		111.0	42.0	NM_012261	B4DHZ7|B7Z9Z9	Missense_Mutation	SNP	ENST00000246070.2	hg19	CCDS13106.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.086851	0.76642	.	.	ENSG00000125869	ENST00000246070;ENST00000427562	T;T	0.34859	1.34;1.34	5.98	5.98	0.97165	.	0.103761	0.64402	D	0.000002	T	0.45438	0.1342	L	0.29908	0.895	0.58432	D	0.999997	P;D	0.63046	0.731;0.992	B;D	0.64506	0.244;0.926	T	0.28202	-1.0051	9	.	.	.	-5.8979	14.2137	0.65779	1.0:0.0:0.0:0.0	.	98;142	Q9UJQ1-2;Q9UJQ1	.;CT103_HUMAN	P	142;98	ENSP00000246070:Q142P;ENSP00000406360:Q98P	.	Q	+	2	0	C20orf103	9444958	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.583000	0.74053	2.296000	0.77279	0.482000	0.46254	CAG	.	.		0.592	LAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077946.2	NM_012261	
BRWD1	54014	hgsc.bcm.edu	37	21	40570714	40570714	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr21:40570714T>C	ENST00000333229.2	-	40	5955	c.5628A>G	c.(5626-5628)atA>atG	p.I1876M	BRWD1_ENST00000380800.3_Missense_Mutation_p.I1876M|BRWD1_ENST00000342449.3_Missense_Mutation_p.I1876M	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1876					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TTGGTTTTTCTATTTTGTCAT	0.348																																					p.I1876M	Melanoma(170;988 1986 4794 16843 39731)	Atlas-SNP	.											.	BRWD1	325	.	0			c.A5628G						.						72.0	65.0	67.0					21																	40570714		2203	4300	6503	SO:0001583	missense	54014	exon40			TTTTTCTATTTTG	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5628A>G	chr21.hg19:g.40570714T>C	ENSP00000330753:p.Ile1876Met	129.0	0.0		96.0	16.0	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	ENST00000333229.2	hg19	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	T	9.841	1.190939	0.21954	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.59083	0.29;0.29;0.29	5.41	1.51	0.23008	.	0.836393	0.10792	N	0.633643	T	0.33469	0.0864	N	0.08118	0	0.09310	N	1	B;B	0.27679	0.054;0.185	B;B	0.28232	0.004;0.087	T	0.24154	-1.0168	10	0.49607	T	0.09	-0.9373	4.5645	0.12177	0.166:0.2475:0.0:0.5865	.	1876;1876	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	M	1876	ENSP00000330753:I1876M;ENSP00000344333:I1876M;ENSP00000370178:I1876M	ENSP00000330753:I1876M	I	-	3	3	BRWD1	39492584	0.053000	0.20554	0.082000	0.20525	0.809000	0.45718	0.793000	0.26944	0.373000	0.24621	0.533000	0.62120	ATA	.	.		0.348	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
SF3A1	10291	hgsc.bcm.edu	37	22	30731656	30731656	+	Silent	SNP	G	G	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr22:30731656G>C	ENST00000215793.8	-	14	2347	c.2193C>G	c.(2191-2193)ctC>ctG	p.L731L	SF3A1_ENST00000439242.1_Silent_p.L666L	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	731	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						CCGTGAGTGGGAGGGTGAAGA	0.537																																					p.L731L		Atlas-SNP	.											.	SF3A1	61	.	0			c.C2193G						.						220.0	159.0	179.0					22																	30731656		2203	4300	6503	SO:0001819	synonymous_variant	10291	exon14			GAGTGGGAGGGTG	X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.2193C>G	chr22.hg19:g.30731656G>C		99.0	0.0		101.0	33.0	NM_005877	E9PAW1	Silent	SNP	ENST00000215793.8	hg19	CCDS13875.1																																																																																			.	.		0.537	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320916.2	NM_005877	
HMGXB4	10042	hgsc.bcm.edu	37	22	35689064	35689064	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr22:35689064C>G	ENST00000216106.5	+	10	1846	c.1718C>G	c.(1717-1719)aCc>aGc	p.T573S	HMGXB4_ENST00000444518.2_Missense_Mutation_p.T464S	NM_001003681.2	NP_001003681.1	Q9UGU5	HMGX4_HUMAN	HMG box domain containing 4	573					endosome to lysosome transport (GO:0008333)|negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)	NURF complex (GO:0016589)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|large_intestine(6)|liver(1)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						GCATGTCTCACCACACAACTA	0.507																																					p.T573S		Atlas-SNP	.											.	HMGXB4	52	.	0			c.C1718G						.						218.0	179.0	192.0					22																	35689064		2203	4300	6503	SO:0001583	missense	10042	exon10			GTCTCACCACACA	AJ010069	CCDS33641.1	22q13	2011-07-01	2009-01-05	2009-01-05	ENSG00000100281	ENSG00000100281		"""High mobility group / Non-canonical"""	5003	protein-coding gene	gene with protein product		604702	"""high-mobility group protein 2-like 1"""	HMG2L1		10329004, 10591208, 20511232	Standard	NM_001003681		Approved	THC211630	uc003anl.3	Q9UGU5	OTTHUMG00000150439	ENST00000216106.5:c.1718C>G	chr22.hg19:g.35689064C>G	ENSP00000216106:p.Thr573Ser	104.0	0.0		111.0	54.0	NM_001003681	O75672|O75673|Q9UMT5	Missense_Mutation	SNP	ENST00000216106.5	hg19	CCDS33641.1	.	.	.	.	.	.	.	.	.	.	C	34	5.302695	0.95601	.	.	ENSG00000100281	ENST00000444518;ENST00000216106	T;T	0.35421	1.31;1.37	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.63768	0.2539	M	0.76574	2.34	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.64732	-0.6338	10	0.87932	D	0	-18.3183	20.2562	0.98421	0.0:1.0:0.0:0.0	.	573	Q9UGU5	HMGX4_HUMAN	S	464;573	ENSP00000398302:T464S;ENSP00000216106:T573S	ENSP00000216106:T573S	T	+	2	0	HMGXB4	34019064	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.716000	0.84723	2.797000	0.96272	0.563000	0.77884	ACC	.	.		0.507	HMGXB4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318104.2	NM_005487	
SH3BP1	23616	hgsc.bcm.edu	37	22	38049838	38049838	+	Missense_Mutation	SNP	C	C	T	rs373477637		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr22:38049838C>T	ENST00000357436.4	+	17	1964	c.1651C>T	c.(1651-1653)Ccc>Tcc	p.P551S	Z83844.1_ENST00000456099.1_RNA|SH3BP1_ENST00000599616.1_Missense_Mutation_p.P487S	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	551					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					CACCAGGAGTCCCCCGGAGAC	0.662																																					p.P551S		Atlas-SNP	.											.	SH3BP1	41	.	0			c.C1651T						.						43.0	41.0	41.0					22																	38049838		2200	4300	6500	SO:0001583	missense	23616	exon17			AGGAGTCCCCCGG		CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1651C>T	chr22.hg19:g.38049838C>T	ENSP00000350018:p.Pro551Ser	296.0	0.0		294.0	126.0	NM_018957	Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	ENST00000357436.4	hg19	CCDS13952.2	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514981	0.27123	.	.	ENSG00000100092	ENST00000357436;ENST00000397014	T	0.19250	2.16	5.45	-2.26	0.06867	.	0.571527	0.16968	N	0.192216	T	0.07638	0.0192	N	0.20986	0.625	0.09310	N	0.999999	P;B;B;P	0.39282	0.666;0.004;0.011;0.666	B;B;B;B	0.30401	0.115;0.002;0.005;0.115	T	0.24584	-1.0156	10	0.28530	T	0.3	.	1.7025	0.02875	0.4038:0.3084:0.1313:0.1564	.	465;487;551;465	E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;3BP1_HUMAN;.	S	551;465	ENSP00000350018:P551S	ENSP00000350018:P551S	P	+	1	0	SH3BP1	36379784	0.000000	0.05858	0.000000	0.03702	0.875000	0.50365	-0.803000	0.04540	-0.389000	0.07786	-0.182000	0.12963	CCC	.	.		0.662	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075884.4	NM_018957	
RP2	6102	hgsc.bcm.edu	37	X	46713108	46713108	+	Silent	SNP	G	G	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chrX:46713108G>T	ENST00000218340.3	+	2	461	c.300G>T	c.(298-300)gtG>gtT	p.V100V		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	100	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						AAGGCAGCGTGTTTTTCCGGA	0.423																																					p.V100V		Atlas-SNP	.											.	RP2	37	.	0			c.G300T						.						146.0	130.0	135.0					X																	46713108		2203	4300	6503	SO:0001819	synonymous_variant	6102	exon2			CAGCGTGTTTTTC	AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.300G>T	chrX.hg19:g.46713108G>T		75.0	0.0		40.0	5.0	NM_006915	Q86XJ7|Q9NU67	Silent	SNP	ENST00000218340.3	hg19	CCDS14270.1																																																																																			.	.		0.423	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056375.1	NM_006915	
LAS1L	81887	hgsc.bcm.edu	37	X	64738079	64738079	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chrX:64738079T>G	ENST00000374811.3	-	12	1755	c.1715A>C	c.(1714-1716)aAa>aCa	p.K572T	LAS1L_ENST00000374804.5_Missense_Mutation_p.K513T|LAS1L_ENST00000312391.8_3'UTR|LAS1L_ENST00000374807.5_Missense_Mutation_p.K555T	NM_031206.4	NP_112483.1	Q9Y4W2	LAS1L_HUMAN	LAS1-like (S. cerevisiae)	572					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|kidney(1)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	33						CAAGACCTCTTTCTCCTCCTT	0.512																																					p.K572T		Atlas-SNP	.											.	LAS1L	72	.	0			c.A1715C						.						147.0	122.0	130.0					X																	64738079		2203	4300	6503	SO:0001583	missense	81887	exon12			ACCTCTTTCTCCT	BC014545	CCDS14381.1, CCDS55433.1, CCDS55434.1	Xq12	2008-02-05			ENSG00000001497	ENSG00000001497			25726	protein-coding gene	gene with protein product						12477932	Standard	NM_031206		Approved	FLJ12525	uc004dwa.2	Q9Y4W2	OTTHUMG00000021720	ENST00000374811.3:c.1715A>C	chrX.hg19:g.64738079T>G	ENSP00000363944:p.Lys572Thr	57.0	0.0		38.0	33.0	NM_031206	A9X410|Q5JXQ0|Q8TEN5|Q9H9V5	Missense_Mutation	SNP	ENST00000374811.3	hg19	CCDS14381.1	.	.	.	.	.	.	.	.	.	.	T	0.082	-1.181615	0.01633	.	.	ENSG00000001497	ENST00000374807;ENST00000374811;ENST00000374804	T	0.66815	-0.23	4.68	2.08	0.27032	.	1.255560	0.05805	N	0.612964	T	0.59487	0.2197	L	0.47716	1.5	0.09310	N	1	B;B;B;B	0.29037	0.144;0.062;0.037;0.231	B;B;B;B	0.24848	0.017;0.017;0.007;0.056	T	0.46373	-0.9196	10	0.49607	T	0.09	.	7.7562	0.28925	0.243:0.0:0.0:0.757	.	513;555;572;85	Q9Y4W2-3;Q9Y4W2-2;Q9Y4W2;B3KNR6	.;.;LAS1L_HUMAN;.	T	555;572;513	ENSP00000363937:K513T	ENSP00000363937:K513T	K	-	2	0	LAS1L	64654804	0.014000	0.17966	0.000000	0.03702	0.004000	0.04260	1.880000	0.39628	0.007000	0.14760	0.441000	0.28932	AAA	.	.		0.512	LAS1L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056974.1	NM_031206	
SMARCA1	6594	hgsc.bcm.edu	37	X	128623009	128623009	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chrX:128623009T>C	ENST00000371122.4	-	16	2131	c.2002A>G	c.(2002-2004)Atg>Gtg	p.M668V	SMARCA1_ENST00000371123.1_Missense_Mutation_p.M656V|SMARCA1_ENST00000371121.3_Missense_Mutation_p.M656V	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	668					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						TGCCGTATCATTTGTAACATT	0.363																																					p.M668V		Atlas-SNP	.											.	SMARCA1	126	.	0			c.A2002G						.						163.0	125.0	138.0					X																	128623009		2203	4300	6503	SO:0001583	missense	6594	exon16			GTATCATTTGTAA	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2002A>G	chrX.hg19:g.128623009T>C	ENSP00000360163:p.Met668Val	57.0	0.0		47.0	40.0	NM_003069	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	hg19	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	T	16.62	3.173596	0.57584	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	T;T;T;T	0.74947	-0.89;-0.89;-0.89;-0.89	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.79476	0.4452	M	0.83384	2.64	0.58432	D	0.999999	B;B;B;B	0.32731	0.175;0.175;0.268;0.382	B;B;B;B	0.37888	0.133;0.133;0.26;0.133	T	0.81258	-0.1014	10	0.87932	D	0	-9.3705	14.6824	0.69028	0.0:0.0:0.0:1.0	.	647;668;656;668	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	V	656;656;668;647	ENSP00000360162:M656V;ENSP00000360164:M656V;ENSP00000360163:M668V;ENSP00000404275:M647V	ENSP00000360162:M656V	M	-	1	0	SMARCA1	128450690	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.033000	0.88852	1.848000	0.53677	0.441000	0.28932	ATG	.	.		0.363	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
MTM1	4534	hgsc.bcm.edu	37	X	149814284	149814284	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chrX:149814284A>T	ENST00000370396.2	+	9	861	c.807A>T	c.(805-807)aaA>aaT	p.K269N	MTM1_ENST00000542741.1_Missense_Mutation_p.K174N|MTM1_ENST00000413012.2_Missense_Mutation_p.K232N|MTM1_ENST00000306167.7_3'UTR|MTM1_ENST00000543350.1_Missense_Mutation_p.K154N	NM_000252.2	NP_000243.1	Q13496	MTM1_HUMAN	myotubularin 1	269	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				endosome to lysosome transport (GO:0008333)|intermediate filament organization (GO:0045109)|mitochondrion distribution (GO:0048311)|mitochondrion morphogenesis (GO:0070584)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|protein transport (GO:0015031)|regulation of vacuole organization (GO:0044088)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	intermediate filament binding (GO:0019215)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Acute lymphoblastic leukemia(192;6.56e-05)					AGACTAATAAACAAATTTCTA	0.418																																					p.K269N		Atlas-SNP	.											.	MTM1	89	.	0			c.A807T						.						138.0	117.0	124.0					X																	149814284		2203	4300	6503	SO:0001583	missense	4534	exon9			TAATAAACAAATT	U46024	CCDS14694.1	Xq27.3-q28	2014-09-17			ENSG00000171100	ENSG00000171100		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7448	protein-coding gene	gene with protein product		300415	"""myotubular myopathy 1"""				Standard	NM_000252		Approved		uc004fef.4	Q13496	OTTHUMG00000024158	ENST00000370396.2:c.807A>T	chrX.hg19:g.149814284A>T	ENSP00000359423:p.Lys269Asn	169.0	0.0		115.0	109.0	NM_000252	A6NDB1|B7Z491|F2Z330|Q8NEL1	Missense_Mutation	SNP	ENST00000370396.2	hg19	CCDS14694.1	.	.	.	.	.	.	.	.	.	.	A	11.55	1.670962	0.29693	.	.	ENSG00000171100	ENST00000370396;ENST00000542741;ENST00000543350;ENST00000413012	D;D;D;D	0.89810	-2.57;-2.57;-2.57;-2.57	5.93	2.3	0.28687	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.346500	0.33272	N	0.005087	T	0.79569	0.4468	N	0.26130	0.795	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.16722	0.016;0.012	T	0.69375	-0.5162	10	0.87932	D	0	.	5.5134	0.16894	0.5014:0.1438:0.3548:0.0	.	232;269	B7Z491;Q13496	.;MTM1_HUMAN	N	269;174;154;232	ENSP00000359423:K269N;ENSP00000444015:K174N;ENSP00000439784:K154N;ENSP00000389157:K232N	ENSP00000359423:K269N	K	+	3	2	MTM1	149564942	0.994000	0.37717	0.045000	0.18777	0.676000	0.39594	0.605000	0.24179	0.340000	0.23745	0.481000	0.45027	AAA	.	.		0.418	MTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060847.3	NM_000252	
DHX8	1659	hgsc.bcm.edu	37	17	41599464	41599471	+	Frame_Shift_Del	DEL	AAGGCCAT	AAGGCCAT	-			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	AAGGCCAT	AAGGCCAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr17:41599464_41599471delAAGGCCAT	ENST00000262415.3	+	22	3385_3392	c.3313_3320delAAGGCCAT	c.(3313-3321)aaggccatcfs	p.KAI1105fs	DHX8_ENST00000540306.1_Frame_Shift_Del_p.KAI1105fs	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	1105					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CCGAGTGCAGAAGGCCATCTGCAGTGGG	0.514																																					p.1104_1107del	NSCLC(56;1548 1661 49258 49987)	Atlas-INDEL	.											.	DHX8	98	.	0			c.3312_3319del						.																																			SO:0001589	frameshift_variant	1659	exon22			.	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.3313_3320delAAGGCCAT	chr17.hg19:g.41599464_41599471delAAGGCCAT	ENSP00000262415:p.Lys1105fs	147.0	0.0		104.0	28.0	NM_004941		Frame_Shift_Del	DEL	ENST00000262415.3	hg19	CCDS11464.1																																																																																			.	.		0.514	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		
FTCD	10841	hgsc.bcm.edu	37	21	47557204	47557205	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr21:47557204_47557205insA	ENST00000291670.5	-	13	1530_1531	c.1487_1488insT	c.(1486-1488)ttcfs	p.F496fs	FTCD_ENST00000397743.1_Frame_Shift_Ins_p.Q482fs|FTCD_ENST00000359679.2_Frame_Shift_Ins_p.F496fs|FTCD_ENST00000397748.1_Frame_Shift_Ins_p.F496fs|FTCD_ENST00000498355.2_5'UTR|FTCD_ENST00000397746.3_Frame_Shift_Ins_p.F496fs|FTCD_ENST00000355384.2_Frame_Shift_Ins_p.Q482fs	NM_006657.2	NP_006648.1	O95954	FTCD_HUMAN	formimidoyltransferase cyclodeaminase	496	Cyclodeaminase/cyclohydrolase. {ECO:0000250}.				cellular nitrogen compound metabolic process (GO:0034641)|cytoskeleton organization (GO:0007010)|folic acid-containing compound metabolic process (GO:0006760)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	folic acid binding (GO:0005542)|formimidoyltetrahydrofolate cyclodeaminase activity (GO:0030412)|glutamate formimidoyltransferase activity (GO:0030409)			endometrium(1)|large_intestine(2)|lung(9)|pancreas(1)|prostate(3)|skin(3)	19	Breast(49;0.214)			Colorectal(79;0.235)	Tetrahydrofolic acid(DB00116)	TGAGCACGTTGAAATATGCGCC	0.609																																					p.F496fs		Atlas-INDEL	.											.	FTCD	59	.	0			c.1488_1489insT						.																																			SO:0001589	frameshift_variant	10841	exon13			.	U91541	CCDS13731.1	21q22.3	2013-06-10	2013-06-10		ENSG00000160282	ENSG00000160282	2.1.2.5, 4.3.1.4		3974	protein-coding gene	gene with protein product		606806	"""formiminotransferase cyclodeaminase"""			10029623, 10773664	Standard	NM_006657		Approved		uc002zif.3	O95954	OTTHUMG00000090488	ENST00000291670.5:c.1488dupT	chr21.hg19:g.47557207_47557207dupA	ENSP00000291670:p.Phe496fs	44.0	0.0		42.0	32.0	NM_206965	B9EGD0|Q86V03|Q9HCT4|Q9HCT5|Q9HCT6|Q9UHJ2	Frame_Shift_Ins	INS	ENST00000291670.5	hg19	CCDS13731.1																																																																																			.	.		0.609	FTCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206962.1	NM_006657	
SHE	126669	hgsc.bcm.edu	37	1	154474168	154474206	+	In_Frame_Del	DEL	ATCAGACCCTGCAGGCTGTCGCGGGACAGCCGGCTGTCC	ATCAGACCCTGCAGGCTGTCGCGGGACAGCCGGCTGTCC	-	rs200876451		TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	ATCAGACCCTGCAGGCTGTCGCGGGACAGCCGGCTGTCC	ATCAGACCCTGCAGGCTGTCGCGGGACAGCCGGCTGTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr1:154474168_154474206delATCAGACCCTGCAGGCTGTCGCGGGACAGCCGGCTGTCC	ENST00000304760.2	-	1	383_421	c.297_335delGGACAGCCGGCTGTCCCGCGACAGCCTGCAGGGTCTGAT	c.(295-336)aaggacagccggctgtcccgcgacagcctgcagggtctgatt>aat	p.99_112KDSRLSRDSLQGLI>N	TDRD10_ENST00000368480.3_5'Flank|TDRD10_ENST00000368482.4_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	99										breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			GGCGGCCTGAATCAGACCCTGCAGGCTGTCGCGGGACAGCCGGCTGTCCTTGGGGCCGA	0.724																																					p.100_112del		Atlas-INDEL	.											.	SHE	41	.	0			c.298_336del						.																																			SO:0001651	inframe_deletion	126669	exon1			.	AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.297_335delGGACAGCCGGCTGTCCCGCGACAGCCTGCAGGGTCTGAT	chr1.hg19:g.154474168_154474206delATCAGACCCTGCAGGCTGTCGCGGGACAGCCGGCTGTCC	ENSP00000307369:p.Lys99_Ile112delinsAsn	39.0	0.0		48.0	12.0	NM_001010846	Q8TEQ5	In_Frame_Del	DEL	ENST00000304760.2	hg19	CCDS30877.1																																																																																			.	.		0.724	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087910.2	NM_001010846	
C19orf44	84167	hgsc.bcm.edu	37	19	16612008	16612009	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr19:16612008_16612009insT	ENST00000221671.3	+	2	561_562	c.405_406insT	c.(406-408)tctfs	p.S136fs	CTD-3222D19.2_ENST00000409035.1_Intron|C19orf44_ENST00000594035.1_Frame_Shift_Ins_p.S136fs	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	136										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						ACAGAATCCTCTCTGGGGGTGC	0.515																																					p.L135fs		Atlas-INDEL	.											.	C19orf44	47	.	0			c.405_406insT						.																																			SO:0001589	frameshift_variant	84167	exon2			.	AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.406dupT	chr19.hg19:g.16612009_16612009dupT	ENSP00000221671:p.Ser136fs	139.0	0.0		69.0	39.0	NM_032207	Q8N6Y7	Frame_Shift_Ins	INS	ENST00000221671.3	hg19	CCDS12345.1																																																																																			.	.		0.515	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000461218.1	NM_032207	
SCN2A	6326	hgsc.bcm.edu	37	2	166245957	166245957	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr2:166245957delG	ENST00000375437.2	+	27	5931	c.5641delG	c.(5641-5643)gagfs	p.E1881fs	SCN2A_ENST00000375427.2_Frame_Shift_Del_p.E1881fs|SCN2A_ENST00000283256.6_Frame_Shift_Del_p.E1881fs|SCN2A_ENST00000357398.3_Frame_Shift_Del_p.E1881fs	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1881					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACAGATGGAAGAGCGATTCAT	0.463																																					p.E1880fs		Atlas-INDEL	.											.	SCN2A	589	.	0			c.5640delA						.						109.0	95.0	100.0					2																	166245957		2203	4300	6503	SO:0001589	frameshift_variant	6326	exon27			.	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5641delG	chr2.hg19:g.166245957delG	ENSP00000364586:p.Glu1881fs	242.0	0.0		169.0	97.0	NM_001040142	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Frame_Shift_Del	DEL	ENST00000375437.2	hg19	CCDS33314.1																																																																																			.	.		0.463	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
KRT2	3849	hgsc.bcm.edu	37	12	53045638	53045639	+	In_Frame_Ins	INS	-	-	AAAGCCGCTGCCGCCTCC			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr12:53045638_53045639insAAAGCCGCTGCCGCCTCC	ENST00000309680.3	-	1	309_310	c.288_289insGGAGGCGGCAGCGGCTTT	c.(286-291)tttgga>tttGGAGGCGGCAGCGGCTTTgga	p.96_97FG>FGGGSGFG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	96	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		ctgccgcctccaaaaccacctc	0.619																																					p.G97delinsGGGSGFG		Atlas-INDEL	.											.	KRT2	94	.	0			c.289_290insGGAGGCGGCAGCGGCTTT						.																																			SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.288_289insGGAGGCGGCAGCGGCTTT	chr12.hg19:g.53045638_53045639insAAAGCCGCTGCCGCCTCC	ENSP00000310861:p.Phe96_Gly97insGlyGlyGlySerGlyPhe	171.0	0.0		160.0	59.0	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.		0.619	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
RNF145	153830	hgsc.bcm.edu	37	5	158603773	158603774	+	Frame_Shift_Ins	INS	-	-	CAAGG			TCGA-DD-AADD-01A-11D-A40R-10	TCGA-DD-AADD-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41b8300c-eab5-44a5-ab8f-03914a67343e	80263fcb-f4b4-4a2d-ac6c-cf1a471a48be	g.chr5:158603773_158603774insCAAGG	ENST00000424310.2	-	5	846_847	c.487_488insCCTTG	c.(487-489)gttfs	p.V163fs	RNF145_ENST00000521606.2_Frame_Shift_Ins_p.V180fs|RNF145_ENST00000519865.1_Frame_Shift_Ins_p.V163fs|RNF145_ENST00000274542.2_Frame_Shift_Ins_p.V191fs|RNF145_ENST00000520638.1_Frame_Shift_Ins_p.V177fs|RNF145_ENST00000518802.1_Frame_Shift_Ins_p.V193fs	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	163						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCCAAAGGAACAAGGCAGAGT	0.386																																					p.V193fs		Atlas-INDEL	.											.	RNF145	110	.	0			c.578_579insCCTTG						.																																			SO:0001589	frameshift_variant	153830	exon5			.	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.483_487dupCCTTG	chr5.hg19:g.158603774_158603778dupCAAGG	ENSP00000409064:p.Val163fs	485.0	0.0		294.0	160.0	NM_001199380	B7Z903|B7Z949|E7EVI7|Q8IVP7	Frame_Shift_Ins	INS	ENST00000424310.2	hg19	CCDS56390.1																																																																																			.	.		0.386	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
