#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LRRC38	126755	hgsc.bcm.edu	37	1	13839553	13839553	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:13839553C>A	ENST00000376085.3	-	1	990	c.536G>T	c.(535-537)cGc>cTc	p.R179L	RP4-597A16.2_ENST00000563570.1_RNA	NM_001010847.1	NP_001010847.1	Q5VT99	LRC38_HUMAN	leucine rich repeat containing 38	179					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											ACGCAGGGAGCGCAGCGCGGG	0.662																																					p.R179L		Atlas-SNP	.											LRRC38,colon,carcinoma,0,1	LRRC38	12	.	0			c.G536T						.																																			SO:0001583	missense	126755	exon1			AGGGAGCGCAGCG	BC016048	CCDS53269.1	1p36.21	2008-02-05			ENSG00000162494	ENSG00000162494			27005	protein-coding gene	gene with protein product		615212				12477932	Standard	NM_001010847		Approved		uc001avb.3	Q5VT99	OTTHUMG00000007918	ENST00000376085.3:c.536G>T	chr1.hg19:g.13839553C>A	ENSP00000365253:p.Arg179Leu	146.0	0.0		125.0	30.0	NM_001010847	Q96B32	Missense_Mutation	SNP	ENST00000376085.3	hg19	CCDS53269.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704828	0.68615	.	.	ENSG00000162494	ENST00000376085	T	0.61040	0.14	4.47	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.67031	0.2850	L	0.42245	1.32	0.80722	D	1	D	0.65815	0.995	D	0.66979	0.948	T	0.65463	-0.6162	10	0.33940	T	0.23	.	15.7218	0.77718	0.0:1.0:0.0:0.0	.	179	Q5VT99	LRC38_HUMAN	L	179	ENSP00000365253:R179L	ENSP00000365253:R179L	R	-	2	0	LRRC38	13712140	1.000000	0.71417	1.000000	0.80357	0.590000	0.36582	6.005000	0.70716	2.007000	0.58848	0.442000	0.29010	CGC	.	.		0.662	LRRC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021793.1		
NR0B2	8431	hgsc.bcm.edu	37	1	27238458	27238458	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:27238458G>C	ENST00000254227.3	-	2	677	c.652C>G	c.(652-654)Ctc>Gtc	p.L218V		NM_021969.2	NP_068804.1	Q15466	NR0B2_HUMAN	nuclear receptor subfamily 0, group B, member 2	218	Ligand-binding. {ECO:0000250}.				cholesterol metabolic process (GO:0008203)|gene expression (GO:0010467)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ regeneration (GO:0031100)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)			NS(1)|large_intestine(1)|lung(3)	5		all_cancers(24;1.23e-26)|all_epithelial(13;1.19e-23)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Breast(348;0.00017)|Renal(390;0.0007)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.01e-51)|OV - Ovarian serous cystadenocarcinoma(117;8.22e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		GCCGTGAGGAGGACACGGGTC	0.622																																					p.L218V		Atlas-SNP	.											.	NR0B2	14	.	0			c.C652G						.						132.0	132.0	132.0					1																	27238458		2203	4300	6503	SO:0001583	missense	8431	exon2			TGAGGAGGACACG	AF044316	CCDS291.1	1p36.1	2013-01-16			ENSG00000131910	ENSG00000131910		"""Nuclear hormone receptors"""	7961	protein-coding gene	gene with protein product		604630				9603951	Standard	NM_021969		Approved	SHP	uc001bnf.3	Q15466	OTTHUMG00000004231	ENST00000254227.3:c.652C>G	chr1.hg19:g.27238458G>C	ENSP00000254227:p.Leu218Val	227.0	0.0		194.0	66.0	NM_021969	F1D8P5|Q5QP36	Missense_Mutation	SNP	ENST00000254227.3	hg19	CCDS291.1	.	.	.	.	.	.	.	.	.	.	G	17.70	3.454253	0.63290	.	.	ENSG00000131910	ENST00000254227	D	0.98090	-4.71	6.04	6.04	0.98038	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.98868	0.9617	M	0.92691	3.335	0.58432	D	0.999997	D	0.89917	1.0	D	0.87578	0.998	D	0.99010	1.0814	10	0.66056	D	0.02	-9.9219	11.5227	0.50560	0.1202:0.0:0.8798:0.0	.	218	Q15466	NR0B2_HUMAN	V	218	ENSP00000254227:L218V	ENSP00000254227:L218V	L	-	1	0	NR0B2	27111045	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.169000	0.50809	2.873000	0.98535	0.561000	0.74099	CTC	.	.		0.622	NR0B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012185.1		
FLG	2312	hgsc.bcm.edu	37	1	152280880	152280880	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:152280880G>C	ENST00000368799.1	-	3	6517	c.6482C>G	c.(6481-6483)tCt>tGt	p.S2161C	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2161	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGAGTGTCCAGACCTATCTAC	0.567									Ichthyosis																												p.S2161C		Atlas-SNP	.											FLG,NS,carcinoma,0,1	FLG	900	.	0			c.C6482G						.						379.0	329.0	346.0					1																	152280880		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TGTCCAGACCTAT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.6482C>G	chr1.hg19:g.152280880G>C	ENSP00000357789:p.Ser2161Cys	132.0	0.0		128.0	37.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	g	5.167	0.216393	0.09810	.	.	ENSG00000143631	ENST00000368799	T	0.02280	4.36	2.53	2.53	0.30540	.	.	.	.	.	T	0.04815	0.0130	M	0.78049	2.395	0.09310	N	1	D	0.89917	1.0	D	0.65987	0.94	T	0.21999	-1.0229	9	0.87932	D	0	.	8.7315	0.34503	0.0:0.0:1.0:0.0	.	2161	P20930	FILA_HUMAN	C	2161	ENSP00000357789:S2161C	ENSP00000357789:S2161C	S	-	2	0	FLG	150547504	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.646000	0.24797	1.740000	0.51718	0.485000	0.47835	TCT	.	.		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLG2	388698	hgsc.bcm.edu	37	1	152326575	152326575	+	Silent	SNP	T	T	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:152326575T>A	ENST00000388718.5	-	3	3759	c.3687A>T	c.(3685-3687)ggA>ggT	p.G1229G	FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000445097.1_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1229	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAACTGTGGATCCTGACTCTA	0.483																																					p.G1229G		Atlas-SNP	.											.	FLG2	431	.	0			c.A3687T						.						178.0	171.0	173.0					1																	152326575		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			TGTGGATCCTGAC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3687A>T	chr1.hg19:g.152326575T>A		80.0	0.0		80.0	32.0	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	hg19	CCDS30861.1																																																																																			.	.		0.483	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
NTRK1	4914	hgsc.bcm.edu	37	1	156849081	156849081	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:156849081T>C	ENST00000524377.1	+	15	2014	c.1973T>C	c.(1972-1974)gTg>gCg	p.V658A	NTRK1_ENST00000368196.3_Missense_Mutation_p.V652A|NTRK1_ENST00000358660.3_Missense_Mutation_p.V655A|NTRK1_ENST00000392302.2_Missense_Mutation_p.V622A	NM_002529.3	NP_002520.2	P04629	NTRK1_HUMAN	neurotrophic tyrosine kinase, receptor, type 1	658	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|axon guidance (GO:0007411)|axonogenesis involved in innervation (GO:0060385)|B cell differentiation (GO:0030183)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to nicotine (GO:0071316)|circadian rhythm (GO:0007623)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|developmental programmed cell death (GO:0010623)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory nerve development (GO:0021553)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|response to activity (GO:0014823)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to ethanol (GO:0045471)|response to hydrostatic pressure (GO:0051599)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|Sertoli cell development (GO:0060009)|small GTPase mediated signal transduction (GO:0007264)|sympathetic nervous system development (GO:0048485)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome (GO:0005769)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(35)|ovary(8)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	74	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)				Amitriptyline(DB00321)|Imatinib(DB00619)|Regorafenib(DB08896)	AACTGTCTAGTGGGCCAGGGA	0.592			T	"""TPM3, TPR, TFG"""	papillary thyroid					TSP Lung(10;0.080)																											p.V658A		Atlas-SNP	.		Dom	yes		1	1q21-q22	4914	"""neurotrophic tyrosine kinase, receptor, type 1"""		E	.	NTRK1	287	.	0			c.T1973C						.						73.0	63.0	67.0					1																	156849081		2203	4300	6503	SO:0001583	missense	4914	exon15			GTCTAGTGGGCCA	Y09028	CCDS1161.1, CCDS30890.1, CCDS30891.1	1q21-q22	2014-09-17			ENSG00000198400	ENSG00000198400	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8031	protein-coding gene	gene with protein product	"""high affinity nerve growth factor receptor"""	191315				2869410	Standard	NM_001007792		Approved	TRK, TRKA, MTC	uc001fqh.1	P04629	OTTHUMG00000041304	ENST00000524377.1:c.1973T>C	chr1.hg19:g.156849081T>C	ENSP00000431418:p.Val658Ala	46.0	0.0		36.0	12.0	NM_002529	B2R6T5|B7ZM34|P08119|Q15655|Q15656|Q5D056|Q5VZS2|Q7Z5C3|Q9UIU7	Missense_Mutation	SNP	ENST00000524377.1	hg19	CCDS1161.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.390885	0.82902	.	.	ENSG00000198400	ENST00000392302;ENST00000368196;ENST00000524377;ENST00000358660	D;D;D;D	0.85773	-2.03;-2.03;-2.03;-2.03	4.37	4.37	0.52481	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.162238	0.29212	N	0.012817	D	0.92031	0.7475	M	0.91612	3.225	0.80722	D	1	D;D;B;D	0.67145	0.994;0.996;0.448;0.99	D;D;B;D	0.70935	0.971;0.969;0.393;0.931	D	0.93563	0.6897	10	0.87932	D	0	.	12.8118	0.57643	0.0:0.0:0.0:1.0	.	655;652;658;622	A8K3Z4;P04629-2;P04629;A6NF12	.;.;NTRK1_HUMAN;.	A	622;652;658;655	ENSP00000376120:V622A;ENSP00000357179:V652A;ENSP00000431418:V658A;ENSP00000351486:V655A	ENSP00000351486:V655A	V	+	2	0	NTRK1	155115705	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.783000	0.85696	1.968000	0.57251	0.459000	0.35465	GTG	.	.		0.592	NTRK1-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392279.1	NM_002529	
PTGS2	5743	hgsc.bcm.edu	37	1	186648486	186648486	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:186648486C>T	ENST00000367468.5	-	2	273	c.137G>A	c.(136-138)cGg>cAg	p.R46Q	RP5-973M2.2_ENST00000608917.1_lincRNA|PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	46	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	GAATCCTGTCCGGGTACAATC	0.438																																					p.R46Q		Atlas-SNP	.											PTGS2_ENST00000367468,bladder,carcinoma,0,2	PTGS2	144	.	0			c.G137A						.						135.0	114.0	121.0					1																	186648486		2203	4300	6503	SO:0001583	missense	5743	exon2			CCTGTCCGGGTAC	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.137G>A	chr1.hg19:g.186648486C>T	ENSP00000356438:p.Arg46Gln	134.0	1.0		140.0	47.0	NM_000963	A8K802|Q16876	Missense_Mutation	SNP	ENST00000367468.5	hg19	CCDS1371.1	.	.	.	.	.	.	.	.	.	.	C	35	5.542524	0.96474	.	.	ENSG00000073756	ENST00000367468	T	0.68624	-0.34	5.27	5.27	0.74061	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.050276	0.85682	D	0.000000	T	0.54615	0.1869	L	0.28556	0.865	0.58432	D	0.999997	P	0.44260	0.83	B	0.34385	0.181	T	0.63844	-0.6545	10	0.72032	D	0.01	-18.2304	18.5108	0.90916	0.0:1.0:0.0:0.0	.	46	P35354	PGH2_HUMAN	Q	46	ENSP00000356438:R46Q	ENSP00000356438:R46Q	R	-	2	0	PTGS2	184915109	0.959000	0.32827	0.967000	0.41034	0.992000	0.81027	4.712000	0.61888	2.444000	0.82710	0.655000	0.94253	CGG	.	.		0.438	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227381544	227381544	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:227381544T>C	ENST00000366769.3	-	5	1833	c.542A>G	c.(541-543)tAc>tGc	p.Y181C	CDC42BPA_ENST00000366766.2_Missense_Mutation_p.Y181C|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.Y181C|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.Y181C|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.Y181C|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.Y181C|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.Y181C	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CTCAGCCAAGTAAAATCTAGC	0.393																																					p.Y181C		Atlas-SNP	.											.	CDC42BPA	528	.	0			c.A542G						.						120.0	108.0	112.0					1																	227381544		2203	4300	6503	SO:0001583	missense	8476	exon5			GCCAAGTAAAATC	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.542A>G	chr1.hg19:g.227381544T>C	ENSP00000355731:p.Tyr181Cys	73.0	0.0		74.0	23.0	NM_003607		Missense_Mutation	SNP	ENST00000366769.3	hg19	CCDS1558.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.309914	0.81247	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.71091	0.3299	M	0.90922	3.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.79130	-0.1930	10	0.87932	D	0	.	14.4689	0.67501	0.0:0.0:0.0:1.0	.	181;181;181;181	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	C	181	ENSP00000355731:Y181C;ENSP00000355729:Y181C;ENSP00000335341:Y181C;ENSP00000355728:Y181C;ENSP00000355726:Y181C;ENSP00000443275:Y181C;ENSP00000355727:Y181C	ENSP00000335341:Y181C	Y	-	2	0	CDC42BPA	225448167	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.977000	0.88081	1.825000	0.53177	0.460000	0.39030	TAC	.	.		0.393	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
KIAA1804	84451	hgsc.bcm.edu	37	1	233518139	233518139	+	Silent	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:233518139C>T	ENST00000366624.3	+	10	3054	c.2793C>T	c.(2791-2793)gtC>gtT	p.V931V	MLK4_ENST00000366622.1_Silent_p.V377V	NM_032435.2	NP_115811.2																					CAAGGGAGGTCTCACCCAAGA	0.587																																					p.V931V		Atlas-SNP	.											.	KIAA1804	129	.	0			c.C2793T						.						104.0	92.0	96.0					1																	233518139		2203	4300	6503	SO:0001819	synonymous_variant	0	exon10			GGAGGTCTCACCC																												ENST00000366624.3:c.2793C>T	chr1.hg19:g.233518139C>T		102.0	0.0		113.0	32.0	NM_032435		Silent	SNP	ENST00000366624.3	hg19	CCDS1598.1																																																																																			.	.		0.587	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092495.1		
HEATR5B	54497	hgsc.bcm.edu	37	2	37283648	37283648	+	Silent	SNP	G	G	A	rs200961568		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:37283648G>A	ENST00000233099.5	-	16	2429	c.2334C>T	c.(2332-2334)gtC>gtT	p.V778V	HEATR5B_ENST00000354531.2_Silent_p.V778V	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	778						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				CAATGACTGAGACTCCGAGAG	0.448																																					p.V778V		Atlas-SNP	.											.	HEATR5B	185	.	0			c.C2334T						.						94.0	101.0	99.0					2																	37283648		2203	4300	6503	SO:0001819	synonymous_variant	54497	exon16			GACTGAGACTCCG	AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2334C>T	chr2.hg19:g.37283648G>A		529.0	0.0		488.0	150.0	NM_019024	B5MDU8|Q7Z3B2|Q9NVL7	Silent	SNP	ENST00000233099.5	hg19	CCDS33181.1																																																																																			.	G|0.999;C|0.001		0.448	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325492.1	NM_019024	
SMEK2	57223	hgsc.bcm.edu	37	2	55826140	55826140	+	Silent	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:55826140C>T	ENST00000345102.5	-	4	634	c.333G>A	c.(331-333)caG>caA	p.Q111Q	SMEK2_ENST00000407823.3_Silent_p.Q111Q|SMEK2_ENST00000272313.5_Silent_p.Q111Q	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	111					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CAATGAGGTCCTGTGTGACTT	0.348																																					p.Q111Q		Atlas-SNP	.											.	SMEK2	86	.	0			c.G333A						.						116.0	125.0	122.0					2																	55826140		2203	4300	6503	SO:0001819	synonymous_variant	57223	exon4			GAGGTCCTGTGTG	AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.333G>A	chr2.hg19:g.55826140C>T		44.0	0.0		43.0	11.0	NM_001122964	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Silent	SNP	ENST00000345102.5	hg19	CCDS46289.1																																																																																			.	.		0.348	SMEK2-002	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251483.1	NM_020463	
PROKR1	10887	hgsc.bcm.edu	37	2	68882356	68882356	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:68882356G>T	ENST00000303786.3	+	3	1250	c.830G>T	c.(829-831)cGc>cTc	p.R277L	PROKR1_ENST00000394342.2_Missense_Mutation_p.R277L			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	277					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						AAGAGGCTGCGCTGCCGCAGG	0.622																																					p.R277L		Atlas-SNP	.											.	PROKR1	69	.	0			c.G830T						.						73.0	63.0	67.0					2																	68882356		2203	4300	6503	SO:0001583	missense	10887	exon2			GGCTGCGCTGCCG	AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.830G>T	chr2.hg19:g.68882356G>T	ENSP00000303775:p.Arg277Leu	76.0	0.0		94.0	32.0	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	ENST00000303786.3	hg19	CCDS1889.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.528070	0.85706	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.41758	0.99;0.99	4.55	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.57755	0.2075	M	0.71036	2.16	0.80722	D	1	P	0.43701	0.815	P	0.53760	0.734	T	0.61083	-0.7134	10	0.72032	D	0.01	.	15.6333	0.76929	0.0:0.0:1.0:0.0	.	277	Q8TCW9	PKR1_HUMAN	L	277	ENSP00000303775:R277L;ENSP00000377874:R277L	ENSP00000303775:R277L	R	+	2	0	PROKR1	68735860	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.091000	0.71406	2.816000	0.96949	0.563000	0.77884	CGC	.	.		0.622	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
TSGA10	80705	hgsc.bcm.edu	37	2	99767090	99767090	+	Intron	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:99767090T>C	ENST00000393483.3	-	1	225				C2ORF15_ENST00000409684.1_Silent_p.D57D|C2ORF15_ENST00000302513.2_Silent_p.D57D	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10						cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						AAGTGGATGATCACTTAATAC	0.348																																					p.D57D		Atlas-SNP	.											.	C2orf15	11	.	0			c.T171C						.						72.0	72.0	72.0					2																	99767090		2203	4300	6503	SO:0001627	intron_variant	150590	exon4			GGATGATCACTTA	AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.619+4065A>G	chr2.hg19:g.99767090T>C		269.0	0.0		238.0	84.0	NM_144706	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Silent	SNP	ENST00000393483.3	hg19	CCDS2037.1																																																																																			.	.		0.348	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253125.1	NM_182911	
SLC9A2	6549	hgsc.bcm.edu	37	2	103300708	103300708	+	Silent	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:103300708G>T	ENST00000233969.2	+	5	1480	c.1338G>T	c.(1336-1338)gtG>gtT	p.V446V		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	446					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						TTGCGTTAGTGTTTCTCCTTC	0.438																																					p.V446V		Atlas-SNP	.											.	SLC9A2	112	.	0			c.G1338T						.						292.0	266.0	275.0					2																	103300708		2203	4300	6503	SO:0001819	synonymous_variant	6549	exon5			GTTAGTGTTTCTC		CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.1338G>T	chr2.hg19:g.103300708G>T		114.0	0.0		120.0	43.0	NM_003048	B2RMS2	Silent	SNP	ENST00000233969.2	hg19	CCDS2062.1																																																																																			.	.		0.438	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253292.2		
EPB41L5	57669	hgsc.bcm.edu	37	2	120836088	120836088	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:120836088A>T	ENST00000263713.5	+	10	948	c.734A>T	c.(733-735)tAt>tTt	p.Y245F	EPB41L5_ENST00000452780.1_Missense_Mutation_p.Y245F|EPB41L5_ENST00000331393.4_Missense_Mutation_p.Y245F|EPB41L5_ENST00000443124.1_Missense_Mutation_p.Y245F|EPB41L5_ENST00000443902.2_Missense_Mutation_p.Y245F	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	245	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						GGGAATGACTATAGTTTGGGA	0.323																																					p.Y245F		Atlas-SNP	.											.	EPB41L5	98	.	0			c.A734T						.						117.0	115.0	115.0					2																	120836088		2203	4299	6502	SO:0001583	missense	57669	exon10			ATGACTATAGTTT	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.734A>T	chr2.hg19:g.120836088A>T	ENSP00000263713:p.Tyr245Phe	105.0	0.0		109.0	34.0	NM_020909	Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	ENST00000263713.5	hg19	CCDS2130.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.361465	0.82353	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17	4.83	4.83	0.62350	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.64402	D	0.000001	D	0.94486	0.8225	M	0.90922	3.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.991;0.999;0.994;0.999	D	0.95323	0.8422	10	0.59425	D	0.04	.	14.3669	0.66812	1.0:0.0:0.0:0.0	.	245;245;245;245	Q9HCM4-3;Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;.;E41L5_HUMAN	F	245	ENSP00000263713:Y245F;ENSP00000393856:Y245F;ENSP00000329687:Y245F;ENSP00000393722:Y245F;ENSP00000390439:Y245F	ENSP00000263713:Y245F	Y	+	2	0	EPB41L5	120552558	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	8.619000	0.90938	1.946000	0.56461	0.459000	0.35465	TAT	.	.		0.323	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
ERMN	57471	hgsc.bcm.edu	37	2	158178164	158178164	+	Silent	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:158178164T>C	ENST00000410096.1	-	3	765	c.474A>G	c.(472-474)gaA>gaG	p.E158E	ERMN_ENST00000397283.2_Silent_p.E171E|ERMN_ENST00000535935.1_Silent_p.E52E|ERMN_ENST00000420719.2_Silent_p.E138E	NM_020711.1	NP_065762.1	Q8TAM6	ERMIN_HUMAN	ermin, ERM-like protein	158					actin filament organization (GO:0007015)|morphogenesis of a branching structure (GO:0001763)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|internode region of axon (GO:0033269)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|paranode region of axon (GO:0033270)				endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12						ATCCCAGCCATTCAATTTCAG	0.428																																					p.E171E		Atlas-SNP	.											.	ERMN	31	.	0			c.A513G						.						180.0	169.0	172.0					2																	158178164		1928	4130	6058	SO:0001819	synonymous_variant	57471	exon4			CAGCCATTCAATT	AB033015	CCDS42764.1, CCDS46431.1	2q24	2008-02-05	2008-01-15	2008-01-15	ENSG00000136541	ENSG00000136541			29208	protein-coding gene	gene with protein product	"""juxtanodin"", ""ermin"""	610072	"""KIAA1189"""	KIAA1189		16051705, 16421295	Standard	NM_020711		Approved	JN, ERMIN	uc002tzi.3	Q8TAM6	OTTHUMG00000153843	ENST00000410096.1:c.474A>G	chr2.hg19:g.158178164T>C		94.0	0.0		91.0	28.0	NM_001009959	B4DKA6|Q9ULN1	Silent	SNP	ENST00000410096.1	hg19	CCDS46431.1																																																																																			.	.		0.428	ERMN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332659.1	NM_001009959	
DOCK10	55619	hgsc.bcm.edu	37	2	225679061	225679061	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:225679061A>G	ENST00000258390.7	-	31	3452	c.3385T>C	c.(3385-3387)Tcg>Ccg	p.S1129P	DOCK10_ENST00000409592.3_Missense_Mutation_p.S1123P	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1129					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		TCTTGAGTCGATTCTGAAGGT	0.294																																					p.S1129P		Atlas-SNP	.											.	DOCK10	308	.	0			c.T3385C						.						30.0	28.0	29.0					2																	225679061		1500	3326	4826	SO:0001583	missense	55619	exon31			GAGTCGATTCTGA	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3385T>C	chr2.hg19:g.225679061A>G	ENSP00000258390:p.Ser1129Pro	33.0	0.0		33.0	11.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	hg19	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.618675	0.28801	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.23950	1.88;1.88	5.87	3.43	0.39272	.	0.294855	0.32819	N	0.005606	T	0.27866	0.0686	M	0.62723	1.935	0.32573	N	0.529494	B;B	0.31730	0.337;0.337	B;B	0.32289	0.143;0.1	T	0.33904	-0.9850	10	0.59425	D	0.04	.	12.3596	0.55194	0.7353:0.2647:0.0:0.0	.	1129;1123	Q96BY6;B3FL70	DOC10_HUMAN;.	P	1123;1129	ENSP00000386694:S1123P;ENSP00000258390:S1129P	ENSP00000258390:S1129P	S	-	1	0	DOCK10	225387305	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	6.129000	0.71657	0.444000	0.26612	-1.236000	0.01555	TCG	.	.		0.294	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
SLC19A3	80704	hgsc.bcm.edu	37	2	228552226	228552226	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:228552226T>C	ENST00000258403.3	-	6	1449	c.1378A>G	c.(1378-1380)Att>Gtt	p.I460V	SLC19A3_ENST00000409287.1_Intron|SLC19A3_ENST00000541617.1_Missense_Mutation_p.I456V	NM_025243.3	NP_079519.1	Q9BZV2	S19A3_HUMAN	solute carrier family 19 (thiamine transporter), member 3	460					small molecule metabolic process (GO:0044281)|thiamine transmembrane transport (GO:0071934)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	thiamine uptake transmembrane transporter activity (GO:0015403)			breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(5)|lung(8)|ovary(2)|skin(3)	30		Renal(207;0.0112)|all_lung(227;0.0335)|Lung NSC(271;0.142)|all_hematologic(139;0.21)|Esophageal squamous(248;0.236)		Epithelial(121;1.58e-10)|all cancers(144;8.55e-08)|Lung(261;0.00948)|LUSC - Lung squamous cell carcinoma(224;0.0125)	L-Cysteine(DB00151)	GAGTAGGTAATATACATGCTT	0.373																																					p.I460V		Atlas-SNP	.											.	SLC19A3	62	.	0			c.A1378G						.						143.0	142.0	142.0					2																	228552226		2203	4300	6503	SO:0001583	missense	80704	exon6			AGGTAATATACAT	AF271633	CCDS2468.1	2q37	2013-07-18	2013-07-18		ENSG00000135917	ENSG00000135917		"""Solute carriers"""	16266	protein-coding gene	gene with protein product	"""thiamine transporter 2"""	606152	"""solute carrier family 19, member 3"""			11136550, 15871139	Standard	XM_005246871		Approved	THTR2	uc002vpi.3	Q9BZV2	OTTHUMG00000133185	ENST00000258403.3:c.1378A>G	chr2.hg19:g.228552226T>C	ENSP00000258403:p.Ile460Val	93.0	0.0		91.0	28.0	NM_025243		Missense_Mutation	SNP	ENST00000258403.3	hg19	CCDS2468.1	.	.	.	.	.	.	.	.	.	.	T	6.005	0.369356	0.11352	.	.	ENSG00000135917	ENST00000258403;ENST00000541617	D;D	0.85773	-2.0;-2.03	5.65	3.29	0.37713	Major facilitator superfamily domain, general substrate transporter (1);	0.340782	0.30602	N	0.009279	T	0.79058	0.4382	L	0.60957	1.885	0.19300	N	0.999976	P;B	0.34615	0.459;0.059	B;B	0.30943	0.122;0.028	T	0.64588	-0.6372	10	0.27082	T	0.32	-16.8892	9.6299	0.39774	0.0:0.1405:0.0:0.8595	.	456;460	F5H2M8;Q9BZV2	.;S19A3_HUMAN	V	460;456	ENSP00000258403:I460V;ENSP00000445519:I456V	ENSP00000258403:I460V	I	-	1	0	SLC19A3	228260470	0.280000	0.24249	0.291000	0.24904	0.094000	0.18550	1.439000	0.35013	0.443000	0.26582	0.459000	0.35465	ATT	.	.		0.373	SLC19A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256894.1		
NMUR1	10316	hgsc.bcm.edu	37	2	232390063	232390063	+	Silent	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:232390063T>C	ENST00000305141.4	-	3	1105	c.972A>G	c.(970-972)tcA>tcG	p.S324S		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	324					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CTGTCCACTGTGACACGACGC	0.637																																					p.S324S		Atlas-SNP	.											.	NMUR1	46	.	0			c.A972G						.						69.0	57.0	61.0					2																	232390063		2203	4300	6503	SO:0001819	synonymous_variant	10316	exon3			CCACTGTGACACG	AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.972A>G	chr2.hg19:g.232390063T>C		198.0	0.0		202.0	70.0	NM_006056	O43664|Q7LDP6|Q8NE20	Silent	SNP	ENST00000305141.4	hg19	CCDS2486.1																																																																																			.	.		0.637	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256961.1	NM_006056	
SETMAR	6419	hgsc.bcm.edu	37	3	4358293	4358293	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:4358293T>G	ENST00000358065.4	+	3	1485	c.1418T>G	c.(1417-1419)tTt>tGt	p.F473C	SETMAR_ENST00000425863.1_Missense_Mutation_p.F334C|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	473	Mariner transposase Hsmar1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		aatcgtcgttttgaagtgtca	0.413								Chromatin Structure																													p.F473C		Atlas-SNP	.											.	SETMAR	30	.	0			c.T1418G						.						10.0	10.0	10.0					3																	4358293		2065	3990	6055	SO:0001583	missense	6419	exon3			GTCGTTTTGAAGT	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.1418T>G	chr3.hg19:g.4358293T>G	ENSP00000373354:p.Phe473Cys	107.0	0.0		95.0	36.0	NM_006515	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	hg19	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	T	12.64	1.998926	0.35226	.	.	ENSG00000170364	ENST00000358065;ENST00000425863	T;T	0.35421	1.31;1.31	0.235	0.235	0.15431	Transposase, Tc1-like (1);	1.472990	0.04916	U	0.454141	T	0.56470	0.1987	M	0.71036	2.16	0.22701	N	0.998836	D;D;P;D	0.89917	0.999;1.0;0.94;1.0	D;D;D;D	0.79108	0.96;0.992;0.926;0.979	T	0.38200	-0.9672	9	0.44086	T	0.13	.	.	.	.	.	217;334;460;218	B4DND2;E7EN68;Q53H47;Q96H41	.;.;SETMR_HUMAN;.	C	473;334	ENSP00000373354:F473C;ENSP00000403145:F334C	ENSP00000373354:F473C	F	+	2	0	SETMAR	4333293	0.945000	0.32115	0.951000	0.38953	0.951000	0.60555	0.310000	0.19356	0.263000	0.21812	0.260000	0.18958	TTT	.	.		0.413	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515	
SETMAR	6419	hgsc.bcm.edu	37	3	4358307	4358307	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:4358307T>G	ENST00000358065.4	+	3	1499	c.1432T>G	c.(1432-1434)Tct>Gct	p.S478A	SETMAR_ENST00000425863.1_Missense_Mutation_p.S339A|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	478	Mariner transposase Hsmar1.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		agtgtcatcttctcttattct	0.418								Chromatin Structure																													p.S478A		Atlas-SNP	.											.	SETMAR	30	.	0			c.T1432G						.						11.0	11.0	11.0					3																	4358307		1999	3813	5812	SO:0001583	missense	6419	exon3			TCATCTTCTCTTA	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.1432T>G	chr3.hg19:g.4358307T>G	ENSP00000373354:p.Ser478Ala	112.0	0.0		88.0	35.0	NM_006515	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	hg19	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	T	12.40	1.927317	0.34002	.	.	ENSG00000170364	ENST00000358065;ENST00000425863	T;T	0.31247	1.5;1.5	0.235	0.235	0.15431	.	0.081888	0.49305	U	0.000146	T	0.30198	0.0757	L	0.48174	1.505	0.09310	N	0.999992	P;P;B;D	0.59357	0.656;0.793;0.259;0.985	B;P;B;P	0.55749	0.358;0.74;0.299;0.783	T	0.27088	-1.0084	9	0.07813	T	0.8	.	.	.	.	.	222;339;465;223	B4DND2;E7EN68;Q53H47;Q96H41	.;.;SETMR_HUMAN;.	A	478;339	ENSP00000373354:S478A;ENSP00000403145:S339A	ENSP00000373354:S478A	S	+	1	0	SETMAR	4333307	0.503000	0.26115	0.810000	0.32431	0.811000	0.45836	0.310000	0.19356	0.263000	0.21812	0.260000	0.18958	TCT	.	.		0.418	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515	
METTL6	131965	hgsc.bcm.edu	37	3	15466502	15466502	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:15466502T>C	ENST00000443029.1	-	3	560	c.320A>G	c.(319-321)tAt>tGt	p.Y107C	EAF1_ENST00000432764.2_5'Flank|METTL6_ENST00000383790.3_Missense_Mutation_p.Y107C|METTL6_ENST00000383789.5_Missense_Mutation_p.Y107C|EAF1_ENST00000396842.2_5'Flank|METTL6_ENST00000450816.2_Intron			Q8TCB7	METL6_HUMAN	methyltransferase like 6	107							methyltransferase activity (GO:0008168)			endometrium(1)|kidney(1)|large_intestine(9)|lung(3)|prostate(1)	15						ATCACAGGCATAGGCAAAGAT	0.403																																					p.Y107C		Atlas-SNP	.											.	METTL6	27	.	0			c.A320G						.						115.0	107.0	109.0					3																	15466502		1879	4105	5984	SO:0001583	missense	131965	exon3			CAGGCATAGGCAA	AK057791	CCDS43056.1	3p25.1	2005-11-02			ENSG00000206562	ENSG00000206562			28343	protein-coding gene	gene with protein product						12477932	Standard	NM_152396		Approved	MGC24132	uc003bzs.1	Q8TCB7	OTTHUMG00000156431	ENST00000443029.1:c.320A>G	chr3.hg19:g.15466502T>C	ENSP00000407613:p.Tyr107Cys	244.0	0.0		249.0	78.0	NM_152396	Q96LU4	Missense_Mutation	SNP	ENST00000443029.1	hg19	CCDS43056.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.347938	0.82022	.	.	ENSG00000206562	ENST00000383790;ENST00000453819;ENST00000383789	T;T;T	0.69561	-0.41;3.7;-0.41	5.74	5.74	0.90152	Methyltransferase type 12 (1);	0.000000	0.85682	D	0.000000	D	0.87079	0.6088	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75484	0.973;0.986	D	0.90913	0.4777	10	0.87932	D	0	-20.2951	15.6946	0.77484	0.0:0.0:0.0:1.0	.	107;107	Q8TCB7-2;Q8TCB7	.;METL6_HUMAN	C	107;14;107	ENSP00000373300:Y107C;ENSP00000412006:Y14C;ENSP00000373299:Y107C	ENSP00000373299:Y107C	Y	-	2	0	METTL6	15441506	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.942000	0.87708	2.186000	0.69663	0.460000	0.39030	TAT	.	.		0.403	METTL6-007	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346373.1	NM_152396	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266100	41266100	+	Missense_Mutation	SNP	T	T	C	rs121913416		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:41266100T>C	ENST00000349496.5	+	3	377	c.97T>C	c.(97-99)Tct>Cct	p.S33P	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCA	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1,1	CTNNB1	4904	.	212	Deletion - In frame(115)|Substitution - Missense(70)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	liver(130)|large_intestine(20)|endometrium(14)|stomach(10)|pituitary(9)|pancreas(9)|central_nervous_system(8)|adrenal_gland(2)|small_intestine(2)|biliary_tract(2)|skin(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|breast(1)	c.T97C						.						93.0	77.0	82.0					3																	41266100		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGACTCTGGAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.97T>C	chr3.hg19:g.41266100T>C	ENSP00000344456:p.Ser33Pro	118.0	0.0		130.0	39.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395782	0.83011	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74509	-0.3642	10	0.87932	D	0	-10.7796	16.0677	0.80897	0.0:0.0:0.0:1.0	.	33	P35222	CTNB1_HUMAN	P	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26P;ENSP00000385604:S33P;ENSP00000412219:S33P;ENSP00000379486:S33P;ENSP00000344456:S33P;ENSP00000411226:S26P;ENSP00000379488:S33P;ENSP00000409302:S33P;ENSP00000401599:S33P	ENSP00000344456:S33P	S	+	1	0	CTNNB1	41241104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266137	41266137	+	Missense_Mutation	SNP	C	C	A	rs121913409		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:41266137C>A	ENST00000349496.5	+	3	414	c.134C>A	c.(133-135)tCt>tAt	p.S45Y	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45Y|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45F(384)|p.S45del(53)|p.A5_A80del(53)|p.S45C(19)|p.S45Y(17)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.S45_S47>C(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.S45fs*2(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACAGCTCCTTCTCTGAGTGGT	0.498	S45F(HCC15_LUNG)|S45F(LS180_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45Y	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+1,2	CTNNB1	4904	.	601	Substitution - Missense(421)|Deletion - In frame(152)|Complex - deletion inframe(20)|Unknown(7)|Deletion - Frameshift(1)	soft_tissue(233)|liver(141)|large_intestine(85)|kidney(74)|endometrium(16)|skin(11)|adrenal_gland(9)|stomach(7)|biliary_tract(5)|ovary(4)|lung(3)|central_nervous_system(2)|cervix(2)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(1)|pituitary(1)|prostate(1)|bone(1)|pancreas(1)	c.C134A						.						84.0	74.0	77.0					3																	41266137		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTCCTTCTCTGAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.134C>A	chr3.hg19:g.41266137C>A	ENSP00000344456:p.Ser45Tyr	102.0	0.0		115.0	45.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519229	0.85495	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	M	0.65677	2.01	0.80722	D	1	D	0.76494	0.999	D	0.67231	0.95	T	0.69320	-0.5176	10	0.87932	D	0	-13.6823	20.2983	0.98569	0.0:1.0:0.0:0.0	.	45	P35222	CTNB1_HUMAN	Y	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38Y;ENSP00000385604:S45Y;ENSP00000412219:S45Y;ENSP00000379486:S45Y;ENSP00000344456:S45Y;ENSP00000411226:S38Y;ENSP00000379488:S45Y;ENSP00000409302:S45Y;ENSP00000401599:S45Y	ENSP00000344456:S45Y	S	+	2	0	CTNNB1	41241141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
FAM19A1	407738	hgsc.bcm.edu	37	3	68588000	68588000	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:68588000G>T	ENST00000478136.1	+	4	843	c.353G>T	c.(352-354)tGc>tTc	p.C118F	FAM19A1_ENST00000496687.1_Missense_Mutation_p.C118F	NM_213609.3	NP_998774.2	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A1	118						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	7		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		GGATGGATGTGCGCAACAGGC	0.428																																					p.C118F		Atlas-SNP	.											.	FAM19A1	58	.	0			c.G353T						.						131.0	130.0	130.0					3																	68588000		1977	4168	6145	SO:0001583	missense	407738	exon4			GGATGTGCGCAAC	AY325114	CCDS54606.1	3p14.1	2005-01-20			ENSG00000183662	ENSG00000183662			21587	protein-coding gene	gene with protein product						15028294	Standard	NM_213609		Approved	TAFA-1	uc003dnd.3	Q7Z5A9	OTTHUMG00000158745	ENST00000478136.1:c.353G>T	chr3.hg19:g.68588000G>T	ENSP00000418575:p.Cys118Phe	169.0	0.0		167.0	57.0	NM_213609	A8K0V3|Q8TCL8	Missense_Mutation	SNP	ENST00000478136.1	hg19	CCDS54606.1	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501011	0.85176	.	.	ENSG00000183662	ENST00000478136;ENST00000496687	.	.	.	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.83285	0.5221	M	0.80183	2.485	0.52099	D	0.999945	D	0.69078	0.997	D	0.81914	0.995	D	0.85460	0.1166	9	0.87932	D	0	.	19.1554	0.93507	0.0:0.0:1.0:0.0	.	118	Q7Z5A9	F19A1_HUMAN	F	118	.	ENSP00000418575:C118F	C	+	2	0	FAM19A1	68670690	1.000000	0.71417	0.971000	0.41717	0.889000	0.51656	9.690000	0.98676	2.591000	0.87537	0.650000	0.86243	TGC	.	.		0.428	FAM19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352004.1	NM_213609	
ALG3	10195	hgsc.bcm.edu	37	3	183959370	183959370	+	IGR	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:183959370G>A	ENST00000397676.3	-	0	1528				EIF2B5_ENST00000444495.1_Intron|MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000426955.2_Silent_p.S1091S|ALG3_ENST00000463495.1_5'Flank|VWA5B2_ENST00000273794.5_Silent_p.S873S	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GCCGTGCCTCGCCCTTTGCCG	0.711																																					p.S1091S		Atlas-SNP	.											.	VWA5B2	47	.	0			c.G3273A						.						10.0	12.0	11.0					3																	183959370		690	1590	2280	SO:0001628	intergenic_variant	90113	exon19			TGCCTCGCCCTTT	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		chr3.hg19:g.183959370G>A		54.0	0.0		63.0	25.0	NM_138345	A8JZZ6|Q9BT71	Silent	SNP	ENST00000397676.3	hg19	CCDS46968.1																																																																																			.	.		0.711	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
DLG1	1739	hgsc.bcm.edu	37	3	196921381	196921381	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:196921381T>G	ENST00000419354.1	-	5	684	c.398A>C	c.(397-399)gAa>gCa	p.E133A	DLG1_ENST00000357674.4_Missense_Mutation_p.E133A|DLG1_ENST00000314062.3_Missense_Mutation_p.E133A|DLG1_ENST00000392382.2_Missense_Mutation_p.E133A|DLG1_ENST00000422288.1_Missense_Mutation_p.E133A|DLG1_ENST00000485409.1_5'UTR|DLG1_ENST00000450955.1_Missense_Mutation_p.E133A|DLG1_ENST00000448528.2_Missense_Mutation_p.E133A|DLG1_ENST00000346964.2_Missense_Mutation_p.E133A			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	133					actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		ATGAACCAATTCTGGACCTAT	0.353																																					p.E133A		Atlas-SNP	.											.	DLG1	120	.	0			c.A398C						.						147.0	142.0	144.0					3																	196921381		2203	4299	6502	SO:0001583	missense	1739	exon5			ACCAATTCTGGAC	U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.398A>C	chr3.hg19:g.196921381T>G	ENSP00000407531:p.Glu133Ala	82.0	0.0		78.0	32.0	NM_001204386	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	ENST00000419354.1	hg19	CCDS43194.1	.	.	.	.	.	.	.	.	.	.	T	15.41	2.826674	0.50739	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000422288;ENST00000448528;ENST00000392382;ENST00000450955;ENST00000453607;ENST00000456699;ENST00000392380;ENST00000419553	T;T;T;T;T;T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6;0.6	5.67	5.67	0.87782	Membrane-associated guanylate kinase (MAGUK), PEST domain, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70527	0.3234	M	0.72118	2.19	0.58432	D	0.999999	D;D;B;D	0.76494	0.98;0.999;0.277;0.999	P;D;B;D	0.87578	0.842;0.998;0.179;0.998	T	0.69091	-0.5237	10	0.32370	T	0.25	.	15.1003	0.72269	0.0:0.0:0.0:1.0	.	133;133;133;133	Q12959-4;Q12959-3;Q12959;Q12959-2	.;.;DLG1_HUMAN;.	A	133;133;133;133;133;133;133;133;133;133;37;133;133;133	ENSP00000345731:E133A;ENSP00000350303:E133A;ENSP00000321087:E133A;ENSP00000407531:E133A;ENSP00000413238:E133A;ENSP00000391732:E133A;ENSP00000376187:E133A;ENSP00000411278:E133A;ENSP00000412579:E37A;ENSP00000396474:E133A;ENSP00000376185:E133A;ENSP00000414189:E133A	ENSP00000321087:E133A	E	-	2	0	DLG1	198405778	1.000000	0.71417	0.127000	0.21898	0.009000	0.06853	7.679000	0.84048	2.164000	0.68074	0.533000	0.62120	GAA	.	.		0.353	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258170.2	NM_004087	
WHSC1	7468	hgsc.bcm.edu	37	4	1952825	1952825	+	Silent	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr4:1952825C>T	ENST00000382895.3	+	12	2339	c.1908C>T	c.(1906-1908)ccC>ccT	p.P636P	WHSC1_ENST00000382888.3_5'Flank|WHSC1_ENST00000382892.2_Silent_p.P636P|WHSC1_ENST00000382891.5_Silent_p.P636P|WHSC1_ENST00000482415.2_3'UTR|WHSC1_ENST00000508803.1_Silent_p.P636P	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	636					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		GAGACGAGCCCTCGGAGTCCC	0.547			T	IGH@	MM																																p.P636P		Atlas-SNP	.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1	180	.	0			c.C1908T						.						85.0	77.0	80.0					4																	1952825		2203	4300	6503	SO:0001819	synonymous_variant	7468	exon10			CGAGCCCTCGGAG	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1908C>T	chr4.hg19:g.1952825C>T		76.0	0.0		64.0	14.0	NM_133335	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Silent	SNP	ENST00000382895.3	hg19	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	C	8.942	0.966064	0.18659	.	.	ENSG00000109685	ENST00000514329	.	.	.	5.77	0.0947	0.14482	.	.	.	.	.	T	0.42086	0.1187	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.23904	-1.0175	4	.	.	.	.	1.7661	0.03002	0.2998:0.3827:0.0995:0.218	.	.	.	.	F	49	.	.	L	+	1	0	WHSC1	1922623	0.013000	0.17824	0.693000	0.30195	0.759000	0.43091	-0.601000	0.05687	0.032000	0.15435	-0.345000	0.07892	CTC	.	.		0.547	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
EVC	2121	hgsc.bcm.edu	37	4	5812081	5812081	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr4:5812081C>T	ENST00000264956.6	+	20	2982	c.2798C>T	c.(2797-2799)aCt>aTt	p.T933I	EVC_ENST00000382674.2_Missense_Mutation_p.T933I	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	933					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				CCCCTAAGGACTAAAAGGAAG	0.562																																					p.T933I		Atlas-SNP	.											.	EVC	90	.	0			c.C2798T						.						41.0	46.0	45.0					4																	5812081		2203	4300	6503	SO:0001583	missense	2121	exon20			TAAGGACTAAAAG	AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2798C>T	chr4.hg19:g.5812081C>T	ENSP00000264956:p.Thr933Ile	210.0	0.0		173.0	60.0	NM_153717		Missense_Mutation	SNP	ENST00000264956.6	hg19	CCDS3383.1	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428920	0.43122	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.56444	0.46;0.46	4.91	2.99	0.34606	.	0.372093	0.21696	N	0.070483	T	0.54208	0.1844	L	0.54323	1.7	0.80722	D	1	D	0.58268	0.982	P	0.54924	0.764	T	0.51702	-0.8672	10	0.38643	T	0.18	.	6.5505	0.22431	0.2178:0.5993:0.1829:0.0	.	933	P57679	EVC_HUMAN	I	933	ENSP00000264956:T933I;ENSP00000372120:T933I	ENSP00000264956:T933I	T	+	2	0	EVC	5862982	0.962000	0.33011	0.994000	0.49952	0.177000	0.22998	0.571000	0.23669	2.266000	0.75297	0.650000	0.86243	ACT	.	.		0.562	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206859.1		
GABRA2	2555	hgsc.bcm.edu	37	4	46264068	46264068	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr4:46264068C>T	ENST00000510861.1	-	9	1107	c.934G>A	c.(934-936)Gcc>Acc	p.A312T	GABRA2_ENST00000540012.1_Missense_Mutation_p.A257T|GABRA2_ENST00000507069.1_Missense_Mutation_p.A312T|GABRA2_ENST00000356504.1_Missense_Mutation_p.A312T|GABRA2_ENST00000514090.1_Missense_Mutation_p.A312T|GABRA2_ENST00000381620.4_Missense_Mutation_p.A312T|GABRA2_ENST00000515082.1_Missense_Mutation_p.A312T			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	312					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	CAGTCCATGGCAGTTGCATAA	0.413																																					p.A312T		Atlas-SNP	.											.	GABRA2	134	.	0			c.G934A						.						137.0	124.0	128.0					4																	46264068		2203	4300	6503	SO:0001583	missense	2555	exon9			CCATGGCAGTTGC		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.934G>A	chr4.hg19:g.46264068C>T	ENSP00000421828:p.Ala312Thr	125.0	0.0		138.0	50.0	NM_000807	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	hg19	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	C	34	5.404546	0.96051	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	D;D;D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42;-2.42;-2.42	5.35	5.35	0.76521	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.95639	0.8582	M	0.90759	3.145	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.96175	0.9126	10	0.87932	D	0	.	18.4017	0.90519	0.0:1.0:0.0:0.0	.	257;312;312	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	T	312;312;312;312;257;312;312	ENSP00000421828:A312T;ENSP00000421300:A312T;ENSP00000371033:A312T;ENSP00000348897:A312T;ENSP00000444409:A257T;ENSP00000427603:A312T;ENSP00000423840:A312T	ENSP00000348897:A312T	A	-	1	0	GABRA2	45958825	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.765000	0.85310	2.676000	0.91093	0.591000	0.81541	GCC	.	.		0.413	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		
TMPRSS11F	389208	hgsc.bcm.edu	37	4	68938054	68938054	+	Silent	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr4:68938054T>C	ENST00000356291.2	-	5	560	c.501A>G	c.(499-501)tcA>tcG	p.S167S	UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000511571.1_RNA|UBA6-AS1_ENST00000500538.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	167	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						TGAGTCTAAATGATGGTTTGT	0.294																																					p.S167S		Atlas-SNP	.											.	TMPRSS11F	79	.	0			c.A501G						.						77.0	78.0	78.0					4																	68938054		2203	4298	6501	SO:0001819	synonymous_variant	389208	exon5			TCTAAATGATGGT	AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.501A>G	chr4.hg19:g.68938054T>C		49.0	0.0		45.0	18.0	NM_207407	A8MXX2	Silent	SNP	ENST00000356291.2	hg19	CCDS3520.1																																																																																			.	.		0.294	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251439.1	NM_207407	
GLRB	2743	hgsc.bcm.edu	37	4	158091870	158091870	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr4:158091870T>C	ENST00000264428.4	+	10	1754	c.1484T>C	c.(1483-1485)aTa>aCa	p.I495T	GLRB_ENST00000541722.1_3'UTR|GLRB_ENST00000509282.1_Missense_Mutation_p.I495T|GLRB_ENST00000512619.1_3'UTR	NM_000824.4	NP_000815.1	P48167	GLRB_HUMAN	glycine receptor, beta	495					acrosome reaction (GO:0007340)|adult walking behavior (GO:0007628)|chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|righting reflex (GO:0060013)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glycinergic (GO:0060012)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|extracellular-glycine-gated ion channel activity (GO:0016933)|glycine binding (GO:0016594)			central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(6)|skin(5)|upper_aerodigestive_tract(1)	27	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.0564)|COAD - Colon adenocarcinoma(41;0.0642)|Kidney(143;0.0707)	Enflurane(DB00228)|Glycine(DB00145)|Lindane(DB00431)	TATTGGTCTATATATTTATGA	0.313																																					p.I495T		Atlas-SNP	.											.	GLRB	74	.	0			c.T1484C						.						53.0	57.0	56.0					4																	158091870		2202	4299	6501	SO:0001583	missense	2743	exon10			GGTCTATATATTT	U33267	CCDS3796.1, CCDS54813.1	4q31.3	2008-02-05			ENSG00000109738	ENSG00000109738			4329	protein-coding gene	gene with protein product		138492				9676428, 8717357	Standard	NM_000824		Approved		uc003ipj.2	P48167	OTTHUMG00000161954	ENST00000264428.4:c.1484T>C	chr4.hg19:g.158091870T>C	ENSP00000264428:p.Ile495Thr	40.0	0.0		46.0	14.0	NM_000824	A8K3K2|D3DP23|F5GWE1	Missense_Mutation	SNP	ENST00000264428.4	hg19	CCDS3796.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.729604	0.30684	.	.	ENSG00000109738	ENST00000264428;ENST00000509282	D;D	0.83837	-1.77;-1.77	5.95	5.95	0.96441	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.199081	0.56097	D	0.000032	T	0.72819	0.3508	N	0.16708	0.43	0.80722	D	1	B	0.12013	0.005	B	0.14023	0.01	T	0.67007	-0.5779	10	0.30078	T	0.28	.	16.4159	0.83738	0.0:0.0:0.0:1.0	.	495	P48167	GLRB_HUMAN	T	495	ENSP00000264428:I495T;ENSP00000427186:I495T	ENSP00000264428:I495T	I	+	2	0	GLRB	158311320	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.279000	0.76181	0.533000	0.62120	ATA	.	.		0.313	GLRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366507.1	NM_000824	
DDX60L	91351	hgsc.bcm.edu	37	4	169348266	169348266	+	Silent	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr4:169348266A>G	ENST00000511577.1	-	14	2132	c.1885T>C	c.(1885-1887)Tta>Cta	p.L629L	DDX60L_ENST00000505890.1_Silent_p.L629L|DDX60L_ENST00000260184.7_Silent_p.L629L			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	629							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CAGGCAATTAATCCTAACATT	0.338																																					p.L629L		Atlas-SNP	.											.	DDX60L	116	.	0			c.T1885C						.						83.0	72.0	76.0					4																	169348266		1849	4104	5953	SO:0001819	synonymous_variant	91351	exon14			CAATTAATCCTAA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.1885T>C	chr4.hg19:g.169348266A>G		139.0	0.0		150.0	6.0	NM_001012967	Q96ND6	Silent	SNP	ENST00000511577.1	hg19																																																																																				.	.		0.338	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
MARVELD2	153562	hgsc.bcm.edu	37	5	68715559	68715559	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr5:68715559C>A	ENST00000325631.5	+	2	421	c.347C>A	c.(346-348)tCa>tAa	p.S116*	MARVELD2_ENST00000413223.2_Nonsense_Mutation_p.S116*	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	116					cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		GTGGAGTGTTCACCACCAGCC	0.527																																					p.S116X		Atlas-SNP	.											.	MARVELD2	49	.	0			c.C347A						.						48.0	50.0	49.0					5																	68715559		2203	4300	6503	SO:0001587	stop_gained	153562	exon2			AGTGTTCACCACC	AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.347C>A	chr5.hg19:g.68715559C>A	ENSP00000323264:p.Ser116*	58.0	0.0		78.0	31.0	NM_001244734	A1BQX0|A1BQX1|A8KA97|Q96NM9	Nonsense_Mutation	SNP	ENST00000325631.5	hg19	CCDS34175.1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191271	0.78902	.	.	ENSG00000152939	ENST00000325631;ENST00000282886;ENST00000454295;ENST00000515844;ENST00000512803;ENST00000436532;ENST00000413223	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.3572	17.4129	0.87492	0.0:1.0:0.0:0.0	.	.	.	.	X	116	.	ENSP00000282886:S116X	S	+	2	0	MARVELD2	68751315	1.000000	0.71417	0.773000	0.31616	0.513000	0.34164	7.304000	0.78882	2.396000	0.81511	0.655000	0.94253	TCA	.	.		0.527	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369583.1	NM_144724	
FNIP1	96459	hgsc.bcm.edu	37	5	131014861	131014861	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr5:131014861T>C	ENST00000510461.1	-	12	1305	c.1210A>G	c.(1210-1212)Att>Gtt	p.I404V	FNIP1_ENST00000307954.8_Missense_Mutation_p.I359V|FNIP1_ENST00000511848.1_Missense_Mutation_p.I404V|FNIP1_ENST00000307968.7_Missense_Mutation_p.I376V|CTC-432M15.3_ENST00000514667.1_Intron	NM_133372.2	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1	404					cellular response to starvation (GO:0009267)|immature B cell differentiation (GO:0002327)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell apoptotic process (GO:0002904)|positive regulation of GTPase activity (GO:0043547)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|regulation of pro-B cell differentiation (GO:2000973)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		AGATTACAAATTGTTGTTCTA	0.358																																					p.I404V		Atlas-SNP	.											.	FNIP1	104	.	0			c.A1210G						.																																			SO:0001583	missense	96459	exon12			TACAAATTGTTGT	DQ145719	CCDS34226.1, CCDS34227.1	5q23.3	2014-01-28				ENSG00000217128			29418	protein-coding gene	gene with protein product		610594				11853319, 17028174	Standard	NM_001008738		Approved	KIAA1961		Q8TF40		ENST00000510461.1:c.1210A>G	chr5.hg19:g.131014861T>C	ENSP00000421985:p.Ile404Val	385.0	0.0		316.0	14.0	NM_133372	D6RJH5|Q86T47|Q9BUT0	Missense_Mutation	SNP	ENST00000510461.1	hg19	CCDS34227.1	.	.	.	.	.	.	.	.	.	.	T	16.90	3.251249	0.59212	.	.	ENSG00000217128	ENST00000307968;ENST00000307954;ENST00000544351;ENST00000510461;ENST00000511848	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.06	3.89	0.44902	.	.	.	.	.	T	0.35393	0.0930	N	0.19112	0.55	0.53688	D	0.999979	D;P;D;B	0.62365	0.991;0.948;0.991;0.328	D;D;D;B	0.72625	0.978;0.949;0.978;0.239	T	0.04708	-1.0932	9	0.24483	T	0.36	-5.1033	10.8866	0.46971	0.0:0.0748:0.0:0.9252	.	404;404;376;404	A8K8V8;Q8TF40-2;Q8TF40-3;Q8TF40	.;.;.;FNIP1_HUMAN	V	376;359;164;404;404	ENSP00000309266:I376V;ENSP00000310453:I359V;ENSP00000421985:I404V;ENSP00000425619:I404V	ENSP00000310453:I359V	I	-	1	0	FNIP1	131042760	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.742000	0.68646	0.876000	0.35872	0.533000	0.62120	ATT	.	.		0.358	FNIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370077.1	NM_133372	
RBM27	54439	hgsc.bcm.edu	37	5	145610481	145610481	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr5:145610481G>A	ENST00000265271.5	+	6	1016		c.e6+1		RBM27_ENST00000506502.1_Splice_Site	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27						mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATTATGATGGTAAAAATCAC	0.348																																					.		Atlas-SNP	.											.	RBM27	119	.	0			c.850+1G>A						.						99.0	84.0	89.0					5																	145610481		1568	3582	5150	SO:0001630	splice_region_variant	54439	exon6			ATGATGGTAAAAA	AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.850+1G>A	chr5.hg19:g.145610481G>A		103.0	0.0		82.0	27.0	NM_018989	Q8IYW9	Splice_Site	SNP	ENST00000265271.5	hg19	CCDS43378.1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.523236	0.85600	.	.	ENSG00000091009	ENST00000265271	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5365	0.95255	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RBM27	145590674	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.556000	0.90697	2.614000	0.88457	0.563000	0.77884	.	.	.		0.348	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373420.1	XM_291128	Intron
ATP10B	23120	hgsc.bcm.edu	37	5	160049550	160049550	+	Nonsense_Mutation	SNP	G	G	A	rs374261198		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr5:160049550G>A	ENST00000327245.5	-	14	2509	c.1663C>T	c.(1663-1665)Cga>Tga	p.R555*	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	555					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCAGCATCTCGAACCTTGGTC	0.498																																					p.R555X		Atlas-SNP	.											.	ATP10B	201	.	0			c.C1663T						.						102.0	104.0	103.0					5																	160049550		1952	4147	6099	SO:0001587	stop_gained	23120	exon14			CATCTCGAACCTT	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1663C>T	chr5.hg19:g.160049550G>A	ENSP00000313600:p.Arg555*	68.0	0.0		72.0	29.0	NM_025153	Q9H725	Nonsense_Mutation	SNP	ENST00000327245.5	hg19	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	G	46	12.587222	0.99680	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	.	.	.	5.53	3.55	0.40652	.	0.412527	0.25456	N	0.030549	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.337	0.60522	0.0:0.0:0.5723:0.4277	.	.	.	.	X	555;163	.	.	R	-	1	2	ATP10B	159982128	0.350000	0.24878	0.381000	0.26106	0.888000	0.51559	2.752000	0.47516	1.307000	0.44944	0.655000	0.94253	CGA	.	.		0.498	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
CFB	629	hgsc.bcm.edu	37	6	31918993	31918993	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:31918993A>C	ENST00000425368.2	+	15	2441	c.1928A>C	c.(1927-1929)aAg>aCg	p.K643T	CFB_ENST00000456570.1_Missense_Mutation_p.K1145T|CFB_ENST00000556679.1_Missense_Mutation_p.K1145T|CFB_ENST00000477310.1_Missense_Mutation_p.K994T	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	643	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						CTGACTCGGAAGGAGGTCTAC	0.498																																					p.K643T		Atlas-SNP	.											.	CFB	33	.	0			c.A1928C						.						92.0	93.0	92.0					6																	31918993		1511	2709	4220	SO:0001583	missense	629	exon15			CTCGGAAGGAGGT	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.1928A>C	chr6.hg19:g.31918993A>C	ENSP00000416561:p.Lys643Thr	70.0	0.0		65.0	19.0	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Missense_Mutation	SNP	ENST00000425368.2	hg19	CCDS4729.1	.	.	.	.	.	.	.	.	.	.	A	18.75	3.689632	0.68271	.	.	ENSG00000243649;ENSG00000243649;ENSG00000244255;ENSG00000244255	ENST00000556679;ENST00000425368;ENST00000456570;ENST00000477310	D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47	5.41	3.01	0.34805	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.130715	0.34725	N	0.003737	T	0.80534	0.4641	N	0.10760	0.04	0.46437	D	0.999043	D;D	0.71674	0.998;0.98	D;P	0.71184	0.972;0.852	T	0.82623	-0.0366	10	0.62326	D	0.03	-19.5614	7.7646	0.28972	0.8305:0.0:0.1695:0.0	.	1145;643	B4E1Z4;P00751	.;CFAB_HUMAN	T	1145;643;1145;994	ENSP00000451848:K1145T;ENSP00000416561:K643T;ENSP00000410815:K1145T;ENSP00000418996:K994T	ENSP00000416561:K643T	K	+	2	0	CFB;XXbac-BPG116M5.17	32026972	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.779000	0.47734	0.363000	0.24346	0.482000	0.46254	AAG	.	.		0.498	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
CFB	629	hgsc.bcm.edu	37	6	31919010	31919010	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:31919010A>T	ENST00000425368.2	+	15	2458	c.1945A>T	c.(1945-1947)Aat>Tat	p.N649Y	CFB_ENST00000456570.1_Missense_Mutation_p.N1151Y|CFB_ENST00000556679.1_Missense_Mutation_p.N1151Y|CFB_ENST00000477310.1_Missense_Mutation_p.N1000Y	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	649	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						CTACATCAAGAATGGGGATAA	0.502																																					p.N649Y		Atlas-SNP	.											.	CFB	33	.	0			c.A1945T						.						82.0	83.0	82.0					6																	31919010		1511	2709	4220	SO:0001583	missense	629	exon15			ATCAAGAATGGGG	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.1945A>T	chr6.hg19:g.31919010A>T	ENSP00000416561:p.Asn649Tyr	72.0	0.0		55.0	17.0	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Missense_Mutation	SNP	ENST00000425368.2	hg19	CCDS4729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.17|16.17	3.048359|3.048359	0.55110|0.55110	.|.	.|.	ENSG00000243649;ENSG00000243649;ENSG00000244255;ENSG00000244255|ENSG00000243649	ENST00000556679;ENST00000425368;ENST00000456570;ENST00000477310|ENST00000483004	T;T;T;T|.	0.32753|.	1.44;1.44;1.44;1.44|.	5.53|5.53	3.01|3.01	0.34805|0.34805	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.129562|.	0.34700|.	N|.	0.003751|.	T|T	0.35998|0.35998	0.0951|0.0951	L|L	0.46819|0.46819	1.47|1.47	0.35349|0.35349	D|D	0.787216|0.787216	D;D|.	0.89917|.	1.0;0.999|.	D;D|.	0.97110|.	1.0;0.99|.	T|T	0.13845|0.13845	-1.0494|-1.0494	10|5	0.26408|.	T|.	0.33|.	-23.6078|-23.6078	10.426|10.426	0.44378|0.44378	0.6849:0.3151:0.0:0.0|0.6849:0.3151:0.0:0.0	.|.	1151;649|.	B4E1Z4;P00751|.	.;CFAB_HUMAN|.	Y|S	1151;649;1151;1000|189	ENSP00000451848:N1151Y;ENSP00000416561:N649Y;ENSP00000410815:N1151Y;ENSP00000418996:N1000Y|.	ENSP00000416561:N649Y|.	N|R	+|+	1|3	0|2	CFB;XXbac-BPG116M5.17|CFB	32026989|32026989	0.999000|0.999000	0.42202|0.42202	0.941000|0.941000	0.38009|0.38009	0.883000|0.883000	0.51084|0.51084	1.258000|1.258000	0.32944|0.32944	0.339000|0.339000	0.23719|0.23719	0.482000|0.482000	0.46254|0.46254	AAT|AGA	.	.		0.502	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
TNXB	7148	hgsc.bcm.edu	37	6	32038115	32038115	+	Silent	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:32038115T>C	ENST00000375244.3	-	14	5268	c.5067A>G	c.(5065-5067)tcA>tcG	p.S1689S	TNXB_ENST00000375247.2_Silent_p.S1689S			P22105	TENX_HUMAN	tenascin XB	1771	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						AGAGGCGCAGTGAGTCTGGGG	0.642																																					p.S1689S		Atlas-SNP	.											.	TNXB	553	.	0			c.A5067G						.						18.0	20.0	19.0					6																	32038115		1920	4123	6043	SO:0001819	synonymous_variant	7148	exon14			GCGCAGTGAGTCT	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5067A>G	chr6.hg19:g.32038115T>C		112.0	0.0		103.0	35.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	hg19																																																																																				.	.		0.642	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
COL11A2	1302	hgsc.bcm.edu	37	6	33154482	33154482	+	Silent	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:33154482C>T	ENST00000374708.4	-	5	978	c.720G>A	c.(718-720)caG>caA	p.Q240Q	COL11A2_ENST00000374714.1_Silent_p.Q240Q|COL11A2_ENST00000374712.1_Silent_p.Q240Q|COL11A2_ENST00000374713.1_Silent_p.Q240Q|COL11A2_ENST00000357486.1_Silent_p.Q240Q|COL11A2_ENST00000341947.2_Silent_p.Q240Q|COL11A2_ENST00000395197.1_Silent_p.Q240Q|COL11A2_ENST00000395194.1_Silent_p.Q240Q|COL11A2_ENST00000361917.1_Silent_p.Q240Q	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	240	Nonhelical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CTCTGTGAGGCTGTTGGTTTT	0.577																																					p.Q240Q	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											.	COL11A2	124	.	0			c.G720A						.						266.0	242.0	250.0					6																	33154482		2203	4300	6503	SO:0001819	synonymous_variant	1302	exon5			GTGAGGCTGTTGG	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.720G>A	chr6.hg19:g.33154482C>T		117.0	0.0		80.0	23.0	NM_080681	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	hg19	CCDS43452.1																																																																																			.	.		0.577	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
DAAM2	23500	hgsc.bcm.edu	37	6	39832239	39832239	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:39832239A>G	ENST00000398904.2	+	4	471	c.289A>G	c.(289-291)Agc>Ggc	p.S97G	DAAM2_ENST00000494405.1_3'UTR|DAAM2_ENST00000274867.4_Missense_Mutation_p.S97G|DAAM2_ENST00000538976.1_Missense_Mutation_p.S97G			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	97	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GCTGGCAACCAGCTGGCCTGA	0.592																																					p.S97G		Atlas-SNP	.											.	DAAM2	101	.	0			c.A289G						.						73.0	72.0	72.0					6																	39832239		1999	4186	6185	SO:0001583	missense	23500	exon4			GCAACCAGCTGGC	AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.289A>G	chr6.hg19:g.39832239A>G	ENSP00000381876:p.Ser97Gly	56.0	0.0		37.0	11.0	NM_015345	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	ENST00000398904.2	hg19	CCDS56426.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.806040	0.90623	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	D;D;D	0.89270	-2.49;-2.49;-2.49	5.89	5.89	0.94794	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.000000	0.85682	D	0.000000	D	0.91199	0.7227	L	0.59912	1.85	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.79108	0.987;0.992	D	0.90099	0.4183	10	0.33141	T	0.24	.	15.2948	0.73894	1.0:0.0:0.0:0.0	.	97;97	G5EA45;Q86T65	.;DAAM2_HUMAN	G	97	ENSP00000274867:S97G;ENSP00000381876:S97G;ENSP00000437808:S97G	ENSP00000274867:S97G	S	+	1	0	DAAM2	39940217	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.254000	0.74563	0.459000	0.35465	AGC	.	.		0.592	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000280648.1		
HSP90AB1	3326	hgsc.bcm.edu	37	6	44216462	44216462	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:44216462C>A	ENST00000371554.1	+	2	310	c.96C>A	c.(94-96)ttC>ttA	p.F32L	HSP90AB1_ENST00000353801.3_Missense_Mutation_p.F32L|HSP90AB1_ENST00000371646.5_Missense_Mutation_p.F32L			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	32					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			TCAATACCTTCTATTCCAACA	0.438																																					p.F32L		Atlas-SNP	.											.	HSP90AB1	83	.	0			c.C96A						.						179.0	179.0	179.0					6																	44216462		2203	4300	6503	SO:0001583	missense	3326	exon2			TACCTTCTATTCC	AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.96C>A	chr6.hg19:g.44216462C>A	ENSP00000360609:p.Phe32Leu	66.0	0.0		73.0	15.0	NM_007355	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	ENST00000371554.1	hg19	CCDS4909.1	.	.	.	.	.	.	.	.	.	.	C	16.11	3.030558	0.54790	.	.	ENSG00000096384	ENST00000441736;ENST00000371646;ENST00000353801;ENST00000371554	T;T;T	0.15017	2.46;2.46;2.46	4.26	-0.976	0.10286	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (2);	0.000000	0.64402	U	0.000001	T	0.11537	0.0281	L	0.31752	0.955	0.80722	D	1	P;B	0.49447	0.924;0.142	P;B	0.57776	0.827;0.021	T	0.04242	-1.0966	10	0.87932	D	0	-14.0797	10.0808	0.42388	0.0:0.6275:0.0:0.3725	.	32;32	B4DGL0;P08238	.;HS90B_HUMAN	L	32	ENSP00000360709:F32L;ENSP00000325875:F32L;ENSP00000360609:F32L	ENSP00000325875:F32L	F	+	3	2	HSP90AB1	44324440	0.972000	0.33761	0.973000	0.42090	0.949000	0.60115	0.228000	0.17814	-0.177000	0.10690	0.505000	0.49811	TTC	.	.		0.438	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040730.1	NM_007355	
SNAP91	9892	hgsc.bcm.edu	37	6	84304147	84304147	+	Missense_Mutation	SNP	C	C	T	rs200249566		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:84304147C>T	ENST00000439399.2	-	17	1694	c.1378G>A	c.(1378-1380)Gca>Aca	p.A460T	SNAP91_ENST00000521743.1_Missense_Mutation_p.A460T|SNAP91_ENST00000520213.1_Intron|SNAP91_ENST00000428679.2_Missense_Mutation_p.A460T|SNAP91_ENST00000195649.6_Missense_Mutation_p.A460T|SNAP91_ENST00000520302.1_Missense_Mutation_p.A458T|SNAP91_ENST00000369694.2_Missense_Mutation_p.A460T|SNAP91_ENST00000521485.1_Missense_Mutation_p.A460T|SNAP91_ENST00000437520.1_Intron	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	460	Ala-rich.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GTAGCTGGTGCGGCGGCCCCT	0.493																																					p.A460T		Atlas-SNP	.											.	SNAP91	199	.	0			c.G1378A						.	C	THR/ALA,THR/ALA,,THR/ALA	1,3591		0,1,1795	24.0	24.0	24.0		1378,1372,,1378	5.8	1.0	6		24	7,8053		0,7,4023	yes	missense,missense,intron,missense	SNAP91	NM_001242792.1,NM_001242793.1,NM_001242794.1,NM_014841.2	58,58,,58	0,8,5818	TT,TC,CC		0.0868,0.0278,0.0687	possibly-damaging,possibly-damaging,,possibly-damaging	460/908,458/878,,460/908	84304147	8,11644	1796	4030	5826	SO:0001583	missense	9892	exon16			CTGGTGCGGCGGC	AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.1378G>A	chr6.hg19:g.84304147C>T	ENSP00000400459:p.Ala460Thr	82.0	0.0		73.0	4.0	NM_001242792	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	ENST00000439399.2	hg19	CCDS47455.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850394	0.71719	2.78E-4	8.68E-4	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000520302;ENST00000521743	T;T;T;T;T;T;T	0.16743	2.34;2.34;2.34;2.34;2.36;2.32;2.34	5.75	5.75	0.90469	.	0.188671	0.43919	D	0.000510	T	0.09992	0.0245	L	0.60455	1.87	0.80722	D	1	P;P;P	0.50943	0.893;0.94;0.94	B;B;B	0.35607	0.15;0.15;0.206	T	0.17018	-1.0383	10	0.21540	T	0.41	-6.0451	19.9421	0.97168	0.0:1.0:0.0:0.0	.	458;460;458	E5RI02;O60641;E1P549	.;AP180_HUMAN;.	T	460;460;460;460;460;458;460	ENSP00000429776:A460T;ENSP00000358708:A460T;ENSP00000400459:A460T;ENSP00000195649:A460T;ENSP00000412492:A460T;ENSP00000428511:A458T;ENSP00000428215:A460T	ENSP00000195649:A460T	A	-	1	0	SNAP91	84360866	1.000000	0.71417	0.991000	0.47740	0.538000	0.34931	4.078000	0.57606	2.714000	0.92807	0.561000	0.74099	GCA	.	.		0.493	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375296.1		
SHPRH	257218	hgsc.bcm.edu	37	6	146256475	146256475	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:146256475T>C	ENST00000367505.2	-	12	2936	c.2672A>G	c.(2671-2673)cAt>cGt	p.H891R	SHPRH_ENST00000438092.2_Missense_Mutation_p.H891R|SHPRH_ENST00000275233.7_Missense_Mutation_p.H891R|SHPRH_ENST00000367503.3_Missense_Mutation_p.H891R			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	891					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GCTGTAGAGATGCTGAGGATT	0.398																																					p.H891R		Atlas-SNP	.											.	SHPRH	169	.	0			c.A2672G						.						90.0	84.0	86.0					6																	146256475		1891	4108	5999	SO:0001583	missense	257218	exon12			TAGAGATGCTGAG	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2672A>G	chr6.hg19:g.146256475T>C	ENSP00000356475:p.His891Arg	113.0	0.0		94.0	32.0	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	hg19	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	T	11.69	1.715325	0.30413	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	5.73	-6.52	0.01872	SNF2-related (1);	0.558649	0.18320	N	0.144821	T	0.56232	0.1971	N	0.04043	-0.29	0.21675	N	0.999596	B;B;B	0.29805	0.168;0.257;0.217	B;B;B	0.28465	0.086;0.09;0.054	T	0.63829	-0.6548	10	0.21540	T	0.41	3.3162	7.902	0.29740	0.1551:0.0:0.473:0.3719	.	780;891;891	Q149N8-2;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	R	891	ENSP00000356475:H891R;ENSP00000356473:H891R;ENSP00000412797:H891R;ENSP00000275233:H891R	ENSP00000275233:H891R	H	-	2	0	SHPRH	146298168	0.750000	0.28316	0.024000	0.17045	0.998000	0.95712	1.020000	0.30027	-1.883000	0.01120	0.533000	0.62120	CAT	.	.		0.398	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
OPRM1	4988	hgsc.bcm.edu	37	6	154414485	154414485	+	Intron	SNP	T	T	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:154414485T>A	ENST00000330432.7	+	3	1401				OPRM1_ENST00000229768.5_Silent_p.P415P|OPRM1_ENST00000524163.1_Intron|OPRM1_ENST00000419506.2_Intron|OPRM1_ENST00000522236.1_Intron|OPRM1_ENST00000452687.2_Intron|OPRM1_ENST00000337049.4_Intron|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000435918.2_Intron|OPRM1_ENST00000520708.1_Intron|OPRM1_ENST00000360422.4_Intron|OPRM1_ENST00000522555.1_Intron|OPRM1_ENST00000434900.2_Intron|OPRM1_ENST00000414028.2_Intron	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	TGCAAGGACCTCTTGTCAGAT	0.522																																					p.P415P		Atlas-SNP	.											.	OPRM1	241	.	0			c.T1245A						.						244.0	233.0	236.0					6																	154414485		1979	4166	6145	SO:0001627	intron_variant	4988	exon4			AGGACCTCTTGTC	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1164+1878T>A	chr6.hg19:g.154414485T>A		65.0	0.0		62.0	25.0	NM_001008505	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Silent	SNP	ENST00000330432.7	hg19	CCDS55070.1																																																																																			.	.		0.522	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
DFNA5	1687	hgsc.bcm.edu	37	7	24738645	24738645	+	Nonstop_Mutation	SNP	T	T	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:24738645T>A	ENST00000342947.3	-	10	1916	c.1491A>T	c.(1489-1491)tgA>tgT	p.*497C	DFNA5_ENST00000545231.1_Nonstop_Mutation_p.*333C|DFNA5_ENST00000409775.3_Nonstop_Mutation_p.*497C|DFNA5_ENST00000419307.1_Nonstop_Mutation_p.*333C|DFNA5_ENST00000409970.1_Nonstop_Mutation_p.*333C	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	0					apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						ACATATGACATCATGAATGTT	0.388																																					p.X497C	GBM(78;184 1250 20134 20900 23600)	Atlas-SNP	.											.	DFNA5	51	.	0			c.A1491T						.						68.0	65.0	66.0					7																	24738645		2203	4300	6503	SO:0001578	stop_lost	1687	exon10			ATGACATCATGAA	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.1491A>T	chr7.hg19:g.24738645T>A		138.0	0.0		137.0	56.0	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	hg19	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.253495	0.39797	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775	.	.	.	4.89	0.879	0.19155	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0522	0.06173	0.4114:0.1138:0.0:0.4748	.	.	.	.	C	497;333;333;333;497	.	.	X	-	3	0	DFNA5	24705170	0.000000	0.05858	0.000000	0.03702	0.237000	0.25408	-0.136000	0.10405	0.225000	0.20959	0.455000	0.32223	TGA	.	.		0.388	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
SUGCT	79783	hgsc.bcm.edu	37	7	40234573	40234573	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:40234573A>G	ENST00000335693.4	+	6	442	c.419A>G	c.(418-420)tAt>tGt	p.Y140C	C7orf10_ENST00000540834.1_Missense_Mutation_p.Y133C|C7orf10_ENST00000309930.5_Missense_Mutation_p.Y140C|C7orf10_ENST00000401647.2_Missense_Mutation_p.Y140C	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		140					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						GTGGAAAACTATGTCCCTGGC	0.433																																					p.Y140C		Atlas-SNP	.											.	C7orf10	99	.	0			c.A419G						.						189.0	158.0	167.0					7																	40234573		692	1591	2283	SO:0001583	missense	79783	exon6			AAAACTATGTCCC																												ENST00000335693.4:c.419A>G	chr7.hg19:g.40234573A>G	ENSP00000338475:p.Tyr140Cys	34.0	0.0		29.0	10.0	NM_001193313	A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Missense_Mutation	SNP	ENST00000335693.4	hg19	CCDS55105.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.28|19.28	3.797627|3.797627	0.70567|0.70567	.|.	.|.	ENSG00000175600|ENSG00000175600	ENST00000416370|ENST00000309930;ENST00000401647;ENST00000335693;ENST00000540834	.|T;T;T;T	.|0.56776	.|0.44;0.44;0.44;0.44	5.66|5.66	5.66|5.66	0.87406|0.87406	.|CoA-transferase family III domain (2);	.|0.115578	.|0.64402	.|D	.|0.000011	T|T	0.79930|0.79930	0.4531|0.4531	H|H	0.94306|0.94306	3.52|3.52	0.49582|0.49582	D|D	0.999809|0.999809	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.76071	.|0.987;0.987	D|D	0.85756|0.85756	0.1346|0.1346	5|10	.|0.87932	.|D	.|0	-14.6944|-14.6944	14.8629|14.8629	0.70394|0.70394	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|140;140	.|Q4KMW8;Q9HAC7	.|.;CG010_HUMAN	V|C	135|140;140;140;133	.|ENSP00000312054:Y140C;ENSP00000385222:Y140C;ENSP00000338475:Y140C;ENSP00000445521:Y133C	.|ENSP00000312054:Y140C	M|Y	+|+	1|2	0|0	C7orf10|C7orf10	40201098|40201098	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	3.673000|3.673000	0.54591|0.54591	2.146000|2.146000	0.66826|0.66826	0.533000|0.533000	0.62120|0.62120	ATG|TAT	.	.		0.433	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000338388.1		
POM121L12	285877	hgsc.bcm.edu	37	7	53103849	53103849	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:53103849G>A	ENST00000408890.4	+	1	501	c.485G>A	c.(484-486)gGc>gAc	p.G162D		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	162										endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						cgccccgcaggccgccccgcc	0.731																																					p.G162D		Atlas-SNP	.											.	POM121L12	146	.	0			c.G485A						.						12.0	16.0	15.0					7																	53103849		1836	4040	5876	SO:0001583	missense	285877	exon1			CCGCAGGCCGCCC		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.485G>A	chr7.hg19:g.53103849G>A	ENSP00000386133:p.Gly162Asp	59.0	0.0		50.0	19.0	NM_182595	Q8NDI9	Missense_Mutation	SNP	ENST00000408890.4	hg19	CCDS43584.1	.	.	.	.	.	.	.	.	.	.	G	5.425	0.263636	0.10294	.	.	ENSG00000221900	ENST00000408890	T	0.23754	1.89	2.28	-2.06	0.07298	.	.	.	.	.	T	0.12518	0.0304	L	0.43923	1.385	0.09310	N	1	P	0.40211	0.707	B	0.29267	0.1	T	0.25984	-1.0116	9	0.15952	T	0.53	.	3.5864	0.07973	0.4777:0.2328:0.2896:0.0	.	162	Q8N7R1	P1L12_HUMAN	D	162	ENSP00000386133:G162D	ENSP00000386133:G162D	G	+	2	0	POM121L12	53071343	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.588000	0.05774	-0.600000	0.05790	0.505000	0.49811	GGC	.	.		0.731	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595	
ASL	435	hgsc.bcm.edu	37	7	65553861	65553861	+	Silent	SNP	C	C	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:65553861C>G	ENST00000304874.9	+	11	888	c.786C>G	c.(784-786)ctC>ctG	p.L262L	ASL_ENST00000380839.4_Silent_p.L236L|ASL_ENST00000395331.3_Silent_p.L262L|ASL_ENST00000395332.3_Silent_p.L262L|AC068533.7_ENST00000450043.1_Missense_Mutation_p.L31V	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	262					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)			breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	ACCTCATCCTCTACTGCACCA	0.592																																					p.L262L		Atlas-SNP	.											.	ASL	39	.	0			c.C786G						.						95.0	72.0	80.0					7																	65553861		2203	4300	6503	SO:0001819	synonymous_variant	435	exon11			CATCCTCTACTGC		CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.786C>G	chr7.hg19:g.65553861C>G		70.0	0.0		72.0	28.0	NM_000048	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Silent	SNP	ENST00000304874.9	hg19	CCDS5531.1	.	.	.	.	.	.	.	.	.	.	c	6.793	0.515327	0.12944	.	.	ENSG00000249319	ENST00000450043	D	0.99488	-6.0	5.82	2.64	0.31445	.	0.232964	0.37053	N	0.002271	D	0.99026	0.9667	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.98894	1.0774	7	0.72032	D	0.01	.	8.9405	0.35727	0.0:0.7156:0.1289:0.1554	.	.	.	.	V	31	ENSP00000396527:L31V	ENSP00000396527:L31V	L	+	1	2	AC068533.7	65191296	0.997000	0.39634	1.000000	0.80357	0.621000	0.37620	0.360000	0.20250	1.443000	0.47586	0.561000	0.74099	CTA	.	.		0.592	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251695.2	NM_000048	
CDK14	5218	hgsc.bcm.edu	37	7	90546967	90546967	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:90546967A>G	ENST00000380050.3	+	8	885	c.754A>G	c.(754-756)Att>Gtt	p.I252V	CDK14_ENST00000436577.2_Missense_Mutation_p.I123V|CDK14_ENST00000406263.1_Missense_Mutation_p.I206V|CDK14_ENST00000265741.3_Missense_Mutation_p.I234V			O94921	CDK14_HUMAN	cyclin-dependent kinase 14	252	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of cell cycle (GO:0051726)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoplasmic cyclin-dependent protein kinase holoenzyme complex (GO:0000308)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(12)|ovary(1)|skin(4)	32						CCAGCGTTATATTTTGCACAG	0.408																																					p.I234V	GBM(83;1228 1256 8311 16577 31299)	Atlas-SNP	.											.	CDK14	153	.	0			c.A700G						.						150.0	141.0	144.0					7																	90546967		2203	4300	6503	SO:0001583	missense	5218	exon7			CGTTATATTTTGC		CCDS5619.1, CCDS75626.1, CCDS75627.1, CCDS75628.1	7q21-q22	2011-11-08	2009-12-16	2009-12-16	ENSG00000058091	ENSG00000058091		"""Cyclin-dependent kinases"""	8883	protein-coding gene	gene with protein product		610679	"""PFTAIRE protein kinase 1"""	PFTK1		9202329, 11313143, 19884882	Standard	XM_005250436		Approved	PFTAIRE1	uc003ukz.1	O94921	OTTHUMG00000023649	ENST00000380050.3:c.754A>G	chr7.hg19:g.90546967A>G	ENSP00000369390:p.Ile252Val	123.0	0.0		110.0	34.0	NM_012395	A4D1E6|A6NK51|A8WFP6|B4DHG5|B4DNM2|Q75N06|Q75N22|Q8N764|Q9H3D7|Q9UDR0	Missense_Mutation	SNP	ENST00000380050.3	hg19		.	.	.	.	.	.	.	.	.	.	A	6.556	0.470892	0.12461	.	.	ENSG00000058091	ENST00000380050;ENST00000265741;ENST00000406263;ENST00000436577	T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38	5.34	5.34	0.76211	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55242	0.1908	N	0.21508	0.67	0.50039	D	0.999845	B;B;B	0.32781	0.015;0.384;0.049	B;B;B	0.41374	0.019;0.355;0.049	T	0.51919	-0.8644	10	0.02654	T	1	-16.7703	15.3134	0.74053	1.0:0.0:0.0:0.0	.	123;234;252	E7EUK8;O94921-2;O94921	.;.;CDK14_HUMAN	V	252;234;206;123	ENSP00000369390:I252V;ENSP00000265741:I234V;ENSP00000385034:I206V;ENSP00000398936:I123V	ENSP00000265741:I234V	I	+	1	0	CDK14	90384903	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.295000	0.72744	2.027000	0.59764	0.383000	0.25322	ATT	.	.		0.408	CDK14-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000059970.5	NM_012395	
MEST	4232	hgsc.bcm.edu	37	7	130140357	130140357	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:130140357T>G	ENST00000223215.4	+	8	852	c.631T>G	c.(631-633)Ttt>Gtt	p.F211V	MEST_ENST00000393187.1_Missense_Mutation_p.F202V|MEST_ENST00000341441.5_Missense_Mutation_p.F202V|MEST_ENST00000378576.4_Missense_Mutation_p.F202V|MEST_ENST00000437945.1_Missense_Mutation_p.F211V|MEST_ENST00000462132.1_3'UTR|MEST_ENST00000416162.2_Missense_Mutation_p.F202V|hsa-mir-335_ENST00000604666.1_RNA	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	211					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					GATGAACTTCTTTGTATTCTC	0.473																																					p.F211V	Colon(126;2182 2305 6517 35181)	Atlas-SNP	.											.	MEST	28	.	0			c.T631G						.						80.0	68.0	72.0					7																	130140357		2203	4300	6503	SO:0001583	missense	4232	exon8			AACTTCTTTGTAT		CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.631T>G	chr7.hg19:g.130140357T>G	ENSP00000223215:p.Phe211Val	96.0	0.0		90.0	37.0	NM_002402	B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	ENST00000223215.4	hg19	CCDS5822.1	.	.	.	.	.	.	.	.	.	.	T	12.88	2.071325	0.36566	.	.	ENSG00000106484	ENST00000341441;ENST00000427521;ENST00000416162;ENST00000378576;ENST00000393187;ENST00000421001;ENST00000223215;ENST00000437945	T;T;T;T;T;T;T;T	0.67698	-0.22;-0.28;-0.28;-0.28;-0.22;0.95;-0.22;-0.22	6.07	6.07	0.98685	.	0.303326	0.42053	D	0.000774	T	0.55673	0.1935	L	0.33485	1.01	0.34750	D	0.731646	B;B;B;B	0.17667	0.004;0.023;0.023;0.004	B;B;B;B	0.15052	0.003;0.012;0.012;0.007	T	0.59679	-0.7409	10	0.17832	T	0.49	.	15.4508	0.75271	0.0:0.0:0.0:1.0	.	197;211;211;202	B4DQW6;C9JW74;Q5EB52;Q5EB52-3	.;.;MEST_HUMAN;.	V	202;202;202;202;202;202;211;211	ENSP00000342749:F202V;ENSP00000409505:F202V;ENSP00000408933:F202V;ENSP00000367839:F202V;ENSP00000376884:F202V;ENSP00000407222:F202V;ENSP00000223215:F211V;ENSP00000401657:F211V	ENSP00000223215:F211V	F	+	1	0	MEST	129927593	1.000000	0.71417	0.999000	0.59377	0.665000	0.39181	2.756000	0.47549	2.326000	0.78906	0.528000	0.53228	TTT	.	.		0.473	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345183.2	NM_002402	
C7orf55-LUC7L2	100996928	hgsc.bcm.edu	37	7	139097314	139097314	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:139097314A>T	ENST00000354926.4	+	8	1151	c.797A>T	c.(796-798)aAg>aTg	p.K266M	C7orf55-LUC7L2_ENST00000541170.3_Missense_Mutation_p.K263M|C7orf55-LUC7L2_ENST00000263545.6_Missense_Mutation_p.K265M|LUC7L2_ENST00000541515.3_Missense_Mutation_p.K332M	NM_001270643.1|NM_016019.4	NP_001257572.1|NP_057103.2			C7orf55-LUC7L2 readthrough																		TCACACAGCAAGAATCCAAAA	0.289																																					p.K332M		Atlas-SNP	.											.	.	.	.	0			c.A995T						.						126.0	124.0	124.0					7																	139097314		1811	4069	5880	SO:0001583	missense	100996928	exon9			ACAGCAAGAATCC		CCDS59084.1	7q34	2013-02-14			ENSG00000146963	ENSG00000146963			44671	other	readthrough							Standard	NM_001244584		Approved		uc011kqt.3		OTTHUMG00000151717	ENST00000354926.4:c.797A>T	chr7.hg19:g.139097314A>T	ENSP00000347005:p.Lys266Met	75.0	0.0		97.0	4.0	NM_001244584		Missense_Mutation	SNP	ENST00000354926.4	hg19	CCDS43656.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.032403	0.75504	.	.	ENSG00000146963	ENST00000541170;ENST00000541515;ENST00000545899;ENST00000354926;ENST00000263545	T;T;T;T	0.31769	1.48;1.48;1.48;3.22	5.49	5.49	0.81192	.	0.223475	0.43747	D	0.000528	T	0.36193	0.0958	N	0.14661	0.345	0.34584	D	0.714818	D;D;D;D	0.69078	0.995;0.989;0.997;0.989	P;P;D;P	0.64237	0.839;0.737;0.923;0.737	T	0.51252	-0.8729	9	0.59425	D	0.04	-15.0866	14.1756	0.65539	1.0:0.0:0.0:0.0	.	332;263;265;266	B7Z4Q3;B7Z500;Q9Y383-2;Q9Y383	.;.;.;LC7L2_HUMAN	M	263;332;266;266;265	ENSP00000441604:K263M;ENSP00000440222:K332M;ENSP00000347005:K266M;ENSP00000263545:K265M	ENSP00000263545:K265M	K	+	2	0	LUC7L2	138747854	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.717000	0.54911	2.089000	0.63090	0.528000	0.53228	AAG	.	.		0.289	C7orf55-LUC7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323618.2		
MGAM	8972	hgsc.bcm.edu	37	7	141764321	141764321	+	Splice_Site	SNP	G	G	T	rs374771873		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr7:141764321G>T	ENST00000549489.2	+	37	4578	c.4483G>T	c.(4483-4485)Gaa>Taa	p.E1495*	MGAM_ENST00000475668.2_Splice_Site_p.E1495*	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1495	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACCCACATACGAGTGAGTCTC	0.517																																					p.E1495X		Atlas-SNP	.											.	MGAM	767	.	0			c.G4483T						.	G	stop/GLU	0,3978		0,0,1989	18.0	20.0	19.0		4483	4.2	1.0	7		19	1,8297		0,1,4148	no	stop-gained-near-splice	MGAM	NM_004668.2		0,1,6137	TT,TG,GG		0.0121,0.0,0.0081		1495/1858	141764321	1,12275	1989	4149	6138	SO:0001630	splice_region_variant	8972	exon37			ACATACGAGTGAG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4484+1G>T	chr7.hg19:g.141764321G>T		87.0	0.0		61.0	4.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Nonsense_Mutation	SNP	ENST00000549489.2	hg19	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	G	42	9.455672	0.99175	0.0	1.21E-4	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	.	.	.	4.22	4.22	0.49857	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	15.4323	0.75112	0.0:0.0:1.0:0.0	.	.	.	.	X	1495;1495;1372	.	ENSP00000316431:E1372X	E	+	1	0	MGAM	141410790	1.000000	0.71417	0.999000	0.59377	0.199000	0.23934	5.512000	0.67030	1.888000	0.54679	0.306000	0.20318	GAA	.	.		0.517	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		Nonsense_Mutation
MYBL1	4603	hgsc.bcm.edu	37	8	67505381	67505381	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr8:67505381C>A	ENST00000522677.3	-	7	1146	c.736G>T	c.(736-738)Gtt>Ttt	p.V246F	MYBL1_ENST00000524176.2_Missense_Mutation_p.V246F|MYBL1_ENST00000517885.1_Intron	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	246	Transcriptional activation domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			GTAGGCTGAACATGTTCTATA	0.303																																					p.V246F		Atlas-SNP	.											.	MYBL1	73	.	0			c.G736T						.						62.0	57.0	59.0					8																	67505381		1822	4081	5903	SO:0001583	missense	4603	exon7			GCTGAACATGTTC	X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.736G>T	chr8.hg19:g.67505381C>A	ENSP00000429633:p.Val246Phe	439.0	0.0		615.0	97.0	NM_001080416	E7EW29|Q495F9	Missense_Mutation	SNP	ENST00000522677.3	hg19	CCDS47867.1	.	.	.	.	.	.	.	.	.	.	C	12.10	1.835418	0.32421	.	.	ENSG00000185697	ENST00000522677;ENST00000524176	T;T	0.18657	2.68;2.2	5.66	1.93	0.25924	Transcription regulator Wos2-domain (1);	0.549745	0.18931	N	0.127216	T	0.11793	0.0287	N	0.25647	0.755	0.30933	N	0.726648	B;B;B	0.16166	0.002;0.016;0.001	B;B;B	0.16289	0.007;0.015;0.009	T	0.35251	-0.9796	10	0.09843	T	0.71	-5.0933	8.6068	0.33778	0.0:0.4931:0.0:0.5069	.	246;246;246	Q495F9;Q495G0;P10243	.;.;MYBA_HUMAN	F	246	ENSP00000429633:V246F;ENSP00000428011:V246F	ENSP00000429633:V246F	V	-	1	0	MYBL1	67667935	0.917000	0.31117	0.994000	0.49952	0.926000	0.56050	-0.116000	0.10724	0.068000	0.16574	-0.214000	0.12660	GTT	.	.		0.303	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379221.3	XM_034274	
FER1L6	654463	hgsc.bcm.edu	37	8	125103743	125103743	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr8:125103743G>T	ENST00000522917.1	+	34	4677	c.4471G>T	c.(4471-4473)Gga>Tga	p.G1491*	FER1L6_ENST00000399018.1_Nonsense_Mutation_p.G1491*|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1491						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CAAGCTGGATGGACCCTACTT	0.448																																					p.G1491X		Atlas-SNP	.											.	FER1L6	268	.	0			c.G4471T						.						125.0	117.0	119.0					8																	125103743		1901	4113	6014	SO:0001587	stop_gained	654463	exon34			CTGGATGGACCCT	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4471G>T	chr8.hg19:g.125103743G>T	ENSP00000428280:p.Gly1491*	145.0	0.0		283.0	37.0	NM_001039112		Nonsense_Mutation	SNP	ENST00000522917.1	hg19	CCDS43767.1	.	.	.	.	.	.	.	.	.	.	G	43	10.513761	0.99419	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	5.86	5.86	0.93980	.	0.278293	0.35466	U	0.003194	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-18.2966	20.2019	0.98263	0.0:0.0:1.0:0.0	.	.	.	.	X	1491	.	ENSP00000381982:G1491X	G	+	1	0	FER1L6	125172924	1.000000	0.71417	0.990000	0.47175	0.226000	0.24999	7.682000	0.84083	2.776000	0.95493	0.655000	0.94253	GGA	.	.		0.448	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
CNTRL	11064	hgsc.bcm.edu	37	9	123921275	123921275	+	Missense_Mutation	SNP	C	C	T	rs145607154		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr9:123921275C>T	ENST00000373855.1	+	31	5167	c.4907C>T	c.(4906-4908)aCt>aTt	p.T1636I	CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373850.1_Missense_Mutation_p.T1084I|CNTRL_ENST00000373844.1_Missense_Mutation_p.T81I|CNTRL_ENST00000238341.5_Missense_Mutation_p.T1636I			Q7Z7A1	CNTRL_HUMAN	centriolin	1636					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						ACTGAAGTAACTGAGAAGTGC	0.433																																					p.T1636I		Atlas-SNP	.											.	CNTRL	161	.	0			c.C4907T						.						152.0	158.0	156.0					9																	123921275		2203	4300	6503	SO:0001583	missense	11064	exon29			AAGTAACTGAGAA	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.4907C>T	chr9.hg19:g.123921275C>T	ENSP00000362962:p.Thr1636Ile	120.0	0.0		143.0	42.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	hg19	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476772	0.26511	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000431571;ENST00000373845;ENST00000373844	T;T;T	0.29917	1.55;1.55;1.55	5.64	4.75	0.60458	.	.	.	.	.	T	0.27384	0.0672	L	0.44542	1.39	0.09310	N	1	B	0.16603	0.018	B	0.14023	0.01	T	0.16660	-1.0395	9	0.54805	T	0.06	.	9.8339	0.40958	0.1457:0.7799:0.0:0.0744	.	1636	Q7Z7A1	CNTRL_HUMAN	I	1636;1636;1636;392;1084;305;318;81	ENSP00000362962:T1636I;ENSP00000238341:T1636I;ENSP00000362956:T1084I	ENSP00000238341:T1636I	T	+	2	0	CNTRL	122961096	0.043000	0.20138	0.466000	0.27168	0.592000	0.36648	1.016000	0.29976	1.522000	0.49001	0.650000	0.86243	ACT	.	C|1.000;A|0.000		0.433	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
GRIN1	2902	hgsc.bcm.edu	37	9	140056943	140056943	+	Silent	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr9:140056943C>A	ENST00000371561.3	+	13	2936	c.1839C>A	c.(1837-1839)gtC>gtA	p.V613V	GRIN1_ENST00000371555.4_Silent_p.V634V|GRIN1_ENST00000315048.3_Silent_p.V613V|GRIN1_ENST00000371560.3_Silent_p.V634V|GRIN1_ENST00000350902.5_Silent_p.V613V|GRIN1_ENST00000371550.4_Silent_p.V613V|GRIN1_ENST00000371553.3_Silent_p.V634V|GRIN1_ENST00000471122.1_3'UTR|GRIN1_ENST00000371546.4_Silent_p.V634V|GRIN1_ENST00000371559.4_Silent_p.V613V	NM_007327.3	NP_015566.1	Q05586	NMDZ1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 1	613					adult locomotory behavior (GO:0008344)|calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular calcium ion homeostasis (GO:0006874)|cellular response to manganese ion (GO:0071287)|cerebral cortex development (GO:0021987)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|male mating behavior (GO:0060179)|negative regulation of neuron apoptotic process (GO:0043524)|olfactory learning (GO:0008355)|pons maturation (GO:0021586)|positive regulation of apoptotic process (GO:0043065)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|propylene metabolic process (GO:0018964)|protein tetramerization (GO:0051262)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of membrane potential (GO:0042391)|regulation of respiratory gaseous exchange (GO:0043576)|regulation of synapse assembly (GO:0051963)|respiratory gaseous exchange (GO:0007585)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to ethanol (GO:0045471)|response to fungicide (GO:0060992)|response to morphine (GO:0043278)|rhythmic process (GO:0048511)|sensory perception of pain (GO:0019233)|social behavior (GO:0035176)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic cleft (GO:0043083)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate binding (GO:0016595)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|voltage-gated cation channel activity (GO:0022843)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;6.87e-05)|Epithelial(140;0.00095)	Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CCTGGGGCGTCCTGCTCAACT	0.716																																					p.V634V	NSCLC(113;717 1653 2089 20474 37618)	Atlas-SNP	.											.	GRIN1	51	.	0			c.C1902A						.						23.0	27.0	26.0					9																	140056943		2199	4299	6498	SO:0001819	synonymous_variant	2902	exon14			GGGCGTCCTGCTC		CCDS7031.1, CCDS7032.1, CCDS43910.1, CCDS55354.1, CCDS55355.1	9q34.3	2013-01-11			ENSG00000176884	ENSG00000176884		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4584	protein-coding gene	gene with protein product		138249	"""N-methyl-D-aspartate receptor subunit NR1"""	NMDAR1		1350383	Standard	NM_000832		Approved	GluN1	uc004cln.3	Q05586	OTTHUMG00000020976	ENST00000371561.3:c.1839C>A	chr9.hg19:g.140056943C>A		72.0	0.0		62.0	29.0	NM_001185091	A6NLK7|A6NLR1|C9K0X1|P35437|Q12867|Q12868|Q5VSF3|Q5VSF4|Q5VSF5|Q5VSF6|Q5VSF7|Q5VSF8|Q9UPF8|Q9UPF9	Silent	SNP	ENST00000371561.3	hg19	CCDS7031.1																																																																																			.	.		0.716	GRIN1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055267.3	NM_007327	
WAPAL	23063	hgsc.bcm.edu	37	10	88197724	88197724	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr10:88197724T>C	ENST00000298767.5	-	18	3932	c.3460A>G	c.(3460-3462)Ata>Gta	p.I1154V	WAPAL_ENST00000484070.1_5'UTR|WAPAL_ENST00000263070.7_Missense_Mutation_p.I366V|WAPAL_ENST00000372075.1_Missense_Mutation_p.I366V	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	1154	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TCTGTCATTATTGAAAAGTCT	0.333																																					p.I1154V		Atlas-SNP	.											.	WAPAL	81	.	0			c.A3460G						.						64.0	70.0	68.0					10																	88197724		2203	4300	6503	SO:0001583	missense	23063	exon18			TCATTATTGAAAA	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.3460A>G	chr10.hg19:g.88197724T>C	ENSP00000298767:p.Ile1154Val	360.0	0.0		392.0	123.0	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	Missense_Mutation	SNP	ENST00000298767.5	hg19	CCDS7375.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.222198	0.39300	.	.	ENSG00000062650	ENST00000342368;ENST00000298767;ENST00000372076;ENST00000372075;ENST00000263070	T;T;T	0.36699	1.24;1.24;1.24	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.25382	0.0617	N	0.15975	0.35	0.58432	D	0.999991	B;B;B;B	0.30563	0.157;0.076;0.157;0.285	B;B;B;B	0.35470	0.033;0.028;0.033;0.203	T	0.09058	-1.0692	10	0.12103	T	0.63	.	16.0204	0.80478	0.0:0.0:0.0:1.0	.	1148;1192;1154;1191	B2RTX8;E9PH12;Q7Z5K2;Q7Z5K2-2	.;.;WAPL_HUMAN;.	V	1239;1154;1239;366;366	ENSP00000298767:I1154V;ENSP00000361145:I366V;ENSP00000263070:I366V	ENSP00000263070:I366V	I	-	1	0	WAPAL	88187704	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.928000	0.70088	2.174000	0.68829	0.533000	0.62120	ATA	.	.		0.333	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
SORCS3	22986	hgsc.bcm.edu	37	10	106865229	106865229	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr10:106865229G>T	ENST00000369701.3	+	7	1395	c.1168G>T	c.(1168-1170)Gac>Tac	p.D390Y		NM_014978.1	NP_055793.1	Q9UPU3	SORC3_HUMAN	sortilin-related VPS10 domain containing receptor 3	390					learning (GO:0007612)|memory (GO:0007613)|neuropeptide signaling pathway (GO:0007218)|regulation of long term synaptic depression (GO:1900452)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal postsynaptic density (GO:0097481)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(19)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	131		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CCGCTCCATTGACATCAGTTC	0.502																																					p.D390Y	NSCLC(116;1497 1690 7108 13108 14106)	Atlas-SNP	.											.	SORCS3	282	.	0			c.G1168T						.						180.0	151.0	161.0					10																	106865229		2203	4300	6503	SO:0001583	missense	22986	exon7			TCCATTGACATCA	AB028982	CCDS7558.1	10q23-q25	2006-04-12			ENSG00000156395	ENSG00000156395			16699	protein-coding gene	gene with protein product		606285				11499680	Standard	NM_014978		Approved	KIAA1059, SORCS	uc001kyi.1	Q9UPU3	OTTHUMG00000019011	ENST00000369701.3:c.1168G>T	chr10.hg19:g.106865229G>T	ENSP00000358715:p.Asp390Tyr	73.0	0.0		56.0	25.0	NM_014978	Q5VXF9|Q9NQJ2	Missense_Mutation	SNP	ENST00000369701.3	hg19	CCDS7558.1	.	.	.	.	.	.	.	.	.	.	G	18.54	3.647053	0.67358	.	.	ENSG00000156395	ENST00000369701	T	0.40476	1.03	5.43	5.43	0.79202	VPS10 (1);	0.050677	0.85682	D	0.000000	T	0.64811	0.2632	M	0.78637	2.42	0.42010	D	0.990931	D	0.89917	1.0	D	0.70935	0.971	T	0.69386	-0.5159	10	0.87932	D	0	.	14.727	0.69351	0.0:0.0:1.0:0.0	.	390	Q9UPU3	SORC3_HUMAN	Y	390	ENSP00000358715:D390Y	ENSP00000358715:D390Y	D	+	1	0	SORCS3	106855219	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.115000	0.71566	2.536000	0.85505	0.462000	0.41574	GAC	.	.		0.502	SORCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050221.1	NM_014978	
HABP2	3026	hgsc.bcm.edu	37	10	115337800	115337801	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr10:115337800_115337801GG>AT	ENST00000351270.3	+	6	560_561	c.464_465GG>AT	c.(463-465)aGG>aAT	p.R155N	HABP2_ENST00000542051.1_Missense_Mutation_p.R129N|HABP2_ENST00000541666.1_Missense_Mutation_p.R155N|HABP2_ENST00000537906.1_Missense_Mutation_p.G144I	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2	155	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	CCTGTATGCAGGCCAAACCCCT	0.545																																					p.R155K|p.R155S		Atlas-SNP	.											.	HABP2	52	.	0			c.G464A|c.G465T						.																																			SO:0001583	missense	3026	exon6			TATGCAGGCCAAA|ATGCAGGCCAAAC		CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073	Exception_encountered	chr10.hg19:g.115337800_115337801delinsAT	ENSP00000277903:p.Arg155Asn	53.0|54.0	0.0		54.0	28.0	NM_004132	A8K467|B7Z8U5|F5H5M6|O00663	Missense_Mutation	SNP	ENST00000351270.3	hg19	CCDS7577.1																																																																																			.	.		0.545	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050428.1	NM_004132	
EBF3	253738	hgsc.bcm.edu	37	10	131671777	131671777	+	Silent	SNP	G	G	A	rs368078346		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr10:131671777G>A	ENST00000355311.5	-	8	792	c.720C>T	c.(718-720)caC>caT	p.H240H	EBF3_ENST00000368648.3_Silent_p.H240H			Q9H4W6	COE3_HUMAN	early B-cell factor 3	240					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	44		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		CCCGCCTCCCGTGTTTGGAAT	0.512																																					p.H240H		Atlas-SNP	.											EBF3_ENST00000355311,NS,carcinoma,0,2	EBF3	193	.	0			c.C720T						.	G		0,4406		0,0,2203	60.0	59.0	60.0		720	0.9	1.0	10		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	EBF3	NM_001005463.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		240/552	131671777	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	253738	exon8			CCTCCCGTGTTTG		CCDS31314.1	10q26.3	2007-03-30			ENSG00000108001	ENSG00000108001			19087	protein-coding gene	gene with protein product		607407				12355068	Standard	NM_001005463		Approved	COE3, DKFZp667B0210	uc001lki.2	Q9H4W6	OTTHUMG00000019265	ENST00000355311.5:c.720C>T	chr10.hg19:g.131671777G>A		59.0	0.0		29.0	13.0	NM_001005463	A0AUY1|Q5T6H9|Q9H4W5	Silent	SNP	ENST00000355311.5	hg19																																																																																				.	.		0.512	EBF3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051015.2	NM_001005463	
MUC2	4583	hgsc.bcm.edu	37	11	1087896	1087896	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr11:1087896A>G	ENST00000441003.2	+	25	3398	c.3371A>G	c.(3370-3372)tAc>tGc	p.Y1124C	MUC2_ENST00000359061.5_Missense_Mutation_p.Y1124C	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1124					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	TGCGACTACTACAACCCTCCG	0.627																																					p.Y1124C		Atlas-SNP	.											.	MUC2	614	.	0			c.A3371G						.						57.0	63.0	61.0					11																	1087896		2124	4232	6356	SO:0001583	missense	4583	exon25			ACTACTACAACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.3371A>G	chr11.hg19:g.1087896A>G	ENSP00000415183:p.Tyr1124Cys	53.0	0.0		53.0	11.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	a	12.88	2.070145	0.36566	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.14766	2.48;2.48	3.84	3.84	0.44239	.	0.221298	0.29335	N	0.012458	T	0.40040	0.1101	M	0.86028	2.79	0.40527	D	0.980891	D	0.76494	0.999	D	0.79108	0.992	T	0.49224	-0.8962	10	0.87932	D	0	.	12.8325	0.57754	1.0:0.0:0.0:0.0	.	1124	E7EUV1	.	C	1124	ENSP00000415183:Y1124C;ENSP00000351956:Y1124C	ENSP00000351956:Y1124C	Y	+	2	0	MUC2	1077896	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	7.107000	0.77047	1.617000	0.50277	0.450000	0.29827	TAC	.	.		0.627	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
TRIM51	84767	hgsc.bcm.edu	37	11	55653151	55653151	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr11:55653151C>T	ENST00000449290.2	+	2	339	c.247C>T	c.(247-249)Cgg>Tgg	p.R83W	TRIM51_ENST00000244891.3_5'Flank	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	83						intracellular (GO:0005622)	zinc ion binding (GO:0008270)										AGCCAGCCTCCGGCAATTCCT	0.483																																					p.R83W		Atlas-SNP	.											SPRYD5_ENST00000327733,NS,carcinoma,0,2	.	.	.	0			c.C247T						.						17.0	15.0	16.0					11																	55653151		692	1590	2282	SO:0001583	missense	84767	exon2			AGCCTCCGGCAAT	BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.247C>T	chr11.hg19:g.55653151C>T	ENSP00000395086:p.Arg83Trp	120.0	0.0		102.0	5.0	NM_032681	A6NMG2	Missense_Mutation	SNP	ENST00000449290.2	hg19		.	.	.	.	.	.	.	.	.	.	.	0.878	-0.729638	0.03135	.	.	ENSG00000124900	ENST00000449290	T	0.63096	-0.02	.	.	.	Zinc finger, RING/FYVE/PHD-type (1);	.	.	.	.	T	0.34861	0.0912	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.10520	-1.0626	8	0.52906	T	0.07	.	5.1874	0.15191	0.3697:0.6303:0.0:0.0	.	83	Q9BSJ1	SPRY5_HUMAN	W	83	ENSP00000395086:R83W	ENSP00000395086:R83W	R	+	1	2	SPRYD5	55409727	0.002000	0.14202	0.027000	0.17364	0.057000	0.15508	-1.326000	0.02685	-1.461000	0.01909	-1.906000	0.00525	CGG	.	.		0.483	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000391522.1	NM_032681	
TUT1	64852	hgsc.bcm.edu	37	11	62343405	62343405	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr11:62343405G>A	ENST00000476907.1	-	9	2477	c.1786C>T	c.(1786-1788)Cag>Tag	p.Q596*	EEF1G_ENST00000378019.3_5'Flank|EEF1G_ENST00000532986.1_5'Flank|TUT1_ENST00000308436.7_Nonsense_Mutation_p.Q634*|MIR3654_ENST00000496634.2_Intron|EEF1G_ENST00000329251.4_5'Flank			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	596					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GAGCTGGGCTGCAGAAGAGGG	0.642																																					p.Q634X		Atlas-SNP	.											.	TUT1	122	.	0			c.C1900T						.						40.0	44.0	43.0					11																	62343405		2202	4299	6501	SO:0001587	stop_gained	64852	exon9			TGGGCTGCAGAAG	BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.1786C>T	chr11.hg19:g.62343405G>A	ENSP00000419607:p.Gln596*	91.0	0.0		86.0	23.0	NM_022830	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Nonsense_Mutation	SNP	ENST00000476907.1	hg19		.	.	.	.	.	.	.	.	.	.	G	44	10.816036	0.99472	.	.	ENSG00000149016	ENST00000308436;ENST00000476907	.	.	.	5.52	5.52	0.82312	.	0.338854	0.32002	N	0.006728	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-6.5008	16.9363	0.86203	0.0:0.0:1.0:0.0	.	.	.	.	X	634;596	.	ENSP00000308000:Q634X	Q	-	1	0	TUT1	62099981	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	5.604000	0.67626	2.594000	0.87642	0.655000	0.94253	CAG	.	.		0.642	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000351319.2	NM_022830	
B3GAT3	26229	hgsc.bcm.edu	37	11	62388013	62388013	+	Silent	SNP	G	G	A	rs143334227	byFrequency	TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr11:62388013G>A	ENST00000265471.5	-	2	440	c.213C>T	c.(211-213)ccC>ccT	p.P71P	B3GAT3_ENST00000531383.1_Silent_p.P71P|B3GAT3_ENST00000534026.1_Silent_p.P71P	NM_012200.3	NP_036332.2	O94766	B3GA3_HUMAN	beta-1,3-glucuronyltransferase 3	71					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|glucuronosyltransferase activity (GO:0015020)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)|urinary_tract(1)	12						GCAGGGCCTCGGGTTCAGGGG	0.607													G|||	3	0.000599042	0.0	0.0	5008	,	,		14644	0.0		0.003	False		,,,				2504	0.0				p.P71P		Atlas-SNP	.											.	B3GAT3	24	.	0			c.C213T						.	G		0,4396		0,0,2198	17.0	23.0	21.0		213	-6.1	0.9	11	dbSNP_134	21	1,8587		0,1,4293	no	coding-synonymous	B3GAT3	NM_012200.3		0,1,6491	AA,AG,GG		0.0116,0.0,0.0077		71/336	62388013	1,12983	2198	4294	6492	SO:0001819	synonymous_variant	26229	exon2			GGCCTCGGGTTCA	AB009598	CCDS8025.1	11q12	2014-07-08	2014-07-08		ENSG00000149541	ENSG00000149541	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	923	protein-coding gene	gene with protein product	"""glucuronosyltransferase I"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 3"""	606374	"""beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I)"""			9506957	Standard	NM_012200		Approved	GlcAT-I	uc001ntw.3	O94766	OTTHUMG00000167685	ENST00000265471.5:c.213C>T	chr11.hg19:g.62388013G>A		64.0	0.0		69.0	4.0	NM_012200	B7ZAB3|Q96I06|Q9UEP0	Silent	SNP	ENST00000265471.5	hg19	CCDS8025.1																																																																																			.	G|1.000;A|0.000		0.607	B3GAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395588.1	NM_012200	
DCUN1D5	84259	hgsc.bcm.edu	37	11	102937078	102937078	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr11:102937078T>C	ENST00000260247.5	-	6	817	c.475A>G	c.(475-477)Att>Gtt	p.I159V	DCUN1D5_ENST00000531543.1_Missense_Mutation_p.I74V	NM_032299.3	NP_115675.1	Q9BTE7	DCNL5_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 5	159	DCUN1. {ECO:0000255|PROSITE- ProRule:PRU00574}.									NS(1)|central_nervous_system(1)|endometrium(2)	4		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.00032)|Epithelial(105;0.0689)|all cancers(92;0.186)		GCAGTATCAATATCAAGGCTT	0.343																																					p.I159V		Atlas-SNP	.											.	DCUN1D5	11	.	0			c.A475G						.						71.0	70.0	71.0					11																	102937078		2202	4298	6500	SO:0001583	missense	84259	exon6			TATCAATATCAAG		CCDS8325.1	11q22.3	2013-06-10	2013-06-10		ENSG00000137692	ENSG00000137692			28409	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 5 (S. cerevisiae)"""			15988528	Standard	NM_032299		Approved	MGC2714, FLJ32431	uc001phm.3	Q9BTE7	OTTHUMG00000165822	ENST00000260247.5:c.475A>G	chr11.hg19:g.102937078T>C	ENSP00000260247:p.Ile159Val	176.0	0.0		162.0	53.0	NM_032299	Q3ZTT2	Missense_Mutation	SNP	ENST00000260247.5	hg19	CCDS8325.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.31|15.31	2.796290|2.796290	0.50208|0.50208	.|.	.|.	ENSG00000137692|ENSG00000137692	ENST00000260247;ENST00000531543|ENST00000527260	T|.	0.21191|.	2.02|.	5.9|5.9	5.9|5.9	0.94986|0.94986	Domain of unknown function DUF298 (2);|.	0.097389|.	0.64402|.	D|.	0.000001|.	T|T	0.56601|0.56601	0.1996|0.1996	L|L	0.31371|0.31371	0.925|0.925	0.50171|0.50171	D|D	0.999855|0.999855	B|.	0.25169|.	0.119|.	B|.	0.25614|.	0.062|.	T|T	0.52726|0.52726	-0.8537|-0.8537	10|5	0.49607|.	T|.	0.09|.	-22.6649|-22.6649	16.3246|16.3246	0.82970|0.82970	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	159|.	Q9BTE7|.	DCNL5_HUMAN|.	V|C	159;74|130	ENSP00000260247:I159V|.	ENSP00000260247:I159V|.	I|Y	-|-	1|2	0|0	DCUN1D5|DCUN1D5	102442288|102442288	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	4.046000|4.046000	0.57376|0.57376	2.256000|2.256000	0.74724|0.74724	0.528000|0.528000	0.53228|0.53228	ATT|TAT	.	.		0.343	DCUN1D5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386382.2	NM_032299	
NFRKB	4798	hgsc.bcm.edu	37	11	129745336	129745336	+	Silent	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr11:129745336C>T	ENST00000446488.3	-	17	1873	c.1770G>A	c.(1768-1770)ctG>ctA	p.L590L	NFRKB_ENST00000304521.5_Silent_p.L590L|NFRKB_ENST00000524746.1_Silent_p.L590L|NFRKB_ENST00000524794.1_Silent_p.L615L	NM_001143835.1	NP_001137307.1	Q6P4R8	NFRKB_HUMAN	nuclear factor related to kappaB binding protein	590					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protease binding (GO:0002020)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(13)|ovary(4)|skin(3)|urinary_tract(1)	32	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0167)|Lung(977;0.171)|LUSC - Lung squamous cell carcinoma(976;0.184)		CTCCATTAGGCAGTCGAGCCG	0.542																																					p.L615L		Atlas-SNP	.											.	NFRKB	101	.	0			c.G1845A						.						82.0	58.0	66.0					11																	129745336		2201	4297	6498	SO:0001819	synonymous_variant	4798	exon16			ATTAGGCAGTCGA		CCDS8483.1, CCDS44770.1	11q24-q25	2011-07-06			ENSG00000170322	ENSG00000170322		"""INO80 complex subunits"""	7802	protein-coding gene	gene with protein product	"""nuclear factor related to kappa B binding protein"", ""DNA-binding protein R kappa B"", ""INO80 complex subunit G"""	164013				1427843	Standard	NM_006165		Approved	DKFZp547B2013, INO80G	uc001qfg.3	Q6P4R8	OTTHUMG00000165761	ENST00000446488.3:c.1770G>A	chr11.hg19:g.129745336C>T		60.0	0.0		53.0	20.0	NM_006165	Q12869|Q15312|Q9H048	Silent	SNP	ENST00000446488.3	hg19	CCDS44770.1																																																																																			.	.		0.542	NFRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386063.2	NM_006165	
CLEC12B	387837	hgsc.bcm.edu	37	12	10163364	10163364	+	Silent	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:10163364T>C	ENST00000338896.5	+	1	134	c.6T>C	c.(4-6)tcT>tcC	p.S2S	CLEC12B_ENST00000396502.1_Silent_p.S2S|CLEC1B_ENST00000428126.2_Intron	NM_001129998.1	NP_001123470.1	Q2HXU8	CL12B_HUMAN	C-type lectin domain family 12, member B	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(2)|large_intestine(2)|lung(5)	9						CTACAATGTCTGAAGAAGTGA	0.398																																					p.S2S		Atlas-SNP	.											.	CLEC12B	25	.	0			c.T6C						.						52.0	50.0	51.0					12																	10163364		2203	4300	6503	SO:0001819	synonymous_variant	387837	exon1			AATGTCTGAAGAA	AK128243	CCDS8610.1, CCDS44830.1	12p13.2	2010-08-17			ENSG00000256660	ENSG00000256660		"""C-type lectin domain containing"""	31966	protein-coding gene	gene with protein product						17562706	Standard	NM_205852		Approved		uc001qwz.2	Q2HXU8	OTTHUMG00000168397	ENST00000338896.5:c.6T>C	chr12.hg19:g.10163364T>C		59.0	0.0		65.0	31.0	NM_001129998	Q6UWF2|Q6ZRG0	Silent	SNP	ENST00000338896.5	hg19	CCDS44830.1																																																																																			.	.		0.398	CLEC12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399554.2	NM_205852	
MAP3K12	7786	hgsc.bcm.edu	37	12	53879856	53879856	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:53879856C>G	ENST00000267079.2	-	5	931	c.706G>C	c.(706-708)Gat>Cat	p.D236H	MAP3K12_ENST00000547035.1_Missense_Mutation_p.D269H|MAP3K12_ENST00000547151.1_5'Flank|MAP3K12_ENST00000547488.1_Missense_Mutation_p.D269H	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	236	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GACTTGAGATCCCTGTGGATA	0.572																																					p.D269H		Atlas-SNP	.											.	MAP3K12	160	.	0			c.G805C						.						131.0	111.0	118.0					12																	53879856		2203	4300	6503	SO:0001583	missense	7786	exon4			TGAGATCCCTGTG	U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.706G>C	chr12.hg19:g.53879856C>G	ENSP00000267079:p.Asp236His	55.0	0.0		52.0	16.0	NM_001193511	B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	ENST00000267079.2	hg19	CCDS8860.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225734	0.79576	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	D;D;D	0.96491	-4.03;-4.03;-4.03	5.36	5.36	0.76844	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48286	D	0.000194	D	0.98912	0.9631	H	0.97682	4.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99429	1.0935	10	0.87932	D	0	.	18.2434	0.89977	0.0:1.0:0.0:0.0	.	269;236	G3V1Y2;Q12852	.;M3K12_HUMAN	H	236;269;269	ENSP00000267079:D236H;ENSP00000449038:D269H;ENSP00000448689:D269H	ENSP00000267079:D236H	D	-	1	0	MAP3K12	52166123	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.818000	0.86416	2.688000	0.91661	0.561000	0.74099	GAT	.	.		0.572	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406267.1	NM_006301	
HOXC8	3224	hgsc.bcm.edu	37	12	54405052	54405052	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:54405052A>G	ENST00000040584.4	+	2	853	c.616A>G	c.(616-618)Aag>Gag	p.K206E	RP11-834C11.12_ENST00000513209.1_Intron	NM_022658.3	NP_073149.1	P31273	HXC8_HUMAN	homeobox C8	206					anterior/posterior pattern specification (GO:0009952)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)	8						GAAGTGGAAAAAGGAGAACAA	0.478																																					p.K206E	GBM(197;701 2226 7002 18822 41696)	Atlas-SNP	.											.	HOXC8	15	.	0			c.A616G						.						89.0	92.0	91.0					12																	54405052		2203	4300	6503	SO:0001583	missense	3224	exon2			TGGAAAAAGGAGA	X99680	CCDS8870.1	12q13.13	2011-06-20	2005-12-22			ENSG00000037965		"""Homeoboxes / ANTP class : HOXL subclass"""	5129	protein-coding gene	gene with protein product		142970	"""homeo box C8"""	HOX3, HOX3A		1973146, 1358459	Standard	NM_022658		Approved		uc001ser.3	P31273		ENST00000040584.4:c.616A>G	chr12.hg19:g.54405052A>G	ENSP00000040584:p.Lys206Glu	69.0	0.0		50.0	16.0	NM_022658	A8K4J4|O15221|O15362	Missense_Mutation	SNP	ENST00000040584.4	hg19	CCDS8870.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.275785	0.80580	.	.	ENSG00000037965	ENST00000040584	D	0.96802	-4.13	5.31	5.31	0.75309	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98686	0.9559	H	0.96430	3.82	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.99701	1.1004	10	0.87932	D	0	.	14.5515	0.68070	1.0:0.0:0.0:0.0	.	206	P31273	HXC8_HUMAN	E	206	ENSP00000040584:K206E	ENSP00000040584:K206E	K	+	1	0	HOXC8	52691319	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.148000	0.66965	0.533000	0.62120	AAG	.	.		0.478	HOXC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358957.2		
MARS	4141	hgsc.bcm.edu	37	12	57908591	57908591	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:57908591A>G	ENST00000262027.5	+	16	2190	c.2056A>G	c.(2056-2058)Acc>Gcc	p.T686A	RN7SL312P_ENST00000582079.1_RNA|MARS_ENST00000315473.5_Missense_Mutation_p.T452A	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	686					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GGCCCATGTCACCCTGGAGCT	0.527																																					p.T686A		Atlas-SNP	.											.	MARS	84	.	0			c.A2056G						.						207.0	205.0	206.0					12																	57908591		2203	4300	6503	SO:0001583	missense	4141	exon16			CATGTCACCCTGG	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2056A>G	chr12.hg19:g.57908591A>G	ENSP00000262027:p.Thr686Ala	56.0	0.0		47.0	16.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	hg19	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.676943	0.29783	.	.	ENSG00000166986	ENST00000262027;ENST00000315473;ENST00000552914	T;T;T	0.40225	1.04;1.04;1.04	5.55	1.76	0.24704	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.482752	0.23069	N	0.052298	T	0.12263	0.0298	N	0.01446	-0.86	0.25157	N	0.990387	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.21586	-1.0241	10	0.14252	T	0.57	-11.7149	3.5131	0.07716	0.5466:0.0:0.1484:0.305	.	452;686	A6NC17;P56192	.;SYMC_HUMAN	A	686;452;42	ENSP00000262027:T686A;ENSP00000314653:T452A;ENSP00000449787:T42A	ENSP00000262027:T686A	T	+	1	0	MARS	56194858	0.974000	0.33945	0.840000	0.33206	0.998000	0.95712	0.786000	0.26844	0.413000	0.25759	0.482000	0.46254	ACC	.	.		0.527	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
TRHDE	29953	hgsc.bcm.edu	37	12	72936117	72936117	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:72936117T>C	ENST00000261180.4	+	7	1730	c.1634T>C	c.(1633-1635)gTt>gCt	p.V545A		NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	545					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						GGCCATTCAGTTTTCCAGAGG	0.303																																					p.V545A		Atlas-SNP	.											.	TRHDE	194	.	0			c.T1634C						.						116.0	113.0	114.0					12																	72936117		2203	4299	6502	SO:0001583	missense	29953	exon7			ATTCAGTTTTCCA	AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1634T>C	chr12.hg19:g.72936117T>C	ENSP00000261180:p.Val545Ala	65.0	0.0		55.0	23.0	NM_013381	A5PL19|Q6UWJ4	Missense_Mutation	SNP	ENST00000261180.4	hg19	CCDS9004.1	.	.	.	.	.	.	.	.	.	.	T	15.60	2.882023	0.51908	.	.	ENSG00000072657	ENST00000261180	T	0.04551	3.6	5.25	5.25	0.73442	.	0.144848	0.47455	D	0.000222	T	0.04679	0.0127	N	0.25825	0.765	0.47511	D	0.999447	B	0.25609	0.13	B	0.15870	0.014	T	0.48917	-0.8992	10	0.30854	T	0.27	.	15.4347	0.75137	0.0:0.0:0.0:1.0	.	545	Q9UKU6	TRHDE_HUMAN	A	545	ENSP00000261180:V545A	ENSP00000261180:V545A	V	+	2	0	TRHDE	71222384	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.764000	0.68826	2.104000	0.64026	0.459000	0.35465	GTT	.	.		0.303	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405380.1	NM_013381	
CCDC62	84660	hgsc.bcm.edu	37	12	123265875	123265875	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:123265875G>A	ENST00000253079.6	+	3	738	c.394G>A	c.(394-396)Gag>Aag	p.E132K	CCDC62_ENST00000537566.1_Intron|CCDC62_ENST00000392441.4_Missense_Mutation_p.E132K|CCDC62_ENST00000392440.2_Intron	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	132					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		TGAAGACCTTGAGGTTGGGAT	0.428																																					p.E132K		Atlas-SNP	.											.	CCDC62	119	.	0			c.G394A						.						105.0	97.0	99.0					12																	123265875		2203	4300	6503	SO:0001583	missense	84660	exon3			GACCTTGAGGTTG		CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.394G>A	chr12.hg19:g.123265875G>A	ENSP00000253079:p.Glu132Lys	69.0	0.0		96.0	36.0	NM_201435	A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	ENST00000253079.6	hg19	CCDS9238.1	.	.	.	.	.	.	.	.	.	.	G	17.15	3.317295	0.60524	.	.	ENSG00000130783	ENST00000253079;ENST00000392441	T;T	0.38401	1.14;1.14	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000003	T	0.59459	0.2195	M	0.72894	2.215	0.80722	D	1	D;D	0.76494	0.996;0.999	D;D	0.83275	0.919;0.996	T	0.56390	-0.7987	10	0.35671	T	0.21	-21.8044	16.6212	0.84931	0.0:0.0:1.0:0.0	.	132;132	Q6P9F0-2;Q6P9F0	.;CCD62_HUMAN	K	132	ENSP00000253079:E132K;ENSP00000376236:E132K	ENSP00000253079:E132K	E	+	1	0	CCDC62	121831828	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	4.572000	0.60886	2.527000	0.85204	0.557000	0.71058	GAG	.	.		0.428	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400930.1	NM_032573	
SBNO1	55206	hgsc.bcm.edu	37	12	123834937	123834937	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:123834937T>C	ENST00000602398.1	-	2	179	c.52A>G	c.(52-54)Att>Gtt	p.I18V	Y_RNA_ENST00000384460.1_RNA|SBNO1_ENST00000267176.4_Missense_Mutation_p.I18V|SBNO1_ENST00000420886.2_Missense_Mutation_p.I18V|SBNO1_ENST00000602750.1_Missense_Mutation_p.I18V			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	18					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		TTCGGACTAATTCCACTCTCA	0.413																																					p.I18V		Atlas-SNP	.											.	SBNO1	138	.	0			c.A52G						.						222.0	222.0	222.0					12																	123834937		2203	4300	6503	SO:0001583	missense	55206	exon1			GACTAATTCCACT	AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.52A>G	chr12.hg19:g.123834937T>C	ENSP00000473665:p.Ile18Val	100.0	0.0		101.0	39.0	NM_001167856	Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Missense_Mutation	SNP	ENST00000602398.1	hg19	CCDS53844.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.360602	0.61403	.	.	ENSG00000139697	ENST00000420886;ENST00000267176;ENST00000442601	T;T	0.34667	1.36;1.35	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.45558	0.1348	L	0.34521	1.04	0.49483	D	0.999793	P;P;P	0.43314	0.803;0.65;0.65	P;P;P	0.55824	0.785;0.658;0.658	T	0.23940	-1.0174	10	0.34782	T	0.22	-24.8406	16.1026	0.81194	0.0:0.0:0.0:1.0	.	18;18;18	A3KN83;A3KN83-2;A3KN83-3	SBNO1_HUMAN;.;.	V	18	ENSP00000387361:I18V;ENSP00000267176:I18V	ENSP00000267176:I18V	I	-	1	0	SBNO1	122400890	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.898000	0.75676	2.198000	0.70561	0.383000	0.25322	ATT	.	.		0.413	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467684.1	NM_018183	
ZNF140	7699	hgsc.bcm.edu	37	12	133683150	133683150	+	Silent	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:133683150T>C	ENST00000355557.2	+	5	2570	c.1287T>C	c.(1285-1287)gcT>gcC	p.A429A	ZNF140_ENST00000440550.2_3'UTR|ZNF140_ENST00000544426.1_Silent_p.A326A	NM_003440.2	NP_003431.2	P52738	ZN140_HUMAN	zinc finger protein 140	429					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.114)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CAAACCTTGCTAAACATCAGA	0.398																																					p.A429A		Atlas-SNP	.											.	ZNF140	18	.	0			c.T1287C						.						79.0	77.0	78.0					12																	133683150		2203	4297	6500	SO:0001819	synonymous_variant	7699	exon5			CCTTGCTAAACAT	U09368	CCDS9282.1, CCDS73550.1	12q24.33	2013-01-08	2006-06-13		ENSG00000196387	ENSG00000196387		"""Zinc fingers, C2H2-type"", ""-"""	12925	protein-coding gene	gene with protein product		604082	"""zinc finger protein 140 (clone pHZ-39)"""			7557990	Standard	XR_245353		Approved	pHZ-39	uc001ulo.3	P52738	OTTHUMG00000167942	ENST00000355557.2:c.1287T>C	chr12.hg19:g.133683150T>C		33.0	0.0		34.0	14.0	NM_003440	D3DXJ3|Q05CP6|Q8IV75	Silent	SNP	ENST00000355557.2	hg19	CCDS9282.1																																																																																			.	.		0.398	ZNF140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397169.1	NM_003440	
PCDH8	5100	hgsc.bcm.edu	37	13	53422358	53422358	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr13:53422358A>T	ENST00000377942.3	-	1	417	c.214T>A	c.(214-216)Tct>Act	p.S72T	PCDH8_ENST00000338862.4_Missense_Mutation_p.S72T	NM_002590.3	NP_002581.2	O95206	PCDH8_HUMAN	protocadherin 8	72	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell-cell signaling (GO:0007267)|homophilic cell adhesion (GO:0007156)|morphogenesis of embryonic epithelium (GO:0016331)|somitogenesis (GO:0001756)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(23)|ovary(1)|skin(1)|urinary_tract(1)	36		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		CGGAGCAGAGAGCTGTTGAAT	0.677																																					p.S72T	GBM(36;25 841 9273 49207)	Atlas-SNP	.											.	PCDH8	95	.	0			c.T214A						.						73.0	74.0	74.0					13																	53422358		2203	4300	6503	SO:0001583	missense	5100	exon1			GCAGAGAGCTGTT	AF061573	CCDS9438.1, CCDS9439.1	13q21.1	2010-02-22			ENSG00000136099	ENSG00000136099		"""Cadherins / Protocadherins : Non-clustered"""	8660	protein-coding gene	gene with protein product		603580				9787079, 9315676	Standard	NM_002590		Approved	PAPC, ARCADLIN	uc001vhi.3	O95206	OTTHUMG00000016979	ENST00000377942.3:c.214T>A	chr13.hg19:g.53422358A>T	ENSP00000367177:p.Ser72Thr	48.0	0.0		39.0	16.0	NM_032949	B4DMV7|Q5TAN1|Q5TAN2|Q8IYE9|Q96SF1	Missense_Mutation	SNP	ENST00000377942.3	hg19	CCDS9438.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.040389	0.75732	.	.	ENSG00000136099	ENST00000377942;ENST00000338862;ENST00000418407;ENST00000448969	T;T	0.27557	1.66;1.66	4.99	4.99	0.66335	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.39083	N	0.001478	T	0.55986	0.1955	M	0.77486	2.375	0.52501	D	0.999957	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.57619	-0.7780	10	0.39692	T	0.17	.	14.7172	0.69277	1.0:0.0:0.0:0.0	.	72;72	O95206-2;O95206	.;PCDH8_HUMAN	T	72	ENSP00000367177:S72T;ENSP00000341350:S72T	ENSP00000341350:S72T	S	-	1	0	PCDH8	52320359	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.473000	0.81007	1.895000	0.54865	0.459000	0.35465	TCT	.	.		0.677	PCDH8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045108.2	NM_002590	
CUL4A	8451	hgsc.bcm.edu	37	13	113900301	113900301	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr13:113900301T>C	ENST00000375440.4	+	15	1646	c.1562T>C	c.(1561-1563)aTa>aCa	p.I521T	CUL4A_ENST00000326335.4_Missense_Mutation_p.I421T|CUL4A_ENST00000375441.3_Missense_Mutation_p.I421T|CUL4A_ENST00000451881.1_Missense_Mutation_p.I421T	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	521					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			TCAGGCCCTATAGACCTCACA	0.398																																					p.I521T		Atlas-SNP	.											.	CUL4A	50	.	0			c.T1562C						.						96.0	79.0	84.0					13																	113900301		2203	4300	6503	SO:0001583	missense	8451	exon15			GCCCTATAGACCT	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.1562T>C	chr13.hg19:g.113900301T>C	ENSP00000364589:p.Ile521Thr	96.0	0.0		103.0	41.0	NM_001008895	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	hg19	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.883415	0.51908	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86	4.97	4.97	0.65823	Cullin, N-terminal (1);Cullin homology (3);	0.045201	0.85682	D	0.000000	D	0.86826	0.6026	M	0.89095	3.005	0.80722	D	1	B;B	0.30542	0.284;0.284	P;P	0.50231	0.635;0.635	D	0.87681	0.2547	10	0.59425	D	0.04	-37.075	14.9369	0.70964	0.0:0.0:0.0:1.0	.	521;521	Q13619;A8MSH7	CUL4A_HUMAN;.	T	421;421;421;521	ENSP00000364590:I421T;ENSP00000389118:I421T;ENSP00000322132:I421T;ENSP00000364589:I521T	ENSP00000322132:I421T	I	+	2	0	CUL4A	112948302	1.000000	0.71417	0.049000	0.19019	0.322000	0.28314	7.837000	0.86796	1.978000	0.57642	0.455000	0.32223	ATA	.	.		0.398	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589	
RAB15	376267	hgsc.bcm.edu	37	14	65418368	65418368	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr14:65418368G>T	ENST00000533601.2	-	3	536	c.199C>A	c.(199-201)Cag>Aag	p.Q67K	CHURC1-FNTB_ENST00000549987.1_Intron|FNTB_ENST00000542227.1_Intron|RAB15_ENST00000426039.3_Missense_Mutation_p.Q21K|FNTB_ENST00000447296.2_Intron|RAB15_ENST00000436278.2_Missense_Mutation_p.Q21K|RAB15_ENST00000267512.5_Missense_Mutation_p.Q67K			P59190	RAB15_HUMAN	RAB15, member RAS oncogene family	67					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|large_intestine(2)|lung(4)|ovary(1)	8				all cancers(60;0.00136)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.0102)		TATCTCTCCTGCCCTGCAGTG	0.587																																					p.Q67K		Atlas-SNP	.											.	RAB15	23	.	0			c.C199A						.						129.0	100.0	110.0					14																	65418368		2203	4300	6503	SO:0001583	missense	376267	exon3			TCTCCTGCCCTGC	BC014511	CCDS9768.1	14q23.2	2012-02-28	2012-02-28		ENSG00000139998	ENSG00000139998		"""RAB, member RAS oncogene"""	20150	protein-coding gene	gene with protein product						11697911	Standard	NM_198686		Approved		uc001xhz.2	P59190	OTTHUMG00000142810	ENST00000533601.2:c.199C>A	chr14.hg19:g.65418368G>T	ENSP00000434103:p.Gln67Lys	97.0	0.0		65.0	24.0	NM_198686	G5EMR7|Q86TX7|Q8IW89	Missense_Mutation	SNP	ENST00000533601.2	hg19		.	.	.	.	.	.	.	.	.	.	G	26.6	4.750467	0.89753	.	.	ENSG00000139998	ENST00000267512;ENST00000533601;ENST00000426039;ENST00000554593	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	5.46	5.46	0.80206	.	0.000000	0.35677	N	0.003053	D	0.92854	0.7727	M	0.91612	3.225	0.42181	D	0.991686	D	0.76494	0.999	D	0.68765	0.96	D	0.94343	0.7572	10	0.87932	D	0	.	18.0769	0.89430	0.0:0.0:1.0:0.0	.	67	P59190-2	.	K	67;67;21;21	ENSP00000267512:Q67K;ENSP00000434103:Q67K;ENSP00000433485:Q21K;ENSP00000452195:Q21K	ENSP00000267512:Q67K	Q	-	1	0	RAB15	64488121	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	9.084000	0.94076	2.556000	0.86216	0.561000	0.74099	CAG	.	.		0.587	RAB15-003	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000390443.2	NM_198686	
SETD3	84193	hgsc.bcm.edu	37	14	99865113	99865113	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr14:99865113G>C	ENST00000331768.5	-	13	1847	c.1688C>G	c.(1687-1689)aCc>aGc	p.T563S		NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	563					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				TTCGGACCTGGTCCCATTAGG	0.468																																					p.T563S		Atlas-SNP	.											.	SETD3	56	.	0			c.C1688G						.						239.0	212.0	221.0					14																	99865113		2203	4300	6503	SO:0001583	missense	84193	exon13			GACCTGGTCCCAT	AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.1688C>G	chr14.hg19:g.99865113G>C	ENSP00000327436:p.Thr563Ser	110.0	0.0		72.0	23.0	NM_032233	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Missense_Mutation	SNP	ENST00000331768.5	hg19	CCDS9951.1	.	.	.	.	.	.	.	.	.	.	G	8.566	0.878911	0.17395	.	.	ENSG00000183576	ENST00000331768	T	0.14516	2.5	5.19	4.28	0.50868	.	0.228496	0.43579	N	0.000547	T	0.19167	0.0460	M	0.65498	2.005	0.80722	D	1	B	0.17038	0.02	B	0.19148	0.024	T	0.02411	-1.1163	10	0.52906	T	0.07	-7.8795	15.6068	0.76679	0.0:0.138:0.862:0.0	.	563	Q86TU7	SETD3_HUMAN	S	563	ENSP00000327436:T563S	ENSP00000327436:T563S	T	-	2	0	SETD3	98934866	1.000000	0.71417	0.192000	0.23308	0.103000	0.19146	3.092000	0.50207	1.153000	0.42468	0.655000	0.94253	ACC	.	.		0.468	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072339.3	NM_032233	
RCOR1	23186	hgsc.bcm.edu	37	14	103188603	103188603	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr14:103188603T>G	ENST00000570597.1	+	11	1260	c.1260T>G	c.(1258-1260)ttT>ttG	p.F420L	RCOR1_ENST00000262241.6_Missense_Mutation_p.F423L			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	420	SANT 2. {ECO:0000255|PROSITE- ProRule:PRU00624}.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						TGAAAAACTTTTTTGTAAATT	0.413																																					p.F423L		Atlas-SNP	.											.	RCOR1	39	.	0			c.T1269G						.						86.0	91.0	89.0					14																	103188603		2203	4300	6503	SO:0001583	missense	23186	exon11			AAACTTTTTTGTA	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.1260T>G	chr14.hg19:g.103188603T>G	ENSP00000459789:p.Phe420Leu	348.0	0.0		371.0	114.0	NM_015156	Q15044|Q6P2I9|Q86VG5	Missense_Mutation	SNP	ENST00000570597.1	hg19		.	.	.	.	.	.	.	.	.	.	T	25.2	4.616586	0.87359	.	.	ENSG00000089902	ENST00000262241	.	.	.	5.74	2.05	0.26809	Myb, DNA-binding (1);SANT domain, DNA binding (1);Homeodomain-related (1);Homeodomain-like (1);SANT, eukarya (1);	0.000000	0.85682	D	0.000000	T	0.76321	0.3971	M	0.80982	2.52	0.80722	D	1	D	0.67145	0.996	D	0.76071	0.987	T	0.75246	-0.3385	9	0.87932	D	0	-17.6519	9.4748	0.38864	0.0:0.2018:0.0:0.7982	.	420	Q9UKL0	RCOR1_HUMAN	L	420	.	ENSP00000262241:F420L	F	+	3	2	RCOR1	102258356	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.385000	0.34408	0.111000	0.17947	0.533000	0.62120	TTT	.	.		0.413	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015156	
OCA2	4948	hgsc.bcm.edu	37	15	28326852	28326852	+	Missense_Mutation	SNP	C	C	T	rs372901106		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr15:28326852C>T	ENST00000354638.3	-	2	324	c.169G>A	c.(169-171)Ggg>Agg	p.G57R	OCA2_ENST00000382996.2_Missense_Mutation_p.G57R|OCA2_ENST00000353809.5_Missense_Mutation_p.G57R	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	57					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.G57W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GAGCTCTGCCCGGCAGCCCCC	0.607									Oculocutaneous Albinism																												p.G57R		Atlas-SNP	.											OCA2,NS,carcinoma,0,1	OCA2	173	.	1	Substitution - Missense(1)	lung(1)	c.G169A						.	C	ARG/GLY	2,4404	4.2+/-10.8	0,2,2201	36.0	35.0	35.0		169	-0.3	0.0	15		35	0,8600		0,0,4300	no	missense	OCA2	NM_000275.2	125	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	57/839	28326852	2,13004	2203	4300	6503	SO:0001583	missense	4948	exon2	Familial Cancer Database		TCTGCCCGGCAGC		CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.169G>A	chr15.hg19:g.28326852C>T	ENSP00000346659:p.Gly57Arg	144.0	1.0		142.0	7.0	NM_000275	Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	ENST00000354638.3	hg19	CCDS10020.1	.	.	.	.	.	.	.	.	.	.	C	9.349	1.065049	0.20067	4.54E-4	0.0	ENSG00000104044	ENST00000354638;ENST00000353809;ENST00000382996;ENST00000445578;ENST00000431101	D;D;D;D;D	0.96619	-3.31;-3.63;-3.34;-4.07;-2.78	2.82	-0.268	0.12934	.	0.398052	0.21970	N	0.066479	D	0.90611	0.7056	L	0.54323	1.7	0.09310	N	1	B;B	0.28667	0.219;0.14	B;B	0.21360	0.034;0.015	T	0.78409	-0.2215	10	0.07813	T	0.8	-0.5995	4.9821	0.14170	0.0:0.4427:0.4272:0.1301	.	57;57	Q04671-2;Q04671	.;P_HUMAN	R	57	ENSP00000346659:G57R;ENSP00000261276:G57R;ENSP00000372457:G57R;ENSP00000414425:G57R;ENSP00000415431:G57R	ENSP00000261276:G57R	G	-	1	0	OCA2	26000447	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.018000	0.12568	-0.033000	0.13736	-0.386000	0.06593	GGG	.	.		0.607	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250823.1	NM_000275	
CSPG4	1464	hgsc.bcm.edu	37	15	75980591	75980591	+	Silent	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr15:75980591G>T	ENST00000308508.5	-	3	2907	c.2815C>A	c.(2815-2817)Cgg>Agg	p.R939R		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	939	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.|Interaction with COL6A2. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGGCGGGGCCGCTCCATGACC	0.587																																					p.R939R		Atlas-SNP	.											.	CSPG4	175	.	0			c.C2815A						.						75.0	78.0	77.0					15																	75980591		2193	4282	6475	SO:0001819	synonymous_variant	1464	exon3			GGGGCCGCTCCAT	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.2815C>A	chr15.hg19:g.75980591G>T		59.0	0.0		45.0	14.0	NM_001897	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	hg19	CCDS10284.1																																																																																			.	.		0.587	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
SCAPER	49855	hgsc.bcm.edu	37	15	77154760	77154760	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr15:77154760C>A	ENST00000563290.1	-	3	216	c.121G>T	c.(121-123)Gat>Tat	p.D41Y	SCAPER_ENST00000324767.7_Missense_Mutation_p.D41Y|SCAPER_ENST00000538941.2_5'Flank			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	41						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)	p.D40Y(1)		NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TACATACCATCATCATCTTTG	0.353																																					p.D41Y		Atlas-SNP	.											SCAPER,colon,carcinoma,0,1	SCAPER	160	.	1	Substitution - Missense(1)	large_intestine(1)	c.G121T						.						97.0	88.0	91.0					15																	77154760		1833	4087	5920	SO:0001583	missense	49855	exon2			TACCATCATCATC	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.121G>T	chr15.hg19:g.77154760C>A	ENSP00000454973:p.Asp41Tyr	57.0	0.0		58.0	17.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.661629	0.88154	.	.	ENSG00000140386	ENST00000324767	T	0.25414	1.8	6.08	6.08	0.98989	.	0.102270	0.64402	D	0.000003	T	0.41119	0.1145	L	0.38175	1.15	0.58432	D	0.999999	D;D	0.60575	0.988;0.983	P;P	0.58873	0.847;0.837	T	0.08249	-1.0731	10	0.87932	D	0	.	20.2672	0.98462	0.0:1.0:0.0:0.0	.	41;56	Q6NSF1;Q9BY12-2	.;.	Y	41	ENSP00000326924:D41Y	ENSP00000326924:D41Y	D	-	1	0	SCAPER	74941815	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.237000	0.78164	2.894000	0.99253	0.591000	0.81541	GAT	.	.		0.353	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
ANPEP	290	hgsc.bcm.edu	37	15	90344728	90344728	+	Silent	SNP	G	G	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr15:90344728G>C	ENST00000300060.6	-	11	1993	c.1680C>G	c.(1678-1680)acC>acG	p.T560T	ANPEP_ENST00000558177.1_5'UTR	NM_001150.2	NP_001141.2	P15144	AMPN_HUMAN	alanyl (membrane) aminopeptidase	560	Metalloprotease.				angiogenesis (GO:0001525)|angiotensin maturation (GO:0002003)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|viral process (GO:0016032)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|receptor activity (GO:0004872)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	57	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)|Icatibant(DB06196)	CCTGGGAAAGGGTCCCCGTGC	0.602																																					p.T560T	NSCLC(30;827 977 2459 19669 26125)	Atlas-SNP	.											.	ANPEP	124	.	0			c.C1680G						.						115.0	108.0	111.0					15																	90344728		2200	4299	6499	SO:0001819	synonymous_variant	290	exon11			GGAAAGGGTCCCC	M22324	CCDS10356.1	15q25-q26	2008-07-31	2008-07-31		ENSG00000166825	ENSG00000166825	3.4.11.2	"""CD molecules"""	500	protein-coding gene	gene with protein product	"""aminopeptidase N"", ""aminopeptidase M"", ""microsomal aminopeptidase"""	151530		CD13, PEPN		2428842, 1977688	Standard	NM_001150		Approved	LAP1, gp150, p150	uc002bop.4	P15144	OTTHUMG00000149814	ENST00000300060.6:c.1680C>G	chr15.hg19:g.90344728G>C		138.0	0.0		131.0	39.0	NM_001150	Q16728|Q6GT90|Q8IUK3|Q8IVH3|Q9UCE0	Silent	SNP	ENST00000300060.6	hg19	CCDS10356.1																																																																																			.	.		0.602	ANPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313425.1		
MPG	4350	hgsc.bcm.edu	37	16	129606	129606	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr16:129606C>G	ENST00000219431.4	+	3	453	c.222C>G	c.(220-222)atC>atG	p.I74M	MPG_ENST00000475280.1_3'UTR|MPG_ENST00000397817.1_Missense_Mutation_p.I57M	NM_002434.3	NP_002425.2	P29372	3MG_HUMAN	N-methylpurine-DNA glycosylase	74					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depurination (GO:0045007)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)	alkylbase DNA N-glycosylase activity (GO:0003905)|damaged DNA binding (GO:0003684)|DNA-3-methyladenine glycosylase activity (GO:0008725)|DNA-3-methylguanine glycosylase activity (GO:0052822)|DNA-7-methyladenine glycosylase activity (GO:0052821)|DNA-7-methylguanine glycosylase activity (GO:0043916)			endometrium(4)|kidney(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9		all_cancers(16;9.01e-08)|all_epithelial(16;7.64e-07)|Hepatocellular(780;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				ACCGCAGCATCTATTTCTCAA	0.642								Base excision repair (BER), DNA glycosylases																													p.I74M		Atlas-SNP	.											.	MPG	26	.	0			c.C222G						.						29.0	36.0	33.0					16																	129606		2190	4297	6487	SO:0001583	missense	4350	exon3			CAGCATCTATTTC		CCDS32345.1, CCDS32346.1, CCDS42087.1	16p13.3	2008-07-29			ENSG00000103152	ENSG00000103152	3.2.2.21		7211	protein-coding gene	gene with protein product	"""alkyladenine DNA glycosylase"""	156565				1874728	Standard	NM_002434		Approved	MDG	uc002cfo.4	P29372	OTTHUMG00000047887	ENST00000219431.4:c.222C>G	chr16.hg19:g.129606C>G	ENSP00000219431:p.Ile74Met	105.0	0.0		97.0	27.0	NM_002434	G5E9E2|Q13770|Q15275|Q15961|Q5J9I4|Q96BZ6|Q96S33|Q9NNX5	Missense_Mutation	SNP	ENST00000219431.4	hg19	CCDS32346.1	.	.	.	.	.	.	.	.	.	.	c	11.68	1.709645	0.30322	.	.	ENSG00000103152	ENST00000436333;ENST00000397817;ENST00000356432;ENST00000219431	T;T;T;T	0.10573	2.86;3.03;3.01;3.01	5.12	2.06	0.26882	.	0.729988	0.13434	N	0.388187	T	0.10337	0.0253	L	0.36672	1.1	0.24063	N	0.996005	P;P;P	0.51240	0.943;0.943;0.943	B;P;P	0.47430	0.428;0.466;0.547	T	0.19321	-1.0309	10	0.42905	T	0.14	-8.5521	4.0102	0.09619	0.3554:0.4666:0.0:0.178	.	57;69;74	A2IDA3;Q5J9I4;P29372	.;.;3MG_HUMAN	M	57;57;69;74	ENSP00000388097:I57M;ENSP00000380918:I57M;ENSP00000348809:I69M;ENSP00000219431:I74M	ENSP00000219431:I74M	I	+	3	3	MPG	69606	0.998000	0.40836	0.848000	0.33437	0.210000	0.24377	0.354000	0.20146	0.302000	0.22762	0.556000	0.70494	ATC	.	.		0.642	MPG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109121.4		
CLN3	1201	hgsc.bcm.edu	37	16	28495439	28495439	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr16:28495439G>A	ENST00000569430.1	-	11	1497	c.678C>T	c.(676-678)agC>agT	p.S226S	CLN3_ENST00000354630.5_Splice_Site_p.S226S|CLN3_ENST00000568224.1_Splice_Site_p.S148S|CLN3_ENST00000567963.1_Splice_Site_p.S226S|CLN3_ENST00000355477.5_Splice_Site_p.S178S|CLN3_ENST00000395653.4_Splice_Site_p.S126S|CLN3_ENST00000357857.9_Splice_Site_p.S172S|CLN3_ENST00000333496.9_Splice_Site_p.S202S|CLN3_ENST00000357076.5_Intron|CLN3_ENST00000565316.1_Splice_Site_p.S226S|CLN3_ENST00000357806.7_Splice_Site_p.C127C|CLN3_ENST00000359984.7_Splice_Site_p.S226S|CLN3_ENST00000360019.2_Splice_Site_p.S226S|CLN3_ENST00000535392.1_Splice_Site_p.S148S			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3	226					action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						ACAAGAAATAGCTAGGAGTAG	0.582																																					p.S226S		Atlas-SNP	.											.	CLN3	33	.	0			c.C678T						.						36.0	36.0	36.0					16																	28495439		2197	4300	6497	SO:0001630	splice_region_variant	1201	exon10			GAAATAGCTAGGA	U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.678-1C>T	chr16.hg19:g.28495439G>A		49.0	0.0		44.0	13.0	NM_001042432	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	Silent	SNP	ENST00000569430.1	hg19	CCDS10632.1																																																																																			.	.		0.582	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214115.2		Silent
SLC7A6OS	84138	hgsc.bcm.edu	37	16	68335257	68335257	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr16:68335257T>A	ENST00000263997.6	-	5	869	c.851A>T	c.(850-852)cAg>cTg	p.Q284L	SLC7A6_ENST00000219343.6_3'UTR|SLC7A6_ENST00000566454.1_3'UTR	NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand	284					hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		CCACATCCGCTGTCTGCTGCT	0.522																																					p.Q284L		Atlas-SNP	.											.	SLC7A6OS	22	.	0			c.A851T						.						193.0	150.0	164.0					16																	68335257		2198	4300	6498	SO:0001583	missense	84138	exon5			ATCCGCTGTCTGC		CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558	ENST00000263997.6:c.851A>T	chr16.hg19:g.68335257T>A	ENSP00000263997:p.Gln284Leu	49.0	0.0		43.0	11.0	NM_032178	Q8TCZ3|Q9H8R8	Missense_Mutation	SNP	ENST00000263997.6	hg19	CCDS10865.1	.	.	.	.	.	.	.	.	.	.	T	7.281	0.609100	0.14066	.	.	ENSG00000103061	ENST00000263997	T	0.18657	2.2	5.72	-1.51	0.08664	.	1.047410	0.07417	N	0.893357	T	0.15609	0.0376	L	0.36672	1.1	0.09310	N	1	B	0.19817	0.039	B	0.19391	0.025	T	0.38585	-0.9654	10	0.20519	T	0.43	-29.9379	8.9266	0.35643	0.0:0.4654:0.2327:0.3019	.	284	Q96CW6	S7A6O_HUMAN	L	284	ENSP00000263997:Q284L	ENSP00000263997:Q284L	Q	-	2	0	SLC7A6OS	66892758	0.003000	0.15002	0.001000	0.08648	0.039000	0.13416	-0.078000	0.11375	-0.532000	0.06332	-0.256000	0.11100	CAG	.	.		0.522	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268894.3	NM_032178	
MVD	4597	hgsc.bcm.edu	37	16	88721205	88721205	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr16:88721205G>A	ENST00000301012.3	-	8	937	c.908C>T	c.(907-909)aCc>aTc	p.T303I	MVD_ENST00000568709.1_5'Flank	NM_002461.1	NP_002452.1	P53602	MVD1_HUMAN	mevalonate (diphospho) decarboxylase	303					cellular protein metabolic process (GO:0044267)|cholesterol biosynthetic process (GO:0006695)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|positive regulation of cell proliferation (GO:0008284)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|diphosphomevalonate decarboxylase activity (GO:0004163)|Hsp70 protein binding (GO:0030544)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(1)|lung(7)|ovary(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.0478)		CGCGTCAAAGGTGTACGCCAC	0.622																																					p.T303I		Atlas-SNP	.											.	MVD	27	.	0			c.C908T						.						88.0	72.0	78.0					16																	88721205		2198	4300	6498	SO:0001583	missense	4597	exon8			TCAAAGGTGTACG	U49260	CCDS10968.1	16q24.3	2010-04-29			ENSG00000167508	ENSG00000167508	4.1.1.33		7529	protein-coding gene	gene with protein product	"""mevalonate pyrophosphate decarboxylase"""	603236				8626466	Standard	NM_002461		Approved	MPD	uc002flg.1	P53602	OTTHUMG00000137865	ENST00000301012.3:c.908C>T	chr16.hg19:g.88721205G>A	ENSP00000301012:p.Thr303Ile	66.0	0.0		74.0	26.0	NM_002461	Q53Y65	Missense_Mutation	SNP	ENST00000301012.3	hg19	CCDS10968.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.96|14.96	2.690649|2.690649	0.48097|0.48097	.|.	.|.	ENSG00000167508|ENSG00000167508	ENST00000378400|ENST00000301012	.|T	.|0.62788	.|-0.0	4.38|4.38	4.38|4.38	0.52667|0.52667	.|.	.|0.108077	.|0.64402	.|D	.|0.000007	D|D	0.82563|0.82563	0.5064|0.5064	H|H	0.95645|0.95645	3.7|3.7	0.54753|0.54753	D|D	0.999983|0.999983	.|D	.|0.89917	.|1.0	.|D	.|0.81914	.|0.995	D|D	0.85628|0.85628	0.1268|0.1268	6|10	0.87932|0.87932	D|D	0|0	-3.199|-3.199	8.6575|8.6575	0.34073|0.34073	0.0845:0.1522:0.7634:0.0|0.0845:0.1522:0.7634:0.0	.|.	.|303	.|P53602	.|MVD1_HUMAN	S|I	131|303	.|ENSP00000301012:T303I	ENSP00000367653:P131S|ENSP00000301012:T303I	P|T	-|-	1|2	0|0	MVD|MVD	87248706|87248706	0.998000|0.998000	0.40836|0.40836	0.939000|0.939000	0.37840|0.37840	0.506000|0.506000	0.33950|0.33950	2.610000|2.610000	0.46325|0.46325	2.156000|2.156000	0.67533|0.67533	0.491000|0.491000	0.48974|0.48974	CCT|ACC	.	.		0.622	MVD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269547.2	NM_002461	
DVL2	1856	hgsc.bcm.edu	37	17	7137429	7137429	+	Silent	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr17:7137429C>A	ENST00000005340.5	-	1	435	c.153G>T	c.(151-153)gcG>gcT	p.A51A	PHF23_ENST00000570753.1_5'Flank|DVL2_ENST00000575458.1_Silent_p.A51A	NM_004422.2	NP_004413.1	O14641	DVL2_HUMAN	dishevelled segment polarity protein 2	51	DIX. {ECO:0000255|PROSITE- ProRule:PRU00069}.				canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration in hindbrain (GO:0021535)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|hippo signaling (GO:0035329)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|segment specification (GO:0007379)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|cell cortex (GO:0005938)|clathrin-coated endocytic vesicle (GO:0045334)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|identical protein binding (GO:0042802)			breast(2)|endometrium(3)|kidney(1)|large_intestine(11)|lung(7)|skin(1)	25						ACTTGGCGCCCGCGGGCCGCT	0.597																																					p.A51A		Atlas-SNP	.											.	DVL2	49	.	0			c.G153T						.						99.0	118.0	112.0					17																	7137429		2203	4300	6503	SO:0001819	synonymous_variant	1856	exon1			GGCGCCCGCGGGC	BC014844	CCDS11091.1	17p13.1	2013-05-22	2013-05-22		ENSG00000004975	ENSG00000004975		"""Dishevelled homologs"""	3086	protein-coding gene	gene with protein product		602151	"""dishevelled 2 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 2 (Drosophila)"""			8662242	Standard	NM_004422		Approved		uc002gez.1	O14641	OTTHUMG00000102155	ENST00000005340.5:c.153G>T	chr17.hg19:g.7137429C>A		81.0	0.0		37.0	22.0	NM_004422	D3DTN3|Q53XM0	Silent	SNP	ENST00000005340.5	hg19	CCDS11091.1																																																																																			.	.		0.597	DVL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219999.2	NM_004422	
MRPL45	84311	hgsc.bcm.edu	37	17	36476595	36476595	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr17:36476595A>T	ENST00000312513.5	+	6	765	c.604A>T	c.(604-606)Atg>Ttg	p.M202L		NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	202						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTGTTCAAGTATGATGAACCA	0.512																																					p.M202L		Atlas-SNP	.											.	MRPL45	27	.	0			c.A604T						.						212.0	190.0	197.0					17																	36476595		2203	4300	6503	SO:0001583	missense	84311	exon6			TCAAGTATGATGA	BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.604A>T	chr17.hg19:g.36476595A>T	ENSP00000308901:p.Met202Leu	58.0	0.0		69.0	16.0	NM_032351	A1L436|Q6ZMJ5	Missense_Mutation	SNP	ENST00000312513.5	hg19	CCDS11326.1	.	.	.	.	.	.	.	.	.	.	A	9.689	1.151436	0.21371	.	.	ENSG00000174100	ENST00000312513	T	0.75589	-0.95	5.53	-3.36	0.04913	.	0.314836	0.35615	N	0.003086	T	0.44603	0.1301	N	0.12961	0.28	0.22710	N	0.998822	B	0.02656	0.0	B	0.06405	0.002	T	0.44726	-0.9309	10	0.02654	T	1	-1.7728	7.9544	0.30033	0.711:0.1299:0.0819:0.0773	.	202	Q9BRJ2	RM45_HUMAN	L	202	ENSP00000308901:M202L	ENSP00000308901:M202L	M	+	1	0	MRPL45	33730122	0.000000	0.05858	0.004000	0.12327	0.350000	0.29205	-0.084000	0.11268	-0.345000	0.08325	-0.666000	0.03841	ATG	.	.		0.512	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256792.3	NM_032351	
ACBD4	79777	hgsc.bcm.edu	37	17	43213538	43213538	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr17:43213538G>T	ENST00000376955.4	+	2	324	c.27G>T	c.(25-27)gaG>gaT	p.E9D	ACBD4_ENST00000586346.1_Missense_Mutation_p.E9D|ACBD4_ENST00000431281.1_Missense_Mutation_p.E9D|ACBD4_ENST00000591859.1_Missense_Mutation_p.E9D|ACBD4_ENST00000321854.8_Missense_Mutation_p.E9D|ACBD4_ENST00000592162.1_Missense_Mutation_p.E9D|ACBD4_ENST00000398322.3_Missense_Mutation_p.E9D	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4	9							fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			kidney(1)|lung(3)|ovary(1)	5						AAAGCCCAGAGCCCGACTGCC	0.612																																					p.E9D		Atlas-SNP	.											.	ACBD4	51	.	0			c.G27T						.						34.0	41.0	39.0					17																	43213538		2016	4174	6190	SO:0001583	missense	79777	exon2			CCCAGAGCCCGAC	BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.27G>T	chr17.hg19:g.43213538G>T	ENSP00000366154:p.Glu9Asp	54.0	0.0		84.0	14.0	NM_001135707	D3DX64|Q8IUT1|Q9H8Q4	Missense_Mutation	SNP	ENST00000376955.4	hg19	CCDS45711.1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.128433	0.77549	.	.	ENSG00000181513	ENST00000431281;ENST00000321854;ENST00000398322;ENST00000376955	T;T;T;T	0.16597	2.37;2.61;2.61;2.33	5.94	1.38	0.22167	.	0.321335	0.30593	N	0.009281	T	0.16557	0.0398	L	0.40543	1.245	0.09310	N	0.999998	D;P;P	0.54047	0.964;0.905;0.828	P;B;P	0.49708	0.62;0.253;0.474	T	0.07770	-1.0755	10	0.62326	D	0.03	.	4.9459	0.13989	0.3108:0.0:0.5392:0.15	.	9;9;9	Q8NC06-3;Q8NC06;Q8NC06-2	.;ACBD4_HUMAN;.	D	9	ENSP00000405969:E9D;ENSP00000314440:E9D;ENSP00000381367:E9D;ENSP00000366154:E9D	ENSP00000314440:E9D	E	+	3	2	ACBD4	40569064	0.997000	0.39634	0.105000	0.21289	0.935000	0.57460	0.682000	0.25335	0.273000	0.22049	0.561000	0.74099	GAG	.	.		0.612	ACBD4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000449816.1	NM_024722	
CACNA1G	8913	hgsc.bcm.edu	37	17	48667952	48667952	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr17:48667952A>T	ENST00000359106.5	+	10	2422	c.2422A>T	c.(2422-2424)Aac>Tac	p.N808Y	CACNA1G_ENST00000514079.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000513689.2_Missense_Mutation_p.N808Y|CACNA1G_ENST00000510366.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000507896.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000416767.4_Missense_Mutation_p.N808Y|CACNA1G_ENST00000442258.2_Missense_Mutation_p.N808Y|CACNA1G_ENST00000354983.4_Missense_Mutation_p.N808Y|CACNA1G_ENST00000514717.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000515411.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000507609.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000360761.4_Missense_Mutation_p.N808Y|CACNA1G_ENST00000507510.2_Missense_Mutation_p.N808Y|CACNA1G_ENST00000512389.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000510115.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000514181.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000505165.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000358244.5_Missense_Mutation_p.N808Y|CACNA1G_ENST00000429973.2_Missense_Mutation_p.N808Y|CACNA1G_ENST00000502264.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000515765.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000503485.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000515165.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000507336.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000513964.1_Missense_Mutation_p.N808Y|CACNA1G_ENST00000352832.5_Missense_Mutation_p.N808Y	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	808					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GAATCCCTACAACATCTTCGA	0.537																																					p.N808Y		Atlas-SNP	.											.	CACNA1G	659	.	0			c.A2422T						.						108.0	105.0	106.0					17																	48667952		2021	4172	6193	SO:0001583	missense	8913	exon10			CCCTACAACATCT	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.2422A>T	chr17.hg19:g.48667952A>T	ENSP00000352011:p.Asn808Tyr	45.0	0.0		65.0	36.0	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	ENST00000359106.5	hg19	CCDS45730.1	.	.	.	.	.	.	.	.	.	.	a	25.1	4.604033	0.87157	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99259	-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64;-5.64	5.63	5.63	0.86233	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99654	0.9872	H	0.97365	3.99	0.80722	D	1	P;D;P;P;D;P;P;P;P;D;D;D;D;D;P;D;D;D;D;D;D;D;P;P;D;D	0.89917	0.785;0.989;0.839;0.71;0.995;0.905;0.817;0.903;0.817;1.0;0.984;0.986;0.989;0.99;0.888;0.969;0.995;0.96;0.995;0.995;1.0;0.997;0.944;0.907;1.0;0.993	P;D;P;P;D;P;P;D;P;D;D;D;D;D;P;D;D;P;D;D;D;D;D;P;D;D	0.91635	0.721;0.976;0.903;0.841;0.967;0.903;0.8;0.949;0.8;0.992;0.959;0.945;0.967;0.967;0.724;0.949;0.967;0.89;0.967;0.949;0.999;0.967;0.933;0.908;0.999;0.945	D	0.97456	1.0031	10	0.87932	D	0	.	15.8337	0.78782	1.0:0.0:0.0:0.0	.	808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808;808	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	Y	808	ENSP00000353990:N808Y;ENSP00000339302:N808Y;ENSP00000392390:N808Y;ENSP00000347078:N808Y;ENSP00000409759:N808Y;ENSP00000425522:N808Y;ENSP00000426261:N808Y;ENSP00000425451:N808Y;ENSP00000422407:N808Y;ENSP00000426814:N808Y;ENSP00000427238:N808Y;ENSP00000423112:N808Y;ENSP00000420918:N808Y;ENSP00000426172:N808Y;ENSP00000423045:N808Y;ENSP00000427173:N808Y;ENSP00000426098:N808Y;ENSP00000425698:N808Y;ENSP00000426232:N808Y;ENSP00000423317:N808Y;ENSP00000350979:N808Y;ENSP00000352011:N808Y;ENSP00000414388:N808Y;ENSP00000423155:N808Y;ENSP00000422268:N808Y;ENSP00000421518:N808Y	ENSP00000339302:N808Y	N	+	1	0	CACNA1G	46022951	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.152000	0.67230	0.459000	0.35465	AAC	.	.		0.537	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
INTS2	57508	hgsc.bcm.edu	37	17	59989028	59989028	+	Silent	SNP	A	A	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr17:59989028A>G	ENST00000444766.3	-	7	906	c.831T>C	c.(829-831)ctT>ctC	p.L277L	INTS2_ENST00000251334.6_Silent_p.L269L	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	277					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						AAGCCACACCAAGGCCTGGCA	0.398																																					p.L277L		Atlas-SNP	.											.	INTS2	89	.	0			c.T831C						.						66.0	64.0	65.0					17																	59989028		1920	4142	6062	SO:0001819	synonymous_variant	57508	exon7			CACACCAAGGCCT	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.831T>C	chr17.hg19:g.59989028A>G		221.0	0.0		302.0	156.0	NM_020748	Q9ULD3	Silent	SNP	ENST00000444766.3	hg19	CCDS45750.1																																																																																			.	.		0.398	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
SCN4A	6329	hgsc.bcm.edu	37	17	62034767	62034767	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr17:62034767C>T	ENST00000435607.1	-	13	2207	c.2131G>A	c.(2131-2133)Gtg>Atg	p.V711M	SCN4A_ENST00000578147.1_Missense_Mutation_p.V711M	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	711					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AAGATGAACACGATGATAGCC	0.567																																					p.V711M		Atlas-SNP	.											SCN4A,colon,carcinoma,0,1	SCN4A	205	.	0			c.G2131A						.						111.0	120.0	117.0					17																	62034767		2202	4300	6502	SO:0001583	missense	6329	exon13			TGAACACGATGAT	U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2131G>A	chr17.hg19:g.62034767C>T	ENSP00000396320:p.Val711Met	71.0	0.0		117.0	31.0	NM_000334	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	ENST00000435607.1	hg19	CCDS45761.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746783	0.69418	.	.	ENSG00000007314	ENST00000435607	D	0.98567	-5.0	3.66	3.66	0.41972	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97867	0.9299	L	0.37750	1.13	0.51233	D	0.99991	D	0.69078	0.997	D	0.68943	0.961	D	0.98487	1.0608	10	0.66056	D	0.02	.	14.9158	0.70795	0.0:1.0:0.0:0.0	.	711	P35499	SCN4A_HUMAN	M	711	ENSP00000396320:V711M	ENSP00000396320:V711M	V	-	1	0	SCN4A	59388499	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.062000	0.61559	0.561000	0.74099	GTG	.	.		0.567	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_000334	
RNF213	57674	hgsc.bcm.edu	37	17	78247203	78247203	+	Splice_Site	SNP	A	A	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr17:78247203A>C	ENST00000582970.1	+	3	404	c.261A>C	c.(259-261)gaA>gaC	p.E87D	RNF213_ENST00000508628.2_Splice_Site_p.E87D|RNF213_ENST00000456466.1_Splice_Site_p.E87D|RNF213_ENST00000319921.4_Splice_Site_p.E87D	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	87					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			CCGTCCAAGAAGTGAGTGCAC	0.627																																					p.E87D		Atlas-SNP	.											.	RNF213	766	.	1	Unknown(1)	autonomic_ganglia(1)	c.A261C						.						58.0	54.0	56.0					17																	78247203		2203	4299	6502	SO:0001630	splice_region_variant	57674	exon3			CCAAGAAGTGAGT	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.261+1A>C	chr17.hg19:g.78247203A>C		62.0	0.0		52.0	15.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	hg19	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	A	8.743	0.919411	0.17982	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	T	0.23348	1.91	3.31	-3.2	0.05156	.	.	.	.	.	T	0.10337	0.0253	N	0.08118	0	0.35902	D	0.83043	B	0.25169	0.119	B	0.23574	0.047	T	0.37731	-0.9693	9	0.15499	T	0.54	.	9.6741	0.40030	0.197:0.0:0.803:0.0	.	87	Q9HCF4-2	.	D	87	ENSP00000425956:E87D	ENSP00000324392:E87D	E	+	3	2	RNF213	75861798	0.038000	0.19896	0.037000	0.18230	0.008000	0.06430	-0.193000	0.09573	-0.515000	0.06479	-0.417000	0.06048	GAA	.	.		0.627	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	Missense_Mutation
MOCOS	55034	hgsc.bcm.edu	37	18	33795576	33795576	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr18:33795576T>C	ENST00000261326.5	+	8	1454	c.1433T>C	c.(1432-1434)gTc>gCc	p.V478A		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CTGGATGATGTCCAGGCCTTT	0.552																																					p.V478A		Atlas-SNP	.											.	MOCOS	84	.	0			c.T1433C						.						71.0	69.0	69.0					18																	33795576		2203	4300	6503	SO:0001583	missense	55034	exon8			ATGATGTCCAGGC	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.1433T>C	chr18.hg19:g.33795576T>C	ENSP00000261326:p.Val478Ala	56.0	0.0		56.0	28.0	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	hg19	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	t	0.022	-1.407162	0.01155	.	.	ENSG00000075643	ENST00000261326	D	0.91631	-2.88	5.59	3.73	0.42828	Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.277081	0.42053	N	0.000775	T	0.79890	0.4524	N	0.03000	-0.44	0.22803	N	0.998712	B	0.06786	0.001	B	0.10450	0.005	T	0.59590	-0.7426	10	0.10636	T	0.68	-11.1231	15.2153	0.73261	0.0:0.9229:0.0:0.0771	.	478	Q96EN8	MOCOS_HUMAN	A	478	ENSP00000261326:V478A	ENSP00000261326:V478A	V	+	2	0	MOCOS	32049574	1.000000	0.71417	0.998000	0.56505	0.155000	0.21991	2.218000	0.42889	0.734000	0.32515	-1.204000	0.01649	GTC	.	.		0.552	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
MOCOS	55034	hgsc.bcm.edu	37	18	33840138	33840138	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr18:33840138G>A	ENST00000261326.5	+	13	2430	c.2409G>A	c.(2407-2409)caG>caA	p.Q803Q	MOCOS_ENST00000588132.1_3'UTR	NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						TGCGTTTCCAGGTAAGTTTGG	0.443																																					p.Q803Q		Atlas-SNP	.											.	MOCOS	84	.	0			c.G2409A						.						188.0	183.0	184.0					18																	33840138		2203	4300	6503	SO:0001630	splice_region_variant	55034	exon13			TTTCCAGGTAAGT	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2409+1G>A	chr18.hg19:g.33840138G>A		119.0	0.0		106.0	42.0	NM_017947		Silent	SNP	ENST00000261326.5	hg19	CCDS11919.1																																																																																			.	.		0.443	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		Silent
PIGN	23556	hgsc.bcm.edu	37	18	59815546	59815546	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr18:59815546T>C	ENST00000357637.5	-	8	990	c.575A>G	c.(574-576)aAc>aGc	p.N192S	PIGN_ENST00000400334.3_Missense_Mutation_p.N192S	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	192					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				CAAAGACTGGTTGTTTCTGGC	0.274																																					p.N192S		Atlas-SNP	.											.	PIGN	62	.	0			c.A575G						.						21.0	19.0	19.0					18																	59815546		1585	3625	5210	SO:0001583	missense	23556	exon8			GACTGGTTGTTTC	AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.575A>G	chr18.hg19:g.59815546T>C	ENSP00000350263:p.Asn192Ser	518.0	0.0		473.0	141.0	NM_176787	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	ENST00000357637.5	hg19	CCDS45879.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.421779	0.83559	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.71698	-0.59;-0.59	5.73	5.73	0.89815	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.83478	0.5263	M	0.74389	2.26	0.58432	D	0.999999	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.988	D	0.84033	0.0360	9	.	.	.	-18.6256	16.0325	0.80588	0.0:0.0:0.0:1.0	.	192;192	B2RCI8;O95427	.;PIGN_HUMAN	S	192	ENSP00000350263:N192S;ENSP00000383188:N192S	.	N	-	2	0	PIGN	57966526	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.086000	0.64474	2.180000	0.69256	0.528000	0.53228	AAC	.	.		0.274	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449757.2	NM_176787	
KANK2	25959	hgsc.bcm.edu	37	19	11286587	11286587	+	Silent	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:11286587C>T	ENST00000586659.1	-	8	2153	c.1839G>A	c.(1837-1839)gaG>gaA	p.E613E	KANK2_ENST00000589359.1_Silent_p.E621E|KANK2_ENST00000589894.1_Silent_p.E613E|KANK2_ENST00000355150.5_Silent_p.E613E|KANK2_ENST00000432929.2_Silent_p.E621E			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	613					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CCAGCTCCCGCTCTGTGAGGG	0.627																																					p.E621E		Atlas-SNP	.											.	KANK2	47	.	0			c.G1863A						.						122.0	108.0	113.0					19																	11286587		2203	4300	6503	SO:0001819	synonymous_variant	25959	exon6			CTCCCGCTCTGTG	AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1839G>A	chr19.hg19:g.11286587C>T		58.0	0.0		78.0	31.0	NM_015493	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Silent	SNP	ENST00000586659.1	hg19	CCDS12255.1																																																																																			.	.		0.627	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000453066.2	NM_015493	
PRKCSH	5589	hgsc.bcm.edu	37	19	11560181	11560181	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:11560181A>C	ENST00000589838.1	+	16	1541	c.1541A>C	c.(1540-1542)gAg>gCg	p.E514A	PRKCSH_ENST00000412601.1_Missense_Mutation_p.E511A|PRKCSH_ENST00000592741.1_Missense_Mutation_p.E521A|PRKCSH_ENST00000587327.1_Missense_Mutation_p.E511A|PRKCSH_ENST00000591462.1_Missense_Mutation_p.E511A|PRKCSH_ENST00000252455.2_Missense_Mutation_p.E514A			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	514					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						GCCTGCCCGGAGCCACCGCCT	0.672																																					p.E514A		Atlas-SNP	.											.	PRKCSH	55	.	0			c.A1541C						.						54.0	58.0	57.0					19																	11560181		2202	4299	6501	SO:0001583	missense	5589	exon17			GCCCGGAGCCACC		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.1541A>C	chr19.hg19:g.11560181A>C	ENSP00000465461:p.Glu514Ala	65.0	0.0		78.0	22.0	NM_002743	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	ENST00000589838.1	hg19	CCDS32911.1	.	.	.	.	.	.	.	.	.	.	A	9.117	1.008015	0.19199	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.74002	-0.79;-0.8	3.7	2.67	0.31697	.	0.287297	0.32081	N	0.006602	T	0.71134	0.3304	M	0.81682	2.555	0.47183	D	0.999347	B;B;B;B	0.28128	0.09;0.09;0.019;0.201	B;B;B;B	0.28385	0.089;0.089;0.056;0.089	T	0.63580	-0.6605	10	0.27785	T	0.31	-22.6865	8.4396	0.32808	0.8251:0.0:0.0:0.1749	.	521;521;511;514	E7EQZ9;B4DJQ5;A8K318;P14314	.;.;.;GLU2B_HUMAN	A	514;511	ENSP00000252455:E514A;ENSP00000395616:E511A	ENSP00000252455:E514A	E	+	2	0	PRKCSH	11421181	1.000000	0.71417	0.500000	0.27589	0.003000	0.03518	5.872000	0.69636	0.479000	0.27511	-0.301000	0.09380	GAG	.	.		0.672	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
GMIP	51291	hgsc.bcm.edu	37	19	19753423	19753423	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:19753423G>A	ENST00000203556.4	-	2	162	c.25C>T	c.(25-27)Ccc>Tcc	p.P9S	GMIP_ENST00000445806.2_Missense_Mutation_p.P9S|GMIP_ENST00000587238.1_Missense_Mutation_p.P9S	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	9					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GGACCTGGGGGGAGTCCTAGG	0.582																																					p.P9S		Atlas-SNP	.											.	GMIP	55	.	0			c.C25T						.						109.0	100.0	103.0					19																	19753423		2203	4300	6503	SO:0001583	missense	51291	exon2			CTGGGGGGAGTCC	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.25C>T	chr19.hg19:g.19753423G>A	ENSP00000203556:p.Pro9Ser	69.0	0.0		79.0	29.0	NM_016573	A0AVN9|B7ZLZ0	Missense_Mutation	SNP	ENST00000203556.4	hg19	CCDS12408.1	.	.	.	.	.	.	.	.	.	.	G	11.52	1.662555	0.29515	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.19250	2.17;2.16	4.32	-1.37	0.09056	.	0.593417	0.14095	N	0.341739	T	0.14270	0.0345	L	0.44542	1.39	0.09310	N	1	B;B;B	0.20052	0.041;0.041;0.041	B;B;B	0.14578	0.011;0.011;0.011	T	0.26503	-1.0101	10	0.26408	T	0.33	-2.2825	7.2941	0.26383	0.0:0.1451:0.3897:0.4652	.	9;9;9	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	S	9	ENSP00000203556:P9S;ENSP00000397075:P9S	ENSP00000203556:P9S	P	-	1	0	GMIP	19614423	0.001000	0.12720	0.010000	0.14722	0.050000	0.14768	-0.820000	0.04457	0.002000	0.14630	0.561000	0.74099	CCC	.	.		0.582	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573	
ZNF729	100287226	hgsc.bcm.edu	37	19	22499902	22499902	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:22499902C>T	ENST00000601693.1	+	4	3801	c.3683C>T	c.(3682-3684)cCt>cTt	p.P1228L	ZNF729_ENST00000357491.6_Intron			A6NN14	ZN729_HUMAN	zinc finger protein 729	1228					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						TTAAGCAATCCTCACACCTTA	0.348																																					p.P1228L		Atlas-SNP	.											.	ZNF729	78	.	0			c.C3683T						.																																			SO:0001583	missense	100287226	exon4			GCAATCCTCACAC		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.3683C>T	chr19.hg19:g.22499902C>T	ENSP00000469582:p.Pro1228Leu	19.0	0.0		26.0	7.0	NM_001242680	M0QY45	Missense_Mutation	SNP	ENST00000601693.1	hg19	CCDS59368.1																																																																																			.	.		0.348	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
CEACAM20	125931	hgsc.bcm.edu	37	19	45026913	45026913	+	RNA	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:45026913C>T	ENST00000454753.1	-	0	779							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				CACCAGACTCCAATTTGATTT	0.493																																					p.L167L		Atlas-SNP	.											.	CEACAM20	31	.	0			c.G501A						.						59.0	64.0	62.0					19																	45026913		2084	4233	6317			125931	exon4			AGACTCCAATTTG	AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		chr19.hg19:g.45026913C>T		72.0	0.0		89.0	28.0	NM_001102600		Silent	SNP	ENST00000454753.1	hg19																																																																																				.	.		0.493	CEACAM20-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000323032.1	NM_198444	
NR1H2	7376	hgsc.bcm.edu	37	19	50885832	50885832	+	Silent	SNP	G	G	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:50885832G>C	ENST00000253727.5	+	10	1591	c.1356G>C	c.(1354-1356)ctG>ctC	p.L452L	NR1H2_ENST00000598168.1_Silent_p.L422L|NR1H2_ENST00000411902.2_Silent_p.L355L|POLD1_ENST00000440232.2_5'Flank|NR1H2_ENST00000593926.1_Silent_p.L452L|NR1H2_ENST00000542413.1_Silent_p.L183L|POLD1_ENST00000599857.1_5'Flank|NR1H2_ENST00000599105.1_Silent_p.L408L	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	452	Ligand-binding. {ECO:0000255}.				cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CGCCTCTGCTGTCGGAGATCT	0.647																																					p.L452L		Atlas-SNP	.											.	NR1H2	47	.	0			c.G1356C						.						27.0	34.0	31.0					19																	50885832		2032	4204	6236	SO:0001819	synonymous_variant	7376	exon10			TCTGCTGTCGGAG	U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.1356G>C	chr19.hg19:g.50885832G>C		30.0	0.0		33.0	12.0	NM_007121	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Silent	SNP	ENST00000253727.5	hg19	CCDS42593.1																																																																																			.	.		0.647	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464724.2		
NLRP4	147945	hgsc.bcm.edu	37	19	56379080	56379080	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:56379080T>C	ENST00000301295.6	+	6	2614	c.2192T>C	c.(2191-2193)gTa>gCa	p.V731A	NLRP4_ENST00000346986.5_Intron|NLRP4_ENST00000587891.1_Missense_Mutation_p.V656A	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	731					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TGCAGGCTGGTAAATTGTCAC	0.468																																					p.V731A		Atlas-SNP	.											NLRP4_ENST00000301295,NS,neuroblastoma,0,1	NLRP4	331	.	0			c.T2192C						.						181.0	145.0	157.0					19																	56379080		2203	4300	6503	SO:0001583	missense	147945	exon6			GGCTGGTAAATTG	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2192T>C	chr19.hg19:g.56379080T>C	ENSP00000301295:p.Val731Ala	50.0	0.0		55.0	19.0	NM_134444	Q86W87|Q96AY6	Missense_Mutation	SNP	ENST00000301295.6	hg19	CCDS12936.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.134523	0.00338	.	.	ENSG00000160505	ENST00000301295	T	0.07688	3.17	2.95	-5.89	0.02282	.	.	.	.	.	T	0.02727	0.0082	N	0.11673	0.155	0.09310	N	1	B;B	0.15141	0.012;0.012	B;B	0.18561	0.022;0.005	T	0.41945	-0.9480	9	0.08599	T	0.76	.	2.202	0.03926	0.1221:0.1572:0.2425:0.4782	.	656;731	Q96MN2-3;Q96MN2	.;NALP4_HUMAN	A	731	ENSP00000301295:V731A	ENSP00000301295:V731A	V	+	2	0	NLRP4	61070892	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	-2.321000	0.01119	-2.406000	0.00574	-0.526000	0.04340	GTA	.	.		0.468	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
VN1R1	57191	hgsc.bcm.edu	37	19	57967008	57967008	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:57967008A>C	ENST00000321039.3	-	1	846	c.847T>G	c.(847-849)Ttt>Gtt	p.F283V	AC004076.9_ENST00000596831.1_Intron|AC004076.9_ENST00000415705.3_5'UTR	NM_020633.3	NP_065684.1	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	283					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		TAGAAAACAAAAAAGGAGCTC	0.488																																					p.F283V		Atlas-SNP	.											.	VN1R1	48	.	0			c.T847G						.						101.0	86.0	91.0					19																	57967008		2203	4300	6503	SO:0001583	missense	57191	exon1			AAACAAAAAAGGA	AF255342	CCDS12951.1	19q13.4	2012-08-22	2003-01-15		ENSG00000178201	ENSG00000178201		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	13548	protein-coding gene	gene with protein product		605234	"""vomeronasal olfactory receptor, (chromosome 19) subtype I, member 1"""	VNR19I1		10973240	Standard	NM_020633		Approved	V1RL1, ZVNR1, ZVNH1	uc002qos.2	Q9GZP7		ENST00000321039.3:c.847T>G	chr19.hg19:g.57967008A>C	ENSP00000322339:p.Phe283Val	92.0	0.0		87.0	33.0	NM_020633	B3KSV5|Q7Z5H8|Q7Z5H9	Missense_Mutation	SNP	ENST00000321039.3	hg19	CCDS12951.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.541236	0.00934	.	.	ENSG00000178201	ENST00000321039	T	0.04603	3.59	4.07	-8.15	0.01065	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01222	0.0040	N	0.01742	-0.745	0.09310	N	1	B	0.17667	0.023	B	0.14023	0.01	T	0.37596	-0.9699	9	0.02654	T	1	.	5.2675	0.15607	0.5738:0.1768:0.1787:0.0708	.	283	Q9GZP7	VN1R1_HUMAN	V	283	ENSP00000322339:F283V	ENSP00000322339:F283V	F	-	1	0	VN1R1	62658820	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.891000	0.04135	-2.442000	0.00549	-0.339000	0.08088	TTT	.	.		0.488	VN1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466464.1	NM_020633	
FASTKD5	60493	hgsc.bcm.edu	37	20	3128547	3128547	+	Silent	SNP	A	A	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr20:3128547A>T	ENST00000380266.3	-	2	1491	c.1170T>A	c.(1168-1170)gtT>gtA	p.V390V	UBOX5_ENST00000217173.2_Intron|UBOX5_ENST00000348031.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	390					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						TGACACCTTGAACTCCCAGGG	0.468																																					p.V390V		Atlas-SNP	.											.	FASTKD5	63	.	0			c.T1170A						.						84.0	78.0	80.0					20																	3128547		2203	4300	6503	SO:0001819	synonymous_variant	60493	exon2			ACCTTGAACTCCC	BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.1170T>A	chr20.hg19:g.3128547A>T		194.0	0.0		194.0	57.0	NM_021826	Q96JN3|Q9H5D1|Q9H8Y3	Silent	SNP	ENST00000380266.3	hg19	CCDS13048.1																																																																																			.	.		0.468	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077701.2	NM_021826	
SPATA25	128497	hgsc.bcm.edu	37	20	44515576	44515576	+	Silent	SNP	T	T	G			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr20:44515576T>G	ENST00000372519.3	-	2	308	c.264A>C	c.(262-264)cgA>cgC	p.R88R		NM_080608.3	NP_542175.1	Q9BR10	SPT25_HUMAN	spermatogenesis associated 25	88					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGTGGCAGTTTCGGCTGTATT	0.647																																					p.R88R		Atlas-SNP	.											.	.	.	.	0			c.A264C						.						117.0	118.0	118.0					20																	44515576		2203	4300	6503	SO:0001819	synonymous_variant	128497	exon2			GCAGTTTCGGCTG	AL008726	CCDS13383.1	20q13.12	2011-11-24	2011-11-24	2011-11-24	ENSG00000149634	ENSG00000149634			16158	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 165"""	C20orf165		19240080	Standard	NM_080608		Approved	dJ337O18.8, TSG23	uc002xqf.3	Q9BR10	OTTHUMG00000032628	ENST00000372519.3:c.264A>C	chr20.hg19:g.44515576T>G		34.0	0.0		43.0	15.0	NM_080608		Silent	SNP	ENST00000372519.3	hg19	CCDS13383.1																																																																																			.	.		0.647	SPATA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079541.1		
MMP9	4318	hgsc.bcm.edu	37	20	44642394	44642394	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr20:44642394T>C	ENST00000372330.3	+	10	1728	c.1709T>C	c.(1708-1710)gTc>gCc	p.V570A	RP11-465L10.10_ENST00000535913.1_RNA	NM_004994.2	NP_004985.2	P14780	MMP9_HUMAN	matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)	570					collagen catabolic process (GO:0030574)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|macrophage differentiation (GO:0030225)|negative regulation of cation channel activity (GO:2001258)|ossification (GO:0001503)|positive regulation of apoptotic process (GO:0043065)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of receptor binding (GO:1900122)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|identical protein binding (GO:0042802)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|large_intestine(14)|liver(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(3)	46		Myeloproliferative disorder(115;0.0122)			Captopril(DB01197)|Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)	CTGGACTCGGTCTTTGAGGAG	0.607											OREG0025990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V570A		Atlas-SNP	.											.	MMP9	84	.	0			c.T1709C						.						41.0	44.0	43.0					20																	44642394		2203	4300	6503	SO:0001583	missense	4318	exon10			ACTCGGTCTTTGA		CCDS13390.1	20q12-q13	2008-01-07	2005-08-08		ENSG00000100985	ENSG00000100985	3.4.24.35		7176	protein-coding gene	gene with protein product		120361	"""matrix metalloproteinase 9 (gelatinase B, 92kD gelatinase, 92kD type IV collagenase)"", ""matrix metalloproteinase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)"""	CLG4B		2158484	Standard	NM_004994		Approved		uc002xqz.3	P14780	OTTHUMG00000033044	ENST00000372330.3:c.1709T>C	chr20.hg19:g.44642394T>C	ENSP00000361405:p.Val570Ala	114.0	0.0	925	103.0	35.0	NM_004994	B2R7V9|Q3LR70|Q8N725|Q9H4Z1|Q9UCJ9|Q9UCL1|Q9UDK2	Missense_Mutation	SNP	ENST00000372330.3	hg19	CCDS13390.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.259124	0.23051	.	.	ENSG00000100985	ENST00000372330;ENST00000545925	T	0.01369	4.97	4.85	2.9	0.33743	Hemopexin/matrixin, conserved site (1);Hemopexin/matrixin (2);	0.106602	0.64402	N	0.000005	T	0.00412	0.0013	N	0.00191	-1.88	0.26531	N	0.974259	B	0.02656	0.0	B	0.01281	0.0	T	0.45279	-0.9272	10	0.02654	T	1	.	7.6049	0.28097	0.0:0.7063:0.1376:0.1561	.	570	P14780	MMP9_HUMAN	A	570;140	ENSP00000361405:V570A	ENSP00000361405:V570A	V	+	2	0	MMP9	44075801	0.974000	0.33945	0.930000	0.37139	0.359000	0.29487	2.270000	0.43355	0.626000	0.30322	-0.846000	0.03041	GTC	.	.		0.607	MMP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080337.1		
TMPRSS3	64699	hgsc.bcm.edu	37	21	43805592	43805592	+	Silent	SNP	C	C	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr21:43805592C>T	ENST00000291532.3	-	6	1453	c.498G>A	c.(496-498)cgG>cgA	p.R166R	TMPRSS3_ENST00000433957.2_Silent_p.R166R|TMPRSS3_ENST00000398397.3_Silent_p.R166R|TMPRSS3_ENST00000398405.1_Silent_p.R164R|TMPRSS3_ENST00000380399.1_Silent_p.R250R|TMPRSS3_ENST00000474596.1_5'UTR	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	166	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						CAAACTCCTCCCGGAACTGCC	0.507																																					p.R166R		Atlas-SNP	.											.	TMPRSS3	40	.	0			c.G498A						.						178.0	162.0	167.0					21																	43805592		2203	4300	6503	SO:0001819	synonymous_variant	64699	exon6			CTCCTCCCGGAAC	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.498G>A	chr21.hg19:g.43805592C>T		92.0	0.0		99.0	34.0	NM_001256317	D3DSJ6|Q5USC7|Q6ZMC3	Silent	SNP	ENST00000291532.3	hg19	CCDS13686.1																																																																																			.	.		0.507	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		
TBX1	6899	hgsc.bcm.edu	37	22	19748651	19748651	+	Silent	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr22:19748651C>A	ENST00000329705.7	+	3	387	c.258C>A	c.(256-258)ccC>ccA	p.P86P	TBX1_ENST00000332710.4_Silent_p.P86P|TBX1_ENST00000359500.3_Silent_p.P86P	NM_080646.1	NP_542377.1	O43435	TBX1_HUMAN	T-box 1	86					angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|aorta morphogenesis (GO:0035909)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|blood vessel morphogenesis (GO:0048514)|blood vessel remodeling (GO:0001974)|cell fate specification (GO:0001708)|cell proliferation (GO:0008283)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|coronary artery morphogenesis (GO:0060982)|determination of left/right symmetry (GO:0007368)|ear morphogenesis (GO:0042471)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic viscerocranium morphogenesis (GO:0048703)|enamel mineralization (GO:0070166)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|heart development (GO:0007507)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|lymph vessel development (GO:0001945)|mesenchymal cell apoptotic process (GO:0097152)|mesoderm development (GO:0007498)|middle ear morphogenesis (GO:0042474)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle organ morphogenesis (GO:0048644)|muscle tissue morphogenesis (GO:0060415)|negative regulation of cell differentiation (GO:0045596)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|parathyroid gland development (GO:0060017)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of tongue muscle cell differentiation (GO:2001037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of organ morphogenesis (GO:2000027)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retinoic acid receptor signaling pathway (GO:0048384)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|social behavior (GO:0035176)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|tongue morphogenesis (GO:0043587)|transcription, DNA-templated (GO:0006351)|vagus nerve morphogenesis (GO:0021644)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|lung(3)|ovary(2)	8	Colorectal(54;0.0993)	all_lung(157;3.05e-06)				ccgccgAGCCCGAGGGCCCCG	0.806																																					p.P86P		Atlas-SNP	.											.	TBX1	62	.	0			c.C258A						.						4.0	4.0	4.0					22																	19748651		1976	3914	5890	SO:0001819	synonymous_variant	6899	exon3			CGAGCCCGAGGGC	AF012131	CCDS13765.1, CCDS13766.1, CCDS13767.1	22q11.21	2014-09-17			ENSG00000184058	ENSG00000184058		"""T-boxes"""	11592	protein-coding gene	gene with protein product		602054	"""velocardiofacial syndrome"""	VCF		9268629, 23000736	Standard	NM_080646		Approved	CATCH22	uc002zqa.1	O43435	OTTHUMG00000150421	ENST00000329705.7:c.258C>A	chr22.hg19:g.19748651C>A		231.0	0.0		172.0	63.0	NM_080647	C6G493|C6G494|O43436|Q96RJ2	Silent	SNP	ENST00000329705.7	hg19	CCDS13766.1																																																																																			.	.		0.806	TBX1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318033.1	NM_080647	
PPP2R3B	28227	hgsc.bcm.edu	37	X	301663	301663	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chrX:301663C>A	ENST00000390665.3	-	10	1206	c.1188G>T	c.(1186-1188)tgG>tgT	p.W396C		NM_013239.4	NP_037371.2	Q9Y5P8	P2R3B_HUMAN	protein phosphatase 2, regulatory subunit B'', beta	396	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cell cycle arrest (GO:0007050)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|phosphoprotein phosphatase activity (GO:0004721)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(5)|lung(5)|skin(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGCAGCGGAACCAGTACTCGA	0.687																																					p.W396C		Atlas-SNP	.											.	PPP2R3B	43	.	0			c.G1188T						.						102.0	78.0	86.0					X																	301663		2196	4288	6484	SO:0001583	missense	28227	exon10			GCGGAACCAGTAC	AF215840	CCDS14104.1	Xp22.3 and Yp11.3	2013-01-10	2010-06-18		ENSG00000167393	ENSG00000167393		"""Pseudoautosomal regions / PAR1"", ""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	13417	protein-coding gene	gene with protein product		300339	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'', beta"""	PPP2R3L		11173861	Standard	NM_013239		Approved	PPP2R3LY, PR48	uc004cpg.3	Q9Y5P8	OTTHUMG00000021052	ENST00000390665.3:c.1188G>T	chrX.hg19:g.301663C>A	ENSP00000375080:p.Trp396Cys	131.0	0.0		80.0	33.0	NM_013239	Q6P4G9|Q7RTT1|Q96H01	Missense_Mutation	SNP	ENST00000390665.3	hg19	CCDS14104.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.907035	0.33628	.	.	ENSG00000167393	ENST00000390665	T	0.48522	0.81	2.05	2.05	0.26809	EF-hand-like domain (1);	0.000000	0.85682	U	0.000000	T	0.75324	0.3834	H	0.96460	3.825	0.32841	D	0.505407	D	0.89917	1.0	D	0.97110	1.0	T	0.83353	-0.0002	10	0.87932	D	0	.	11.0142	0.47679	0.0:1.0:0.0:0.0	.	396	Q9Y5P8	P2R3B_HUMAN	C	396	ENSP00000375080:W396C	ENSP00000375080:W396C	W	-	3	0	PPP2R3B	221663	1.000000	0.71417	0.994000	0.49952	0.297000	0.27493	5.819000	0.69243	0.600000	0.29862	0.174000	0.16983	TGG	.	.		0.687	PPP2R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055577.2	NM_013239	
USP9X	8239	hgsc.bcm.edu	37	X	41075386	41075386	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chrX:41075386G>T	ENST00000324545.8	+	35	6199	c.5566G>T	c.(5566-5568)Gag>Tag	p.E1856*	USP9X_ENST00000378308.2_Nonsense_Mutation_p.E1856*	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1856	USP.				axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GTCTGAAAGTGAGACAGCAGG	0.473																																					p.E1856X	Ovarian(172;1807 2695 35459 49286)	Atlas-SNP	.											.	USP9X	385	.	0			c.G5566T						.						108.0	115.0	113.0					X																	41075386		2196	4294	6490	SO:0001587	stop_gained	8239	exon35			GAAAGTGAGACAG	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5566G>T	chrX.hg19:g.41075386G>T	ENSP00000316357:p.Glu1856*	197.0	0.0		174.0	130.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Nonsense_Mutation	SNP	ENST00000324545.8	hg19	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	G	50	16.667748	0.99869	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	.	.	.	5.89	5.89	0.94794	.	0.094058	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	19.178	0.93611	0.0:0.0:1.0:0.0	.	.	.	.	X	1856	.	ENSP00000316357:E1856X	E	+	1	0	USP9X	40960330	1.000000	0.71417	0.798000	0.32154	0.990000	0.78478	6.168000	0.71908	2.480000	0.83734	0.600000	0.82982	GAG	.	.		0.473	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
CFP	5199	hgsc.bcm.edu	37	X	47486303	47486303	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chrX:47486303G>C	ENST00000396992.3	-	6	929	c.809C>G	c.(808-810)cCt>cGt	p.P270R	CFP_ENST00000480317.1_5'Flank|CFP_ENST00000247153.3_Missense_Mutation_p.P270R|CFP_ENST00000377005.2_Missense_Mutation_p.P270R	NM_001145252.1	NP_001138724.1	P27918	PROP_HUMAN	complement factor properdin	270	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				breast(3)|endometrium(4)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	18						ACAGGTCACAGGGCAGGGGCT	0.662																																					p.P270R		Atlas-SNP	.											.	CFP	43	.	0			c.C809G						.						19.0	19.0	19.0					X																	47486303		2191	4280	6471	SO:0001583	missense	5199	exon6			GTCACAGGGCAGG	M83652	CCDS14282.1	Xp11.4	2014-09-17	2006-03-02	2006-03-02	ENSG00000126759	ENSG00000126759		"""Complement system"""	8864	protein-coding gene	gene with protein product		300383	"""properdin P factor, complement"""	PFC		1783405	Standard	NM_001145252		Approved		uc004dih.3	P27918	OTTHUMG00000021451	ENST00000396992.3:c.809C>G	chrX.hg19:g.47486303G>C	ENSP00000380189:p.Pro270Arg	84.0	0.0		61.0	37.0	NM_001145252	O15134|O15135|O15136|O75826	Missense_Mutation	SNP	ENST00000396992.3	hg19	CCDS14282.1	.	.	.	.	.	.	.	.	.	.	G	17.45	3.391986	0.62066	.	.	ENSG00000126759	ENST00000396992;ENST00000247153;ENST00000377005;ENST00000469388	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.33	5.33	0.75918	.	0.552403	0.20365	N	0.093763	T	0.58807	0.2148	L	0.42632	1.34	0.24132	N	0.995763	P;P	0.50272	0.933;0.916	P;P	0.62435	0.902;0.818	T	0.53711	-0.8400	10	0.72032	D	0.01	.	13.5925	0.61967	0.0:0.0:1.0:0.0	.	206;270	B3KVK6;P27918	.;PROP_HUMAN	R	270;270;270;135	ENSP00000380189:P270R;ENSP00000247153:P270R;ENSP00000366204:P270R;ENSP00000418258:P135R	ENSP00000247153:P270R	P	-	2	0	CFP	47371247	0.985000	0.35326	0.759000	0.31340	0.983000	0.72400	5.583000	0.67484	2.365000	0.80145	0.529000	0.55759	CCT	.	.		0.662	CFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056435.2	NM_002621	
SLC6A14	11254	hgsc.bcm.edu	37	X	115590099	115590099	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chrX:115590099G>A	ENST00000371900.4	+	14	1995	c.1907G>A	c.(1906-1908)aGt>aAt	p.S636N	SLC6A14_ENST00000463626.1_3'UTR	NM_007231.3	NP_009162.1	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid transporter), member 14	636					amino acid transmembrane transport (GO:0003333)|amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	amino acid transmembrane transporter activity (GO:0015171)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	23					L-Proline(DB00172)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	CCTACTGTTAGTGGCAGCAGA	0.363																																					p.S636N		Atlas-SNP	.											.	SLC6A14	56	.	0			c.G1907A						.						114.0	108.0	110.0					X																	115590099		2203	4300	6503	SO:0001583	missense	11254	exon14			CTGTTAGTGGCAG	AF151978	CCDS14570.1	Xq23	2013-05-22			ENSG00000087916	ENSG00000268104		"""Solute carriers"""	11047	protein-coding gene	gene with protein product		300444	"""solute carrier family 6 (neurotransmitter transporter), member 14"""			10446133	Standard	NM_007231		Approved		uc004eqi.3	Q9UN76	OTTHUMG00000022245	ENST00000371900.4:c.1907G>A	chrX.hg19:g.115590099G>A	ENSP00000360967:p.Ser636Asn	355.0	0.0		292.0	200.0	NM_007231	Q5H942	Missense_Mutation	SNP	ENST00000371900.4	hg19	CCDS14570.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.862334	0.32884	.	.	ENSG00000087916	ENST00000371900	T	0.73575	-0.76	5.68	3.91	0.45181	.	0.316888	0.34879	N	0.003614	T	0.52240	0.1722	N	0.08118	0	0.28179	N	0.928251	B	0.10296	0.003	B	0.08055	0.003	T	0.42068	-0.9473	10	0.33141	T	0.24	.	9.5558	0.39337	0.1756:0.0:0.8244:0.0	.	636	Q9UN76	S6A14_HUMAN	N	636	ENSP00000360967:S636N	ENSP00000360967:S636N	S	+	2	0	SLC6A14	115504127	.	.	0.993000	0.49108	0.463000	0.32649	.	.	0.654000	0.30846	0.538000	0.68166	AGT	.	.		0.363	SLC6A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057986.1		
ZCCHC12	170261	hgsc.bcm.edu	37	X	117959625	117959626	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chrX:117959625_117959626GC>TT	ENST00000310164.2	+	4	925_926	c.418_419GC>TT	c.(418-420)GCt>TTt	p.A140F		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	140					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						caccctacaagctcaaggggag	0.465																																					p.A140S|p.A140V		Atlas-SNP	.											.	ZCCHC12	60	.	0			c.G418T|c.C419T						.																																			SO:0001583	missense	170261	exon4			CTACAAGCTCAAG|TACAAGCTCAAGG	AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	Exception_encountered	chrX.hg19:g.117959625_117959626delinsTT	ENSP00000308921:p.Ala140Phe	106.0	0.0		69.0	7.0	NM_173798	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	ENST00000310164.2	hg19	CCDS14574.1																																																																																			.	.		0.465	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058014.1	NM_173798	
SOX3	6658	hgsc.bcm.edu	37	X	139586656	139586656	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chrX:139586656G>T	ENST00000370536.2	-	1	569	c.570C>A	c.(568-570)gaC>gaA	p.D190E		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	190					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					GCTTGGCCTCGTCGATGAATG	0.572																																					p.D190E		Atlas-SNP	.											.	SOX3	44	.	0			c.C570A						.						75.0	67.0	70.0					X																	139586656		2203	4300	6503	SO:0001583	missense	6658	exon1			GGCCTCGTCGATG		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.570C>A	chrX.hg19:g.139586656G>T	ENSP00000359567:p.Asp190Glu	351.0	2.0		294.0	204.0	NM_005634	P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	ENST00000370536.2	hg19	CCDS14669.1	.	.	.	.	.	.	.	.	.	.	g	17.33	3.362026	0.61403	.	.	ENSG00000134595	ENST00000370536	D	0.99113	-5.44	4.12	3.25	0.37280	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.85682	U	0.000000	D	0.96855	0.8973	N	0.12663	0.25	0.80722	D	1	P	0.37636	0.603	P	0.48982	0.597	D	0.93965	0.7244	9	.	.	.	.	10.5182	0.44903	0.0989:0.0:0.9011:0.0	.	190	P41225	SOX3_HUMAN	E	190	ENSP00000359567:D190E	.	D	-	3	2	SOX3	139414322	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.039000	0.64185	0.561000	0.29186	-0.351000	0.07748	GAC	.	.		0.572	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1		
MDN1	23195	hgsc.bcm.edu	37	6	90411385	90411385	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr6:90411385delT	ENST00000369393.3	-	55	8434	c.8319delA	c.(8317-8319)gaafs	p.E2773fs	MDN1_ENST00000428876.1_Frame_Shift_Del_p.E2773fs			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2773					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAGTCTGAACTTCTTTGTAAT	0.423																																					p.V2774fs		Atlas-INDEL	.											.	MDN1	478	.	0			c.8320delG						.						41.0	42.0	41.0					6																	90411385		2203	4300	6503	SO:0001589	frameshift_variant	23195	exon55			.	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.8319delA	chr6.hg19:g.90411385delT	ENSP00000358400:p.Glu2773fs	92.0	0.0		102.0	46.0	NM_014611	O15019|Q5T794	Frame_Shift_Del	DEL	ENST00000369393.3	hg19	CCDS5024.1																																																																																			.	.		0.423	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
DVL1	1855	hgsc.bcm.edu	37	1	1274773	1274775	+	In_Frame_Del	DEL	CGT	CGT	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	CGT	CGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr1:1274773_1274775delCGT	ENST00000378888.5	-	11	1383_1385	c.1099_1101delACG	c.(1099-1101)acgdel	p.T367del	DVL1_ENST00000378891.5_In_Frame_Del_p.T367del			O14640	DVL1_HUMAN	dishevelled segment polarity protein 1	367					axon extension (GO:0048675)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|cochlea morphogenesis (GO:0090103)|collateral sprouting (GO:0048668)|convergent extension (GO:0060026)|convergent extension involved in neural plate elongation (GO:0022007)|cytoplasmic microtubule organization (GO:0031122)|dendrite morphogenesis (GO:0048813)|intracellular signal transduction (GO:0035556)|negative regulation of protein binding (GO:0032091)|negative regulation of protein kinase activity (GO:0006469)|neural tube development (GO:0021915)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prepulse inhibition (GO:0060134)|protein localization to microtubule (GO:0035372)|protein localization to nucleus (GO:0034504)|receptor clustering (GO:0043113)|regulation of neurotransmitter levels (GO:0001505)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|social behavior (GO:0035176)|synapse organization (GO:0050808)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	axon (GO:0030424)|cell cortex (GO:0005938)|clathrin-coated vesicle (GO:0030136)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|growth cone (GO:0030426)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	enzyme binding (GO:0019899)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|Rac GTPase binding (GO:0048365)			endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TCAGTGCCGCCGTGTGGGACAGC	0.709																																					p.367_368del		Atlas-INDEL	.											.	DVL1	36	.	0			c.1100_1102del						.																																			SO:0001651	inframe_deletion	1855	exon11			.	AF006011	CCDS22.1	1p36	2013-05-22	2013-05-22		ENSG00000107404	ENSG00000107404		"""Dishevelled homologs"""	3084	protein-coding gene	gene with protein product		601365	"""dishevelled 1 (homologous to Drosophila dsh)"", ""dishevelled, dsh homolog 1 (Drosophila)"""			8817329	Standard	NM_004421		Approved		uc001aer.4	O14640	OTTHUMG00000003069	ENST00000378888.5:c.1099_1101delACG	chr1.hg19:g.1274773_1274775delCGT	ENSP00000368166:p.Thr367del	165.0	0.0		103.0	38.0	NM_004421	Q5TA33|Q5TA35	In_Frame_Del	DEL	ENST00000378888.5	hg19																																																																																				.	.		0.709	DVL1-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000008490.1	NM_004421	
OR5K4	403278	hgsc.bcm.edu	37	3	98073346	98073350	+	Frame_Shift_Del	DEL	TCTTA	TCTTA	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	TCTTA	TCTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:98073346_98073350delTCTTA	ENST00000354924.2	+	1	649_653	c.649_653delTCTTA	c.(649-654)tcttatfs	p.SY217fs	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005517.1	NP_001005517.1	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K, member 4	217						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	21						TGTCTTGATCTCTTATCTCTGCATC	0.346																																					p.216_218del		Atlas-INDEL	.											.	OR5K4	75	.	0			c.648_652del						.																																			SO:0001589	frameshift_variant	403278	exon1			.		CCDS33802.1	3q11.2	2013-09-23			ENSG00000196098	ENSG00000196098		"""GPCR / Class A : Olfactory receptors"""	31291	protein-coding gene	gene with protein product							Standard	NM_001005517		Approved		uc011bgv.2	A6NMS3	OTTHUMG00000160081	ENST00000354924.2:c.649_653delTCTTA	chr3.hg19:g.98073346_98073350delTCTTA	ENSP00000347003:p.Ser217fs	98.0	0.0		81.0	26.0	NM_001005517		Frame_Shift_Del	DEL	ENST00000354924.2	hg19	CCDS33802.1																																																																																			.	.		0.346	OR5K4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359114.1		
SECISBP2L	9728	hgsc.bcm.edu	37	15	49284718	49284719	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr15:49284718_49284719delTC	ENST00000559471.1	-	18	3291_3292	c.3028_3029delGA	c.(3028-3030)gaafs	p.E1010fs	SECISBP2L_ENST00000261847.3_Frame_Shift_Del_p.E965fs	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	1010							poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						GAGCTGCACTTCTACAGATATG	0.455																																					p.1010_1010del		Atlas-INDEL	.											.	SECISBP2L	118	.	0			c.3029_3030del						.																																			SO:0001589	frameshift_variant	9728	exon18			.	BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.3028_3029delGA	chr15.hg19:g.49284718_49284719delTC	ENSP00000453854:p.Glu1010fs	86.0	0.0		88.0	36.0	NM_001193489	Q8N767	Frame_Shift_Del	DEL	ENST00000559471.1	hg19	CCDS53942.1																																																																																			.	.		0.455	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417277.1	NM_014701	
NPHP3	27031	hgsc.bcm.edu	37	3	132400798	132400798	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr3:132400798delT	ENST00000337331.5	-	27	4035	c.3949delA	c.(3949-3951)acafs	p.T1317fs	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	1317					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						GAATGAGCTGTTTTTAAGCTA	0.363																																					p.T1317fs		Atlas-INDEL	.											.	NPHP3	110	.	0			c.3950delC						.						162.0	157.0	159.0					3																	132400798		2203	4300	6503	SO:0001589	frameshift_variant	27031	exon27			.	AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.3949delA	chr3.hg19:g.132400798delT	ENSP00000338766:p.Thr1317fs	122.0	0.0		143.0	32.0	NM_153240	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Frame_Shift_Del	DEL	ENST00000337331.5	hg19	CCDS3078.1																																																																																			.	.		0.363	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357020.2	NM_153240	
MAML3	55534	hgsc.bcm.edu	37	4	140811058	140811069	+	In_Frame_Del	DEL	TGCTGTTGCTGC	TGCTGTTGCTGC	-	rs58015886|rs370122702		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	TGCTGTTGCTGC	TGCTGTTGCTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr4:140811058_140811069delTGCTGTTGCTGC	ENST00000509479.2	-	2	2377_2388	c.1521_1532delGCAGCAACAGCA	c.(1519-1533)cagcagcaacagcac>cac	p.QQQQ507del	MAML3_ENST00000398940.1_Splice_Site_p.AAT37del|MAML3_ENST00000327122.5_In_Frame_Del_p.QQQQ351del	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					CTGATTTGAGtgctgttgctgctgctgctgct	0.519																																					p.505_507del		Atlas-INDEL	.											.	MAML3	192	.	0			c.1513_1521del						.																																			SO:0001651	inframe_deletion	55534	exon3			.	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1521_1532delGCAGCAACAGCA	chr4.hg19:g.140811058_140811069delTGCTGTTGCTGC	ENSP00000421180:p.Gln507_Gln510del	63.0	0.0		71.0	10.0	NM_018717		In_Frame_Del	DEL	ENST00000509479.2	hg19	CCDS54805.1																																																																																			.	.		0.519	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
CLASRP	11129	hgsc.bcm.edu	37	19	45567295	45567300	+	In_Frame_Del	DEL	TCCCGC	TCCCGC	-	rs199673955|rs537392385		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	TCCCGC	TCCCGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:45567295_45567300delTCCCGC	ENST00000221455.3	+	12	1029_1034	c.931_936delTCCCGC	c.(931-936)tcccgcdel	p.SR315del	CLASRP_ENST00000544944.2_In_Frame_Del_p.SR315del|CLASRP_ENST00000391953.4_In_Frame_Del_p.SR253del	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	315					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						CAGCTCAGAGTCCCGCTCCCGCTCCC	0.67																																					p.310_312del		Atlas-INDEL	.											.	CLASRP	44	.	0			c.930_935del						.																																			SO:0001651	inframe_deletion	11129	exon12			.	AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.931_936delTCCCGC	chr19.hg19:g.45567301_45567306delTCCCGC	ENSP00000221455:p.Ser315_Arg316del	83.0	0.0		77.0	12.0	NM_007056	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	In_Frame_Del	DEL	ENST00000221455.3	hg19	CCDS12652.2																																																																																			.	.		0.670	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316749.1	NM_007056	
FAP	2191	hgsc.bcm.edu	37	2	163045653	163045655	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr2:163045653_163045655delGAG	ENST00000188790.4	-	19	1784_1786	c.1577_1579delCTC	c.(1576-1581)cctcaa>caa	p.P526del	FAP_ENST00000443424.1_In_Frame_Del_p.P501del	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						CTGTCAAATTGAGGAGGAAGAAT	0.296																																					p.526_527del		Atlas-INDEL	.											.	FAP	122	.	0			c.1578_1580del						.																																			SO:0001651	inframe_deletion	2191	exon19			.	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1577_1579delCTC	chr2.hg19:g.163045656_163045658delGAG	ENSP00000188790:p.Pro526del	320.0	0.0		313.0	98.0	NM_004460		In_Frame_Del	DEL	ENST00000188790.4	hg19	CCDS33311.1																																																																																			.	.		0.296	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		
RAB8A	4218	hgsc.bcm.edu	37	19	16236349	16236350	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr19:16236349_16236350insT	ENST00000300935.3	+	4	589_590	c.316_317insT	c.(316-318)attfs	p.I106fs	CTD-2231E14.8_ENST00000597983.1_RNA|RAB8A_ENST00000586682.1_Frame_Shift_Ins_p.I106fs	NM_005370.4	NP_005361.2	P61006	RAB8A_HUMAN	RAB8A, member RAS oncogene family	106					axonogenesis (GO:0007409)|cellular response to insulin stimulus (GO:0032869)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi vesicle fusion to target membrane (GO:0048210)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|vesicle docking involved in exocytosis (GO:0006904)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nonmotile primary cilium (GO:0031513)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)|recycling endosome membrane (GO:0055038)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	8						GATTCGCAACATTGAGGAGGTG	0.574																																					p.I106fs		Atlas-INDEL	.											.	RAB8A	19	.	0			c.316_317insT						.																																			SO:0001589	frameshift_variant	4218	exon4			.		CCDS12339.1	19p13.2-p13.1	2008-05-14	2004-01-30	2004-01-30		ENSG00000167461		"""RAB, member RAS oncogene"""	7007	protein-coding gene	gene with protein product		165040	"""mel transforming oncogene (derived from cell line NK14)"""	MEL		1886711, 8408203	Standard	NM_005370		Approved	RAB8	uc002ndn.4	P61006		ENST00000300935.3:c.318dupT	chr19.hg19:g.16236351_16236351dupT	ENSP00000300935:p.Ile106fs	74.0	0.0		59.0	18.0	NM_005370	B4DEK7|P24407|Q6FHV5	Frame_Shift_Ins	INS	ENST00000300935.3	hg19	CCDS12339.1																																																																																			.	.		0.574	RAB8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460186.1	NM_005370	
NR2C1	7181	hgsc.bcm.edu	37	12	95456409	95456413	+	Frame_Shift_Del	DEL	GAGTA	GAGTA	-	rs377594230		TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	GAGTA	GAGTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:95456409_95456413delGAGTA	ENST00000333003.5	-	3	486_490	c.156_160delTACTC	c.(154-162)tctactccafs	p.TP53fs	NR2C1_ENST00000330677.7_Frame_Shift_Del_p.TP53fs|NR2C1_ENST00000393101.3_Frame_Shift_Del_p.TP53fs|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	53	Required for interaction with KAT2B. {ECO:0000250}.				gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						ACTTTGCTTGGAGTAGAGCCGTCGT	0.454																																					p.53_54del		Atlas-INDEL	.											.	NR2C1	56	.	0			c.157_161del						.																																			SO:0001589	frameshift_variant	7181	exon3			.	M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.156_160delTACTC	chr12.hg19:g.95456409_95456413delGAGTA	ENSP00000333275:p.Thr53fs	87.0	0.0		69.0	22.0	NM_001032287	A8K5K4|Q15625|Q15626	Frame_Shift_Del	DEL	ENST00000333003.5	hg19	CCDS9051.1																																																																																			.	.		0.454	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407565.2	NM_003297	
NR1H4	9971	hgsc.bcm.edu	37	12	100934530	100934539	+	Frame_Shift_Del	DEL	GAGATTTTCA	GAGATTTTCA	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	GAGATTTTCA	GAGATTTTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr12:100934530_100934539delGAGATTTTCA	ENST00000551379.1	+	7	1070_1079	c.1042_1051delGAGATTTTCA	c.(1042-1053)gagattttcaatfs	p.EIFN348fs	NR1H4_ENST00000188403.7_Frame_Shift_Del_p.EIFN344fs|NR1H4_ENST00000548884.1_Frame_Shift_Del_p.EIFN334fs|NR1H4_ENST00000392986.3_Frame_Shift_Del_p.EIFN338fs|NR1H4_ENST00000549996.1_Frame_Shift_Del_p.EIFN287fs			Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	348	Agonist binding. {ECO:0000250}.|Ligand-binding.				bile acid metabolic process (GO:0008206)|cellular response to acid chemical (GO:0071229)|cellular response to organonitrogen compound (GO:0071417)|digestive tract development (GO:0048565)|gene expression (GO:0010467)|intracellular bile acid receptor signaling pathway (GO:0038185)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitrogen catabolite activation of transcription from RNA polymerase II promoter (GO:0001080)|positive regulation of ammonia assimilation cycle (GO:2001250)|positive regulation of glutamate metabolic process (GO:2000213)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of carbohydrate metabolic process (GO:0006109)|regulation of cholesterol metabolic process (GO:0090181)|regulation of urea metabolic process (GO:0034255)|response to glucose (GO:0009749)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)	bile acid binding (GO:0032052)|bile acid receptor activity (GO:0038181)|chenodeoxycholic acid binding (GO:1902122)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor binding (GO:0016922)|peptide binding (GO:0042277)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	44					Chenodeoxycholic acid(DB06777)	TCGTTCAGCTGAGATTTTCAATAAGAAACT	0.395																																					p.347_350del		Atlas-INDEL	.											.	NR1H4	145	.	0			c.1041_1050del						.																																			SO:0001589	frameshift_variant	9971	exon7			.	U68233	CCDS9078.1, CCDS55873.1, CCDS55874.1, CCDS55875.1, CCDS55876.1	12q23.1	2013-01-16				ENSG00000012504		"""Nuclear hormone receptors"""	7967	protein-coding gene	gene with protein product		603826				7774010, 9223286	Standard	NM_001206977		Approved	FXR, RIP14, HRR1, HRR-1	uc001tht.2	Q96RI1	OTTHUMG00000170359	ENST00000551379.1:c.1042_1051delGAGATTTTCA	chr12.hg19:g.100934530_100934539delGAGATTTTCA	ENSP00000447149:p.Glu348fs	87.0	0.0		64.0	16.0	NM_001206993	A1L4K5|B7Z412|B7ZM06|F8VYG8|Q8NFP5|Q8NFP6|Q92943	Frame_Shift_Del	DEL	ENST00000551379.1	hg19	CCDS55876.1																																																																																			.	.		0.395	NR1H4-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409140.1	NM_005123	
IL6ST	3572	hgsc.bcm.edu	37	5	55259984	55259986	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-DD-AADE-01A-11D-A40R-10	TCGA-DD-AADE-10A-01D-A40U-10	AGG	AGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0c6e46a4-0a92-4775-9edb-024c9b2fba8d	c6c3ad3c-f886-41dc-8a10-31c20b29d836	g.chr5:55259984_55259986delAGG	ENST00000381298.2	-	6	958_960	c.646_648delCCT	c.(646-648)cctdel	p.P216del	IL6ST_ENST00000577363.1_5'Flank|IL6ST_ENST00000522633.2_In_Frame_Del_p.P216del|IL6ST_ENST00000336909.5_In_Frame_Del_p.P216del|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000381294.3_In_Frame_Del_p.P216del|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000502326.3_In_Frame_Del_p.P216del|IL6ST_ENST00000536319.1_In_Frame_Del_p.P216del|IL6ST_ENST00000381287.4_In_Frame_Del_p.P216del	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	216	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				CTTTATATACAGGATCAAAATTG	0.3			O		hepatocellular ca																																p.216_217del		Atlas-INDEL	.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	75	.	0			c.647_649del						.																																			SO:0001651	inframe_deletion	3572	exon6			.	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.646_648delCCT	chr5.hg19:g.55259984_55259986delAGG	ENSP00000370698:p.Pro216del	157.0	0.0		135.0	35.0	NM_002184	A0N0L4|Q5FC04|Q9UQ41	In_Frame_Del	DEL	ENST00000381298.2	hg19	CCDS3971.1																																																																																			.	.		0.300	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
