#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ADAM30	11085	hgsc.bcm.edu	37	1	120438417	120438417	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:120438417C>G	ENST00000369400.1	-	1	701	c.543G>C	c.(541-543)tgG>tgC	p.W181C		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	181					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		GGGCCATCTGCCATTCTATTT	0.438																																					p.W181C		Atlas-SNP	.											.	ADAM30	88	.	0			c.G543C						.						86.0	84.0	85.0					1																	120438417		2203	4300	6503	SO:0001583	missense	11085	exon1			CATCTGCCATTCT	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.543G>C	chr1.hg19:g.120438417C>G	ENSP00000358407:p.Trp181Cys	54.0	0.0		90.0	4.0	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	hg19	CCDS907.1	.	.	.	.	.	.	.	.	.	.	C	7.667	0.686131	0.14973	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.01197	5.19	4.67	-3.78	0.04333	.	2.199350	0.03384	N	0.200754	T	0.00241	0.0007	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.46076	-0.9217	10	0.37606	T	0.19	.	1.216	0.01914	0.1264:0.3082:0.2478:0.3176	.	181	Q9UKF2	ADA30_HUMAN	C	181	ENSP00000358407:W181C	ENSP00000358407:W181C	W	-	3	0	ADAM30	120239940	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.492000	0.02300	-0.655000	0.05387	0.563000	0.77884	TGG	.	.		0.438	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
FLG2	388698	hgsc.bcm.edu	37	1	152328831	152328831	+	Silent	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:152328831A>G	ENST00000388718.5	-	3	1503	c.1431T>C	c.(1429-1431)tcT>tcC	p.S477S	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	477	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCAAAGCCAGATGTCTTAC	0.522																																					p.S477S		Atlas-SNP	.											.	FLG2	431	.	0			c.T1431C						.						206.0	202.0	204.0					1																	152328831		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			AAAGCCAGATGTC	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.1431T>C	chr1.hg19:g.152328831A>G		105.0	0.0		212.0	9.0	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	hg19	CCDS30861.1																																																																																			.	.		0.522	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
CHTOP	26097	hgsc.bcm.edu	37	1	153617713	153617713	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:153617713A>G	ENST00000368694.3	+	6	1027	c.715A>G	c.(715-717)Atg>Gtg	p.M239V	CHTOP_ENST00000368687.1_Missense_Mutation_p.M214V|CHTOP_ENST00000368690.3_Missense_Mutation_p.M193V|CHTOP_ENST00000403433.1_Missense_Mutation_p.M193V|CHTOP_ENST00000495554.1_3'UTR	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	239					mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						GGATGCCTACATGGCGCAGAC	0.473																																					p.M240V		Atlas-SNP	.											.	CHTOP	34	.	0			c.A718G						.						122.0	109.0	114.0					1																	153617713		2203	4300	6503	SO:0001583	missense	26097	exon6			GCCTACATGGCGC		CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.715A>G	chr1.hg19:g.153617713A>G	ENSP00000357683:p.Met239Val	57.0	0.0		166.0	7.0	NM_001206612	D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Missense_Mutation	SNP	ENST00000368694.3	hg19	CCDS1048.1	.	.	.	.	.	.	.	.	.	.	A	18.18	3.566204	0.65651	.	.	ENSG00000160679	ENST00000368694;ENST00000403433;ENST00000368690;ENST00000368687	.	.	.	6.15	6.15	0.99193	.	0.000000	0.85682	D	0.000000	T	0.72740	0.3498	M	0.75085	2.285	0.80722	D	1	P;P	0.44776	0.811;0.843	P;P	0.61722	0.828;0.893	T	0.76124	-0.3074	9	0.72032	D	0.01	-24.2997	14.7406	0.69451	1.0:0.0:0.0:0.0	.	240;239	Q9Y3Y2-3;Q9Y3Y2	.;CHTOP_HUMAN	V	239;193;193;214	.	ENSP00000357676:M214V	M	+	1	0	CHTOP	151884337	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.958000	0.93099	2.363000	0.80096	0.523000	0.50628	ATG	.	.		0.473	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089967.1	NM_015607	
GBA	2629	hgsc.bcm.edu	37	1	155208419	155208419	+	Silent	SNP	C	C	T	rs75249684		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:155208419C>T	ENST00000327247.5	-	6	709	c.477G>A	c.(475-477)cgG>cgA	p.R159R	GBA_ENST00000536770.1_Silent_p.R46R|GBA_ENST00000493842.1_5'UTR|AL713999.1_ENST00000401290.1_RNA|GBA_ENST00000427500.3_Silent_p.R110R|GBA_ENST00000428024.3_Silent_p.R72R|GBA_ENST00000368373.3_Silent_p.R159R	NM_001005741.2|NM_001005742.2	NP_001005741.1|NP_001005742.1	P04062	GLCM_HUMAN	glucosidase, beta, acid	159			R -> Q (in GD; type 2; 13% of normal activity). {ECO:0000269|PubMed:10796875}.|R -> W (in GD; severe). {ECO:0000269|PubMed:10796875, ECO:0000269|PubMed:15605411, ECO:0000269|PubMed:9217217}.		carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|cellular response to tumor necrosis factor (GO:0071356)|ceramide biosynthetic process (GO:0046513)|glucosylceramide catabolic process (GO:0006680)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of MAP kinase activity (GO:0043407)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of water loss via skin (GO:0033561)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to pH (GO:0009268)|response to testosterone (GO:0033574)|response to thyroid hormone (GO:0097066)|skin morphogenesis (GO:0043589)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)|termination of signal transduction (GO:0023021)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)	glucosylceramidase activity (GO:0004348)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	26	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Velaglucerase alfa(DB06720)	CCATGGGTACCCGGATGATGT	0.488									Gaucher disease type I																												p.R159R		Atlas-SNP	.											.	GBA	46	.	0			c.G477A						.						122.0	114.0	117.0					1																	155208419		2202	4299	6501	SO:0001819	synonymous_variant	2629	exon6	Familial Cancer Database	glucocerebrosidase insufficiency	GGGTACCCGGATG	M19285	CCDS1102.1, CCDS53373.1, CCDS53374.1	1q22	2010-01-19	2010-01-19		ENSG00000177628	ENSG00000177628	3.2.1.21		4177	protein-coding gene	gene with protein product		606463	"""glucosylceramidase"", ""glucosidase, beta; acid (includes glucosylceramidase)"""	GLUC		3359914	Standard	NM_001005742		Approved	GBA1	uc001fjl.3	P04062	OTTHUMG00000035841	ENST00000327247.5:c.477G>A	chr1.hg19:g.155208419C>T		272.0	0.0		649.0	59.0	NM_001005742	A8K796|B7Z5G2|B7Z6S1|J3KQG4|J3KQK9|Q16545|Q4VX22|Q6I9R6|Q9UMJ8	Silent	SNP	ENST00000327247.5	hg19	CCDS1102.1																																																																																			.	.		0.488	GBA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087204.1	NM_000157	
PKLR	5313	hgsc.bcm.edu	37	1	155264423	155264423	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:155264423A>G	ENST00000342741.4	-	6	853	c.815T>C	c.(814-816)cTg>cCg	p.L272P	PKLR_ENST00000392414.3_Missense_Mutation_p.L241P	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	272			L -> V (in PKRD). {ECO:0000269|PubMed:19085939}.		ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	CCCGAAGCGCAGGTCTCGGAC	0.672																																					p.L272P		Atlas-SNP	.											.	PKLR	70	.	0			c.T815C						.						54.0	52.0	53.0					1																	155264423		2203	4300	6503	SO:0001583	missense	5313	exon6			AAGCGCAGGTCTC	BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.815T>C	chr1.hg19:g.155264423A>G	ENSP00000339933:p.Leu272Pro	72.0	0.0		180.0	75.0	NM_000298	O75758|P11973	Missense_Mutation	SNP	ENST00000342741.4	hg19	CCDS1109.1	.	.	.	.	.	.	.	.	.	.	A	18.60	3.659502	0.67586	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99857	-7.22;-7.22	4.48	4.48	0.54585	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.000000	0.64402	D	0.000001	D	0.99889	0.9947	H	0.94925	3.6	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.96278	0.9204	10	0.87932	D	0	-20.4261	12.022	0.53348	1.0:0.0:0.0:0.0	.	272;263	P30613;B1AVT1	KPYR_HUMAN;.	P	297;241;272;186	ENSP00000376214:L241P;ENSP00000339933:L272P	ENSP00000271946:L186P	L	-	2	0	PKLR	153531047	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	7.002000	0.76304	2.010000	0.58986	0.383000	0.25322	CTG	.	.		0.672	PKLR-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000087407.2	NM_000298	
OR10X1	128367	hgsc.bcm.edu	37	1	158548821	158548821	+	Missense_Mutation	SNP	G	G	A	rs150430213		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:158548821G>A	ENST00000368150.1	-	1	868	c.869C>T	c.(868-870)cCt>cTt	p.P290L		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					GACAGTATAAGGGACTGCTAT	0.443													G|||	1	0.000199681	0.0	0.0	5008	,	,		22074	0.0		0.0	False		,,,				2504	0.001				p.P290L		Atlas-SNP	.											.	OR10X1	96	.	0			c.C869T						.	G	LEU/PRO	0,4406		0,0,2203	107.0	112.0	110.0		869	4.5	0.6	1	dbSNP_134	110	1,8599	1.2+/-3.3	0,1,4299	no	missense	OR10X1	NM_001004477.1	98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	290/327	158548821	1,13005	2203	4300	6503	SO:0001583	missense	128367	exon1			GTATAAGGGACTG	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.869C>T	chr1.hg19:g.158548821G>A	ENSP00000357132:p.Pro290Leu	97.0	0.0		193.0	44.0	NM_001004477	Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	hg19	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707340	0.48412	0.0	1.16E-4	ENSG00000186400	ENST00000368150	T	0.00016	9.13	4.5	4.5	0.54988	.	0.000000	0.48286	D	0.000184	T	0.00039	0.0001	N	0.00242	-1.785	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.48514	-0.9029	10	0.08381	T	0.77	.	6.9583	0.24583	0.1895:0.0:0.8105:0.0	.	290	Q8NGY0	O10X1_HUMAN	L	290	ENSP00000357132:P290L	ENSP00000357132:P290L	P	-	2	0	OR10X1	156815445	0.007000	0.16637	0.650000	0.29550	0.993000	0.82548	1.975000	0.40569	2.473000	0.83533	0.563000	0.77884	CCT	.	G|1.000;A|0.000		0.443	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477	
PAPPA2	60676	hgsc.bcm.edu	37	1	176563717	176563717	+	Missense_Mutation	SNP	G	G	A	rs372509506		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:176563717G>A	ENST00000367662.3	+	3	2141	c.977G>A	c.(976-978)cGc>cAc	p.R326H	PAPPA2_ENST00000367661.3_Missense_Mutation_p.R326H	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	326					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTGGGGATCCGCTCAGGGAAG	0.542																																					p.R326H		Atlas-SNP	.											.	PAPPA2	665	.	0			c.G977A						.	G	HIS/ARG,HIS/ARG	0,3972		0,0,1986	51.0	51.0	51.0		977,977	3.6	1.0	1		51	1,8329		0,1,4164	no	missense,missense	PAPPA2	NM_020318.2,NM_021936.2	29,29	0,1,6150	AA,AG,GG		0.012,0.0,0.0081	possibly-damaging,possibly-damaging	326/1792,326/828	176563717	1,12301	1986	4165	6151	SO:0001583	missense	60676	exon3			GGATCCGCTCAGG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.977G>A	chr1.hg19:g.176563717G>A	ENSP00000356634:p.Arg326His	78.0	0.0		152.0	39.0	NM_021936	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	hg19	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.192772	0.38707	0.0	1.2E-4	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.73897	-0.79;-0.79	5.45	3.59	0.41128	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.111801	0.64402	N	0.000007	T	0.63757	0.2538	L	0.45051	1.395	0.39139	D	0.962005	B;B	0.31125	0.026;0.309	B;B	0.27170	0.014;0.077	T	0.59736	-0.7398	10	0.30854	T	0.27	-19.5477	11.4449	0.50116	0.1471:0.0:0.8528:0.0	.	326;326	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	H	326	ENSP00000356634:R326H;ENSP00000356633:R326H	ENSP00000356633:R326H	R	+	2	0	PAPPA2	174830340	0.009000	0.17119	1.000000	0.80357	0.984000	0.73092	0.828000	0.27435	0.677000	0.31305	0.650000	0.86243	CGC	.	.		0.542	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
IPO9	55705	hgsc.bcm.edu	37	1	201839912	201839912	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:201839912G>A	ENST00000361565.4	+	18	2404	c.2335G>A	c.(2335-2337)Ggg>Agg	p.G779R		NM_018085.4	NP_060555.2	Q96P70	IPO9_HUMAN	importin 9	779					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	histone binding (GO:0042393)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	38						GCGGGAACTCGGGGAGAATCT	0.592																																					p.G779R		Atlas-SNP	.											.	IPO9	98	.	0			c.G2335A						.						52.0	53.0	52.0					1																	201839912		2203	4300	6503	SO:0001583	missense	55705	exon18			GAACTCGGGGAGA	AF410465	CCDS1415.1	1q31.3	2008-02-05			ENSG00000198700	ENSG00000198700		"""Importins"""	19425	protein-coding gene	gene with protein product						11823430, 10574461	Standard	NM_018085		Approved	Imp9, FLJ10402	uc001gwz.3	Q96P70	OTTHUMG00000035805	ENST00000361565.4:c.2335G>A	chr1.hg19:g.201839912G>A	ENSP00000354742:p.Gly779Arg	37.0	0.0		108.0	6.0	NM_018085	B1ASV5|Q8N1Y1|Q8N3I2|Q8NCG9|Q96SU6|Q9NW01|Q9P0A8|Q9ULM8	Missense_Mutation	SNP	ENST00000361565.4	hg19	CCDS1415.1	.	.	.	.	.	.	.	.	.	.	G	31	5.093265	0.94149	.	.	ENSG00000198700	ENST00000361565	T	0.66280	-0.2	5.59	5.59	0.84812	Armadillo-like helical (1);Armadillo-type fold (1);	0.047505	0.85682	D	0.000000	T	0.76976	0.4063	M	0.71206	2.165	0.80722	D	1	D	0.76494	0.999	D	0.65010	0.931	T	0.76429	-0.2962	10	0.44086	T	0.13	-8.8262	17.091	0.86622	0.0:0.0:1.0:0.0	.	779	Q96P70	IPO9_HUMAN	R	779	ENSP00000354742:G779R	ENSP00000354742:G779R	G	+	1	0	IPO9	200106535	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.363000	0.97131	2.629000	0.89072	0.591000	0.81541	GGG	.	.		0.592	IPO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087088.1	NM_018085	
BROX	148362	hgsc.bcm.edu	37	1	222900566	222900566	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:222900566G>A	ENST00000340934.5	+	8	1043	c.637G>A	c.(637-639)Gcg>Acg	p.A213T	BROX_ENST00000539697.1_Missense_Mutation_p.A181T|BROX_ENST00000537020.1_Missense_Mutation_p.A213T	NM_144695.2	NP_653296.2	Q5VW32	BROX_HUMAN	BRO1 domain and CAAX motif containing	213	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	14						TGCTGCACTGGCGTATGAAAC	0.333																																					p.A213T		Atlas-SNP	.											.	BROX	45	.	0			c.G637A						.						113.0	112.0	112.0					1																	222900566		2203	4300	6503	SO:0001583	missense	148362	exon8			GCACTGGCGTATG		CCDS1534.1, CCDS73036.1, CCDS73037.1	1q41	2010-11-30	2010-11-30	2010-11-30	ENSG00000162819	ENSG00000162819			26512	protein-coding gene	gene with protein product	"""BRO1 domain containing protein"""		"""chromosome 1 open reading frame 58"""	C1orf58		18190528	Standard	XM_005273065		Approved	FLJ32421	uc001hnq.1	Q5VW32	OTTHUMG00000037650	ENST00000340934.5:c.637G>A	chr1.hg19:g.222900566G>A	ENSP00000343742:p.Ala213Thr	148.0	0.0		344.0	15.0	NM_144695	B7Z9G5|Q96MG1	Missense_Mutation	SNP	ENST00000340934.5	hg19	CCDS1534.1	.	.	.	.	.	.	.	.	.	.	g	35	5.576968	0.96565	.	.	ENSG00000162819	ENST00000340934;ENST00000426638;ENST00000537020;ENST00000539697	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	5.96	5.96	0.96718	BRO1 domain (3);	0.000000	0.85682	D	0.000000	T	0.62295	0.2416	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.988;0.983;0.993	T	0.63391	-0.6648	10	0.59425	D	0.04	-17.355	20.422	0.99049	0.0:0.0:1.0:0.0	.	213;181;213	F5GXQ0;B7Z9G5;Q5VW32	.;.;BROX_HUMAN	T	213;213;213;181	ENSP00000343742:A213T;ENSP00000398862:A213T;ENSP00000440041:A213T;ENSP00000441080:A181T	ENSP00000343742:A213T	A	+	1	0	BROX	220967189	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	8.950000	0.93019	2.832000	0.97577	0.655000	0.94253	GCG	.	.		0.333	BROX-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091815.2	NM_144695	
PCNXL2	80003	hgsc.bcm.edu	37	1	233394789	233394789	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:233394789G>C	ENST00000258229.9	-	5	1053	c.819C>G	c.(817-819)ttC>ttG	p.F273L	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	273						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				CCCACGGCTGGAAAGAAACGT	0.522																																					p.F273L		Atlas-SNP	.											.	PCNXL2	204	.	0			c.C819G						.						54.0	58.0	57.0					1																	233394789		1925	4124	6049	SO:0001583	missense	80003	exon5			CGGCTGGAAAGAA	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.819C>G	chr1.hg19:g.233394789G>C	ENSP00000258229:p.Phe273Leu	72.0	0.0		202.0	39.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	hg19	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.842492	0.32606	.	.	ENSG00000135749	ENST00000258229	T	0.61980	0.06	4.4	2.45	0.29901	.	.	.	.	.	T	0.41351	0.1155	L	0.27053	0.805	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.32534	-0.9903	9	0.46703	T	0.11	.	1.2293	0.01940	0.1725:0.1468:0.3785:0.3022	.	273	A6NKB5	PCX2_HUMAN	L	273	ENSP00000258229:F273L	ENSP00000258229:F273L	F	-	3	2	PCNXL2	231461412	1.000000	0.71417	0.977000	0.42913	0.947000	0.59692	0.888000	0.28268	0.546000	0.28920	-0.263000	0.10527	TTC	.	.		0.522	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
OR14A16	284532	hgsc.bcm.edu	37	1	247978806	247978806	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:247978806C>T	ENST00000357627.1	-	1	225	c.226G>A	c.(226-228)Gct>Act	p.A76T		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	76						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						GATTTGGGAGCCGTGACTGAA	0.418																																					p.A76T	Ovarian(112;180 1586 15073 21914 33526)	Atlas-SNP	.											OR14A16,NS,carcinoma,0,1	OR14A16	90	.	0			c.G226A						.						81.0	83.0	82.0					1																	247978806		2203	4300	6503	SO:0001583	missense	284532	exon1			TGGGAGCCGTGAC	BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.226G>A	chr1.hg19:g.247978806C>T	ENSP00000350248:p.Ala76Thr	186.0	0.0		404.0	45.0	NM_001001966	Q6IF96	Missense_Mutation	SNP	ENST00000357627.1	hg19	CCDS31097.1	.	.	.	.	.	.	.	.	.	.	C	10.94	1.491701	0.26774	.	.	ENSG00000196772	ENST00000357627	T	0.01197	5.19	3.51	-0.103	0.13609	GPCR, rhodopsin-like superfamily (1);	0.874344	0.09353	U	0.813915	T	0.00695	0.0023	N	0.03930	-0.32	0.09310	N	1	B	0.13594	0.008	B	0.17098	0.017	T	0.47005	-0.9150	10	0.42905	T	0.14	.	5.4843	0.16741	0.0:0.5641:0.1447:0.2912	.	76	Q8NHC5	O14AG_HUMAN	T	76	ENSP00000350248:A76T	ENSP00000350248:A76T	A	-	1	0	OR14A16	246045429	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.856000	0.00349	0.029000	0.15352	0.590000	0.80494	GCT	.	.		0.418	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096856.1	NM_001001966	
SPAST	6683	hgsc.bcm.edu	37	2	32289153	32289153	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:32289153G>A	ENST00000315285.3	+	1	378	c.253G>A	c.(253-255)Gcc>Acc	p.A85T	SPAST_ENST00000345662.1_Missense_Mutation_p.A85T	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					CTTCTCCCGCGCCCTCATGGC	0.711																																					p.A85T		Atlas-SNP	.											.	SPAST	61	.	0			c.G253A						.						26.0	25.0	26.0					2																	32289153		2203	4300	6503	SO:0001583	missense	6683	exon1			TCCCGCGCCCTCA	AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.253G>A	chr2.hg19:g.32289153G>A	ENSP00000320885:p.Ala85Thr	553.0	0.0		713.0	124.0	NM_199436		Missense_Mutation	SNP	ENST00000315285.3	hg19	CCDS1778.1	.	.	.	.	.	.	.	.	.	.	g	13.32	2.202123	0.38905	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	D;D	0.93811	-3.29;-3.2	4.29	2.25	0.28309	.	0.495427	0.17461	N	0.173455	T	0.80727	0.4678	N	0.08118	0	0.35049	D	0.760482	B;B	0.31837	0.168;0.342	B;B	0.20184	0.013;0.028	T	0.77998	-0.2376	10	0.23891	T	0.37	-1.8705	7.0207	0.24912	0.095:0.3399:0.565:0.0	.	85;85	E5KRP6;Q9UBP0	.;SPAST_HUMAN	T	85	ENSP00000340817:A85T;ENSP00000320885:A85T	ENSP00000320885:A85T	A	+	1	0	SPAST	32142657	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	3.012000	0.49575	0.884000	0.36064	0.637000	0.83480	GCC	.	.		0.711	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436	
SOS1	6654	hgsc.bcm.edu	37	2	39250269	39250269	+	Missense_Mutation	SNP	C	C	T	rs397517148		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:39250269C>T	ENST00000426016.1	-	11	1386	c.1300G>A	c.(1300-1302)Gga>Aga	p.G434R	SOS1_ENST00000402219.2_Missense_Mutation_p.G434R|SOS1_ENST00000472480.1_5'UTR|SOS1_ENST00000395038.2_Missense_Mutation_p.G434R			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	434			G -> K (in NS4; requires 2 nucleotide substitutions). {ECO:0000269|PubMed:21387466}.|G -> R (in NS4). {ECO:0000269|PubMed:17143285, ECO:0000269|PubMed:21387466}.		apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				ATGTCTTTTCCCTCCCAACCA	0.388									Noonan syndrome																												p.G434R		Atlas-SNP	.											SOS1,scalp,malignant_melanoma,+1,1	SOS1	134	.	0			c.G1300A	GRCh37	CM070282|CM074572	SOS1	M		.						116.0	103.0	107.0					2																	39250269		2203	4300	6503	SO:0001583	missense	6654	exon10	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	CTTTTCCCTCCCA	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.1300G>A	chr2.hg19:g.39250269C>T	ENSP00000387784:p.Gly434Arg	63.0	0.0		83.0	25.0	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	hg19	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490590	0.84962	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	D;D;D	0.91577	-2.87;-2.87;-2.87	5.52	5.52	0.82312	Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.95014	0.8386	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94925	0.8077	10	0.72032	D	0.01	.	19.8	0.96502	0.0:1.0:0.0:0.0	.	166;434	F5GX06;Q07889	.;SOS1_HUMAN	R	434;434;166;434;434	ENSP00000387784:G434R;ENSP00000384675:G434R;ENSP00000378479:G434R	ENSP00000263879:G434R	G	-	1	0	SOS1	39103773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.666000	0.83877	2.753000	0.94483	0.557000	0.71058	GGA	.	.		0.388	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
DYSF	8291	hgsc.bcm.edu	37	2	71839841	71839841	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:71839841G>A	ENST00000258104.3	+	39	4515	c.4238G>A	c.(4237-4239)cGc>cAc	p.R1413H	DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000409366.1_Missense_Mutation_p.R1414H|DYSF_ENST00000409744.1_Missense_Mutation_p.R1400H|DYSF_ENST00000394120.2_Missense_Mutation_p.R1414H|DYSF_ENST00000409582.3_Missense_Mutation_p.R1430H|DYSF_ENST00000429174.2_Missense_Mutation_p.R1413H|DYSF_ENST00000409651.1_Missense_Mutation_p.R1445H|DYSF_ENST00000410020.3_Missense_Mutation_p.R1431H|DYSF_ENST00000410041.1_Missense_Mutation_p.R1431H|DYSF_ENST00000413539.2_Missense_Mutation_p.R1444H|DYSF_ENST00000409762.1_Missense_Mutation_p.R1430H	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1413	C2 5. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)	p.R1413L(1)|p.R1431L(1)		autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						CAGTTTGGCCGCCGGCCTGTG	0.647																																					p.R1445H		Atlas-SNP	.											DYSF_ENST00000410020,NS,carcinoma,0,2	DYSF	536	.	2	Substitution - Missense(2)	lung(2)	c.G4334A						.						56.0	52.0	53.0					2																	71839841		2203	4300	6503	SO:0001583	missense	8291	exon40			TTGGCCGCCGGCC	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.4238G>A	chr2.hg19:g.71839841G>A	ENSP00000258104:p.Arg1413His	143.0	0.0		199.0	56.0	NM_001130982	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	hg19	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	G	35	5.553529	0.96501	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	T;T;T;T;T;T;T;T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47;-1.47	5.52	5.52	0.82312	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.92024	0.7473	M	0.92833	3.35	0.58432	D	0.999996	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;1.0;1.0;1.0;1.0;1.0;0.999;1.0;0.993;1.0;0.996;1.0;1.0;1.0;1.0	D	0.93056	0.6470	10	0.54805	T	0.06	-23.5585	16.9157	0.86150	0.0:0.0:1.0:0.0	.	156;1445;1431;1414;1400;1431;1400;1430;1399;1444;1430;1413;1399;1414;1413	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	H	1444;1430;1430;1413;1413;1445;1414;1400;1414;1431;1431	ENSP00000407046:R1444H;ENSP00000387137:R1430H;ENSP00000386547:R1430H;ENSP00000398305:R1413H;ENSP00000258104:R1413H;ENSP00000386683:R1445H;ENSP00000377678:R1414H;ENSP00000386285:R1400H;ENSP00000386512:R1414H;ENSP00000386881:R1431H;ENSP00000386617:R1431H	ENSP00000258104:R1413H	R	+	2	0	DYSF	71693349	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.835000	0.86780	2.610000	0.88304	0.561000	0.74099	CGC	.	.		0.647	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
ST6GAL2	84620	hgsc.bcm.edu	37	2	107450508	107450508	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:107450508C>T	ENST00000409382.3	-	3	1648	c.1038G>A	c.(1036-1038)tcG>tcA	p.S346S	ST6GAL2_ENST00000409087.3_Silent_p.S346S|ST6GAL2_ENST00000361686.4_Silent_p.S346S|AC016994.2_ENST00000425419.1_RNA	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	346					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						GTCTTACCTGCGAATTAATGA	0.388																																					p.S346S		Atlas-SNP	.											.	ST6GAL2	159	.	0			c.G1038A						.						213.0	201.0	205.0					2																	107450508		2203	4300	6503	SO:0001819	synonymous_variant	84620	exon3			TACCTGCGAATTA	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1038G>A	chr2.hg19:g.107450508C>T		68.0	0.0		99.0	30.0	NM_032528	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	hg19	CCDS2073.1																																																																																			.	.		0.388	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
SH3RF3	344558	hgsc.bcm.edu	37	2	109964272	109964272	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:109964272C>A	ENST00000309415.6	+	2	716	c.716C>A	c.(715-717)aCa>aAa	p.T239K		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	239	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CTGCACGGCACACAGGGCTTC	0.577																																					p.T239K		Atlas-SNP	.											.	SH3RF3	62	.	0			c.C716A						.						55.0	63.0	60.0					2																	109964272		2158	4250	6408	SO:0001583	missense	344558	exon2			ACGGCACACAGGG	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.716C>A	chr2.hg19:g.109964272C>A	ENSP00000309186:p.Thr239Lys	124.0	0.0		164.0	13.0	NM_001099289	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	hg19		.	.	.	.	.	.	.	.	.	.	C	0.006	-2.078175	0.00375	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.41065	1.01;1.01	4.82	1.61	0.23674	Src homology-3 domain (4);	.	.	.	.	T	0.15522	0.0374	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.17979	0.02	T	0.31280	-0.9949	8	0.05620	T	0.96	.	2.7912	0.05388	0.4913:0.3035:0.0988:0.1063	.	239	Q8TEJ3	SH3R3_HUMAN	K	239	ENSP00000414997:T239K;ENSP00000309186:T239K	ENSP00000309186:T239K	T	+	2	0	SH3RF3	109330704	0.000000	0.05858	0.000000	0.03702	0.192000	0.23643	0.036000	0.13819	0.059000	0.16252	0.484000	0.47621	ACA	.	.		0.577	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
METAP1D	254042	hgsc.bcm.edu	37	2	172930371	172930371	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:172930371C>T	ENST00000315796.4	+	4	775	c.388C>T	c.(388-390)Cgg>Tgg	p.R130W	METAP1D_ENST00000488581.1_Intron	NM_199227.1	NP_954697.1	Q6UB28	MAP12_HUMAN	methionyl aminopeptidase type 1D (mitochondrial)	130					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|protein initiator methionine removal (GO:0070084)	mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			NS(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	8						TCTTGTTCATCGGGAAATCAT	0.368																																					p.R130W		Atlas-SNP	.											.	METAP1D	32	.	0			c.C388T						.						210.0	172.0	185.0					2																	172930371		2203	4300	6503	SO:0001583	missense	254042	exon4			GTTCATCGGGAAA	AY374142, BC029123	CCDS2246.1	2q31.1	2010-09-21			ENSG00000172878	ENSG00000172878			32583	protein-coding gene	gene with protein product	"""methionine aminopeptidase 1D"""	610267				14532271, 16568094	Standard	NM_199227		Approved	MAP1D, Metap1l	uc002uhk.3	Q6UB28	OTTHUMG00000132283	ENST00000315796.4:c.388C>T	chr2.hg19:g.172930371C>T	ENSP00000315152:p.Arg130Trp	68.0	0.0		89.0	6.0	NM_199227	Q1WNX3	Missense_Mutation	SNP	ENST00000315796.4	hg19	CCDS2246.1	.	.	.	.	.	.	.	.	.	.	C	5.241	0.230000	0.09969	.	.	ENSG00000172878	ENST00000315796	T	0.76968	-1.06	5.68	3.87	0.44632	Peptidase M24, structural domain (3);	0.314175	0.39615	N	0.001313	T	0.71617	0.3361	L	0.58810	1.83	0.24283	N	0.995196	B	0.06786	0.001	B	0.01281	0.0	T	0.64931	-0.6291	10	0.72032	D	0.01	-8.3285	8.5518	0.33455	0.0:0.7392:0.1253:0.1355	.	130	Q6UB28	AMP1D_HUMAN	W	130	ENSP00000315152:R130W	ENSP00000315152:R130W	R	+	1	2	METAP1D	172638617	1.000000	0.71417	0.999000	0.59377	0.009000	0.06853	2.805000	0.47939	0.846000	0.35142	-0.145000	0.13849	CGG	.	.		0.368	METAP1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255378.2	NM_199227	
HECW2	57520	hgsc.bcm.edu	37	2	197066049	197066049	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:197066049T>A	ENST00000260983.3	-	29	4853	c.4671A>T	c.(4669-4671)gaA>gaT	p.E1557D	HECW2_ENST00000409111.1_Missense_Mutation_p.E1201D	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	1557	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						TCAACAGTTTTTCATAAAGCA	0.453																																					p.E1557D		Atlas-SNP	.											.	HECW2	239	.	0			c.A4671T						.						140.0	126.0	131.0					2																	197066049		2203	4300	6503	SO:0001583	missense	57520	exon29			CAGTTTTTCATAA	AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.4671A>T	chr2.hg19:g.197066049T>A	ENSP00000260983:p.Glu1557Asp	95.0	0.0		92.0	24.0	NM_020760	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	ENST00000260983.3	hg19	CCDS33354.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.428499	0.43122	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.51574	0.7;0.7	4.98	-2.07	0.07276	HECT (4);	0.000000	0.85682	D	0.000000	T	0.57710	0.2072	L	0.56340	1.77	0.47994	D	0.999566	D	0.57571	0.98	D	0.70935	0.971	T	0.53373	-0.8448	10	0.52906	T	0.07	.	12.7739	0.57436	0.0:0.3837:0.0:0.6163	.	1557	Q9P2P5	HECW2_HUMAN	D	1201;1557	ENSP00000386775:E1201D;ENSP00000260983:E1557D	ENSP00000260983:E1557D	E	-	3	2	HECW2	196774294	1.000000	0.71417	0.948000	0.38648	0.845000	0.48019	1.078000	0.30754	-0.920000	0.03799	-1.937000	0.00501	GAA	.	.		0.453	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335199.3	NM_020760	
SLC16A14	151473	hgsc.bcm.edu	37	2	230914607	230914607	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:230914607G>A	ENST00000295190.4	-	3	731	c.273C>T	c.(271-273)ggC>ggT	p.G91G		NM_152527.4	NP_689740.2	Q7RTX9	MOT14_HUMAN	solute carrier family 16, member 14	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			NS(1)|cervix(1)|endometrium(7)|large_intestine(7)|lung(3)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.149)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;7.31e-13)|all cancers(144;5.1e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00948)		TAATGAACAAGCCGATGAAAG	0.468																																					p.G91G		Atlas-SNP	.											.	SLC16A14	75	.	0			c.C273T						.						51.0	52.0	52.0					2																	230914607		2203	4300	6503	SO:0001819	synonymous_variant	151473	exon3			GAACAAGCCGATG	BN000146	CCDS2473.1	2q37.1	2013-07-18	2013-07-18		ENSG00000163053	ENSG00000163053		"""Solute carriers"""	26417	protein-coding gene	gene with protein product	"""monocarboxylic acid transporter 14"""		"""solute carrier family 16 (monocarboxylic acid transporters), member 14"""				Standard	NM_152527		Approved	FLJ30794, MCT14	uc002vqd.2	Q7RTX9	OTTHUMG00000133205	ENST00000295190.4:c.273C>T	chr2.hg19:g.230914607G>A		238.0	0.0		300.0	101.0	NM_152527	A8KA08|Q53R92|Q96NI7	Silent	SNP	ENST00000295190.4	hg19	CCDS2473.1																																																																																			.	.		0.468	SLC16A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256918.2	NM_152527	
NGEF	25791	hgsc.bcm.edu	37	2	233785159	233785159	+	Silent	SNP	C	C	T	rs533719625	byFrequency	TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr2:233785159C>T	ENST00000264051.3	-	5	941	c.663G>A	c.(661-663)gaG>gaA	p.E221E	NGEF_ENST00000373552.4_Silent_p.E129E|NGEF_ENST00000409079.1_Silent_p.E129E	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	221	Poly-Glu.|Regulatory region; modulates activity toward RHOA, RAC1 and CDC42. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E221E(3)		central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		cctcctcctcctcttcttctt	0.572																																					p.E221E		Atlas-SNP	.											NGEF_ENST00000264051,NS,carcinoma,0,7	NGEF	198	.	3	Substitution - coding silent(3)	endometrium(2)|central_nervous_system(1)	c.G663A						.						68.0	72.0	71.0					2																	233785159		2203	4300	6503	SO:0001819	synonymous_variant	25791	exon5			CTCCTCCTCTTCT	AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.663G>A	chr2.hg19:g.233785159C>T		39.0	0.0		74.0	4.0	NM_019850	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Silent	SNP	ENST00000264051.3	hg19	CCDS2500.1																																																																																			.	.		0.572	NGEF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257051.2	XM_044799	
FBLN2	2199	hgsc.bcm.edu	37	3	13612701	13612701	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr3:13612701G>A	ENST00000295760.7	+	2	915	c.846G>A	c.(844-846)gaG>gaA	p.E282E	FBLN2_ENST00000492059.1_Silent_p.E282E|FBLN2_ENST00000404922.3_Silent_p.E282E|FBLN2_ENST00000535798.1_Silent_p.E308E	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	282	N.|Subdomain NB (Cys-free).				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			aggaagaagaggaggaggagg	0.657																																					p.E282E		Atlas-SNP	.											.	FBLN2	137	.	0			c.G846A						.						9.0	12.0	11.0					3																	13612701		2129	4247	6376	SO:0001819	synonymous_variant	2199	exon2			AGAAGAGGAGGAG	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.846G>A	chr3.hg19:g.13612701G>A		83.0	0.0		111.0	5.0	NM_001998	B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	ENST00000295760.7	hg19	CCDS46762.1																																																																																			.	.		0.657	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
COLQ	8292	hgsc.bcm.edu	37	3	15498035	15498035	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr3:15498035C>T	ENST00000383788.5	-	14	1131	c.1006G>A	c.(1006-1008)Gcc>Acc	p.A336T	COLQ_ENST00000383781.4_Missense_Mutation_p.A326T|COLQ_ENST00000383786.5_Missense_Mutation_p.A302T|COLQ_ENST00000435459.2_Missense_Mutation_p.A326T|COLQ_ENST00000383787.2_Missense_Mutation_p.A327T|COLQ_ENST00000383785.2_3'UTR|COLQ_ENST00000603808.1_Missense_Mutation_p.A336T	NM_005677.3	NP_005668.2	Q9Y215	COLQ_HUMAN	collagen-like tail subunit (single strand of homotrimer) of asymmetric acetylcholinesterase	336					acetylcholine catabolic process in synaptic cleft (GO:0001507)|asymmetric protein localization (GO:0008105)	basal lamina (GO:0005605)|cell junction (GO:0030054)|collagen trimer (GO:0005581)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(4)|lung(10)|skin(3)	19						AAGGCAATGGCGTTTTGGGTG	0.537																																					p.A336T		Atlas-SNP	.											.	COLQ	82	.	0			c.G1006A						.						163.0	152.0	156.0					3																	15498035		2203	4300	6503	SO:0001583	missense	8292	exon14			CAATGGCGTTTTG	AF057036	CCDS33709.1, CCDS43057.1, CCDS46768.1	3p	2008-07-18			ENSG00000206561	ENSG00000206561			2226	protein-coding gene	gene with protein product	"""single strand of homotrimeric collagen-like tail subunit of asymmetric acetylcholinesterase"", ""collagenic tail of endplate acetylcholinesterase"", ""AChE Q subunit"", ""acetylcholinesterase-associated collagen"""	603033				9689136	Standard	NM_005677		Approved	EAD	uc003bzx.3	Q9Y215	OTTHUMG00000156233	ENST00000383788.5:c.1006G>A	chr3.hg19:g.15498035C>T	ENSP00000373298:p.Ala336Thr	28.0	0.0		55.0	15.0	NM_005677	B3KY09|Q6DK18|Q6YH18|Q6YH19|Q6YH20|Q6YH21|Q9NP18|Q9NP19|Q9NP20|Q9NP21|Q9NP22|Q9NP23|Q9NP24|Q9UP88	Missense_Mutation	SNP	ENST00000383788.5	hg19	CCDS33709.1	.	.	.	.	.	.	.	.	.	.	C	19.88	3.909156	0.72868	.	.	ENSG00000206561	ENST00000383787;ENST00000383781;ENST00000435459;ENST00000383788;ENST00000420589;ENST00000454772;ENST00000383786	D;D;D;D;D	0.93133	-2.8;-2.92;-3.17;-2.89;-2.91	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.95802	0.8634	L	0.60455	1.87	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.997;0.993;0.999	D	0.93918	0.7203	10	0.24483	T	0.36	-14.5069	19.4381	0.94806	0.0:1.0:0.0:0.0	.	302;327;336;326	Q9Y215-3;Q9Y215-5;Q9Y215;Q9Y215-2	.;.;COLQ_HUMAN;.	T	327;326;326;336;326;336;302	ENSP00000373297:A327T;ENSP00000373291:A326T;ENSP00000402511:A326T;ENSP00000373298:A336T;ENSP00000373296:A302T	ENSP00000373291:A326T	A	-	1	0	COLQ	15473039	1.000000	0.71417	0.960000	0.40013	0.979000	0.70002	5.743000	0.68655	2.606000	0.88127	0.561000	0.74099	GCC	.	.		0.537	COLQ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000343575.1	NM_005677	
GADL1	339896	hgsc.bcm.edu	37	3	30842571	30842571	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr3:30842571T>A	ENST00000282538.5	-	12	1210	c.1060A>T	c.(1060-1062)Aaa>Taa	p.K354*	GADL1_ENST00000454381.3_Nonsense_Mutation_p.K354*	NM_207359.2	NP_997242.2	Q6ZQY3	GADL1_HUMAN	glutamate decarboxylase-like 1	354					carboxylic acid metabolic process (GO:0019752)		aspartate 1-decarboxylase activity (GO:0004068)|pyridoxal phosphate binding (GO:0030170)|sulfinoalanine decarboxylase activity (GO:0004782)			breast(2)|endometrium(3)|kidney(2)|lung(17)|upper_aerodigestive_tract(1)	25						TAGCATTTTTTAAGAAGATCC	0.353																																					p.K354X		Atlas-SNP	.											.	GADL1	91	.	0			c.A1060T						.						72.0	67.0	69.0					3																	30842571		2203	4300	6503	SO:0001587	stop_gained	339896	exon12			ATTTTTTAAGAAG	AK128643	CCDS2649.2	3p23-p22	2009-01-14			ENSG00000144644	ENSG00000144644			27949	protein-coding gene	gene with protein product		615601					Standard	NM_207359		Approved		uc003cep.2	Q6ZQY3	OTTHUMG00000130621	ENST00000282538.5:c.1060A>T	chr3.hg19:g.30842571T>A	ENSP00000282538:p.Lys354*	58.0	0.0		85.0	29.0	NM_207359		Nonsense_Mutation	SNP	ENST00000282538.5	hg19	CCDS2649.2	.	.	.	.	.	.	.	.	.	.	T	16.81	3.226614	0.58668	.	.	ENSG00000144644	ENST00000282538;ENST00000454381	.	.	.	5.47	4.3	0.51218	.	0.233059	0.42172	D	0.000760	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	12.5695	0.56328	0.0:0.0:0.1392:0.8608	.	.	.	.	X	354	.	ENSP00000282538:K354X	K	-	1	0	GADL1	30817575	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	3.188000	0.50958	0.892000	0.36259	-0.449000	0.05564	AAA	.	.		0.353	GADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253106.2	NM_207359	
RASSF1	11186	hgsc.bcm.edu	37	3	50374725	50374725	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr3:50374725A>C	ENST00000327761.3	-	1	170	c.26T>G	c.(25-27)tTc>tGc	p.F9C	RASSF1_ENST00000488024.1_5'UTR|RASSF1_ENST00000359365.4_Intron|RASSF1_ENST00000395126.3_Intron|RASSF1_ENST00000357043.2_Intron	NM_170713.2	NP_733831.1			Ras association (RalGDS/AF-6) domain family member 1											lung(2)|ovary(1)|skin(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000278)|OV - Ovarian serous cystadenocarcinoma(275;0.0015)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GGTCATTTCGAAAGAAGGCGC	0.667																																					p.F9C		Atlas-SNP	.											.	RASSF1	46	.	0			c.T26G						.						57.0	56.0	57.0					3																	50374725		2203	4300	6503	SO:0001583	missense	11186	exon1			ATTTCGAAAGAAG	AF132675	CCDS2820.1, CCDS2821.1, CCDS2822.1, CCDS43096.1	3p21.3	2008-02-22	2008-02-22		ENSG00000068028	ENSG00000068028			9882	protein-coding gene	gene with protein product		605082					Standard	NM_170713		Approved	NORE2A, REH3P21, RDA32, 123F2	uc003dad.1	Q9NS23	OTTHUMG00000149958	ENST00000327761.3:c.26T>G	chr3.hg19:g.50374725A>C	ENSP00000333327:p.Phe9Cys	53.0	0.0		56.0	20.0	NM_170713		Missense_Mutation	SNP	ENST00000327761.3	hg19	CCDS2821.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.518993	0.85495	.	.	ENSG00000068028	ENST00000327761	T	0.11930	2.73	4.62	4.62	0.57501	.	.	.	.	.	T	0.15565	0.0375	L	0.57536	1.79	0.80722	D	1	P	0.50710	0.938	B	0.42771	0.397	T	0.01349	-1.1378	9	0.87932	D	0	.	8.3873	0.32508	0.9067:0.0:0.0933:0.0	.	9	Q5TZT2	.	C	9	ENSP00000333327:F9C	ENSP00000333327:F9C	F	-	2	0	RASSF1	50349729	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	6.037000	0.70956	1.935000	0.56089	0.448000	0.29417	TTC	.	.		0.667	RASSF1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314309.1		
APPL1	26060	hgsc.bcm.edu	37	3	57282311	57282311	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr3:57282311C>T	ENST00000288266.3	+	10	942	c.795C>T	c.(793-795)gaC>gaT	p.D265D		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	265	Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)			breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		ATGTGCCTGACCCAGACCCCA	0.403																																					p.D265D		Atlas-SNP	.											.	APPL1	59	.	0			c.C795T						.						113.0	108.0	110.0					3																	57282311		2203	4300	6503	SO:0001819	synonymous_variant	26060	exon10			GCCTGACCCAGAC	AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.795C>T	chr3.hg19:g.57282311C>T		151.0	0.0		181.0	33.0	NM_012096	Q9P2B9	Silent	SNP	ENST00000288266.3	hg19	CCDS2882.1																																																																																			.	.		0.403	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	NM_012096	
CCNL1	57018	hgsc.bcm.edu	37	3	156876717	156876717	+	Silent	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr3:156876717T>C	ENST00000295926.3	-	3	544	c.426A>G	c.(424-426)gcA>gcG	p.A142A	CCNL1_ENST00000461804.1_Silent_p.A142A|CCNL1_ENST00000295925.4_Silent_p.A142A	NM_020307.2	NP_064703.1	Q9UK58	CCNL1_HUMAN	cyclin L1	142	Cyclin-like 1.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|nucleus (GO:0005634)				NS(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|stomach(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			TTCTTCTAGGTGCTTCTTCGA	0.368																																					p.A142A		Atlas-SNP	.											.	CCNL1	53	.	0			c.A426G						.						195.0	181.0	186.0					3																	156876717		2203	4300	6503	SO:0001819	synonymous_variant	57018	exon3			TCTAGGTGCTTCT	AF180920	CCDS3178.1	3q25.31	2008-02-05			ENSG00000163660	ENSG00000163660			20569	protein-coding gene	gene with protein product		613384				11980906	Standard	NM_020307		Approved	ania-6a	uc003fbf.3	Q9UK58	OTTHUMG00000158713	ENST00000295926.3:c.426A>G	chr3.hg19:g.156876717T>C		45.0	0.0		72.0	7.0	NM_020307	B3KMY3|Q6NVY9|Q6UWS7|Q8NI48|Q96QT0|Q9NZF3	Silent	SNP	ENST00000295926.3	hg19	CCDS3178.1																																																																																			.	.		0.368	CCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351859.1	NM_020307	
PIK3CA	5290	hgsc.bcm.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047R	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,adenocarcinoma,0,2044	PIK3CA	8460	.	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140G						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290	exon21			ATGCACATCATGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	chr3.hg19:g.178952085A>G	ENSP00000263967:p.His1047Arg	128.0	0.0		128.0	10.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	.	.		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
STK32B	55351	hgsc.bcm.edu	37	4	5333066	5333066	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr4:5333066T>G	ENST00000282908.5	+	4	802	c.380T>G	c.(379-381)aTc>aGc	p.I127S	STK32B_ENST00000512636.1_Missense_Mutation_p.I80S|STK32B_ENST00000510398.1_Missense_Mutation_p.I80S	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						AAACTCTACATCTGTGAGCTG	0.577																																					p.I127S		Atlas-SNP	.											.	STK32B	87	.	0			c.T380G						.						106.0	91.0	96.0					4																	5333066		2203	4300	6503	SO:0001583	missense	55351	exon4			TCTACATCTGTGA	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.380T>G	chr4.hg19:g.5333066T>G	ENSP00000282908:p.Ile127Ser	48.0	0.0		66.0	30.0	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	hg19	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	T	13.59	2.282690	0.40394	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.66460	-0.21;-0.21;-0.21	5.19	5.19	0.71726	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.42053	U	0.000770	T	0.71970	0.3403	L	0.31420	0.93	0.54753	D	0.999987	P	0.48503	0.911	D	0.63793	0.918	T	0.75584	-0.3267	10	0.87932	D	0	.	14.5285	0.67905	0.0:0.0:0.0:1.0	.	127	Q9NY57	ST32B_HUMAN	S	127;80;80	ENSP00000282908:I127S;ENSP00000423209:I80S;ENSP00000420984:I80S	ENSP00000282908:I127S	I	+	2	0	STK32B	5383967	1.000000	0.71417	1.000000	0.80357	0.321000	0.28281	7.434000	0.80377	2.068000	0.61886	0.460000	0.39030	ATC	.	.		0.577	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
GRXCR1	389207	hgsc.bcm.edu	37	4	42895607	42895607	+	Silent	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr4:42895607C>A	ENST00000399770.2	+	1	324	c.324C>A	c.(322-324)ggC>ggA	p.G108G	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	108					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						CAGTCAGAGGCGTCAAATACA	0.433																																					p.G108G		Atlas-SNP	.											.	GRXCR1	78	.	0			c.C324A						.						110.0	112.0	112.0					4																	42895607		1960	4152	6112	SO:0001819	synonymous_variant	389207	exon1			CAGAGGCGTCAAA		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.324C>A	chr4.hg19:g.42895607C>A		65.0	0.0		72.0	6.0	NM_001080476		Silent	SNP	ENST00000399770.2	hg19	CCDS43225.1																																																																																			.	.		0.433	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
GRXCR1	389207	hgsc.bcm.edu	37	4	42964912	42964912	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr4:42964912C>A	ENST00000399770.2	+	2	388	c.388C>A	c.(388-390)Cca>Aca	p.P130T		NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	130	Glutaredoxin. {ECO:0000255|PROSITE- ProRule:PRU00686}.				auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						CCTTCAGCAACCATCAACTGA	0.358																																					p.P130T		Atlas-SNP	.											.	GRXCR1	78	.	0			c.C388A						.						154.0	148.0	150.0					4																	42964912		1868	4103	5971	SO:0001583	missense	389207	exon2			CAGCAACCATCAA		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.388C>A	chr4.hg19:g.42964912C>A	ENSP00000382670:p.Pro130Thr	101.0	0.0		131.0	49.0	NM_001080476		Missense_Mutation	SNP	ENST00000399770.2	hg19	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	C	10.40	1.340764	0.24339	.	.	ENSG00000215203	ENST00000399770	T	0.32753	1.44	5.78	5.78	0.91487	Glutaredoxin (1);Thioredoxin-like fold (1);	0.254842	0.33834	U	0.004518	T	0.23492	0.0568	L	0.34521	1.04	0.35793	D	0.822526	B	0.26400	0.148	B	0.19946	0.027	T	0.17684	-1.0361	10	0.16420	T	0.52	-21.6966	15.2736	0.73726	0.0:0.8498:0.1501:0.0	.	130	A8MXD5	GRCR1_HUMAN	T	130	ENSP00000382670:P130T	ENSP00000382670:P130T	P	+	1	0	GRXCR1	42659669	1.000000	0.71417	1.000000	0.80357	0.529000	0.34654	1.623000	0.37008	2.724000	0.93272	0.655000	0.94253	CCA	.	.		0.358	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
LRRC66	339977	hgsc.bcm.edu	37	4	52883570	52883570	+	Silent	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr4:52883570A>G	ENST00000343457.3	-	1	216	c.210T>C	c.(208-210)aaT>aaC	p.N70N		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	70						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						CTCTAAAGAAATTGAAACTTA	0.353																																					p.N70N		Atlas-SNP	.											.	LRRC66	128	.	0			c.T210C						.						88.0	87.0	87.0					4																	52883570		1839	4093	5932	SO:0001819	synonymous_variant	339977	exon1			AAAGAAATTGAAA	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.210T>C	chr4.hg19:g.52883570A>G		92.0	0.0		144.0	59.0	NM_001024611		Silent	SNP	ENST00000343457.3	hg19	CCDS43229.1																																																																																			.	.		0.353	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
MANBA	4126	hgsc.bcm.edu	37	4	103561007	103561007	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr4:103561007T>A	ENST00000226578.4	-	14	1976	c.1877A>T	c.(1876-1878)cAg>cTg	p.Q626L	MANBA_ENST00000505239.1_Missense_Mutation_p.Q569L	NM_005908.3	NP_005899.3	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal	626					cellular protein modification process (GO:0006464)|glycoprotein catabolic process (GO:0006516)|mannan catabolic process (GO:0046355)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)	beta-mannosidase activity (GO:0004567)|mannose binding (GO:0005537)			cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		ACACTGGGCCTGCATCACCTG	0.448																																					p.Q626L		Atlas-SNP	.											.	MANBA	78	.	0			c.A1877T						.						108.0	95.0	99.0					4																	103561007		2203	4300	6503	SO:0001583	missense	4126	exon14			TGGGCCTGCATCA		CCDS3658.1	4q24	2013-09-20			ENSG00000109323	ENSG00000109323	3.2.1.25		6831	protein-coding gene	gene with protein product		609489				7876128	Standard	NM_005908		Approved		uc003hwg.3	O00462	OTTHUMG00000131123	ENST00000226578.4:c.1877A>T	chr4.hg19:g.103561007T>A	ENSP00000226578:p.Gln626Leu	78.0	0.0		81.0	13.0	NM_005908	Q96BC3|Q9NYX9	Missense_Mutation	SNP	ENST00000226578.4	hg19	CCDS3658.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.969171	0.92855	.	.	ENSG00000109323	ENST00000226578;ENST00000505239	D;D	0.97752	-4.52;-4.52	5.74	5.74	0.90152	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99118	0.9696	H	0.95470	3.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.985;0.988	D	0.99282	1.0896	10	0.87932	D	0	-18.2689	16.0292	0.80564	0.0:0.0:0.0:1.0	.	569;626	E9PFW2;O00462	.;MANBA_HUMAN	L	626;569	ENSP00000226578:Q626L;ENSP00000427322:Q569L	ENSP00000226578:Q626L	Q	-	2	0	MANBA	103780055	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.626000	0.83164	2.187000	0.69744	0.533000	0.62120	CAG	.	.		0.448	MANBA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253803.2		
TRIM2	23321	hgsc.bcm.edu	37	4	154191666	154191666	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr4:154191666C>A	ENST00000437508.2	+	2	330	c.129C>A	c.(127-129)tgC>tgA	p.C43*	TRIM2_ENST00000494872.1_3'UTR|TRIM2_ENST00000338700.5_Nonsense_Mutation_p.C70*	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2	43					cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		ACACTTTCTGCGAGAGGTAAG	0.498																																					p.C70X		Atlas-SNP	.											.	TRIM2	105	.	0			c.C210A						.						129.0	113.0	118.0					4																	154191666		2203	4300	6503	SO:0001587	stop_gained	23321	exon2			TTTCTGCGAGAGG	AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.129C>A	chr4.hg19:g.154191666C>A	ENSP00000415812:p.Cys43*	104.0	0.0		97.0	62.0	NM_015271	D3DP09|O60272|Q9BSI9|Q9UFZ1	Nonsense_Mutation	SNP	ENST00000437508.2	hg19	CCDS47147.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.332918	0.81801	.	.	ENSG00000109654	ENST00000441616;ENST00000437508;ENST00000338700	.	.	.	5.68	2.6	0.31112	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.8624	7.0645	0.25143	0.0:0.5496:0.0:0.4504	.	.	.	.	X	43;43;70	.	ENSP00000339659:C70X	C	+	3	2	TRIM2	154411116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.773000	0.38563	0.761000	0.33130	0.650000	0.86243	TGC	.	.		0.498	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342652.1		
IRF2	3660	hgsc.bcm.edu	37	4	185339806	185339806	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr4:185339806T>C	ENST00000393593.3	-	4	451	c.244A>G	c.(244-246)Aga>Gga	p.R82G	IRF2_ENST00000512020.1_5'UTR	NM_002199.3	NP_002190.2	P14316	IRF2_HUMAN	interferon regulatory factor 2	82					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(2)|prostate(1)|skin(3)|stomach(1)|urinary_tract(2)	22		all_lung(41;7.86e-14)|Lung NSC(41;1.87e-13)|Colorectal(36;0.00146)|Hepatocellular(41;0.00826)|Renal(120;0.00992)|Prostate(90;0.0115)|all_neural(102;0.0573)|all_hematologic(60;0.0592)		all cancers(43;3.94e-27)|Epithelial(43;5.3e-24)|OV - Ovarian serous cystadenocarcinoma(60;1.06e-10)|Colorectal(24;7.98e-07)|STAD - Stomach adenocarcinoma(60;3.95e-05)|GBM - Glioblastoma multiforme(59;8.3e-05)|COAD - Colon adenocarcinoma(29;0.000106)|BRCA - Breast invasive adenocarcinoma(30;0.000311)|LUSC - Lung squamous cell carcinoma(40;0.0128)|READ - Rectum adenocarcinoma(43;0.0419)		ATGGCGCATCTGAAATTCGCC	0.393																																					p.R82G		Atlas-SNP	.											.	IRF2	53	.	0			c.A244G						.						103.0	100.0	101.0					4																	185339806		2203	4300	6503	SO:0001583	missense	3660	exon4			CGCATCTGAAATT		CCDS3835.1	4q34.1-q35.1	2008-07-29				ENSG00000168310			6117	protein-coding gene	gene with protein product		147576				2475256	Standard	NM_002199		Approved		uc003iwf.4	P14316		ENST00000393593.3:c.244A>G	chr4.hg19:g.185339806T>C	ENSP00000377218:p.Arg82Gly	76.0	0.0		59.0	22.0	NM_002199	D6RCK5|H0Y8S3|Q6IAS7|Q96B99	Missense_Mutation	SNP	ENST00000393593.3	hg19	CCDS3835.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.238810	0.79800	.	.	ENSG00000168310	ENST00000393593;ENST00000507523;ENST00000510814;ENST00000506230;ENST00000505316	D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0	4.82	3.96	0.45880	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.065540	0.64402	D	0.000005	D	0.99155	0.9708	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99293	1.0899	10	0.87932	D	0	-18.4248	14.8733	0.70474	0.0:0.0:0.8533:0.1467	.	82	P14316	IRF2_HUMAN	G	82	ENSP00000377218:R82G;ENSP00000427204:R82G;ENSP00000424552:R82G;ENSP00000422860:R82G	ENSP00000377218:R82G	R	-	1	2	IRF2	185576800	1.000000	0.71417	0.986000	0.45419	0.905000	0.53344	5.518000	0.67068	1.368000	0.46115	-0.302000	0.09304	AGA	.	.		0.393	IRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361393.1		
ICE1	23379	hgsc.bcm.edu	37	5	5463105	5463105	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:5463105A>T	ENST00000296564.7	+	13	3880	c.3658A>T	c.(3658-3660)Aga>Tga	p.R1220*		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1220					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						AGAAAAATACAGAAAGCAACC	0.363																																					p.R1220X		Atlas-SNP	.											.	KIAA0947	301	.	0			c.A3658T						.						51.0	50.0	50.0					5																	5463105		1832	4082	5914	SO:0001587	stop_gained	23379	exon13			AAATACAGAAAGC																												ENST00000296564.7:c.3658A>T	chr5.hg19:g.5463105A>T	ENSP00000296564:p.Arg1220*	151.0	0.0		146.0	44.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Nonsense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	41	9.095237	0.99064	.	.	ENSG00000164151	ENST00000296564	.	.	.	4.45	-0.765	0.11023	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-0.7671	8.1922	0.31374	0.3896:0.0:0.6104:0.0	.	.	.	.	X	1220	.	ENSP00000296564:R1220X	R	+	1	2	KIAA0947	5516105	0.000000	0.05858	0.000000	0.03702	0.127000	0.20565	-1.099000	0.03343	-0.148000	0.11234	0.254000	0.18369	AGA	.	.		0.363	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
ZNF131	7690	hgsc.bcm.edu	37	5	43139306	43139306	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:43139306C>T	ENST00000399534.1	+	4	310	c.266C>T	c.(265-267)aCa>aTa	p.T89I	ZNF131_ENST00000505606.2_Missense_Mutation_p.T89I|ZNF131_ENST00000306938.4_Missense_Mutation_p.T89I|ZNF131_ENST00000509634.1_Missense_Mutation_p.T89I|ZNF131_ENST00000509156.1_Missense_Mutation_p.T89I|ZNF131_ENST00000509931.1_Intron			P52739	ZN131_HUMAN	zinc finger protein 131	89	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(2)|kidney(1)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	17						ATTGAGTTCACATATACAGCA	0.343																																					p.T89I		Atlas-SNP	.											.	ZNF131	51	.	0			c.C266T						.						104.0	99.0	101.0					5																	43139306		1865	4097	5962	SO:0001583	missense	7690	exon4			AGTTCACATATAC	U09410	CCDS43313.1	5p12	2013-01-09	2006-06-13		ENSG00000172262	ENSG00000172262		"""Zinc fingers, C2H2-type"", ""-"", ""BTB/POZ domain containing"""	12915	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 35"""	604073	"""zinc finger protein 131 (clone pHZ-10)"""				Standard	XM_005248359		Approved	ZBTB35, pHZ-10	uc003jnk.3	P52739	OTTHUMG00000162223	ENST00000399534.1:c.266C>T	chr5.hg19:g.43139306C>T	ENSP00000382450:p.Thr89Ile	142.0	0.0		122.0	5.0	NM_003432	B4DRL3|Q6PIF0	Missense_Mutation	SNP	ENST00000399534.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.02	3.003305	0.54254	.	.	ENSG00000172262	ENST00000515326;ENST00000509156;ENST00000508259;ENST00000306938;ENST00000399534;ENST00000505606;ENST00000509634;ENST00000509341	T;T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;0.08;0.08;0.08	5.34	5.34	0.76211	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.48241	0.1489	N	0.00788	-1.185	0.58432	D	0.999992	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.997	T	0.63817	-0.6551	10	0.18276	T	0.48	-11.4399	19.0469	0.93025	0.0:1.0:0.0:0.0	.	89;89	P52739;P52739-2	ZN131_HUMAN;.	I	89	ENSP00000422079:T89I;ENSP00000426504:T89I;ENSP00000422659:T89I;ENSP00000305804:T89I;ENSP00000382450:T89I;ENSP00000423945:T89I;ENSP00000421246:T89I;ENSP00000424771:T89I	ENSP00000305804:T89I	T	+	2	0	ZNF131	43175063	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.179000	0.77665	2.474000	0.83562	0.655000	0.94253	ACA	.	.		0.343	ZNF131-201	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000367982.1	NM_003432	
SKIV2L2	23517	hgsc.bcm.edu	37	5	54640445	54640445	+	Silent	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:54640445A>G	ENST00000230640.5	+	9	1256	c.1002A>G	c.(1000-1002)gaA>gaG	p.E334E	SKIV2L2_ENST00000545714.1_Silent_p.E233E	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	334					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TGGTTGATGAAAATGTAAGAG	0.338																																					p.E334E	Melanoma(2;92 134 23744 29976 33782)	Atlas-SNP	.											.	SKIV2L2	104	.	0			c.A1002G						.						60.0	56.0	57.0					5																	54640445		2203	4300	6503	SO:0001819	synonymous_variant	23517	exon9			TGATGAAAATGTA	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.1002A>G	chr5.hg19:g.54640445A>G		203.0	0.0		258.0	15.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Silent	SNP	ENST00000230640.5	hg19	CCDS3967.1																																																																																			.	.		0.338	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
DDX4	54514	hgsc.bcm.edu	37	5	55082361	55082361	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:55082361A>G	ENST00000505374.1	+	14	972	c.880A>G	c.(880-882)Aat>Gat	p.N294D	DDX4_ENST00000354991.5_Missense_Mutation_p.N260D|DDX4_ENST00000353507.5_Missense_Mutation_p.N260D|DDX4_ENST00000511853.1_Missense_Mutation_p.N145D|DDX4_ENST00000514278.2_Missense_Mutation_p.N274D	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	294					male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				TGAAGAAGCTAATCTCTGTCA	0.328																																					p.N294D		Atlas-SNP	.											.	DDX4	194	.	0			c.A880G						.						71.0	70.0	71.0					5																	55082361		2203	4300	6503	SO:0001583	missense	54514	exon14			GAAGCTAATCTCT	AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.880A>G	chr5.hg19:g.55082361A>G	ENSP00000424838:p.Asn294Asp	98.0	0.0		110.0	31.0	NM_024415	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	ENST00000505374.1	hg19	CCDS3969.1	.	.	.	.	.	.	.	.	.	.	A	11.30	1.596876	0.28445	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97	4.56	0.845	0.18950	RNA helicase, DEAD-box type, Q motif (1);	0.448366	0.25720	N	0.028741	T	0.20740	0.0499	N	0.13168	0.305	0.32535	N	0.534478	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.10450	0.002;0.001;0.005;0.002	T	0.12863	-1.0531	10	0.25751	T	0.34	-10.9394	6.349	0.21365	0.7003:0.1384:0.1612:0.0	.	274;145;260;294	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	D	260;274;294;274;260;145	ENSP00000334167:N260D;ENSP00000425359:N274D;ENSP00000424838:N294D;ENSP00000427167:N274D;ENSP00000347087:N260D;ENSP00000423123:N145D	ENSP00000334167:N260D	N	+	1	0	DDX4	55118118	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	2.377000	0.44300	0.281000	0.22233	0.482000	0.46254	AAT	.	.		0.328	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214147.2	NM_024415	
FBN2	2201	hgsc.bcm.edu	37	5	127668623	127668623	+	Silent	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:127668623T>C	ENST00000508053.1	-	38	5177	c.4203A>G	c.(4201-4203)ggA>ggG	p.G1401G	FBN2_ENST00000262464.4_Silent_p.G1401G|FBN2_ENST00000508989.1_Silent_p.G1368G|FBN2_ENST00000507835.1_Silent_p.G251G			P35556	FBN2_HUMAN	fibrillin 2	1401	EGF-like 22; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TGATGCCGTTTCCAATCCAGC	0.418																																					p.G1401G		Atlas-SNP	.											.	FBN2	858	.	0			c.A4203G						.						220.0	206.0	211.0					5																	127668623		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon32			GCCGTTTCCAATC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4203A>G	chr5.hg19:g.127668623T>C		158.0	0.0		174.0	51.0	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	hg19	CCDS34222.1																																																																																			.	.		0.418	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
SLC4A9	83697	hgsc.bcm.edu	37	5	139743132	139743132	+	Silent	SNP	G	G	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:139743132G>T	ENST00000230993.6	+	8	1178	c.1143G>T	c.(1141-1143)cgG>cgT	p.R381R	SLC4A9_ENST00000507527.1_Silent_p.R381R|SLC4A9_ENST00000506757.2_Silent_p.R357R|SLC4A9_ENST00000506545.1_Silent_p.R357R|SLC4A9_ENST00000432095.2_Silent_p.R357R	NM_001258428.1	NP_001245357.1	Q96Q91	B3A4_HUMAN	solute carrier family 4, sodium bicarbonate cotransporter, member 9	381					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGTTGCAGCGGACCGGCAGGT	0.677											OREG0016461	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R381R		Atlas-SNP	.											.	SLC4A9	125	.	0			c.G1143T						.						7.0	11.0	10.0					5																	139743132		2145	4200	6345	SO:0001819	synonymous_variant	83697	exon8			GCAGCGGACCGGC	AF313465	CCDS47278.1, CCDS58973.1, CCDS58974.1, CCDS58975.1	5q31.3	2013-05-22			ENSG00000113073	ENSG00000113073		"""Solute carriers"""	11035	protein-coding gene	gene with protein product		610207				11305939	Standard	NM_031467		Approved	AE4	uc003lfk.2	Q96Q91	OTTHUMG00000163352	ENST00000230993.6:c.1143G>T	chr5.hg19:g.139743132G>T		83.0	0.0	1651	122.0	14.0	NM_001258428	B7ZL63|D3DQD4|D3DQD5|D3DQD6|E9PDK1|Q96RM5|Q9BXF2|Q9BXN3	Silent	SNP	ENST00000230993.6	hg19	CCDS58973.1																																																																																			.	.		0.677	SLC4A9-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372823.1	NM_031467	
PDGFRB	5159	hgsc.bcm.edu	37	5	149515368	149515368	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:149515368C>T	ENST00000261799.4	-	3	583	c.114G>A	c.(112-114)ccG>ccA	p.P38P		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	38	Ig-like C2-type 1.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCTCTGGCCCCGGGGGTGTGA	0.597			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.P38P		Atlas-SNP	.		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	PDGFRB	142	.	0			c.G114A						.						36.0	34.0	35.0					5																	149515368		2203	4300	6503	SO:0001819	synonymous_variant	5159	exon3			TGGCCCCGGGGGT	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.114G>A	chr5.hg19:g.149515368C>T		100.0	0.0		184.0	37.0	NM_002609	B5A957|Q8N5L4	Silent	SNP	ENST00000261799.4	hg19	CCDS4303.1																																																																																			.	.		0.597	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
C1QTNF2	114898	hgsc.bcm.edu	37	5	159776448	159776448	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:159776448G>A	ENST00000393975.3	-	3	723	c.720C>T	c.(718-720)taC>taT	p.Y240Y		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	195	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGGTGAAGTAGTAGATCCCAG	0.587																																					p.Y240Y		Atlas-SNP	.											.	C1QTNF2	33	.	0			c.C720T						.						89.0	92.0	91.0					5																	159776448		2203	4300	6503	SO:0001819	synonymous_variant	114898	exon3			GAAGTAGTAGATC	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.720C>T	chr5.hg19:g.159776448G>A		43.0	0.0		74.0	8.0	NM_031908		Silent	SNP	ENST00000393975.3	hg19	CCDS4351.2																																																																																			.	.		0.587	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
COL23A1	91522	hgsc.bcm.edu	37	5	177695729	177695729	+	Splice_Site	SNP	A	A	G	rs200266099		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr5:177695729A>G	ENST00000390654.3	-	7	853		c.e7+1		COL23A1_ENST00000407622.1_Splice_Site	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1						collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		ggcaTCACTTACCTTTTCCCC	0.567																																					.		Atlas-SNP	.											.	COL23A1	47	.	0			c.495+2T>C						.						66.0	70.0	69.0					5																	177695729		1993	4174	6167	SO:0001630	splice_region_variant	91522	exon8			TCACTTACCTTTT	AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.495+1T>C	chr5.hg19:g.177695729A>G		29.0	0.0		62.0	21.0	NM_173465	Q8IVR4|Q9NT93	Splice_Site	SNP	ENST00000390654.3	hg19	CCDS4436.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297773	0.60086	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2526	0.49034	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL23A1	177628335	1.000000	0.71417	0.998000	0.56505	0.714000	0.41099	5.371000	0.66150	1.978000	0.57642	0.454000	0.30748	.	.	A|0.999;G|0.001		0.567	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253475.1	NM_173465	Intron
SLC17A3	10786	hgsc.bcm.edu	37	6	25849672	25849672	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr6:25849672C>G	ENST00000360657.3	-	10	1343	c.1058G>C	c.(1057-1059)gGa>gCa	p.G353A	SLC17A3_ENST00000361703.6_Missense_Mutation_p.G353A|SLC17A3_ENST00000397060.4_Missense_Mutation_p.G431A			O00476	NPT4_HUMAN	solute carrier family 17 (organic anion transporter), member 3	353					drug transmembrane transport (GO:0006855)|drug transport (GO:0015893)|glucose-6-phosphate transport (GO:0015760)|ion transmembrane transport (GO:0034220)|organic acid transport (GO:0015849)|organic anion transport (GO:0015711)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of anion transport (GO:0044070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	drug transmembrane transporter activity (GO:0015238)|efflux transmembrane transporter activity (GO:0015562)|organic anion transmembrane transporter activity (GO:0008514)|sodium:phosphate symporter activity (GO:0005436)|toxin transporter activity (GO:0019534)|urate transmembrane transporter activity (GO:0015143)|voltage-gated anion channel activity (GO:0008308)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)	20						TCTTGATGCTCCCATGAGAAA	0.433																																					p.G431A		Atlas-SNP	.											.	SLC17A3	95	.	0			c.G1292C						.						97.0	85.0	89.0					6																	25849672		2203	4300	6503	SO:0001583	missense	10786	exon11			GATGCTCCCATGA	U90545	CCDS4566.2, CCDS47385.1	6p22.2	2013-07-18	2013-07-18		ENSG00000124564	ENSG00000124564		"""Solute carriers"""	10931	protein-coding gene	gene with protein product		611034	"""solute carrier family 17 (sodium phosphate), member 3"""			9149941	Standard	NM_006632		Approved	NPT4	uc003nfk.4	O00476	OTTHUMG00000014412	ENST00000360657.3:c.1058G>C	chr6.hg19:g.25849672C>G	ENSP00000353873:p.Gly353Ala	84.0	0.0		132.0	46.0	NM_001098486	B7WNJ5|B7Z511|Q8WWC7|Q9H533	Missense_Mutation	SNP	ENST00000360657.3	hg19	CCDS4566.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.45|13.45	2.241383|2.241383	0.39598|0.39598	.|.	.|.	ENSG00000124564|ENSG00000124564	ENST00000481949|ENST00000397060;ENST00000360657;ENST00000361703	.|T;T;T	.|0.63417	.|-0.04;-0.04;-0.04	4.4|4.4	4.4|4.4	0.53042|0.53042	.|Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	.|0.000000	.|0.42964	.|D	.|0.000625	T|T	0.66036|0.66036	0.2749|0.2749	M|M	0.63843|0.63843	1.955|1.955	0.43953|0.43953	D|D	0.996623|0.996623	.|D;D	.|0.64830	.|0.966;0.994	.|D;D	.|0.67382	.|0.951;0.923	T|T	0.64428|0.64428	-0.6410|-0.6410	5|10	.|0.31617	.|T	.|0.26	.|.	12.8418|12.8418	0.57806|0.57806	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|431;353	.|B7Z511;O00476	.|.;NPT4_HUMAN	Q|A	32|431;353;353	.|ENSP00000380250:G431A;ENSP00000353873:G353A;ENSP00000355307:G353A	.|ENSP00000353873:G353A	E|G	-|-	1|2	0|0	SLC17A3|SLC17A3	25957651|25957651	0.962000|0.962000	0.33011|0.33011	0.984000|0.984000	0.44739|0.44739	0.088000|0.088000	0.18126|0.18126	3.495000|3.495000	0.53280|0.53280	2.150000|2.150000	0.67090|0.67090	0.650000|0.650000	0.86243|0.86243	GAG|GGA	.	.		0.433	SLC17A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000040070.2		
HIST1H3B	8358	hgsc.bcm.edu	37	6	26032006	26032006	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr6:26032006C>T	ENST00000244661.2	-	1	282	c.283G>A	c.(283-285)Gag>Aag	p.E95K		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	95					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						TCACAAGCCTCCTGCAGCGCC	0.562																																					p.E95K		Atlas-SNP	.											HIST1H3B,NS,carcinoma,0,1	HIST1H3B	59	.	0			c.G283A						.						72.0	73.0	73.0					6																	26032006		2203	4300	6503	SO:0001583	missense	8358	exon1			AAGCCTCCTGCAG	X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.283G>A	chr6.hg19:g.26032006C>T	ENSP00000244661:p.Glu95Lys	82.0	0.0		89.0	31.0	NM_003537	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000244661.2	hg19	CCDS4573.1	.	.	.	.	.	.	.	.	.	.	c	16.97	3.267456	0.59540	.	.	ENSG00000124693	ENST00000244661	T	0.70749	-0.51	5.07	5.07	0.68467	.	.	.	.	.	T	0.80003	0.4544	.	.	.	0.47994	D	0.999564	.	.	.	.	.	.	T	0.82824	-0.0266	6	0.87932	D	0	.	17.7852	0.88535	0.0:1.0:0.0:0.0	.	.	.	.	K	95	ENSP00000244661:E95K	ENSP00000244661:E95K	E	-	1	0	HIST1H3B	26139985	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	7.492000	0.81482	2.487000	0.83934	0.561000	0.74099	GAG	.	.		0.562	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040077.1	NM_003537	
LEMD2	221496	hgsc.bcm.edu	37	6	33748859	33748859	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr6:33748859T>C	ENST00000293760.5	-	4	944	c.925A>G	c.(925-927)Ata>Gta	p.I309V	LEMD2_ENST00000508327.1_Missense_Mutation_p.I7V|LEMD2_ENST00000502643.1_5'UTR	NM_181336.3	NP_851853.1	Q8NC56	LEMD2_HUMAN	LEM domain containing 2	309					negative regulation of MAPK cascade (GO:0043409)|skeletal muscle cell differentiation (GO:0035914)	integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear membrane (GO:0031965)				central_nervous_system(2)|endometrium(3)|large_intestine(1)|lung(2)|pancreas(1)	9						CTTACGGCTATATATTCTTGG	0.408																																					p.I309V		Atlas-SNP	.											.	LEMD2	20	.	0			c.A925G						.						85.0	79.0	81.0					6																	33748859		2203	4300	6503	SO:0001583	missense	221496	exon4			CGGCTATATATTC		CCDS4785.1, CCDS47411.1	6p21.31	2009-11-06			ENSG00000161904	ENSG00000161904			21244	protein-coding gene	gene with protein product						12477932	Standard	NM_001143944		Approved	dJ482C21.1, NET25	uc011drm.2	Q8NC56	OTTHUMG00000014535	ENST00000293760.5:c.925A>G	chr6.hg19:g.33748859T>C	ENSP00000293760:p.Ile309Val	30.0	0.0		68.0	26.0	NM_181336	B4DVH5|E7EVT2|Q5T972|Q5T974	Missense_Mutation	SNP	ENST00000293760.5	hg19	CCDS4785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.035|7.035	0.561403|0.561403	0.13498|0.13498	.|.	.|.	ENSG00000161904|ENSG00000161904	ENST00000442696|ENST00000293760;ENST00000508327;ENST00000513701	.|.	.|.	.|.	5.65|5.65	-3.04|-3.04	0.05412|0.05412	.|Inner nuclear membrane protein MAN1 (1);	0.632623|0.632623	0.15520|0.15520	N|N	0.258115|0.258115	T|T	0.06781|0.06781	0.0173|0.0173	N|N	0.16903|0.16903	0.455|0.455	0.09310|0.09310	N|N	1|1	.|B	.|0.10296	.|0.003	.|B	.|0.10450	.|0.005	T|T	0.40421|0.40421	-0.9564|-0.9564	6|9	.|0.13853	.|T	.|0.58	-0.8734|-0.8734	7.8602|7.8602	0.29506|0.29506	0.0:0.2134:0.4858:0.3008|0.0:0.2134:0.4858:0.3008	.|.	.|309	.|Q8NC56	.|LEMD2_HUMAN	M|V	174|309;7;7	.|.	.|ENSP00000293760:I309V	I|I	-|-	3|1	3|0	LEMD2|LEMD2	33856837|33856837	0.010000|0.010000	0.17322|0.17322	0.004000|0.004000	0.12327|0.12327	0.673000|0.673000	0.39480|0.39480	-0.160000|-0.160000	0.10041|0.10041	-0.814000|-0.814000	0.04352|0.04352	0.533000|0.533000	0.62120|0.62120	ATA|ATA	.	.		0.408	LEMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040209.3	XM_166338	
SEC63	11231	hgsc.bcm.edu	37	6	108214765	108214765	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr6:108214765A>T	ENST00000369002.4	-	16	1774	c.1595T>A	c.(1594-1596)tTa>tAa	p.L532*		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	532	SEC63 1.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)	p.L532*(2)		endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		TTTTTTTTTTAAAGGTTTCTT	0.368																																					p.L532X		Atlas-SNP	.											SEC63,NS,carcinoma,0,2	SEC63	79	.	2	Substitution - Nonsense(2)	lung(1)|kidney(1)	c.T1595A						.						114.0	119.0	117.0					6																	108214765		2202	4300	6502	SO:0001587	stop_gained	11231	exon16			TTTTTTAAAGGTT	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.1595T>A	chr6.hg19:g.108214765A>T	ENSP00000357998:p.Leu532*	61.0	0.0		92.0	8.0	NM_007214	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Nonsense_Mutation	SNP	ENST00000369002.4	hg19	CCDS5061.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	37|37	6.342620|6.342620	0.97489|0.97489	.|.	.|.	ENSG00000025796|ENSG00000025796	ENST00000423697|ENST00000369002;ENST00000437345	.|.	.|.	.|.	5.38|5.38	3.01|3.01	0.34805|0.34805	.|.	.|0.323197	.|0.31989	.|N	.|0.006744	T|.	0.17450|.	0.0419|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.07673|.	-1.0760|.	4|.	0.10636|0.14656	T|T	0.68|0.56	-2.4355|-2.4355	7.8269|7.8269	0.29320|0.29320	0.7741:0.0:0.2259:0.0|0.7741:0.0:0.2259:0.0	.|.	.|.	.|.	.|.	L|X	391|532;183	.|.	ENSP00000394572:F391L|ENSP00000357998:L532X	F|L	-|-	3|2	2|0	SEC63|SEC63	108321458|108321458	0.977000|0.977000	0.34250|0.34250	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	2.787000|2.787000	0.47798|0.47798	0.991000|0.991000	0.38814|0.38814	0.460000|0.460000	0.39030|0.39030	TTT|TTA	.	.		0.368	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
FABP7	2173	hgsc.bcm.edu	37	6	123101529	123101529	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr6:123101529G>A	ENST00000368444.3	+	2	487	c.167G>A	c.(166-168)aGc>aAc	p.S56N	FABP7_ENST00000356535.4_Missense_Mutation_p.S56N	NM_001446.3	NP_001437.1	O15540	FABP7_HUMAN	fatty acid binding protein 7, brain	56					cell proliferation in forebrain (GO:0021846)|epithelial cell proliferation (GO:0050673)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neurogenesis (GO:0022008)|prepulse inhibition (GO:0060134)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			kidney(1)|large_intestine(1)|lung(2)|stomach(1)	5				GBM - Glioblastoma multiforme(226;0.226)	Alpha-Linolenic Acid(DB00132)|Dihomo-gamma-linolenic acid(DB00154)|Icosapent(DB00159)	AGGACTCTCAGCACATTCAAG	0.448																																					p.S56N		Atlas-SNP	.											.	FABP7	10	.	0			c.G167A						.						96.0	91.0	93.0					6																	123101529		2203	4300	6503	SO:0001583	missense	2173	exon2			CTCTCAGCACATT	D88648	CCDS5127.1	6q22-q23	2013-03-01			ENSG00000164434	ENSG00000164434		"""Fatty acid binding protein family"""	3562	protein-coding gene	gene with protein product	"""brain lipid binding protein"""	602965				9375786	Standard	NM_001446		Approved	B-FABP, BLBP	uc003pzf.3	O15540	OTTHUMG00000015489	ENST00000368444.3:c.167G>A	chr6.hg19:g.123101529G>A	ENSP00000357429:p.Ser56Asn	185.0	0.0		272.0	89.0	NM_001446	B2R4L1|O14951|Q6IAU7|Q9H047	Missense_Mutation	SNP	ENST00000368444.3	hg19	CCDS5127.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.350179	0.82132	.	.	ENSG00000164434	ENST00000368444;ENST00000356535	T;T	0.10288	2.89;2.89	5.54	4.66	0.58398	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.074834	0.85682	D	0.000000	T	0.30634	0.0771	M	0.89095	3.005	0.54753	D	0.999988	P;D;D	0.76494	0.847;0.999;0.998	D;D;D	0.76575	0.931;0.988;0.982	T	0.08680	-1.0710	10	0.72032	D	0.01	.	14.1479	0.65362	0.0723:0.0:0.9277:0.0	.	56;62;56	O15540;Q59HE4;Q9H047	FABP7_HUMAN;.;.	N	56	ENSP00000357429:S56N;ENSP00000348931:S56N	ENSP00000348931:S56N	S	+	2	0	FABP7	123143228	1.000000	0.71417	0.986000	0.45419	0.617000	0.37484	6.745000	0.74860	2.751000	0.94390	0.563000	0.77884	AGC	.	.		0.448	FABP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042037.1	NM_001446	
STXBP5	134957	hgsc.bcm.edu	37	6	147646126	147646126	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr6:147646126G>A	ENST00000321680.6	+	17	1834	c.1834G>A	c.(1834-1836)Ggt>Agt	p.G612S	STXBP5_ENST00000179882.6_Missense_Mutation_p.G283S|STXBP5_ENST00000367480.3_Missense_Mutation_p.G612S|STXBP5_ENST00000367481.3_Missense_Mutation_p.G612S	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	612					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		ACAGTCTCCAGGTTATCAAAC	0.353																																					p.G612S		Atlas-SNP	.											.	STXBP5	163	.	0			c.G1834A						.						67.0	71.0	70.0					6																	147646126		2203	4300	6503	SO:0001583	missense	134957	exon17			TCTCCAGGTTATC	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.1834G>A	chr6.hg19:g.147646126G>A	ENSP00000321826:p.Gly612Ser	333.0	0.0		465.0	37.0	NM_139244	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	hg19	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	35	5.426832	0.96131	.	.	ENSG00000164506	ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	T;T;T;T	0.72167	-0.63;-0.12;-0.16;0.2	4.85	4.85	0.62838	WD40 repeat-like-containing domain (1);	0.105185	0.64402	D	0.000003	T	0.73628	0.3611	M	0.84219	2.685	0.80722	D	1	B;D;B	0.53885	0.357;0.963;0.291	B;P;B	0.47206	0.385;0.541;0.275	T	0.80699	-0.1266	10	0.87932	D	0	.	18.3063	0.90182	0.0:0.0:1.0:0.0	.	612;612;283	Q5T5C0-2;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	S	612;612;612;283	ENSP00000356451:G612S;ENSP00000321826:G612S;ENSP00000356450:G612S;ENSP00000179882:G283S	ENSP00000179882:G283S	G	+	1	0	STXBP5	147687819	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.385000	0.81259	0.655000	0.94253	GGT	.	.		0.353	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
MAP3K4	4216	hgsc.bcm.edu	37	6	161494612	161494612	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr6:161494612G>A	ENST00000392142.4	+	5	2213	c.2065G>A	c.(2065-2067)Gct>Act	p.A689T	MAP3K4_ENST00000366919.2_Missense_Mutation_p.A689T|MAP3K4_ENST00000366920.2_Missense_Mutation_p.A689T|MAP3K4_ENST00000348824.7_Missense_Mutation_p.A689T	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	689					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CAACATTGACGCTTTTGAAGA	0.438																																					p.A689T		Atlas-SNP	.											.	MAP3K4	364	.	0			c.G2065A						.						101.0	104.0	103.0					6																	161494612		2203	4300	6503	SO:0001583	missense	4216	exon5			ATTGACGCTTTTG	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2065G>A	chr6.hg19:g.161494612G>A	ENSP00000375986:p.Ala689Thr	107.0	0.0		113.0	32.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	ENST00000392142.4	hg19	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	G	10.77	1.443084	0.25987	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	5.13	3.15	0.36227	.	0.229422	0.37304	N	0.002141	T	0.03011	0.0089	L	0.36672	1.1	0.30640	N	0.756567	P;P;P	0.41673	0.759;0.59;0.646	B;B;B	0.30401	0.115;0.077;0.054	T	0.37686	-0.9695	10	0.14252	T	0.57	-19.2576	8.0142	0.30372	0.0911:0.0:0.6106:0.2983	.	689;689;689	F5H538;Q9Y6R4-2;Q9Y6R4	.;.;M3K4_HUMAN	T	689	ENSP00000355886:A689T;ENSP00000375986:A689T;ENSP00000355887:A689T;ENSP00000297332:A689T	ENSP00000297332:A689T	A	+	1	0	MAP3K4	161414602	1.000000	0.71417	0.411000	0.26484	0.901000	0.52897	3.673000	0.54591	1.159000	0.42565	0.585000	0.79938	GCT	.	.		0.438	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
ZNF716	441234	hgsc.bcm.edu	37	7	57529086	57529086	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr7:57529086C>T	ENST00000420713.1	+	4	1031	c.919C>T	c.(919-921)Cgc>Tgc	p.R307C		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	307					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						AGCCTTTAGCCGCTCTTCAAC	0.423																																					p.R307C		Atlas-SNP	.											.	ZNF716	207	.	0			c.C919T						.						35.0	35.0	35.0					7																	57529086		692	1591	2283	SO:0001583	missense	441234	exon4			TTTAGCCGCTCTT	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.919C>T	chr7.hg19:g.57529086C>T	ENSP00000394248:p.Arg307Cys	60.0	0.0		74.0	24.0	NM_001159279		Missense_Mutation	SNP	ENST00000420713.1	hg19	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	C	0.232	-1.020547	0.02061	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	T	0.07567	3.18	0.109	-0.218	0.13142	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08980	0.0222	M	0.66297	2.02	0.09310	N	1	B	0.17038	0.02	B	0.06405	0.002	T	0.36768	-0.9734	9	0.30078	T	0.28	.	5.4529	0.16574	0.0:0.6456:0.3543:0.0	.	295	A6NP11	ZN716_HUMAN	C	307;295	ENSP00000394248:R307C	ENSP00000387687:R295C	R	+	1	0	ZNF716	57533028	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-3.527000	0.00441	-1.131000	0.02910	-1.174000	0.01732	CGC	.	.		0.423	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279	
PHTF2	57157	hgsc.bcm.edu	37	7	77579094	77579094	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr7:77579094C>T	ENST00000248550.7	+	16	2135	c.2059C>T	c.(2059-2061)Ctt>Ttt	p.L687F	PHTF2_ENST00000307305.8_Missense_Mutation_p.L649F|PHTF2_ENST00000275575.7_Intron|PHTF2_ENST00000416283.2_Missense_Mutation_p.L653F|PHTF2_ENST00000422959.2_Missense_Mutation_p.L653F			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	687					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						ATTTGTTACCCTTGGATCAGA	0.343																																					p.L653F		Atlas-SNP	.											PHTF2_ENST00000416283,NS,carcinoma,0,2	PHTF2	104	.	0			c.C1957T						.						106.0	94.0	98.0					7																	77579094		1843	4080	5923	SO:0001583	missense	57157	exon15			GTTACCCTTGGAT	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.2059C>T	chr7.hg19:g.77579094C>T	ENSP00000248550:p.Leu687Phe	89.0	0.0		113.0	38.0	NM_001127357	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Missense_Mutation	SNP	ENST00000248550.7	hg19		.	.	.	.	.	.	.	.	.	.	C	31	5.090030	0.94149	.	.	ENSG00000006576	ENST00000427986;ENST00000422959;ENST00000307305;ENST00000416283;ENST00000248550	.	.	.	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.80265	0.4591	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.995;0.989	T	0.82065	-0.0642	9	0.87932	D	0	-15.5885	19.3637	0.94453	0.0:1.0:0.0:0.0	.	653;687;649	Q8N3S3-2;Q8N3S3;Q8N3S3-3	.;PHTF2_HUMAN;.	F	653;653;649;653;687	.	ENSP00000248550:L687F	L	+	1	0	PHTF2	77417030	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	7.776000	0.85560	2.648000	0.89879	0.655000	0.94253	CTT	.	.		0.343	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
NRCAM	4897	hgsc.bcm.edu	37	7	107808806	107808806	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr7:107808806C>A	ENST00000425651.2	-	26	3228	c.3229G>T	c.(3229-3231)Gct>Tct	p.A1077S	NRCAM_ENST00000379028.3_Missense_Mutation_p.A1077S|NRCAM_ENST00000351718.4_Intron|NRCAM_ENST00000413765.2_Intron|NRCAM_ENST00000379024.4_Intron|NRCAM_ENST00000379022.4_Missense_Mutation_p.A1077S	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1077	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						GTCTCAGCAGCTGCAGCAGTA	0.378																																					p.A1077S		Atlas-SNP	.											.	NRCAM	267	.	0			c.G3229T						.						76.0	74.0	75.0					7																	107808806		1898	4126	6024	SO:0001583	missense	4897	exon26			CAGCAGCTGCAGC		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3229G>T	chr7.hg19:g.107808806C>A	ENSP00000401244:p.Ala1077Ser	71.0	0.0		84.0	32.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	hg19	CCDS47686.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.37|14.37	2.514197|2.514197	0.44763|0.44763	.|.	.|.	ENSG00000091129|ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000425651;ENST00000379022|ENST00000445634	T;T;T|.	0.56611|.	0.45;0.45;0.45|.	5.64|5.64	5.64|5.64	0.86602|0.86602	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.374815|.	0.30101|.	N|.	0.010410|.	T|T	0.63153|0.63153	0.2487|0.2487	L|L	0.56769|0.56769	1.78|1.78	0.29775|0.29775	N|N	0.834471|0.834471	B|.	0.11235|.	0.004|.	B|.	0.23275|.	0.045|.	T|T	0.60924|0.60924	-0.7166|-0.7166	10|5	0.48119|.	T|.	0.1|.	.|.	17.864|17.864	0.88791|0.88791	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1077|.	Q92823|.	NRCAM_HUMAN|.	S|H	1077|26	ENSP00000368314:A1077S;ENSP00000401244:A1077S;ENSP00000368308:A1077S|.	ENSP00000368308:A1077S|.	A|Q	-|-	1|3	0|2	NRCAM|NRCAM	107596042|107596042	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.961000|0.961000	0.63080|0.63080	2.885000|2.885000	0.48570|0.48570	2.643000|2.643000	0.89663|0.89663	0.650000|0.650000	0.86243|0.86243	GCT|CAG	.	.		0.378	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
OR2F1	26211	hgsc.bcm.edu	37	7	143657530	143657530	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr7:143657530C>G	ENST00000392899.1	+	1	504	c.467C>G	c.(466-468)tCt>tGt	p.S156C	RP4-669B10.3_ENST00000466281.1_lincRNA	NM_012369.2	NP_036501.2	Q13607	OR2F1_HUMAN	olfactory receptor, family 2, subfamily F, member 1 (gene/pseudogene)	156					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|skin(4)	34	Melanoma(164;0.0903)					TTCATCAGCTCTCCTGTGCAG	0.522																																					p.S156C		Atlas-SNP	.											OR2F1,right_upper_lobe,carcinoma,0,2	OR2F1	71	.	0			c.C467G						.						140.0	117.0	125.0					7																	143657530		2203	4300	6503	SO:0001583	missense	26211	exon1			TCAGCTCTCCTGT	U56421	CCDS5887.1	7q35	2013-06-03	2013-06-03		ENSG00000213215	ENSG00000213215		"""GPCR / Class A : Olfactory receptors"""	8246	protein-coding gene	gene with protein product		608497	"""olfactory receptor, family 2, subfamily F, member 1"""	OR2F4, OR2F5, OR2F3, OR2F3P		9500546	Standard	NM_012369		Approved	OLF3, OR7-140, OR7-139, OR14-60	uc003wds.1	Q13607	OTTHUMG00000157771	ENST00000392899.1:c.467C>G	chr7.hg19:g.143657530C>G	ENSP00000376633:p.Ser156Cys	104.0	0.0		137.0	45.0	NM_012369	A4D2G1|Q6IFP7|Q96R49|Q9UDX1	Missense_Mutation	SNP	ENST00000392899.1	hg19	CCDS5887.1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287663	0.40494	.	.	ENSG00000213215	ENST00000392899	T	0.44482	0.92	5.53	5.53	0.82687	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000066	T	0.69115	0.3075	M	0.85099	2.735	0.42344	D	0.992342	D	0.89917	1.0	D	0.91635	0.999	T	0.72994	-0.4122	10	0.66056	D	0.02	-25.1823	17.0114	0.86407	0.0:1.0:0.0:0.0	.	156	Q13607	OR2F1_HUMAN	C	156	ENSP00000376633:S156C	ENSP00000376633:S156C	S	+	2	0	OR2F1	143288463	0.000000	0.05858	0.578000	0.28575	0.022000	0.10575	0.316000	0.19469	2.871000	0.98454	0.655000	0.94253	TCT	.	.		0.522	OR2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349581.1		
TMUB1	83590	hgsc.bcm.edu	37	7	150778970	150778970	+	Missense_Mutation	SNP	C	C	G	rs568920028		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr7:150778970C>G	ENST00000392818.3	-	3	764	c.407G>C	c.(406-408)cGg>cCg	p.R136P	FASTK_ENST00000489884.1_5'Flank|TMUB1_ENST00000462940.1_Missense_Mutation_p.R136P|FASTK_ENST00000297532.6_5'Flank|FASTK_ENST00000482571.1_5'Flank|FASTK_ENST00000540185.1_5'Flank|TMUB1_ENST00000476627.1_Missense_Mutation_p.R136P|TMUB1_ENST00000297533.4_Missense_Mutation_p.R136P|FASTK_ENST00000353841.2_5'Flank|TMUB1_ENST00000482202.1_Missense_Mutation_p.R136P	NM_031434.3	NP_113622.1	Q9BVT8	TMUB1_HUMAN	transmembrane and ubiquitin-like domain containing 1	136	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGCTGTTCCCGGCCGGGAAA	0.647																																					p.R136P		Atlas-SNP	.											.	TMUB1	7	.	0			c.G407C						.						19.0	15.0	16.0					7																	150778970		2192	4294	6486	SO:0001583	missense	83590	exon3			TGTTCCCGGCCGG	BC000936	CCDS5920.1	7q36.1	2006-06-27	2006-06-27	2006-06-27	ENSG00000164897	ENSG00000164897			21709	protein-coding gene	gene with protein product		614792	"""chromosome 7 open reading frame 21"""	C7orf21			Standard	NM_001136044		Approved	SB144	uc003wjd.3	Q9BVT8	OTTHUMG00000158621	ENST00000392818.3:c.407G>C	chr7.hg19:g.150778970C>G	ENSP00000376565:p.Arg136Pro	25.0	0.0		27.0	7.0	NM_031434	D3DX06|Q53AQ2	Missense_Mutation	SNP	ENST00000392818.3	hg19	CCDS5920.1	.	.	.	.	.	.	.	.	.	.	C	15.41	2.824695	0.50739	.	.	ENSG00000164897	ENST00000297533;ENST00000392818;ENST00000462940;ENST00000482202;ENST00000476627;ENST00000488752;ENST00000492838	T;T;T;T;T;T	0.44482	0.94;0.94;0.94;0.94;0.94;0.92	4.9	-0.0351	0.13894	Ubiquitin supergroup (1);Ubiquitin (1);	0.254864	0.33272	N	0.005088	T	0.37073	0.0990	L	0.38531	1.155	0.30262	N	0.793023	P	0.47484	0.896	P	0.52481	0.7	T	0.35251	-0.9796	10	0.72032	D	0.01	.	4.264	0.10754	0.1547:0.4001:0.0:0.4452	.	136	Q9BVT8	TMUB1_HUMAN	P	136	ENSP00000297533:R136P;ENSP00000376565:R136P;ENSP00000417519:R136P;ENSP00000418709:R136P;ENSP00000419214:R136P;ENSP00000420692:R136P	ENSP00000297533:R136P	R	-	2	0	TMUB1	150409903	0.994000	0.37717	0.995000	0.50966	0.927000	0.56198	0.413000	0.21148	0.050000	0.15949	0.313000	0.20887	CGG	.	.		0.647	TMUB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351485.1	NM_031434	
TMUB1	83590	hgsc.bcm.edu	37	7	150778972	150778972	+	Silent	SNP	G	G	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr7:150778972G>T	ENST00000392818.3	-	3	762	c.405C>A	c.(403-405)ggC>ggA	p.G135G	FASTK_ENST00000489884.1_5'Flank|TMUB1_ENST00000462940.1_Silent_p.G135G|FASTK_ENST00000297532.6_5'Flank|FASTK_ENST00000482571.1_5'Flank|FASTK_ENST00000540185.1_5'Flank|TMUB1_ENST00000476627.1_Silent_p.G135G|TMUB1_ENST00000297533.4_Silent_p.G135G|FASTK_ENST00000353841.2_5'Flank|TMUB1_ENST00000482202.1_Silent_p.G135G	NM_031434.3	NP_113622.1	Q9BVT8	TMUB1_HUMAN	transmembrane and ubiquitin-like domain containing 1	135	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGTTCCCGGCCGGGAAACT	0.642																																					p.G135G		Atlas-SNP	.											.	TMUB1	7	.	0			c.C405A						.						17.0	14.0	15.0					7																	150778972		2191	4292	6483	SO:0001819	synonymous_variant	83590	exon3			TTCCCGGCCGGGA	BC000936	CCDS5920.1	7q36.1	2006-06-27	2006-06-27	2006-06-27	ENSG00000164897	ENSG00000164897			21709	protein-coding gene	gene with protein product		614792	"""chromosome 7 open reading frame 21"""	C7orf21			Standard	NM_001136044		Approved	SB144	uc003wjd.3	Q9BVT8	OTTHUMG00000158621	ENST00000392818.3:c.405C>A	chr7.hg19:g.150778972G>T		26.0	0.0		27.0	7.0	NM_031434	D3DX06|Q53AQ2	Silent	SNP	ENST00000392818.3	hg19	CCDS5920.1																																																																																			.	.		0.642	TMUB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351485.1	NM_031434	
ADAM2	2515	hgsc.bcm.edu	37	8	39607233	39607233	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr8:39607233A>T	ENST00000265708.4	-	17	1931	c.1828T>A	c.(1828-1830)Tca>Aca	p.S610T	ADAM2_ENST00000521880.1_Missense_Mutation_p.S547T|ADAM2_ENST00000347580.4_Missense_Mutation_p.S591T|ADAM2_ENST00000379853.2_Missense_Mutation_p.S454T	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	610					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CCCAAGTATGAAGAACTCACA	0.343																																					p.S610T		Atlas-SNP	.											.	ADAM2	124	.	0			c.T1828A						.						135.0	126.0	129.0					8																	39607233		2203	4300	6503	SO:0001583	missense	2515	exon17			AGTATGAAGAACT	U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.1828T>A	chr8.hg19:g.39607233A>T	ENSP00000265708:p.Ser610Thr	170.0	0.0		182.0	31.0	NM_001464	P78326|Q9UQQ8	Missense_Mutation	SNP	ENST00000265708.4	hg19	CCDS34884.1	.	.	.	.	.	.	.	.	.	.	A	8.875	0.950200	0.18431	.	.	ENSG00000104755	ENST00000347580;ENST00000379853;ENST00000265708;ENST00000521880	D;D;D;T	0.85339	-1.97;-1.97;-1.97;5.14	4.21	-8.42	0.00957	.	.	.	.	.	T	0.68522	0.3010	L	0.35854	1.095	0.09310	N	1	B;B;B;B	0.15719	0.005;0.01;0.014;0.005	B;B;B;B	0.18263	0.021;0.005;0.02;0.005	T	0.54497	-0.8285	9	0.18710	T	0.47	.	1.5026	0.02480	0.2766:0.3052:0.0814:0.3369	.	547;454;591;610	B4DWY7;Q6P2G0;Q99965-2;Q99965	.;.;.;ADAM2_HUMAN	T	591;454;610;547	ENSP00000343854:S591T;ENSP00000369182:S454T;ENSP00000265708:S610T;ENSP00000429352:S547T	ENSP00000265708:S610T	S	-	1	0	ADAM2	39726390	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.494000	0.00972	-1.963000	0.01013	-0.313000	0.08912	TCA	.	.		0.343	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376926.1	NM_001464	
CSMD3	114788	hgsc.bcm.edu	37	8	113403006	113403006	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr8:113403006C>A	ENST00000297405.5	-	36	6065	c.5821G>T	c.(5821-5823)Gga>Tga	p.G1941*	CSMD3_ENST00000455883.2_Nonsense_Mutation_p.G1837*|CSMD3_ENST00000352409.3_Nonsense_Mutation_p.G1871*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.G1901*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1941	CUB 11. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTTAAAATTCCACCACAGGGC	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.G1941X		Atlas-SNP	.											.	CSMD3	2325	.	0			c.G5821T						.						78.0	72.0	74.0					8																	113403006		2203	4300	6503	SO:0001587	stop_gained	114788	exon36			AAATTCCACCACA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5821G>T	chr8.hg19:g.113403006C>A	ENSP00000297405:p.Gly1941*	69.0	0.0		149.0	38.0	NM_198123	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	C	44	11.125595	0.99519	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	5.24	4.35	0.52113	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	15.295	0.73898	0.1411:0.8589:0.0:0.0	.	.	.	.	X	1901;1941;1211;1837;1871	.	ENSP00000297405:G1941X	G	-	1	0	CSMD3	113472182	1.000000	0.71417	0.999000	0.59377	0.006000	0.05464	7.640000	0.83355	1.428000	0.47296	-0.518000	0.04402	GGA	.	.		0.408	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
SLC30A8	169026	hgsc.bcm.edu	37	8	118174119	118174119	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr8:118174119T>A	ENST00000456015.2	+	5	715	c.715T>A	c.(715-717)Tac>Aac	p.Y239N	SLC30A8_ENST00000427715.2_Missense_Mutation_p.Y190N|RN7SL826P_ENST00000479724.2_RNA|SLC30A8_ENST00000521243.1_Missense_Mutation_p.Y190N|SLC30A8_ENST00000519688.1_Missense_Mutation_p.Y190N	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	239					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			ACTTATTATCTACTTTAAGGT	0.413																																					p.Y239N	Ovarian(162;1202 1922 6011 16223 52092)	Atlas-SNP	.											.	SLC30A8	102	.	0			c.T715A						.						171.0	145.0	154.0					8																	118174119		2203	4300	6503	SO:0001583	missense	169026	exon5			ATTATCTACTTTA		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.715T>A	chr8.hg19:g.118174119T>A	ENSP00000415011:p.Tyr239Asn	76.0	0.0		163.0	20.0	NM_173851	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	hg19	CCDS6322.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.421387	0.83559	.	.	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	5.47	4.32	0.51571	.	0.229124	0.46145	D	0.000319	T	0.76870	0.4048	M	0.81682	2.555	0.53005	D	0.999963	D	0.63880	0.993	D	0.71184	0.972	T	0.78976	-0.1991	10	0.59425	D	0.04	-16.8794	10.3447	0.43899	0.0:0.0771:0.0:0.9229	.	239	Q8IWU4	ZNT8_HUMAN	N	190;190;190;239	ENSP00000428545:Y190N;ENSP00000407505:Y190N;ENSP00000431069:Y190N;ENSP00000415011:Y239N	ENSP00000407505:Y190N	Y	+	1	0	SLC30A8	118243300	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.985000	0.63845	2.214000	0.71695	0.533000	0.62120	TAC	.	.		0.413	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851	
COL22A1	169044	hgsc.bcm.edu	37	8	139696713	139696713	+	Splice_Site	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr8:139696713C>A	ENST00000303045.6	-	39	3414		c.e39-1		COL22A1_ENST00000341807.4_Splice_Site|COL22A1_ENST00000435777.1_Splice_Site	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CACGGAGTCCCTGGAGAAATA	0.532										HNSCC(7;0.00092)																											.		Atlas-SNP	.											.	COL22A1	390	.	0			c.2968-1G>T						.						92.0	96.0	95.0					8																	139696713		2203	4300	6503	SO:0001630	splice_region_variant	169044	exon40			GAGTCCCTGGAGA	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2968-1G>T	chr8.hg19:g.139696713C>A		91.0	0.0		141.0	34.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Splice_Site	SNP	ENST00000303045.6	hg19	CCDS6376.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163351	0.38217	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8162	0.52211	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL22A1	139765895	1.000000	0.71417	0.997000	0.53966	0.532000	0.34746	1.943000	0.40253	2.122000	0.65172	0.448000	0.29417	.	.	.		0.532	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	Intron
FRMPD1	22844	hgsc.bcm.edu	37	9	37745441	37745441	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr9:37745441G>A	ENST00000539465.1	+	16	4005	c.3412G>A	c.(3412-3414)Ggt>Agt	p.G1138S	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.G1138S			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	1138						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		TGACTCCCCGGGTGATGTGTC	0.433																																					p.G1138S		Atlas-SNP	.											.	FRMPD1	237	.	0			c.G3412A						.						56.0	57.0	57.0					9																	37745441		2203	4300	6503	SO:0001583	missense	22844	exon16			TCCCCGGGTGATG	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.3412G>A	chr9.hg19:g.37745441G>A	ENSP00000444411:p.Gly1138Ser	86.0	0.0		110.0	36.0	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	hg19	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	G	9.617	1.132800	0.21041	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.07021	3.23;3.23	5.12	1.56	0.23342	.	0.890085	0.09915	N	0.739211	T	0.04588	0.0125	L	0.27053	0.805	0.09310	N	1	B	0.20052	0.041	B	0.14023	0.01	T	0.45833	-0.9234	10	0.09338	T	0.73	-4.1821	2.935	0.05811	0.2648:0.0:0.5264:0.2089	.	1138	Q5SYB0	FRPD1_HUMAN	S	1138	ENSP00000366995:G1138S;ENSP00000444411:G1138S	ENSP00000366995:G1138S	G	+	1	0	FRMPD1	37735441	0.000000	0.05858	0.014000	0.15608	0.025000	0.11179	0.108000	0.15396	1.150000	0.42419	0.462000	0.41574	GGT	.	.		0.433	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
PTPDC1	138639	hgsc.bcm.edu	37	9	96864001	96864001	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr9:96864001G>A	ENST00000375360.3	+	8	2345	c.2005G>A	c.(2005-2007)Gat>Aat	p.D669N	PTPDC1_ENST00000288976.3_Missense_Mutation_p.D721N|PTPDC1_ENST00000467049.1_3'UTR	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	669					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						CAGGCGAGCAGATGCCGCAGA	0.453																																					p.D723N		Atlas-SNP	.											PTPDC1_ENST00000375360,NS,carcinoma,0,2	PTPDC1	134	.	0			c.G2167A						.						133.0	126.0	129.0					9																	96864001		2203	4300	6503	SO:0001583	missense	138639	exon7			CGAGCAGATGCCG	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.2005G>A	chr9.hg19:g.96864001G>A	ENSP00000364509:p.Asp669Asn	121.0	1.0		173.0	27.0	NM_001253829	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	hg19	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.896202	0.33442	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.16597	2.33;2.33	5.6	5.6	0.85130	.	0.188820	0.56097	D	0.000037	T	0.19805	0.0476	L	0.49126	1.545	0.40210	D	0.977618	B;B;B;B	0.27264	0.108;0.173;0.108;0.108	B;B;B;B	0.33620	0.08;0.167;0.08;0.045	T	0.03051	-1.1078	10	0.39692	T	0.17	-16.9498	11.9896	0.53168	0.0784:0.0:0.9216:0.0	.	723;721;723;669	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	N	669;721	ENSP00000364509:D669N;ENSP00000288976:D721N	ENSP00000288976:D721N	D	+	1	0	PTPDC1	95903822	1.000000	0.71417	0.354000	0.25760	0.482000	0.33219	3.349000	0.52217	2.630000	0.89119	0.655000	0.94253	GAT	.	.		0.453	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
GALNT12	79695	hgsc.bcm.edu	37	9	101570305	101570305	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr9:101570305G>A	ENST00000375011.3	+	1	325	c.325G>A	c.(325-327)Gac>Aac	p.D109N		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	109					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				CTACCTCAGCGACCGCATCTC	0.706																																					p.D109N		Atlas-SNP	.											.	GALNT12	37	.	0			c.G325A						.						8.0	9.0	8.0					9																	101570305		2172	4241	6413	SO:0001583	missense	79695	exon1			CTCAGCGACCGCA	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.325G>A	chr9.hg19:g.101570305G>A	ENSP00000364150:p.Asp109Asn	30.0	0.0		64.0	20.0	NM_024642	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	hg19	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	g	28.6	4.934265	0.92458	.	.	ENSG00000119514	ENST00000375011	T	0.61274	0.12	3.91	3.0	0.34707	.	0.117349	0.56097	D	0.000036	T	0.68146	0.2969	M	0.66378	2.025	0.46458	D	0.999053	D	0.76494	0.999	D	0.75020	0.985	T	0.65857	-0.6066	10	0.41790	T	0.15	.	7.4213	0.27073	0.1223:0.0:0.8777:0.0	.	109	Q8IXK2	GLT12_HUMAN	N	109	ENSP00000364150:D109N	ENSP00000364150:D109N	D	+	1	0	GALNT12	100610126	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.006000	0.88564	0.980000	0.38523	0.450000	0.29827	GAC	.	.		0.706	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
GALNT12	79695	hgsc.bcm.edu	37	9	101597550	101597550	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr9:101597550G>A	ENST00000375011.3	+	5	937	c.937G>A	c.(937-939)Ggg>Agg	p.G313R		NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	313	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				AATGGCTGGTGGGCTGTTTGC	0.418																																					p.G313R		Atlas-SNP	.											.	GALNT12	37	.	0			c.G937A						.						142.0	150.0	147.0					9																	101597550		2203	4300	6503	SO:0001583	missense	79695	exon5			GCTGGTGGGCTGT	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.937G>A	chr9.hg19:g.101597550G>A	ENSP00000364150:p.Gly313Arg	88.0	0.0		119.0	41.0	NM_024642	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	hg19	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670338	0.88348	.	.	ENSG00000119514	ENST00000375011	T	0.61274	0.12	5.43	5.43	0.79202	Glycosyl transferase, family 2 (1);	0.046562	0.85682	D	0.000000	D	0.82407	0.5030	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86683	0.1918	10	0.87932	D	0	.	17.0949	0.86632	0.0:0.0:1.0:0.0	.	313	Q8IXK2	GLT12_HUMAN	R	313	ENSP00000364150:G313R	ENSP00000364150:G313R	G	+	1	0	GALNT12	100637371	1.000000	0.71417	0.989000	0.46669	0.927000	0.56198	9.781000	0.99029	2.722000	0.93159	0.655000	0.94253	GGG	.	.		0.418	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
LCN9	392399	hgsc.bcm.edu	37	9	138556630	138556630	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr9:138556630A>G	ENST00000277526.3	+	3	296	c.296A>G	c.(295-297)tAc>tGc	p.Y99C	LCN9_ENST00000430290.2_3'UTR	NM_001001676.1	NP_001001676.1	Q8WX39	LCN9_HUMAN	lipocalin 9	99						extracellular region (GO:0005576)	pheromone binding (GO:0005550)|transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	6		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)		AATGGGGAATACTCCATCAAC	0.592																																					p.Y99C		Atlas-SNP	.											.	LCN9	42	.	0			c.A296G						.						61.0	70.0	67.0					9																	138556630		2047	4195	6242	SO:0001583	missense	392399	exon3			GGGAATACTCCAT	AY301270	CCDS56593.1	9q34	2011-11-14			ENSG00000148386	ENSG00000148386		"""Lipocalins"""	17442	protein-coding gene	gene with protein product	"""MUP-like lipocalin"", ""epididymal-specific lipocalin-9"""	612903				15363845	Standard	NM_001001676		Approved		uc004cgk.2	Q8WX39	OTTHUMG00000020916	ENST00000277526.3:c.296A>G	chr9.hg19:g.138556630A>G	ENSP00000277526:p.Tyr99Cys	65.0	0.0		108.0	7.0	NM_001001676	C9J5F0|Q6JVE7	Missense_Mutation	SNP	ENST00000277526.3	hg19	CCDS56593.1	.	.	.	.	.	.	.	.	.	.	A	7.015	0.557591	0.13436	.	.	ENSG00000148386	ENST00000277526	T	0.52983	0.64	3.09	-6.17	0.02091	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.344020	0.05435	N	0.546560	T	0.36826	0.0981	L	0.58669	1.825	0.09310	N	1	B	0.21905	0.062	B	0.24974	0.057	T	0.40194	-0.9576	10	0.52906	T	0.07	-60.3132	1.1993	0.01881	0.2139:0.1585:0.1245:0.5031	.	99	Q8WX39	LCN9_HUMAN	C	99	ENSP00000277526:Y99C	ENSP00000277526:Y99C	Y	+	2	0	LCN9	137696451	0.000000	0.05858	0.001000	0.08648	0.027000	0.11550	-0.710000	0.05024	-1.022000	0.03346	-0.695000	0.03696	TAC	.	.		0.592	LCN9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410711.1	NM_001001676	
PTPLA	9200	hgsc.bcm.edu	37	10	17645602	17645602	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr10:17645602G>A	ENST00000361271.3	-	4	477	c.440C>T	c.(439-441)tCa>tTa	p.S147L		NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	147					fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						AAAGATTCTTGAACTCACTTG	0.368																																					p.S147L		Atlas-SNP	.											.	PTPLA	34	.	0			c.C440T						.						99.0	92.0	94.0					10																	17645602		2203	4300	6503	SO:0001583	missense	9200	exon4			ATTCTTGAACTCA	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.440C>T	chr10.hg19:g.17645602G>A	ENSP00000355308:p.Ser147Leu	183.0	0.0		308.0	100.0	NM_014241	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	hg19	CCDS7121.1	.	.	.	.	.	.	.	.	.	.	G	15.79	2.937285	0.52972	.	.	ENSG00000165996	ENST00000361271	T	0.39592	1.07	4.87	4.87	0.63330	.	0.068458	0.64402	D	0.000009	T	0.77039	0.4072	H	0.96805	3.885	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.85897	0.1432	10	0.87932	D	0	-6.8978	18.4033	0.90525	0.0:0.0:1.0:0.0	.	147	B0YJ81	HACD1_HUMAN	L	147	ENSP00000355308:S147L	ENSP00000355308:S147L	S	-	2	0	PTPLA	17685608	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.795000	0.99099	2.426000	0.82243	0.460000	0.39030	TCA	.	.		0.368	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
MYO3A	53904	hgsc.bcm.edu	37	10	26446396	26446396	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr10:26446396G>A	ENST00000265944.5	+	26	3117	c.2951G>A	c.(2950-2952)cGa>cAa	p.R984Q	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	984	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GCAAGAATTCGAAGACTAGGA	0.363																																					p.R984Q		Atlas-SNP	.											MYO3A,NS,carcinoma,0,1	MYO3A	371	.	0			c.G2951A						.						109.0	106.0	107.0					10																	26446396		2203	4300	6503	SO:0001583	missense	53904	exon26			GAATTCGAAGACT	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.2951G>A	chr10.hg19:g.26446396G>A	ENSP00000265944:p.Arg984Gln	86.0	1.0		130.0	15.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	35	5.426828	0.96131	.	.	ENSG00000095777	ENST00000265944	T	0.73681	-0.77	5.07	5.07	0.68467	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.91267	0.7247	H	0.96604	3.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94026	0.7297	10	0.72032	D	0.01	.	18.8211	0.92097	0.0:0.0:1.0:0.0	.	984	Q8NEV4	MYO3A_HUMAN	Q	984	ENSP00000265944:R984Q	ENSP00000265944:R984Q	R	+	2	0	MYO3A	26486402	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.809000	0.99208	2.524000	0.85096	0.655000	0.94253	CGA	.	.		0.363	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
CDH23	64072	hgsc.bcm.edu	37	10	73560411	73560411	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr10:73560411T>C	ENST00000224721.6	+	52	7401	c.7396T>C	c.(7396-7398)Tct>Cct	p.S2466P	CDH23_ENST00000475158.1_3'UTR|CDH23_ENST00000398788.3_Missense_Mutation_p.S221P	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2461	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CTATGTGCTGTCTTCTCTGGA	0.488																																					p.S2461P		Atlas-SNP	.											.	CDH23	365	.	0			c.T7381C						.						57.0	59.0	59.0					10																	73560411		1937	4135	6072	SO:0001583	missense	64072	exon51			GTGCTGTCTTCTC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7396T>C	chr10.hg19:g.73560411T>C	ENSP00000224721:p.Ser2466Pro	55.0	0.0		79.0	28.0	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	hg19		.	.	.	.	.	.	.	.	.	.	T	22.3	4.266048	0.80358	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000224721;ENST00000398788	T	0.01871	4.59	5.43	5.43	0.79202	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.07007	0.0178	L	0.29908	0.895	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.70227	0.968;0.968	T	0.41360	-0.9513	10	0.56958	D	0.05	.	15.4863	0.75571	0.0:0.0:0.0:1.0	.	2461;2461	E9PEX1;Q9H251	.;CAD23_HUMAN	P	2466;2461;2464;221	ENSP00000381768:S221P	ENSP00000224721:S2466P	S	+	1	0	CDH23	73230417	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	5.720000	0.68470	2.062000	0.61559	0.438000	0.28831	TCT	.	.		0.488	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
SLIT1	6585	hgsc.bcm.edu	37	10	98762647	98762647	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr10:98762647A>T	ENST00000266058.4	-	35	4213	c.3968T>A	c.(3967-3969)cTg>cAg	p.L1323Q	ARHGAP19-SLIT1_ENST00000453547.2_3'UTR|SLIT1_ENST00000371070.4_Missense_Mutation_p.L1323Q	NM_003061.2	NP_003052.2	O75093	SLIT1_HUMAN	slit homolog 1 (Drosophila)	1323	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|dorsal/ventral axon guidance (GO:0033563)|establishment of nucleus localization (GO:0040023)|forebrain morphogenesis (GO:0048853)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of synapse assembly (GO:0051964)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord development (GO:0021510)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(37)|ovary(5)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	78		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GAAGTCCTGCAGCTCGTTGTT	0.602																																					p.L1323Q		Atlas-SNP	.											.	SLIT1	154	.	0			c.T3968A						.						170.0	165.0	167.0					10																	98762647		2203	4300	6503	SO:0001583	missense	6585	exon35			TCCTGCAGCTCGT	AB011537	CCDS7453.1	10q23.3-q24	2008-08-01	2001-11-28		ENSG00000187122	ENSG00000187122			11085	protein-coding gene	gene with protein product		603742	"""slit (Drosophila) homolog 1"""	SLIL1		9693030, 9813312	Standard	NM_003061		Approved	slit1, MEGF4, Slit-1, SLIT3	uc001kmw.2	O75093	OTTHUMG00000018843	ENST00000266058.4:c.3968T>A	chr10.hg19:g.98762647A>T	ENSP00000266058:p.Leu1323Gln	118.0	0.0		130.0	54.0	NM_003061	Q5T0V1|Q8WWZ2|Q9UIL7	Missense_Mutation	SNP	ENST00000266058.4	hg19	CCDS7453.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.259060	0.80246	.	.	ENSG00000187122	ENST00000266058;ENST00000371070	T;T	0.69926	-0.44;-0.44	4.75	4.75	0.60458	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.64402	D	0.000001	T	0.77961	0.4209	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78443	-0.2202	10	0.46703	T	0.11	.	14.0816	0.64925	1.0:0.0:0.0:0.0	.	1323	O75093	SLIT1_HUMAN	Q	1323	ENSP00000266058:L1323Q;ENSP00000360109:L1323Q	ENSP00000266058:L1323Q	L	-	2	0	SLIT1	98752637	1.000000	0.71417	0.995000	0.50966	0.987000	0.75469	9.115000	0.94336	1.995000	0.58328	0.459000	0.35465	CTG	.	.		0.602	SLIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049636.1	NM_003061	
MMP21	118856	hgsc.bcm.edu	37	10	127460888	127460888	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr10:127460888T>C	ENST00000368808.3	-	4	877	c.878A>G	c.(877-879)cAc>cGc	p.H293R		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	293					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	CCTGTAGGTGTGAGGCAAGCC	0.527																																					p.H293R		Atlas-SNP	.											.	MMP21	46	.	0			c.A878G						.						106.0	89.0	95.0					10																	127460888		2203	4300	6503	SO:0001583	missense	118856	exon4			TAGGTGTGAGGCA	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.878A>G	chr10.hg19:g.127460888T>C	ENSP00000357798:p.His293Arg	65.0	0.0		87.0	26.0	NM_147191	Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	hg19	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.944663	0.73672	.	.	ENSG00000154485	ENST00000368808	T	0.66995	-0.24	5.05	3.89	0.44902	Peptidase M10, metallopeptidase (1);Peptidase, metallopeptidase (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86234	0.5884	H	0.96996	3.92	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.87684	0.2549	10	0.87932	D	0	-17.9828	10.161	0.42851	0.0:0.0:0.1683:0.8317	.	293	Q8N119	MMP21_HUMAN	R	293	ENSP00000357798:H293R	ENSP00000357798:H293R	H	-	2	0	MMP21	127450878	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.012000	0.64017	0.746000	0.32786	0.459000	0.35465	CAC	.	.		0.527	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
MUC5B	727897	hgsc.bcm.edu	37	11	1258280	1258280	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr11:1258280C>T	ENST00000529681.1	+	25	3241	c.3183C>T	c.(3181-3183)tgC>tgT	p.C1061C	MUC5B_ENST00000447027.1_Silent_p.C1064C	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1061	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCCCTCCTGCCCGGACGCCC	0.657																																					p.C1061C		Atlas-SNP	.											.	MUC5B	473	.	0			c.C3183T						.						41.0	58.0	52.0					11																	1258280		2092	4193	6285	SO:0001819	synonymous_variant	727897	exon25			CTCCTGCCCGGAC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.3183C>T	chr11.hg19:g.1258280C>T		80.0	0.0		96.0	19.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Silent	SNP	ENST00000529681.1	hg19	CCDS44515.2																																																																																			.	.		0.657	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
IPO7	10527	hgsc.bcm.edu	37	11	9446761	9446761	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr11:9446761A>C	ENST00000379719.3	+	12	1429	c.1287A>C	c.(1285-1287)aaA>aaC	p.K429N		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	429					innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CTCGAAAAAAAGATGGAGCCC	0.348																																					p.K429N		Atlas-SNP	.											.	IPO7	72	.	0			c.A1287C						.						84.0	82.0	83.0					11																	9446761		2201	4295	6496	SO:0001583	missense	10527	exon12			AAAAAAAGATGGA	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.1287A>C	chr11.hg19:g.9446761A>C	ENSP00000369042:p.Lys429Asn	98.0	0.0		101.0	6.0	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Missense_Mutation	SNP	ENST00000379719.3	hg19	CCDS31425.1	.	.	.	.	.	.	.	.	.	.	A	19.64	3.865484	0.71949	.	.	ENSG00000205339	ENST00000379719	T	0.69806	-0.43	5.45	3.15	0.36227	Armadillo-like helical (1);Armadillo-type fold (1);Exportin/Importin, Cse1-like (1);	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	M	0.88310	2.945	0.80722	D	1	D	0.60160	0.987	D	0.66084	0.941	T	0.82222	-0.0564	10	0.87932	D	0	.	9.1753	0.37107	0.8524:0.0:0.1476:0.0	.	429	O95373	IPO7_HUMAN	N	429	ENSP00000369042:K429N	ENSP00000369042:K429N	K	+	3	2	IPO7	9403337	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.046000	0.30354	0.881000	0.35993	0.533000	0.62120	AAA	.	.		0.348	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
TTC17	55761	hgsc.bcm.edu	37	11	43421488	43421488	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr11:43421488A>T	ENST00000039989.4	+	9	1123	c.1109A>T	c.(1108-1110)gAc>gTc	p.D370V	TTC17_ENST00000299240.6_Missense_Mutation_p.D370V|TTC17_ENST00000526774.1_3'UTR	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	370					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						AAGCAGCATGACCACTACCTG	0.348																																					p.D370V		Atlas-SNP	.											.	TTC17	112	.	0			c.A1109T						.						108.0	106.0	106.0					11																	43421488		2203	4300	6503	SO:0001583	missense	55761	exon9			AGCATGACCACTA	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.1109A>T	chr11.hg19:g.43421488A>T	ENSP00000039989:p.Asp370Val	280.0	0.0		406.0	27.0	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	hg19	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.533124	0.85812	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.37752	1.33;1.18	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.55970	0.1954	L	0.57536	1.79	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.79108	0.972;0.986;0.992	T	0.52924	-0.8510	10	0.36615	T	0.2	-21.9472	15.7262	0.77763	1.0:0.0:0.0:0.0	.	370;370;370	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	V	370	ENSP00000299240:D370V;ENSP00000039989:D370V	ENSP00000039989:D370V	D	+	2	0	TTC17	43378064	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.108000	0.64289	0.460000	0.39030	GAC	.	.		0.348	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
SERPINH1	871	hgsc.bcm.edu	37	11	75280184	75280184	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr11:75280184A>G	ENST00000524558.1	+	4	2357	c.922A>G	c.(922-924)Aag>Gag	p.K308E	SERPINH1_ENST00000525876.1_Missense_Mutation_p.K91E|SERPINH1_ENST00000533603.1_Missense_Mutation_p.K308E|SERPINH1_ENST00000530284.1_Missense_Mutation_p.K308E|SERPINH1_ENST00000358171.3_Missense_Mutation_p.K308E			P50454	SERPH_HUMAN	serpin peptidase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)	308					chondrocyte development involved in endochondral bone morphogenesis (GO:0003433)|collagen biosynthetic process (GO:0032964)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|protein maturation (GO:0051604)|regulation of proteolysis (GO:0030162)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(4)|large_intestine(3)|liver(1)|lung(4)|ovary(2)|stomach(1)	15	Ovarian(111;0.11)					CTCCTTGCCCAAGGGTGTGGT	0.612																																					p.K308E		Atlas-SNP	.											.	SERPINH1	33	.	0			c.A922G						.						55.0	45.0	49.0					11																	75280184		2200	4293	6493	SO:0001583	missense	871	exon5			TTGCCCAAGGGTG	X61598	CCDS8239.1	11q13.5	2014-02-18	2005-08-18		ENSG00000149257	ENSG00000149257		"""Serine (or cysteine) peptidase inhibitors"""	1546	protein-coding gene	gene with protein product		600943	"""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 2"", ""serine (or cysteine) proteinase inhibitor, clade H (heat shock protein 47), member 1, (collagen binding protein 1)"""	CBP1, CBP2, SERPINH2		7656593, 9533029, 24172014	Standard	NM_001207014		Approved	HSP47, colligen	uc001owr.3	P50454	OTTHUMG00000165362	ENST00000524558.1:c.922A>G	chr11.hg19:g.75280184A>G	ENSP00000434412:p.Lys308Glu	72.0	0.0		118.0	11.0	NM_001207014	B3KVJ3|P29043|Q5XPB4|Q6NSJ6|Q8IY96|Q9NP88	Missense_Mutation	SNP	ENST00000524558.1	hg19	CCDS8239.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.408313	0.83340	.	.	ENSG00000149257	ENST00000533603;ENST00000358171;ENST00000421448;ENST00000530284;ENST00000524558;ENST00000525876	D;D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97;-2.97	5.54	5.54	0.83059	Serpin domain (3);	0.000000	0.85682	D	0.000000	D	0.95683	0.8596	M	0.77820	2.39	0.58432	D	0.999999	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.968	D	0.96021	0.9009	10	0.72032	D	0.01	.	13.6314	0.62198	1.0:0.0:0.0:0.0	.	308;308	E9PPV6;P50454	.;SERPH_HUMAN	E	308;308;287;308;308;91	ENSP00000434657:K308E;ENSP00000350894:K308E;ENSP00000436305:K308E;ENSP00000434412:K308E;ENSP00000433532:K91E	ENSP00000350894:K308E	K	+	1	0	SERPINH1	74957832	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.425000	0.80255	2.104000	0.64026	0.533000	0.62120	AAG	.	.		0.612	SERPINH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383610.1	NM_004353	
KIAA1377	57562	hgsc.bcm.edu	37	11	101863554	101863554	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr11:101863554T>A	ENST00000263468.8	+	10	3560	c.3290T>A	c.(3289-3291)tTa>tAa	p.L1097*	KIAA1377_ENST00000537689.1_Nonsense_Mutation_p.L898*	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	1097										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAAAATACTTTACAAATAATA	0.274																																					p.L1097X		Atlas-SNP	.											.	KIAA1377	111	.	0			c.T3290A						.						27.0	29.0	28.0					11																	101863554		2188	4263	6451	SO:0001587	stop_gained	57562	exon10			ATACTTTACAAAT	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.3290T>A	chr11.hg19:g.101863554T>A	ENSP00000263468:p.Leu1097*	273.0	0.0		378.0	111.0	NM_020802	Q4G0U6	Nonsense_Mutation	SNP	ENST00000263468.8	hg19	CCDS31658.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	45|45	12.056640|12.056640	0.99631|0.99631	.|.	.|.	ENSG00000110318|ENSG00000110318	ENST00000532077|ENST00000263468;ENST00000537689	.|.	.|.	.|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|.	.|0.133751	.|0.34200	.|N	.|0.004164	T|.	0.41834|.	0.1176|.	.|.	.|.	.|.	0.52099|0.52099	D|D	0.999949|0.999949	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.33266|.	-0.9875|.	4|.	.|0.02654	.|T	.|1	-4.7772|-4.7772	14.562|14.562	0.68148|0.68148	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	L|X	60|1097;898	.|.	.|ENSP00000263468:L1097X	F|L	+|+	3|2	2|0	KIAA1377|KIAA1377	101368764|101368764	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.954000|0.954000	0.61252|0.61252	4.773000|4.773000	0.62331|0.62331	2.149000|2.149000	0.67028|0.67028	0.477000|0.477000	0.44152|0.44152	TTT|TTA	.	.		0.274	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
KMT2A	4297	hgsc.bcm.edu	37	11	118347552	118347552	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr11:118347552G>A	ENST00000389506.5	+	4	3189	c.3189G>A	c.(3187-3189)gtG>gtA	p.V1063V	KMT2A_ENST00000354520.4_Silent_p.V1063V|KMT2A_ENST00000534358.1_Silent_p.V1063V			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1063					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										AGACCTCTGTGCGAGGACCCC	0.468																																					p.V1063V		Atlas-SNP	.											.	MLL	548	.	0			c.G3189A						.						112.0	108.0	109.0					11																	118347552		2200	4296	6496	SO:0001819	synonymous_variant	4297	exon4			CTCTGTGCGAGGA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3189G>A	chr11.hg19:g.118347552G>A		84.0	0.0		155.0	8.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Silent	SNP	ENST00000389506.5	hg19	CCDS31686.1																																																																																			.	.		0.468	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
KCNA6	3742	hgsc.bcm.edu	37	12	4920420	4920420	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr12:4920420C>T	ENST00000280684.3	+	1	2079	c.1213C>T	c.(1213-1215)Ctt>Ttt	p.L405F	KCNA6_ENST00000433855.1_Missense_Mutation_p.L405F|RP11-234B24.4_ENST00000542988.1_lincRNA			P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 6	405					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|endometrium(5)|large_intestine(6)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(5)	49					Dalfampridine(DB06637)	TGACGATTCGCTTTTTCCCAG	0.562										HNSCC(72;0.22)																											p.L405F		Atlas-SNP	.											.	KCNA6	122	.	0			c.C1213T						.						142.0	121.0	128.0					12																	4920420		2203	4300	6503	SO:0001583	missense	3742	exon1			GATTCGCTTTTTC	X17622	CCDS8534.1	12p13	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6225	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 96"""	176257				16382104	Standard	NM_002235		Approved	Kv1.6, HBK2, PPP1R96	uc001qng.3	P17658		ENST00000280684.3:c.1213C>T	chr12.hg19:g.4920420C>T	ENSP00000280684:p.Leu405Phe	103.0	0.0		141.0	25.0	NM_002235		Missense_Mutation	SNP	ENST00000280684.3	hg19	CCDS8534.1	.	.	.	.	.	.	.	.	.	.	C	2.998	-0.206675	0.06180	.	.	ENSG00000151079	ENST00000433855;ENST00000280684	D;D	0.98493	-4.96;-4.96	5.18	5.18	0.71444	Ion transport (1);	0.213205	0.39475	N	0.001346	D	0.93976	0.8071	N	0.16656	0.425	0.22610	N	0.998937	B	0.13145	0.007	B	0.21546	0.035	D	0.84155	0.0425	10	0.21540	T	0.41	.	9.5211	0.39135	0.0:0.8421:0.0:0.1579	.	405	P17658	KCNA6_HUMAN	F	405	ENSP00000408321:L405F;ENSP00000280684:L405F	ENSP00000280684:L405F	L	+	1	0	KCNA6	4790681	0.000000	0.05858	0.960000	0.40013	0.710000	0.40934	-0.043000	0.12043	2.688000	0.91661	0.655000	0.94253	CTT	.	.		0.562	KCNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398909.1	NM_002235	
ARID2	196528	hgsc.bcm.edu	37	12	46244283	46244283	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr12:46244283C>A	ENST00000334344.6	+	15	2549	c.2377C>A	c.(2377-2379)Caa>Aaa	p.Q793K	ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000444670.1_Missense_Mutation_p.Q403K|ARID2_ENST00000422737.1_Missense_Mutation_p.Q644K|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	793	Gln-rich.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TACAGTAATTCAACAAGCTGT	0.453			"""N, S, F"""		hepatocellular carcinoma																																p.Q793K		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.C2377A						.						91.0	80.0	84.0					12																	46244283		2203	4300	6503	SO:0001583	missense	196528	exon15			GTAATTCAACAAG		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2377C>A	chr12.hg19:g.46244283C>A	ENSP00000335044:p.Gln793Lys	82.0	0.0		96.0	27.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.275244	0.80580	.	.	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T	0.36340	1.26	5.83	5.83	0.93111	.	0.049507	0.85682	D	0.000000	T	0.37892	0.1020	N	0.24115	0.695	0.80722	D	1	P;P;P	0.51933	0.859;0.949;0.9	P;P;B	0.50659	0.554;0.647;0.444	T	0.02860	-1.1101	10	0.24483	T	0.36	-4.521	20.1152	0.97926	0.0:1.0:0.0:0.0	.	793;403;793	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	K	793;644;403	ENSP00000335044:Q793K	ENSP00000335044:Q793K	Q	+	1	0	ARID2	44530550	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	6.776000	0.75023	2.750000	0.94351	0.655000	0.94253	CAA	.	.		0.453	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
ARHGAP9	64333	hgsc.bcm.edu	37	12	57871256	57871256	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr12:57871256T>A	ENST00000356411.2	-	4	880	c.742A>T	c.(742-744)Agt>Tgt	p.S248C	ARHGAP9_ENST00000550288.1_Missense_Mutation_p.S327C|ARHGAP9_ENST00000393797.2_Missense_Mutation_p.S319C|ARHGAP9_ENST00000424809.2_Missense_Mutation_p.S248C|ARHGAP9_ENST00000393791.3_Missense_Mutation_p.S248C|ARHGAP9_ENST00000430041.2_Missense_Mutation_p.S64C|ARHGAP9_ENST00000550454.1_5'UTR			Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9	248					positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)			endometrium(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)	30			GBM - Glioblastoma multiforme(3;3.37e-34)			TCGCTGCGACTGCGGCGCGGG	0.587																																					p.S248C		Atlas-SNP	.											.	ARHGAP9	79	.	0			c.A742T						.						54.0	61.0	59.0					12																	57871256		2203	4300	6503	SO:0001583	missense	64333	exon3			TGCGACTGCGGCG	AB051853	CCDS8941.2, CCDS44928.1, CCDS44929.1	12q13.3	2013-01-10			ENSG00000123329	ENSG00000123329		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	14130	protein-coding gene	gene with protein product		610576				11396949	Standard	NM_032496		Approved	MGC1295, 10C	uc001soc.3	Q9BRR9	OTTHUMG00000150147	ENST00000356411.2:c.742A>T	chr12.hg19:g.57871256T>A	ENSP00000348782:p.Ser248Cys	108.0	0.0		186.0	60.0	NM_001080157	B4DVI3|E9PDX9|Q8NAF3|Q8TCJ3|Q8WYR0|Q96EZ2|Q96S74	Missense_Mutation	SNP	ENST00000356411.2	hg19		.	.	.	.	.	.	.	.	.	.	T	13.39	2.223052	0.39300	.	.	ENSG00000123329	ENST00000393791;ENST00000356411;ENST00000424809;ENST00000393797;ENST00000340423;ENST00000430041;ENST00000548139;ENST00000552604;ENST00000551452;ENST00000552066	T;T;T;T;T;T	0.47177	3.11;3.11;1.75;3.09;2.99;0.85	3.58	2.39	0.29439	WW/Rsp5/WWP (1);	0.631054	0.15570	N	0.255515	T	0.32675	0.0837	N	0.19112	0.55	0.23978	N	0.99628	P;P;P;B;B;B	0.50369	0.934;0.79;0.845;0.32;0.41;0.291	B;B;B;B;B;B	0.43916	0.436;0.275;0.319;0.325;0.088;0.078	T	0.11891	-1.0569	10	0.72032	D	0.01	.	7.0886	0.25272	0.0:0.0:0.2299:0.7701	.	248;327;248;248;248;64	B4E248;Q6ZN13;Q9BRR9;Q9BRR9-2;E9PDX9;B4DVI3	.;.;RHG09_HUMAN;.;.;.	C	248;248;248;319;297;64;64;64;101;64	ENSP00000377380:S248C;ENSP00000348782:S248C;ENSP00000394307:S248C;ENSP00000377386:S319C;ENSP00000397950:S64C;ENSP00000449829:S64C	ENSP00000344852:S297C	S	-	1	0	ARHGAP9	56157523	0.059000	0.20769	0.005000	0.12908	0.002000	0.02628	-0.045000	0.12003	0.701000	0.31803	0.533000	0.62120	AGT	.	.		0.587	ARHGAP9-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_032496	
MARS	4141	hgsc.bcm.edu	37	12	57892224	57892224	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr12:57892224G>C	ENST00000262027.5	+	9	1043	c.909G>C	c.(907-909)tgG>tgC	p.W303C	MARS_ENST00000447721.2_3'UTR|MARS_ENST00000315473.5_Missense_Mutation_p.W69C	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	303					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	TCCGCCAGTGGAACACCCTCT	0.587																																					p.W303C		Atlas-SNP	.											.	MARS	84	.	0			c.G909C						.						78.0	71.0	73.0					12																	57892224		2203	4300	6503	SO:0001583	missense	4141	exon9			CCAGTGGAACACC	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.909G>C	chr12.hg19:g.57892224G>C	ENSP00000262027:p.Trp303Cys	68.0	0.0		100.0	36.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	hg19	CCDS8942.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.7|22.7	4.318956|4.318956	0.81469|0.81469	.|.	.|.	ENSG00000166986|ENSG00000166986	ENST00000552371|ENST00000262027;ENST00000315473	.|T;T	.|0.42131	.|1.55;0.98	4.7|4.7	4.7|4.7	0.59300|0.59300	.|Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.58206|0.58206	0.2106|0.2106	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.957;0.998;0.997	.|P;D;D	.|0.69142	.|0.719;0.962;0.962	T|T	0.59736|0.59736	-0.7398|-0.7398	5|10	.|0.52906	.|T	.|0.07	-8.4755|-8.4755	16.7833|16.7833	0.85567|0.85567	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|69;176;303	.|A6NC17;B4E0E9;P56192	.|.;.;SYMC_HUMAN	A|C	136|303;69	.|ENSP00000262027:W303C;ENSP00000314653:W69C	.|ENSP00000262027:W303C	G|W	+|+	2|3	0|0	MARS|MARS	56178491|56178491	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.318000|9.318000	0.96334|0.96334	2.325000|2.325000	0.78763|0.78763	0.561000|0.561000	0.74099|0.74099	GGA|TGG	.	.		0.587	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
ANKRD13A	88455	hgsc.bcm.edu	37	12	110437503	110437503	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr12:110437503G>A	ENST00000261739.4	+	1	176	c.10G>A	c.(10-12)Gcc>Acc	p.A4T	ANKRD13A_ENST00000550404.1_3'UTR	NM_033121.1	NP_149112.1	Q8IZ07	AN13A_HUMAN	ankyrin repeat domain 13A	4						endosome (GO:0005768)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(8)|lung(3)|urinary_tract(1)	16						CATGTCCTCGGCCTGCGACGC	0.726																																					p.A4T		Atlas-SNP	.											.	ANKRD13A	39	.	0			c.G10A						.						11.0	11.0	11.0					12																	110437503		1861	3508	5369	SO:0001583	missense	88455	exon1			TCCTCGGCCTGCG	AF064604	CCDS9140.1	12q24.12	2013-01-10	2006-06-30	2006-06-30		ENSG00000076513		"""Ankyrin repeat domain containing"""	21268	protein-coding gene	gene with protein product		615123	"""ankyrin repeat domain 13"""	ANKRD13		10508479	Standard	NM_033121		Approved	NY-REN-25	uc001tpx.3	Q8IZ07	OTTHUMG00000169314	ENST00000261739.4:c.10G>A	chr12.hg19:g.110437503G>A	ENSP00000261739:p.Ala4Thr	89.0	0.0		112.0	11.0	NM_033121	O60736	Missense_Mutation	SNP	ENST00000261739.4	hg19	CCDS9140.1	.	.	.	.	.	.	.	.	.	.	G	13.17	2.158000	0.38119	.	.	ENSG00000076513	ENST00000261739	T	0.56776	0.44	3.98	0.966	0.19667	.	0.888139	0.09933	N	0.736907	T	0.28532	0.0706	N	0.13235	0.315	0.80722	D	1	B;B;B	0.12013	0.0;0.005;0.002	B;B;B	0.17098	0.003;0.017;0.004	T	0.17198	-1.0377	10	0.14252	T	0.57	-15.6115	3.1807	0.06583	0.0994:0.3553:0.3849:0.1605	.	4;4;4	B4DYP5;Q3ZTS7;Q8IZ07	.;.;AN13A_HUMAN	T	4	ENSP00000261739:A4T	ENSP00000261739:A4T	A	+	1	0	ANKRD13A	108921886	0.001000	0.12720	0.992000	0.48379	0.835000	0.47333	0.141000	0.16076	0.072000	0.16694	0.563000	0.77884	GCC	.	.		0.726	ANKRD13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403430.1	NM_033121	
HCAR1	27198	hgsc.bcm.edu	37	12	123214615	123214615	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr12:123214615C>T	ENST00000436083.2	-	1	775	c.272G>A	c.(271-273)gGg>gAg	p.G91E	HCAR1_ENST00000432564.1_Missense_Mutation_p.G91E|HCAR1_ENST00000356987.2_Missense_Mutation_p.G91E			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	91					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						CGTGAAGAGCCCCACTCGGCA	0.577																																					p.G91E		Atlas-SNP	.											.	HCAR1	21	.	0			c.G272A						.						60.0	55.0	56.0					12																	123214615		2203	4300	6503	SO:0001583	missense	27198	exon1			AAGAGCCCCACTC	AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.272G>A	chr12.hg19:g.123214615C>T	ENSP00000409980:p.Gly91Glu	66.0	0.0		92.0	34.0	NM_032554	B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Missense_Mutation	SNP	ENST00000436083.2	hg19	CCDS9236.1	.	.	.	.	.	.	.	.	.	.	C	9.108	1.005757	0.19199	.	.	ENSG00000196917	ENST00000356987;ENST00000432564;ENST00000436083	T;T;T	0.36520	1.25;1.25;1.25	5.34	0.2	0.15181	GPCR, rhodopsin-like superfamily (1);	0.601453	0.15126	N	0.279097	T	0.20047	0.0482	N	0.08118	0	0.28458	N	0.916018	B	0.26400	0.148	B	0.35770	0.21	T	0.27191	-1.0081	10	0.45353	T	0.12	-5.4874	6.8077	0.23786	0.7579:0.1293:0.1128:0.0	.	91	Q9BXC0	HCAR1_HUMAN	E	91	ENSP00000349478:G91E;ENSP00000389255:G91E;ENSP00000409980:G91E	ENSP00000349478:G91E	G	-	2	0	HCAR1	121780568	0.000000	0.05858	0.591000	0.28745	0.241000	0.25554	-0.406000	0.07187	-0.202000	0.10268	-0.262000	0.10625	GGG	.	.		0.577	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401415.1		
PSPC1	55269	hgsc.bcm.edu	37	13	20346623	20346623	+	Silent	SNP	T	T	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr13:20346623T>G	ENST00000338910.4	-	2	592	c.433A>C	c.(433-435)Aga>Cga	p.R145R		NM_001042414.2	NP_001035879.1	Q8WXF1	PSPC1_HUMAN	paraspeckle component 1	145	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficient for paraspeckles localization.				negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	23		all_cancers(29;1.25e-22)|all_lung(29;1.97e-20)|all_epithelial(30;2.29e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;4.63e-06)|Epithelial(112;2.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00256)|Lung(94;0.00975)|LUSC - Lung squamous cell carcinoma(192;0.0483)		CGTAGAGGTCTGCTCTTGAGA	0.438																																					p.R145R		Atlas-SNP	.											.	PSPC1	61	.	0			c.A433C						.						119.0	114.0	116.0					13																	20346623		1929	4148	6077	SO:0001819	synonymous_variant	55269	exon3			GAGGTCTGCTCTT	AK001817	CCDS41870.1	13q11	2013-02-12			ENSG00000121390	ENSG00000121390		"""RNA binding motif (RRM) containing"""	20320	protein-coding gene	gene with protein product		612408				11790299	Standard	NM_001042414		Approved	PSP1, FLJ10955	uc021rgx.1	Q8WXF1	OTTHUMG00000016502	ENST00000338910.4:c.433A>C	chr13.hg19:g.20346623T>G		64.0	0.0		86.0	9.0	NM_001042414	Q5JTQ3|Q8NCZ9|Q8WXE8|Q9NV36	Silent	SNP	ENST00000338910.4	hg19	CCDS41870.1																																																																																			.	.		0.438	PSPC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044037.2		
ZMYM2	7750	hgsc.bcm.edu	37	13	20605572	20605572	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr13:20605572G>A	ENST00000382874.2	+	11	2155	c.1965G>A	c.(1963-1965)tgG>tgA	p.W655*	ZMYM2_ENST00000382883.3_Nonsense_Mutation_p.W137*|ZMYM2_ENST00000382871.2_Nonsense_Mutation_p.W655*|ZMYM2_ENST00000382869.3_Nonsense_Mutation_p.W655*	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	655					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TCCTGGAATGGGAGGCAAGTT	0.353																																					p.W655X		Atlas-SNP	.											.	ZMYM2	191	.	0			c.G1965A						.						82.0	74.0	76.0					13																	20605572		1824	4079	5903	SO:0001587	stop_gained	7750	exon11			GGAATGGGAGGCA	AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.1965G>A	chr13.hg19:g.20605572G>A	ENSP00000372327:p.Trp655*	103.0	0.0		131.0	39.0	NM_001190964	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Nonsense_Mutation	SNP	ENST00000382874.2	hg19	CCDS45016.1	.	.	.	.	.	.	.	.	.	.	G	39	7.594909	0.98381	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382883;ENST00000382870	.	.	.	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0185	19.6801	0.95958	0.0:0.0:1.0:0.0	.	.	.	.	X	655;655;655;655;137;35	.	ENSP00000372322:W655X	W	+	3	0	ZMYM2	19503572	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.444000	0.97578	2.652000	0.90054	0.655000	0.94253	TGG	.	.		0.353	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044051.2	NM_003453	
ERICH6B	220081	hgsc.bcm.edu	37	13	46161363	46161363	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr13:46161363G>A	ENST00000298738.2	-	5	855	c.691C>T	c.(691-693)Cca>Tca	p.P231S		NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		231										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CCAGCGTCTGGACTCCTGTCA	0.557																																					p.P231S		Atlas-SNP	.											.	FAM194B	42	.	0			c.C691T						.						27.0	30.0	29.0					13																	46161363		692	1591	2283	SO:0001583	missense	220081	exon5			CGTCTGGACTCCT																												ENST00000298738.2:c.691C>T	chr13.hg19:g.46161363G>A	ENSP00000298738:p.Pro231Ser	71.0	0.0		94.0	14.0	NM_182542	Q96MB5	Missense_Mutation	SNP	ENST00000298738.2	hg19	CCDS45045.1	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169388	0.38315	.	.	ENSG00000165837	ENST00000298738	T	0.10477	2.87	3.69	-1.45	0.08828	.	.	.	.	.	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	P;P	0.35745	0.518;0.518	B;B	0.33392	0.163;0.103	T	0.34179	-0.9839	9	0.87932	D	0	0.8152	3.4644	0.07544	0.4801:0.0:0.3327:0.1872	.	231;231	A2VDI6;Q5W0A0	.;F194B_HUMAN	S	231	ENSP00000298738:P231S	ENSP00000298738:P231S	P	-	1	0	FAM194B	45059364	0.000000	0.05858	0.000000	0.03702	0.071000	0.16799	-0.805000	0.04530	-0.364000	0.08088	0.655000	0.94253	CCA	.	.		0.557	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044781.3		
PML	5371	hgsc.bcm.edu	37	15	74324992	74324992	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr15:74324992C>G	ENST00000268058.3	+	5	1430	c.1334C>G	c.(1333-1335)tCa>tGa	p.S445*	PML_ENST00000563500.1_Intron|PML_ENST00000359928.4_Intron|PML_ENST00000395135.3_Nonsense_Mutation_p.S445*|PML_ENST00000435786.2_Nonsense_Mutation_p.S445*|PML_ENST00000569477.1_Nonsense_Mutation_p.S445*|PML_ENST00000436891.3_Nonsense_Mutation_p.S445*|PML_ENST00000567543.1_Intron|PML_ENST00000569161.1_3'UTR|PML_ENST00000569965.1_Nonsense_Mutation_p.S445*|PML_ENST00000395132.2_Intron|PML_ENST00000354026.6_Intron|PML_ENST00000268059.6_Nonsense_Mutation_p.S445*|PML_ENST00000564428.1_Intron|PML_ENST00000565898.1_Intron	NM_033238.2	NP_150241.2	P29590	PML_HUMAN	promyelocytic leukemia	445					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to interleukin-4 (GO:0071353)|cellular senescence (GO:0090398)|circadian regulation of gene expression (GO:0032922)|common-partner SMAD protein phosphorylation (GO:0007182)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|entrainment of circadian clock by photoperiod (GO:0043153)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|maintenance of protein location in nucleus (GO:0051457)|myeloid cell differentiation (GO:0030099)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation in response to oxidative stress (GO:0032938)|negative regulation of viral release from host cell (GO:1902187)|PML body organization (GO:0030578)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of histone deacetylation (GO:0031065)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)|regulation of calcium ion transport into cytosol (GO:0010522)|regulation of circadian rhythm (GO:0042752)|regulation of double-strand break repair (GO:2000779)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of protein phosphorylation (GO:0001932)|regulation of transcription, DNA-templated (GO:0006355)|response to cytokine (GO:0034097)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|retinoic acid receptor signaling pathway (GO:0048384)|SMAD protein import into nucleus (GO:0007184)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of endoplasmic reticulum membrane (GO:0042406)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	cobalt ion binding (GO:0050897)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|SUMO binding (GO:0032183)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	31						GTGGTACAGTCAGTGCCCGGG	0.607			T	"""RARA, PAX5"""	"""APL, ALL"""																																p.S445X		Atlas-SNP	.		Dom	yes		15	15q22	5371	promyelocytic leukemia		L	.	PML	169	.	0			c.C1334G						.						46.0	44.0	44.0					15																	74324992		2198	4297	6495	SO:0001587	stop_gained	5371	exon5			TACAGTCAGTGCC	AB208950	CCDS10255.1, CCDS10256.1, CCDS10257.1, CCDS10258.1, CCDS45297.1, CCDS45298.1, CCDS45299.1, CCDS45300.1, CCDS58386.1	15q24.1	2011-04-21			ENSG00000140464	ENSG00000140464		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9113	protein-coding gene	gene with protein product		102578					Standard	NM_033244		Approved	MYL, TRIM19, RNF71	uc002awv.3	P29590	OTTHUMG00000137607	ENST00000268058.3:c.1334C>G	chr15.hg19:g.74324992C>G	ENSP00000268058:p.Ser445*	173.0	0.0		247.0	94.0	NM_033244	E9PBR7|P29591|P29592|P29593|Q00755|Q15959|Q59FP9|Q8WUA0|Q96S41|Q9BPW2|Q9BWP7|Q9BZX6|Q9BZX7|Q9BZX8|Q9BZX9|Q9BZY0|Q9BZY2|Q9BZY3	Nonsense_Mutation	SNP	ENST00000268058.3	hg19	CCDS10255.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.313822	0.81358	.	.	ENSG00000140464	ENST00000395135;ENST00000435786;ENST00000436891;ENST00000268058;ENST00000268059;ENST00000417341;ENST00000418568	.	.	.	3.32	1.36	0.22044	.	3.634120	0.00875	N	0.002062	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-1.1575	3.7563	0.08586	0.2625:0.6064:0.0:0.1311	.	.	.	.	X	445;445;445;445;445;6;445	.	ENSP00000268058:S445X	S	+	2	0	PML	72112045	0.036000	0.19791	0.003000	0.11579	0.161000	0.22273	0.905000	0.28504	0.386000	0.24997	0.561000	0.74099	TCA	.	.		0.607	PML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269021.3	NM_002675	
CCDC33	80125	hgsc.bcm.edu	37	15	74588203	74588203	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr15:74588203A>G	ENST00000398814.3	+	11	1635	c.1204A>G	c.(1204-1206)Aca>Gca	p.T402A	CCDC33_ENST00000321288.5_Missense_Mutation_p.T605A|CCDC33_ENST00000563951.1_3'UTR	NM_025055.3	NP_079331.3	Q8N5R6	CCD33_HUMAN	coiled-coil domain containing 33	605										breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(4)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						GTCCAAGGACACAGTGAGCTC	0.522																																					p.T402A		Atlas-SNP	.											.	CCDC33	160	.	0			c.A1204G						.						68.0	68.0	68.0					15																	74588203		2026	4182	6208	SO:0001583	missense	80125	exon11			AAGGACACAGTGA	BC025689	CCDS42058.1, CCDS42059.1, CCDS73753.1	15q24.1	2009-08-06				ENSG00000140481			26552	protein-coding gene	gene with protein product	"""cancer/testis antigen 61"""					12477932	Standard	NM_025055		Approved	FLJ32855, CT61	uc002axo.4	Q8N5R6		ENST00000398814.3:c.1204A>G	chr15.hg19:g.74588203A>G	ENSP00000381795:p.Thr402Ala	101.0	0.0		151.0	13.0	NM_025055	A8K3U4|A8MPQ6|A8MV61|A8MVU9|B3KQ49|Q8TAX6|Q9H5Q6	Missense_Mutation	SNP	ENST00000398814.3	hg19	CCDS42058.1	.	.	.	.	.	.	.	.	.	.	A	9.349	1.064938	0.20067	.	.	ENSG00000140481	ENST00000321288;ENST00000398814	T;T	0.34859	1.34;2.21	4.02	-0.542	0.11854	.	1.900250	0.02565	N	0.097122	T	0.30135	0.0755	L	0.44542	1.39	0.09310	N	1	B;B	0.28291	0.028;0.206	B;B	0.31101	0.016;0.124	T	0.12451	-1.0547	10	0.25106	T	0.35	.	4.5536	0.12126	0.4581:0.3487:0.0:0.1931	.	605;402	C9JFX2;Q8N5R6-6	.;.	A	605;402	ENSP00000325012:T605A;ENSP00000381795:T402A	ENSP00000325012:T605A	T	+	1	0	CCDC33	72375256	0.000000	0.05858	0.000000	0.03702	0.200000	0.23975	-1.379000	0.02554	0.081000	0.16988	0.459000	0.35465	ACA	.	.		0.522	CCDC33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419491.2	NM_182791	
AGBL1	123624	hgsc.bcm.edu	37	15	86791026	86791026	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr15:86791026C>T	ENST00000441037.2	+	6	608	c.513C>T	c.(511-513)tgC>tgT	p.C171C	AGBL1_ENST00000421325.2_Silent_p.C171C	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	171					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TGCTGCTCTGCCTCAGGCACA	0.652																																					p.C171C		Atlas-SNP	.											.	AGBL1	151	.	0			c.C513T						.						46.0	48.0	47.0					15																	86791026		2154	4261	6415	SO:0001819	synonymous_variant	123624	exon6			GCTCTGCCTCAGG	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.513C>T	chr15.hg19:g.86791026C>T		61.0	0.0		71.0	25.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	ENST00000441037.2	hg19	CCDS58398.1																																																																																			.	.		0.652	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
ACAN	176	hgsc.bcm.edu	37	15	89402510	89402510	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr15:89402510A>G	ENST00000561243.1	+	11	6694	c.6694A>G	c.(6694-6696)Acg>Gcg	p.T2232A	ACAN_ENST00000352105.7_Missense_Mutation_p.T2232A|ACAN_ENST00000439576.2_Missense_Mutation_p.T2232A|ACAN_ENST00000559004.1_Missense_Mutation_p.T2232A			P16112	PGCA_HUMAN	aggrecan	2117	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.|G3.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			CCCTGCAGAGACGCATCTAGA	0.577																																					p.T2232A		Atlas-SNP	.											.	ACAN	220	.	0			c.A6694G						.						38.0	42.0	41.0					15																	89402510		2097	4226	6323	SO:0001583	missense	176	exon12			GCAGAGACGCATC	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.6694A>G	chr15.hg19:g.89402510A>G	ENSP00000453342:p.Thr2232Ala	75.0	0.0		133.0	44.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	hg19	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	A	0.020	-1.440852	0.01098	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02067	4.8;4.47	5.27	0.974	0.19715	.	0.850575	0.09579	N	0.783071	T	0.00754	0.0025	N	0.00621	-1.32	0.09310	N	0.999999	B;B	0.17852	0.024;0.024	B;B	0.23150	0.044;0.024	T	0.46414	-0.9193	10	0.02654	T	1	-0.9054	6.3809	0.21533	0.3009:0.1233:0.5758:0.0	.	2232;2232	E7ENV9;E7EX88	.;.	A	2232;2232;2118	ENSP00000387356:T2232A;ENSP00000341615:T2232A	ENSP00000268134:T2118A	T	+	1	0	ACAN	87203514	0.946000	0.32159	0.319000	0.25293	0.840000	0.47671	1.199000	0.32235	0.210000	0.20664	-0.262000	0.10625	ACG	.	.		0.577	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
THOC6	79228	hgsc.bcm.edu	37	16	3077415	3077415	+	Missense_Mutation	SNP	G	G	A	rs374499488		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr16:3077415G>A	ENST00000326266.8	+	12	1155	c.859G>A	c.(859-861)Ggg>Agg	p.G287R	THOC6_ENST00000575576.1_Missense_Mutation_p.G263R|THOC6_ENST00000253952.9_Intron|THOC6_ENST00000574549.1_Missense_Mutation_p.G263R	NM_024339.3	NP_077315.2	Q86W42	THOC6_HUMAN	THO complex 6 homolog (Drosophila)	287					apoptotic process (GO:0006915)|central nervous system development (GO:0007417)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)	13						GCAGCTGAGCGGGGAGCTGAA	0.667																																					p.G287R		Atlas-SNP	.											.	THOC6	40	.	0			c.G859A						.	G	,ARG/GLY	1,4395		0,1,2197	25.0	28.0	27.0		,859	4.4	1.0	16		27	0,8600		0,0,4300	no	intron,missense	THOC6	NM_001142350.1,NM_024339.3	,125	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	,probably-damaging	,287/342	3077415	1,12995	2198	4300	6498	SO:0001583	missense	79228	exon12			CTGAGCGGGGAGC	BC050674	CCDS10491.1, CCDS45392.1	16p13.3	2013-02-11	2006-03-02	2006-03-02		ENSG00000131652		"""WD repeat domain containing"", ""THO complex subunits"""	28369	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 35"""	615403	"""WD repeat domain 58"""	WDR58		12477932	Standard	NM_024339		Approved	MGC2655, fSAP35	uc002ctb.2	Q86W42		ENST00000326266.8:c.859G>A	chr16.hg19:g.3077415G>A	ENSP00000326531:p.Gly287Arg	22.0	0.0		32.0	5.0	NM_024339	B2RA85|Q8NBR1|Q9BTV9	Missense_Mutation	SNP	ENST00000326266.8	hg19	CCDS10491.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.238871	0.79800	2.27E-4	0.0	ENSG00000131652	ENST00000326266	T	0.35236	1.32	4.44	4.44	0.53790	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.61677	0.2366	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67565	-0.5638	10	0.72032	D	0.01	-18.3705	14.5962	0.68410	0.0:0.0:1.0:0.0	.	287	Q86W42	THOC6_HUMAN	R	287	ENSP00000326531:G287R	ENSP00000326531:G287R	G	+	1	0	THOC6	3017416	1.000000	0.71417	0.988000	0.46212	0.988000	0.76386	6.124000	0.71620	2.318000	0.78349	0.462000	0.41574	GGG	.	.		0.667	THOC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436981.1	NM_024339	
CDH1	999	hgsc.bcm.edu	37	16	68849586	68849586	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr16:68849586G>T	ENST00000261769.5	+	10	1680	c.1489G>T	c.(1489-1491)Gag>Tag	p.E497*	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Nonsense_Mutation_p.E436*|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	497	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GGAAGTGTCCGAGGACTTTGG	0.512			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.E497X		Atlas-SNP	.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	CDH1,NS,carcinoma,0,1	CDH1	535	.	1	Unknown(1)	breast(1)	c.G1489T						.						158.0	140.0	146.0					16																	68849586		2198	4300	6498	SO:0001587	stop_gained	999	exon10	Familial Cancer Database	HDGC	GTGTCCGAGGACT	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1489G>T	chr16.hg19:g.68849586G>T	ENSP00000261769:p.Glu497*	136.0	0.0		104.0	57.0	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	ENST00000261769.5	hg19	CCDS10869.1	.	.	.	.	.	.	.	.	.	.	G	33	5.274003	0.95459	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.5	5.5	0.81552	.	0.000000	0.51477	D	0.000086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9951	0.92809	0.0:0.0:1.0:0.0	.	.	.	.	X	497;515;497;436	.	ENSP00000261769:E497X	E	+	1	0	CDH1	67407087	1.000000	0.71417	0.791000	0.31998	0.335000	0.28730	9.414000	0.97362	2.588000	0.87417	0.561000	0.74099	GAG	.	.		0.512	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
RAP1GAP2	23108	hgsc.bcm.edu	37	17	2868924	2868924	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:2868924C>T	ENST00000254695.8	+	8	673	c.583C>T	c.(583-585)Cgg>Tgg	p.R195W	RAP1GAP2_ENST00000366401.4_Missense_Mutation_p.R180W|CTD-3060P21.1_ENST00000574885.1_RNA|RAP1GAP2_ENST00000540393.2_Missense_Mutation_p.R176W|RAP1GAP2_ENST00000542807.1_Missense_Mutation_p.R195W	NM_015085.4	NP_055900.4	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2	195					negative regulation of neuron projection development (GO:0010977)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)|nuclear membrane (GO:0031965)	Rap GTPase activator activity (GO:0046582)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	11						CGAGTACCTCCGGGTCATCCT	0.547																																					p.R195W		Atlas-SNP	.											.	RAP1GAP2	90	.	0			c.C583T						.						50.0	52.0	51.0					17																	2868924		2074	4192	6266	SO:0001583	missense	23108	exon8			TACCTCCGGGTCA	AB028962	CCDS45573.1, CCDS45574.1	17p13.3	2009-09-14	2009-09-14	2009-09-14		ENSG00000132359			29176	protein-coding gene	gene with protein product			"""GTPase activating RANGAP domain-like 4"", ""GTPase activating Rap/RanGAP domain-like 4"""	GARNL4		15632203	Standard	NM_015085		Approved	KIAA1039	uc010ckd.3	Q684P5		ENST00000254695.8:c.583C>T	chr17.hg19:g.2868924C>T	ENSP00000254695:p.Arg195Trp	30.0	0.0		56.0	4.0	NM_015085	B2RTY5|Q684P4|Q6AI00|Q6ZVF0|Q9UPW2	Missense_Mutation	SNP	ENST00000254695.8	hg19	CCDS45573.1	.	.	.	.	.	.	.	.	.	.	C	14.72	2.619757	0.46736	.	.	ENSG00000132359	ENST00000254695;ENST00000366401;ENST00000540393;ENST00000542807	D;D;D;D	0.94862	-3.54;-3.54;-3.54;-3.54	5.21	4.22	0.49857	.	0.054039	0.64402	D	0.000001	D	0.96608	0.8893	M	0.74546	2.27	0.50313	D	0.999864	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.987	D	0.96738	0.9544	10	0.87932	D	0	-21.4404	12.7447	0.57276	0.3145:0.6855:0.0:0.0	.	180;195	Q684P5-2;Q684P5	.;RPGP2_HUMAN	W	195;180;176;195	ENSP00000254695:R195W;ENSP00000389824:R180W;ENSP00000439688:R176W;ENSP00000444890:R195W	ENSP00000254695:R195W	R	+	1	2	RAP1GAP2	2815674	0.977000	0.34250	0.879000	0.34478	0.054000	0.15201	1.560000	0.36331	1.193000	0.43086	0.558000	0.71614	CGG	.	.		0.547	RAP1GAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438208.2		
AIPL1	23746	hgsc.bcm.edu	37	17	6331740	6331740	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:6331740G>A	ENST00000381129.3	-	3	443	c.363C>T	c.(361-363)tgC>tgT	p.C121C	AIPL1_ENST00000571740.1_Silent_p.C121C|AIPL1_ENST00000574506.1_Silent_p.C109C|AIPL1_ENST00000575265.1_Silent_p.C121C|AIPL1_ENST00000250087.5_Intron|AIPL1_ENST00000576307.1_Silent_p.C61C|AIPL1_ENST00000576776.1_Silent_p.C121C|AIPL1_ENST00000570466.1_Silent_p.C99C	NM_001033055.1|NM_014336.3	NP_001028227.1|NP_055151.3	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting protein-like 1	121	PPIase FKBP-type.				negative regulation of apoptotic process (GO:0043066)|phototransduction, visible light (GO:0007603)|protein farnesylation (GO:0018343)|protein folding (GO:0006457)|regulation of cGMP metabolic process (GO:0030823)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)	farnesylated protein binding (GO:0001918)|unfolded protein binding (GO:0051082)			NS(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|skin(1)	12				COAD - Colon adenocarcinoma(228;0.141)		TGGCCAGCCCGCACGTGTGCA	0.632																																					p.C121C		Atlas-SNP	.											.	AIPL1	34	.	0			c.C363T						.						99.0	81.0	87.0					17																	6331740		2203	4300	6503	SO:0001819	synonymous_variant	23746	exon3			CAGCCCGCACGTG	AF148864	CCDS11075.1, CCDS32539.1, CCDS32540.1, CCDS67130.1, CCDS67131.1, CCDS67132.1, CCDS67133.1	17p13.1	2013-01-08	2001-11-29		ENSG00000129221	ENSG00000129221			359	protein-coding gene	gene with protein product		604392	"""aryl hydrocarbon receptor-interacting protein-like 1"""	LCA4		10615133, 14555765, 15365173	Standard	NM_001285402		Approved		uc002gcp.3	Q9NZN9	OTTHUMG00000102043	ENST00000381129.3:c.363C>T	chr17.hg19:g.6331740G>A		26.0	0.0		33.0	6.0	NM_014336	D3DTM4|Q659W3|Q659W4|Q6ZZB6|Q8N6A0|Q9H873|Q9NS10	Silent	SNP	ENST00000381129.3	hg19	CCDS11075.1																																																																																			.	.		0.632	AIPL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219828.3	NM_014336	
PFAS	5198	hgsc.bcm.edu	37	17	8172487	8172487	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:8172487G>C	ENST00000314666.6	+	28	4055	c.3922G>C	c.(3922-3924)Gca>Cca	p.A1308P	PFAS_ENST00000545834.1_Missense_Mutation_p.A884P	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	1308					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	TTGGCAGTGGGCATGGCGACC	0.637																																					p.A1308P		Atlas-SNP	.											.	PFAS	91	.	0			c.G3922C						.						47.0	48.0	47.0					17																	8172487		2203	4300	6503	SO:0001583	missense	5198	exon28			CAGTGGGCATGGC	AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.3922G>C	chr17.hg19:g.8172487G>C	ENSP00000313490:p.Ala1308Pro	72.0	0.0		77.0	14.0	NM_012393	A6H8V8	Missense_Mutation	SNP	ENST00000314666.6	hg19	CCDS11136.1	.	.	.	.	.	.	.	.	.	.	G	4.055	0.007902	0.07866	.	.	ENSG00000178921	ENST00000545834;ENST00000314666;ENST00000546020	T;T	0.30182	1.54;2.29	5.46	4.48	0.54585	Glutamine amidotransferase type 1 (1);	0.130712	0.50627	D	0.000117	T	0.11750	0.0286	N	0.00801	-1.175	0.49389	D	0.999784	B	0.13594	0.008	B	0.14578	0.011	T	0.08597	-1.0714	10	0.87932	D	0	-6.0835	12.613	0.56561	0.0:0.3201:0.6799:0.0	.	1308	O15067	PUR4_HUMAN	P	884;1308;717	ENSP00000441706:A884P;ENSP00000313490:A1308P	ENSP00000313490:A1308P	A	+	1	0	PFAS	8113212	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	2.742000	0.47434	1.266000	0.44231	0.655000	0.94253	GCA	.	.		0.637	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226994.2		
DNAH9	1770	hgsc.bcm.edu	37	17	11778277	11778277	+	Silent	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:11778277A>T	ENST00000262442.4	+	53	10322	c.10254A>T	c.(10252-10254)ccA>ccT	p.P3418P	DNAH9_ENST00000454412.2_Silent_p.P3418P|RP11-628O18.1_ENST00000579621.1_RNA	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3418					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTCCCATTCCAGTCACCCCAG	0.567																																					p.P3418P		Atlas-SNP	.											.	DNAH9	695	.	0			c.A10254T						.						100.0	87.0	91.0					17																	11778277		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon53			CATTCCAGTCACC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10254A>T	chr17.hg19:g.11778277A>T		43.0	0.0		79.0	34.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	hg19	CCDS11160.1																																																																																			.	.		0.567	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
CACNA1G	8913	hgsc.bcm.edu	37	17	48667882	48667882	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:48667882C>T	ENST00000359106.5	+	10	2352	c.2352C>T	c.(2350-2352)agC>agT	p.S784S	CACNA1G_ENST00000416767.4_Silent_p.S784S|CACNA1G_ENST00000507896.1_Silent_p.S784S|CACNA1G_ENST00000507609.1_Silent_p.S784S|CACNA1G_ENST00000510366.1_Silent_p.S784S|CACNA1G_ENST00000358244.5_Silent_p.S784S|CACNA1G_ENST00000515765.1_Silent_p.S784S|CACNA1G_ENST00000507336.1_Silent_p.S784S|CACNA1G_ENST00000354983.4_Silent_p.S784S|CACNA1G_ENST00000514079.1_Silent_p.S784S|CACNA1G_ENST00000510115.1_Silent_p.S784S|CACNA1G_ENST00000502264.1_Silent_p.S784S|CACNA1G_ENST00000513964.1_Silent_p.S784S|CACNA1G_ENST00000507510.2_Silent_p.S784S|CACNA1G_ENST00000515165.1_Silent_p.S784S|CACNA1G_ENST00000442258.2_Silent_p.S784S|CACNA1G_ENST00000513689.2_Silent_p.S784S|CACNA1G_ENST00000352832.5_Silent_p.S784S|CACNA1G_ENST00000503485.1_Silent_p.S784S|CACNA1G_ENST00000429973.2_Silent_p.S784S|CACNA1G_ENST00000505165.1_Silent_p.S784S|CACNA1G_ENST00000514717.1_Silent_p.S784S|CACNA1G_ENST00000515411.1_Silent_p.S784S|CACNA1G_ENST00000512389.1_Silent_p.S784S|CACNA1G_ENST00000360761.4_Silent_p.S784S|CACNA1G_ENST00000514181.1_Silent_p.S784S	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	784					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TCTTCACCAGCCTCTTTGCCC	0.537																																					p.S784S		Atlas-SNP	.											.	CACNA1G	659	.	0			c.C2352T						.						113.0	116.0	115.0					17																	48667882		2079	4210	6289	SO:0001819	synonymous_variant	8913	exon10			CACCAGCCTCTTT	AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.2352C>T	chr17.hg19:g.48667882C>T		46.0	0.0		64.0	12.0	NM_001256360	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Silent	SNP	ENST00000359106.5	hg19	CCDS45730.1																																																																																			.	.		0.537	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367895.1	NM_018896	
EPX	8288	hgsc.bcm.edu	37	17	56281642	56281642	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:56281642T>C	ENST00000225371.5	+	12	2116	c.2006T>C	c.(2005-2007)aTt>aCt	p.I669T		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	669					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CTGAGCAGAATTTCCTTGTCT	0.517																																					p.I669T		Atlas-SNP	.											.	EPX	95	.	0			c.T2006C						.						116.0	102.0	106.0					17																	56281642		2203	4300	6503	SO:0001583	missense	8288	exon12			GCAGAATTTCCTT	M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.2006T>C	chr17.hg19:g.56281642T>C	ENSP00000225371:p.Ile669Thr	60.0	0.0		98.0	30.0	NM_000502	Q4TVP3	Missense_Mutation	SNP	ENST00000225371.5	hg19	CCDS11602.1	.	.	.	.	.	.	.	.	.	.	T	9.766	1.171414	0.21621	.	.	ENSG00000121053	ENST00000225371	T	0.64085	-0.08	5.65	4.57	0.56435	.	0.388040	0.31612	N	0.007346	T	0.64702	0.2622	L	0.31157	0.91	0.09310	N	1	P	0.39903	0.694	D	0.68039	0.955	T	0.54443	-0.8293	10	0.28530	T	0.3	-4.0709	5.0829	0.14666	0.1609:0.0837:0.0:0.7555	.	669	P11678	PERE_HUMAN	T	669	ENSP00000225371:I669T	ENSP00000225371:I669T	I	+	2	0	EPX	53636641	0.001000	0.12720	0.260000	0.24451	0.374000	0.29953	0.921000	0.28718	0.950000	0.37743	0.533000	0.62120	ATT	.	.		0.517	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443367.1	NM_000502	
MRC2	9902	hgsc.bcm.edu	37	17	60766907	60766907	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:60766907C>G	ENST00000303375.5	+	24	3761	c.3359C>G	c.(3358-3360)gCa>gGa	p.A1120G	MRC2_ENST00000580916.1_Intron|MRC2_ENST00000446119.2_Intron	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1120					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCGTCCCCAGCAGCGCTGCCC	0.682																																					p.A1120G		Atlas-SNP	.											.	MRC2	126	.	0			c.C3359G						.						10.0	11.0	11.0					17																	60766907		2195	4285	6480	SO:0001583	missense	9902	exon24			CCCCAGCAGCGCT	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3359C>G	chr17.hg19:g.60766907C>G	ENSP00000307513:p.Ala1120Gly	70.0	0.0		111.0	8.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Missense_Mutation	SNP	ENST00000303375.5	hg19	CCDS11634.1	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275275	0.40194	.	.	ENSG00000011028	ENST00000303375	T	0.05855	3.38	4.61	2.39	0.29439	.	0.427081	0.25546	N	0.029921	T	0.03477	0.0100	N	0.08118	0	0.58432	D	0.999996	B	0.24483	0.104	B	0.21151	0.033	T	0.50242	-0.8851	10	0.25106	T	0.35	-9.5306	12.6815	0.56924	0.4034:0.5966:0.0:0.0	.	1120	Q9UBG0	MRC2_HUMAN	G	1120	ENSP00000307513:A1120G	ENSP00000307513:A1120G	A	+	2	0	MRC2	58120639	0.167000	0.22975	0.978000	0.43139	0.689000	0.40095	1.421000	0.34815	1.241000	0.43820	0.561000	0.74099	GCA	.	.		0.682	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
FASN	2194	hgsc.bcm.edu	37	17	80042151	80042151	+	Silent	SNP	G	G	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr17:80042151G>T	ENST00000306749.2	-	28	5096	c.4878C>A	c.(4876-4878)gtC>gtA	p.V1626V	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1626					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GTGACAGCAGGACAGAGGTGG	0.657																																					p.V1626V	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.C4878A						.						64.0	61.0	62.0					17																	80042151		2193	4291	6484	SO:0001819	synonymous_variant	2194	exon28			CAGCAGGACAGAG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4878C>A	chr17.hg19:g.80042151G>T		132.0	0.0		185.0	15.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	hg19	CCDS11801.1																																																																																			.	.		0.657	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
NEDD4L	23327	hgsc.bcm.edu	37	18	56034978	56034978	+	Splice_Site	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr18:56034978G>A	ENST00000400345.3	+	22	2347	c.2064G>A	c.(2062-2064)acG>acA	p.T688T	NEDD4L_ENST00000382850.4_Splice_Site_p.T668T|NEDD4L_ENST00000357895.5_Splice_Site_p.T680T|NEDD4L_ENST00000456986.1_Splice_Site_p.T567T|NEDD4L_ENST00000356462.6_Splice_Site_p.T624T|NEDD4L_ENST00000256830.9_Splice_Site_p.T584T|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000431212.2_Splice_Site_p.T567T|NEDD4L_ENST00000586263.1_Splice_Site_p.T660T|NEDD4L_ENST00000256832.7_Splice_Site_p.T548T|NEDD4L_ENST00000456173.2_Splice_Site_p.T547T|NEDD4L_ENST00000435432.2_Splice_Site_p.T547T	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	688	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						TCCTCAAAAGGGACAACTACA	0.423																																					p.T688T		Atlas-SNP	.											.	NEDD4L	126	.	0			c.G2064A						.						118.0	107.0	110.0					18																	56034978		1901	4122	6023	SO:0001630	splice_region_variant	23327	exon22			CAAAAGGGACAAC	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.2064-1G>A	chr18.hg19:g.56034978G>A		103.0	0.0		111.0	10.0	NM_001144967	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	hg19	CCDS45872.1																																																																																			.	.		0.423	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		Silent
SLC25A23	79085	hgsc.bcm.edu	37	19	6442104	6442104	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:6442104C>A	ENST00000301454.4	-	10	1395	c.1289G>T	c.(1288-1290)gGc>gTc	p.G430V	SLC25A23_ENST00000414491.2_Missense_Mutation_p.G191V|SLC25A23_ENST00000601760.1_Intron	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	430					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						GCCCCGCATGCCCTCCTGGGA	0.632																																					p.G430V		Atlas-SNP	.											.	SLC25A23	43	.	0			c.G1289T						.						33.0	28.0	30.0					19																	6442104		2203	4300	6503	SO:0001583	missense	79085	exon10			CGCATGCCCTCCT	AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.1289G>T	chr19.hg19:g.6442104C>A	ENSP00000301454:p.Gly430Val	56.0	0.0		59.0	17.0	NM_024103	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	ENST00000301454.4	hg19	CCDS32882.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.693024	0.88735	.	.	ENSG00000125648	ENST00000301454;ENST00000414491	D;D	0.97688	-4.49;-4.49	5.0	5.0	0.66597	Mitochondrial carrier domain (2);	.	.	.	.	D	0.99486	0.9817	H	0.99954	5.04	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97526	1.0076	9	0.87932	D	0	.	17.05	0.86516	0.0:1.0:0.0:0.0	.	191;430	E7ESZ5;Q9BV35	.;SCMC3_HUMAN	V	430;191	ENSP00000301454:G430V;ENSP00000408814:G191V	ENSP00000301454:G430V	G	-	2	0	SLC25A23	6393104	1.000000	0.71417	0.992000	0.48379	0.989000	0.77384	7.264000	0.78432	2.302000	0.77476	0.448000	0.29417	GGC	.	.		0.632	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453325.1	NM_024103	
ZNF557	79230	hgsc.bcm.edu	37	19	7075098	7075098	+	Missense_Mutation	SNP	G	G	T	rs377018544		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:7075098G>T	ENST00000439035.2	+	3	253	c.13G>T	c.(13-15)Gtc>Ttc	p.V5F	ZNF557_ENST00000414706.1_Missense_Mutation_p.V5F|ZNF557_ENST00000252840.6_Missense_Mutation_p.V5F			Q8N988	ZN557_HUMAN	zinc finger protein 557	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17				Lung(535;0.179)		GGCGGCTGTCGTCCTGCCCCC	0.632																																					p.V5F		Atlas-SNP	.											.	ZNF557	40	.	0			c.G13T						.						52.0	58.0	56.0					19																	7075098		2203	4300	6503	SO:0001583	missense	79230	exon3			GCTGTCGTCCTGC	AK095524	CCDS42485.1, CCDS45945.1	19p13.2	2013-09-20			ENSG00000130544	ENSG00000130544		"""Zinc fingers, C2H2-type"", ""-"""	28632	protein-coding gene	gene with protein product						12477932	Standard	NM_024341		Approved	MGC4054	uc002mgc.3	Q8N988	OTTHUMG00000181977	ENST00000439035.2:c.13G>T	chr19.hg19:g.7075098G>T	ENSP00000398965:p.Val5Phe	30.0	0.0		47.0	18.0	NM_001044387	Q6PEJ3|Q9BTZ1	Missense_Mutation	SNP	ENST00000439035.2	hg19	CCDS45945.1	.	.	.	.	.	.	.	.	.	.	.	4.233	0.042230	0.08196	.	.	ENSG00000130544	ENST00000252840;ENST00000414706;ENST00000439035	T;T;T	0.08634	3.16;3.16;3.07	1.22	0.109	0.14578	.	.	.	.	.	T	0.03305	0.0096	N	0.14661	0.345	0.09310	N	1	P;P	0.39391	0.542;0.671	B;B	0.29524	0.048;0.103	T	0.43925	-0.9361	9	0.10111	T	0.7	.	8.4553	0.32895	0.1681:0.0:0.8319:0.0	.	5;5	Q8N988;Q8N988-2	ZN557_HUMAN;.	F	5	ENSP00000252840:V5F;ENSP00000404065:V5F;ENSP00000398965:V5F	ENSP00000252840:V5F	V	+	1	0	ZNF557	7026098	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.555000	0.05999	-0.325000	0.08577	-1.829000	0.00594	GTC	.	.		0.632	ZNF557-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458502.1	NM_024341	
RASAL3	64926	hgsc.bcm.edu	37	19	15565556	15565556	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:15565556C>T	ENST00000343625.7	-	12	1955	c.1870G>A	c.(1870-1872)Ggt>Agt	p.G624S	RASAL3_ENST00000608577.1_5'Flank	NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	624	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						GGTGCCAAACCAAAGAGGCTG	0.647											OREG0025322	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G624S		Atlas-SNP	.											.	RASAL3	49	.	0			c.G1870A						.						26.0	35.0	32.0					19																	15565556		2116	4239	6355	SO:0001583	missense	64926	exon12			CCAAACCAAAGAG		CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.1870G>A	chr19.hg19:g.15565556C>T	ENSP00000341905:p.Gly624Ser	131.0	0.0	703	167.0	10.0	NM_022904	Q8N2T9|Q9H735	Missense_Mutation	SNP	ENST00000343625.7	hg19	CCDS46006.1	.	.	.	.	.	.	.	.	.	.	C	16.97	3.268600	0.59540	.	.	ENSG00000105122	ENST00000343625	D	0.84298	-1.83	4.76	4.76	0.60689	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.000000	0.34676	U	0.003775	D	0.86351	0.5912	M	0.61387	1.9	0.43540	D	0.995834	P;D	0.57899	0.952;0.981	P;P	0.54431	0.485;0.752	D	0.84070	0.0379	10	0.30078	T	0.28	.	9.3186	0.37950	0.0:0.9008:0.0:0.0992	.	624;624	Q86YV0-2;Q86YV0	.;RASL3_HUMAN	S	624	ENSP00000341905:G624S	ENSP00000341905:G624S	G	-	1	0	RASAL3	15426556	0.001000	0.12720	0.997000	0.53966	0.563000	0.35712	0.281000	0.18810	2.374000	0.81015	0.561000	0.74099	GGT	.	.		0.647	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461331.3	NM_022904	
OR10H1	26539	hgsc.bcm.edu	37	19	15918067	15918067	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:15918067G>A	ENST00000334920.2	-	1	869	c.781C>T	c.(781-783)Ctg>Ttg	p.L261L		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	261						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L261L(1)		cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						TTGGGCTTCAGGTAAATGACG	0.557																																					p.L261L		Atlas-SNP	.											OR10H1,NS,carcinoma,0,1	OR10H1	59	.	1	Substitution - coding silent(1)	lung(1)	c.C781T						.						123.0	94.0	104.0					19																	15918067		2203	4300	6503	SO:0001819	synonymous_variant	26539	exon1			GCTTCAGGTAAAT	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.781C>T	chr19.hg19:g.15918067G>A		133.0	0.0		183.0	8.0	NM_013940	Q6IFQ2|Q96R59	Silent	SNP	ENST00000334920.2	hg19	CCDS12335.1																																																																																			.	.		0.557	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
MAP1S	55201	hgsc.bcm.edu	37	19	17830385	17830385	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:17830385G>A	ENST00000324096.4	+	1	225	c.74G>A	c.(73-75)gGg>gAg	p.G25E	MAP1S_ENST00000597681.1_3'UTR|MAP1S_ENST00000544059.2_5'Flank	NM_018174.4	NP_060644.4	Q66K74	MAP1S_HUMAN	microtubule-associated protein 1S	25	Necessary for the microtubule-organizing center localization.				apoptotic DNA fragmentation (GO:0006309)|brain development (GO:0007420)|execution phase of apoptosis (GO:0097194)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	actin filament binding (GO:0051015)|beta-tubulin binding (GO:0048487)|DNA binding (GO:0003677)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	25						AGCGAGTTCGGGAGCCCGGGG	0.751																																					p.G25E		Atlas-SNP	.											.	MAP1S	74	.	0			c.G74A						.						2.0	3.0	3.0					19																	17830385		1546	3239	4785	SO:0001583	missense	55201	exon1			AGTTCGGGAGCCC	BC067115	CCDS32954.1	19p13.12	2008-02-05	2006-07-04	2006-07-04		ENSG00000130479			15715	protein-coding gene	gene with protein product		607573	"""chromosome 19 open reading frame 5"", ""VCY2 interacting protein 1"", ""BPY2 interacting protein 1"""	C19orf5, VCY2IP1, BPY2IP1		11827465, 15528209, 16297881, 14627543	Standard	NM_018174		Approved	FLJ10669, MAP8	uc002nhe.1	Q66K74		ENST00000324096.4:c.74G>A	chr19.hg19:g.17830385G>A	ENSP00000325313:p.Gly25Glu	117.0	0.0		167.0	58.0	NM_018174	B4DH53|Q27QB1|Q6NXF1|Q8N3L8|Q8N3W5|Q8NI88|Q96H94|Q96IT4|Q96SP8|Q9BRC6|Q9H928|Q9NVK7	Missense_Mutation	SNP	ENST00000324096.4	hg19	CCDS32954.1	.	.	.	.	.	.	.	.	.	.	g	11.46	1.646665	0.29246	.	.	ENSG00000130479	ENST00000324096	T	0.16597	2.33	2.57	1.35	0.21983	.	0.196906	0.24128	U	0.041286	T	0.23289	0.0563	L	0.59436	1.845	0.45477	D	0.998448	D;D	0.57257	0.979;0.979	P;P	0.54026	0.461;0.74	T	0.02320	-1.1177	10	0.45353	T	0.12	-22.1755	6.5415	0.22382	0.0:0.3055:0.6945:0.0	.	25;25	A8K940;Q66K74	.;MAP1S_HUMAN	E	25	ENSP00000325313:G25E	ENSP00000325313:G25E	G	+	2	0	MAP1S	17691385	0.005000	0.15991	0.739000	0.30968	0.044000	0.14063	0.245000	0.18142	1.436000	0.47453	0.486000	0.48141	GGG	.	.		0.751	MAP1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466027.1	NM_018174	
ZNF781	163115	hgsc.bcm.edu	37	19	38160112	38160112	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:38160112A>G	ENST00000590008.1	-	5	1790	c.938T>C	c.(937-939)aTg>aCg	p.M313T	ZFP30_ENST00000586732.1_Intron|ZNF781_ENST00000593040.1_5'Flank|ZNF781_ENST00000358582.4_Missense_Mutation_p.M313T			Q8N8C0	ZN781_HUMAN	zinc finger protein 781	313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24						ACTGACATTCATAAGGTTTTT	0.393																																					p.M313T		Atlas-SNP	.											.	ZNF781	66	.	0			c.T938C						.						148.0	142.0	144.0					19																	38160112		2203	4300	6503	SO:0001583	missense	163115	exon4			ACATTCATAAGGT	AK097019	CCDS12507.1	19q13.12	2013-01-08				ENSG00000196381		"""Zinc fingers, C2H2-type"""	26745	protein-coding gene	gene with protein product							Standard	NM_152605		Approved	FLJ37549	uc002ogy.2	Q8N8C0		ENST00000590008.1:c.938T>C	chr19.hg19:g.38160112A>G	ENSP00000466370:p.Met313Thr	48.0	0.0		81.0	7.0	NM_152605	Q2VPJ8	Missense_Mutation	SNP	ENST00000590008.1	hg19	CCDS12507.1	.	.	.	.	.	.	.	.	.	.	A	1.962	-0.438675	0.04636	.	.	ENSG00000196381	ENST00000358582;ENST00000545586	T	0.07444	3.19	2.32	1.26	0.21427	.	.	.	.	.	T	0.05960	0.0155	L	0.31294	0.92	0.18873	N	0.999985	B	0.09022	0.002	B	0.08055	0.003	T	0.41875	-0.9484	9	0.27785	T	0.31	-1.5867	6.263	0.20912	0.86:0.0:0.14:0.0	.	313	Q8N8C0	ZN781_HUMAN	T	313	ENSP00000351391:M313T	ENSP00000351391:M313T	M	-	2	0	ZNF781	42851952	0.000000	0.05858	0.069000	0.20011	0.005000	0.04900	0.242000	0.18087	0.141000	0.18875	-0.410000	0.06199	ATG	.	.		0.393	ZNF781-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000459495.2	NM_152605	
GGN	199720	hgsc.bcm.edu	37	19	38876402	38876402	+	Silent	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:38876402T>C	ENST00000334928.6	-	3	1632	c.1500A>G	c.(1498-1500)ccA>ccG	p.P500P	GGN_ENST00000591809.1_Intron|SPRED3_ENST00000587013.1_5'Flank|AC005789.9_ENST00000585411.1_RNA	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	500	Interactions with ZNF403/GGNBP2 and OAZ3. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			cggtgggagctggagccgggg	0.746																																					p.P500P		Atlas-SNP	.											.	GGN	50	.	0			c.A1500G						.						4.0	6.0	5.0					19																	38876402		1834	3724	5558	SO:0001819	synonymous_variant	199720	exon3			GGGAGCTGGAGCC	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1500A>G	chr19.hg19:g.38876402T>C		33.0	0.0		42.0	7.0	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Silent	SNP	ENST00000334928.6	hg19	CCDS12516.1																																																																																			.	.		0.746	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
RYR1	6261	hgsc.bcm.edu	37	19	38993233	38993233	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:38993233G>A	ENST00000359596.3	+	48	7701	c.7701G>A	c.(7699-7701)ccG>ccA	p.P2567P	RYR1_ENST00000360985.3_Silent_p.P2567P|RYR1_ENST00000355481.4_Silent_p.P2567P			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2567	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AGTGTGCGCCGCTCTTTGCGG	0.647																																					p.P2567P		Atlas-SNP	.											.	RYR1	708	.	0			c.G7701A						.						68.0	53.0	58.0					19																	38993233		2203	4300	6503	SO:0001819	synonymous_variant	6261	exon48			TGCGCCGCTCTTT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7701G>A	chr19.hg19:g.38993233G>A		42.0	0.0		74.0	19.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Silent	SNP	ENST00000359596.3	hg19	CCDS33011.1																																																																																			.	.		0.647	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
FPR2	2358	hgsc.bcm.edu	37	19	52272249	52272249	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:52272249T>C	ENST00000598776.1	+	2	1110	c.338T>C	c.(337-339)gTc>gCc	p.V113A	FPR2_ENST00000598953.1_Missense_Mutation_p.V113A|FPR2_ENST00000340023.6_Missense_Mutation_p.V113A	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	113					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)			endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						TTTGGAAGTGTCTTCTTGATT	0.498																																					p.V113A		Atlas-SNP	.											.	FPR2	66	.	0			c.T338C						.						179.0	155.0	163.0					19																	52272249		2203	4300	6503	SO:0001583	missense	2358	exon2			GAAGTGTCTTCTT	M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.338T>C	chr19.hg19:g.52272249T>C	ENSP00000468897:p.Val113Ala	63.0	0.0		95.0	18.0	NM_001005738	A8K3E2	Missense_Mutation	SNP	ENST00000598776.1	hg19	CCDS12840.1	.	.	.	.	.	.	.	.	.	.	.	16.66	3.185897	0.57909	.	.	ENSG00000171049	ENST00000340023	T	0.73897	-0.79	3.47	3.47	0.39725	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000005	D	0.85217	0.5646	M	0.84511	2.7	0.39781	D	0.972292	D	0.69078	0.997	D	0.72075	0.976	D	0.87427	0.2386	10	0.87932	D	0	.	10.1975	0.43062	0.0:0.0:0.0:1.0	.	113	P25090	FPR2_HUMAN	A	113	ENSP00000340191:V113A	ENSP00000340191:V113A	V	+	2	0	FPR2	56964061	1.000000	0.71417	0.978000	0.43139	0.389000	0.30415	7.204000	0.77872	1.587000	0.49959	0.402000	0.26972	GTC	.	.		0.498	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466912.2	NM_001005738	
ZNF548	147694	hgsc.bcm.edu	37	19	57909862	57909862	+	Silent	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr19:57909862A>T	ENST00000366197.5	+	3	457	c.207A>T	c.(205-207)tcA>tcT	p.S69S	ZNF548_ENST00000336128.7_Silent_p.S81S|AC003002.4_ENST00000597658.1_Silent_p.S72S|AC003002.6_ENST00000596400.1_Intron|ZNF548_ENST00000597400.1_3'UTR|AC003002.6_ENST00000600421.1_Intron|AC004076.7_ENST00000597410.1_Intron	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TAGGAGTGTCAGAGGTTACAG	0.512																																					p.S81S		Atlas-SNP	.											.	ZNF548	64	.	0			c.A243T						.						102.0	100.0	101.0					19																	57909862		2146	4283	6429	SO:0001819	synonymous_variant	147694	exon4			AGTGTCAGAGGTT	AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.207A>T	chr19.hg19:g.57909862A>T		82.0	0.0		117.0	7.0	NM_001172773	Q96M05	Silent	SNP	ENST00000366197.5	hg19	CCDS46209.1																																																																																			.	.		0.512	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000465937.1	NM_152909	
C20orf194	25943	hgsc.bcm.edu	37	20	3306871	3306871	+	Silent	SNP	A	A	G			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr20:3306871A>G	ENST00000252032.9	-	13	1228	c.1161T>C	c.(1159-1161)tgT>tgC	p.C387C	C20orf194_ENST00000453730.2_Silent_p.C125C	NM_001009984.2	NP_001009984.1	Q5TEA3	CT194_HUMAN	chromosome 20 open reading frame 194	387										NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	39						TTTTAGCATAACATGCAATGC	0.313																																					p.C387C		Atlas-SNP	.											.	C20orf194	83	.	0			c.T1161C						.						82.0	80.0	80.0					20																	3306871		1887	4102	5989	SO:0001819	synonymous_variant	25943	exon13			AGCATAACATGCA	AL110249	CCDS42851.1	20p13	2012-10-30			ENSG00000088854	ENSG00000088854			17721	protein-coding gene	gene with protein product		614146					Standard	NM_001009984		Approved	DKFZp434N061	uc002wii.3	Q5TEA3	OTTHUMG00000031742	ENST00000252032.9:c.1161T>C	chr20.hg19:g.3306871A>G		297.0	0.0		397.0	72.0	NM_001009984	Q66K86|Q6P2R9|Q9UFX9	Silent	SNP	ENST00000252032.9	hg19	CCDS42851.1																																																																																			.	.		0.313	C20orf194-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077734.1	NM_001009984	
SEMG2	6407	hgsc.bcm.edu	37	20	43851661	43851661	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr20:43851661A>T	ENST00000372769.3	+	2	1478	c.1388A>T	c.(1387-1389)gAa>gTa	p.E463V		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	463	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				GGCCATAAGGAAAATAAAATG	0.383																																					p.E463V		Atlas-SNP	.											.	SEMG2	92	.	0			c.A1388T						.						78.0	77.0	77.0					20																	43851661		2203	4300	6503	SO:0001583	missense	6407	exon2			ATAAGGAAAATAA		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1388A>T	chr20.hg19:g.43851661A>T	ENSP00000361855:p.Glu463Val	124.0	0.0		204.0	16.0	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	ENST00000372769.3	hg19	CCDS13346.1	.	.	.	.	.	.	.	.	.	.	A	8.748	0.920582	0.17982	.	.	ENSG00000124157	ENST00000372769	T	0.08102	3.13	1.15	-1.65	0.08291	.	.	.	.	.	T	0.05823	0.0152	N	0.22421	0.69	0.09310	N	1	P;P	0.41910	0.626;0.764	B;B	0.42087	0.255;0.375	T	0.34254	-0.9836	9	0.40728	T	0.16	.	5.3595	0.16079	0.5999:0.4001:0.0:0.0	.	463;463	A8K6Z6;Q02383	.;SEMG2_HUMAN	V	463	ENSP00000361855:E463V	ENSP00000361855:E463V	E	+	2	0	SEMG2	43285075	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.322000	0.08007	-0.433000	0.07286	-1.375000	0.01183	GAA	.	.		0.383	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
NFATC2	4773	hgsc.bcm.edu	37	20	50158976	50158976	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr20:50158976C>T	ENST00000396009.3	-	1	282	c.63G>A	c.(61-63)ggG>ggA	p.G21G	NFATC2_ENST00000610033.1_5'UTR|NFATC2_ENST00000609943.1_Intron|NFATC2_ENST00000414705.1_Intron|NFATC2_ENST00000371564.3_Silent_p.G21G|NFATC2_ENST00000609507.1_Intron	NM_001258297.1|NM_173091.3	NP_001245226.1|NP_775114.1	Q13469	NFAC2_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2	21					B cell receptor signaling pathway (GO:0050853)|cell migration (GO:0016477)|cellular response to DNA damage stimulus (GO:0006974)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/NFATC2(9)	breast(2)|endometrium(7)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	53	Hepatocellular(150;0.248)					GGGGGCTGCCCCCAGGCTCGT	0.697																																					p.G21G		Atlas-SNP	.											.	NFATC2	112	.	0			c.G63A						.						15.0	18.0	17.0					20																	50158976		2196	4290	6486	SO:0001819	synonymous_variant	4773	exon1			GCTGCCCCCAGGC	U43342, U43341	CCDS13437.1, CCDS33488.1, CCDS46614.1, CCDS68156.1, CCDS68157.1	20q13.2	2009-11-24			ENSG00000101096	ENSG00000101096		"""Nuclear factor of activated T-cells"""	7776	protein-coding gene	gene with protein product		600490				8202141	Standard	NM_012340		Approved	NF-ATP, NFATp, NFAT1	uc002xwd.4	Q13469	OTTHUMG00000032747	ENST00000396009.3:c.63G>A	chr20.hg19:g.50158976C>T		206.0	0.0		307.0	116.0	NM_012340	B5B2N8|B5B2N9|B5B2P0|B5B2P2|B5B2P3|Q13468|Q5TFW7|Q5TFW8|Q9NPX6|Q9NQH3|Q9UJR2	Silent	SNP	ENST00000396009.3	hg19	CCDS13437.1																																																																																			.	.		0.697	NFATC2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079730.2	NM_012340	
ZNF831	128611	hgsc.bcm.edu	37	20	57769174	57769174	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr20:57769174A>T	ENST00000371030.2	+	1	3100	c.3100A>T	c.(3100-3102)Agg>Tgg	p.R1034W		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1034							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGCCACTAGCAGGCCAGCAGC	0.647																																					p.R1034W		Atlas-SNP	.											.	ZNF831	287	.	0			c.A3100T						.						21.0	26.0	24.0					20																	57769174		2057	4212	6269	SO:0001583	missense	128611	exon1			ACTAGCAGGCCAG	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3100A>T	chr20.hg19:g.57769174A>T	ENSP00000360069:p.Arg1034Trp	31.0	0.0		42.0	4.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	A	11.62	1.692064	0.30052	.	.	ENSG00000124203	ENST00000371030	T	0.04758	3.56	3.97	-0.291	0.12843	.	1.458410	0.04642	N	0.405519	T	0.04227	0.0117	N	0.08118	0	0.09310	N	1	P	0.50819	0.939	P	0.46172	0.506	T	0.42310	-0.9459	10	0.66056	D	0.02	-0.2808	7.6518	0.28352	0.6954:0.0:0.3046:0.0	.	1034	Q5JPB2	ZN831_HUMAN	W	1034	ENSP00000360069:R1034W	ENSP00000360069:R1034W	R	+	1	2	ZNF831	57202569	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.954000	0.03873	0.015000	0.14971	0.338000	0.21704	AGG	.	.		0.647	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
SCAF4	57466	hgsc.bcm.edu	37	21	33065744	33065744	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr21:33065744T>C	ENST00000286835.7	-	12	1758	c.1376A>G	c.(1375-1377)cAt>cGt	p.H459R	SCAF4_ENST00000399804.1_Missense_Mutation_p.H459R|SCAF4_ENST00000434667.3_Missense_Mutation_p.H444R	NM_020706.2	NP_065757.1	O95104	SFR15_HUMAN	SR-related CTD-associated factor 4	459						nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(11)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						AGAACGTCGATGCCGAGACCT	0.473																																					p.H459R		Atlas-SNP	.											.	SCAF4	142	.	0			c.A1376G						.						106.0	82.0	91.0					21																	33065744		2203	4300	6503	SO:0001583	missense	57466	exon12			CGTCGATGCCGAG	AB032998	CCDS33537.1, CCDS46644.1, CCDS54482.1	21q22.1	2013-02-12	2011-01-10	2011-01-10	ENSG00000156304	ENSG00000156304		"""RNA binding motif (RRM) containing"""	19304	protein-coding gene	gene with protein product			"""splicing factor, arginine/serine-rich 15"""	SFRS15		10574461	Standard	NM_020706		Approved	KIAA1172, DKFZp434E098, SRA4	uc002ypd.2	O95104	OTTHUMG00000084903	ENST00000286835.7:c.1376A>G	chr21.hg19:g.33065744T>C	ENSP00000286835:p.His459Arg	72.0	0.0		156.0	50.0	NM_020706	C9JLZ0|Q0P5W8|Q6P1M5|Q8N3I8|Q9UFM1|Q9ULP8	Missense_Mutation	SNP	ENST00000286835.7	hg19	CCDS33537.1	.	.	.	.	.	.	.	.	.	.	T	17.99	3.522640	0.64747	.	.	ENSG00000156304	ENST00000434667;ENST00000286835;ENST00000399804	T;T;T	0.39997	1.05;1.05;1.05	5.2	5.2	0.72013	.	0.153980	0.47852	D	0.000210	T	0.60805	0.2297	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.89917	0.999;0.981;1.0;0.999	D;D;D;D	0.83275	0.991;0.966;0.996;0.991	T	0.60042	-0.7340	10	0.09084	T	0.74	-20.1116	15.063	0.71970	0.0:0.0:0.0:1.0	.	444;459;459;459	C9JLZ0;C9J1W7;O95104-2;O95104	.;.;.;SFR15_HUMAN	R	444;459;459	ENSP00000402377:H444R;ENSP00000286835:H459R;ENSP00000382703:H459R	ENSP00000286835:H459R	H	-	2	0	SCAF4	31987615	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	7.644000	0.83416	1.954000	0.56735	0.455000	0.32223	CAT	.	.		0.473	SCAF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000192659.1	XM_047889	
NEFH	4744	hgsc.bcm.edu	37	22	29885648	29885648	+	Silent	SNP	A	A	G	rs267607535		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr22:29885648A>G	ENST00000310624.6	+	4	2052	c.2019A>G	c.(2017-2019)gaA>gaG	p.E673E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	679	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAAGGCAGAAGCAAAGTCCC	0.567																																					p.E673E		Atlas-SNP	.											.	NEFH	178	.	0			c.A2019G						.						93.0	99.0	97.0					22																	29885648		2203	4299	6502	SO:0001819	synonymous_variant	4744	exon4			GGCAGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2019A>G	chr22.hg19:g.29885648A>G		237.0	0.0		353.0	18.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu	37	22	29885651	29885651	+	Silent	SNP	A	A	C	rs267607535		TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr22:29885651A>C	ENST00000310624.6	+	4	2055	c.2022A>C	c.(2020-2022)gcA>gcC	p.A674A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	680	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGCAGAAGCAAAGTCCCCTG	0.567																																					p.A674A		Atlas-SNP	.											.	NEFH	178	.	0			c.A2022C						.						92.0	98.0	96.0					22																	29885651		2203	4297	6500	SO:0001819	synonymous_variant	4744	exon4			AGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2022A>C	chr22.hg19:g.29885651A>C		241.0	0.0		355.0	19.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
CACNA1I	8911	hgsc.bcm.edu	37	22	40042812	40042812	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr22:40042812G>A	ENST00000402142.3	+	8	1388	c.1388G>A	c.(1387-1389)cGg>cAg	p.R463Q	CACNA1I_ENST00000401624.1_Missense_Mutation_p.R463Q|CACNA1I_ENST00000336649.4_Missense_Mutation_p.R463Q|CACNA1I_ENST00000400164.3_Missense_Mutation_p.R463Q|CACNA1I_ENST00000407673.1_Missense_Mutation_p.R463Q|CACNA1I_ENST00000404898.1_Missense_Mutation_p.R463Q	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	463					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CTGCAGAGCCGGCGCCAGGCC	0.721																																					p.R463Q		Atlas-SNP	.											.	CACNA1I	264	.	0			c.G1388A						.																																			SO:0001583	missense	8911	exon8			AGAGCCGGCGCCA	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.1388G>A	chr22.hg19:g.40042812G>A	ENSP00000385019:p.Arg463Gln	93.0	0.0		114.0	11.0	NM_001003406	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	hg19	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	G	14.60	2.585266	0.46110	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.97066	-4.19;-4.17;-4.18;-4.18;-4.23;-4.14	3.55	3.55	0.40652	.	1.989150	0.02561	N	0.096703	D	0.97604	0.9215	M	0.66939	2.045	0.31726	N	0.637683	D;D;D;P	0.63880	0.979;0.957;0.993;0.804	B;P;P;B	0.50109	0.44;0.481;0.631;0.166	D	0.92301	0.5849	10	0.66056	D	0.02	.	16.0019	0.80301	0.0:0.0:1.0:0.0	.	463;463;463;463	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	Q	463	ENSP00000385019:R463Q;ENSP00000384093:R463Q;ENSP00000383887:R463Q;ENSP00000385680:R463Q;ENSP00000337829:R463Q;ENSP00000383028:R463Q	ENSP00000337829:R463Q	R	+	2	0	CACNA1I	38372758	1.000000	0.71417	1.000000	0.80357	0.507000	0.33981	4.705000	0.61838	1.926000	0.55796	0.305000	0.20034	CGG	.	.		0.721	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382381	24382382	+	IGR	DNP	GC	GC	AT			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chrX:24382381_24382382GC>AT								AC004552.1 (15358 upstream) : PDK3 (100955 downstream)																							tattgctgctgctgctgctgct	0.579																																					p.A502T|p.A502V		Atlas-SNP	.											.	.	.	.	0			c.G1504A|c.C1505T						.																																			SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTGCTG|CTGCTGCTGCTGC																													chrX.hg19:g.24382381_24382382delinsAT		171.0|166.0	0.0		241.0|239.0	19.0	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.579								
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382420	24382420	+	IGR	SNP	G	G	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chrX:24382420G>C								AC004552.1 (15397 upstream) : PDK3 (100917 downstream)																							tgctgctgctgctgctgctcc	0.622																																					p.A515P		Atlas-SNP	.											.	.	.	.	0			c.G1543C						.						2.0	2.0	2.0					X																	24382420		1005	2388	3393	SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTGCTG																													chrX.hg19:g.24382420G>C		130.0	0.0		167.0	10.0	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.622								
PHKA1	5255	hgsc.bcm.edu	37	X	71813017	71813017	+	Silent	SNP	C	C	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chrX:71813017C>T	ENST00000373542.4	-	29	3339	c.3180G>A	c.(3178-3180)ctG>ctA	p.L1060L	PHKA1_ENST00000339490.3_Silent_p.L1047L|PHKA1_ENST00000541944.1_Silent_p.L988L|PHKA1_ENST00000373539.3_Silent_p.L1077L|PHKA1_ENST00000373545.3_Silent_p.L1018L	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	1060	Calmodulin-binding. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GTGCCCCATCCAGCCTTCTTC	0.433																																					p.L1060L		Atlas-SNP	.											.	PHKA1	129	.	0			c.G3180A						.						135.0	116.0	123.0					X																	71813017		2203	4300	6503	SO:0001819	synonymous_variant	5255	exon29			CCCATCCAGCCTT		CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.3180G>A	chrX.hg19:g.71813017C>T		170.0	0.0		180.0	75.0	NM_002637	B7ZL05|B7ZL07|Q2M3D7	Silent	SNP	ENST00000373542.4	hg19	CCDS14421.1																																																																																			.	.		0.433	PHKA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058896.1		
NRK	203447	hgsc.bcm.edu	37	X	105197132	105197132	+	Silent	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chrX:105197132G>A	ENST00000243300.9	+	28	4923	c.4620G>A	c.(4618-4620)aaG>aaA	p.K1540K	NRK_ENST00000428173.2_Silent_p.K1541K|NRK_ENST00000540278.1_Silent_p.K121K	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1540	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						GGTCAATTAAGAAGCTGAGAT	0.468										HNSCC(51;0.14)																											p.K1540K		Atlas-SNP	.											.	NRK	321	.	0			c.G4620A						.						48.0	47.0	48.0					X																	105197132		1878	4104	5982	SO:0001819	synonymous_variant	203447	exon28			AATTAAGAAGCTG	BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.4620G>A	chrX.hg19:g.105197132G>A		254.0	0.0		309.0	51.0	NM_198465	Q32ND6|Q5H9K2|Q6ZMP2	Silent	SNP	ENST00000243300.9	hg19																																																																																				.	.		0.468	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000106480.6	NM_198465	
COL4A5	1287	hgsc.bcm.edu	37	X	107863658	107863658	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chrX:107863658T>C	ENST00000361603.2	+	31	2921		c.e31+2		COL4A5_ENST00000328300.6_Splice_Site	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GATTTCCAGGTAATTTGTTTA	0.443									Alport syndrome with Diffuse Leiomyomatosis																												.		Atlas-SNP	.											.	COL4A5	262	.	0			c.2677+2T>C						.						25.0	25.0	25.0					X																	107863658		2203	4298	6501	SO:0001630	splice_region_variant	1287	exon31	Familial Cancer Database		TCCAGGTAATTTG	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.2677+2T>C	chrX.hg19:g.107863658T>C		121.0	0.0		175.0	21.0	NM_033380	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Splice_Site	SNP	ENST00000361603.2	hg19	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.577454	0.86645	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6831	0.77388	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL4A5	107750314	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.596000	0.74113	2.088000	0.63022	0.486000	0.48141	.	.	.		0.443	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		Intron
DDX26B	203522	hgsc.bcm.edu	37	X	134711160	134711160	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chrX:134711160C>A	ENST00000370752.4	+	14	2150	c.1816C>A	c.(1816-1818)Caa>Aaa	p.Q606K	DDX26B_ENST00000481908.1_3'UTR	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	606										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					AGCAGGGCCACAAAACAAAGT	0.403																																					p.Q606K		Atlas-SNP	.											.	DDX26B	130	.	0			c.C1816A						.						211.0	187.0	195.0					X																	134711160		2203	4300	6503	SO:0001583	missense	203522	exon14			GGGCCACAAAACA	AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.1816C>A	chrX.hg19:g.134711160C>A	ENSP00000359788:p.Gln606Lys	168.0	0.0		259.0	42.0	NM_182540	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	ENST00000370752.4	hg19	CCDS35401.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356585	0.82243	.	.	ENSG00000165359	ENST00000370752	T	0.36878	1.23	5.2	5.2	0.72013	.	0.104565	0.64402	D	0.000003	T	0.37461	0.1004	M	0.75447	2.3	0.53688	D	0.999974	B;P	0.38048	0.346;0.616	B;B	0.35278	0.118;0.199	T	0.33059	-0.9883	10	0.08837	T	0.75	-6.7628	17.0269	0.86450	0.0:1.0:0.0:0.0	.	606;606	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	K	606	ENSP00000359788:Q606K	ENSP00000359788:Q606K	Q	+	1	0	DDX26B	134538826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.035000	0.70940	2.316000	0.78162	0.600000	0.82982	CAA	.	.		0.403	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058420.1	NM_182540	
FATE1	89885	hgsc.bcm.edu	37	X	150891213	150891213	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chrX:150891213G>A	ENST00000370350.3	+	5	619	c.534G>A	c.(532-534)tgG>tgA	p.W178*		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	178						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CCAACCTGTGGCTGTGGATGA	0.657																																					p.W178X		Atlas-SNP	.											.	FATE1	30	.	0			c.G534A						.						50.0	51.0	51.0					X																	150891213		2203	4300	6503	SO:0001587	stop_gained	89885	exon5			CCTGTGGCTGTGG	AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.534G>A	chrX.hg19:g.150891213G>A	ENSP00000359375:p.Trp178*	160.0	0.0		274.0	104.0	NM_033085		Nonsense_Mutation	SNP	ENST00000370350.3	hg19	CCDS14700.1	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518970	0.44866	.	.	ENSG00000147378	ENST00000370350	.	.	.	4.39	4.39	0.52855	.	0.000000	0.42053	D	0.000768	.	.	.	.	.	.	0.37504	D	0.91686	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.5415	11.3766	0.49733	0.0:0.0:1.0:0.0	.	.	.	.	X	178	.	ENSP00000359375:W178X	W	+	3	0	FATE1	150641869	1.000000	0.71417	1.000000	0.80357	0.285000	0.27093	4.082000	0.57635	2.161000	0.67846	0.600000	0.82982	TGG	.	.		0.657	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060885.1	NM_033085	
LAMB1	3912	hgsc.bcm.edu	37	7	107603404	107603404	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr7:107603404delA	ENST00000222399.6	-	15	2033	c.1803delT	c.(1801-1803)attfs	p.I601fs	LAMB1_ENST00000393560.1_Frame_Shift_Del_p.I601fs|LAMB1_ENST00000393561.1_Frame_Shift_Del_p.I625fs	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	601	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						GTATGTTGTCAATGAAAAACT	0.507																																					p.D602fs		Atlas-INDEL	.											.	LAMB1	185	.	0			c.1804delG						.						114.0	113.0	113.0					7																	107603404		2203	4300	6503	SO:0001589	frameshift_variant	3912	exon15			.	M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.1803delT	chr7.hg19:g.107603404delA	ENSP00000222399:p.Ile601fs	63.0	0.0		76.0	21.0	NM_002291	Q14D91	Frame_Shift_Del	DEL	ENST00000222399.6	hg19	CCDS5750.1																																																																																			.	.		0.507	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314584.1	NM_002291	
CD1E	913	hgsc.bcm.edu	37	1	158325883	158325889	+	Frame_Shift_Del	DEL	ATCATCC	ATCATCC	-			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	ATCATCC	ATCATCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:158325883_158325889delATCATCC	ENST00000368167.3	+	4	1131_1137	c.892_898delATCATCC	c.(892-900)atcatccatfs	p.IIH298fs	CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000434258.1_Frame_Shift_Del_p.IIH296fs|CD1E_ENST00000444681.2_Frame_Shift_Del_p.IIH199fs|CD1E_ENST00000368161.3_Intron|CD1E_ENST00000368156.1_Frame_Shift_Del_p.IIH208fs|CD1E_ENST00000368165.3_Frame_Shift_Del_p.IIH208fs|CD1E_ENST00000452291.2_Frame_Shift_Del_p.IIH109fs|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368166.3_Frame_Shift_Del_p.IIH109fs|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368163.3_Intron|CD1E_ENST00000368160.3_Frame_Shift_Del_p.IIH298fs	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	298	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					CCATGATCTAATCATCCATTGGGGTGA	0.551																																					p.297_299del		Atlas-INDEL	.											.	CD1E	129	.	0			c.891_897del						.																																			SO:0001589	frameshift_variant	913	exon4			.	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.892_898delATCATCC	chr1.hg19:g.158325883_158325889delATCATCC	ENSP00000357149:p.Ile298fs	54.0	0.0		108.0	14.0	NM_030893	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Frame_Shift_Del	DEL	ENST00000368167.3	hg19	CCDS41417.1																																																																																			.	.		0.551	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	
CD1E	913	hgsc.bcm.edu	37	1	158325895	158325896	+	Splice_Site	INS	-	-	T			TCGA-DD-AADI-01A-11D-A40R-10	TCGA-DD-AADI-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	dba0ae12-2411-4434-99df-3c0ffe50d5b8	0c54a21e-f61a-458f-971c-33e10b96eec4	g.chr1:158325895_158325896insT	ENST00000368167.3	+	4	1143	c.904_904insT	c.(904-906)ggt>Tggt	p.G302fs	CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000434258.1_Frame_Shift_Ins_p.G300fs|CD1E_ENST00000444681.2_Splice_Site_p.G203fs|CD1E_ENST00000368161.3_Intron|CD1E_ENST00000368156.1_Splice_Site_p.G212fs|CD1E_ENST00000368165.3_Splice_Site_p.G212fs|CD1E_ENST00000452291.2_Splice_Site_p.G113fs|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368166.3_Splice_Site_p.G113fs|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368163.3_Intron|CD1E_ENST00000368160.3_Splice_Site_p.G302fs	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	302					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					CATCCATTGGGGTGAGAAACAG	0.55																																					p.G302fs		Atlas-INDEL	.											.	CD1E	129	.	0			c.904_905insT						.																																			SO:0001630	splice_region_variant	913	exon4			.	AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.904+1->T	chr1.hg19:g.158325895_158325896insT		48.0	0.0		103.0	17.0	NM_030893	B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Frame_Shift_Ins	INS	ENST00000368167.3	hg19	CCDS41417.1																																																																																			.	.		0.550	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046353.3	NM_030893	Frame_Shift_Ins
