#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	hgsc.bcm.edu	37	1	11184573	11184573	+	Missense_Mutation	SNP	G	G	T	rs587777894		TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:11184573G>T	ENST00000361445.4	-	47	6720	c.6644C>A	c.(6643-6645)tCt>tAt	p.S2215Y	MTOR_ENST00000376838.1_Missense_Mutation_p.S420Y	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2215	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		S -> Y (in a colorectal adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.S2215Y(4)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TTTCCGAAGAGATGTTGGGTC	0.438																																					p.S2215Y		Atlas-SNP	.											MTOR,NS,malignant_melanoma,0,5	MTOR	327	.	4	Substitution - Missense(4)	large_intestine(2)|kidney(1)|endometrium(1)	c.C6644A						.						101.0	98.0	99.0					1																	11184573		2203	4300	6503	SO:0001583	missense	2475	exon47			CGAAGAGATGTTG	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.6644C>A	chr1.hg19:g.11184573G>T	ENSP00000354558:p.Ser2215Tyr	124.0	0.0		111.0	16.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	hg19	CCDS127.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.903707	0.92035	.	.	ENSG00000198793	ENST00000361445;ENST00000376838	T;T	0.78364	-1.17;-1.17	5.8	5.8	0.92144	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.88862	0.6552	M	0.86651	2.83	0.80722	D	1	D	0.58970	0.984	P	0.60541	0.876	D	0.90182	0.4243	10	0.87932	D	0	-14.2436	18.2956	0.90145	0.0:0.0:1.0:0.0	.	2215	P42345	MTOR_HUMAN	Y	2215;420	ENSP00000354558:S2215Y;ENSP00000366034:S420Y	ENSP00000354558:S2215Y	S	-	2	0	MTOR	11107160	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.362000	0.97126	2.761000	0.94854	0.650000	0.86243	TCT	.	.		0.438	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
RIMKLA	284716	hgsc.bcm.edu	37	1	42865094	42865094	+	Silent	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:42865094G>A	ENST00000431473.3	+	2	312	c.183G>A	c.(181-183)aaG>aaA	p.K61K		NM_173642.3	NP_775913.2	Q8IXN7	RIMKA_HUMAN	ribosomal modification protein rimK-like family member A	61					cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			NS(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TAAACCAGAAGGCCCTCACCA	0.532																																					p.K61K		Atlas-SNP	.											.	RIMKLA	32	.	0			c.G183A						.						47.0	38.0	41.0					1																	42865094		2203	4300	6503	SO:0001819	synonymous_variant	284716	exon2			CCAGAAGGCCCTC	BC039737	CCDS466.2	1p34.2	2011-09-21	2008-10-13	2008-10-13	ENSG00000177181	ENSG00000177181	6.3.2.N6		28725	protein-coding gene	gene with protein product	"""N-acetylaspartylglutamate synthetase II"""		"""family with sequence similarity 80, member A"""	FAM80A		20657015, 21454531	Standard	NM_173642		Approved	MGC47816, RP11-157D18.1, NAAGS-II	uc001chi.2	Q8IXN7	OTTHUMG00000007335	ENST00000431473.3:c.183G>A	chr1.hg19:g.42865094G>A		50.0	0.0		48.0	8.0	NM_173642	Q5VUS5	Silent	SNP	ENST00000431473.3	hg19	CCDS466.2																																																																																			.	.		0.532	RIMKLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019174.3	NM_173642	
COL11A1	1301	hgsc.bcm.edu	37	1	103471625	103471625	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:103471625T>C	ENST00000370096.3	-	17	2102	c.1790A>G	c.(1789-1791)aAg>aGg	p.K597R	COL11A1_ENST00000358392.2_Splice_Site_p.K609R|COL11A1_ENST00000353414.4_Splice_Site_p.K558R|COL11A1_ENST00000512756.1_Splice_Site_p.K481R|COL11A1_ENST00000461720.1_5'UTR	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	597	Collagen-like 3.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCTCCTGACCTTTGCCCCAGG	0.393																																					p.K609R		Atlas-SNP	.											.	COL11A1	972	.	0			c.A1826G						.						61.0	60.0	60.0					1																	103471625		2203	4300	6503	SO:0001630	splice_region_variant	1301	exon17			CTGACCTTTGCCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1791+1A>G	chr1.hg19:g.103471625T>C		197.0	0.0		253.0	45.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.087513	0.76642	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.95588	-3.17;-3.17;-3.17;-3.75	6.06	6.06	0.98353	.	0.050491	0.85682	D	0.000000	D	0.92437	0.7599	L	0.29908	0.895	0.80722	D	1	P;P;P;P	0.47253	0.892;0.868;0.868;0.892	P;B;B;P	0.48488	0.579;0.443;0.443;0.579	D	0.93761	0.7067	10	0.62326	D	0.03	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	481;558;609;597	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	R	597;609;558;481	ENSP00000359114:K597R;ENSP00000351163:K609R;ENSP00000302551:K558R;ENSP00000426533:K481R	ENSP00000302551:K558R	K	-	2	0	COL11A1	103244213	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	7.571000	0.82399	2.324000	0.78689	0.533000	0.62120	AAG	.	.		0.393	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Missense_Mutation
VANGL1	81839	hgsc.bcm.edu	37	1	116194093	116194093	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:116194093C>A	ENST00000355485.2	+	2	330	c.59C>A	c.(58-60)tCt>tAt	p.S20Y	VANGL1_ENST00000369509.1_Missense_Mutation_p.S20Y|VANGL1_ENST00000369510.4_Missense_Mutation_p.S20Y|VANGL1_ENST00000310260.3_Missense_Mutation_p.S20Y	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	20					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		TCGAAAAAATCTCACAGACAA	0.418																																					p.S20Y		Atlas-SNP	.											.	VANGL1	65	.	0			c.C59A						.						94.0	84.0	87.0					1																	116194093		2203	4300	6503	SO:0001583	missense	81839	exon2			AAAAATCTCACAG	AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.59C>A	chr1.hg19:g.116194093C>A	ENSP00000347672:p.Ser20Tyr	49.0	0.0		45.0	13.0	NM_001172411	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	ENST00000355485.2	hg19	CCDS883.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850129	0.71719	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.81821	-1.53;-1.54;-1.53;-1.53	4.92	4.92	0.64577	.	0.058434	0.64402	D	0.000001	T	0.81730	0.4884	L	0.61218	1.895	0.45035	D	0.998053	P;P	0.49559	0.925;0.877	P;P	0.54100	0.742;0.557	D	0.83925	0.0303	10	0.66056	D	0.02	-7.9245	15.1536	0.72723	0.0:1.0:0.0:0.0	.	20;20	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	Y	20	ENSP00000347672:S20Y;ENSP00000358523:S20Y;ENSP00000310800:S20Y;ENSP00000358522:S20Y	ENSP00000310800:S20Y	S	+	2	0	VANGL1	115995616	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.942000	0.63547	2.521000	0.84997	0.655000	0.94253	TCT	.	.		0.418	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000033096.1		
SEMA6C	10500	hgsc.bcm.edu	37	1	151105786	151105786	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:151105786C>T	ENST00000341697.3	-	19	3658	c.1967G>A	c.(1966-1968)cGg>cAg	p.R656Q	RP11-68I18.10_ENST00000563624.1_RNA|SEMA6C_ENST00000479820.1_5'Flank			Q9H3T2	SEM6C_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C	656					axon guidance (GO:0007411)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	28	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCGTGGAGCCGGGCCAAACT	0.736																																					p.R688Q		Atlas-SNP	.											.	SEMA6C	70	.	0			c.G2063A						.						8.0	12.0	11.0					1																	151105786		2143	4192	6335	SO:0001583	missense	10500	exon20			TGGAGCCGGGCCA	AF339154	CCDS984.1, CCDS53363.1, CCDS53364.1	1q21.2	2008-02-05			ENSG00000143434	ENSG00000143434		"""Semaphorins"""	10740	protein-coding gene	gene with protein product	"""m-Sema Y2"""	609294				12110693	Standard	NM_030913		Approved	KIAA1869	uc001ewv.3	Q9H3T2	OTTHUMG00000012261	ENST00000341697.3:c.1967G>A	chr1.hg19:g.151105786C>T	ENSP00000344148:p.Arg656Gln	101.0	0.0		176.0	30.0	NM_001178061	D3DV15|Q5JR71|Q5JR72|Q5JR73|Q8WXT8|Q8WXT9|Q8WXU0|Q96JF8	Missense_Mutation	SNP	ENST00000341697.3	hg19	CCDS984.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148583	0.78001	.	.	ENSG00000143434	ENST00000368914;ENST00000368912;ENST00000368913;ENST00000341697	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	3.89	3.89	0.44902	.	761.094000	0.00166	N	0.000000	T	0.65026	0.2652	L	0.39898	1.24	0.28729	N	0.902586	D;D;D	0.76494	0.999;0.996;0.998	D;P;D	0.71870	0.975;0.883;0.945	T	0.51426	-0.8707	10	0.54805	T	0.06	.	7.2776	0.26294	0.0:0.8813:0.0:0.1187	.	648;688;656	Q9H3T2-2;Q9H3T2-3;Q9H3T2	.;.;SEM6C_HUMAN	Q	656;648;688;656	ENSP00000357910:R656Q;ENSP00000357908:R648Q;ENSP00000357909:R688Q;ENSP00000344148:R656Q	ENSP00000344148:R656Q	R	-	2	0	SEMA6C	149372410	1.000000	0.71417	0.996000	0.52242	0.944000	0.59088	2.180000	0.42537	1.999000	0.58509	0.561000	0.74099	CGG	.	.		0.736	SEMA6C-004	KNOWN	alternative_5_UTR|mRNA_start_NF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000034074.1	NM_030913	
PI4KB	5298	hgsc.bcm.edu	37	1	151262451	151262451	+	IGR	SNP	T	T	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:151262451T>A	ENST00000368873.1	-	0	3340				ZNF687_ENST00000368879.2_Missense_Mutation_p.Y978N			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GCGTGATGAATACGTGGCCCA	0.637																																					p.Y978N	Colon(154;765 1838 9854 28443 37492)	Atlas-SNP	.											.	ZNF687	94	.	0			c.T2932A						.						19.0	18.0	18.0					1																	151262451		2198	4295	6493	SO:0001628	intergenic_variant	57592	exon6			GATGAATACGTGG	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348		chr1.hg19:g.151262451T>A		49.0	0.0		66.0	11.0	NM_020832	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.05|15.05	2.716944|2.716944	0.48622|0.48622	.|.	.|.	ENSG00000143373|ENSG00000143373	ENST00000426871|ENST00000336715;ENST00000324048;ENST00000368879	.|T;T;T	.|0.76968	.|-1.06;-1.06;-1.06	5.25|5.25	4.12|4.12	0.48240|0.48240	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	.|0.000000	.|0.32301	.|N	.|0.006298	T|T	0.78207|0.78207	0.4247|0.4247	M|M	0.68317|0.68317	2.08|2.08	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.57899	.|0.976;0.981	.|P;P	.|0.59357	.|0.853;0.856	T|T	0.80837|0.80837	-0.1204|-0.1204	5|10	.|0.87932	.|D	.|0	.|.	9.7566|9.7566	0.40506|0.40506	0.1545:0.0:0.0:0.8455|0.1545:0.0:0.0:0.8455	.|.	.|978;978	.|Q8N1G0-2;Q8N1G0	.|.;ZN687_HUMAN	K|N	580|978	.|ENSP00000336620:Y978N;ENSP00000319829:Y978N;ENSP00000357874:Y978N	.|ENSP00000319829:Y978N	N|Y	+|+	3|1	2|0	ZNF687|ZNF687	149529075|149529075	1.000000|1.000000	0.71417|0.71417	0.411000|0.411000	0.26484|0.26484	0.314000|0.314000	0.28054|0.28054	5.998000|5.998000	0.70653|0.70653	1.003000|1.003000	0.39130|0.39130	0.260000|0.260000	0.18958|0.18958	AAT|TAC	.	.		0.637	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
CRTC2	200186	hgsc.bcm.edu	37	1	153924613	153924613	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:153924613G>A	ENST00000368633.1	-	10	1005	c.878C>T	c.(877-879)cCt>cTt	p.P293L	CRTC2_ENST00000476883.1_5'Flank|CRTC2_ENST00000368630.3_Intron	NM_181715.2	NP_859066.1	Q53ET0	CRTC2_HUMAN	CREB regulated transcription coactivator 2	293					gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|histone H3-K9 acetylation (GO:0043970)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)			NS(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	27	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TGTCTCTTCAGGGTCCAGGGG	0.632																																					p.P293L		Atlas-SNP	.											.	CRTC2	58	.	0			c.C878T						.						72.0	75.0	74.0					1																	153924613		2203	4299	6502	SO:0001583	missense	200186	exon10			TCTTCAGGGTCCA	AY360172	CCDS30875.1	1q21.3	2008-02-05			ENSG00000160741	ENSG00000160741			27301	protein-coding gene	gene with protein product		608972				14506290, 14536081	Standard	NM_181715		Approved	TORC2	uc021pab.1	Q53ET0	OTTHUMG00000037156	ENST00000368633.1:c.878C>T	chr1.hg19:g.153924613G>A	ENSP00000357622:p.Pro293Leu	90.0	0.0		113.0	38.0	NM_181715	Q6UUV8|Q7Z3X7|Q8N332	Missense_Mutation	SNP	ENST00000368633.1	hg19	CCDS30875.1	.	.	.	.	.	.	.	.	.	.	G	17.59	3.426922	0.62733	.	.	ENSG00000160741	ENST00000368633	T	0.48836	0.8	4.05	4.05	0.47172	Transducer of regulated CREB activity, middle domain (1);	0.169992	0.40728	N	0.001025	T	0.57651	0.2068	M	0.72118	2.19	0.47037	D	0.999299	D	0.69078	0.997	D	0.69142	0.962	T	0.62272	-0.6889	10	0.56958	D	0.05	-8.4711	13.7737	0.63039	0.0:0.0:1.0:0.0	.	293	Q53ET0	CRTC2_HUMAN	L	293	ENSP00000357622:P293L	ENSP00000357622:P293L	P	-	2	0	CRTC2	152191237	0.999000	0.42202	1.000000	0.80357	0.976000	0.68499	2.904000	0.48719	2.100000	0.63781	0.450000	0.29827	CCT	.	.		0.632	CRTC2-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090272.3	NM_181715	
DUSP27	92235	hgsc.bcm.edu	37	1	167097157	167097157	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:167097157A>G	ENST00000361200.2	+	6	2955	c.2789A>G	c.(2788-2790)gAg>gGg	p.E930G	DUSP27_ENST00000271385.5_Missense_Mutation_p.E930G|DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000443333.1_Missense_Mutation_p.E930G			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	930	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GTTGGCAAAGAGATGGATAGC	0.493																																					p.E930G		Atlas-SNP	.											.	DUSP27	235	.	0			c.A2789G						.						60.0	54.0	56.0					1																	167097157		2203	4300	6503	SO:0001583	missense	92235	exon5			GCAAAGAGATGGA	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2789A>G	chr1.hg19:g.167097157A>G	ENSP00000354483:p.Glu930Gly	73.0	0.0		111.0	9.0	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	hg19	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.495883	0.44352	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.04706	3.57;3.57;3.57	4.45	3.29	0.37713	.	0.131674	0.34484	N	0.003936	T	0.03695	0.0105	M	0.65975	2.015	0.29884	N	0.825797	D	0.56035	0.974	P	0.45310	0.476	T	0.15178	-1.0446	10	0.87932	D	0	-10.9628	11.0506	0.47884	0.844:0.156:0.0:0.0	.	930	Q5VZP5	DUS27_HUMAN	G	930	ENSP00000354483:E930G;ENSP00000271385:E930G;ENSP00000404874:E930G	ENSP00000271385:E930G	E	+	2	0	DUSP27	165363781	1.000000	0.71417	0.034000	0.17996	0.889000	0.51656	7.793000	0.85851	0.697000	0.31718	0.523000	0.50628	GAG	.	.		0.493	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
CNTN2	6900	hgsc.bcm.edu	37	1	205027173	205027173	+	Silent	SNP	C	C	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:205027173C>T	ENST00000331830.4	+	3	479	c.195C>T	c.(193-195)gcC>gcT	p.A65A		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	65	Ig-like C2-type 1.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCGCCCGGGCCAGCCCTCCAG	0.642																																					p.A65A	Melanoma(183;2548 2817 37099 41192)	Atlas-SNP	.											.	CNTN2	116	.	0			c.C195T						.						20.0	22.0	21.0					1																	205027173		2202	4299	6501	SO:0001819	synonymous_variant	6900	exon3			CCGGGCCAGCCCT	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.195C>T	chr1.hg19:g.205027173C>T		120.0	0.0		173.0	83.0	NM_005076	P78432|Q5T054	Silent	SNP	ENST00000331830.4	hg19	CCDS1449.1																																																																																			.	.		0.642	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
DYRK3	8444	hgsc.bcm.edu	37	1	206821451	206821451	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:206821451A>T	ENST00000367109.2	+	3	1076	c.908A>T	c.(907-909)aAg>aTg	p.K303M	DYRK3_ENST00000367108.3_Missense_Mutation_p.K283M|DYRK3_ENST00000367106.1_Missense_Mutation_p.K283M|DYRK3_ENST00000489878.1_Intron	NM_003582.2	NP_003573.2	O43781	DYRK3_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3	303	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				erythrocyte differentiation (GO:0030218)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(9)|lung(8)|skin(1)|stomach(2)	25	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			AAAAAAAATAAGTTTCAGGGT	0.413																																					p.K303M	Melanoma(164;427 2622 26826 51707)	Atlas-SNP	.											.	DYRK3	146	.	0			c.A908T						.						88.0	94.0	92.0					1																	206821451		2202	4300	6502	SO:0001583	missense	8444	exon3			AAAATAAGTTTCA	Y12735	CCDS30999.1, CCDS31000.1	1q32	2008-07-18			ENSG00000143479	ENSG00000143479	2.7.12.1		3094	protein-coding gene	gene with protein product	"""regulatory erythroid kinase"", ""dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 5"", ""protein kinase Dyrk3"""	603497				9748265	Standard	NM_003582		Approved	RED, REDK, hYAK3-2	uc001hej.3	O43781	OTTHUMG00000036339	ENST00000367109.2:c.908A>T	chr1.hg19:g.206821451A>T	ENSP00000356076:p.Lys303Met	144.0	0.0		210.0	33.0	NM_003582	D3DT79|Q7Z752|Q9HBY6|Q9HBY7	Missense_Mutation	SNP	ENST00000367109.2	hg19	CCDS30999.1	.	.	.	.	.	.	.	.	.	.	A	16.17	3.046677	0.55110	.	.	ENSG00000143479	ENST00000367109;ENST00000367108;ENST00000367106	T;T;T	0.68025	-0.3;-0.3;-0.3	5.21	5.21	0.72293	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80544	0.4643	M	0.73430	2.235	0.80722	D	1	D;D	0.76494	0.993;0.999	D;D	0.71414	0.941;0.973	T	0.82995	-0.0180	10	0.72032	D	0.01	.	14.3994	0.67031	1.0:0.0:0.0:0.0	.	303;283	O43781;O43781-2	DYRK3_HUMAN;.	M	303;283;283	ENSP00000356076:K303M;ENSP00000356075:K283M;ENSP00000356073:K283M	ENSP00000356073:K283M	K	+	2	0	DYRK3	204888074	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.104000	0.94239	2.190000	0.69967	0.391000	0.25812	AAG	.	.		0.413	DYRK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088458.1	NM_003582	
RHOB	388	hgsc.bcm.edu	37	2	20647230	20647230	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr2:20647230G>T	ENST00000272233.4	+	1	396	c.4G>T	c.(4-6)Gcg>Tcg	p.A2S		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	2					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	CCCGCTCATGGCGGCCATCCG	0.711																																					p.A2S		Atlas-SNP	.											.	RHOB	18	.	0			c.G4T						.						22.0	30.0	27.0					2																	20647230		2198	4291	6489	SO:0001583	missense	388	exon1			CTCATGGCGGCCA		CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.4G>T	chr2.hg19:g.20647230G>T	ENSP00000272233:p.Ala2Ser	52.0	0.0		68.0	12.0	NM_004040	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Missense_Mutation	SNP	ENST00000272233.4	hg19	CCDS1699.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.637458	0.87760	.	.	ENSG00000143878	ENST00000272233	T	0.71817	-0.6	5.58	5.58	0.84498	.	0.000000	0.85682	U	0.000000	T	0.59945	0.2231	N	0.16790	0.44	0.80722	D	1	B	0.14438	0.01	B	0.20384	0.029	T	0.53802	-0.8387	10	0.40728	T	0.16	-26.4184	19.561	0.95373	0.0:0.0:1.0:0.0	.	2	P62745	RHOB_HUMAN	S	2	ENSP00000272233:A2S	ENSP00000272233:A2S	A	+	1	0	RHOB	20510711	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.565000	0.98154	2.612000	0.88384	0.643000	0.83706	GCG	.	.		0.711	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207500.1	NM_004040	
CAPN13	92291	hgsc.bcm.edu	37	2	30993223	30993223	+	Silent	SNP	T	T	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr2:30993223T>C	ENST00000295055.8	-	5	656	c.480A>G	c.(478-480)caA>caG	p.Q160Q	CAPN13_ENST00000465960.2_5'UTR|CAPN13_ENST00000534090.2_Silent_p.Q160Q	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	160	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					ACTCTTGGTTTTGGTGGCGAG	0.562																																					p.Q160Q		Atlas-SNP	.											.	CAPN13	70	.	0			c.A480G						.						171.0	182.0	178.0					2																	30993223		2146	4258	6404	SO:0001819	synonymous_variant	92291	exon5			TTGGTTTTGGTGG		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.480A>G	chr2.hg19:g.30993223T>C		125.0	0.0		122.0	23.0	NM_144575	Q17RF0|Q580X1|Q8TE80	Silent	SNP	ENST00000295055.8	hg19	CCDS46252.1																																																																																			.	.		0.562	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
FOXN2	3344	hgsc.bcm.edu	37	2	48602537	48602537	+	Silent	SNP	A	A	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr2:48602537A>C	ENST00000340553.3	+	7	1512	c.1251A>C	c.(1249-1251)ctA>ctC	p.L417L		NM_002158.3	NP_002149.2	P32314	FOXN2_HUMAN	forkhead box N2	417					transcription, DNA-templated (GO:0006351)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TAGGTTCCCTAATAAGTACTG	0.378																																					p.L417L		Atlas-SNP	.											.	FOXN2	39	.	0			c.A1251C						.						31.0	32.0	32.0					2																	48602537		2203	4300	6503	SO:0001819	synonymous_variant	3344	exon7			TTCCCTAATAAGT		CCDS1838.1	2p22-p16	2008-02-05	2006-10-02	2006-10-02	ENSG00000170802	ENSG00000170802		"""Forkhead boxes"""	5281	protein-coding gene	gene with protein product		143089	"""human T-cell leukemia virus enhancer factor"""	HTLF		1639393	Standard	NM_002158		Approved		uc002rwh.1	P32314	OTTHUMG00000129168	ENST00000340553.3:c.1251A>C	chr2.hg19:g.48602537A>C		43.0	0.0		43.0	5.0	NM_002158	Q15769|Q6P4Q2	Silent	SNP	ENST00000340553.3	hg19	CCDS1838.1																																																																																			.	.		0.378	FOXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251240.3	NM_002158	
KIAA1841	84542	hgsc.bcm.edu	37	2	61333780	61333780	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr2:61333780A>G	ENST00000402291.1	+	14	1835	c.1594A>G	c.(1594-1596)Act>Gct	p.T532A	KIAA1841_ENST00000356719.2_Missense_Mutation_p.T532A|KIAA1841_ENST00000453873.1_Missense_Mutation_p.T532A|KIAA1841_ENST00000295031.5_Missense_Mutation_p.T532A	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	532										breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			GGGTCCCAAAACTGGGGAGCT	0.358																																					p.T532A		Atlas-SNP	.											.	KIAA1841	95	.	0			c.A1594G						.						126.0	139.0	135.0					2																	61333780		2203	4300	6503	SO:0001583	missense	84542	exon14			CCCAAAACTGGGG	BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1594A>G	chr2.hg19:g.61333780A>G	ENSP00000385579:p.Thr532Ala	112.0	0.0		98.0	12.0	NM_032506	Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	ENST00000402291.1	hg19	CCDS46296.1	.	.	.	.	.	.	.	.	.	.	A	12.65	2.000409	0.35320	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	.	.	.	5.53	4.38	0.52667	.	0.215850	0.48286	D	0.000183	T	0.49695	0.1572	L	0.60455	1.87	0.37164	D	0.90274	B;B	0.23806	0.091;0.026	B;B	0.26693	0.072;0.022	T	0.46775	-0.9167	9	0.10377	T	0.69	-8.6994	10.5245	0.44941	0.9224:0.0:0.0776:0.0	.	532;532	Q6NSI8-2;Q6NSI8	.;K1841_HUMAN	A	532	.	ENSP00000295031:T532A	T	+	1	0	KIAA1841	61187284	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	3.604000	0.54081	1.032000	0.39892	0.477000	0.44152	ACT	.	.		0.358	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325477.1	NM_032506	
PROM2	150696	hgsc.bcm.edu	37	2	95943741	95943741	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr2:95943741A>G	ENST00000317620.9	+	8	1172	c.1039A>G	c.(1039-1041)Atg>Gtg	p.M347V	PROM2_ENST00000463580.1_3'UTR|PROM2_ENST00000542147.1_Missense_Mutation_p.M347V|PROM2_ENST00000317668.4_Missense_Mutation_p.M347V|PROM2_ENST00000403131.2_Missense_Mutation_p.M347V	NM_001165978.1	NP_001159450.1	Q8N271	PROM2_HUMAN	prominin 2	347					negative regulation of caveolin-mediated endocytosis (GO:2001287)|negative regulation of pinocytosis (GO:0048550)|positive regulation of cell projection organization (GO:0031346)|positive regulation of protein phosphorylation (GO:0001934)|regulation of Cdc42 GTPase activity (GO:0043088)	cell projection (GO:0042995)|cell surface (GO:0009986)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|microspike (GO:0044393)|microvillus (GO:0005902)|prominosome (GO:0071914)	cholesterol binding (GO:0015485)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	32						CTTCTCCAGCATGGTCCAGGA	0.567																																					p.M347V		Atlas-SNP	.											.	PROM2	78	.	0			c.A1039G						.						76.0	59.0	65.0					2																	95943741		2203	4300	6503	SO:0001583	missense	150696	exon8			TCCAGCATGGTCC	AF245303	CCDS2012.1	2q11.1	2008-02-05			ENSG00000155066	ENSG00000155066			20685	protein-coding gene	gene with protein product						12514187	Standard	NM_001165978		Approved		uc002sui.3	Q8N271	OTTHUMG00000130393	ENST00000317620.9:c.1039A>G	chr2.hg19:g.95943741A>G	ENSP00000318270:p.Met347Val	57.0	0.0		49.0	13.0	NM_001165977	A8K2V1|Q2HIX6|Q8NB84|Q8TAE2	Missense_Mutation	SNP	ENST00000317620.9	hg19	CCDS2012.1	.	.	.	.	.	.	.	.	.	.	A	13.96	2.392854	0.42410	.	.	ENSG00000155066	ENST00000403131;ENST00000317668;ENST00000317620;ENST00000542147	T;T;T;T	0.38722	1.12;1.12;1.12;1.12	5.17	5.17	0.71159	.	0.249960	0.35525	N	0.003143	T	0.40743	0.1129	M	0.73962	2.25	0.36350	D	0.860036	B	0.17038	0.02	B	0.15870	0.014	T	0.43686	-0.9376	10	0.13853	T	0.58	-40.5868	11.3368	0.49509	1.0:0.0:0.0:0.0	.	347	Q8N271	PROM2_HUMAN	V	347	ENSP00000385716:M347V;ENSP00000318520:M347V;ENSP00000318270:M347V;ENSP00000442542:M347V	ENSP00000318270:M347V	M	+	1	0	PROM2	95307468	0.996000	0.38824	1.000000	0.80357	0.965000	0.64279	4.357000	0.59436	2.183000	0.69458	0.533000	0.62120	ATG	.	.		0.567	PROM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252771.1	NM_144707	
SETD2	29072	hgsc.bcm.edu	37	3	47155365	47155365	+	Splice_Site	SNP	C	C	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr3:47155365C>T	ENST00000409792.3	-	5	4758		c.e5+1			NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2						angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		AAAGAACTTACGAAGGAAGGT	0.453			"""N, F, S, Mis"""		clear cell renal carcinoma																																.		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.4715+1G>A						.						106.0	107.0	106.0					3																	47155365		2203	4300	6503	SO:0001630	splice_region_variant	29072	exon6			AACTTACGAAGGA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4715+1G>A	chr3.hg19:g.47155365C>T		96.0	0.0		84.0	23.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Splice_Site	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.377351	0.82682	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.8075	0.88606	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SETD2	47130369	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.256000	0.78350	2.518000	0.84900	0.585000	0.79938	.	.	.		0.453	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	Intron
PIK3CB	5291	hgsc.bcm.edu	37	3	138478043	138478043	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr3:138478043C>A	ENST00000477593.1	-	2	216	c.143G>T	c.(142-144)cGg>cTg	p.R48L	PIK3CB_ENST00000289153.2_Missense_Mutation_p.R48L			P42338	PK3CB_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit beta	48	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|embryonic cleavage (GO:0040016)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of autophagy (GO:0010508)|regulation of cell-matrix adhesion (GO:0001952)|regulation of clathrin-mediated endocytosis (GO:2000369)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			NS(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	41					Caffeine(DB00201)	GGTAGCTTCCCGAGGTACCTC	0.408																																					p.R48L		Atlas-SNP	.											.	PIK3CB	103	.	0			c.G143T						.						61.0	59.0	60.0					3																	138478043		2203	4300	6503	SO:0001583	missense	5291	exon1			GCTTCCCGAGGTA		CCDS3104.1	3q22.3	2013-09-19	2012-07-13		ENSG00000051382	ENSG00000051382	2.7.1.153		8976	protein-coding gene	gene with protein product		602925	"""phosphoinositide-3-kinase, catalytic, beta polypeptide"""	PIK3C1		8246984	Standard	NM_006219		Approved		uc011bmq.3	P42338	OTTHUMG00000159893	ENST00000477593.1:c.143G>T	chr3.hg19:g.138478043C>A	ENSP00000418143:p.Arg48Leu	336.0	0.0		382.0	81.0	NM_006219	D3DNF0|Q24JU2	Missense_Mutation	SNP	ENST00000477593.1	hg19	CCDS3104.1	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321471	0.81580	.	.	ENSG00000051382	ENST00000477593;ENST00000289153;ENST00000483968;ENST00000461451;ENST00000465581	T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61	5.84	5.84	0.93424	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	T	0.73418	0.3584	M	0.73962	2.25	0.80722	D	1	B	0.29646	0.253	B	0.35278	0.199	T	0.68891	-0.5289	10	0.10636	T	0.68	-15.982	20.1551	0.98106	0.0:1.0:0.0:0.0	.	48	P42338	PK3CB_HUMAN	L	48	ENSP00000418143:R48L;ENSP00000289153:R48L;ENSP00000419857:R48L;ENSP00000420399:R48L	ENSP00000289153:R48L	R	-	2	0	PIK3CB	139960733	1.000000	0.71417	1.000000	0.80357	0.807000	0.45602	5.691000	0.68249	2.760000	0.94817	0.655000	0.94253	CGG	.	.		0.408	PIK3CB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358019.1		
MECOM	2122	hgsc.bcm.edu	37	3	168806945	168806945	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr3:168806945C>G	ENST00000464456.1	-	14	4037	c.2837G>C	c.(2836-2838)gGa>gCa	p.G946A	MECOM_ENST00000264674.3_Missense_Mutation_p.G1020A|MECOM_ENST00000460814.1_Missense_Mutation_p.G946A|MECOM_ENST00000392736.3_Missense_Mutation_p.G955A|MECOM_ENST00000494292.1_Missense_Mutation_p.G1134A|MECOM_ENST00000472280.1_Missense_Mutation_p.G956A|MECOM_ENST00000468789.1_Missense_Mutation_p.G955A|MECOM_ENST00000433243.2_Missense_Mutation_p.G956A	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G955E(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						AGCAGAAAGTCCACTTTTATA	0.313																																					p.G1143A		Atlas-SNP	.											MECOM,mouth,carcinoma,0,1	MECOM	216	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G3428C						.						85.0	84.0	84.0					3																	168806945		2203	4300	6503	SO:0001583	missense	2122	exon16			GAAAGTCCACTTT	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2837G>C	chr3.hg19:g.168806945C>G	ENSP00000419770:p.Gly946Ala	74.0	0.0		66.0	3.0	NM_004991	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	hg19	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	C	17.83	3.486314	0.63962	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.05925	3.43;3.42;3.39;3.53;3.37;3.42;3.39;3.53	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000010	T	0.11793	0.0287	L	0.52573	1.65	0.46241	D	0.998949	P;B;P;B;B	0.43287	0.802;0.4;0.702;0.4;0.451	B;B;B;B;B	0.42495	0.389;0.173;0.217;0.173;0.137	T	0.00527	-1.1688	10	0.87932	D	0	-12.6946	20.0572	0.97657	0.0:1.0:0.0:0.0	.	1143;947;1134;1020;955	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	A	1020;955;946;956;1134;955;946;956	ENSP00000264674:G1020A;ENSP00000376493:G955A;ENSP00000419770:G946A;ENSP00000420048:G956A;ENSP00000417899:G1134A;ENSP00000419995:G955A;ENSP00000420466:G946A;ENSP00000394302:G956A	ENSP00000264674:G1020A	G	-	2	0	MECOM	170289639	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	6.786000	0.75094	2.826000	0.97356	0.655000	0.94253	GGA	.	.		0.313	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
KIAA0226	9711	hgsc.bcm.edu	37	3	197431443	197431443	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr3:197431443C>T	ENST00000296343.5	-	4	432	c.433G>A	c.(433-435)Gat>Aat	p.D145N	KIAA0226_ENST00000389665.5_Missense_Mutation_p.D145N|KIAA0226_ENST00000273582.5_Missense_Mutation_p.D85N|KIAA0226_ENST00000467303.1_5'UTR|KIAA0226_ENST00000449205.1_Missense_Mutation_p.D145N	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	145	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TACTGTCTATCCCCGAGCAGG	0.567																																					p.D145N	Esophageal Squamous(3;167 355 3763 15924)	Atlas-SNP	.											.	KIAA0226	136	.	0			c.G433A						.						75.0	82.0	80.0					3																	197431443		1987	4156	6143	SO:0001583	missense	9711	exon4			GTCTATCCCCGAG	D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.433G>A	chr3.hg19:g.197431443C>T	ENSP00000296343:p.Asp145Asn	139.0	0.0		144.0	22.0	NM_014687	Q96CK5	Missense_Mutation	SNP	ENST00000296343.5	hg19	CCDS43195.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.02|16.02	3.005684|3.005684	0.54254|0.54254	.|.	.|.	ENSG00000145016|ENSG00000145016	ENST00000273582;ENST00000296343;ENST00000389665;ENST00000449205|ENST00000413360	T;T;T;T|T	0.11063|0.26373	2.81;2.81;2.81;2.81|1.74	6.06|6.06	6.06|6.06	0.98353|0.98353	RUN (3);|.	0.123546|.	0.53938|.	D|.	0.000042|.	T|T	0.17195|0.17195	0.0413|0.0413	N|N	0.19112|0.19112	0.55|0.55	0.33049|0.33049	D|D	0.532519|0.532519	B;B;B|.	0.26577|.	0.153;0.007;0.015|.	B;B;B|.	0.23275|.	0.045;0.006;0.01|.	T|T	0.18618|0.18618	-1.0331|-1.0331	10|7	0.21540|0.13108	T|T	0.41|0.6	.|.	7.9773|7.9773	0.30161|0.30161	0.0:0.8156:0.0:0.1844|0.0:0.8156:0.0:0.1844	.|.	145;85;145|.	E9PEM3;Q92622-2;Q92622|.	.;.;RUBIC_HUMAN|.	N|E	85;145;145;145|123	ENSP00000273582:D85N;ENSP00000296343:D145N;ENSP00000374316:D145N;ENSP00000390962:D145N|ENSP00000405115:G123E	ENSP00000273582:D85N|ENSP00000405115:G123E	D|G	-|-	1|2	0|0	KIAA0226|KIAA0226	198915840|198915840	1.000000|1.000000	0.71417|0.71417	0.900000|0.900000	0.35374|0.35374	0.985000|0.985000	0.73830|0.73830	4.056000|4.056000	0.57448|0.57448	2.885000|2.885000	0.99019|0.99019	0.643000|0.643000	0.83706|0.83706	GAT|GGA	.	.		0.567	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000340184.1	XM_032901	
HNRNPD	3184	hgsc.bcm.edu	37	4	83294718	83294718	+	Silent	SNP	C	C	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr4:83294718C>T	ENST00000313899.7	-	1	391	c.114G>A	c.(112-114)gcG>gcA	p.A38A	RP11-127B20.3_ENST00000609552.1_RNA|HNRNPD_ENST00000541060.1_5'UTR|HNRNPD_ENST00000543098.1_Intron|HNRNPD_ENST00000352301.4_Silent_p.A38A|HNRNPD_ENST00000353341.4_Silent_p.A38A|RP11-127B20.3_ENST00000609575.1_RNA	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	38	Ala-rich.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						ccgccgccgccgctgccccct	0.771																																					p.A38A		Atlas-SNP	.											.	HNRNPD	23	.	0			c.G114A						.						6.0	5.0	5.0					4																	83294718		1776	3334	5110	SO:0001819	synonymous_variant	3184	exon1			CGCCGCCGCTGCC	AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.114G>A	chr4.hg19:g.83294718C>T		46.0	0.0		48.0	4.0	NM_031370	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Silent	SNP	ENST00000313899.7	hg19	CCDS3592.1																																																																																			.	.		0.771	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252630.2	NM_031370	
GPR98	84059	hgsc.bcm.edu	37	5	90106600	90106600	+	Missense_Mutation	SNP	G	G	A	rs535921202		TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr5:90106600G>A	ENST00000405460.2	+	74	15619	c.15523G>A	c.(15523-15525)Gtg>Atg	p.V5175M	GPR98_ENST00000425867.2_Missense_Mutation_p.V836M	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	5175					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GCCAACCAACGTGGTTGCCAT	0.498													G|||	1	0.000199681	0.0	0.0	5008	,	,		20381	0.001		0.0	False		,,,				2504	0.0				p.V5175M		Atlas-SNP	.											.	GPR98	605	.	0			c.G15523A						.						161.0	157.0	158.0					5																	90106600		2052	4205	6257	SO:0001583	missense	84059	exon74			ACCAACGTGGTTG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.15523G>A	chr5.hg19:g.90106600G>A	ENSP00000384582:p.Val5175Met	71.0	0.0		45.0	6.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	G	0.252	-1.005673	0.02112	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.29655	1.63;1.56	4.91	-1.7	0.08159	.	0.779388	0.11889	N	0.519773	T	0.18467	0.0443	L	0.36672	1.1	0.09310	N	1	B;B;B	0.12013	0.003;0.001;0.005	B;B;B	0.09377	0.002;0.001;0.004	T	0.24693	-1.0153	9	.	.	.	.	5.3672	0.16121	0.3691:0.1788:0.4521:0.0	.	836;5175;836	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	M	5175;5175;836	ENSP00000384582:V5175M;ENSP00000392618:V836M	.	V	+	1	0	GPR98	90142356	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	0.181000	0.16880	-0.224000	0.09928	-0.471000	0.05019	GTG	.	.		0.498	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
HIST1H1C	3006	hgsc.bcm.edu	37	6	26056141	26056141	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr6:26056141C>G	ENST00000343677.2	-	1	558	c.516G>C	c.(514-516)aaG>aaC	p.K172N		NM_005319.3	NP_005310.1	P16403	H12_HUMAN	histone cluster 1, H1c	172					nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	nuclear euchromatin (GO:0005719)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	34						TCTTTGGGCTCTTAGCCACTT	0.562																																					p.K172N		Atlas-SNP	.											.	HIST1H1C	80	.	0			c.G516C						.						98.0	110.0	106.0					6																	26056141		2203	4300	6503	SO:0001583	missense	3006	exon1			TGGGCTCTTAGCC	X57129	CCDS4577.1	6p21.3	2012-10-02	2006-10-11	2003-02-21	ENSG00000187837	ENSG00000187837		"""Histones / Replication-dependent"""	4716	protein-coding gene	gene with protein product		142710	"""H1 histone family, member 2"", ""histone 1, H1c"""	H1F2		2759094, 12408966	Standard	NM_005319		Approved	H1.2, H1s-1, H1c	uc003nfw.3	P16403	OTTHUMG00000016140	ENST00000343677.2:c.516G>C	chr6.hg19:g.26056141C>G	ENSP00000339566:p.Lys172Asn	88.0	0.0		98.0	19.0	NM_005319	A8K4I2	Missense_Mutation	SNP	ENST00000343677.2	hg19	CCDS4577.1	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535886	0.27475	.	.	ENSG00000187837	ENST00000343677	T	0.21361	2.01	5.3	4.43	0.53597	.	0.182554	0.46145	D	0.000303	T	0.18087	0.0434	N	0.14661	0.345	0.58432	D	0.999997	D	0.76494	0.999	D	0.80764	0.994	T	0.12528	-1.0544	10	0.56958	D	0.05	-6.1029	13.5495	0.61723	0.0:0.924:0.0:0.076	.	172	P16403	H12_HUMAN	N	172	ENSP00000339566:K172N	ENSP00000339566:K172N	K	-	3	2	HIST1H1C	26164120	1.000000	0.71417	1.000000	0.80357	0.274000	0.26718	2.365000	0.44196	1.376000	0.46267	-0.143000	0.13931	AAG	.	.		0.562	HIST1H1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043372.1	NM_005319	
AGR3	155465	hgsc.bcm.edu	37	7	16900171	16900171	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr7:16900171C>G	ENST00000310398.2	-	7	474	c.404G>C	c.(403-405)aGa>aCa	p.R135T	AGR3_ENST00000402239.3_Missense_Mutation_p.R135T	NM_176813.3	NP_789783.1	Q8TD06	AGR3_HUMAN	anterior gradient 3	135						extracellular region (GO:0005576)	dystroglycan binding (GO:0002162)			central_nervous_system(1)|kidney(8)|lung(2)|skin(1)|stomach(1)	13	Lung NSC(10;0.0376)|all_lung(11;0.0721)|all_epithelial(12;0.202)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		GTTAGAGTATCTTCCAGCTAT	0.378																																					p.R135T		Atlas-SNP	.											.	AGR3	19	.	0			c.G404C						.						138.0	139.0	139.0					7																	16900171		2203	4300	6503	SO:0001583	missense	155465	exon7			GAGTATCTTCCAG	AY069977	CCDS5365.1	7p21.1	2013-07-31	2013-07-31		ENSG00000173467	ENSG00000173467		"""Protein disulfide isomerases"""	24167	protein-coding gene	gene with protein product	"""breast cancer membrane protein 11"", ""protein disulfide isomerase family A, member 18"""	609482	"""anterior gradient 3 homolog (Xenopus laevis)"""			12592373, 12477722	Standard	NM_176813		Approved	HAG3, hAG-3, BCMP11, PDIA18	uc003sts.3	Q8TD06	OTTHUMG00000128411	ENST00000310398.2:c.404G>C	chr7.hg19:g.16900171C>G	ENSP00000308606:p.Arg135Thr	134.0	0.0		112.0	22.0	NM_176813	A4D120	Missense_Mutation	SNP	ENST00000310398.2	hg19	CCDS5365.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.81|11.81	1.749331|1.749331	0.30955|0.30955	.|.	.|.	ENSG00000173467|ENSG00000173467	ENST00000414935|ENST00000310398;ENST00000402239	.|T;T	.|0.41758	.|0.99;0.99	4.28|4.28	1.47|1.47	0.22746|0.22746	.|Thioredoxin-like fold (2);	.|0.085531	.|0.49305	.|D	.|0.000146	T|T	0.33323|0.33323	0.0859|0.0859	M|M	0.64404|0.64404	1.975|1.975	0.40241|0.40241	D|D	0.977954|0.977954	.|B	.|0.22541	.|0.071	.|B	.|0.17433	.|0.018	T|T	0.08785|0.08785	-1.0705|-1.0705	5|10	.|0.23302	.|T	.|0.38	-15.2218|-15.2218	6.4396|6.4396	0.21843|0.21843	0.1463:0.6935:0.0:0.1603|0.1463:0.6935:0.0:0.1603	.|.	.|135	.|Q8TD06	.|AGR3_HUMAN	N|T	113|135	.|ENSP00000308606:R135T;ENSP00000386016:R135T	.|ENSP00000308606:R135T	K|R	-|-	3|2	2|0	AGR3|AGR3	16866696|16866696	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.678000|0.678000	0.39670|0.39670	0.585000|0.585000	0.23879|0.23879	0.110000|0.110000	0.17919|0.17919	0.655000|0.655000	0.94253|0.94253	AAG|AGA	.	.		0.378	AGR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250191.2	NM_176813	
GLI3	2737	hgsc.bcm.edu	37	7	42085105	42085105	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr7:42085105G>C	ENST00000395925.3	-	6	788	c.704C>G	c.(703-705)gCa>gGa	p.A235G	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	235					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A235G(1)		NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						ATAGTATTCTGCTGGGCTGAC	0.547									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.A235G		Atlas-SNP	.											GLI3,NS,carcinoma,0,1	GLI3	312	.	1	Substitution - Missense(1)	lung(1)	c.C704G						.						58.0	62.0	60.0					7																	42085105		2203	4300	6503	SO:0001583	missense	2737	exon6	Familial Cancer Database	;	TATTCTGCTGGGC		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.704C>G	chr7.hg19:g.42085105G>C	ENSP00000379258:p.Ala235Gly	49.0	0.0		47.0	6.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	hg19	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.848284	0.91277	.	.	ENSG00000106571	ENST00000395925	T	0.67523	-0.27	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.77980	0.4212	M	0.63843	1.955	0.80722	D	1	D	0.60160	0.987	P	0.57776	0.827	T	0.78163	-0.2311	10	0.52906	T	0.07	.	19.5837	0.95482	0.0:0.0:1.0:0.0	.	235	P10071	GLI3_HUMAN	G	235	ENSP00000379258:A235G	ENSP00000379258:A235G	A	-	2	0	GLI3	42051630	1.000000	0.71417	0.894000	0.35097	0.909000	0.53808	9.464000	0.97655	2.630000	0.89119	0.655000	0.94253	GCA	.	.		0.547	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
C7orf25	79020	hgsc.bcm.edu	37	7	42949496	42949496	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr7:42949496T>G	ENST00000350427.4	-	2	1279	c.1004A>C	c.(1003-1005)aAt>aCt	p.N335T	C7orf25_ENST00000447342.1_Missense_Mutation_p.N335T|C7orf25_ENST00000431882.2_Missense_Mutation_p.N393T|PSMA2_ENST00000442788.1_3'UTR|C7orf25_ENST00000438029.1_Missense_Mutation_p.N335T			Q9BPX7	CG025_HUMAN	chromosome 7 open reading frame 25	335										endometrium(6)|kidney(1)|large_intestine(7)|lung(2)|skin(1)	17						TGGTACCACATTAATTCGCTT	0.453																																					p.N393T		Atlas-SNP	.											.	C7orf25	36	.	0			c.A1178C						.						87.0	82.0	83.0					7																	42949496		2203	4300	6503	SO:0001583	missense	79020	exon2			ACCACATTAATTC	BC001845	CCDS5466.1, CCDS47576.1	7p14.1	2011-11-24			ENSG00000136197	ENSG00000136197			21703	protein-coding gene	gene with protein product							Standard	NM_024054		Approved	MGC2821	uc003thx.4	Q9BPX7	OTTHUMG00000128869	ENST00000350427.4:c.1004A>C	chr7.hg19:g.42949496T>G	ENSP00000343364:p.Asn335Thr	152.0	0.0		202.0	32.0	NM_001099858	A4D1V2|J3KR36|Q9H779	Missense_Mutation	SNP	ENST00000350427.4	hg19	CCDS5466.1	.	.	.	.	.	.	.	.	.	.	T	0.022	-1.410545	0.01145	.	.	ENSG00000136197	ENST00000350427;ENST00000447342;ENST00000431882;ENST00000438029	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	5.79	-2.75	0.05914	.	0.802027	0.12205	N	0.489902	T	0.08088	0.0202	N	0.00217	-1.83	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.41627	-0.9498	10	0.07175	T	0.84	-13.467	7.884	0.29640	0.0:0.3394:0.1895:0.4711	.	393;335	B4DQM3;Q9BPX7	.;CG025_HUMAN	T	335;335;393;335	ENSP00000343364:N335T;ENSP00000413029:N335T;ENSP00000416290:N393T;ENSP00000396597:N335T	ENSP00000343364:N335T	N	-	2	0	C7orf25	42916021	0.000000	0.05858	0.981000	0.43875	0.926000	0.56050	-0.373000	0.07494	-0.287000	0.09064	0.459000	0.35465	AAT	.	.		0.453	C7orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250814.2	NM_024054	
UBE3C	9690	hgsc.bcm.edu	37	7	157046730	157046730	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr7:157046730A>G	ENST00000348165.5	+	20	3137	c.2777A>G	c.(2776-2778)tAc>tGc	p.Y926C		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	926	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GTGGCAGACTACAGGCTGAAC	0.537																																					p.Y926C		Atlas-SNP	.											.	UBE3C	124	.	0			c.A2777G						.						58.0	57.0	57.0					7																	157046730		2203	4300	6503	SO:0001583	missense	9690	exon20			CAGACTACAGGCT	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2777A>G	chr7.hg19:g.157046730A>G	ENSP00000309198:p.Tyr926Cys	98.0	0.0		105.0	18.0	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	hg19	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.384710	0.82792	.	.	ENSG00000009335	ENST00000348165	T	0.61040	0.14	5.31	5.31	0.75309	HECT (4);	0.000000	0.85682	D	0.000000	T	0.81517	0.4839	M	0.92367	3.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.86419	0.1753	10	0.87932	D	0	.	15.5565	0.76200	1.0:0.0:0.0:0.0	.	926;779	Q15386;B4DHJ9	UBE3C_HUMAN;.	C	926	ENSP00000309198:Y926C	ENSP00000309198:Y926C	Y	+	2	0	UBE3C	156739491	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	8.946000	0.92992	2.143000	0.66587	0.533000	0.62120	TAC	.	.		0.537	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	
PREX2	80243	hgsc.bcm.edu	37	8	69020463	69020463	+	Silent	SNP	T	T	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr8:69020463T>A	ENST00000288368.4	+	24	3112	c.2835T>A	c.(2833-2835)gtT>gtA	p.V945V		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	945					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGATGGAAGTTTCTTATCCCA	0.428																																					p.V945V		Atlas-SNP	.											.	PREX2	614	.	0			c.T2835A						.						127.0	114.0	118.0					8																	69020463		2203	4300	6503	SO:0001819	synonymous_variant	80243	exon24			GGAAGTTTCTTAT	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2835T>A	chr8.hg19:g.69020463T>A		104.0	0.0		153.0	14.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	hg19	CCDS6201.1																																																																																			.	.		0.428	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
NLRP6	171389	hgsc.bcm.edu	37	11	281308	281308	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr11:281308G>A	ENST00000312165.5	+	4	1574	c.1574G>A	c.(1573-1575)gGc>gAc	p.G525D	NLRP6_ENST00000534750.1_Missense_Mutation_p.G525D	NM_138329.1	NP_612202.2	P59044	NALP6_HUMAN	NLR family, pyrin domain containing 6	525					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|regulation of inflammatory response (GO:0050727)|response to bacterium (GO:0009617)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|vasopressin receptor activity (GO:0005000)			breast(1)|skin(1)|upper_aerodigestive_tract(2)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.28e-28)|Epithelial(43;2.47e-27)|OV - Ovarian serous cystadenocarcinoma(40;4.66e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.0485)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCGGCTGGCGGCGTTGGGACA	0.682																																					p.G525D		Atlas-SNP	.											.	NLRP6	4	.	0			c.G1574A						.						29.0	25.0	26.0					11																	281308		2197	4294	6491	SO:0001583	missense	171389	exon4			CTGGCGGCGTTGG	AF479748	CCDS7693.1, CCDS60680.1	11p15	2006-12-08	2006-12-08	2006-12-08	ENSG00000174885	ENSG00000174885		"""Nucleotide-binding domain and leucine rich repeat containing"""	22944	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 6"""	609650	"""NACHT, leucine rich repeat and PYD containing 6"""	NALP6		12563287, 12019269	Standard	NM_138329		Approved	PYPAF5, PAN3, CLR11.4	uc010qvs.3	P59044	OTTHUMG00000119070	ENST00000312165.5:c.1574G>A	chr11.hg19:g.281308G>A	ENSP00000309767:p.Gly525Asp	64.0	0.0		69.0	16.0	NM_138329	A8K9F3|E9PJZ8	Missense_Mutation	SNP	ENST00000312165.5	hg19	CCDS7693.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.773994	0.00640	.	.	ENSG00000174885	ENST00000534750;ENST00000312165	T;T	0.73789	-0.78;-0.76	2.79	1.87	0.25490	.	1.041160	0.07672	N	0.935599	T	0.57242	0.2040	N	0.16567	0.415	0.09310	N	1	B;D	0.54047	0.024;0.964	B;P	0.45310	0.027;0.476	T	0.43540	-0.9385	10	0.06757	T	0.87	.	7.5797	0.27957	0.139:0.0:0.861:0.0	.	525;525	E9PJZ8;P59044	.;NALP6_HUMAN	D	525	ENSP00000433617:G525D;ENSP00000309767:G525D	ENSP00000309767:G525D	G	+	2	0	NLRP6	271308	0.000000	0.05858	0.001000	0.08648	0.213000	0.24496	0.992000	0.29667	0.718000	0.32166	0.462000	0.41574	GGC	.	.		0.682	NLRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239283.1	NM_138329	
MICALCL	84953	hgsc.bcm.edu	37	11	12315446	12315446	+	Silent	SNP	A	A	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr11:12315446A>G	ENST00000256186.2	+	3	759	c.468A>G	c.(466-468)aaA>aaG	p.K156K		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	156					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		ACCGGGAAAAAGGGAGTACTG	0.562																																					p.K156K		Atlas-SNP	.											.	MICALCL	59	.	0			c.A468G						.						61.0	70.0	67.0					11																	12315446		1953	4135	6088	SO:0001819	synonymous_variant	84953	exon3			GGAAAAAGGGAGT	BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.468A>G	chr11.hg19:g.12315446A>G		95.0	0.0		111.0	5.0	NM_032867	Q7RTP7|Q96JU6	Silent	SNP	ENST00000256186.2	hg19	CCDS41620.1																																																																																			.	.		0.562	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386164.1	NM_032867	
BBOX1	8424	hgsc.bcm.edu	37	11	27114762	27114762	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr11:27114762G>A	ENST00000529202.1	+	4	721	c.382G>A	c.(382-384)Gaa>Aaa	p.E128K	BBOX1_ENST00000263182.3_Missense_Mutation_p.E128K|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.E128K|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000527505.1_Intron|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000528583.1_Missense_Mutation_p.E128K			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	128					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	TTTGGATTTTGAAGATGTTTT	0.408																																					p.E128K		Atlas-SNP	.											BBOX1,right_upper_lobe,carcinoma,0,1	BBOX1	46	.	0			c.G382A						.						73.0	73.0	73.0					11																	27114762		2202	4298	6500	SO:0001583	missense	8424	exon5			GATTTTGAAGATG	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.382G>A	chr11.hg19:g.27114762G>A	ENSP00000435781:p.Glu128Lys	105.0	0.0		113.0	26.0	NM_003986	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	ENST00000529202.1	hg19	CCDS7862.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044333	0.55110	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.82167	-1.58;-1.58;-1.58;-1.58	5.5	4.58	0.56647	.	0.258585	0.43747	D	0.000524	T	0.73410	0.3583	L	0.41236	1.265	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.65619	-0.6124	10	0.14656	T	0.56	.	11.3317	0.49479	0.0872:0.0:0.9128:0.0	.	128	O75936	BODG_HUMAN	K	128	ENSP00000435781:E128K;ENSP00000263182:E128K;ENSP00000434918:E128K;ENSP00000433772:E128K	ENSP00000263182:E128K	E	+	1	0	BBOX1	27071338	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.050000	0.64251	2.576000	0.86940	0.650000	0.86243	GAA	.	.		0.408	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986	
UCP2	7351	hgsc.bcm.edu	37	11	73687988	73687988	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr11:73687988C>A	ENST00000310473.3	-	5	1254	c.412G>T	c.(412-414)Gat>Tat	p.D138Y	UCP2_ENST00000542615.1_5'Flank|UCP2_ENST00000536983.1_Missense_Mutation_p.D138Y	NM_003355.2	NP_003346.2	P55851	UCP2_HUMAN	uncoupling protein 2 (mitochondrial, proton carrier)	138					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to amino acid starvation (GO:0034198)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|female pregnancy (GO:0007565)|liver regeneration (GO:0097421)|mitochondrial transport (GO:0006839)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|positive regulation of cell death (GO:0010942)|proton transport (GO:0015992)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				large_intestine(1)|lung(3)|prostate(1)	5	Breast(11;0.000112)					TTTACCACATCCGTGGGCTGG	0.632																																					p.D138Y	Colon(191;388 2040 43557 45622 48925)	Atlas-SNP	.											.	UCP2	24	.	0			c.G412T						.						69.0	69.0	69.0					11																	73687988		2200	4293	6493	SO:0001583	missense	7351	exon5			CCACATCCGTGGG	U76367	CCDS8228.1	11q13	2014-02-12						"""Solute carriers"""	12518	protein-coding gene	gene with protein product		601693	"""body mass index QTL 4"", ""body mass index quantitative trait 4"""	BMIQ4		9196039, 11381268	Standard	NM_003355		Approved	SLC25A8	uc001oup.1	P55851		ENST00000310473.3:c.412G>T	chr11.hg19:g.73687988C>A	ENSP00000312029:p.Asp138Tyr	75.0	0.0		107.0	20.0	NM_003355	Q4PJH8|Q53HM3	Missense_Mutation	SNP	ENST00000310473.3	hg19	CCDS8228.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.028710	0.93518	.	.	ENSG00000175567	ENST00000310473;ENST00000536983;ENST00000544615;ENST00000545212	D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88	5.92	5.92	0.95590	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.94703	0.8291	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.95353	0.8448	10	0.87932	D	0	-24.0112	18.8845	0.92370	0.0:1.0:0.0:0.0	.	138;138	F5GX45;P55851	.;UCP2_HUMAN	Y	138;138;111;22	ENSP00000312029:D138Y;ENSP00000441147:D138Y;ENSP00000439951:D111Y;ENSP00000439706:D22Y	ENSP00000312029:D138Y	D	-	1	0	UCP2	73365636	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.813000	0.96785	0.561000	0.74099	GAT	.	.		0.632	UCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398108.1	NM_003355	
GALNT6	11226	hgsc.bcm.edu	37	12	51773494	51773494	+	Silent	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr12:51773494G>A	ENST00000543196.2	-	2	277	c.72C>T	c.(70-72)ctC>ctT	p.L24L	GALNT6_ENST00000603203.1_5'Flank|GALNT6_ENST00000356317.3_Silent_p.L24L			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	24					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GCAGGAGGAAGAGGAAGAGCA	0.637																																					p.L24L		Atlas-SNP	.											.	GALNT6	63	.	0			c.C72T						.						39.0	42.0	41.0					12																	51773494		2203	4300	6503	SO:0001819	synonymous_variant	11226	exon3			GAGGAAGAGGAAG	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.72C>T	chr12.hg19:g.51773494G>A		37.0	0.0		36.0	9.0	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	ENST00000543196.2	hg19	CCDS8813.1																																																																																			.	.		0.637	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
OR9K2	441639	hgsc.bcm.edu	37	12	55524551	55524551	+	Silent	SNP	T	T	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr12:55524551T>C	ENST00000305377.5	+	1	1087	c.999T>C	c.(997-999)atT>atC	p.I333I		NM_001005243.1	NP_001005243.1	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K, member 2	333						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(3)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(2)	31						AGAAAAATATTATTCTTTGAT	0.308																																					p.I333I		Atlas-SNP	.											.	OR9K2	63	.	0			c.T999C						.						23.0	24.0	24.0					12																	55524551		2117	4241	6358	SO:0001819	synonymous_variant	441639	exon1			AAATATTATTCTT	BK004326	CCDS31814.1	12q13.2	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	15339	protein-coding gene	gene with protein product							Standard	NM_001005243		Approved		uc010spe.2	Q8NGE7	OTTHUMG00000169827	ENST00000305377.5:c.999T>C	chr12.hg19:g.55524551T>C		40.0	0.0		53.0	9.0	NM_001005243	B9EH19|Q6IFD6	Silent	SNP	ENST00000305377.5	hg19	CCDS31814.1																																																																																			.	.		0.308	OR9K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406105.1		
ESYT1	23344	hgsc.bcm.edu	37	12	56532051	56532051	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr12:56532051G>A	ENST00000394048.5	+	21	2596	c.2332G>A	c.(2332-2334)Gag>Aag	p.E778K	ESYT1_ENST00000550878.1_3'UTR|ESYT1_ENST00000541590.1_Missense_Mutation_p.E788K|ESYT1_ENST00000267113.4_Missense_Mutation_p.E788K	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	778					lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						TGCTGAGTTAGAGGAGGTAGG	0.607																																					p.E788K		Atlas-SNP	.											.	ESYT1	84	.	0			c.G2362A						.						85.0	86.0	86.0					12																	56532051		2203	4300	6503	SO:0001583	missense	23344	exon21			GAGTTAGAGGAGG	AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2332G>A	chr12.hg19:g.56532051G>A	ENSP00000377612:p.Glu778Lys	78.0	0.0		108.0	14.0	NM_001184796	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	ENST00000394048.5	hg19	CCDS8904.1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521037	0.64747	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.56275	0.47;0.49;0.49	5.38	5.38	0.77491	.	0.155344	0.56097	D	0.000028	T	0.34571	0.0902	N	0.05383	-0.06	0.42720	D	0.993679	B;B	0.31837	0.342;0.141	B;B	0.35413	0.202;0.019	T	0.20338	-1.0278	10	0.11485	T	0.65	-28.6595	16.9874	0.86344	0.0:0.0:1.0:0.0	.	788;778	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	K	778;732;788;788	ENSP00000377612:E778K;ENSP00000267113:E788K;ENSP00000445952:E788K	ENSP00000267113:E788K	E	+	1	0	ESYT1	54818318	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.215000	0.51169	2.682000	0.91365	0.561000	0.74099	GAG	.	.		0.607	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407906.1	NM_015292	
SHMT2	6472	hgsc.bcm.edu	37	12	57627403	57627403	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr12:57627403A>G	ENST00000328923.3	+	9	1533	c.1081A>G	c.(1081-1083)Atg>Gtg	p.M361V	SHMT2_ENST00000449049.3_Missense_Mutation_p.M340V|SHMT2_ENST00000393827.4_Missense_Mutation_p.M265V|SHMT2_ENST00000414700.3_Missense_Mutation_p.M340V|SHMT2_ENST00000553474.1_Missense_Mutation_p.M340V|SHMT2_ENST00000557487.1_Missense_Mutation_p.M351V	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	361					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TGCTCGGGCCATGGCAGATGC	0.607																																					p.M361V	Esophageal Squamous(150;1369 2416 49071 49364)	Atlas-SNP	.											.	SHMT2	40	.	0			c.A1081G						.						82.0	71.0	75.0					12																	57627403		2203	4300	6503	SO:0001583	missense	6472	exon9			CGGGCCATGGCAG	AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.1081A>G	chr12.hg19:g.57627403A>G	ENSP00000333667:p.Met361Val	55.0	0.0		85.0	11.0	NM_005412	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Missense_Mutation	SNP	ENST00000328923.3	hg19	CCDS8934.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.56|18.56	3.649772|3.649772	0.67358|0.67358	.|.	.|.	ENSG00000182199|ENSG00000182199	ENST00000557529|ENST00000328923;ENST00000557487;ENST00000555634;ENST00000414700;ENST00000553474;ENST00000449049;ENST00000393827	.|T;T;T;T;T;T;T	.|0.42513	.|0.97;0.97;0.97;0.97;0.97;0.97;0.97	4.32|4.32	4.32|4.32	0.51571|0.51571	.|Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.56804|0.56804	0.2010|0.2010	M|M	0.80982|0.80982	2.52|2.52	0.58432|0.58432	D|D	0.999999|0.999999	.|B;P;P;B;P	.|0.49358	.|0.417;0.792;0.923;0.261;0.788	.|B;B;P;B;P	.|0.52481	.|0.374;0.411;0.7;0.42;0.447	T|T	0.63479|0.63479	-0.6628|-0.6628	5|10	.|0.56958	.|D	.|0.05	-1.5384|-1.5384	12.9188|12.9188	0.58220|0.58220	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|370;351;265;292;361	.|B4DWA7;Q8N1A5;B4DLV4;B4DP88;P34897	.|.;.;.;.;GLYM_HUMAN	R|V	160|361;351;200;340;340;340;265	.|ENSP00000333667:M361V;ENSP00000452315:M351V;ENSP00000450930:M200V;ENSP00000406881:M340V;ENSP00000452419:M340V;ENSP00000413770:M340V;ENSP00000377413:M265V	.|ENSP00000333667:M361V	H|M	+|+	2|1	0|0	SHMT2|SHMT2	55913670|55913670	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	3.453000|3.453000	0.52978|0.52978	1.953000|1.953000	0.56701|0.56701	0.459000|0.459000	0.35465|0.35465	CAT|ATG	.	.		0.607	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412525.2	NM_005412	
MVK	4598	hgsc.bcm.edu	37	12	110029107	110029107	+	Missense_Mutation	SNP	G	G	A	rs104895352		TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr12:110029107G>A	ENST00000228510.3	+	9	906	c.830G>A	c.(829-831)cGc>cAc	p.R277H	MVK_ENST00000539575.1_Missense_Mutation_p.R225H|MVK_ENST00000541384.1_Missense_Mutation_p.R83H|MVK_ENST00000539696.1_5'UTR|MVK_ENST00000392727.3_Missense_Mutation_p.R225H	NM_000431.2|NM_001114185.1	NP_000422.1|NP_001107657.1	Q03426	KIME_HUMAN	mevalonate kinase	277					cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|negative regulation of inflammatory response (GO:0050728)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|mevalonate kinase activity (GO:0004496)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8						GAGTGTGAGCGCGTGCTGGGA	0.607																																					p.R277H		Atlas-SNP	.											.	MVK	42	.	0			c.G830A	GRCh37	CM055448	MVK	M	rs104895352	.						75.0	76.0	76.0					12																	110029107		2203	4300	6503	SO:0001583	missense	4598	exon9			GTGAGCGCGTGCT	M88468	CCDS9132.1, CCDS73522.1	12q24	2014-09-17	2008-01-30		ENSG00000110921	ENSG00000110921	2.7.1.36		7530	protein-coding gene	gene with protein product	"""LH receptor mRNA-binding protein"", ""mevalonic aciduria"""	251170	"""mevalonate kinase (mevalonic aciduria)"""			1377680	Standard	XM_005253883		Approved	LRBP, MK	uc001toy.4	Q03426	OTTHUMG00000169256	ENST00000228510.3:c.830G>A	chr12.hg19:g.110029107G>A	ENSP00000228510:p.Arg277His	73.0	0.0		88.0	9.0	NM_000431		Missense_Mutation	SNP	ENST00000228510.3	hg19	CCDS9132.1	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645874	0.47258	.	.	ENSG00000110921	ENST00000228510;ENST00000392727;ENST00000539575;ENST00000541384	D;D;D;D	0.94650	-3.48;-3.48;-3.48;-3.48	4.6	1.78	0.24846	.	0.175457	0.51477	D	0.000092	D	0.91778	0.7399	M	0.79805	2.47	0.39377	D	0.966193	B;B	0.29037	0.052;0.231	B;B	0.17722	0.019;0.006	D	0.86440	0.1766	10	0.48119	T	0.1	-13.0518	6.3446	0.21343	0.3002:0.0:0.6998:0.0	.	225;277	F5H8H2;Q03426	.;KIME_HUMAN	H	277;225;225;83	ENSP00000228510:R277H;ENSP00000376487:R225H;ENSP00000443551:R225H;ENSP00000443182:R83H	ENSP00000228510:R277H	R	+	2	0	MVK	108513490	0.991000	0.36638	0.897000	0.35233	0.982000	0.71751	2.330000	0.43885	0.193000	0.20303	0.655000	0.94253	CGC	.	.		0.607	MVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403143.1	NM_000431	
KIAA0586	9786	hgsc.bcm.edu	37	14	58938977	58938977	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr14:58938977G>A	ENST00000556134.1	+	19	2843	c.2569G>A	c.(2569-2571)Gaa>Aaa	p.E857K	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000261244.5_Missense_Mutation_p.E796K|KIAA0586_ENST00000354386.6_Missense_Mutation_p.E925K|KIAA0586_ENST00000423743.3_Missense_Mutation_p.E828K	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	857					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						TAACTTTGATGAAATAATCGA	0.333																																					p.E925K		Atlas-SNP	.											.	KIAA0586	180	.	0			c.G2773A						.						55.0	52.0	53.0					14																	58938977		1815	4064	5879	SO:0001583	missense	9786	exon20			TTTGATGAAATAA	AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2569G>A	chr14.hg19:g.58938977G>A	ENSP00000452351:p.Glu857Lys	404.0	0.0		392.0	62.0	NM_001244189	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	ENST00000556134.1	hg19	CCDS58321.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449816	0.84101	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.54675	0.56;0.56;0.56;0.56	5.76	5.76	0.90799	.	0.136929	0.51477	D	0.000092	T	0.71056	0.3295	.	.	.	0.34179	D	0.670692	D;D;D;D;D;D	0.71674	0.995;0.995;0.997;0.998;0.995;0.995	D;D;D;D;D;D	0.78314	0.92;0.965;0.921;0.991;0.976;0.945	T	0.80151	-0.1502	9	0.66056	D	0.02	.	13.0958	0.59190	0.0:0.161:0.839:0.0	.	732;732;925;796;857;828	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	K	925;857;828;796;732	ENSP00000346359:E925K;ENSP00000452351:E857K;ENSP00000399427:E828K;ENSP00000261244:E796K	ENSP00000261244:E796K	E	+	1	0	KIAA0586	58008730	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.238000	0.58688	2.714000	0.92807	0.591000	0.81541	GAA	.	.		0.333	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000411887.1	NM_014749	
TTBK2	146057	hgsc.bcm.edu	37	15	43038338	43038338	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr15:43038338A>T	ENST00000267890.6	-	15	3498	c.3390T>A	c.(3388-3390)agT>agA	p.S1130R	CTD-2036P10.3_ENST00000500850.2_lincRNA	NM_173500.3	NP_775771.3	Q6IQ55	TTBK2_HUMAN	tau tubulin kinase 2	1130					cell death (GO:0008219)|cilium assembly (GO:0042384)|peptidyl-serine phosphorylation (GO:0018105)|smoothened signaling pathway (GO:0007224)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	43		all_cancers(109;6.11e-16)|all_epithelial(112;5.5e-14)|Lung NSC(122;1.76e-08)|all_lung(180;6.04e-08)|Melanoma(134;0.0179)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;3.23e-07)		GAGATCCTGGACTCTTGCACT	0.537																																					p.S1130R		Atlas-SNP	.											.	TTBK2	82	.	0			c.T3390A						.						163.0	162.0	162.0					15																	43038338		1958	4133	6091	SO:0001583	missense	146057	exon15			TCCTGGACTCTTG	AB020654	CCDS42029.1	15q15.2	2014-01-21			ENSG00000128881	ENSG00000128881			19141	protein-coding gene	gene with protein product		611695	"""spinocerebellar ataxia 11"""	SCA11		10048485	Standard	NM_173500		Approved	KIAA0847	uc001zqo.2	Q6IQ55	OTTHUMG00000175802	ENST00000267890.6:c.3390T>A	chr15.hg19:g.43038338A>T	ENSP00000267890:p.Ser1130Arg	64.0	0.0		55.0	13.0	NM_173500	O94932|Q6ZN52|Q8IVV1	Missense_Mutation	SNP	ENST00000267890.6	hg19	CCDS42029.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.143647	0.57044	.	.	ENSG00000128881	ENST00000267890;ENST00000399479;ENST00000263802	T	0.38722	1.12	5.13	2.82	0.32997	.	0.157934	0.56097	D	0.000022	T	0.44767	0.1309	N	0.25890	0.77	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.22103	-1.0226	10	0.34782	T	0.22	.	7.3879	0.26893	0.7023:0.0:0.2977:0.0	.	1061;1130	Q6IQ55-2;Q6IQ55	.;TTBK2_HUMAN	R	1130;1060;1535	ENSP00000267890:S1130R	ENSP00000263802:S1535R	S	-	3	2	TTBK2	40825630	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.114000	0.31196	0.434000	0.26340	0.533000	0.62120	AGT	.	.		0.537	TTBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000431106.2	NM_173500	
CRLF3	51379	hgsc.bcm.edu	37	17	29120592	29120592	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr17:29120592G>C	ENST00000324238.6	-	5	826	c.702C>G	c.(700-702)ttC>ttG	p.F234L	CRLF3_ENST00000544695.1_Missense_Mutation_p.F118L|CRLF3_ENST00000577725.1_Intron|CTD-2349P21.9_ENST00000580085.1_lincRNA	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	234	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				GCAATACTATGAATTCAGTTT	0.458																																					p.F234L	Pancreas(30;346 881 29244 33464 41299)	Atlas-SNP	.											.	CRLF3	36	.	0			c.C702G						.						101.0	97.0	98.0					17																	29120592		2203	4300	6503	SO:0001583	missense	51379	exon5			TACTATGAATTCA	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.702C>G	chr17.hg19:g.29120592G>C	ENSP00000318804:p.Phe234Leu	90.0	0.0		130.0	9.0	NM_015986	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Missense_Mutation	SNP	ENST00000324238.6	hg19	CCDS32607.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834762	0.91036	.	.	ENSG00000176390	ENST00000324238;ENST00000544695	T;T	0.27557	1.66;1.66	5.64	4.67	0.58626	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.33933	0.0880	L	0.38175	1.15	0.80722	D	1	D	0.55385	0.971	P	0.53062	0.717	T	0.03852	-1.0998	10	0.13470	T	0.59	-15.6682	14.4272	0.67225	0.0715:0.0:0.9285:0.0	.	234	Q8IUI8	CRLF3_HUMAN	L	234;118	ENSP00000318804:F234L;ENSP00000444188:F118L	ENSP00000318804:F234L	F	-	3	2	CRLF3	26144718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.563000	0.45922	1.377000	0.46286	0.591000	0.81541	TTC	.	.		0.458	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444354.1		
ERN1	2081	hgsc.bcm.edu	37	17	62125306	62125306	+	Missense_Mutation	SNP	G	G	T	rs563941838		TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr17:62125306G>T	ENST00000433197.3	-	19	2536	c.2441C>A	c.(2440-2442)gCg>gAg	p.A814E		NM_001433.3	NP_001424.3			endoplasmic reticulum to nucleus signaling 1											central_nervous_system(4)|kidney(1)|lung(2)|ovary(1)|stomach(1)	9						AGGATCCATCGCAATCATCTT	0.468																																					p.A814E		Atlas-SNP	.											.	ERN1	102	.	0			c.C2441A						.						86.0	84.0	85.0					17																	62125306		1950	4149	6099	SO:0001583	missense	2081	exon19			TCCATCGCAATCA	AF059198	CCDS45762.1	17q23	2011-08-12	2007-08-14			ENSG00000178607			3449	protein-coding gene	gene with protein product	"""inositol-requiring enzyme 1"""	604033	"""ER to nucleus signalling 1"""			9637683	Standard	NM_001433		Approved	IRE1, IRE1P	uc002jdz.2	O75460		ENST00000433197.3:c.2441C>A	chr17.hg19:g.62125306G>T	ENSP00000401445:p.Ala814Glu	58.0	0.0		60.0	4.0	NM_001433		Missense_Mutation	SNP	ENST00000433197.3	hg19	CCDS45762.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.853757	0.32791	.	.	ENSG00000178607	ENST00000433197	T	0.64438	-0.1	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.240041	0.44097	D	0.000485	T	0.43100	0.1232	N	0.11154	0.105	0.18873	N	0.999988	B	0.28233	0.204	B	0.31495	0.131	T	0.31752	-0.9932	10	0.26408	T	0.33	-13.2305	12.3599	0.55197	0.0:0.0:0.7177:0.2823	.	814	O75460	ERN1_HUMAN	E	814	ENSP00000401445:A814E	ENSP00000401445:A814E	A	-	2	0	ERN1	59479038	0.993000	0.37304	0.268000	0.24571	0.573000	0.36030	3.574000	0.53863	2.600000	0.87896	0.491000	0.48974	GCG	.	.		0.468	ERN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443734.2	NM_001433	
RNF213	57674	hgsc.bcm.edu	37	17	78269372	78269372	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr17:78269372T>C	ENST00000582970.1	+	10	1914	c.1771T>C	c.(1771-1773)Tgg>Cgg	p.W591R	RNF213_ENST00000508628.2_Missense_Mutation_p.W640R|RNF213_ENST00000319921.4_Missense_Mutation_p.W591R|RNF213_ENST00000456466.1_Missense_Mutation_p.W591R	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	591					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GAGATACCTGTGGCAACATCT	0.517																																					p.W591R		Atlas-SNP	.											.	RNF213	766	.	0			c.T1771C						.						70.0	66.0	67.0					17																	78269372		2203	4300	6503	SO:0001583	missense	57674	exon10			TACCTGTGGCAAC	AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1771T>C	chr17.hg19:g.78269372T>C	ENSP00000464087:p.Trp591Arg	95.0	0.0		116.0	12.0	NM_001256071	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	ENST00000582970.1	hg19	CCDS58606.1	.	.	.	.	.	.	.	.	.	.	T	3.718	-0.058119	0.07317	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	4.22	4.22	0.49857	.	0.210998	0.32430	N	0.006120	T	0.70150	0.3191	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68522	-0.5386	9	0.33141	T	0.24	-19.945	10.307	0.43687	0.0:0.0:0.0:1.0	.	591;591	Q9HCF4;Q9HCF4-2	ALO17_HUMAN;.	R	591;640;591;591	.	ENSP00000324392:W591R	W	+	1	0	RNF213	75883967	1.000000	0.71417	1.000000	0.80357	0.025000	0.11179	1.377000	0.34317	1.851000	0.53745	0.456000	0.33151	TGG	.	.		0.517	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000443298.1	NM_020914	
EPB41L3	23136	hgsc.bcm.edu	37	18	5423479	5423479	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr18:5423479G>A	ENST00000341928.2	-	11	1577	c.1237C>T	c.(1237-1239)Caa>Taa	p.Q413*	EPB41L3_ENST00000342933.3_Nonsense_Mutation_p.Q413*|EPB41L3_ENST00000540638.2_Nonsense_Mutation_p.Q413*|EPB41L3_ENST00000544123.1_Nonsense_Mutation_p.Q413*|EPB41L3_ENST00000400111.3_Nonsense_Mutation_p.Q413*|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	413	Hydrophilic.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GTTTGCGCTTGTGTCCTGCCA	0.463																																					p.Q413X		Atlas-SNP	.											.	EPB41L3	222	.	0			c.C1237T						.						128.0	99.0	109.0					18																	5423479		2203	4300	6503	SO:0001587	stop_gained	23136	exon11			GCGCTTGTGTCCT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1237C>T	chr18.hg19:g.5423479G>A	ENSP00000343158:p.Gln413*	143.0	0.0		166.0	31.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Nonsense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	41	8.958766	0.99018	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	.	.	.	X	413;304;413;304;413;413	.	ENSP00000343158:Q413X	Q	-	1	0	EPB41L3	5413479	1.000000	0.71417	0.990000	0.47175	0.568000	0.35870	9.830000	0.99415	2.894000	0.99253	0.591000	0.81541	CAA	.	.		0.463	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
RPRD1A	55197	hgsc.bcm.edu	37	18	33607210	33607210	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr18:33607210G>A	ENST00000399022.4	-	5	721	c.550C>T	c.(550-552)Cat>Tat	p.H184Y	RPRD1A_ENST00000590898.1_Missense_Mutation_p.H148Y|RPRD1A_ENST00000357384.4_Missense_Mutation_p.H184Y|RPRD1A_ENST00000319040.6_Missense_Mutation_p.H184Y|RPRD1A_ENST00000337059.5_Missense_Mutation_p.H148Y|RPRD1A_ENST00000588737.1_Missense_Mutation_p.H148Y	NM_018170.3	NP_060640.2	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing 1A	184					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(2)	12						ATCCTCTGATGAACTGCTGCA	0.358																																					p.H184Y		Atlas-SNP	.											.	RPRD1A	30	.	0			c.C550T						.						124.0	126.0	125.0					18																	33607210		2203	4300	6503	SO:0001583	missense	55197	exon5			TCTGATGAACTGC	AF419845	CCDS11917.1	18q12.2	2012-02-09	2008-08-15		ENSG00000141425	ENSG00000141425			25560	protein-coding gene	gene with protein product	"""cyclin-dependent kinase 2B-inhibitor-related protein"", ""Cyclin-dependent kinase inhibitor 2B-related protein (p15INK4B-related protein)"""	610347				12470661, 22231121	Standard	NM_018170		Approved	P15RS, FLJ10656, HsT3101	uc002kzg.3	Q96P16	OTTHUMG00000132591	ENST00000399022.4:c.550C>T	chr18.hg19:g.33607210G>A	ENSP00000381984:p.His184Tyr	208.0	0.0		204.0	46.0	NM_018170	A8KA42|B2RBA3|Q7Z5G8|Q96FY9|Q9NVL4	Missense_Mutation	SNP	ENST00000399022.4	hg19	CCDS11917.1	.	.	.	.	.	.	.	.	.	.	G	18.80	3.701162	0.68501	.	.	ENSG00000141425	ENST00000399022;ENST00000357384;ENST00000337059;ENST00000319040	.	.	.	5.22	5.22	0.72569	.	0.091610	0.85682	D	0.000000	T	0.57169	0.2035	L	0.44542	1.39	0.43043	D	0.994634	P;P;P	0.47253	0.892;0.692;0.892	P;B;P	0.45712	0.491;0.216;0.491	T	0.63088	-0.6715	9	0.72032	D	0.01	-9.3564	16.6336	0.85040	0.0:0.0:1.0:0.0	.	184;184;148	Q96P16-2;Q96P16;Q96P16-3	.;RPR1A_HUMAN;.	Y	184;184;148;184	.	ENSP00000314602:H184Y	H	-	1	0	RPRD1A	31861208	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.504000	0.81646	2.583000	0.87209	0.650000	0.86243	CAT	.	.		0.358	RPRD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255802.1	NM_018170	
SUPT5H	6829	hgsc.bcm.edu	37	19	39966766	39966766	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr19:39966766A>G	ENST00000599117.1	+	30	3437	c.3070A>G	c.(3070-3072)Agc>Ggc	p.S1024G	SUPT5H_ENST00000432763.2_Missense_Mutation_p.S1024G|SUPT5H_ENST00000598725.1_Missense_Mutation_p.S1024G|SUPT5H_ENST00000359191.6_Missense_Mutation_p.S1020G|SUPT5H_ENST00000402194.2_Missense_Mutation_p.S1020G			O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog (S. cerevisiae)	1024					7-methylguanosine mRNA capping (GO:0006370)|cell cycle (GO:0007049)|chromatin remodeling (GO:0006338)|DNA-templated transcription, elongation (GO:0006354)|gene expression (GO:0010467)|negative regulation of DNA-templated transcription, elongation (GO:0032785)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to organic substance (GO:0010033)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	DSIF complex (GO:0032044)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(13)|lung(12)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	51	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GAAGGTTGTCAGCATTTCCAG	0.582																																					p.S1024G		Atlas-SNP	.											.	SUPT5H	119	.	0			c.A3070G						.						96.0	76.0	83.0					19																	39966766		2203	4300	6503	SO:0001583	missense	6829	exon28			GTTGTCAGCATTT	U56402	CCDS12536.1, CCDS46072.1	19q13	2008-07-22	2001-11-28			ENSG00000196235			11469	protein-coding gene	gene with protein product		602102	"""suppressor of Ty (S.cerevisiae) 5 homolog"""			8975720	Standard	NM_003169		Approved	SPT5H, SPT5, FLJ34157	uc002olp.4	O00267		ENST00000599117.1:c.3070A>G	chr19.hg19:g.39966766A>G	ENSP00000470252:p.Ser1024Gly	42.0	0.0		79.0	24.0	NM_003169	O43279|Q59G52|Q99639	Missense_Mutation	SNP	ENST00000599117.1	hg19	CCDS12536.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.029905	0.54790	.	.	ENSG00000196235	ENST00000432763;ENST00000402194;ENST00000378524;ENST00000359191	.	.	.	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.54095	0.1837	M	0.72894	2.215	0.80722	D	1	B;P	0.34546	0.415;0.456	B;B	0.31442	0.112;0.13	T	0.56341	-0.7995	8	.	.	.	-30.1885	12.7754	0.57443	1.0:0.0:0.0:0.0	.	1020;1024	O00267-2;O00267	.;SPT5H_HUMAN	G	1024;1020;1002;1024	.	.	S	+	1	0	SUPT5H	44658606	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	8.815000	0.91973	1.852000	0.53769	0.379000	0.24179	AGC	.	.		0.582	SUPT5H-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464918.1	NM_003169	
NRSN2	80023	hgsc.bcm.edu	37	20	333968	333968	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr20:333968G>A	ENST00000382291.3	+	4	544	c.304G>A	c.(304-306)Gat>Aat	p.D102N	NRSN2_ENST00000382285.2_Missense_Mutation_p.D102N|NRSN2_ENST00000608736.1_Intron|NRSN2_ENST00000492242.1_3'UTR	NM_024958.2	NP_079234.1	Q9GZP1	NRSN2_HUMAN	neurensin 2	102						integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8		all_cancers(10;0.0834)				CCTGGTGTTGGATCAGCGGGC	0.652																																					p.D102N		Atlas-SNP	.											.	NRSN2	20	.	0			c.G304A						.						78.0	73.0	75.0					20																	333968		2203	4300	6503	SO:0001583	missense	80023	exon4			GTGTTGGATCAGC	AL136915	CCDS12996.1	20p13	2008-02-04	2006-07-04	2006-07-04	ENSG00000125841	ENSG00000125841			16229	protein-coding gene	gene with protein product		610666	"""chromosome 20 open reading frame 98"""	C20orf98		16527258	Standard	NM_024958		Approved	dJ1103G7.6	uc002wdi.4	Q9GZP1	OTTHUMG00000031628	ENST00000382291.3:c.304G>A	chr20.hg19:g.333968G>A	ENSP00000371728:p.Asp102Asn	48.0	0.0		79.0	17.0	NM_024958	A8K3B2|Q6FII5|Q9NUD3	Missense_Mutation	SNP	ENST00000382291.3	hg19	CCDS12996.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140589	0.77775	.	.	ENSG00000125841	ENST00000382291;ENST00000382285	T;T	0.35973	1.28;1.28	4.76	3.81	0.43845	.	0.055512	0.64402	D	0.000001	T	0.54095	0.1837	M	0.73217	2.22	0.35056	D	0.761106	D	0.67145	0.996	D	0.66351	0.943	T	0.67852	-0.5563	10	0.87932	D	0	-14.1649	10.2024	0.43092	0.0:0.0:0.8016:0.1984	.	102	Q9GZP1	NRSN2_HUMAN	N	102	ENSP00000371728:D102N;ENSP00000371722:D102N	ENSP00000371722:D102N	D	+	1	0	NRSN2	281968	1.000000	0.71417	0.943000	0.38184	0.953000	0.61014	5.454000	0.66651	1.226000	0.43582	0.643000	0.83706	GAT	.	.		0.652	NRSN2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077446.1	NM_024958	
RNF114	55905	hgsc.bcm.edu	37	20	48553085	48553085	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr20:48553085C>T	ENST00000244061.2	+	1	138	c.136C>T	c.(136-138)Cac>Tac	p.H46Y		NM_018683.3	NP_061153.1	Q9Y508	RN114_HUMAN	ring finger protein 114	46					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(1)|ovary(1)	5						GCCCTGCGGACACGTGTAAGC	0.692																																					p.H46Y		Atlas-SNP	.											.	RNF114	9	.	0			c.C136T						.						8.0	8.0	8.0					20																	48553085		2079	4118	6197	SO:0001583	missense	55905	exon1			TGCGGACACGTGT	AF265215	CCDS33482.1	20q13	2013-01-09	2008-06-16	2008-06-16	ENSG00000124226	ENSG00000124226		"""RING-type (C3HC4) zinc fingers"""	13094	protein-coding gene	gene with protein product		612451	"""zinc finger protein 313"""	ZNF313		18364390	Standard	NM_018683		Approved	PSORS12	uc002xux.3	Q9Y508	OTTHUMG00000032709	ENST00000244061.2:c.136C>T	chr20.hg19:g.48553085C>T	ENSP00000244061:p.His46Tyr	110.0	0.0		123.0	7.0	NM_018683	B2RDQ9|B4DWY5|E1P627|Q6N0B0	Missense_Mutation	SNP	ENST00000244061.2	hg19	CCDS33482.1	.	.	.	.	.	.	.	.	.	.	C	34	5.343975	0.95807	.	.	ENSG00000124226	ENST00000449816;ENST00000244061	D	0.99557	-6.16	4.65	4.65	0.58169	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	D	0.99799	0.9914	H	0.97852	4.09	0.58432	D	0.999999	D;D	0.76494	0.999;0.995	D;P	0.83275	0.996;0.874	D	0.96755	0.9557	10	0.87932	D	0	-24.7937	16.8046	0.85623	0.0:1.0:0.0:0.0	.	46;46	Q9Y508-2;Q9Y508	.;RN114_HUMAN	Y	46	ENSP00000244061:H46Y	ENSP00000244061:H46Y	H	+	1	0	RNF114	47986492	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.134000	0.57990	2.565000	0.86533	0.555000	0.69702	CAC	.	.		0.692	RNF114-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079663.1	NM_018683	
SYCP2	10388	hgsc.bcm.edu	37	20	58467458	58467458	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr20:58467458T>C	ENST00000357552.3	-	24	2176	c.1951A>G	c.(1951-1953)Act>Gct	p.T651A	SYCP2_ENST00000371001.2_Missense_Mutation_p.T651A			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	651					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TTTTGTTTAGTAAGTTTTTTA	0.224																																					p.T651A		Atlas-SNP	.											.	SYCP2	204	.	0			c.A1951G						.						33.0	32.0	32.0					20																	58467458		2195	4279	6474	SO:0001583	missense	10388	exon23			GTTTAGTAAGTTT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1951A>G	chr20.hg19:g.58467458T>C	ENSP00000350162:p.Thr651Ala	43.0	0.0		31.0	7.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	hg19	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	T	0.017	-1.495187	0.01009	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.18174	2.49;2.49;2.23	5.08	-10.2	0.00374	.	1.219660	0.05641	N	0.583361	T	0.10637	0.0260	L	0.47716	1.5	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.15665	-1.0429	10	0.24483	T	0.36	1.2526	4.6103	0.12399	0.19:0.1434:0.5184:0.1482	.	651	Q9BX26	SYCP2_HUMAN	A	651	ENSP00000360040:T651A;ENSP00000350162:T651A;ENSP00000402456:T651A	ENSP00000350162:T651A	T	-	1	0	SYCP2	57900853	0.000000	0.05858	0.000000	0.03702	0.270000	0.26580	-0.702000	0.05069	-2.296000	0.00662	0.482000	0.46254	ACT	.	.		0.224	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
PPARA	5465	hgsc.bcm.edu	37	22	46614190	46614190	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr22:46614190C>G	ENST00000396000.2	+	5	665	c.400C>G	c.(400-402)Ctg>Gtg	p.L134V	PPARA_ENST00000407236.1_Missense_Mutation_p.L134V|PPARA_ENST00000402126.1_Missense_Mutation_p.L134V|PPARA_ENST00000434345.2_Missense_Mutation_p.L134V|PPARA_ENST00000262735.5_Missense_Mutation_p.L134V			Q07869	PPARA_HUMAN	peroxisome proliferator-activated receptor alpha	134					behavioral response to nicotine (GO:0035095)|cellular lipid metabolic process (GO:0044255)|circadian regulation of gene expression (GO:0032922)|enamel mineralization (GO:0070166)|epidermis development (GO:0008544)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular receptor signaling pathway (GO:0030522)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|negative regulation of appetite (GO:0032099)|negative regulation of blood pressure (GO:0045776)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of glycolytic process (GO:0045820)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular ketone metabolic process by positive regulation of transcription from RNA polymerase II promoter (GO:0072366)|regulation of circadian rhythm (GO:0042752)|regulation of glycolytic by positive regulation of transcription from RNA polymerase II promoter (GO:0072363)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|wound healing (GO:0042060)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|lipid binding (GO:0008289)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	15		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00522)	Bezafibrate(DB01393)|Clofibrate(DB00636)|Fenofibrate(DB01039)|Gemfibrozil(DB01241)|Indomethacin(DB00328)	TCGACTCAAGCTGGTGTATGA	0.483																																					p.L134V		Atlas-SNP	.											.	PPARA	36	.	0			c.C400G						.						116.0	102.0	107.0					22																	46614190		2203	4300	6503	SO:0001583	missense	5465	exon5			CTCAAGCTGGTGT	L02932	CCDS33669.1	22q12-q13.1	2013-01-16	2006-10-17		ENSG00000186951	ENSG00000186951		"""Nuclear hormone receptors"""	9232	protein-coding gene	gene with protein product		170998	"""peroxisome proliferative activated receptor, alpha"""	PPAR		7684926, 10591208	Standard	XM_005261655		Approved	hPPAR, NR1C1	uc003bgx.1	Q07869	OTTHUMG00000150443	ENST00000396000.2:c.400C>G	chr22.hg19:g.46614190C>G	ENSP00000379322:p.Leu134Val	71.0	0.0		83.0	14.0	NM_001001928	B0G0X3|Q16241|Q6I9S0|Q92486|Q92689|Q9Y3N1	Missense_Mutation	SNP	ENST00000396000.2	hg19	CCDS33669.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559141	0.86335	.	.	ENSG00000186951	ENST00000396000;ENST00000262735;ENST00000407236;ENST00000402126;ENST00000434345	D;D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04;-4.04	5.67	4.66	0.58398	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.000000	0.85682	D	0.000000	D	0.97445	0.9164	M	0.68317	2.08	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.85130	0.997;0.997	D	0.97454	1.0030	10	0.87932	D	0	.	13.1436	0.59448	0.0:0.9238:0.0:0.0762	.	134;134	F1D8S4;Q07869	.;PPARA_HUMAN	V	134	ENSP00000379322:L134V;ENSP00000262735:L134V;ENSP00000385523:L134V;ENSP00000385246:L134V;ENSP00000408149:L134V	ENSP00000262735:L134V	L	+	1	2	PPARA	44992854	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	4.804000	0.62554	2.658000	0.90341	0.591000	0.81541	CTG	.	.		0.483	PPARA-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318129.3	NM_001001928	
YY2	404281	hgsc.bcm.edu	37	X	21875452	21875452	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chrX:21875452G>T	ENST00000429584.2	+	1	1348	c.850G>T	c.(850-852)Gta>Tta	p.V284L	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000379484.5_Intron|MBTPS2_ENST00000365779.2_Intron	NM_206923.3	NP_996806.2	O15391	TYY2_HUMAN	YY2 transcription factor	284	Mediates transcriptional repression.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	19						CAGAGTCCACGTATGTGCAGA	0.532																																					p.V284L		Atlas-SNP	.											.	YY2	43	.	0			c.G850T						.						148.0	144.0	146.0					X																	21875452		2203	4300	6503	SO:0001583	missense	404281	exon1			GTCCACGTATGTG	AK091850	CCDS14202.1	Xp22.2-p22.1	2011-02-11			ENSG00000230797	ENSG00000230797		"""Zinc fingers, C2H2-type"""	31684	protein-coding gene	gene with protein product	"""transcription factor yin yang 2"""	300570				14702039	Standard	NM_206923		Approved	ZNF631	uc011mjp.2	O15391	OTTHUMG00000021236	ENST00000429584.2:c.850G>T	chrX.hg19:g.21875452G>T	ENSP00000389381:p.Val284Leu	152.0	0.0		180.0	39.0	NM_206923	B2RP10|Q6Q1S4	Missense_Mutation	SNP	ENST00000429584.2	hg19	CCDS14202.1	.	.	.	.	.	.	.	.	.	.	G	13.80	2.346360	0.41599	.	.	ENSG00000230797	ENST00000429584	T	0.35605	1.3	4.43	1.68	0.24146	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	U	0.000000	T	0.21347	0.0514	N	0.17922	0.545	0.50467	D	0.99987	P	0.40360	0.714	B	0.38562	0.276	T	0.03364	-1.1044	10	0.66056	D	0.02	.	7.5425	0.27746	0.3024:0.0:0.6975:0.0	.	284	O15391	TYY2_HUMAN	L	284	ENSP00000389381:V284L	ENSP00000389381:V284L	V	+	1	0	YY2	21785373	1.000000	0.71417	0.015000	0.15790	0.478000	0.33099	3.401000	0.52601	0.441000	0.26529	0.600000	0.82982	GTA	.	.		0.532	YY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056025.1	NM_206923	
FAM47A	158724	hgsc.bcm.edu	37	X	34148744	34148744	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chrX:34148744C>T	ENST00000346193.3	-	1	1703	c.1652G>A	c.(1651-1653)cGt>cAt	p.R551H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	551										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GGACACCCGACGACTCTTGGG	0.602																																					p.R551H		Atlas-SNP	.											.	FAM47A	249	.	0			c.G1652A						.						52.0	53.0	53.0					X																	34148744		2192	4292	6484	SO:0001583	missense	158724	exon1			ACCCGACGACTCT	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1652G>A	chrX.hg19:g.34148744C>T	ENSP00000345029:p.Arg551His	73.0	0.0		109.0	5.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	7.547	0.661842	0.14645	.	.	ENSG00000185448	ENST00000346193	T	0.29397	1.57	0.673	-0.29	0.12847	.	.	.	.	.	T	0.34687	0.0906	L	0.34521	1.04	0.09310	N	1	D	0.69078	0.997	D	0.64237	0.923	T	0.18272	-1.0342	8	0.42905	T	0.14	.	.	.	.	.	551	Q5JRC9	FA47A_HUMAN	H	551	ENSP00000345029:R551H	ENSP00000345029:R551H	R	-	2	0	FAM47A	34058665	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	-1.671000	0.01954	-0.242000	0.09667	-0.785000	0.03343	CGT	.	.		0.602	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
GRIPAP1	56850	hgsc.bcm.edu	37	X	48840243	48840243	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chrX:48840243G>T	ENST00000376441.1	-	15	1250	c.1216C>A	c.(1216-1218)Caa>Aaa	p.Q406K	GRIPAP1_ENST00000376444.3_Missense_Mutation_p.Q361K|GRIPAP1_ENST00000376425.3_Missense_Mutation_p.Q375K|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.Q353K|GRIPAP1_ENST00000473581.1_5'UTR	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	406						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						CCTATTTCTTGAAGTTGTTCC	0.507																																					p.Q406K		Atlas-SNP	.											.	GRIPAP1	128	.	0			c.C1216A						.						240.0	181.0	201.0					X																	48840243		2203	4300	6503	SO:0001583	missense	56850	exon15			TTTCTTGAAGTTG	AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1216C>A	chrX.hg19:g.48840243G>T	ENSP00000365624:p.Gln406Lys	99.0	0.0		90.0	18.0	NM_020137	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	ENST00000376441.1	hg19	CCDS35248.1	.	.	.	.	.	.	.	.	.	.	-	15.29	2.790949	0.50102	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T;T	0.24151	1.87;1.87;1.87;1.87	4.74	4.74	0.60224	.	0.166997	0.41194	D	0.000940	T	0.36936	0.0985	L	0.53249	1.67	0.28256	N	0.925037	P;P;D	0.57257	0.914;0.859;0.979	P;P;P	0.56563	0.501;0.554;0.801	T	0.25467	-1.0131	10	0.10902	T	0.67	-1.4095	15.7813	0.78264	0.0:0.0:1.0:0.0	.	353;296;406	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	K	375;361;406;375;353	ENSP00000365608:Q375K;ENSP00000365627:Q361K;ENSP00000365624:Q406K;ENSP00000365606:Q353K	ENSP00000365606:Q353K	Q	-	1	0	GRIPAP1	48725187	1.000000	0.71417	0.976000	0.42696	0.305000	0.27757	4.768000	0.62293	1.970000	0.57323	0.522000	0.50473	CAA	.	.		0.507	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080970.2	NM_207672	
TRO	7216	hgsc.bcm.edu	37	X	54949797	54949797	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chrX:54949797C>A	ENST00000173898.7	+	3	944	c.832C>A	c.(832-834)Cta>Ata	p.L278I	TRO_ENST00000399736.1_Intron|TRO_ENST00000319167.8_Missense_Mutation_p.L278I|TRO_ENST00000375022.4_Missense_Mutation_p.L278I|TRO_ENST00000375041.2_Intron|TRO_ENST00000484031.1_Intron|TRO_ENST00000420798.2_Intron	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	278					embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						TATAGAGGCTCTAAATGTCAC	0.507																																					p.L278I		Atlas-SNP	.											.	TRO	246	.	0			c.C832A						.						32.0	30.0	30.0					X																	54949797		1992	4145	6137	SO:0001583	missense	7216	exon3			GAGGCTCTAAATG	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.832C>A	chrX.hg19:g.54949797C>A	ENSP00000173898:p.Leu278Ile	262.0	0.0		289.0	60.0	NM_016157	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	ENST00000173898.7	hg19	CCDS43959.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.021981	0.00414	.	.	ENSG00000067445	ENST00000173898;ENST00000319167;ENST00000375022	T;T;T	0.41758	0.99;3.79;3.79	3.13	0.337	0.15966	.	.	.	.	.	T	0.18467	0.0443	N	0.08118	0	0.09310	N	1	B;B	0.16603	0.018;0.009	B;B	0.14578	0.011;0.003	T	0.25537	-1.0129	8	.	.	.	.	4.9041	0.13789	0.0:0.5741:0.1793:0.2466	.	278;278	Q96SX2;Q12816	.;TROP_HUMAN	I	278	ENSP00000173898:L278I;ENSP00000318278:L278I;ENSP00000364162:L278I	.	L	+	1	2	TRO	54966522	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.332000	0.07904	-0.342000	0.08363	-1.563000	0.00883	CTA	.	.		0.507	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
TXLNG	55787	hgsc.bcm.edu	37	X	16836781	16836782	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chrX:16836781_16836782insT	ENST00000380122.5	+	2	248_249	c.187_188insT	c.(187-189)attfs	p.I63fs	TXLNG_ENST00000398155.4_Intron	NM_018360.2	NP_060830.2	Q9NUQ3	TXLNG_HUMAN	taxilin gamma	63					cell cycle (GO:0007049)|regulation of bone mineralization (GO:0030500)|regulation of cell cycle (GO:0051726)|regulation of cell cycle process (GO:0010564)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)	protein heterodimerization activity (GO:0046982)	p.I63S(1)		breast(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	15						ATCAAATGATATTCTTCAACAT	0.396																																					p.I63fs		Atlas-INDEL	.											.	TXLNG	40	.	1	Substitution - Missense(1)	skin(1)	c.187_188insT						.																																			SO:0001589	frameshift_variant	55787	exon2			.	AK002071	CCDS14178.1, CCDS55373.1	Xp22.2	2014-05-07	2010-04-20	2010-04-20	ENSG00000086712	ENSG00000086712			18578	protein-coding gene	gene with protein product	"""lipopolysaccharide specific response-5 protein"", ""factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription"""	300677	"""chromosome X open reading frame 15"""	CXorf15		15911876, 15184072, 16831913	Standard	NM_018360		Approved	FLJ11209, LSR5, FIAT, MGC126621, MGC126625, TXLNGX	uc004cxq.2	Q9NUQ3	OTTHUMG00000021196	ENST00000380122.5:c.189dupT	chrX.hg19:g.16836783_16836783dupT	ENSP00000369465:p.Ile63fs	439.0	0.0		483.0	93.0	NM_018360	Q2KQ75|Q5JNZ7|Q9P0X1	Frame_Shift_Ins	INS	ENST00000380122.5	hg19	CCDS14178.1																																																																																			.	.		0.396	TXLNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055912.1	NM_018360	
IGSF1	3547	hgsc.bcm.edu	37	X	130417074	130417074	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chrX:130417074C>A	ENST00000361420.3	-	6	911	c.832G>T	c.(832-834)Gag>Tag	p.E278*	IGSF1_ENST00000370910.1_Nonsense_Mutation_p.E269*|IGSF1_ENST00000370903.3_Nonsense_Mutation_p.E278*|IGSF1_ENST00000370904.1_Nonsense_Mutation_p.E269*			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	278	Ig-like C2-type 3.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						AAATTTGCCTCATTTTTTATT	0.398																																					p.E278X		Atlas-SNP	.											.	IGSF1	231	.	0			c.G832T						.						113.0	98.0	103.0					X																	130417074		2203	4300	6503	SO:0001587	stop_gained	3547	exon6			TTGCCTCATTTTT	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.832G>T	chrX.hg19:g.130417074C>A	ENSP00000355010:p.Glu278*	450.0	0.0		470.0	26.0	NM_001555	B5MEG2|H9KV64|O15070|Q9NTC8	Nonsense_Mutation	SNP	ENST00000361420.3	hg19	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	C	32	5.120958	0.94385	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	.	.	.	4.64	3.71	0.42584	.	0.290655	0.24815	N	0.035365	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	.	8.3888	0.32516	0.2329:0.7671:0.0:0.0	.	.	.	.	X	269;278;269;278	.	ENSP00000355010:E278X	E	-	1	0	IGSF1	130244755	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	1.212000	0.32394	2.308000	0.77769	0.594000	0.82650	GAG	.	.		0.398	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		
FMO3	2328	hgsc.bcm.edu	37	1	171086300	171086302	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:171086300_171086302delCTT	ENST00000367755.4	+	9	1428_1430	c.1317_1319delCTT	c.(1315-1320)tccttc>tcc	p.F440del	FMO3_ENST00000538429.1_In_Frame_Del_p.F377del|FMO3_ENST00000392085.2_In_Frame_Del_p.F440del|FMO3_ENST00000542847.1_In_Frame_Del_p.F420del	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	440					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	AACTCTCCTCCTTCATTGGGGCA	0.463																																					p.439_440del		Atlas-INDEL	.											.	FMO3	73	.	0			c.1316_1318del						.																																			SO:0001651	inframe_deletion	2328	exon9			.	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1317_1319delCTT	chr1.hg19:g.171086300_171086302delCTT	ENSP00000356729:p.Phe440del	135.0	0.0		142.0	16.0	NM_001002294	B2R816|Q14854|Q8N5N5	In_Frame_Del	DEL	ENST00000367755.4	hg19	CCDS1292.1																																																																																			.	.		0.463	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
MGAT4B	11282	hgsc.bcm.edu	37	5	179228997	179228997	+	Intron	DEL	G	G	-			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr5:179228997delG	ENST00000292591.7	-	2	448				MGAT4B_ENST00000337755.5_Frame_Shift_Del_p.L39fs|MGAT4B_ENST00000521305.1_Intron	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B						cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCCGTCACGAGGGGGCGGTCT	0.622											OREG0017110	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L39fs	GBM(13;414 434 4098 22176 23230)	Atlas-INDEL	.											.	MGAT4B	41	.	0			c.116delT						.						64.0	74.0	71.0					5																	179228997		2203	4300	6503	SO:0001627	intron_variant	11282	exon1			.	AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.98-28C>-	chr5.hg19:g.179228997delG		123.0	0.0	1952	152.0	48.0	NM_054013	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Frame_Shift_Del	DEL	ENST00000292591.7	hg19	CCDS4448.1																																																																																			.	.		0.622	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253503.3	NM_014275	
LCE1F	353137	hgsc.bcm.edu	37	1	152749026	152749027	+	In_Frame_Ins	INS	-	-	CAGCTCTGGGGGCTGCTG	rs201223178	byFrequency	TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:152749026_152749027insCAGCTCTGGGGGCTGCTG	ENST00000334371.2	+	1	179_180	c.179_180insCAGCTCTGGGGGCTGCTG	c.(178-183)tgcagc>tgCAGCTCTGGGGGCTGCTGcagc	p.60_61CS>CSSGGCCS		NM_178354.2	NP_848131.1	Q5T754	LCE1F_HUMAN	late cornified envelope 1F	60					keratinization (GO:0031424)					kidney(1)|large_intestine(2)|lung(7)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGGGGCTGCTGCAGCTCTGGGG	0.678																																					p.C60delinsCSSGGCC		Atlas-INDEL	.											.	LCE1F	42	.	0			c.179_180insCAGCTCTGGGGGCTGCTG						.																																			SO:0001652	inframe_insertion	353137	exon1			.		CCDS1023.1	1q21.3	2008-02-05			ENSG00000240386	ENSG00000240386		"""Late cornified envelopes"""	29467	protein-coding gene	gene with protein product		612608				11698679	Standard	NM_178354		Approved	LEP6	uc010pdv.2	Q5T754	OTTHUMG00000012403	ENST00000334371.2:c.162_179dupCAGCTCTGGGGGCTGCTG	chr1.hg19:g.152749026_152749027insCAGCTCTGGGGGCTGCTG	ENSP00000334187:p.Ser55_Cys60dup	178.0	0.0		281.0	31.0	NM_178354		In_Frame_Ins	INS	ENST00000334371.2	hg19	CCDS1023.1																																																																																			.	.		0.678	LCE1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034523.2	NM_178354	
PPP1R12B	4660	hgsc.bcm.edu	37	1	202318209	202318209	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AADK-01A-11D-A40R-10	TCGA-DD-AADK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	81255bf2-6aa2-4e6b-a03b-09b29c43c763	e0c3f2fd-7b5a-4c19-828c-8f89bcfc39ee	g.chr1:202318209delT	ENST00000608999.1	+	1	383	c.230delT	c.(229-231)cttfs	p.L78fs	PPP1R12B_ENST00000356764.2_Frame_Shift_Del_p.L78fs|PPP1R12B_ENST00000336894.4_Frame_Shift_Del_p.L78fs|PPP1R12B_ENST00000480184.1_Frame_Shift_Del_p.L78fs	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B	78					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			GTGAGAAAGCTTCTGGCAAGA	0.612																																					p.L77fs		Atlas-INDEL	.											.	PPP1R12B	100	.	0			c.229delC						.						43.0	39.0	40.0					1																	202318209		2203	4300	6503	SO:0001589	frameshift_variant	4660	exon1			.	AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.230delT	chr1.hg19:g.202318209delT	ENSP00000476755:p.Leu78fs	95.0	0.0		149.0	24.0	NM_001167857	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Frame_Shift_Del	DEL	ENST00000608999.1	hg19	CCDS1426.1																																																																																			.	.		0.612	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099166.3	NM_032105	
