#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ANGPTL7	10218	hgsc.bcm.edu	37	1	11249740	11249740	+	Missense_Mutation	SNP	C	C	T	rs554783669		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:11249740C>T	ENST00000376819.3	+	1	343	c.104C>T	c.(103-105)cCa>cTa	p.P35L	MTOR_ENST00000361445.4_Intron	NM_021146.2	NP_066969.1	O43827	ANGL7_HUMAN	angiopoietin-like 7	35					response to oxidative stress (GO:0006979)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.39e-06)|COAD - Colon adenocarcinoma(227;0.000244)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0487)		CACAAGACACCAGCACAGCCA	0.552													C|||	1	0.000199681	0.0	0.0	5008	,	,		21423	0.001		0.0	False		,,,				2504	0.0				p.P35L		Atlas-SNP	.											.	ANGPTL7	23	.	0			c.C104T						.						64.0	64.0	64.0					1																	11249740		2203	4300	6503	SO:0001583	missense	10218	exon1			AGACACCAGCACA	Y16132	CCDS128.1	1p36	2013-02-06			ENSG00000171819	ENSG00000171819		"""Fibrinogen C domain containing"""	24078	protein-coding gene	gene with protein product						9727400, 11682471	Standard	NM_021146		Approved	CDT6, AngX	uc001ase.4	O43827	OTTHUMG00000002002	ENST00000376819.3:c.104C>T	chr1.hg19:g.11249740C>T	ENSP00000366015:p.Pro35Leu	146.0	0.0		157.0	57.0	NM_021146	B2R9B2|F1T0A6|Q4ZGK4	Missense_Mutation	SNP	ENST00000376819.3	hg19	CCDS128.1	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051330	0.36181	.	.	ENSG00000171819	ENST00000376819	T	0.53206	0.63	4.56	3.65	0.41850	.	1.766140	0.04043	U	0.303386	T	0.38931	0.1059	L	0.27053	0.805	0.45946	D	0.998778	B	0.09022	0.002	B	0.06405	0.002	T	0.02625	-1.1132	10	0.27785	T	0.31	.	10.4341	0.44424	0.1956:0.8044:0.0:0.0	.	35	O43827	ANGL7_HUMAN	L	35	ENSP00000366015:P35L	ENSP00000366015:P35L	P	+	2	0	ANGPTL7	11172327	0.036000	0.19791	0.956000	0.39512	0.750000	0.42670	3.098000	0.50259	1.040000	0.40099	-0.122000	0.15005	CCA	.	.		0.552	ANGPTL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005564.1	NM_021146	
STMN1	3925	hgsc.bcm.edu	37	1	26230232	26230232	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:26230232T>A	ENST00000399728.1	-	3	449	c.86A>T	c.(85-87)aAa>aTa	p.K29I	STMN1_ENST00000357865.2_Missense_Mutation_p.K29I|STMN1_ENST00000426559.2_Missense_Mutation_p.K29I|STMN1_ENST00000455785.2_Missense_Mutation_p.K29I|STMN1_ENST00000465604.1_5'UTR|STMN1_ENST00000374291.1_Missense_Mutation_p.K29I|MIR3917_ENST00000580971.1_RNA	NM_203401.1	NP_981946.1	P16949	STMN1_HUMAN	stathmin 1	29	SLD. {ECO:0000255|PROSITE- ProRule:PRU00998}.				axonogenesis (GO:0007409)|intracellular signal transduction (GO:0035556)|microtubule depolymerization (GO:0007019)|mitotic spindle organization (GO:0007052)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of cellular component movement (GO:0051272)|response to virus (GO:0009615)|signal transduction (GO:0007165)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|microtubule (GO:0005874)	signal transducer activity (GO:0004871)|tubulin binding (GO:0015631)			breast(2)|large_intestine(2)|skin(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000163)|all_lung(284;0.000234)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.013)|READ - Rectum adenocarcinoma(331;0.0649)		AACAGATTCTTTTGACCGAGG	0.433																																					p.K29I		Atlas-SNP	.											.	STMN1	22	.	0			c.A86T						.						77.0	84.0	82.0					1																	26230232		2203	4300	6503	SO:0001583	missense	3925	exon3			GATTCTTTTGACC	J04991	CCDS269.1, CCDS44090.1	1p36.11	2011-02-09	2009-04-28	2001-07-13	ENSG00000117632	ENSG00000117632			6510	protein-coding gene	gene with protein product	"""oncoprotein 18"""	151442	"""chromosome 1 open reading frame 215"", ""stathmin 1/oncoprotein 18"""	LAP18, C1orf215		2917975	Standard	NM_005563		Approved	SMN, OP18, PR22, PP19, PP17, Lag, FLJ32206	uc010oev.2	P16949	OTTHUMG00000007389	ENST00000399728.1:c.86A>T	chr1.hg19:g.26230232T>A	ENSP00000382633:p.Lys29Ile	61.0	0.0		71.0	20.0	NM_005563	A2A2D1|B2R4E7|B7Z8N4|D3DPJ5	Missense_Mutation	SNP	ENST00000399728.1	hg19	CCDS269.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.621195	0.46736	.	.	ENSG00000117632	ENST00000426559;ENST00000455785;ENST00000399728;ENST00000357865;ENST00000374291;ENST00000446334	.	.	.	5.72	5.72	0.89469	.	0.229569	0.46145	D	0.000301	T	0.34803	0.0910	L	0.42245	1.32	0.21841	N	0.999514	P;P;P	0.39404	0.672;0.533;0.533	B;B;B	0.38194	0.195;0.267;0.25	T	0.30707	-0.9969	9	0.30854	T	0.27	.	10.8717	0.46887	0.1405:0.0:0.0:0.8595	.	29;29;29	P16949-2;B5BU83;P16949	.;.;STMN1_HUMAN	I	29	.	ENSP00000350531:K29I	K	-	2	0	STMN1	26102819	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.622000	0.54217	2.194000	0.70268	0.533000	0.62120	AAA	.	.		0.433	STMN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019359.1	NM_005563	
CYP4B1	1580	hgsc.bcm.edu	37	1	47279879	47279879	+	Splice_Site	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:47279879A>G	ENST00000271153.4	+	7	808		c.e7-1		CYP4B1_ENST00000452782.2_Splice_Site|CYP4B1_ENST00000371919.4_Splice_Site|CYP4B1_ENST00000371923.4_Splice_Site			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1						biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	CTTTTGGTTCAGACCAGGTCA	0.577																																					.		Atlas-SNP	.											.	CYP4B1	81	.	0			c.776-2A>G						.						61.0	63.0	62.0					1																	47279879		2203	4300	6503	SO:0001630	splice_region_variant	1580	exon7			TGGTTCAGACCAG	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.773-1A>G	chr1.hg19:g.47279879A>G		74.0	0.0		83.0	26.0	NM_001099772	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Splice_Site	SNP	ENST00000271153.4	hg19	CCDS542.1	.	.	.	.	.	.	.	.	.	.	A	13.47	2.246845	0.39697	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000452782;ENST00000468637	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.598	0.76602	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CYP4B1	47052466	1.000000	0.71417	0.841000	0.33234	0.263000	0.26337	8.888000	0.92464	2.100000	0.63781	0.391000	0.25812	.	.	.		0.577	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	Intron
CYP4A11	1579	hgsc.bcm.edu	37	1	47400132	47400132	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:47400132A>G	ENST00000310638.4	-	7	921	c.890T>C	c.(889-891)tTg>tCg	p.L297S	CYP4A11_ENST00000457840.2_Silent_p.L141L|CYP4A11_ENST00000462347.1_Silent_p.L245L|CYP4A11_ENST00000496519.1_5'Flank|CYP4A11_ENST00000371904.4_Missense_Mutation_p.L298S|CYP4A11_ENST00000371905.1_Missense_Mutation_p.L297S	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	297					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	CACTTTGGCCAAGAGGAGGAT	0.498																																					p.L297S		Atlas-SNP	.											.	CYP4A11	77	.	0			c.T890C						.						120.0	115.0	117.0					1																	47400132		2203	4300	6503	SO:0001583	missense	1579	exon7			TTGGCCAAGAGGA	L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.890T>C	chr1.hg19:g.47400132A>G	ENSP00000311095:p.Leu297Ser	115.0	0.0		181.0	47.0	NM_000778	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	ENST00000310638.4	hg19	CCDS543.1	.	.	.	.	.	.	.	.	.	.	N	0.562	-0.844804	0.02671	.	.	ENSG00000187048	ENST00000310638;ENST00000371904;ENST00000371905	T;T;T	0.69435	-0.4;-0.4;-0.4	5.23	1.73	0.24493	.	0.622767	0.18285	N	0.145912	T	0.44074	0.1276	N	0.17312	0.475	0.09310	N	1	B	0.09022	0.002	B	0.15052	0.012	T	0.21827	-1.0234	10	0.09590	T	0.72	.	9.707	0.40222	0.5497:0.3722:0.0781:0.0	.	297	Q02928	CP4AB_HUMAN	S	297;298;297	ENSP00000311095:L297S;ENSP00000360971:L298S;ENSP00000360972:L297S	ENSP00000311095:L297S	L	-	2	0	CYP4A11	47172719	0.005000	0.15991	0.025000	0.17156	0.402000	0.30811	0.683000	0.25349	0.059000	0.16252	0.528000	0.53228	TTG	.	.		0.498	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022022.1	NM_000778	
LRP8	7804	hgsc.bcm.edu	37	1	53715077	53715077	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:53715077G>A	ENST00000306052.6	-	18	2929	c.2828C>T	c.(2827-2829)tCc>tTc	p.S943F	LRP8_ENST00000354412.3_Intron|LRP8_ENST00000465675.1_Intron|LRP8_ENST00000371454.2_Intron|LRP8_ENST00000347547.2_Missense_Mutation_p.S773F	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	943					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						AGGCAGCTCGGAAAGAGGGTT	0.587																																					p.S943F		Atlas-SNP	.											.	LRP8	58	.	0			c.C2828T						.						80.0	72.0	75.0					1																	53715077		2203	4300	6503	SO:0001583	missense	7804	exon18			AGCTCGGAAAGAG	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2828C>T	chr1.hg19:g.53715077G>A	ENSP00000303634:p.Ser943Phe	94.0	0.0		111.0	34.0	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	hg19	CCDS578.1	.	.	.	.	.	.	.	.	.	.	G	15.97	2.990386	0.54041	.	.	ENSG00000157193	ENST00000306052;ENST00000347547	D;D	0.90955	-2.76;-2.73	4.02	3.09	0.35607	.	.	.	.	.	D	0.85788	0.5778	N	0.19112	0.55	0.34984	D	0.754368	D;D	0.60575	0.97;0.988	P;P	0.49708	0.62;0.601	D	0.88243	0.2911	9	0.87932	D	0	.	9.0878	0.36592	0.0:0.0:0.7814:0.2186	.	773;943	Q14114-4;Q14114	.;LRP8_HUMAN	F	943;773	ENSP00000303634:S943F;ENSP00000334522:S773F	ENSP00000303634:S943F	S	-	2	0	LRP8	53487665	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.817000	0.55668	1.252000	0.44001	0.467000	0.42956	TCC	.	.		0.587	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144892215	144892215	+	Intron	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:144892215T>A	ENST00000369354.3	-	22	3094				PDE4DIP_ENST00000524974.1_Intron|PDE4DIP_ENST00000369349.3_Nonstop_Mutation_p.*970L|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000313431.9_Nonstop_Mutation_p.*1133L|PDE4DIP_ENST00000369356.4_Intron|PDE4DIP_ENST00000369351.3_3'UTR|PDE4DIP_ENST00000313382.9_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTTCTGAAGCTATAGCTACAG	0.453			T	PDGFRB	MPD																																p.X1133L		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.A3398T						.						65.0	68.0	67.0					1																	144892215		2203	4296	6499	SO:0001627	intron_variant	9659	exon19			TGAAGCTATAGCT	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.2904+285A>T	chr1.hg19:g.144892215T>A		164.0	0.0		246.0	42.0	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396444	0.62177	.	.	ENSG00000178104	ENST00000369349;ENST00000313431	.	.	.	4.85	3.7	0.42460	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.7886	0.18347	0.0:0.1208:0.0:0.8792	.	.	.	.	L	970;1133	.	.	X	-	2	0	PDE4DIP	143603572	1.000000	0.71417	0.998000	0.56505	0.811000	0.45836	1.993000	0.40747	2.060000	0.61445	0.529000	0.55759	TAG	.	.		0.453	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
FLG2	388698	hgsc.bcm.edu	37	1	152323287	152323287	+	Silent	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:152323287T>A	ENST00000388718.5	-	3	7047	c.6975A>T	c.(6973-6975)gcA>gcT	p.A2325A	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	2325					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAAATGACTTGCTCTACTAG	0.458																																					p.A2325A		Atlas-SNP	.											.	FLG2	431	.	0			c.A6975T						.						299.0	275.0	283.0					1																	152323287		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			ATGACTTGCTCTA	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.6975A>T	chr1.hg19:g.152323287T>A		104.0	0.0		147.0	50.0	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	hg19	CCDS30861.1																																																																																			.	.		0.458	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
ASH1L	55870	hgsc.bcm.edu	37	1	155319387	155319387	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:155319387T>C	ENST00000368346.3	-	18	8021	c.7382A>G	c.(7381-7383)gAt>gGt	p.D2461G	ASH1L_ENST00000392403.3_Splice_Site_p.D2456G			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2461					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CCGGGAAGAATCTGCAAAAGA	0.413																																					p.D2456G		Atlas-SNP	.											.	ASH1L	279	.	0			c.A7367G						.						44.0	44.0	44.0					1																	155319387		2203	4300	6503	SO:0001630	splice_region_variant	55870	exon18			GAAGAATCTGCAA	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.7382-1A>G	chr1.hg19:g.155319387T>C		218.0	0.0		252.0	86.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	T	23.5	4.420079	0.83559	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	T;T	0.34275	1.37;1.37	5.02	5.02	0.67125	Bromodomain (4);	0.047006	0.85682	D	0.000000	T	0.54175	0.1842	M	0.81614	2.55	0.80722	D	1	D;D	0.67145	0.996;0.995	D;D	0.79108	0.992;0.985	T	0.61893	-0.6969	10	0.72032	D	0.01	.	14.5653	0.68171	0.0:0.0:0.0:1.0	.	2461;2456	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	G	2461;2456	ENSP00000357330:D2461G;ENSP00000376204:D2456G	ENSP00000357330:D2461G	D	-	2	0	ASH1L	153586011	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	6.686000	0.74548	2.118000	0.64928	0.454000	0.30748	GAT	.	.		0.413	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	Missense_Mutation
CD5L	922	hgsc.bcm.edu	37	1	157805814	157805814	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:157805814G>A	ENST00000368174.4	-	3	283	c.187C>T	c.(187-189)Cgg>Tgg	p.R63W	CD5L_ENST00000484609.1_5'UTR	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	63	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCAGCTCCCGGCACAACACA	0.577																																					p.R63W		Atlas-SNP	.											.	CD5L	112	.	0			c.C187T						.						128.0	130.0	130.0					1																	157805814		2203	4300	6503	SO:0001583	missense	922	exon3			GCTCCCGGCACAA	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.187C>T	chr1.hg19:g.157805814G>A	ENSP00000357156:p.Arg63Trp	45.0	0.0		80.0	29.0	NM_005894	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	hg19	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666152	0.47677	.	.	ENSG00000073754	ENST00000368174	T	0.44482	0.92	4.85	1.82	0.25136	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.343624	0.21072	N	0.080652	T	0.51126	0.1656	H	0.96833	3.89	0.30263	N	0.792999	D	0.69078	0.997	P	0.56788	0.806	T	0.51228	-0.8732	10	0.72032	D	0.01	.	3.1111	0.06359	0.0872:0.1533:0.4444:0.3151	.	63	O43866	CD5L_HUMAN	W	63	ENSP00000357156:R63W	ENSP00000357156:R63W	R	-	1	2	CD5L	156072438	0.008000	0.16893	0.997000	0.53966	0.758000	0.43043	0.000000	0.12993	0.202000	0.20498	0.563000	0.77884	CGG	.	.		0.577	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
SPTA1	6708	hgsc.bcm.edu	37	1	158595952	158595952	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:158595952G>T	ENST00000368147.4	-	42	6074	c.5894C>A	c.(5893-5895)aCt>aAt	p.T1965N		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1965					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGCCAGAAGAGTGAGGAAGTC	0.398																																					p.T1965N		Atlas-SNP	.											.	SPTA1	720	.	0			c.C5894A						.						119.0	119.0	119.0					1																	158595952		1920	4120	6040	SO:0001583	missense	6708	exon42			AGAAGAGTGAGGA	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.5894C>A	chr1.hg19:g.158595952G>T	ENSP00000357129:p.Thr1965Asn	101.0	0.0		164.0	49.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.901993	0.33535	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.49139	0.79;0.79	4.93	2.91	0.33838	.	0.251551	0.20859	N	0.084397	T	0.37210	0.0995	L	0.51422	1.61	0.28046	N	0.93354	D	0.53462	0.96	P	0.57009	0.811	T	0.07083	-1.0791	10	0.36615	T	0.2	.	8.3622	0.32365	0.2082:0.0:0.7918:0.0	.	1965	P02549	SPTA1_HUMAN	N	1965;1962	ENSP00000357130:T1965N;ENSP00000357129:T1962N	ENSP00000357129:T1962N	T	-	2	0	SPTA1	156862576	0.917000	0.31117	0.023000	0.16930	0.215000	0.24574	1.594000	0.36697	1.303000	0.44873	0.563000	0.77884	ACT	.	.		0.398	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
FCRL6	343413	hgsc.bcm.edu	37	1	159772232	159772232	+	Silent	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:159772232T>A	ENST00000368106.3	+	1	19	c.18T>A	c.(16-18)gcT>gcA	p.A6A	FCRL6_ENST00000321935.6_Silent_p.A13A|FCRL6_ENST00000339348.5_Silent_p.A6A|FCRL6_ENST00000392235.3_Silent_p.A6A	NM_001004310.2	NP_001004310.2	Q6DN72	FCRL6_HUMAN	Fc receptor-like 6	6						external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	24	all_hematologic(112;0.0597)					TCTGGACGGCTGTGCTGCTCT	0.572																																					p.A6A		Atlas-SNP	.											.	FCRL6	61	.	0			c.T18A						.						80.0	58.0	65.0					1																	159772232		2203	4300	6503	SO:0001819	synonymous_variant	343413	exon1			GACGGCTGTGCTG	AK131201	CCDS30912.1, CCDS60312.1	1q23.2	2013-01-11			ENSG00000181036	ENSG00000181036		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31910	protein-coding gene	gene with protein product		613562					Standard	NM_001004310		Approved	IFGP6, FLJ16056, FcRH6	uc001fud.4	Q6DN72	OTTHUMG00000035351	ENST00000368106.3:c.18T>A	chr1.hg19:g.159772232T>A		42.0	0.0		62.0	17.0	NM_001004310	A1KXW6|A2A4D6|Q6DN73|Q6XRC3|Q6ZNI1	Silent	SNP	ENST00000368106.3	hg19	CCDS30912.1																																																																																			.	.		0.572	FCRL6-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276853.1	NM_001004310	
SLC19A2	10560	hgsc.bcm.edu	37	1	169446983	169446983	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:169446983T>C	ENST00000236137.5	-	2	453	c.217A>G	c.(217-219)Att>Gtt	p.I73V	SLC19A2_ENST00000367804.4_Intron	NM_006996.2	NP_008927.1	O60779	S19A2_HUMAN	solute carrier family 19 (thiamine transporter), member 2	73					folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|thiamine transport (GO:0015888)|thiamine-containing compound metabolic process (GO:0042723)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid transporter activity (GO:0008517)|thiamine transmembrane transporter activity (GO:0015234)|thiamine uptake transmembrane transporter activity (GO:0015403)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	11	all_hematologic(923;0.208)				Thiamine(DB00152)	ACTGGATAAATTTCATTGAAG	0.363																																					p.I73V		Atlas-SNP	.											.	SLC19A2	35	.	0			c.A217G						.						29.0	27.0	27.0					1																	169446983		2203	4300	6503	SO:0001583	missense	10560	exon2			GATAAATTTCATT	AF135488	CCDS1280.1	1q23.3	2013-05-22			ENSG00000117479	ENSG00000117479		"""Solute carriers"""	10938	protein-coding gene	gene with protein product		603941		TRMA		9399900, 10391221	Standard	NM_006996		Approved	THTR1	uc001gge.4	O60779	OTTHUMG00000035452	ENST00000236137.5:c.217A>G	chr1.hg19:g.169446983T>C	ENSP00000236137:p.Ile73Val	227.0	0.0		333.0	126.0	NM_006996	B2R9H0|B4E1X4|Q8WV87|Q9UBL7|Q9UKJ2|Q9UN31|Q9UN43	Missense_Mutation	SNP	ENST00000236137.5	hg19	CCDS1280.1	.	.	.	.	.	.	.	.	.	.	T	12.30	1.895528	0.33442	.	.	ENSG00000117479	ENST00000236137;ENST00000367802	D;D	0.85013	-1.93;-1.93	4.44	4.44	0.53790	Major facilitator superfamily domain, general substrate transporter (1);	0.050436	0.85682	D	0.000000	T	0.75406	0.3845	L	0.35542	1.07	0.39660	D	0.970595	B	0.34241	0.444	P	0.47786	0.557	T	0.72754	-0.4198	9	0.09590	T	0.72	-21.0558	14.1622	0.65454	0.0:0.0:0.0:1.0	.	73	O60779	S19A2_HUMAN	V	73	ENSP00000236137:I73V;ENSP00000356776:I73V	ENSP00000236137:I73V	I	-	1	0	SLC19A2	167713607	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.315000	0.51951	1.993000	0.58246	0.455000	0.32223	ATT	.	.		0.363	SLC19A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086106.1	NM_006996	
WNT9A	7483	hgsc.bcm.edu	37	1	228109383	228109383	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:228109383T>A	ENST00000272164.5	-	4	944	c.934A>T	c.(934-936)Agg>Tgg	p.R312W		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	312					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				CGGTGGCACCTACGGCCAGCG	0.672																																					p.R312W		Atlas-SNP	.											.	WNT9A	39	.	0			c.A934T						.						31.0	30.0	30.0					1																	228109383		2202	4300	6502	SO:0001583	missense	7483	exon4			GGCACCTACGGCC	AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.934A>T	chr1.hg19:g.228109383T>A	ENSP00000272164:p.Arg312Trp	88.0	0.0		102.0	35.0	NM_003395	A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Missense_Mutation	SNP	ENST00000272164.5	hg19	CCDS31045.1	.	.	.	.	.	.	.	.	.	.	T	18.34	3.602115	0.66445	.	.	ENSG00000143816	ENST00000272164	T	0.76578	-1.03	4.64	2.14	0.27477	.	0.112361	0.64402	D	0.000014	D	0.83922	0.5359	M	0.73319	2.225	0.34845	D	0.741081	D	0.63046	0.992	D	0.63957	0.92	D	0.86659	0.1903	10	0.66056	D	0.02	.	10.4114	0.44296	0.0:0.0:0.3149:0.685	.	312	O14904	WNT9A_HUMAN	W	312	ENSP00000272164:R312W	ENSP00000272164:R312W	R	-	1	2	WNT9A	226176006	0.749000	0.28305	0.998000	0.56505	0.862000	0.49288	2.078000	0.41567	0.243000	0.21327	0.397000	0.26171	AGG	.	.		0.672	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091646.1	NM_003395	
OBSCN	84033	hgsc.bcm.edu	37	1	228447295	228447295	+	Intron	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:228447295A>T	ENST00000422127.1	+	15	4629				OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000570156.2_Missense_Mutation_p.Q1652L|OBSCN_ENST00000366707.4_Intron|OBSCN_ENST00000366709.4_Intron|OBSCN_ENST00000359599.6_Missense_Mutation_p.Q124L	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGGTGGCCCAGGCCCAGACA	0.617																																					p.Q1652L		Atlas-SNP	.											.	OBSCN	2142	.	0			c.A4955T						.						98.0	89.0	92.0					1																	228447295		876	1991	2867	SO:0001627	intron_variant	84033	exon17			TGGCCCAGGCCCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4585+2668A>T	chr1.hg19:g.228447295A>T		100.0	0.0		99.0	33.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	18.72	3.683736	0.68157	.	.	ENSG00000154358	ENST00000359599	T	0.66995	-0.24	5.25	5.25	0.73442	.	.	.	.	.	T	0.71517	0.3349	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68780	-0.5318	6	0.28530	T	0.3	.	15.1356	0.72562	1.0:0.0:0.0:0.0	.	.	.	.	L	124	ENSP00000352613:Q124L	ENSP00000352613:Q124L	Q	+	2	0	OBSCN	226513918	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	8.523000	0.90576	1.984000	0.57885	0.533000	0.62120	CAG	.	.		0.617	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
PGBD5	79605	hgsc.bcm.edu	37	1	230492898	230492898	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:230492898C>G	ENST00000525115.1	-	2	317	c.294G>C	c.(292-294)atG>atC	p.M98I	PGBD5_ENST00000391860.1_Missense_Mutation_p.M52I|PGBD5_ENST00000321327.2_Missense_Mutation_p.M197I			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	98						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GGAACGCCTTCATCTCCGTCA	0.592																																					p.M167I		Atlas-SNP	.											.	PGBD5	73	.	0			c.G501C						.						131.0	106.0	114.0					1																	230492898		2203	4300	6503	SO:0001583	missense	79605	exon2			CGCCTTCATCTCC	AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.294G>C	chr1.hg19:g.230492898C>G	ENSP00000431404:p.Met98Ile	93.0	0.0		119.0	33.0	NM_001258311	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	ENST00000525115.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.10	1.835669	0.32421	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.13538	2.58;2.58;2.58	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.08492	0.0211	N	0.12746	0.255	0.80722	D	1	B	0.13145	0.007	B	0.14578	0.011	T	0.29852	-0.9998	10	0.11485	T	0.65	-59.592	15.6149	0.76756	0.138:0.862:0.0:0.0	.	98	Q8N414	PGBD5_HUMAN	I	52;197;98	ENSP00000375733:M52I;ENSP00000322530:M197I;ENSP00000431404:M98I	ENSP00000322530:M197I	M	-	3	0	PGBD5	228559521	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.970000	0.70431	2.746000	0.94184	0.655000	0.94253	ATG	.	.		0.592	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000382617.1	NM_024554	
PCNXL2	80003	hgsc.bcm.edu	37	1	233388234	233388234	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:233388234T>C	ENST00000258229.9	-	7	2228	c.1994A>G	c.(1993-1995)aAt>aGt	p.N665S	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	665						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TCTTTGTCTATTGCCCTGAAA	0.358																																					p.N665S		Atlas-SNP	.											.	PCNXL2	204	.	0			c.A1994G						.						115.0	108.0	110.0					1																	233388234		1834	4089	5923	SO:0001583	missense	80003	exon7			TGTCTATTGCCCT	AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.1994A>G	chr1.hg19:g.233388234T>C	ENSP00000258229:p.Asn665Ser	129.0	0.0		137.0	50.0	NM_014801	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	ENST00000258229.9	hg19	CCDS44335.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.234803	0.39498	.	.	ENSG00000135749	ENST00000258229	T	0.07327	3.2	5.49	-4.66	0.03329	.	.	.	.	.	T	0.03959	0.0111	N	0.14661	0.345	0.31695	N	0.641377	B	0.12630	0.006	B	0.08055	0.003	T	0.50415	-0.8831	9	0.02654	T	1	.	14.4351	0.67274	0.0:0.6325:0.1032:0.2643	.	665	A6NKB5	PCX2_HUMAN	S	665	ENSP00000258229:N665S	ENSP00000258229:N665S	N	-	2	0	PCNXL2	231454857	0.059000	0.20769	0.109000	0.21407	0.957000	0.61999	-0.856000	0.04290	-0.810000	0.04375	0.455000	0.32223	AAT	.	.		0.358	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092480.3	NM_014801	
RYR2	6262	hgsc.bcm.edu	37	1	237814791	237814791	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:237814791T>A	ENST00000366574.2	+	51	8131	c.7814T>A	c.(7813-7815)aTg>aAg	p.M2605K	RYR2_ENST00000360064.6_Missense_Mutation_p.M2603K|RYR2_ENST00000542537.1_Missense_Mutation_p.M2589K	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2605	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CACGCAAAGATGCCTCTTAAA	0.323																																					p.M2605K		Atlas-SNP	.											.	RYR2	1273	.	0			c.T7814A						.						74.0	66.0	68.0					1																	237814791		1829	4098	5927	SO:0001583	missense	6262	exon51			CAAAGATGCCTCT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7814T>A	chr1.hg19:g.237814791T>A	ENSP00000355533:p.Met2605Lys	141.0	0.0		206.0	77.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.363850	0.82353	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96830	-4.14;-4.14;-4.14	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	D	0.97161	0.9072	M	0.68317	2.08	0.80722	D	1	D	0.65815	0.995	P	0.58721	0.844	D	0.97777	1.0230	10	0.87932	D	0	-19.6589	15.4811	0.75528	0.0:0.0:0.0:1.0	.	2605	Q92736	RYR2_HUMAN	K	2605;2603;2589	ENSP00000355533:M2605K;ENSP00000353174:M2603K;ENSP00000443798:M2589K	ENSP00000353174:M2603K	M	+	2	0	RYR2	235881414	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.972000	0.88022	2.113000	0.64589	0.477000	0.44152	ATG	.	.		0.323	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
WDR64	128025	hgsc.bcm.edu	37	1	241912886	241912886	+	Silent	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:241912886G>A	ENST00000366552.2	+	13	1809	c.1602G>A	c.(1600-1602)gaG>gaA	p.E534E	WDR64_ENST00000437684.2_Silent_p.E534E	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	534										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			GTGGGCAGGAGATGAAGGTGT	0.502																																					p.E534E		Atlas-SNP	.											.	WDR64	234	.	0			c.G1602A						.						132.0	134.0	134.0					1																	241912886		2203	4300	6503	SO:0001819	synonymous_variant	128025	exon13			GCAGGAGATGAAG	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1602G>A	chr1.hg19:g.241912886G>A		159.0	0.0		244.0	31.0	NM_144625	B1ANT0|Q7Z573|Q96LY9	Silent	SNP	ENST00000366552.2	hg19		.	.	.	.	.	.	.	.	.	.	G	9.797	1.179570	0.21787	.	.	ENSG00000162843	ENST00000425826	.	.	.	6.06	3.96	0.45880	.	.	.	.	.	T	0.54951	0.1890	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52495	-0.8568	4	.	.	.	-16.1446	5.696	0.17855	0.2928:0.0:0.7072:0.0	.	.	.	.	K	13	.	.	R	+	2	0	WDR64	239979509	1.000000	0.71417	0.994000	0.49952	0.943000	0.58893	1.690000	0.37711	1.545000	0.49373	0.655000	0.94253	AGA	.	.		0.502	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
OR2G2	81470	hgsc.bcm.edu	37	1	247752022	247752022	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:247752022A>T	ENST00000320065.1	+	1	361	c.361A>T	c.(361-363)Atg>Ttg	p.M121L	RP11-978I15.10_ENST00000435333.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	121						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CCCGGCTGTGATGTCCTGTGA	0.537																																					p.M121L		Atlas-SNP	.											.	OR2G2	88	.	0			c.A361T						.						279.0	223.0	242.0					1																	247752022		2203	4300	6503	SO:0001583	missense	81470	exon1			GCTGTGATGTCCT	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.361A>T	chr1.hg19:g.247752022A>T	ENSP00000326349:p.Met121Leu	114.0	0.0		155.0	39.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	hg19	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.671958	0.67928	.	.	ENSG00000177489	ENST00000320065	T	0.01647	4.71	4.29	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42420	U	0.000718	T	0.08447	0.0210	H	0.98507	4.25	0.31641	N	0.648085	P	0.34757	0.467	B	0.34590	0.186	T	0.03608	-1.1020	10	0.87932	D	0	.	11.4683	0.50252	1.0:0.0:0.0:0.0	.	121	Q8NGZ5	OR2G2_HUMAN	L	121	ENSP00000326349:M121L	ENSP00000326349:M121L	M	+	1	0	OR2G2	245818645	1.000000	0.71417	0.923000	0.36655	0.993000	0.82548	6.968000	0.76086	1.789000	0.52484	0.481000	0.45027	ATG	.	.		0.537	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
OR14C36	127066	hgsc.bcm.edu	37	1	248512548	248512548	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr1:248512548A>T	ENST00000317861.1	+	1	472	c.472A>T	c.(472-474)Act>Tct	p.T158S		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	158						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						AGGCATGCACACTGGCAGCAC	0.522																																					p.T158S		Atlas-SNP	.											.	OR14C36	113	.	0			c.A472T						.						133.0	113.0	120.0					1																	248512548		2203	4300	6503	SO:0001583	missense	127066	exon1			ATGCACACTGGCA	BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.472A>T	chr1.hg19:g.248512548A>T	ENSP00000324534:p.Thr158Ser	37.0	0.0		51.0	13.0	NM_001001918	Q6IEZ6	Missense_Mutation	SNP	ENST00000317861.1	hg19	CCDS31112.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621843	0.46840	.	.	ENSG00000177174	ENST00000317861	T	0.00258	8.41	4.05	4.05	0.47172	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	D	0.000190	T	0.00440	0.0014	M	0.62088	1.915	0.23271	N	0.998003	D	0.69078	0.997	D	0.74674	0.984	T	0.53493	-0.8431	10	0.51188	T	0.08	.	11.497	0.50415	1.0:0.0:0.0:0.0	.	158	Q8NHC7	O14CZ_HUMAN	S	158	ENSP00000324534:T158S	ENSP00000324534:T158S	T	+	1	0	OR14C36	246579171	0.000000	0.05858	0.187000	0.23214	0.782000	0.44232	-0.052000	0.11865	1.728000	0.51552	0.324000	0.21423	ACT	.	.		0.522	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097359.1	NM_001001918	
SPTBN1	6711	hgsc.bcm.edu	37	2	54873140	54873140	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:54873140A>G	ENST00000356805.4	+	22	4851	c.4570A>G	c.(4570-4572)Ata>Gta	p.I1524V	SPTBN1_ENST00000333896.5_Missense_Mutation_p.I1511V	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	1524					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GCAGCTGTTAATAAAGAAAAA	0.433																																					p.I1524V		Atlas-SNP	.											.	SPTBN1	378	.	0			c.A4570G						.						91.0	88.0	89.0					2																	54873140		2203	4300	6503	SO:0001583	missense	6711	exon22			CTGTTAATAAAGA		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.4570A>G	chr2.hg19:g.54873140A>G	ENSP00000349259:p.Ile1524Val	61.0	0.0		84.0	33.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.532848	0.64972	.	.	ENSG00000115306	ENST00000356805;ENST00000333896	T;T	0.48201	1.26;0.82	5.74	5.74	0.90152	.	0.043762	0.85682	D	0.000000	T	0.57110	0.2031	M	0.83774	2.66	0.50632	D	0.999884	B;B	0.26445	0.026;0.149	B;B	0.32928	0.026;0.155	T	0.57934	-0.7725	10	0.45353	T	0.12	.	16.3305	0.83010	1.0:0.0:0.0:0.0	.	1511;1524	Q01082-3;Q01082	.;SPTB2_HUMAN	V	1524;1511	ENSP00000349259:I1524V;ENSP00000334156:I1511V	ENSP00000334156:I1511V	I	+	1	0	SPTBN1	54726644	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.193000	0.94954	2.317000	0.78254	0.459000	0.35465	ATA	.	.		0.433	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
SLC5A7	60482	hgsc.bcm.edu	37	2	108614395	108614395	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:108614395G>T	ENST00000264047.2	+	5	826	c.550G>T	c.(550-552)Gtg>Ttg	p.V184L	SLC5A7_ENST00000409059.1_Missense_Mutation_p.V184L|SLC5A7_ENST00000540517.1_Missense_Mutation_p.V79L	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	184					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	GCTCTATTCTGTGGCCTACAC	0.463																																					p.V184L		Atlas-SNP	.											.	SLC5A7	109	.	0			c.G550T						.						243.0	214.0	223.0					2																	108614395		2203	4300	6503	SO:0001583	missense	60482	exon5			TATTCTGTGGCCT	AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.550G>T	chr2.hg19:g.108614395G>T	ENSP00000264047:p.Val184Leu	132.0	0.0		162.0	59.0	NM_021815	Q53TF2	Missense_Mutation	SNP	ENST00000264047.2	hg19	CCDS2074.1	.	.	.	.	.	.	.	.	.	.	G	32	5.141610	0.94560	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.89746	-2.56;-2.56;-2.56	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.96103	0.8730	M	0.93594	3.435	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.97178	0.9849	10	0.87932	D	0	0.9748	18.5601	0.91097	0.0:0.0:1.0:0.0	.	184	Q9GZV3	SC5A7_HUMAN	L	184;79;184	ENSP00000387346:V184L;ENSP00000445351:V79L;ENSP00000264047:V184L	ENSP00000264047:V184L	V	+	1	0	SLC5A7	107980827	1.000000	0.71417	0.976000	0.42696	0.913000	0.54294	9.869000	0.99810	2.390000	0.81377	0.655000	0.94253	GTG	.	.		0.463	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253562.1		
SCN2A	6326	hgsc.bcm.edu	37	2	166210790	166210790	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:166210790T>C	ENST00000375437.2	+	17	3298	c.3008T>C	c.(3007-3009)cTc>cCc	p.L1003P	SCN2A_ENST00000283256.6_Missense_Mutation_p.L1003P|SCN2A_ENST00000357398.3_Missense_Mutation_p.L1003P|SCN2A_ENST00000375427.2_Missense_Mutation_p.L1003P	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1003			L -> I (in BFIS3). {ECO:0000269|PubMed:15048894}.		intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ATGAATAATCTCCAGATTGCT	0.388																																					p.L1003P		Atlas-SNP	.											.	SCN2A	589	.	0			c.T3008C						.						151.0	156.0	154.0					2																	166210790		2203	4300	6503	SO:0001583	missense	6326	exon16			ATAATCTCCAGAT	AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.3008T>C	chr2.hg19:g.166210790T>C	ENSP00000364586:p.Leu1003Pro	157.0	0.0		179.0	70.0	NM_001040143	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	ENST00000375437.2	hg19	CCDS33314.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.251735	0.80135	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.90444	-2.67;-2.67;-2.67;-2.67	5.6	5.6	0.85130	Sodium ion transport-associated (1);	0.202030	0.35235	N	0.003345	D	0.96800	0.8955	H	0.95745	3.715	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.952;1.0	D	0.97992	1.0355	10	0.87932	D	0	.	15.7718	0.78176	0.0:0.0:0.0:1.0	.	1003;1003	Q99250-2;Q99250	.;SCN2A_HUMAN	P	1003	ENSP00000364586:L1003P;ENSP00000349973:L1003P;ENSP00000283256:L1003P;ENSP00000364576:L1003P	ENSP00000283256:L1003P	L	+	2	0	SCN2A	165919036	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.036000	0.88901	2.110000	0.64415	0.482000	0.46254	CTC	.	.		0.388	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000102659.2	NM_021007	
TLK1	9874	hgsc.bcm.edu	37	2	171863315	171863315	+	Silent	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:171863315T>A	ENST00000431350.2	-	16	1997	c.1593A>T	c.(1591-1593)acA>acT	p.T531T	TLK1_ENST00000521943.1_Silent_p.T483T|TLK1_ENST00000360843.3_Silent_p.T552T|TLK1_ENST00000442919.2_Silent_p.T483T|TLK1_ENST00000434911.2_Silent_p.T435T			Q9UKI8	TLK1_HUMAN	tousled-like kinase 1	531	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|intracellular protein transport (GO:0006886)|intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(8)|liver(3)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						CTTACGTATCTGTATCCAAGG	0.368																																					p.T531T		Atlas-SNP	.											.	TLK1	134	.	0			c.A1593T						.						104.0	111.0	109.0					2																	171863315		2202	4298	6500	SO:0001819	synonymous_variant	9874	exon16			CGTATCTGTATCC	AB004885	CCDS2241.1, CCDS46447.1, CCDS46448.1	2q31.1	2010-04-19			ENSG00000198586	ENSG00000198586			11841	protein-coding gene	gene with protein product		608438				9427565, 12660173	Standard	NM_012290		Approved	KIAA0137, PKU-BETA	uc002ugp.2	Q9UKI8	OTTHUMG00000132243	ENST00000431350.2:c.1593A>T	chr2.hg19:g.171863315T>A		92.0	0.0		135.0	48.0	NM_012290	B3KR15|B4DX87|Q14150|Q8N591|Q9NYH2|Q9Y4F6	Silent	SNP	ENST00000431350.2	hg19	CCDS2241.1																																																																																			.	.		0.368	TLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255314.1	NM_012290	
MAP2	4133	hgsc.bcm.edu	37	2	210560650	210560650	+	Silent	SNP	A	A	T	rs185809016	byFrequency	TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:210560650A>T	ENST00000360351.4	+	7	4262	c.3756A>T	c.(3754-3756)tcA>tcT	p.S1252S	MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Silent_p.S1248S|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1252					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TCTTCCGCTCAGACACCCTTC	0.483																																					p.S1252S	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											.	MAP2	372	.	0			c.A3756T						.						95.0	99.0	98.0					2																	210560650		2203	4300	6503	SO:0001819	synonymous_variant	4133	exon7			CCGCTCAGACACC		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.3756A>T	chr2.hg19:g.210560650A>T		85.0	0.0		108.0	49.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	ENST00000360351.4	hg19	CCDS2384.1																																																																																			.	A|0.997;C|0.003		0.483	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
ABCA12	26154	hgsc.bcm.edu	37	2	215823030	215823030	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:215823030A>T	ENST00000272895.7	-	41	6307	c.6088T>A	c.(6088-6090)Tac>Aac	p.Y2030N	AC072062.1_ENST00000607412.1_RNA|AC072062.1_ENST00000420134.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.Y1712N	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2030					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTTACCCAGTAGCATGTCACG	0.413																																					p.Y2030N	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.T6088A						.						225.0	197.0	206.0					2																	215823030		2203	4300	6503	SO:0001583	missense	26154	exon41			CCCAGTAGCATGT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6088T>A	chr2.hg19:g.215823030A>T	ENSP00000272895:p.Tyr2030Asn	83.0	0.0		141.0	45.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.122354	0.77436	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.94497	-3.44;-3.44	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000015	D	0.97598	0.9213	M	0.89287	3.02	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98485	1.0607	10	0.87932	D	0	.	15.9507	0.79835	1.0:0.0:0.0:0.0	.	2030;1712	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	2030;1712	ENSP00000272895:Y2030N;ENSP00000374312:Y1712N	ENSP00000272895:Y2030N	Y	-	1	0	ABCA12	215531275	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.232000	0.73038	0.528000	0.53228	TAC	.	.		0.413	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
TRIP12	9320	hgsc.bcm.edu	37	2	230638898	230638898	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:230638898G>C	ENST00000283943.5	-	37	5562	c.5384C>G	c.(5383-5385)aCt>aGt	p.T1795S	TRIP12_ENST00000389045.3_Missense_Mutation_p.T1525S|TRIP12_ENST00000389044.4_Missense_Mutation_p.T1843S	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1795					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CCCTGGCAGAGTGAAATCCAG	0.413																																					p.T1795S		Atlas-SNP	.											.	TRIP12	207	.	0			c.C5384G						.						141.0	136.0	138.0					2																	230638898		2203	4300	6503	SO:0001583	missense	9320	exon37			GGCAGAGTGAAAT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.5384C>G	chr2.hg19:g.230638898G>C	ENSP00000283943:p.Thr1795Ser	74.0	0.0		105.0	42.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	ENST00000283943.5	hg19	CCDS33391.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.278588	0.80692	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044;ENST00000418123	T;T;T;T	0.60424	0.19;0.19;0.19;0.99	6.08	6.08	0.98989	HECT (4);	0.000000	0.85682	D	0.000000	T	0.69646	0.3134	L	0.31926	0.97	0.80722	D	1	D;D;D	0.57257	0.979;0.979;0.979	D;D;D	0.74023	0.982;0.982;0.982	T	0.69179	-0.5213	10	0.62326	D	0.03	.	20.6721	0.99693	0.0:0.0:1.0:0.0	.	1525;1843;1795	Q14CF1;Q14CA3;Q14669	.;.;TRIPC_HUMAN	S	1795;1525;1843;93	ENSP00000283943:T1795S;ENSP00000373697:T1525S;ENSP00000373696:T1843S;ENSP00000408330:T93S	ENSP00000283943:T1795S	T	-	2	0	TRIP12	230347142	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.214000	0.95140	2.894000	0.99253	0.591000	0.81541	ACT	.	.		0.413	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
DGKD	8527	hgsc.bcm.edu	37	2	234299052	234299052	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr2:234299052A>G	ENST00000264057.2	+	3	283	c.271A>G	c.(271-273)Atc>Gtc	p.I91V	AC019221.4_ENST00000442524.1_RNA|DGKD_ENST00000409813.3_Missense_Mutation_p.I47V	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	91	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TTTCTAGTCAATCATATTTGA	0.463																																					p.I91V		Atlas-SNP	.											.	DGKD	106	.	0			c.A271G						.						203.0	177.0	186.0					2																	234299052		2203	4300	6503	SO:0001583	missense	8527	exon3			TAGTCAATCATAT	D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.271A>G	chr2.hg19:g.234299052A>G	ENSP00000264057:p.Ile91Val	75.0	0.0		95.0	43.0	NM_152879	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	ENST00000264057.2	hg19	CCDS2504.1	.	.	.	.	.	.	.	.	.	.	A	15.54	2.864339	0.51482	.	.	ENSG00000077044	ENST00000264057;ENST00000447484;ENST00000409813	T;T;T	0.74947	-0.89;-0.89;-0.89	5.6	5.6	0.85130	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000001	T	0.48624	0.1510	N	0.04090	-0.28	0.38224	D	0.940834	B;B	0.32753	0.383;0.045	B;B	0.29716	0.106;0.098	T	0.55218	-0.8175	10	0.11794	T	0.64	.	11.1269	0.48324	0.8455:0.1544:0.0:0.0	.	47;91	Q16760-2;Q16760	.;DGKD_HUMAN	V	91;61;47	ENSP00000264057:I91V;ENSP00000395530:I61V;ENSP00000386455:I47V	ENSP00000264057:I91V	I	+	1	0	DGKD	233963791	0.996000	0.38824	0.959000	0.39883	0.868000	0.49771	3.510000	0.53393	2.274000	0.75844	0.533000	0.62120	ATC	.	.		0.463	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257072.2	NM_003648	
SETMAR	6419	hgsc.bcm.edu	37	3	4354838	4354838	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr3:4354838A>C	ENST00000358065.4	+	2	480	c.413A>C	c.(412-414)cAg>cCg	p.Q138P	SUMF1_ENST00000534863.1_Intron|SETMAR_ENST00000430981.1_Missense_Mutation_p.Q138P|SETMAR_ENST00000425863.1_Missense_Mutation_p.Q138P	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	138	Histone-lysine N-methyltransferase.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		AAAGGTCTACAGTTCCACTTC	0.458								Chromatin Structure																													p.Q138P		Atlas-SNP	.											.	SETMAR	30	.	0			c.A413C						.						62.0	61.0	61.0					3																	4354838		2203	4300	6503	SO:0001583	missense	6419	exon2			GTCTACAGTTCCA	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.413A>C	chr3.hg19:g.4354838A>C	ENSP00000373354:p.Gln138Pro	74.0	0.0		98.0	29.0	NM_001243723	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	hg19	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	A	17.68	3.448238	0.63178	.	.	ENSG00000170364	ENST00000358065;ENST00000430981;ENST00000425863	D;D;T	0.89415	-2.51;-2.51;-1.4	5.18	4.02	0.46733	SET domain (1);	.	.	.	.	D	0.93835	0.8028	M	0.85630	2.765	0.26133	N	0.980384	D;P;P	0.71674	0.998;0.951;0.77	D;P;B	0.67231	0.95;0.692;0.408	D	0.86699	0.1928	9	0.72032	D	0.01	.	9.6681	0.39996	0.8541:0.0:0.1459:0.0	.	138;125;138	E7EN68;Q53H47;C9JHK2	.;SETMR_HUMAN;.	P	138	ENSP00000373354:Q138P;ENSP00000403000:Q138P;ENSP00000403145:Q138P	ENSP00000373354:Q138P	Q	+	2	0	SETMAR	4329838	0.998000	0.40836	0.927000	0.36925	0.850000	0.48378	3.234000	0.51320	0.809000	0.34255	0.455000	0.32223	CAG	.	.		0.458	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515	
NBEAL2	23218	hgsc.bcm.edu	37	3	47044767	47044767	+	Silent	SNP	C	C	T	rs201985571		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr3:47044767C>T	ENST00000450053.3	+	35	5867	c.5688C>T	c.(5686-5688)ctC>ctT	p.L1896L	NBEAL2_ENST00000292309.5_Silent_p.L1712L|NBEAL2_ENST00000383740.2_Silent_p.L175L	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1896					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		AGGACCAGCTCGGCGAGGACG	0.647																																					p.L1896L		Atlas-SNP	.											.	NBEAL2	267	.	0			c.C5688T						.	C		0,3876		0,0,1938	29.0	34.0	32.0		5688	-8.2	0.1	3		32	1,8255		0,1,4127	no	coding-synonymous	NBEAL2	NM_015175.1		0,1,6065	TT,TC,CC		0.0121,0.0,0.0082		1896/2755	47044767	1,12131	1938	4128	6066	SO:0001819	synonymous_variant	23218	exon35			CCAGCTCGGCGAG	AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.5688C>T	chr3.hg19:g.47044767C>T		95.0	0.0		122.0	41.0	NM_015175	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	ENST00000450053.3	hg19	CCDS46817.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	0.283|0.283	-0.985041|-0.985041	0.02180|0.02180	0.0|0.0	1.21E-4|1.21E-4	ENSG00000160796|ENSG00000160796	ENST00000443829|ENST00000416683	.|.	.|.	.|.	5.01|5.01	-8.2|-8.2	0.01045|0.01045	.|.	.|.	.|.	.|.	.|.	T|T	0.35098|0.35098	0.0920|0.0920	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.39313|0.39313	-0.9620|-0.9620	4|4	.|.	.|.	.|.	.|.	2.6218|2.6218	0.04918|0.04918	0.403:0.2965:0.2031:0.0974|0.403:0.2965:0.2031:0.0974	.|.	.|.	.|.	.|.	W|L	265|1184	.|.	.|.	R|S	+|+	1|2	2|0	NBEAL2|NBEAL2	47019771|47019771	0.981000|0.981000	0.34729|0.34729	0.050000|0.050000	0.19076|0.19076	0.047000|0.047000	0.14425|0.14425	0.041000|0.041000	0.13927|0.13927	-1.748000|-1.748000	0.01332|0.01332	-1.762000|-1.762000	0.00668|0.00668	CGG|TCG	.	C|0.998;T|0.002		0.647	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344363.3	XM_291064	
MITF	4286	hgsc.bcm.edu	37	3	69788758	69788758	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr3:69788758G>T	ENST00000448226.2	+	1	137	c.10G>T	c.(10-12)Gaa>Taa	p.E4*	MITF_ENST00000352241.4_Nonsense_Mutation_p.E4*			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	4					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		CATGCAGTCCGAATCGGGGAT	0.592			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""																														p.E4X	Melanoma(29;269 969 31479 41502 42961)	Atlas-SNP	.		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	.	MITF	156	.	0			c.G10T						.						37.0	43.0	42.0					3																	69788758		1919	4118	6037	SO:0001587	stop_gained	4286	exon1			CAGTCCGAATCGG		CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.10G>T	chr3.hg19:g.69788758G>T	ENSP00000391803:p.Glu4*	73.0	0.0		86.0	20.0	NM_198159	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Nonsense_Mutation	SNP	ENST00000448226.2	hg19		.	.	.	.	.	.	.	.	.	.	G	37	6.395046	0.97533	.	.	ENSG00000187098	ENST00000352241;ENST00000448226	.	.	.	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2345	0.89945	0.0:0.0:1.0:0.0	.	.	.	.	X	4	.	.	E	+	1	0	MITF	69871448	1.000000	0.71417	0.993000	0.49108	0.285000	0.27093	8.045000	0.89436	2.550000	0.86006	0.313000	0.20887	GAA	.	.		0.592	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000313947.1	NM_198159	
CASR	846	hgsc.bcm.edu	37	3	121976018	121976018	+	Silent	SNP	G	G	T	rs201013419		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr3:121976018G>T	ENST00000490131.1	+	3	648	c.276G>T	c.(274-276)acG>acT	p.T92T	CASR_ENST00000296154.5_Silent_p.T92T|CASR_ENST00000498619.1_Silent_p.T92T	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	92					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CCAACTTGACGCTGGGATACA	0.443																																					p.T92T		Atlas-SNP	.											.	CASR	190	.	0			c.G276T						.						120.0	120.0	120.0					3																	121976018		2203	4300	6503	SO:0001819	synonymous_variant	846	exon3			CTTGACGCTGGGA	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.276G>T	chr3.hg19:g.121976018G>T		103.0	0.0		150.0	44.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Silent	SNP	ENST00000490131.1	hg19	CCDS3010.1																																																																																			.	G|0.999;A|0.001		0.443	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
RTP2	344892	hgsc.bcm.edu	37	3	187416345	187416345	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr3:187416345A>T	ENST00000358241.1	-	2	1047	c.619T>A	c.(619-621)Tct>Act	p.S207T		NM_001004312.2	NP_001004312.2	Q5QGT7	RTP2_HUMAN	receptor (chemosensory) transporter protein 2	207					protein insertion into membrane (GO:0051205)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	olfactory receptor binding (GO:0031849)			large_intestine(3)|lung(14)|skin(1)	18	all_cancers(143;4.06e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0515)		AGGCAGAGAGAGGCCCAGAAG	0.582																																					p.S207T		Atlas-SNP	.											.	RTP2	38	.	0			c.T619A						.						85.0	89.0	88.0					3																	187416345		2203	4300	6503	SO:0001583	missense	344892	exon2			AGAGAGAGGCCCA	AY562236	CCDS33911.1	3q27.3	2014-02-20	2006-11-21		ENSG00000198471	ENSG00000198471		"""Receptor transporter proteins"""	32486	protein-coding gene	gene with protein product	"""receptor transporting protein 2"", ""zinc finger, 3CxxC-type 2"""	609138	"""receptor transporter protein 2"""			16271481, 15550249, 16720576	Standard	NM_001004312		Approved	MGC78665, Z3CXXC2	uc003fro.1	Q5QGT7	OTTHUMG00000156458	ENST00000358241.1:c.619T>A	chr3.hg19:g.187416345A>T	ENSP00000350976:p.Ser207Thr	75.0	0.0		112.0	38.0	NM_001004312	Q6NVH4	Missense_Mutation	SNP	ENST00000358241.1	hg19	CCDS33911.1	.	.	.	.	.	.	.	.	.	.	A	0.761	-0.769407	0.02974	.	.	ENSG00000198471	ENST00000358241	T	0.11930	2.73	3.93	1.49	0.22878	.	0.729779	0.12614	N	0.453594	T	0.04998	0.0134	N	0.11201	0.11	0.21527	N	0.999656	B	0.02656	0.0	B	0.01281	0.0	T	0.43426	-0.9392	10	0.02654	T	1	-13.1634	4.4722	0.11717	0.5976:0.2053:0.0:0.1971	.	207	Q5QGT7	RTP2_HUMAN	T	207	ENSP00000350976:S207T	ENSP00000350976:S207T	S	-	1	0	RTP2	188899039	0.041000	0.20044	0.863000	0.33907	0.891000	0.51852	-0.188000	0.09642	0.321000	0.23259	0.379000	0.24179	TCT	.	.		0.582	RTP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344259.1	NM_001004312	
RGS12	6002	hgsc.bcm.edu	37	4	3318367	3318367	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:3318367G>T	ENST00000344733.5	+	2	1374	c.470G>T	c.(469-471)tGt>tTt	p.C157F	RGS12_ENST00000336727.3_Missense_Mutation_p.C157F|RGS12_ENST00000382788.3_Missense_Mutation_p.C157F|RGS12_ENST00000543385.1_Missense_Mutation_p.C157F	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	157					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CCGAGCCTTTGTGCGAGCAAT	0.413																																					p.C157F		Atlas-SNP	.											.	RGS12	128	.	0			c.G470T						.						47.0	53.0	51.0					4																	3318367		2203	4300	6503	SO:0001583	missense	6002	exon2			GCCTTTGTGCGAG	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.470G>T	chr4.hg19:g.3318367G>T	ENSP00000339381:p.Cys157Phe	50.0	0.0		87.0	4.0	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	ENST00000344733.5	hg19	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	G	8.524	0.869483	0.17322	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	T;T;T;T	0.29655	1.56;1.67;1.66;1.66	4.72	3.88	0.44766	.	0.482216	0.23678	N	0.045649	T	0.26846	0.0657	L	0.44542	1.39	0.20074	N	0.999934	P;P;P	0.43287	0.736;0.802;0.797	B;B;P	0.45099	0.195;0.26;0.469	T	0.07462	-1.0771	10	0.14656	T	0.56	-0.0181	8.5146	0.33237	0.1777:0.0:0.8223:0.0	.	157;157;157	Q8WX97;O14924;O14924-4	.;RGS12_HUMAN;.	F	157	ENSP00000440566:C157F;ENSP00000339381:C157F;ENSP00000338509:C157F;ENSP00000372238:C157F	ENSP00000338509:C157F	C	+	2	0	RGS12	3288165	0.980000	0.34600	0.001000	0.08648	0.018000	0.09664	2.886000	0.48578	0.983000	0.38602	0.491000	0.48974	TGT	.	.		0.413	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	
GABRG1	2565	hgsc.bcm.edu	37	4	46067562	46067562	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:46067562C>A	ENST00000295452.4	-	4	528	c.361G>T	c.(361-363)Gac>Tac	p.D121Y		NM_173536.3	NP_775807.2	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 1	121					gamma-aminobutyric acid signaling pathway (GO:0007214)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|central_nervous_system(5)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(2)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	76				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AAACGACTGTCAAACCAGGTT	0.299																																					p.D121Y		Atlas-SNP	.											.	GABRG1	172	.	0			c.G361T						.						43.0	44.0	44.0					4																	46067562		2203	4299	6502	SO:0001583	missense	2565	exon4			GACTGTCAAACCA	BC031087	CCDS3470.1	4p12	2012-06-22			ENSG00000163285	ENSG00000163285		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4086	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma"""	137166				1321425	Standard	NM_173536		Approved		uc003gxb.3	Q8N1C3	OTTHUMG00000128609	ENST00000295452.4:c.361G>T	chr4.hg19:g.46067562C>A	ENSP00000295452:p.Asp121Tyr	62.0	0.0		70.0	18.0	NM_173536	Q5H9T8	Missense_Mutation	SNP	ENST00000295452.4	hg19	CCDS3470.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438906	0.83885	.	.	ENSG00000163285	ENST00000295452;ENST00000540030	D	0.93763	-3.28	5.08	5.08	0.68730	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.98134	0.9384	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99675	1.0997	10	0.87932	D	0	.	17.8218	0.88652	0.0:1.0:0.0:0.0	.	121	Q8N1C3	GBRG1_HUMAN	Y	121	ENSP00000295452:D121Y	ENSP00000295452:D121Y	D	-	1	0	GABRG1	45762319	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.772000	0.85439	2.513000	0.84729	0.508000	0.49915	GAC	.	.		0.299	GABRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250470.1	NM_173536	
PAICS	10606	hgsc.bcm.edu	37	4	57325638	57325638	+	Silent	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:57325638A>T	ENST00000512576.1	+	9	1373	c.1212A>T	c.(1210-1212)gcA>gcT	p.A404A	PAICS_ENST00000399688.3_Silent_p.A411A|PAICS_ENST00000264221.2_Silent_p.A404A|PAICS_ENST00000514888.1_Silent_p.A312A	NM_001079524.1	NP_001072992.1	P22234	PUR6_HUMAN	phosphoribosylaminoimidazole carboxylase, phosphoribosylaminoimidazole succinocarboxamide synthetase	404	AIR carboxylase.				'de novo' IMP biosynthetic process (GO:0006189)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|phosphoribosylaminoimidazole carboxylase activity (GO:0004638)|phosphoribosylaminoimidazolesuccinocarboxamide synthase activity (GO:0004639)			endometrium(1)|kidney(2)|large_intestine(1)|urinary_tract(1)	5	Glioma(25;0.08)|all_neural(26;0.101)				L-Aspartic Acid(DB00128)	AACTGCGAGCAAGCATTTTGA	0.393																																					p.A411A	GBM(53;429 1144 8755 40726)	Atlas-SNP	.											.	PAICS	21	.	0			c.A1233T						.						70.0	62.0	64.0					4																	57325638		1850	4097	5947	SO:0001819	synonymous_variant	10606	exon10			GCGAGCAAGCATT	X53793	CCDS47060.1, CCDS47061.1	4q12	2012-07-13			ENSG00000128050	ENSG00000128050	4.1.1.21, 6.3.2.6		8587	protein-coding gene	gene with protein product		172439		PAIS		2253271, 8106516	Standard	NM_006452		Approved	ADE2H1, AIRC	uc003hbt.1	P22234	OTTHUMG00000160957	ENST00000512576.1:c.1212A>T	chr4.hg19:g.57325638A>T		153.0	0.0		232.0	78.0	NM_001079525	E9PDH9|Q68CQ5	Silent	SNP	ENST00000512576.1	hg19	CCDS47061.1																																																																																			.	.		0.393	PAICS-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363136.2	NM_006452	
UGT2B7	7364	hgsc.bcm.edu	37	4	69962793	69962793	+	Silent	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:69962793A>G	ENST00000508661.1	+	1	582	c.555A>G	c.(553-555)ggA>ggG	p.G185G	UGT2B7_ENST00000509763.1_Intron|UGT2B7_ENST00000305231.7_Silent_p.G185G			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	185					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AGCATAGTGGAGGATTTATTT	0.393																																					p.G185G		Atlas-SNP	.											.	UGT2B7	79	.	0			c.A555G						.						119.0	118.0	118.0					4																	69962793		2203	4298	6501	SO:0001819	synonymous_variant	7364	exon1			TAGTGGAGGATTT	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.555A>G	chr4.hg19:g.69962793A>G		107.0	0.0		146.0	54.0	NM_001074	B2R810|Q6GTW0	Silent	SNP	ENST00000508661.1	hg19																																																																																				.	.		0.393	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074	
FABP2	2169	hgsc.bcm.edu	37	4	120241841	120241841	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:120241841T>A	ENST00000274024.3	-	2	511	c.224A>T	c.(223-225)gAc>gTc	p.D75V		NM_000134.3	NP_000125.2	P12104	FABPI_HUMAN	fatty acid binding protein 2, intestinal	75					digestion (GO:0007586)	cytoplasm (GO:0005737)	fatty acid binding (GO:0005504)|transporter activity (GO:0005215)			breast(1)|large_intestine(4)|lung(1)|ovary(1)|pancreas(1)	8					Estradiol(DB00783)|Ibuprofen(DB01050)|Sulfinpyrazone(DB01138)	TTCAGTTCCGTCTGCTAGATT	0.318																																					p.D75V		Atlas-SNP	.											.	FABP2	21	.	0			c.A224T						.						87.0	93.0	91.0					4																	120241841		2201	4299	6500	SO:0001583	missense	2169	exon2			GTTCCGTCTGCTA	J03465	CCDS3712.1	4q28-q31	2013-03-01			ENSG00000145384	ENSG00000145384		"""Fatty acid binding protein family"""	3556	protein-coding gene	gene with protein product		134640					Standard	NM_000134		Approved	I-FABP	uc003icw.3	P12104	OTTHUMG00000132972	ENST00000274024.3:c.224A>T	chr4.hg19:g.120241841T>A	ENSP00000274024:p.Asp75Val	36.0	0.0		35.0	12.0	NM_000134	Q2NKJ1	Missense_Mutation	SNP	ENST00000274024.3	hg19	CCDS3712.1	.	.	.	.	.	.	.	.	.	.	T	16.02	3.004733	0.54254	.	.	ENSG00000145384	ENST00000274024	T	0.56611	0.45	5.71	5.71	0.89125	Calycin-like (1);Cytosolic fatty-acid binding (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.000000	0.85682	D	0.000000	T	0.72415	0.3457	M	0.74881	2.28	0.80722	D	1	D	0.60575	0.988	D	0.74023	0.982	T	0.76061	-0.3097	10	0.87932	D	0	.	15.6632	0.77206	0.0:0.0:0.0:1.0	.	75	P12104	FABPI_HUMAN	V	75	ENSP00000274024:D75V	ENSP00000274024:D75V	D	-	2	0	FABP2	120461289	1.000000	0.71417	0.893000	0.35052	0.060000	0.15804	7.496000	0.81526	2.176000	0.68965	0.528000	0.53228	GAC	.	.		0.318	FABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256531.1	NM_000134	
INPP4B	8821	hgsc.bcm.edu	37	4	143324209	143324209	+	Splice_Site	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:143324209T>A	ENST00000513000.1	-	8	689		c.e8-2		INPP4B_ENST00000508116.1_Splice_Site|INPP4B_ENST00000262992.4_Splice_Site|INPP4B_ENST00000506217.1_Splice_Site|INPP4B_ENST00000509777.1_Splice_Site|INPP4B_ENST00000308502.4_Splice_Site	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa						cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					CCTTGTTCCCTGTAACAGCAC	0.443																																					.		Atlas-SNP	.											.	INPP4B	132	.	0			c.256-2A>T						.						144.0	126.0	132.0					4																	143324209		2203	4300	6503	SO:0001630	splice_region_variant	8821	exon9			GTTCCCTGTAACA	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.256-2A>T	chr4.hg19:g.143324209T>A		68.0	0.0		83.0	29.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Splice_Site	SNP	ENST00000513000.1	hg19	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	T	19.49	3.836521	0.71373	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000508116;ENST00000509777;ENST00000510812;ENST00000506217	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8101	0.78552	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	INPP4B	143543659	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	5.783000	0.68982	2.178000	0.69098	0.533000	0.62120	.	.	.		0.443	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	Intron
FRG1	2483	hgsc.bcm.edu	37	4	190878604	190878604	+	Missense_Mutation	SNP	G	G	A	rs371189769		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:190878604G>A	ENST00000226798.4	+	6	706	c.484G>A	c.(484-486)Gca>Aca	p.A162T	FRG1_ENST00000514482.1_3'UTR	NM_004477.2	NP_004468.1	Q14331	FRG1_HUMAN	FSHD region gene 1	162					mRNA splicing, via spliceosome (GO:0000398)|muscle organ development (GO:0007517)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|lung(11)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|urinary_tract(1)	32		all_cancers(14;1.44e-58)|all_epithelial(14;6.32e-41)|all_lung(41;8.13e-17)|Lung NSC(41;2.13e-16)|Breast(6;2.54e-06)|Melanoma(20;0.000263)|Hepatocellular(41;0.00213)|Renal(120;0.0183)|all_hematologic(60;0.0358)|Prostate(90;0.0421)|all_neural(102;0.147)		all cancers(3;1.73e-30)|Epithelial(3;5.85e-30)|OV - Ovarian serous cystadenocarcinoma(60;5.56e-15)|BRCA - Breast invasive adenocarcinoma(30;9.14e-06)|Lung(3;3.54e-05)|STAD - Stomach adenocarcinoma(60;8.83e-05)|LUSC - Lung squamous cell carcinoma(40;0.000198)|GBM - Glioblastoma multiforme(59;0.00892)|READ - Rectum adenocarcinoma(43;0.161)		ATGCAATGAAGCAGGGGACAT	0.383																																					p.A162T		Atlas-SNP	.											.	FRG1	76	.	0			c.G484A						.						36.0	36.0	36.0					4																	190878604		2184	4280	6464	SO:0001583	missense	2483	exon6			AATGAAGCAGGGG	L76159	CCDS34121.1	4q35	2008-02-05			ENSG00000109536	ENSG00000109536			3954	protein-coding gene	gene with protein product		601278				8733123	Standard	XM_005262880		Approved	FSG1, FRG1A	uc003izs.3	Q14331	OTTHUMG00000160202	ENST00000226798.4:c.484G>A	chr4.hg19:g.190878604G>A	ENSP00000226798:p.Ala162Thr	204.0	0.0		265.0	16.0	NM_004477	A8K775	Missense_Mutation	SNP	ENST00000226798.4	hg19	CCDS34121.1	.	.	.	.	.	.	.	.	.	.	.	11.61	1.689550	0.29962	.	.	ENSG00000109536	ENST00000226798;ENST00000524583;ENST00000531991	T;T	0.42900	1.94;0.96	4.19	4.19	0.49359	Actin cross-linking (1);	0.268853	0.42821	D	0.000657	T	0.36110	0.0955	L	0.47716	1.5	0.31376	N	0.679557	B	0.27951	0.195	B	0.30716	0.119	T	0.35001	-0.9806	10	0.14656	T	0.56	-21.4303	14.4711	0.67517	0.0:0.0:1.0:0.0	.	162	Q14331	FRG1_HUMAN	T	162;34;99	ENSP00000226798:A162T;ENSP00000435943:A99T	ENSP00000226798:A162T	A	+	1	0	FRG1	191115598	1.000000	0.71417	1.000000	0.80357	0.534000	0.34807	4.336000	0.59304	2.063000	0.61619	0.454000	0.30748	GCA	.	.		0.383	FRG1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000359622.4	NM_004477	
NKD2	85409	hgsc.bcm.edu	37	5	1034416	1034416	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:1034416T>A	ENST00000296849.5	+	6	626	c.397T>A	c.(397-399)Ttt>Att	p.F133I	NKD2_ENST00000537972.1_Missense_Mutation_p.F133I|NKD2_ENST00000274150.4_Missense_Mutation_p.F133I|NKD2_ENST00000382730.2_5'Flank	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)	133	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Interaction with DVL1, DVL2 and DVL3. {ECO:0000250}.|Targeting to the basolateral cell membrane.				exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			GCTCTATGACTTTGACAACTG	0.627																																					p.F133I		Atlas-SNP	.											.	NKD2	39	.	0			c.T397A						.						135.0	100.0	112.0					5																	1034416		2202	4297	6499	SO:0001583	missense	85409	exon6			TATGACTTTGACA	AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.397T>A	chr5.hg19:g.1034416T>A	ENSP00000296849:p.Phe133Ile	88.0	0.0		95.0	25.0	NM_001271082	Q96EK8|Q9BSN0	Missense_Mutation	SNP	ENST00000296849.5	hg19	CCDS3859.1	.	.	.	.	.	.	.	.	.	.	T	17.27	3.347800	0.61183	.	.	ENSG00000145506	ENST00000296849;ENST00000274150;ENST00000537972	T;T;T	0.00597	6.31;6.31;6.31	3.65	3.65	0.41850	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.01421	0.0046	M	0.77486	2.375	0.80722	D	1	P;P	0.50156	0.932;0.872	P;P	0.50659	0.647;0.495	T	0.63616	-0.6597	10	0.52906	T	0.07	-14.1761	8.6817	0.34212	0.0:0.0:0.0:1.0	.	133;133	Q969F2-2;Q969F2	.;NKD2_HUMAN	I	133	ENSP00000296849:F133I;ENSP00000274150:F133I;ENSP00000440925:F133I	ENSP00000274150:F133I	F	+	1	0	NKD2	1087416	1.000000	0.71417	0.981000	0.43875	0.248000	0.25809	4.522000	0.60539	1.306000	0.44926	0.454000	0.30748	TTT	.	.		0.627	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206720.2	NM_033120	
TERT	7015	hgsc.bcm.edu	37	5	1266629	1266629	+	Silent	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:1266629A>G	ENST00000310581.5	-	10	2661	c.2604T>C	c.(2602-2604)gaT>gaC	p.D868D	TERT_ENST00000334602.6_Silent_p.D868D|TERT_ENST00000508104.2_Nonstop_Mutation_p.*808R|TERT_ENST00000296820.5_Nonstop_Mutation_p.*808R	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	868	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	ACAAGAAATCATCCACCAAAC	0.498									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																												p.D868D		Atlas-SNP	.											.	TERT	2594	.	0			c.T2604C						.						140.0	96.0	111.0					5																	1266629		2201	4298	6499	SO:0001819	synonymous_variant	7015	exon10	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	GAAATCATCCACC	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.2604T>C	chr5.hg19:g.1266629A>G		127.0	0.0		144.0	58.0	NM_001193376	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Silent	SNP	ENST00000310581.5	hg19	CCDS3861.2	.	.	.	.	.	.	.	.	.	.	A	0.045	-1.271324	0.01421	.	.	ENSG00000164362	ENST00000296820;ENST00000508104	.	.	.	3.87	-3.87	0.04218	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.4092	9.9408	0.41578	0.5685:0.0:0.4315:0.0	.	.	.	.	R	808	.	.	X	-	1	0	TERT	1319629	0.990000	0.36364	0.835000	0.33067	0.041000	0.13682	0.251000	0.18257	-1.038000	0.03279	-0.371000	0.07208	TGA	.	.		0.498	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206729.2		
CTNND2	1501	hgsc.bcm.edu	37	5	11098730	11098730	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:11098730C>A	ENST00000304623.8	-	15	2783	c.2594G>T	c.(2593-2595)gGg>gTg	p.G865V	CTNND2_ENST00000511377.1_Missense_Mutation_p.G774V|CTNND2_ENST00000458100.2_Missense_Mutation_p.G432V|CTNND2_ENST00000503622.1_Missense_Mutation_p.G528V|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Intron	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	865					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GCCTGCCGCCCCTTCCAGCGT	0.517																																					p.G865V		Atlas-SNP	.											.	CTNND2	289	.	0			c.G2594T						.						92.0	85.0	88.0					5																	11098730		2203	4300	6503	SO:0001583	missense	1501	exon15			GCCGCCCCTTCCA	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2594G>T	chr5.hg19:g.11098730C>A	ENSP00000307134:p.Gly865Val	64.0	0.0		86.0	4.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	hg19	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	30	5.050037	0.93740	.	.	ENSG00000169862	ENST00000304623;ENST00000511377;ENST00000458100;ENST00000503622	D;D;D;D	0.85556	-2.0;-2.0;-2.0;-2.0	6.17	6.17	0.99709	Armadillo-like helical (1);Armadillo-type fold (1);	0.049769	0.85682	D	0.000000	D	0.91236	0.7238	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90766	0.4668	10	0.87932	D	0	-23.4378	20.8794	0.99867	0.0:1.0:0.0:0.0	.	528;432;865	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	V	865;774;432;528	ENSP00000307134:G865V;ENSP00000426510:G774V;ENSP00000391155:G432V;ENSP00000426887:G528V	ENSP00000307134:G865V	G	-	2	0	CTNND2	11151730	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	GGG	.	.		0.517	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
ITGA1	3672	hgsc.bcm.edu	37	5	52235677	52235677	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:52235677A>G	ENST00000282588.6	+	26	3646	c.3188A>G	c.(3187-3189)aAt>aGt	p.N1063S	CTD-2175A23.1_ENST00000505701.1_RNA|CTD-2175A23.1_ENST00000503559.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1	1063					activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				CAGGACTGCAATACATGTAAA	0.313																																					p.N1063S		Atlas-SNP	.											.	ITGA1	112	.	0			c.A3188G						.						114.0	97.0	103.0					5																	52235677		2203	4300	6503	SO:0001583	missense	3672	exon26			ACTGCAATACATG	X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.3188A>G	chr5.hg19:g.52235677A>G	ENSP00000282588:p.Asn1063Ser	186.0	0.0		265.0	77.0	NM_181501	B2RNU0	Missense_Mutation	SNP	ENST00000282588.6	hg19	CCDS3955.1	.	.	.	.	.	.	.	.	.	.	A	0.020	-1.442891	0.01089	.	.	ENSG00000213949	ENST00000282588	T	0.45668	0.89	6.05	0.239	0.15484	.	0.692454	0.15883	N	0.239946	T	0.09686	0.0238	N	0.00841	-1.15	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.34502	-0.9826	10	0.02654	T	1	.	4.1856	0.10397	0.4688:0.1769:0.3543:0.0	.	1063	P56199	ITA1_HUMAN	S	1063	ENSP00000282588:N1063S	ENSP00000282588:N1063S	N	+	2	0	ITGA1	52271434	0.112000	0.22096	0.087000	0.20705	0.320000	0.28249	1.206000	0.32321	0.129000	0.18514	-0.182000	0.12963	AAT	.	.		0.313	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253855.3	NM_181501	
ESM1	11082	hgsc.bcm.edu	37	5	54277844	54277844	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:54277844G>T	ENST00000381405.4	-	2	577	c.432C>A	c.(430-432)aaC>aaA	p.N144K	ESM1_ENST00000381403.4_Intron|ESM1_ENST00000598310.1_Intron	NM_007036.4	NP_008967.1	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1	144					angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of hepatocyte growth factor receptor signaling pathway (GO:1902204)|regulation of cell growth (GO:0001558)|sprouting angiogenesis (GO:0002040)	extracellular region (GO:0005576)	hepatocyte growth factor receptor binding (GO:0005171)|integrin binding (GO:0005178)			breast(1)|kidney(1)|large_intestine(4)|lung(4)	10		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			AAACAAATCTGTTGGAAGACT	0.428																																					p.N144K		Atlas-SNP	.											.	ESM1	27	.	0			c.C432A						.						121.0	118.0	119.0					5																	54277844		2203	4300	6503	SO:0001583	missense	11082	exon2			AAATCTGTTGGAA	X89426	CCDS3963.1, CCDS47206.1	5q11	2008-02-05			ENSG00000164283	ENSG00000164283			3466	protein-coding gene	gene with protein product		601521				8702785	Standard	NM_001135604		Approved		uc003jpk.3	Q9NQ30	OTTHUMG00000097010	ENST00000381405.4:c.432C>A	chr5.hg19:g.54277844G>T	ENSP00000370812:p.Asn144Lys	99.0	0.0		138.0	48.0	NM_007036	B2R4G3|Q15330|Q3V4E3|Q96ES3	Missense_Mutation	SNP	ENST00000381405.4	hg19	CCDS3963.1	.	.	.	.	.	.	.	.	.	.	G	9.583	1.124210	0.20959	.	.	ENSG00000164283	ENST00000381405	.	.	.	5.63	2.57	0.30868	.	1.035260	0.07602	N	0.923825	T	0.44286	0.1286	N	0.24115	0.695	0.58432	D	0.999991	B	0.06786	0.001	B	0.04013	0.001	T	0.39396	-0.9616	9	0.62326	D	0.03	-24.379	8.7588	0.34661	0.0737:0.0:0.568:0.3583	.	144	Q9NQ30	ESM1_HUMAN	K	144	.	ENSP00000370812:N144K	N	-	3	2	ESM1	54313601	1.000000	0.71417	0.534000	0.28014	0.282000	0.26991	0.980000	0.29513	1.357000	0.45904	-0.309000	0.09137	AAC	.	.		0.428	ESM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214099.2	NM_007036	
KDM3B	51780	hgsc.bcm.edu	37	5	137753199	137753199	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:137753199A>T	ENST00000314358.5	+	13	3535	c.3335A>T	c.(3334-3336)cAt>cTt	p.H1112L	KDM3B_ENST00000394866.1_Missense_Mutation_p.H768L|KDM3B_ENST00000542866.1_Missense_Mutation_p.H144L	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1112					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						GACATGGTACATGCTGCCCGG	0.418																																					p.H1112L		Atlas-SNP	.											.	KDM3B	177	.	0			c.A3335T						.						142.0	129.0	134.0					5																	137753199		2203	4300	6503	SO:0001583	missense	51780	exon13			TGGTACATGCTGC	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.3335A>T	chr5.hg19:g.137753199A>T	ENSP00000326563:p.His1112Leu	75.0	0.0		110.0	5.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	hg19	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	A	31	5.092109	0.94149	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	D;D;D	0.85861	-1.5;-2.04;-1.53	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.92642	0.7662	M	0.82517	2.595	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.978	D	0.93705	0.7019	10	0.87932	D	0	-5.6809	15.6827	0.77385	1.0:0.0:0.0:0.0	.	768;1112	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	L	1112;902;768;144	ENSP00000326563:H1112L;ENSP00000378335:H768L;ENSP00000439462:H144L	ENSP00000326563:H1112L	H	+	2	0	KDM3B	137781098	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.103000	0.63969	0.460000	0.39030	CAT	.	.		0.418	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
PCDHA12	56137	hgsc.bcm.edu	37	5	140255480	140255480	+	Silent	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:140255480T>A	ENST00000398631.2	+	1	423	c.423T>A	c.(421-423)ccT>ccA	p.P141P	PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	141	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAAAGGTACCTGTTTCTGAAT	0.502																																					p.P141P	Pancreas(113;759 1672 13322 24104 50104)	Atlas-SNP	.											.	PCDHA12	196	.	0			c.T423A						.						81.0	94.0	89.0					5																	140255480		2203	4300	6503	SO:0001819	synonymous_variant	56137	exon1			GGTACCTGTTTCT	AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.423T>A	chr5.hg19:g.140255480T>A		169.0	0.0		219.0	75.0	NM_018903	O75278|Q2M1N8	Silent	SNP	ENST00000398631.2	hg19	CCDS47285.1																																																																																			.	.		0.502	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372882.2	NM_018903	
PCDHA13	56136	hgsc.bcm.edu	37	5	140262777	140262777	+	Silent	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:140262777A>T	ENST00000289272.2	+	1	924	c.924A>T	c.(922-924)ctA>ctT	p.L308L	PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Silent_p.L308L|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AAGGCAAACTAGATTTCGAAG	0.383																																					p.L308L	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											.	PCDHA13	213	.	0			c.A924T						.						57.0	65.0	62.0					5																	140262777		2203	4300	6503	SO:0001819	synonymous_variant	56136	exon1			CAAACTAGATTTC	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.924A>T	chr5.hg19:g.140262777A>T		130.0	0.0		143.0	51.0	NM_031865	O75277	Silent	SNP	ENST00000289272.2	hg19	CCDS4240.1																																																																																			.	.		0.383	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
PCDHAC2	56134	hgsc.bcm.edu	37	5	140348697	140348697	+	Silent	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:140348697A>G	ENST00000289269.5	+	1	2878	c.2346A>G	c.(2344-2346)cgA>cgG	p.R782R	PCDHA6_ENST00000527624.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	782					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGAAGTTCGAGGGAATGGCT	0.512																																					p.R782R	Melanoma(190;638 2083 3390 11909 52360)	Atlas-SNP	.											.	PCDHAC2	142	.	0			c.A2346G						.						92.0	86.0	88.0					5																	140348697		2203	4300	6503	SO:0001819	synonymous_variant	56134	exon1			AGTTCGAGGGAAT	AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.2346A>G	chr5.hg19:g.140348697A>G		101.0	0.0		146.0	50.0	NM_031883	Q2M3V1|Q9Y5F4	Silent	SNP	ENST00000289269.5	hg19	CCDS4242.1																																																																																			.	.		0.512	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251802.2	NM_018899	
PCDHB16	57717	hgsc.bcm.edu	37	5	140564018	140564018	+	Missense_Mutation	SNP	G	G	T	rs146665935	byFrequency	TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:140564018G>T	ENST00000361016.2	+	1	3039	c.1884G>T	c.(1882-1884)agG>agT	p.R628S		NM_020957.1	NP_066008.1	Q9NRJ7	PCDBG_HUMAN	protocadherin beta 16	628	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(10)|kidney(3)|large_intestine(14)|lung(29)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|urinary_tract(1)	69			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCACCGCCAGGCTGCTGAGCG	0.692																																					p.R628S		Atlas-SNP	.											.	PCDHB16	159	.	0			c.G1884T						.						23.0	24.0	24.0					5																	140564018		2048	4023	6071	SO:0001583	missense	57717	exon1			CGCCAGGCTGCTG	AF217757	CCDS4251.1	5q31	2014-04-11			ENSG00000196963			"""Cadherins / Protocadherins : Clustered"""	14546	other	protocadherin	"""cadherin ME1"", ""protocadherin-3x"", ""PCDHbeta 16"""	606345				11230163, 11322959	Standard	NM_020957		Approved	PCDHB8a, PCDH3X, KIAA1621, PCDH-BETA16, ME1	uc003liv.3	Q9NRJ7	OTTHUMG00000188325	ENST00000361016.2:c.1884G>T	chr5.hg19:g.140564018G>T	ENSP00000354293:p.Arg628Ser	50.0	0.0		65.0	18.0	NM_020957	B3KPK5|Q8IYD5|Q96SE9|Q9HCF1	Missense_Mutation	SNP	ENST00000361016.2	hg19	CCDS4251.1	.	.	.	.	.	.	.	.	.	.	g	16.00	2.998736	0.54147	.	.	ENSG00000196963	ENST00000361016	T	0.52295	0.67	3.96	2.07	0.26955	Cadherin (4);Cadherin-like (1);	0.000000	0.35207	N	0.003380	T	0.58963	0.2159	M	0.74467	2.265	0.09310	N	1	D	0.76494	0.999	D	0.77557	0.99	T	0.50996	-0.8761	10	0.87932	D	0	.	1.4092	0.02287	0.2688:0.1443:0.4394:0.1475	.	628	Q9NRJ7	PCDBG_HUMAN	S	628	ENSP00000354293:R628S	ENSP00000354293:R628S	R	+	3	2	PCDHB16	140544202	0.001000	0.12720	0.939000	0.37840	0.814000	0.46013	0.322000	0.19576	0.629000	0.30376	0.298000	0.19748	AGG	.	G|0.999;A|0.001		0.692	PCDHB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251800.1	NM_020957	
PCDH12	51294	hgsc.bcm.edu	37	5	141334585	141334585	+	Silent	SNP	G	G	A	rs375930414		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:141334585G>A	ENST00000231484.3	-	1	4042	c.2832C>T	c.(2830-2832)gcC>gcT	p.A944A	AC005740.6_ENST00000607378.1_RNA	NM_016580.2	NP_057664.1	Q9NPG4	PCD12_HUMAN	protocadherin 12	944					calcium-dependent cell-cell adhesion (GO:0016339)|glycogen metabolic process (GO:0005977)|homophilic cell adhesion (GO:0007156)|labyrinthine layer development (GO:0060711)|neuron recognition (GO:0008038)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(3)|prostate(2)|skin(1)	38		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTTCCGCTCGGCGAAGGCAG	0.607													G|||	1	0.000199681	0.0	0.0	5008	,	,		17283	0.0		0.0	False		,,,				2504	0.001				p.A944A		Atlas-SNP	.											.	PCDH12	133	.	0			c.C2832T						.						38.0	42.0	41.0					5																	141334585		2203	4300	6503	SO:0001819	synonymous_variant	51294	exon1			CCGCTCGGCGAAG	AF231025	CCDS4269.1	5q31.3	2010-01-26			ENSG00000113555	ENSG00000113555		"""Cadherins / Protocadherins : Non-clustered"""	8657	protein-coding gene	gene with protein product		605622				10716726, 10380929	Standard	NM_016580		Approved	VE-cadherin-2	uc003llx.3	Q9NPG4	OTTHUMG00000129658	ENST00000231484.3:c.2832C>T	chr5.hg19:g.141334585G>A		94.0	0.0		78.0	22.0	NM_016580	Q6UXB6|Q96KB8|Q9H7Y6|Q9H8E0	Silent	SNP	ENST00000231484.3	hg19	CCDS4269.1																																																																																			.	.		0.607	PCDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251858.1	NM_016580	
DPYSL3	1809	hgsc.bcm.edu	37	5	146780396	146780396	+	Splice_Site	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:146780396G>T	ENST00000398514.3	-	10	1340	c.969C>A	c.(967-969)agC>agA	p.S323R	DPYSL3_ENST00000534907.1_Intron|DPYSL3_ENST00000343218.5_Splice_Site_p.S437R|CTB-108O6.2_ENST00000607270.1_RNA	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	323					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGATCCCCGCTGGCAAAGG	0.537																																					p.S437R		Atlas-SNP	.											DPYSL3,NS,carcinoma,0,1	DPYSL3	58	.	0			c.C1311A						.						57.0	62.0	60.0					5																	146780396		2148	4275	6423	SO:0001630	splice_region_variant	1809	exon10			ATCCCCGCTGGCA	D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.969-1C>A	chr5.hg19:g.146780396G>T		45.0	1.0		60.0	12.0	NM_001197294	B3SXQ8|Q93012	Missense_Mutation	SNP	ENST00000398514.3	hg19	CCDS43381.1	.	.	.	.	.	.	.	.	.	.	G	13.42	2.233314	0.39498	.	.	ENSG00000113657	ENST00000398514;ENST00000343218	D;D	0.90844	-2.74;-2.74	5.53	-2.89	0.05665	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.90957	0.7157	L	0.45698	1.435	0.80722	D	1	D;P	0.64830	0.994;0.585	D;B	0.69307	0.963;0.21	D	0.87817	0.2635	10	0.48119	T	0.1	.	11.3928	0.49824	0.6163:0.0:0.3837:0.0	.	437;323	B3SXQ8;Q14195	.;DPYL3_HUMAN	R	323;437	ENSP00000381526:S323R;ENSP00000343690:S437R	ENSP00000343690:S437R	S	-	3	2	DPYSL3	146760589	0.999000	0.42202	0.991000	0.47740	0.280000	0.26924	0.906000	0.28517	-0.373000	0.07979	-0.956000	0.02647	AGC	.	.		0.537	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373421.2	NM_001387	Missense_Mutation
GABRG2	2566	hgsc.bcm.edu	37	5	161580332	161580332	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:161580332C>G	ENST00000361925.4	+	9	1582	c.1362C>G	c.(1360-1362)tgC>tgG	p.C454W	GABRG2_ENST00000414552.2_Missense_Mutation_p.C502W|GABRG2_ENST00000356592.3_Missense_Mutation_p.C462W|GABRG2_ENST00000393933.4_Missense_Mutation_p.C359W			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	454					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CTGCCTTCTGCCTGTTTAATC	0.463																																					p.C502W		Atlas-SNP	.											.	GABRG2	142	.	0			c.C1506G						.						268.0	273.0	271.0					5																	161580332		2203	4300	6503	SO:0001583	missense	2566	exon11			CTTCTGCCTGTTT		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.1362C>G	chr5.hg19:g.161580332C>G	ENSP00000354651:p.Cys454Trp	120.0	0.0		147.0	40.0	NM_198903	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Missense_Mutation	SNP	ENST00000361925.4	hg19	CCDS4358.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265804	0.40095	.	.	ENSG00000113327	ENST00000356592;ENST00000414552;ENST00000361925;ENST00000393933	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.95	3.2	0.36748	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.148926	0.64402	D	0.000009	D	0.82838	0.5124	L	0.29908	0.895	0.58432	D	0.999998	P;P;P	0.50272	0.933;0.532;0.663	P;P;P	0.60173	0.87;0.497;0.694	D	0.83981	0.0332	10	0.72032	D	0.01	.	10.8297	0.46652	0.0:0.7303:0.0:0.2697	.	502;454;462	F5HB82;P18507;P18507-2	.;GBRG2_HUMAN;.	W	462;502;454;359	ENSP00000349000:C462W;ENSP00000410732:C502W;ENSP00000354651:C454W;ENSP00000377510:C359W	ENSP00000349000:C462W	C	+	3	2	GABRG2	161512910	0.893000	0.30496	1.000000	0.80357	0.995000	0.86356	-0.031000	0.12287	1.530000	0.49136	0.655000	0.94253	TGC	.	.		0.463	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
IRF4	3662	hgsc.bcm.edu	37	6	393256	393256	+	Missense_Mutation	SNP	G	G	A	rs538907751		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr6:393256G>A	ENST00000380956.4	+	2	230	c.104G>A	c.(103-105)gGc>gAc	p.G35D	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	35					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		ATCGACAGCGGCAAGTACCCC	0.667			T	IGH@	MM																																p.G35D		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.G104A						.						35.0	35.0	35.0					6																	393256		2201	4298	6499	SO:0001583	missense	3662	exon2			ACAGCGGCAAGTA	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.104G>A	chr6.hg19:g.393256G>A	ENSP00000370343:p.Gly35Asp	214.0	0.0		260.0	84.0	NM_001195286	Q5VUI7|Q99660	Missense_Mutation	SNP	ENST00000380956.4	hg19	CCDS4469.1	.	.	.	.	.	.	.	.	.	.	G	34	5.294557	0.95546	.	.	ENSG00000137265	ENST00000380956;ENST00000412334	D	0.98044	-4.68	4.58	4.58	0.56647	Winged helix-turn-helix transcription repressor DNA-binding (1);Interferon regulatory factor DNA-binding domain (4);	0.098877	0.64402	D	0.000001	D	0.98406	0.9470	M	0.79258	2.445	0.80722	D	1	D;D;P	0.56521	0.976;0.971;0.946	D;P;P	0.66602	0.945;0.908;0.775	D	0.99274	1.0894	10	0.66056	D	0.02	-28.3311	17.6301	0.88104	0.0:0.0:1.0:0.0	.	35;35;35	F2Z3D5;Q15306-2;Q15306	.;.;IRF4_HUMAN	D	35;65	ENSP00000370343:G35D	ENSP00000370343:G35D	G	+	2	0	IRF4	338256	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	8.812000	0.91959	2.399000	0.81585	0.306000	0.20318	GGC	.	.		0.667	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
PHF1	5252	hgsc.bcm.edu	37	6	33382581	33382581	+	Missense_Mutation	SNP	C	C	T	rs201507218		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr6:33382581C>T	ENST00000374516.3	+	11	1295	c.1024C>T	c.(1024-1026)Cct>Tct	p.P342S	PHF1_ENST00000374512.3_Missense_Mutation_p.P342S	NM_024165.2	NP_077084.1	O43189	PHF1_HUMAN	PHD finger protein 1	342					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of histone H3-K27 methylation (GO:0061087)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19		Ovarian(999;0.0443)				TGTGGAGCCCCCTACTGGAGA	0.527											OREG0017346	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P342S		Atlas-SNP	.											.	PHF1	42	.	0			c.C1024T						.						67.0	66.0	66.0					6																	33382581		2203	4294	6497	SO:0001583	missense	5252	exon11			GAGCCCCCTACTG	AF029678	CCDS4777.1, CCDS4778.1	6p21.3	2013-01-28			ENSG00000112511	ENSG00000112511		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	8919	protein-coding gene	gene with protein product	"""tudor domain containing 19C"""	602881				9545646, 18385154	Standard	NM_024165		Approved	MTF2L2, TDRD19C	uc003oeh.3	O43189	OTTHUMG00000031105	ENST00000374516.3:c.1024C>T	chr6.hg19:g.33382581C>T	ENSP00000363640:p.Pro342Ser	61.0	0.0	839	73.0	18.0	NM_024165	B1AZX2|B1AZX3|O60929|Q5SU07|Q5SU08|Q96KM7	Missense_Mutation	SNP	ENST00000374516.3	hg19	CCDS4777.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.136914	0.37728	.	.	ENSG00000112511	ENST00000374512;ENST00000374516	T;T	0.24350	1.92;1.86	4.75	4.75	0.60458	.	0.509864	0.20175	N	0.097653	T	0.05227	0.0139	N	0.02011	-0.69	0.29377	N	0.863601	P;B	0.43231	0.801;0.179	B;B	0.41571	0.36;0.197	T	0.16100	-1.0414	10	0.29301	T	0.29	-0.3061	15.279	0.73767	0.0:1.0:0.0:0.0	.	342;342	O43189-2;O43189	.;PHF1_HUMAN	S	342	ENSP00000363636:P342S;ENSP00000363640:P342S	ENSP00000363636:P342S	P	+	1	0	PHF1	33490559	0.029000	0.19370	0.348000	0.25681	0.928000	0.56348	1.846000	0.39289	2.493000	0.84123	0.555000	0.69702	CCT	.	C|1.000;G|0.000		0.527	PHF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076175.3		
PTCHD4	442213	hgsc.bcm.edu	37	6	47976781	47976781	+	Missense_Mutation	SNP	G	G	C	rs375811446		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr6:47976781G>C	ENST00000339488.4	-	2	529	c.496C>G	c.(496-498)Cgg>Ggg	p.R166G	PTCHD4_ENST00000543600.1_Missense_Mutation_p.R149G	NM_001013732.3	NP_001013754.3	Q6ZW05	PTHD4_HUMAN	patched domain containing 4	166						integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)										GACTTGACCCGCTGATCTTTG	0.493																																					p.R166G		Atlas-SNP	.											.	.	.	.	0			c.C496G						.						38.0	38.0	38.0					6																	47976781		1973	4150	6123	SO:0001583	missense	442213	exon2			TGACCCGCTGATC		CCDS34473.2	6p12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000244694	ENSG00000244694			21345	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 138"""	C6orf138			Standard	NM_001013732		Approved	dJ402H5.2, FLJ41841	uc011dwm.2	Q6ZW05	OTTHUMG00000150404	ENST00000339488.4:c.496C>G	chr6.hg19:g.47976781G>C	ENSP00000341914:p.Arg166Gly	68.0	0.0		100.0	41.0	NM_001013732	B0QZ29|B4DRK3|Q5T884	Missense_Mutation	SNP	ENST00000339488.4	hg19	CCDS34473.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.07|17.07	3.295842|3.295842	0.60086|0.60086	.|.	.|.	ENSG00000244694|ENSG00000244694	ENST00000398738|ENST00000339488;ENST00000543600	.|D;D	.|0.85484	.|-1.99;-1.99	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|0.171773	.|0.52532	.|D	.|0.000080	T|T	0.79969|0.79969	0.4538|0.4538	L|L	0.34521|0.34521	1.04|1.04	0.50813|0.50813	D|D	0.999892|0.999892	.|P;P	.|0.52842	.|0.653;0.956	.|B;P	.|0.53722	.|0.361;0.733	T|T	0.76345|0.76345	-0.2993|-0.2993	5|10	.|0.21014	.|T	.|0.42	.|.	15.4463|15.4463	0.75232|0.75232	0.0:0.0:0.8297:0.1703|0.0:0.0:0.8297:0.1703	.|.	.|166;149	.|Q6ZW05;B0QZ29	.|CF138_HUMAN;.	G|G	165|166;149	.|ENSP00000341914:R166G;ENSP00000439864:R149G	.|ENSP00000341914:R166G	A|R	-|-	2|1	0|2	C6orf138|C6orf138	48084740|48084740	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.091000|5.091000	0.64505|0.64505	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GCG|CGG	.	.		0.493	PTCHD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317987.2	NM_001013732	
B3GAT2	135152	hgsc.bcm.edu	37	6	71603943	71603943	+	Silent	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr6:71603943A>T	ENST00000230053.6	-	2	1232	c.624T>A	c.(622-624)ccT>ccA	p.P208P		NM_080742.2	NP_542780.1	Q9NPZ5	B3GA2_HUMAN	beta-1,3-glucuronyltransferase 2	208					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						CCAGGCCCACAGGCCAGACGG	0.527																																					p.P208P		Atlas-SNP	.											.	B3GAT2	33	.	0			c.T624A						.						74.0	72.0	73.0					6																	71603943		2203	4300	6503	SO:0001819	synonymous_variant	135152	exon2			GCCCACAGGCCAG	AB075843	CCDS4974.1	6q12	2014-07-08	2014-07-08		ENSG00000112309	ENSG00000112309	2.4.1.135	"""Beta-1,3-glucuronyltransferases"""	922	protein-coding gene	gene with protein product	"""glucuronosyltransferase S"", ""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2"""	607497				12383500	Standard	NM_080742		Approved	GlcAT-S	uc003pfv.3	Q9NPZ5	OTTHUMG00000014997	ENST00000230053.6:c.624T>A	chr6.hg19:g.71603943A>T		183.0	0.0		238.0	72.0	NM_080742	Q5JS09|Q8TF38|Q96NK4	Silent	SNP	ENST00000230053.6	hg19	CCDS4974.1																																																																																			.	.		0.527	B3GAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041150.2	NM_080742	
PHIP	55023	hgsc.bcm.edu	37	6	79679818	79679818	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr6:79679818C>G	ENST00000275034.4	-	26	3237	c.3070G>C	c.(3070-3072)Gct>Cct	p.A1024P	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1024	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TCTAGAAAAGCAAGTTTAAGG	0.383																																					p.A1024P		Atlas-SNP	.											.	PHIP	177	.	0			c.G3070C						.						125.0	125.0	125.0					6																	79679818		2203	4300	6503	SO:0001583	missense	55023	exon26			GAAAAGCAAGTTT	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3070G>C	chr6.hg19:g.79679818C>G	ENSP00000275034:p.Ala1024Pro	95.0	0.0		120.0	37.0	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	hg19	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342062	0.81911	.	.	ENSG00000146247	ENST00000275034	T	0.46819	0.86	5.4	5.4	0.78164	.	0.000000	0.64402	D	0.000002	T	0.63663	0.2530	M	0.76170	2.325	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.994	T	0.63804	-0.6554	9	.	.	.	-19.0361	18.1612	0.89708	0.0:1.0:0.0:0.0	.	1024;1024	A7J992;Q8WWQ0	.;PHIP_HUMAN	P	1024	ENSP00000275034:A1024P	.	A	-	1	0	PHIP	79736537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.527000	0.60573	2.544000	0.85801	0.557000	0.71058	GCT	.	.		0.383	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
COL28A1	340267	hgsc.bcm.edu	37	7	7412740	7412740	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:7412740C>G	ENST00000399429.3	-	32	2937	c.2797G>C	c.(2797-2799)Ggg>Cgg	p.G933R		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	933	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		TTCACCACCCCTATCACAAAT	0.398																																					p.G933R		Atlas-SNP	.											COL28A1,colon,carcinoma,0,1	COL28A1	113	.	0			c.G2797C						.						120.0	113.0	115.0					7																	7412740		1874	4103	5977	SO:0001583	missense	340267	exon32			CCACCCCTATCAC	AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.2797G>C	chr7.hg19:g.7412740C>G	ENSP00000382356:p.Gly933Arg	92.0	1.0		152.0	34.0	NM_001037763	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Missense_Mutation	SNP	ENST00000399429.3	hg19	CCDS43553.1	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740460	0.69304	.	.	ENSG00000215018	ENST00000399429	D	0.91740	-2.9	4.09	4.09	0.47781	von Willebrand factor, type A (3);	0.000000	0.64402	U	0.000004	D	0.97396	0.9148	H	0.96889	3.9	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98137	1.0434	10	0.49607	T	0.09	-5.903	16.8665	0.86030	0.0:1.0:0.0:0.0	.	933	Q2UY09	COSA1_HUMAN	R	933	ENSP00000382356:G933R	ENSP00000382356:G933R	G	-	1	0	COL28A1	7379265	1.000000	0.71417	1.000000	0.80357	0.602000	0.36980	7.416000	0.80143	2.284000	0.76573	0.655000	0.94253	GGG	.	.		0.398	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315899.1	NM_001037763	
NXPH1	30010	hgsc.bcm.edu	37	7	8791265	8791265	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:8791265T>A	ENST00000405863.1	+	3	1593	c.682T>A	c.(682-684)Tcc>Acc	p.S228T	NXPH1_ENST00000497400.1_3'UTR|NXPH1_ENST00000602349.1_Missense_Mutation_p.S111T	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	228	V (Cys-rich).					extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		AAGTCATGTATCCTGGCTCTG	0.408																																					p.S228T		Atlas-SNP	.											.	NXPH1	42	.	0			c.T682A						.						46.0	42.0	43.0					7																	8791265		1876	4115	5991	SO:0001583	missense	30010	exon3			CATGTATCCTGGC	AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.682T>A	chr7.hg19:g.8791265T>A	ENSP00000384551:p.Ser228Thr	171.0	0.0		345.0	16.0	NM_152745	Q8NB31	Missense_Mutation	SNP	ENST00000405863.1	hg19	CCDS47540.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.973252	0.53614	.	.	ENSG00000122584	ENST00000405863;ENST00000417186	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.57095	0.2030	L	0.45051	1.395	0.80722	D	1	P	0.46395	0.877	P	0.48654	0.585	T	0.51419	-0.8708	9	0.18710	T	0.47	-12.4694	15.827	0.78718	0.0:0.0:0.0:1.0	.	228	P58417	NXPH1_HUMAN	T	228;111	.	ENSP00000384551:S228T	S	+	1	0	NXPH1	8757790	1.000000	0.71417	0.994000	0.49952	0.999000	0.98932	7.841000	0.86834	2.324000	0.78689	0.533000	0.62120	TCC	.	.		0.408	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324591.1	NM_152745	
BZW2	28969	hgsc.bcm.edu	37	7	16720989	16720989	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:16720989C>A	ENST00000433922.2	+	4	477	c.299C>A	c.(298-300)tCa>tAa	p.S100*	BZW2_ENST00000258761.3_Nonsense_Mutation_p.S100*|BZW2_ENST00000432311.1_3'UTR|BZW2_ENST00000452975.2_Nonsense_Mutation_p.S100*|BZW2_ENST00000405202.1_Nonsense_Mutation_p.S24*	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	100					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		TGTGTGTTTTCAGCAAATGAA	0.418																																					p.S100X		Atlas-SNP	.											.	BZW2	35	.	0			c.C299A						.						145.0	128.0	134.0					7																	16720989		2203	4300	6503	SO:0001587	stop_gained	28969	exon4			TGTTTTCAGCAAA	AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.299C>A	chr7.hg19:g.16720989C>A	ENSP00000397249:p.Ser100*	72.0	0.0		102.0	28.0	NM_014038	A4D123|Q3B779|Q96JW5|Q9H3F7	Nonsense_Mutation	SNP	ENST00000433922.2	hg19	CCDS5362.1	.	.	.	.	.	.	.	.	.	.	C	37	6.168190	0.97343	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000452975;ENST00000405202;ENST00000446596;ENST00000438834;ENST00000430000	.	.	.	5.89	4.83	0.62350	.	0.424586	0.23718	N	0.045252	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-22.1205	13.6347	0.62215	0.0:0.885:0.0:0.115	.	.	.	.	X	100;100;100;100;24;100;100;100	.	ENSP00000258761:S100X	S	+	2	0	BZW2	16687514	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.536000	0.36072	2.788000	0.95919	0.557000	0.71058	TCA	.	.		0.418	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253256.2	NM_014038	
PDE1C	5137	hgsc.bcm.edu	37	7	31887658	31887658	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:31887658A>C	ENST00000396191.1	-	9	1359	c.904T>G	c.(904-906)Tta>Gta	p.L302V	PDE1C_ENST00000396182.2_Missense_Mutation_p.L302V|PDE1C_ENST00000321453.7_Missense_Mutation_p.L302V|PDE1C_ENST00000396193.1_Missense_Mutation_p.L362V|PDE1C_ENST00000396184.3_Missense_Mutation_p.L302V	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	302	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	GCTGCACTTAAATGGTGATTC	0.383																																					p.L362V		Atlas-SNP	.											.	PDE1C	465	.	0			c.T1084G						.						111.0	103.0	106.0					7																	31887658		2203	4300	6503	SO:0001583	missense	5137	exon10			CACTTAAATGGTG	U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.904T>G	chr7.hg19:g.31887658A>C	ENSP00000379494:p.Leu302Val	92.0	0.0		110.0	18.0	NM_001191058	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	ENST00000396191.1	hg19	CCDS55099.1	.	.	.	.	.	.	.	.	.	.	A	5.757	0.324146	0.10900	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.77750	-1.12;-1.12;-1.12;-1.12;-1.12	5.92	0.593	0.17478	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.123681	0.53938	D	0.000058	T	0.49029	0.1533	N	0.11064	0.09	0.37526	D	0.917734	B;B;B	0.10296	0.0;0.003;0.001	B;B;B	0.21546	0.003;0.035;0.007	T	0.15867	-1.0422	10	0.11485	T	0.65	.	1.4002	0.02269	0.3821:0.2603:0.2388:0.1188	.	302;362;302	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	V	362;302;302;302;302	ENSP00000379496:L362V;ENSP00000379494:L302V;ENSP00000318105:L302V;ENSP00000379487:L302V;ENSP00000379485:L302V	ENSP00000318105:L302V	L	-	1	2	PDE1C	31854183	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	3.045000	0.49838	0.461000	0.27071	0.528000	0.53228	TTA	.	.		0.383	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328458.1		
ZNF679	168417	hgsc.bcm.edu	37	7	63726440	63726440	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:63726440A>T	ENST00000421025.1	+	5	698	c.429A>T	c.(427-429)gaA>gaT	p.E143D	ZNF679_ENST00000255746.4_Missense_Mutation_p.E143D	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	143					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						GTTGTAATGAAGTTAACCAAT	0.328																																					p.E143D		Atlas-SNP	.											.	ZNF679	80	.	0			c.A429T						.						198.0	175.0	182.0					7																	63726440		692	1591	2283	SO:0001583	missense	168417	exon5			TAATGAAGTTAAC	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.429A>T	chr7.hg19:g.63726440A>T	ENSP00000416809:p.Glu143Asp	172.0	0.0		337.0	79.0	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	hg19	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	A	5.935	0.356624	0.11239	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	T;T	0.06371	3.31;3.31	1.03	-2.06	0.07298	.	.	.	.	.	T	0.05593	0.0147	L	0.53561	1.675	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.41910	-0.9482	9	0.39692	T	0.17	.	1.3855	0.02239	0.3407:0.0:0.314:0.3453	.	143	Q8IYX0	ZN679_HUMAN	D	143	ENSP00000416809:E143D;ENSP00000255746:E143D	ENSP00000255746:E143D	E	+	3	2	ZNF679	63363875	0.001000	0.12720	0.005000	0.12908	0.246000	0.25737	0.735000	0.26115	-0.694000	0.05113	0.163000	0.16589	GAA	.	.		0.328	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
CD36	948	hgsc.bcm.edu	37	7	80302699	80302699	+	Missense_Mutation	SNP	A	A	C	rs550565800	byFrequency	TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:80302699A>C	ENST00000435819.1	+	16	1912	c.1228A>C	c.(1228-1230)Att>Ctt	p.I410L	CD36_ENST00000432207.1_Missense_Mutation_p.I410L|CD36_ENST00000534394.1_Missense_Mutation_p.I334L|CD36_ENST00000544133.1_3'UTR|CD36_ENST00000538969.1_Missense_Mutation_p.I350L|CD36_ENST00000309881.7_Missense_Mutation_p.I410L|CD36_ENST00000447544.2_Missense_Mutation_p.I410L|CD36_ENST00000394788.3_Missense_Mutation_p.I410L|CD36_ENST00000433696.2_Missense_Mutation_p.I371L			P16671	CD36_HUMAN	CD36 molecule (thrombospondin receptor)	410					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular lipid metabolic process (GO:0044255)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to hydroperoxide (GO:0071447)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cGMP-mediated signaling (GO:0019934)|cholesterol transport (GO:0030301)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response (GO:0045087)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|lipoprotein transport (GO:0042953)|long-chain fatty acid import (GO:0044539)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle mediated signaling (GO:0055096)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of transcription factor import into nucleus (GO:0042992)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nitric oxide mediated signal transduction (GO:0007263)|phagocytosis, recognition (GO:0006910)|plasma lipoprotein particle clearance (GO:0034381)|plasma membrane long-chain fatty acid transport (GO:0015911)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood microparticle formation (GO:2000334)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of removal of superoxide radicals (GO:2000121)|response to stilbenoid (GO:0035634)|small molecule metabolic process (GO:0044281)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|lipoprotein particle binding (GO:0071813)|lipoteichoic acid receptor activity (GO:0070892)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|thrombospondin receptor activity (GO:0070053)|transforming growth factor beta binding (GO:0050431)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(10)|large_intestine(1)|lung(6)|ovary(1)	21						GAGGAACTATATTGTGCCTAT	0.254																																					p.I410L		Atlas-SNP	.											.	CD36	185	.	0			c.A1228C	GRCh37	CD012238	CD36	D		.						73.0	75.0	75.0					7																	80302699		2202	4268	6470	SO:0001583	missense	948	exon11			AACTATATTGTGC	Z32770	CCDS34673.1	7q11.2	2010-02-26	2006-03-28		ENSG00000135218	ENSG00000135218		"""CD molecules"""	1663	protein-coding gene	gene with protein product		173510	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)"""			7503937	Standard	NM_001001548		Approved	SCARB3, GPIV, FAT, GP4, GP3B	uc003uhg.4	P16671	OTTHUMG00000155383	ENST00000435819.1:c.1228A>C	chr7.hg19:g.80302699A>C	ENSP00000399421:p.Ile410Leu	141.0	0.0		352.0	23.0	NM_001127444	D9IX66|D9IX67|D9IX68|D9IX69|Q13966|Q16093|Q8TCV7|Q9BPZ8|Q9BQC2|Q9BZM8|Q9BZN3|Q9BZN4|Q9BZN5	Missense_Mutation	SNP	ENST00000435819.1	hg19	CCDS34673.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.52|10.52	1.373800|1.373800	0.24857|0.24857	.|.	.|.	ENSG00000135218|ENSG00000135218	ENST00000435819;ENST00000309881;ENST00000534394;ENST00000394788;ENST00000447544;ENST00000432207;ENST00000419819;ENST00000538969;ENST00000433696|ENST00000488048	T;T;T;T;T;T;T;T;T|T	0.72051|0.71817	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62|-0.6	5.83|5.83	-11.7|-11.7	0.00046|0.00046	.|.	0.663319|.	0.15051|.	N|.	0.283281|.	T|T	0.53932|0.53932	0.1827|0.1827	L|L	0.31294|0.31294	0.92|0.92	0.54753|0.54753	D|D	0.999989|0.999989	B|.	0.14012|.	0.009|.	B|.	0.15870|.	0.014|.	T|T	0.56195|0.56195	-0.8019|-0.8019	9|6	.|.	.|.	.|.	-1.671|-1.671	9.3781|9.3781	0.38295|0.38295	0.1122:0.6218:0.0529:0.2131|0.1122:0.6218:0.0529:0.2131	.|.	410|.	P16671|.	CD36_HUMAN|.	L|S	410;410;334;410;410;410;410;350;371|3	ENSP00000399421:I410L;ENSP00000308165:I410L;ENSP00000431296:I334L;ENSP00000378268:I410L;ENSP00000415743:I410L;ENSP00000411411:I410L;ENSP00000392298:I410L;ENSP00000439543:I350L;ENSP00000401863:I371L|ENSP00000435698:Y3S	.|.	I|Y	+|+	1|2	0|0	CD36|CD36	80140635|80140635	0.000000|0.000000	0.05858|0.05858	0.016000|0.016000	0.15963|0.15963	0.118000|0.118000	0.20060|0.20060	-1.319000|-1.319000	0.02702|0.02702	-1.425000|-1.425000	0.01997|0.01997	-1.096000|-1.096000	0.02151|0.02151	ATT|TAT	.	.		0.254	CD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339767.6	NM_001001547	
SEMA3A	10371	hgsc.bcm.edu	37	7	83610774	83610774	+	Silent	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:83610774T>C	ENST00000265362.4	-	14	1829	c.1515A>G	c.(1513-1515)tcA>tcG	p.S505S	SEMA3A_ENST00000436949.1_Silent_p.S505S	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	505	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CCCCAGCCGTTGAACCAATAT	0.433																																					p.S505S		Atlas-SNP	.											.	SEMA3A	121	.	0			c.A1515G						.						55.0	56.0	55.0					7																	83610774		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon14			AGCCGTTGAACCA	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1515A>G	chr7.hg19:g.83610774T>C		88.0	0.0		203.0	9.0	NM_006080		Silent	SNP	ENST00000265362.4	hg19	CCDS5599.1																																																																																			.	.		0.433	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
KIAA1324L	222223	hgsc.bcm.edu	37	7	86574266	86574266	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:86574266A>T	ENST00000450689.2	-	4	788	c.603T>A	c.(601-603)taT>taA	p.Y201*	KIAA1324L_ENST00000416314.1_Nonsense_Mutation_p.Y34*|KIAA1324L_ENST00000444627.1_Nonsense_Mutation_p.Y201*	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like	201						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					CAAAGAAGACATAGCCTGACT	0.393																																					p.Y201X		Atlas-SNP	.											.	KIAA1324L	225	.	0			c.T603A						.						133.0	119.0	123.0					7																	86574266		692	1591	2283	SO:0001587	stop_gained	222223	exon4			GAAGACATAGCCT	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.603T>A	chr7.hg19:g.86574266A>T	ENSP00000413445:p.Tyr201*	269.0	0.0		427.0	117.0	NM_001142749	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Nonsense_Mutation	SNP	ENST00000450689.2	hg19	CCDS47632.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.304548|5.304548	0.95601|0.95601	.|.	.|.	ENSG00000164659|ENSG00000164659	ENST00000423294|ENST00000450689;ENST00000444627;ENST00000416314;ENST00000398276;ENST00000425689	.|.	.|.	.|.	5.66|5.66	2.03|2.03	0.26663|0.26663	.|.	.|20.081800	.|0.03009	.|U	.|0.149243	T|.	0.57286|.	0.2043|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.16453|.	-1.0402|.	4|.	.|.	.|.	.|.	.|.	8.72|8.72	0.34434|0.34434	0.7847:0.0:0.2153:0.0|0.7847:0.0:0.2153:0.0	.|.	.|.	.|.	.|.	S|X	162|201;201;34;87;87	.|.	.|.	C|Y	-|-	1|3	0|2	KIAA1324L|KIAA1324L	86412202|86412202	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	0.653000|0.653000	0.24902|0.24902	0.172000|0.172000	0.19760|0.19760	0.533000|0.533000	0.62120|0.62120	TGT|TAT	.	.		0.393	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	
SGCE	8910	hgsc.bcm.edu	37	7	94259029	94259029	+	Splice_Site	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:94259029A>G	ENST00000265735.7	-	2	343		c.e2+1		SGCE_ENST00000445866.2_Splice_Site|SGCE_ENST00000437425.2_Intron|SGCE_ENST00000447873.1_Splice_Site|SGCE_ENST00000428696.2_Splice_Site|SGCE_ENST00000415788.2_Splice_Site	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon						cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CAAAGAACATACCAGGTTTTG	0.318																																					.		Atlas-SNP	.											.	SGCE	68	.	0			c.232+2T>C	GRCh37	CS062103	SGCE	S		.						103.0	115.0	111.0					7																	94259029		2203	4299	6502	SO:0001630	splice_region_variant	8910	exon3			GAACATACCAGGT	AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.232+1T>C	chr7.hg19:g.94259029A>G		256.0	0.0		476.0	233.0	NM_001099400	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Splice_Site	SNP	ENST00000265735.7	hg19	CCDS5637.1	.	.	.	.	.	.	.	.	.	.	A	23.8	4.454778	0.84209	.	.	ENSG00000127990	ENST00000265735;ENST00000445866;ENST00000447873;ENST00000428696;ENST00000415788	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.187	0.81960	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SGCE	94096965	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.962000	0.93254	2.285000	0.76669	0.533000	0.62120	.	.	.		0.318	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		Intron
LMTK2	22853	hgsc.bcm.edu	37	7	97770825	97770825	+	Silent	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:97770825A>T	ENST00000297293.5	+	3	641	c.348A>T	c.(346-348)ccA>ccT	p.P116P	LMTK2_ENST00000493372.1_3'UTR	NM_014916.3	NP_055731.2	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	116					early endosome to late endosome transport (GO:0045022)|endocytic recycling (GO:0032456)|negative regulation of catalytic activity (GO:0043086)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|myosin VI binding (GO:0070853)|protein phosphatase inhibitor activity (GO:0004864)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|pancreas(2)|skin(2)|stomach(3)	59	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)					TTTCACTCCCAGCTCCCTCGC	0.468																																					p.P116P		Atlas-SNP	.											.	LMTK2	228	.	0			c.A348T						.						166.0	164.0	165.0					7																	97770825		2203	4300	6503	SO:0001819	synonymous_variant	22853	exon3			ACTCCCAGCTCCC	AB029002	CCDS5654.1	7q22.1	2014-06-12			ENSG00000164715	ENSG00000164715			17880	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 100"""	610989				15005709	Standard	NM_014916		Approved	KIAA1079, KPI2, KPI-2, cprk, LMR2, BREK, AATYK2, PPP1R100	uc003upd.2	Q8IWU2	OTTHUMG00000154256	ENST00000297293.5:c.348A>T	chr7.hg19:g.97770825A>T		97.0	0.0		158.0	27.0	NM_014916	A4D272|Q75MG7|Q9UPS3	Silent	SNP	ENST00000297293.5	hg19	CCDS5654.1																																																																																			.	.		0.468	LMTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334560.1	NM_014916	
SLC37A3	84255	hgsc.bcm.edu	37	7	140055481	140055481	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:140055481T>A	ENST00000326232.9	-	7	808	c.605A>T	c.(604-606)cAg>cTg	p.Q202L	SLC37A3_ENST00000447932.2_Missense_Mutation_p.Q202L|SLC37A3_ENST00000429996.2_Silent_p.S153S|SLC37A3_ENST00000340308.3_Missense_Mutation_p.Q202L|SLC37A3_ENST00000461089.1_5'Flank	NM_207113.1	NP_996996.1	Q8NCC5	SPX3_HUMAN	solute carrier family 37, member 3	202					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(4)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|stomach(3)	24	Melanoma(164;0.0142)					ATAACCATACTGAAGAACAGA	0.433																																					p.Q202L	Esophageal Squamous(133;211 1716 4665 11387 37873)	Atlas-SNP	.											.	SLC37A3	80	.	0			c.A605T						.						171.0	141.0	151.0					7																	140055481		2203	4300	6503	SO:0001583	missense	84255	exon7			CCATACTGAAGAA	AK074823	CCDS5858.1, CCDS5859.1, CCDS75669.1	7q34	2013-07-17	2013-07-17		ENSG00000157800	ENSG00000157800		"""Solute carriers"""	20651	protein-coding gene	gene with protein product							Standard	NM_001287498		Approved	DKFZp761N0624	uc003vvo.3	Q8NCC5	OTTHUMG00000157343	ENST00000326232.9:c.605A>T	chr7.hg19:g.140055481T>A	ENSP00000321498:p.Gln202Leu	64.0	0.0		160.0	29.0	NM_207113	Q6PIU7|Q86SS4|Q9BQG7	Missense_Mutation	SNP	ENST00000326232.9	hg19	CCDS5859.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	10.22|10.22	1.290405|1.290405	0.23478|0.23478	.|.	.|.	ENSG00000157800|ENSG00000157800	ENST00000340308;ENST00000447932;ENST00000326232;ENST00000539816|ENST00000485861	T;T;T|.	0.56444|.	0.46;0.46;0.46|.	5.28|5.28	2.81|2.81	0.32909|0.32909	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);|.	0.055692|.	0.64402|.	D|.	0.000001|.	T|T	0.53932|0.53932	0.1827|0.1827	L|L	0.41824|0.41824	1.3|1.3	0.80722|0.80722	D|D	1|1	B;B;B;P;B|.	0.34587|.	0.042;0.03;0.129;0.458;0.257|.	B;B;B;B;B|.	0.36186|.	0.103;0.062;0.138;0.219;0.216|.	T|T	0.41787|0.41787	-0.9489|-0.9489	10|5	0.33141|.	T|.	0.24|.	-13.1658|-13.1658	10.6547|10.6547	0.45667|0.45667	0.2561:0.0:0.0:0.7439|0.2561:0.0:0.0:0.7439	.|.	174;202;202;202;202|.	B4DKF5;F5H743;Q8NCC5-2;Q8NCC5-3;Q8NCC5|.	.;.;.;.;SPX3_HUMAN|.	L|C	202|127	ENSP00000343358:Q202L;ENSP00000397481:Q202L;ENSP00000321498:Q202L|.	ENSP00000321498:Q202L|.	Q|S	-|-	2|1	0|0	SLC37A3|SLC37A3	139701950|139701950	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.175000|0.175000	0.22909|0.22909	4.082000|4.082000	0.57635|0.57635	0.364000|0.364000	0.24374|0.24374	-0.357000|-0.357000	0.07601|0.07601	CAG|AGT	.	.		0.433	SLC37A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348492.1	NM_032295	
UBE3C	9690	hgsc.bcm.edu	37	7	156932031	156932031	+	Splice_Site	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr7:156932031A>G	ENST00000348165.5	+	1	425	c.65A>G	c.(64-66)aAg>aGg	p.K22R	UBE3C_ENST00000389103.4_Splice_Site_p.K22R	NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	22	Cis-determinant of acceptor ubiquitin- binding.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		GCGAGCAGGAAGGTGAGGGCC	0.756																																					p.K22R		Atlas-SNP	.											.	UBE3C	124	.	0			c.A65G						.						9.0	11.0	10.0					7																	156932031		2153	4223	6376	SO:0001630	splice_region_variant	9690	exon1			GCAGGAAGGTGAG	AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.66+1A>G	chr7.hg19:g.156932031A>G		32.0	0.0		44.0	9.0	NM_014671	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	ENST00000348165.5	hg19	CCDS34789.1	.	.	.	.	.	.	.	.	.	.	a	9.715	1.158001	0.21454	.	.	ENSG00000009335	ENST00000348165;ENST00000389103	T	0.50813	0.73	3.92	3.92	0.45320	.	0.000000	0.85682	U	0.000000	T	0.36110	0.0955	L	0.38838	1.175	0.09310	N	0.999995	B;B;B	0.24132	0.001;0.098;0.0	B;B;B	0.29785	0.001;0.107;0.0	T	0.19451	-1.0305	10	0.21014	T	0.42	.	9.4521	0.38731	1.0:0.0:0.0:0.0	.	22;22;22	Q15386;Q15386-2;Q15386-3	UBE3C_HUMAN;.;.	R	22	ENSP00000309198:K22R	ENSP00000309198:K22R	K	+	2	0	UBE3C	156624792	1.000000	0.71417	1.000000	0.80357	0.305000	0.27757	4.808000	0.62583	1.523000	0.49018	0.398000	0.26397	AAG	.	.		0.756	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348108.1	NM_014671	Missense_Mutation
NEFM	4741	hgsc.bcm.edu	37	8	24775019	24775019	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr8:24775019G>C	ENST00000221166.5	+	3	2433	c.1651G>C	c.(1651-1653)Gga>Cga	p.G551R	NEFM_ENST00000518131.1_Missense_Mutation_p.G551R|NEFM_ENST00000521540.1_Intron|GS1-72M22.1_ENST00000607058.1_RNA|NEFM_ENST00000437366.2_Missense_Mutation_p.G551R|NEFM_ENST00000433454.2_Missense_Mutation_p.G175R			P07197	NFM_HUMAN	neurofilament, medium polypeptide	551	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		AGCCGAAGAGGGAGGATCCGA	0.493																																					p.G551R		Atlas-SNP	.											.	NEFM	115	.	0			c.G1651C						.						34.0	38.0	36.0					8																	24775019		2189	4254	6443	SO:0001583	missense	4741	exon3			GAAGAGGGAGGAT	BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.1651G>C	chr8.hg19:g.24775019G>C	ENSP00000221166:p.Gly551Arg	149.0	0.0		179.0	58.0	NM_005382	B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	ENST00000221166.5	hg19	CCDS6046.1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.030565	0.35797	.	.	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366;ENST00000433454	D;D;D;D	0.94758	-1.76;-1.72;-1.72;-3.51	4.41	4.41	0.53225	.	0.000000	0.46145	D	0.000319	D	0.95443	0.8520	M	0.81682	2.555	0.40553	D	0.981136	P;D	0.55800	0.731;0.973	B;P	0.48873	0.231;0.593	D	0.95944	0.8949	10	0.49607	T	0.09	.	16.9666	0.86287	0.0:0.0:1.0:0.0	.	551;551	E7EMV2;P07197	.;NFM_HUMAN	R	551;551;551;175	ENSP00000221166:G551R;ENSP00000427872:G551R;ENSP00000410137:G551R;ENSP00000412295:G175R	ENSP00000221166:G551R	G	+	1	0	NEFM	24830924	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.104000	0.77024	2.152000	0.67230	0.313000	0.20887	GGA	.	.		0.493	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382	
ST18	9705	hgsc.bcm.edu	37	8	53055540	53055540	+	Silent	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr8:53055540T>A	ENST00000276480.7	-	17	2801	c.2118A>T	c.(2116-2118)ccA>ccT	p.P706P		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	706					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GTTTAGGGCTTGGTATAGAGG	0.403																																					p.P706P		Atlas-SNP	.											.	ST18	212	.	0			c.A2118T						.						155.0	145.0	149.0					8																	53055540		2203	4300	6503	SO:0001819	synonymous_variant	9705	exon17			AGGGCTTGGTATA	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.2118A>T	chr8.hg19:g.53055540T>A		85.0	0.0		118.0	42.0	NM_014682	Q17RY1	Silent	SNP	ENST00000276480.7	hg19	CCDS6149.1																																																																																			.	.		0.403	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
STAU2	27067	hgsc.bcm.edu	37	8	74464277	74464277	+	Silent	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr8:74464277C>A	ENST00000521451.1	-	8	1216	c.840G>T	c.(838-840)ctG>ctT	p.L280L	STAU2_ENST00000524300.1_Silent_p.L500L|STAU2_ENST00000522695.1_Silent_p.L468L|STAU2_ENST00000521727.1_Silent_p.L480L|STAU2_ENST00000355780.5_Silent_p.L468L|STAU2_ENST00000522509.1_Silent_p.L468L|STAU2_ENST00000517542.1_Silent_p.L462L|STAU2_ENST00000523558.1_Silent_p.L328L|STAU2_ENST00000519961.1_Silent_p.L500L|STAU2_ENST00000521210.1_Silent_p.L396L			Q9NUL3	STAU2_HUMAN	staufen double-stranded RNA binding protein 2	500					transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)	19	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			CTAAATATTCCAGTTGTTTTG	0.358																																					p.L500L		Atlas-SNP	.											.	STAU2	148	.	0			c.G1500T						.						60.0	65.0	63.0					8																	74464277		2203	4297	6500	SO:0001819	synonymous_variant	27067	exon13			ATATTCCAGTTGT	Y19062	CCDS6214.1, CCDS55244.1, CCDS55245.1, CCDS55246.1, CCDS55247.1, CCDS55248.1	8q21.11	2013-06-05	2013-06-05		ENSG00000040341	ENSG00000040341			11371	protein-coding gene	gene with protein product		605920	"""staufen (Drosophila, RNA-binding protein) homolog 2"", ""staufen, RNA binding protein, homolog 2 (Drosophila)"""			10585778	Standard	NM_014393		Approved	39K2	uc003xzm.3	Q9NUL3	OTTHUMG00000164499	ENST00000521451.1:c.840G>T	chr8.hg19:g.74464277C>A		163.0	0.0		236.0	20.0	NM_001164380	B7Z1I6|B7Z292|B7Z8B4|E7ER74|E9PEI3|E9PF26|E9PF50|Q6AHY7|Q96HM0|Q96HM1|Q9NVI5|Q9UGG6	Silent	SNP	ENST00000521451.1	hg19																																																																																				.	.		0.358	STAU2-006	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000379006.4	NM_001164380	
PLEC	5339	hgsc.bcm.edu	37	8	145001727	145001727	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr8:145001727C>T	ENST00000322810.4	-	27	4187	c.4018G>A	c.(4018-4020)Gag>Aag	p.E1340K	PLEC_ENST00000357649.2_Missense_Mutation_p.E1207K|PLEC_ENST00000398774.2_Missense_Mutation_p.E1171K|PLEC_ENST00000354958.2_Missense_Mutation_p.E1181K|PLEC_ENST00000354589.3_Missense_Mutation_p.E1203K|PLEC_ENST00000356346.3_Missense_Mutation_p.E1189K|PLEC_ENST00000436759.2_Missense_Mutation_p.E1230K|PLEC_ENST00000345136.3_Missense_Mutation_p.E1203K|PLEC_ENST00000527096.1_Missense_Mutation_p.E1226K	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1340	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCCAGTTGCTCGAGCTCGCGC	0.716																																					p.E1340K		Atlas-SNP	.											.	PLEC	1144	.	0			c.G4018A						.						6.0	7.0	7.0					8																	145001727		1801	3847	5648	SO:0001583	missense	5339	exon27			GTTGCTCGAGCTC	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.4018G>A	chr8.hg19:g.145001727C>T	ENSP00000323856:p.Glu1340Lys	26.0	0.0		48.0	17.0	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	hg19	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396421	0.42512	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.17	5.17	0.71159	.	0.267312	0.28098	U	0.016607	T	0.42832	0.1220	L	0.54323	1.7	0.52099	D	0.999941	B;B;B;B;B;B;B;B	0.22211	0.066;0.014;0.014;0.014;0.014;0.014;0.024;0.024	B;B;B;B;B;B;B;B	0.15870	0.014;0.014;0.014;0.006;0.014;0.014;0.014;0.014	T	0.38001	-0.9681	10	0.66056	D	0.02	.	18.2525	0.90009	0.0:1.0:0.0:0.0	.	1230;1189;1181;1340;1171;1203;1207;1203	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	K	1203;1207;1203;1171;1340;1181;1189;1230;1226	ENSP00000344848:E1203K;ENSP00000350277:E1207K;ENSP00000346602:E1203K;ENSP00000381756:E1171K;ENSP00000323856:E1340K;ENSP00000347044:E1181K;ENSP00000348702:E1189K;ENSP00000388180:E1230K;ENSP00000434583:E1226K	ENSP00000323856:E1340K	E	-	1	0	PLEC	145073715	0.986000	0.35501	0.992000	0.48379	0.540000	0.34992	2.910000	0.48766	2.393000	0.81446	0.551000	0.68910	GAG	.	.		0.716	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
RFK	55312	hgsc.bcm.edu	37	9	79002393	79002393	+	Silent	SNP	T	T	A	rs188158713		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr9:79002393T>A	ENST00000376736.1	-	4	723	c.390A>T	c.(388-390)ctA>ctT	p.L130L	RFK_ENST00000479197.1_5'Flank	NM_018339.5	NP_060809.3	Q969G6	RIFK_HUMAN	riboflavin kinase	130					apoptotic process (GO:0006915)|FMN biosynthetic process (GO:0009398)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|reactive oxygen species metabolic process (GO:0072593)|riboflavin biosynthetic process (GO:0009231)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|riboflavin kinase activity (GO:0008531)			pancreas(1)|prostate(1)|urinary_tract(1)	3					Riboflavin(DB00140)	CTGGTAACTCTAGTCGTTTCT	0.308																																					p.L130L		Atlas-SNP	.											.	RFK	13	.	0			c.A390T						.						113.0	116.0	115.0					9																	79002393		2203	4299	6502	SO:0001819	synonymous_variant	55312	exon4			TAACTCTAGTCGT	AK002011	CCDS35044.1, CCDS35044.2	9q21.31	2010-11-16			ENSG00000135002	ENSG00000135002			30324	protein-coding gene	gene with protein product		613010				14580199	Standard	NM_018339		Approved	FLJ11149, RIFK	uc004akd.2	Q969G6	OTTHUMG00000020040	ENST00000376736.1:c.390A>T	chr9.hg19:g.79002393T>A		34.0	0.0		52.0	18.0	NM_018339	Q5JSG9|Q9NUT7	Silent	SNP	ENST00000376736.1	hg19	CCDS35044.2																																																																																			.	T|1.000;C|0.000		0.308	RFK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052720.1	NM_018339	
DENND1A	57706	hgsc.bcm.edu	37	9	126439003	126439003	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr9:126439003C>A	ENST00000373624.2	-	6	569	c.368G>T	c.(367-369)aGa>aTa	p.R123I	DENND1A_ENST00000394219.3_Missense_Mutation_p.R91I|DENND1A_ENST00000473039.1_Intron|DENND1A_ENST00000373620.3_Missense_Mutation_p.R123I|DENND1A_ENST00000373618.1_Missense_Mutation_p.R91I|DENND1A_ENST00000394215.2_Missense_Mutation_p.R93I	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	123	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						AAATACCTGTCTTTTTGTCGT	0.303																																					p.R123I		Atlas-SNP	.											.	DENND1A	112	.	0			c.G368T						.						71.0	72.0	72.0					9																	126439003		2203	4300	6503	SO:0001583	missense	57706	exon6			ACCTGTCTTTTTG	AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.368G>T	chr9.hg19:g.126439003C>A	ENSP00000362727:p.Arg123Ile	60.0	0.0		92.0	34.0	NM_024820	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	ENST00000373624.2	hg19	CCDS35133.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.367285	0.41902	.	.	ENSG00000119522	ENST00000373624;ENST00000394219;ENST00000373620;ENST00000394215;ENST00000373618	T;T;T;T;T	0.11712	2.75;2.75;2.75;2.75;2.75	5.99	4.12	0.48240	DENN (3);	0.106591	0.64402	D	0.000004	T	0.08980	0.0222	L	0.31664	0.95	0.42362	D	0.992412	B;B;B;B;B	0.27140	0.018;0.015;0.169;0.038;0.009	B;B;B;B;B	0.29077	0.062;0.037;0.06;0.098;0.063	T	0.19257	-1.0311	10	0.41790	T	0.15	0.009	9.8722	0.41182	0.0:0.7881:0.0:0.2119	.	91;91;93;123;123	Q8TEH3-6;Q8TEH3-4;Q8TEH3-5;Q8TEH3-2;Q8TEH3	.;.;.;.;DEN1A_HUMAN	I	123;91;123;93;91	ENSP00000362727:R123I;ENSP00000377766:R91I;ENSP00000362722:R123I;ENSP00000377763:R93I;ENSP00000362720:R91I	ENSP00000362720:R91I	R	-	2	0	DENND1A	125478824	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.248000	0.32827	0.827000	0.34685	0.655000	0.94253	AGA	.	.		0.303	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053997.1	NM_024820	
GTF3C5	9328	hgsc.bcm.edu	37	9	135929323	135929323	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr9:135929323A>C	ENST00000372097.5	+	6	1305	c.982A>C	c.(982-984)Aaa>Caa	p.K328Q	GTF3C5_ENST00000372095.5_Missense_Mutation_p.K203Q|GTF3C5_ENST00000342018.8_Missense_Mutation_p.K259Q|GTF3C5_ENST00000372108.5_Missense_Mutation_p.K328Q|GTF3C5_ENST00000372099.6_Missense_Mutation_p.K319Q	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	328					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		TTGTGGAATGAAACACGGTAA	0.423																																					p.K328Q		Atlas-SNP	.											.	GTF3C5	46	.	0			c.A982C						.						66.0	63.0	64.0					9																	135929323		2203	4300	6503	SO:0001583	missense	9328	exon6			GGAATGAAACACG	AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.982A>C	chr9.hg19:g.135929323A>C	ENSP00000361169:p.Lys328Gln	109.0	0.0		135.0	49.0	NM_012087	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	ENST00000372097.5	hg19	CCDS6958.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.5|26.5	4.739835|4.739835	0.89573|0.89573	.|.	.|.	ENSG00000148308|ENSG00000148308	ENST00000372097;ENST00000372099;ENST00000372095;ENST00000372089;ENST00000372108;ENST00000342018;ENST00000439697|ENST00000434175;ENST00000435745	T;T;T;T;T;T|.	0.48836|.	0.8;0.8;0.8;0.8;0.8;0.8|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.042371|.	0.85682|.	D|.	0.000000|.	T|.	0.75466|.	0.3853|.	M|M	0.77820|0.77820	2.39|2.39	0.53688|0.53688	D|D	0.999973|0.999973	D;D;D|.	0.89917|.	1.0;0.995;1.0|.	D;D;D|.	0.76071|.	0.987;0.909;0.974|.	T|.	0.76788|.	-0.2830|.	10|.	0.32370|.	T|.	0.25|.	-0.356|-0.356	14.7944|14.7944	0.69868|0.69868	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	203;328;328|.	B7Z1V3;Q9Y5Q8-3;Q9Y5Q8|.	.;.;TF3C5_HUMAN|.	Q|C	328;319;203;178;328;259;203|99;6	ENSP00000361169:K328Q;ENSP00000361171:K319Q;ENSP00000361167:K203Q;ENSP00000361180:K328Q;ENSP00000339530:K259Q;ENSP00000393207:K203Q|.	ENSP00000339530:K259Q|.	K|X	+|+	1|3	0|0	GTF3C5|GTF3C5	134919144|134919144	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.947000|0.947000	0.59692|0.59692	8.535000|8.535000	0.90623|0.90623	2.085000|2.085000	0.62840|0.62840	0.533000|0.533000	0.62120|0.62120	AAA|TGA	.	.		0.423	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054826.1	NM_001122823	
ITIH5	80760	hgsc.bcm.edu	37	10	7627891	7627891	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:7627891A>T	ENST00000256861.6	-	8	1159	c.1081T>A	c.(1081-1083)Tac>Aac	p.Y361N	ITIH5_ENST00000397145.2_Missense_Mutation_p.Y361N|ITIH5_ENST00000397146.2_Missense_Mutation_p.Y361N|ITIH5_ENST00000446830.2_Missense_Mutation_p.Y143N|ITIH5_ENST00000298441.6_Missense_Mutation_p.Y147N|ITIH5_ENST00000434980.1_5'UTR	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	361	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TGGTGAATGTACACTTTCCCA	0.393																																					p.Y361N		Atlas-SNP	.											.	ITIH5	343	.	0			c.T1081A						.						183.0	145.0	158.0					10																	7627891		2203	4300	6503	SO:0001583	missense	80760	exon8			GAATGTACACTTT			10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1081T>A	chr10.hg19:g.7627891A>T	ENSP00000256861:p.Tyr361Asn	103.0	0.0		141.0	48.0	NM_001001851	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	ENST00000256861.6	hg19		.	.	.	.	.	.	.	.	.	.	A	19.38	3.817403	0.70912	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15	5.3	4.17	0.49024	von Willebrand factor, type A (3);	0.054481	0.64402	D	0.000001	D	0.86740	0.6005	.	.	.	0.42256	D	0.99199	D;P;P	0.54397	0.966;0.856;0.826	D;B;B	0.69307	0.963;0.424;0.299	D	0.87329	0.2323	9	0.87932	D	0	-25.7311	10.9471	0.47306	0.9265:0.0:0.0735:0.0	.	361;361;147	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	N	361;361;147;143;361	ENSP00000256861:Y361N;ENSP00000380333:Y361N;ENSP00000298441:Y147N;ENSP00000387969:Y143N;ENSP00000380332:Y361N	ENSP00000256861:Y361N	Y	-	1	0	ITIH5	7667897	1.000000	0.71417	0.987000	0.45799	0.849000	0.48306	5.847000	0.69451	0.862000	0.35528	0.459000	0.35465	TAC	.	.		0.393	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000046688.1	NM_030569	
TRDMT1	1787	hgsc.bcm.edu	37	10	17191063	17191063	+	Silent	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:17191063T>C	ENST00000377799.3	-	11	1199	c.1152A>G	c.(1150-1152)aaA>aaG	p.K384K	TRDMT1_ENST00000351358.4_Silent_p.K338K|TRDMT1_ENST00000358282.7_3'UTR|TRDMT1_ENST00000412821.3_Silent_p.K360K|TRDMT1_ENST00000377766.5_3'UTR|TRDMT1_ENST00000457442.2_Silent_p.K303K|TRDMT1_ENST00000452380.2_5'Flank	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	384	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	TTTTGATTAGTTTAGCTACTA	0.303																																					p.K384K		Atlas-SNP	.											.	TRDMT1	46	.	0			c.A1152G						.						58.0	59.0	58.0					10																	17191063		2202	4297	6499	SO:0001819	synonymous_variant	1787	exon11			GATTAGTTTAGCT	AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.1152A>G	chr10.hg19:g.17191063T>C		52.0	0.0		61.0	21.0	NM_004412	B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Silent	SNP	ENST00000377799.3	hg19	CCDS7114.1																																																																																			.	.		0.303	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047024.3	NM_004412	
FZD8	8325	hgsc.bcm.edu	37	10	35930122	35930122	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:35930122T>C	ENST00000374694.1	-	1	240	c.236A>G	c.(235-237)cAg>cGg	p.Q79R	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	79	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						GGGCGAGCACTGGATCTCCAC	0.602																																					p.Q79R		Atlas-SNP	.											.	FZD8	41	.	0			c.A236G						.						115.0	94.0	101.0					10																	35930122		2203	4300	6503	SO:0001583	missense	8325	exon1			GAGCACTGGATCT	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.236A>G	chr10.hg19:g.35930122T>C	ENSP00000363826:p.Gln79Arg	53.0	0.0		86.0	24.0	NM_031866		Missense_Mutation	SNP	ENST00000374694.1	hg19	CCDS7192.1	.	.	.	.	.	.	.	.	.	.	T	14.08	2.428992	0.43122	.	.	ENSG00000177283	ENST00000374694	T	0.53423	0.62	3.74	3.74	0.42951	Frizzled domain (5);	0.165679	0.40908	U	0.000983	T	0.37945	0.1022	L	0.37897	1.145	0.44789	D	0.997791	B	0.20052	0.041	B	0.25405	0.06	T	0.17715	-1.0360	10	0.27082	T	0.32	.	12.7482	0.57293	0.0:0.0:0.0:1.0	.	79	Q9H461	FZD8_HUMAN	R	79	ENSP00000363826:Q79R	ENSP00000363826:Q79R	Q	-	2	0	FZD8	35970128	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.989000	0.63870	1.489000	0.48450	0.368000	0.22195	CAG	.	.		0.602	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866	
GPRIN2	9721	hgsc.bcm.edu	37	10	46998926	46998926	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:46998926C>T	ENST00000374317.1	+	3	319	c.46C>T	c.(46-48)Ccc>Tcc	p.P16S	GPRIN2_ENST00000374314.4_Missense_Mutation_p.P16S	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	16										breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						ACCCCTGAGCCCCCGCCTTCA	0.672																																					p.P16S		Atlas-SNP	.											.	GPRIN2	94	.	0			c.C46T						.						45.0	63.0	57.0					10																	46998926		2197	4292	6489	SO:0001583	missense	9721	exon3			CTGAGCCCCCGCC	BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.46C>T	chr10.hg19:g.46998926C>T	ENSP00000363436:p.Pro16Ser	104.0	0.0		109.0	11.0	NM_014696	Q5SVF0	Missense_Mutation	SNP	ENST00000374317.1	hg19	CCDS31192.1	.	.	.	.	.	.	.	.	.	.	C	7.099	0.573722	0.13623	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03580	3.88;3.88	5.33	4.42	0.53409	.	0.483057	0.17726	N	0.164073	T	0.05364	0.0142	L	0.57536	1.79	0.23113	N	0.998272	P	0.44044	0.825	B	0.40066	0.318	T	0.33343	-0.9872	10	0.16896	T	0.51	-6.6732	12.3625	0.55211	0.0:0.8302:0.1698:0.0	.	16	O60269	GRIN2_HUMAN	S	16	ENSP00000363436:P16S;ENSP00000363433:P16S	ENSP00000363433:P16S	P	+	1	0	GPRIN2	46418932	0.014000	0.17966	0.192000	0.23308	0.501000	0.33797	1.430000	0.34914	1.377000	0.46286	0.655000	0.94253	CCC	.	.		0.672	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047836.1	NM_014696	
CDH23	64072	hgsc.bcm.edu	37	10	73560473	73560473	+	Silent	SNP	T	T	A	rs34911784		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:73560473T>A	ENST00000224721.6	+	52	7463	c.7458T>A	c.(7456-7458)ccT>ccA	p.P2486P	CDH23_ENST00000398788.3_Silent_p.P241P|CDH23_ENST00000475158.1_3'UTR	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	2481	Cadherin 23. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						AAGACAACCCTGGGGATGTAG	0.572																																					p.P2481P		Atlas-SNP	.											.	CDH23	365	.	0			c.T7443A						.						66.0	69.0	68.0					10																	73560473		1961	4147	6108	SO:0001819	synonymous_variant	64072	exon51			CAACCCTGGGGAT	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.7458T>A	chr10.hg19:g.73560473T>A		69.0	0.0		93.0	35.0	NM_022124	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Silent	SNP	ENST00000224721.6	hg19																																																																																				.	.		0.572	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
ENTPD7	57089	hgsc.bcm.edu	37	10	101439111	101439111	+	Silent	SNP	C	C	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:101439111C>G	ENST00000370489.4	+	4	463	c.285C>G	c.(283-285)tcC>tcG	p.S95S		NM_020354.3	NP_065087.1	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase 7	95						cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		GCAGTGGTTCCCGGATTTTTG	0.463																																					p.S95S		Atlas-SNP	.											.	ENTPD7	44	.	0			c.C285G						.						95.0	99.0	97.0					10																	101439111		2203	4300	6503	SO:0001819	synonymous_variant	57089	exon4			TGGTTCCCGGATT	AF269255	CCDS7480.1	10q23-q24	2004-07-01			ENSG00000198018	ENSG00000198018			19745	protein-coding gene	gene with protein product						11278936	Standard	NM_020354		Approved	LALP1, FLJ30978	uc001kqa.4	Q9NQZ7	OTTHUMG00000018888	ENST00000370489.4:c.285C>G	chr10.hg19:g.101439111C>G		126.0	0.0		164.0	51.0	NM_020354	B2RB83|B3KP21|D3DR64	Silent	SNP	ENST00000370489.4	hg19	CCDS7480.1																																																																																			.	.		0.463	ENTPD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049809.2	NM_020354	
PWWP2B	170394	hgsc.bcm.edu	37	10	134219298	134219298	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:134219298A>G	ENST00000305233.5	+	2	1353	c.1294A>G	c.(1294-1296)Aga>Gga	p.R432G	PWWP2B_ENST00000368609.4_Missense_Mutation_p.R432G	NM_138499.3	NP_612508.3	Q6NUJ5	PWP2B_HUMAN	PWWP domain containing 2B	432										central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|urinary_tract(1)	9		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;7.49e-05)|Epithelial(32;0.00016)|all cancers(32;0.000186)		GGACGAGGCCAGATCGTCCGG	0.687																																					p.R432G		Atlas-SNP	.											PWWP2B,colon,carcinoma,0,1	PWWP2B	33	.	0			c.A1294G						.						29.0	28.0	28.0					10																	134219298		2195	4297	6492	SO:0001583	missense	170394	exon2			GAGGCCAGATCGT	AK128663	CCDS7667.2	10q26.3	2009-06-03	2007-10-22	2007-10-22	ENSG00000171813	ENSG00000171813			25150	protein-coding gene	gene with protein product			"""PWWP domain containing 2"""	PWWP2			Standard	NM_001098637		Approved	bA432J24.1, FLJ46823	uc001lll.4	Q6NUJ5	OTTHUMG00000019286	ENST00000305233.5:c.1294A>G	chr10.hg19:g.134219298A>G	ENSP00000306324:p.Arg432Gly	32.0	0.0		44.0	16.0	NM_001098637	A6NM90|B5MDQ1|H9KV61|Q5SZI0|Q6ZQX5|Q96F43	Missense_Mutation	SNP	ENST00000305233.5	hg19	CCDS7667.2	.	.	.	.	.	.	.	.	.	.	A	12.81	2.049899	0.36181	.	.	ENSG00000171813	ENST00000305233;ENST00000368609	T;T	0.56444	0.46;1.48	3.59	3.59	0.41128	.	0.064956	0.64402	U	0.000014	T	0.30070	0.0753	N	0.08118	0	0.30022	N	0.814229	B	0.31769	0.339	B	0.23716	0.048	T	0.41448	-0.9508	10	0.87932	D	0	-8.545	12.3972	0.55391	1.0:0.0:0.0:0.0	.	432	Q6NUJ5	PWP2B_HUMAN	G	432	ENSP00000306324:R432G;ENSP00000357598:R432G	ENSP00000306324:R432G	R	+	1	2	PWWP2B	134069288	1.000000	0.71417	0.087000	0.20705	0.404000	0.30871	5.203000	0.65174	1.880000	0.54463	0.460000	0.39030	AGA	.	.		0.687	PWWP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051075.3	NM_138499	
FUOM	282969	hgsc.bcm.edu	37	10	135169315	135169315	+	Splice_Site	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr10:135169315T>C	ENST00000368552.3	-	5	342	c.325A>G	c.(325-327)Aga>Gga	p.R109G	FUOM_ENST00000368551.1_Splice_Site_p.R64G|FUOM_ENST00000465384.1_5'UTR|FUOM_ENST00000278025.4_Splice_Site_p.R109G|FUOM_ENST00000447176.1_Splice_Site_p.R65G	NM_001098483.1	NP_001091953.1	A2VDF0	FUCM_HUMAN	fucose mutarotase	109					female mating behavior (GO:0060180)|fucose metabolic process (GO:0006004)|fucosylation (GO:0036065)|negative regulation of neuron differentiation (GO:0045665)		fucose binding (GO:0042806)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)										GCCAGGGCTCTCTGGAAGACA	0.572																																					p.R109G		Atlas-SNP	.											.	.	.	.	0			c.A325G						.						84.0	101.0	95.0					10																	135169315		2203	4300	6503	SO:0001630	splice_region_variant	282969	exon5			GGGCTCTCTGGAA	AK129527	CCDS7680.1	10q26.3	2012-07-10	2012-07-10	2012-07-10	ENSG00000148803	ENSG00000148803	5.1.3.n2		24733	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 125"""	C10orf125		17602138	Standard	NM_001098483		Approved	FLJ26016, FucU, FucM	uc001lmt.2	A2VDF0	OTTHUMG00000019315	ENST00000368552.3:c.325-1A>G	chr10.hg19:g.135169315T>C		77.0	0.0		89.0	32.0	NM_001098483	A1L300|Q5VWY2|Q5VWY3|Q6ZPD2	Missense_Mutation	SNP	ENST00000368552.3	hg19	CCDS44499.1	.	.	.	.	.	.	.	.	.	.	T	5.581	0.292087	0.10567	.	.	ENSG00000148803	ENST00000278025;ENST00000447176;ENST00000368551;ENST00000368552	.	.	.	4.09	0.219	0.15274	D-ribose pyranase RbsD-like (2);	1.395380	0.04609	N	0.399908	T	0.13713	0.0332	N	0.02539	-0.55	0.09310	N	0.999994	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.16837	-1.0389	9	0.22109	T	0.4	0.1997	2.2049	0.03933	0.2285:0.2903:0.0:0.4812	.	109;109	A2VDF0;A2VDF0-2	FUCM_HUMAN;.	G	109;65;64;109	.	ENSP00000278025:R109G	R	-	1	2	C10orf125	135019305	0.010000	0.17322	0.276000	0.24689	0.638000	0.38207	-0.287000	0.08388	0.148000	0.19059	0.383000	0.25322	AGA	.	.		0.572	FUOM-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_198472	Missense_Mutation
PDDC1	347862	hgsc.bcm.edu	37	11	770992	770992	+	Splice_Site	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr11:770992C>A	ENST00000319863.8	-	7	678		c.e7+1		PDDC1_ENST00000442059.2_Splice_Site|PDDC1_ENST00000524550.1_Splice_Site|PDDC1_ENST00000526325.1_Intron|PDDC1_ENST00000529966.1_Splice_Site|PDDC1_ENST00000397472.2_Intron	NM_182612.2	NP_872418.1	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1							extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(3)|urinary_tract(1)	5		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGTGCCCTCACCGGCTGCCAC	0.622																																					.		Atlas-SNP	.											.	PDDC1	16	.	0			c.656+1G>T						.						56.0	55.0	56.0					11																	770992		2203	4300	6503	SO:0001630	splice_region_variant	347862	exon8			CCCTCACCGGCTG	AK128653	CCDS7713.1	11p15.5	2005-10-26			ENSG00000177225	ENSG00000177225			26616	protein-coding gene	gene with protein product							Standard	XM_005252898		Approved	FLJ34283	uc001lrc.3	Q8NB37	OTTHUMG00000133315	ENST00000319863.8:c.656+1G>T	chr11.hg19:g.770992C>A		60.0	0.0		66.0	26.0	NM_182612	B7ZKW5|Q2NL76|Q6ZQY0|Q8NAE0	Splice_Site	SNP	ENST00000319863.8	hg19	CCDS7713.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201541	0.58234	.	.	ENSG00000177225	ENST00000465313;ENST00000319863;ENST00000442059;ENST00000524550	.	.	.	4.55	4.55	0.56014	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4372	0.83880	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDDC1	760992	1.000000	0.71417	0.998000	0.56505	0.894000	0.52154	4.483000	0.60264	2.250000	0.74265	0.462000	0.41574	.	.	.		0.622	PDDC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258051.2	NM_182612	Intron
BBOX1	8424	hgsc.bcm.edu	37	11	27114795	27114795	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr11:27114795A>T	ENST00000529202.1	+	4	754	c.415A>T	c.(415-417)Aag>Tag	p.K139*	RP11-1L12.3_ENST00000530430.1_RNA|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000527505.1_Intron|BBOX1_ENST00000528583.1_Nonsense_Mutation_p.K139*|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000525090.1_Nonsense_Mutation_p.K139*|BBOX1_ENST00000263182.3_Nonsense_Mutation_p.K139*			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	139					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	ACACGCATACAAGTGGCTCTC	0.428																																					p.K139X		Atlas-SNP	.											.	BBOX1	46	.	0			c.A415T						.						100.0	99.0	99.0					11																	27114795		2202	4298	6500	SO:0001587	stop_gained	8424	exon5			GCATACAAGTGGC	AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.415A>T	chr11.hg19:g.27114795A>T	ENSP00000435781:p.Lys139*	145.0	0.0		176.0	60.0	NM_003986	B2R8L7|D3DQZ1|Q6IBJ2	Nonsense_Mutation	SNP	ENST00000529202.1	hg19	CCDS7862.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.468958	0.84533	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	.	.	.	5.29	1.51	0.23008	.	0.580480	0.20309	N	0.094879	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5756	0.27933	0.4013:0.4619:0.0:0.1368	.	.	.	.	X	139	.	ENSP00000263182:K139X	K	+	1	0	BBOX1	27071371	0.999000	0.42202	0.980000	0.43619	0.285000	0.27093	2.049000	0.41288	-0.010000	0.14271	0.528000	0.53228	AAG	.	.		0.428	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387946.1	NM_003986	
MYBPC3	4607	hgsc.bcm.edu	37	11	47361216	47361216	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr11:47361216T>A	ENST00000545968.1	-	21	2107	c.2053A>T	c.(2053-2055)Aag>Tag	p.K685*	MYBPC3_ENST00000399249.2_Nonsense_Mutation_p.K685*|MYBPC3_ENST00000256993.4_Nonsense_Mutation_p.K684*	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	685	Ig-like C2-type 5.				cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GTGATAGCCTTCTGCCAGATC	0.572																																					p.K685X		Atlas-SNP	.											.	MYBPC3	102	.	0			c.A2053T						.						68.0	72.0	71.0					11																	47361216		2005	4164	6169	SO:0001587	stop_gained	4607	exon20			TAGCCTTCTGCCA	X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.2053A>T	chr11.hg19:g.47361216T>A	ENSP00000442795:p.Lys685*	82.0	0.0		82.0	39.0	NM_000256	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Nonsense_Mutation	SNP	ENST00000545968.1	hg19	CCDS53621.1	.	.	.	.	.	.	.	.	.	.	T	37	6.145888	0.97324	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	.	.	.	4.9	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6842	0.69037	0.0:0.0:0.0:1.0	.	.	.	.	X	685;685;684	.	ENSP00000256993:K684X	K	-	1	0	MYBPC3	47317792	1.000000	0.71417	1.000000	0.80357	0.843000	0.47879	7.318000	0.79029	2.054000	0.61138	0.459000	0.35465	AAG	.	.		0.572	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392271.3		
GANAB	23193	hgsc.bcm.edu	37	11	62402314	62402314	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr11:62402314T>C	ENST00000356638.3	-	5	555	c.539A>G	c.(538-540)cAt>cGt	p.H180R	GANAB_ENST00000534779.1_Missense_Mutation_p.H66R|GANAB_ENST00000534422.1_5'UTR|GANAB_ENST00000346178.4_Missense_Mutation_p.H180R|GANAB_ENST00000540933.1_Missense_Mutation_p.H83R	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	180					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	GGCCCTCTGATGCTCAAACTC	0.547																																					p.H180R	Melanoma(23;1005 1074 15747 18937)	Atlas-SNP	.											GANAB,NS,carcinoma,0,1	GANAB	110	.	0			c.A539G						.						124.0	103.0	110.0					11																	62402314		2202	4299	6501	SO:0001583	missense	23193	exon5			CTCTGATGCTCAA	AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.539A>G	chr11.hg19:g.62402314T>C	ENSP00000349053:p.His180Arg	87.0	0.0		122.0	48.0	NM_198334	A6NC20|Q8WTS9|Q9P0X0	Missense_Mutation	SNP	ENST00000356638.3	hg19	CCDS8026.1	.	.	.	.	.	.	.	.	.	.	T	11.15	1.554093	0.27739	.	.	ENSG00000089597	ENST00000346178;ENST00000356638;ENST00000534779;ENST00000540933;ENST00000525994	D;D;D;D;T	0.89681	-2.52;-2.38;-2.55;-2.53;0.99	5.67	5.67	0.87782	Glycoside hydrolase-type carbohydrate-binding (1);	0.100301	0.64402	D	0.000002	D	0.93452	0.7911	M	0.86502	2.82	0.80722	D	1	B;D;B;P	0.59357	0.378;0.985;0.225;0.679	B;P;B;B	0.55112	0.168;0.769;0.087;0.43	D	0.94404	0.7625	10	0.87932	D	0	-24.9071	13.8725	0.63629	0.0:0.0:0.0:1.0	.	66;66;180;180	B4DIW2;E9PKU7;Q14697;Q14697-2	.;.;GANAB_HUMAN;.	R	180;180;66;83;66	ENSP00000340466:H180R;ENSP00000349053:H180R;ENSP00000435306:H66R;ENSP00000442962:H83R;ENSP00000434805:H66R	ENSP00000340466:H180R	H	-	2	0	GANAB	62158890	1.000000	0.71417	1.000000	0.80357	0.038000	0.13279	7.161000	0.77505	2.174000	0.68829	0.533000	0.62120	CAT	.	.		0.547	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395689.1	NM_198334	
SLC2A3	6515	hgsc.bcm.edu	37	12	8085600	8085600	+	Silent	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:8085600G>A	ENST00000075120.7	-	3	492	c.252C>T	c.(250-252)ttC>ttT	p.F84F		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	84					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		AGCGGTTGACGAAGAGTCCGA	0.552											OREG0021656	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F84F	Colon(96;424 1461 14416 20933 23688)	Atlas-SNP	.											.	SLC2A3	83	.	0			c.C252T						.						89.0	82.0	85.0					12																	8085600		2203	4300	6503	SO:0001819	synonymous_variant	6515	exon3			GTTGACGAAGAGT	M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.252C>T	chr12.hg19:g.8085600G>A		114.0	0.0	646	174.0	65.0	NM_006931	B2R606|D3DUU6|Q6I9U2|Q9UG15	Silent	SNP	ENST00000075120.7	hg19	CCDS8586.1																																																																																			.	.		0.552	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257914.1	NM_006931	
KLRC3	3823	hgsc.bcm.edu	37	12	10588437	10588437	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:10588437A>T	ENST00000539033.1	-	1	163	c.149T>A	c.(148-150)cTg>cAg	p.L50Q	KLRC2_ENST00000381901.1_Missense_Mutation_p.L50Q|KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381902.2_Missense_Mutation_p.L50Q																							TTGATGATTCAGGGAAGGATT	0.358																																					p.L50Q		Atlas-SNP	.											.	KLRC2	29	.	0			c.T149A						.						127.0	137.0	134.0					12																	10588437		2110	4201	6311	SO:0001583	missense	3822	exon1			TGATTCAGGGAAG																												ENST00000539033.1:c.149T>A	chr12.hg19:g.10588437A>T	ENSP00000437563:p.Leu50Gln	94.0	0.0		115.0	38.0	NM_002260		Missense_Mutation	SNP	ENST00000539033.1	hg19		.	.	.	.	.	.	.	.	.	.	A	0	-2.739580	0.00088	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901	T;T;T	0.05081	3.5;3.5;3.5	1.71	-3.24	0.05094	.	0.772167	0.11399	N	0.567988	T	0.01421	0.0046	N	0.02120	-0.675	0.09310	N	1	B;B;B	0.11235	0.001;0.0;0.004	B;B;B	0.14578	0.002;0.0;0.011	T	0.41378	-0.9512	10	0.02654	T	1	.	0.1483	0.00090	0.238:0.1683:0.2364:0.3574	.	36;50;50	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	Q	50	ENSP00000437563:L50Q;ENSP00000371327:L50Q;ENSP00000371326:L50Q	ENSP00000371326:L50Q	L	-	2	0	KLRC2;RP11-277P12.6	10479704	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.977000	0.03782	-0.727000	0.04888	-1.194000	0.01681	CTG	.	.		0.358	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	protein_coding	OTTHUMT00000400274.1		
GYS2	2998	hgsc.bcm.edu	37	12	21713357	21713357	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:21713357C>T	ENST00000261195.2	-	8	1386	c.1132G>A	c.(1132-1134)Gaa>Aaa	p.E378K		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	378					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TTCAGGGTTTCCACGTTGAAA	0.373																																					p.E378K	Colon(149;9 1820 3690 10544 50424)	Atlas-SNP	.											.	GYS2	110	.	0			c.G1132A						.						207.0	187.0	194.0					12																	21713357		2203	4300	6503	SO:0001583	missense	2998	exon8			GGGTTTCCACGTT		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.1132G>A	chr12.hg19:g.21713357C>T	ENSP00000261195:p.Glu378Lys	68.0	0.0		81.0	7.0	NM_021957	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	hg19	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	C	36	5.689631	0.96784	.	.	ENSG00000111713	ENST00000261195	T	0.69306	-0.39	4.87	4.87	0.63330	.	0.000000	0.85682	D	0.000000	D	0.85831	0.5788	M	0.90870	3.155	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.89195	0.3553	10	0.87932	D	0	-26.5301	18.1927	0.89812	0.0:1.0:0.0:0.0	.	378	P54840	GYS2_HUMAN	K	378	ENSP00000261195:E378K	ENSP00000261195:E378K	E	-	1	0	GYS2	21604624	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.638000	0.83328	2.530000	0.85305	0.563000	0.77884	GAA	.	.		0.373	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
HOXC11	3227	hgsc.bcm.edu	37	12	54367150	54367150	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:54367150C>A	ENST00000546378.1	+	1	241	c.125C>A	c.(124-126)cCc>cAc	p.P42H	HOTAIR_ENST00000455246.1_RNA|HOTAIR_ENST00000424518.1_RNA|HOXC11_ENST00000243082.4_Missense_Mutation_p.P42H			O43248	HXC11_HUMAN	homeobox C11	42					anterior/posterior pattern specification (GO:0009952)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal joint morphogenesis (GO:0060272)|endoderm development (GO:0007492)|metanephros development (GO:0001656)|organ induction (GO:0001759)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal/distal pattern formation (GO:0009954)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			large_intestine(1)|ovary(1)	2						TACTACATGCCCGAGTTCTCC	0.632			T	NUP98	AML																																p.P42H		Atlas-SNP	.		Dom	yes		12	12q13.3	3227	homeo box C11		L	.	HOXC11	32	.	0			c.C125A						.						115.0	119.0	118.0					12																	54367150		2203	4300	6503	SO:0001583	missense	3227	exon1			ACATGCCCGAGTT		CCDS8867.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123388	ENSG00000123388		"""Homeoboxes / ANTP class : HOXL subclass"""	5123	protein-coding gene	gene with protein product		605559	"""homeo box C11"""	HOX3H		1973146, 1358459	Standard	NM_014212		Approved		uc001sem.3	O43248	OTTHUMG00000160011	ENST00000546378.1:c.125C>A	chr12.hg19:g.54367150C>A	ENSP00000446680:p.Pro42His	60.0	0.0		91.0	30.0	NM_014212	A8K7D1|Q96DH2	Missense_Mutation	SNP	ENST00000546378.1	hg19	CCDS8867.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709630	0.68730	.	.	ENSG00000123388	ENST00000546378;ENST00000243082	T;T	0.46819	0.86;0.86	4.47	4.47	0.54385	Domain of unknown function DUF3528, homeobox protein, eukaryotic (1);	0.000000	0.85682	D	0.000000	T	0.66036	0.2749	M	0.62088	1.915	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70048	-0.4979	10	0.87932	D	0	.	16.4268	0.83817	0.0:1.0:0.0:0.0	.	42	O43248	HXC11_HUMAN	H	42	ENSP00000446680:P42H;ENSP00000243082:P42H	ENSP00000243082:P42H	P	+	2	0	HOXC11	52653417	1.000000	0.71417	0.999000	0.59377	0.962000	0.63368	7.292000	0.78731	2.471000	0.83476	0.561000	0.74099	CCC	.	.		0.632	HOXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358869.2		
PTPRQ	374462	hgsc.bcm.edu	37	12	80928788	80928788	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:80928788A>G	ENST00000266688.5	+	24	2945	c.2945A>G	c.(2944-2946)tAc>tGc	p.Y982C	PTPRQ_ENST00000547485.1_3'UTR			Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1028	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TCTGTTTATTACAGAAATACT	0.294																																					p.Y814C		Atlas-SNP	.											.	PTPRQ	119	.	0			c.A2441G						.						84.0	75.0	78.0					12																	80928788		692	1585	2277	SO:0001583	missense	374462	exon16			TTTATTACAGAAA	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.2945A>G	chr12.hg19:g.80928788A>G	ENSP00000266688:p.Tyr982Cys	156.0	0.0		232.0	67.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.52|15.52	2.856794|2.856794	0.51376|0.51376	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000532722|ENST00000266688	.|T	.|0.73047	.|-0.71	4.91|4.91	4.91|4.91	0.64330|0.64330	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	D|D	0.82282|0.82282	0.5003|0.5003	.|.	.|.	.|.	0.45205|0.45205	D|D	0.998213|0.998213	.|D	.|0.89917	.|1.0	.|D	.|0.77004	.|0.989	D|D	0.83650|0.83650	0.0155|0.0155	4|8	.|0.56958	.|D	.|0.05	.|.	10.7594|10.7594	0.46256|0.46256	0.8492:0.0:0.0:0.1508|0.8492:0.0:0.0:0.1508	.|.	.|1028	.|Q9UMZ3	.|PTPRQ_HUMAN	A|C	683|982	.|ENSP00000266688:Y982C	.|ENSP00000266688:Y982C	T|Y	+|+	1|2	0|0	PTPRQ|PTPRQ	79452919|79452919	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.760000|0.760000	0.43138|0.43138	4.422000|4.422000	0.59854|0.59854	1.964000|1.964000	0.57103|0.57103	0.528000|0.528000	0.53228|0.53228	ACA|TAC	.	.		0.294	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
NUP37	79023	hgsc.bcm.edu	37	12	102512230	102512230	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:102512230C>T	ENST00000552283.1	-	2	206	c.67G>A	c.(67-69)Gaa>Aaa	p.E23K	PARPBP_ENST00000541394.1_5'Flank|PARPBP_ENST00000358383.5_5'Flank|PARPBP_ENST00000392911.2_5'Flank|PARPBP_ENST00000327680.2_5'Flank|NUP37_ENST00000251074.1_Missense_Mutation_p.E23K|NUP37_ENST00000543021.1_5'UTR|PARPBP_ENST00000543784.1_5'Flank|PARPBP_ENST00000378128.3_5'Flank|PARPBP_ENST00000537257.1_5'Flank			Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	23					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)				endometrium(3)|large_intestine(3)|lung(10)|ovary(1)	17						GGATTAAATTCTACCACATGC	0.388																																					p.E23K		Atlas-SNP	.											NUP37,NS,carcinoma,0,1	NUP37	26	.	0			c.G67A						.						230.0	205.0	213.0					12																	102512230		2203	4300	6503	SO:0001583	missense	79023	exon1			TAAATTCTACCAC	AF514994	CCDS9089.1	12q23.2	2014-08-12			ENSG00000075188	ENSG00000075188		"""WD repeat domain containing"""	29929	protein-coding gene	gene with protein product		609264				12196509	Standard	NM_024057		Approved	MGC5585, FLJ22618	uc001tjc.3	Q8NFH4	OTTHUMG00000170478	ENST00000552283.1:c.67G>A	chr12.hg19:g.102512230C>T	ENSP00000448054:p.Glu23Lys	74.0	0.0		109.0	27.0	NM_024057	Q9H644	Missense_Mutation	SNP	ENST00000552283.1	hg19	CCDS9089.1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333640	0.60853	.	.	ENSG00000075188	ENST00000552283;ENST00000251074;ENST00000551744;ENST00000550459	T;T;T	0.27890	1.64;1.64;2.83	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.046533	0.85682	D	0.000000	T	0.25044	0.0608	L	0.58583	1.82	0.58432	D	0.999994	P;B	0.38110	0.618;0.105	B;B	0.32211	0.142;0.018	T	0.04650	-1.0936	10	0.08837	T	0.75	-18.3705	12.7622	0.57372	0.0:0.9141:0.0:0.0859	.	23;23	B4DKV8;Q8NFH4	.;NUP37_HUMAN	K	23	ENSP00000448054:E23K;ENSP00000251074:E23K;ENSP00000448086:E23K	ENSP00000251074:E23K	E	-	1	0	NUP37	101036360	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.256000	0.58810	2.471000	0.83476	0.650000	0.86243	GAA	.	.		0.388	NUP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409330.1	NM_024057	
PITPNM2	57605	hgsc.bcm.edu	37	12	123472076	123472076	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:123472076G>T	ENST00000542749.1	-	20	3308	c.3245C>A	c.(3244-3246)cCt>cAt	p.P1082H	PITPNM2_ENST00000320201.4_Missense_Mutation_p.P1082H|PITPNM2_ENST00000392428.1_Missense_Mutation_p.P803H|PITPNM2_ENST00000280562.5_Missense_Mutation_p.P1076H			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	1082					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CATCTTGATAGGGTAGACACC	0.622																																					p.P1082H		Atlas-SNP	.											.	PITPNM2	105	.	0			c.C3245A						.						107.0	95.0	99.0					12																	123472076		2203	4300	6503	SO:0001583	missense	57605	exon21			TTGATAGGGTAGA	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.3245C>A	chr12.hg19:g.123472076G>T	ENSP00000437611:p.Pro1082His	79.0	0.0		98.0	4.0	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	hg19	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.252243	0.80135	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	D;D;D;D	0.95377	-3.69;-3.69;-3.69;-3.69	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.97926	0.9318	M	0.84585	2.705	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.98440	1.0586	10	0.59425	D	0.04	-37.0685	18.7781	0.91920	0.0:0.0:1.0:0.0	.	1076;1082	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	H	1076;1082;803;1082	ENSP00000280562:P1076H;ENSP00000322218:P1082H;ENSP00000376223:P803H;ENSP00000437611:P1082H	ENSP00000280562:P1076H	P	-	2	0	PITPNM2	122038029	1.000000	0.71417	0.998000	0.56505	0.840000	0.47671	9.781000	0.99029	2.434000	0.82447	0.561000	0.74099	CCT	.	.		0.622	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
GJB6	10804	hgsc.bcm.edu	37	13	20797574	20797574	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr13:20797574G>A	ENST00000356192.6	-	5	666	c.46C>T	c.(46-48)Cac>Tac	p.H16Y	GJB6_ENST00000400066.3_Missense_Mutation_p.H16Y|GJB6_ENST00000400065.3_Missense_Mutation_p.H16Y|GJB6_ENST00000241124.6_Missense_Mutation_p.H16Y	NM_001110219.2	NP_001103689.1	O95452	CXB6_HUMAN	gap junction protein, beta 6, 30kDa	16					apoptotic process (GO:0006915)|cell communication (GO:0007154)|ear morphogenesis (GO:0042471)|inner ear development (GO:0048839)|negative regulation of cell proliferation (GO:0008285)|sensory perception of sound (GO:0007605)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)				biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	9		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		CTGGTGGAGTGTTTGTTGACA	0.507																																					p.H16Y		Atlas-SNP	.											.	GJB6	33	.	0			c.C46T						.						134.0	122.0	126.0					13																	20797574		2203	4300	6503	SO:0001583	missense	10804	exon4			TGGAGTGTTTGTT	AJ005585	CCDS9291.1	13q12	2010-01-06	2007-11-06		ENSG00000121742	ENSG00000121742		"""Ion channels / Gap junction proteins (connexins)"""	4288	protein-coding gene	gene with protein product	"""connexin 30"""	604418	"""ectodermal dysplasia 2, hidrotic (Clouston syndrome)"", ""gap junction protein, beta 6 (connexin 30)"", ""gap junction protein, beta 6"""	DFNA3, ED2		10471490, 8845850	Standard	NM_006783		Approved	EDH, HED, CX30	uc001und.4	O95452	OTTHUMG00000016515	ENST00000356192.6:c.46C>T	chr13.hg19:g.20797574G>A	ENSP00000348521:p.His16Tyr	71.0	0.0		116.0	33.0	NM_001110220	B3KQN2|Q5Q1H9|Q5Q1I0|Q5Q1I1|Q5T5U0|Q8IUP0	Missense_Mutation	SNP	ENST00000356192.6	hg19	CCDS9291.1	.	.	.	.	.	.	.	.	.	.	G	1.233	-0.623550	0.03636	.	.	ENSG00000121742	ENST00000241124;ENST00000400065;ENST00000400066;ENST00000356192	D;D;D;D	0.99143	-5.48;-5.48;-5.48;-5.48	5.38	4.53	0.55603	Connexin, N-terminal (1);	0.129929	0.49916	D	0.000129	D	0.96207	0.8763	L	0.35341	1.055	0.46131	D	0.998889	B	0.22983	0.078	B	0.25614	0.062	D	0.93492	0.6836	10	0.13470	T	0.59	.	9.8206	0.40880	0.1519:0.0:0.8481:0.0	.	16	O95452	CXB6_HUMAN	Y	16	ENSP00000241124:H16Y;ENSP00000382938:H16Y;ENSP00000382939:H16Y;ENSP00000348521:H16Y	ENSP00000241124:H16Y	H	-	1	0	GJB6	19695574	1.000000	0.71417	0.985000	0.45067	0.806000	0.45545	4.163000	0.58183	2.507000	0.84556	0.655000	0.94253	CAC	.	.		0.507	GJB6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272906.1		
SERPINE3	647174	hgsc.bcm.edu	37	13	51936118	51936118	+	Silent	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr13:51936118T>C	ENST00000521255.1	+	7	1320	c.1260T>C	c.(1258-1260)aaT>aaC	p.N420N	RP11-24B19.3_ENST00000602636.1_RNA|RP11-24B19.4_ENST00000602881.1_RNA|SERPINE3_ENST00000524365.1_Intron|SERPINE3_ENST00000400389.4_Intron	NM_001101320.1	NP_001094790.1	A8MV23	SERP3_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 3	420					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			ovary(2)	2						CCCTCAAAAATAAGCATTCTT	0.373																																					p.N420N		Atlas-SNP	.											.	SERPINE3	37	.	0			c.T1260C						.						124.0	111.0	115.0					13																	51936118		1844	4083	5927	SO:0001819	synonymous_variant	647174	exon7			CAAAAATAAGCAT	AX772926	CCDS53870.1	13q14.3	2014-02-18			ENSG00000253309	ENSG00000253309		"""Serine (or cysteine) peptidase inhibitors"""	24774	protein-coding gene	gene with protein product						24172014	Standard	NM_001101320		Approved		uc001vfh.2	A8MV23	OTTHUMG00000016943	ENST00000521255.1:c.1260T>C	chr13.hg19:g.51936118T>C		142.0	0.0		192.0	9.0	NM_001101320	B1V8P3	Silent	SNP	ENST00000521255.1	hg19	CCDS53870.1																																																																																			.	.		0.373	SERPINE3-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045021.2	NM_001101320	
ACIN1	22985	hgsc.bcm.edu	37	14	23548222	23548222	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr14:23548222T>C	ENST00000262710.1	-	7	2315	c.1988A>G	c.(1987-1989)gAc>gGc	p.D663G	ACIN1_ENST00000555352.1_5'Flank|ACIN1_ENST00000457657.1_Missense_Mutation_p.D623G|ACIN1_ENST00000605057.1_Missense_Mutation_p.D605G|ACIN1_ENST00000555053.1_Missense_Mutation_p.D663G	NM_001164814.1|NM_014977.3	NP_001158286.1|NP_055792	Q9UKV3	ACINU_HUMAN	apoptotic chromatin condensation inducer 1	663	Ser-rich.				apoptotic chromosome condensation (GO:0030263)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|erythrocyte differentiation (GO:0030218)|mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|positive regulation of monocyte differentiation (GO:0045657)|RNA splicing (GO:0008380)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|kidney(4)|large_intestine(9)|lung(10)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	37	all_cancers(95;1.36e-05)			GBM - Glioblastoma multiforme(265;0.00816)		GGTGCTGCTGTCCCTGGAGAC	0.448																																					p.D663G		Atlas-SNP	.											.	ACIN1	147	.	0			c.A1988G						.						87.0	81.0	83.0					14																	23548222		2203	4300	6503	SO:0001583	missense	22985	exon7			CTGCTGTCCCTGG	AB014570	CCDS9587.1, CCDS53887.1, CCDS53888.1, CCDS53889.1, CCDS55905.1	14q11.2	2008-11-25	2004-03-31	2004-04-01	ENSG00000100813	ENSG00000100813			17066	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 152"""	604562	"""apoptotic chromatin condensation inducer in the nucleus"""	ACINUS		9734811, 10490026	Standard	NM_014977		Approved	KIAA0670, fSAP152	uc001wit.4	Q9UKV3	OTTHUMG00000028716	ENST00000262710.1:c.1988A>G	chr14.hg19:g.23548222T>C	ENSP00000262710:p.Asp663Gly	66.0	0.0		94.0	32.0	NM_001164814	B2RTT4|D3DS45|O75158|Q9UG91|Q9UKV1|Q9UKV2	Missense_Mutation	SNP	ENST00000262710.1	hg19	CCDS9587.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.297565	0.81025	.	.	ENSG00000100813	ENST00000262710;ENST00000457657;ENST00000555053	T;T;T	0.29655	2.36;1.56;2.36	6.07	6.07	0.98685	.	0.000000	0.43260	D	0.000590	T	0.41351	0.1155	L	0.27053	0.805	0.46774	D	0.999192	D;D;D	0.71674	0.998;0.997;0.997	D;D;D	0.78314	0.991;0.98;0.98	T	0.20907	-1.0261	10	0.38643	T	0.18	-15.3039	13.0325	0.58851	0.0:0.0:0.0:1.0	.	663;663;623	G3V3M7;Q9UKV3;E7EQT4	.;ACINU_HUMAN;.	G	663;623;663	ENSP00000262710:D663G;ENSP00000405677:D623G;ENSP00000451328:D663G	ENSP00000262710:D663G	D	-	2	0	ACIN1	22618062	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.612000	0.54142	2.326000	0.78906	0.533000	0.62120	GAC	.	.		0.448	ACIN1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000071707.3	NM_014977	
PTGR2	145482	hgsc.bcm.edu	37	14	74343770	74343770	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr14:74343770T>A	ENST00000555661.1	+	5	563	c.418T>A	c.(418-420)Tcc>Acc	p.S140T	PTGR2_ENST00000553813.1_Missense_Mutation_p.S6T|PTGR2_ENST00000267568.4_Missense_Mutation_p.S140T|RP5-1021I20.4_ENST00000556551.2_Missense_Mutation_p.S140T|PTGR2_ENST00000555228.1_Missense_Mutation_p.S140T			Q8N8N7	PTGR2_HUMAN	prostaglandin reductase 2	140					prostaglandin metabolic process (GO:0006693)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	13-prostaglandin reductase activity (GO:0036132)|15-oxoprostaglandin 13-oxidase activity (GO:0047522)			NS(1)|large_intestine(3)|lung(2)|prostate(1)|skin(2)	9					Indomethacin(DB00328)	TGGTTTGACTTCCTTGATTGG	0.423																																					p.S140T	Esophageal Squamous(98;1155 1417 16452 47043 47872)	Atlas-SNP	.											.	PTGR2	21	.	0			c.T418A						.						140.0	129.0	133.0					14																	74343770		2203	4300	6503	SO:0001583	missense	145482	exon5			TTGACTTCCTTGA	AK096410	CCDS9820.1	14q24.1-q24.2	2008-06-04	2008-06-02	2008-06-03		ENSG00000140043			20149	protein-coding gene	gene with protein product		608642	"""zinc binding alcohol dehydrogenase domain containing 1"""	ZADH1		17449869	Standard	NM_152444		Approved	FLJ39091	uc001xow.3	Q8N8N7		ENST00000555661.1:c.418T>A	chr14.hg19:g.74343770T>A	ENSP00000452280:p.Ser140Thr	94.0	0.0		133.0	33.0	NM_152444	Q3L8A4|Q6MZH8	Missense_Mutation	SNP	ENST00000555661.1	hg19	CCDS9820.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.946619	0.73672	.	.	ENSG00000140043;ENSG00000140043;ENSG00000140043;ENSG00000140043;ENSG00000258653	ENST00000555228;ENST00000555661;ENST00000267568;ENST00000554885;ENST00000553813	T;T;T;T;T	0.44881	0.91;0.91;0.91;0.91;0.91	5.79	4.61	0.57282	GroES-like (1);	0.098371	0.64402	D	0.000002	T	0.33818	0.0876	L	0.42245	1.32	0.43579	D	0.995917	P	0.35745	0.518	B	0.28991	0.097	T	0.16158	-1.0412	10	0.87932	D	0	-1.504	12.6545	0.56780	0.0:0.0:0.3971:0.6028	.	140	Q8N8N7	PTGR2_HUMAN	T	140;140;140;91;6	ENSP00000450975:S140T;ENSP00000452280:S140T;ENSP00000267568:S140T;ENSP00000451158:S91T;ENSP00000450824:S6T	ENSP00000267568:S140T	S	+	1	0	RP5-1021I20.4;PTGR2	73413523	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.303000	0.51858	0.954000	0.37851	0.477000	0.44152	TCC	.	.		0.423	PTGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412575.1		
TTLL5	23093	hgsc.bcm.edu	37	14	76135787	76135787	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr14:76135787G>A	ENST00000298832.9	+	3	308	c.103G>A	c.(103-105)Ggc>Agc	p.G35S	TTLL5_ENST00000286650.5_Missense_Mutation_p.G35S|TTLL5_ENST00000557636.1_Missense_Mutation_p.G35S|TTLL5_ENST00000556977.1_Missense_Mutation_p.G35S	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	35					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		GTGGACTGGAGGCTGCAGGAG	0.418																																					p.G35S		Atlas-SNP	.											.	TTLL5	102	.	0			c.G103A						.						184.0	178.0	180.0					14																	76135787		2203	4300	6503	SO:0001583	missense	23093	exon3			ACTGGAGGCTGCA	AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.103G>A	chr14.hg19:g.76135787G>A	ENSP00000298832:p.Gly35Ser	77.0	0.0		122.0	11.0	NM_015072	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Missense_Mutation	SNP	ENST00000298832.9	hg19	CCDS32124.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118614	0.77323	.	.	ENSG00000119685	ENST00000557003;ENST00000556977;ENST00000557636;ENST00000286650;ENST00000298832	T;T;T	0.06687	3.89;3.27;3.95	5.39	5.39	0.77823	.	0.109437	0.64402	D	0.000015	T	0.09862	0.0242	L	0.50333	1.59	0.80722	D	1	P;B;P	0.43352	0.488;0.369;0.804	B;B;B	0.37833	0.259;0.132;0.163	T	0.22906	-1.0203	10	0.24483	T	0.36	.	16.0699	0.80919	0.0:0.0:1.0:0.0	.	35;35;35	G3V2J9;Q6EMB2;Q6EMB2-3	.;TTLL5_HUMAN;.	S	35	ENSP00000450713:G35S;ENSP00000286650:G35S;ENSP00000298832:G35S	ENSP00000286650:G35S	G	+	1	0	TTLL5	75205540	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.896000	0.69822	2.520000	0.84964	0.467000	0.42956	GGC	.	.		0.418	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414453.1	NM_015072	
TTC7B	145567	hgsc.bcm.edu	37	14	91044612	91044612	+	Silent	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr14:91044612T>A	ENST00000328459.6	-	19	2269	c.2148A>T	c.(2146-2148)acA>acT	p.T716T	TTC7B_ENST00000554654.1_5'UTR|TTC7B_ENST00000357056.2_Silent_p.T733T	NM_001010854.1	NP_001010854.1	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B	716										NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	36		Melanoma(154;0.222)				GGGTACAGGCTGTGGCTTCTG	0.597																																					p.T716T		Atlas-SNP	.											.	TTC7B	93	.	0			c.A2148T						.						109.0	95.0	100.0					14																	91044612		2203	4300	6503	SO:0001819	synonymous_variant	145567	exon19			ACAGGCTGTGGCT	BC035865	CCDS32140.1	14q32.12	2013-01-11	2004-06-02	2004-06-04		ENSG00000165914		"""Tetratricopeptide (TTC) repeat domain containing"""	19858	protein-coding gene	gene with protein product			"""tetratricopeptide repeat domain 7 like 1"""	TTC7L1			Standard	XM_005267367		Approved		uc001xyp.3	Q86TV6		ENST00000328459.6:c.2148A>T	chr14.hg19:g.91044612T>A		94.0	0.0		141.0	48.0	NM_001010854	Q86U24|Q86VT3	Silent	SNP	ENST00000328459.6	hg19	CCDS32140.1	.	.	.	.	.	.	.	.	.	.	T	10.97	1.502153	0.26949	.	.	ENSG00000165914	ENST00000557292	.	.	.	5.39	-8.05	0.01106	.	.	.	.	.	T	0.37376	0.1001	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41124	-0.9526	4	.	.	.	-12.7696	4.0022	0.09585	0.0924:0.1835:0.4351:0.2889	.	.	.	.	C	144	.	.	S	-	1	0	TTC7B	90114365	0.143000	0.22626	0.839000	0.33178	0.983000	0.72400	-0.538000	0.06120	-1.791000	0.01261	-1.236000	0.01555	AGC	.	.		0.597	TTC7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411364.2		
INO80	54617	hgsc.bcm.edu	37	15	41313274	41313274	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr15:41313274T>A	ENST00000361937.3	-	26	3522	c.3098A>T	c.(3097-3099)tAt>tTt	p.Y1033F	RP11-540O11.4_ENST00000558967.1_RNA|INO80_ENST00000401393.3_Missense_Mutation_p.Y1033F			Q9ULG1	INO80_HUMAN	INO80 complex subunit	1033	Assembles INO80 complex module consisting of conserved components INO80B, INO80C, ACTR5, RVBL1, RVBL2.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						TCGCCTTTCATATTCTGCACT	0.488																																					p.Y1033F		Atlas-SNP	.											.	INO80	122	.	0			c.A3098T						.						89.0	81.0	84.0					15																	41313274		2203	4300	6503	SO:0001583	missense	54617	exon26			CTTTCATATTCTG	AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.3098A>T	chr15.hg19:g.41313274T>A	ENSP00000355205:p.Tyr1033Phe	57.0	0.0		59.0	18.0	NM_017553	A6H8X4|Q9NTG6	Missense_Mutation	SNP	ENST00000361937.3	hg19	CCDS10071.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.566724	0.86439	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.91577	-2.87;-2.87	5.14	5.14	0.70334	.	0.062420	0.64402	D	0.000003	D	0.83519	0.5272	L	0.47190	1.495	0.58432	D	0.999999	P	0.49783	0.928	B	0.32090	0.14	T	0.82896	-0.0230	10	0.15066	T	0.55	.	15.1111	0.72359	0.0:0.0:0.0:1.0	.	1033	Q9ULG1	INO80_HUMAN	F	1033	ENSP00000355205:Y1033F;ENSP00000384686:Y1033F	ENSP00000355205:Y1033F	Y	-	2	0	INO80	39100566	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.047000	0.76599	2.150000	0.67090	0.533000	0.62120	TAT	.	.		0.488	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252527.2	NM_017553	
RPAP1	26015	hgsc.bcm.edu	37	15	41812892	41812892	+	Silent	SNP	C	C	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr15:41812892C>T	ENST00000304330.4	-	22	3608	c.3492G>A	c.(3490-3492)ctG>ctA	p.L1164L	RPAP1_ENST00000561603.1_Intron	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	1164	Leu-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CACTGTCCACCAGGAACACAC	0.642																																					p.L1164L		Atlas-SNP	.											.	RPAP1	111	.	0			c.G3492A						.						74.0	76.0	76.0					15																	41812892		2203	4300	6503	SO:0001819	synonymous_variant	26015	exon22			GTCCACCAGGAAC	BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.3492G>A	chr15.hg19:g.41812892C>T		63.0	0.0		90.0	29.0	NM_015540	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Silent	SNP	ENST00000304330.4	hg19	CCDS10079.1																																																																																			.	.		0.642	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252694.2	NM_015540	
VPS39	23339	hgsc.bcm.edu	37	15	42458405	42458405	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr15:42458405G>C	ENST00000348544.4	-	17	1664	c.1665C>G	c.(1663-1665)ttC>ttG	p.F555L	VPS39_ENST00000318006.5_Missense_Mutation_p.F544L			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	555					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		CTGAGTAGGAGAAAATCAAAT	0.512																																					p.F544L		Atlas-SNP	.											VPS39,NS,carcinoma,0,2	VPS39	53	.	0			c.C1632G						.						102.0	97.0	99.0					15																	42458405		2203	4299	6502	SO:0001583	missense	23339	exon16			GTAGGAGAAAATC	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1665C>G	chr15.hg19:g.42458405G>C	ENSP00000335193:p.Phe555Leu	119.0	0.0		134.0	45.0	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	hg19	CCDS10083.1	.	.	.	.	.	.	.	.	.	.	G	14.03	2.414770	0.42817	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.38560	1.13;1.14	5.89	2.29	0.28610	Vacuolar sorting protein 39/Transforming growth factor beta receptor-associated domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.21267	0.0512	N	0.05574	-0.02	0.80722	D	1	B;B	0.27286	0.174;0.148	B;B	0.36092	0.217;0.079	T	0.09509	-1.0671	10	0.05620	T	0.96	-13.8211	9.5364	0.39224	0.7295:0.0:0.2705:0.0	.	555;544	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	L	544;555	ENSP00000326534:F544L;ENSP00000335193:F555L	ENSP00000326534:F544L	F	-	3	2	VPS39	40245697	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.104000	0.31074	0.492000	0.27815	-0.302000	0.09304	TTC	.	.		0.512	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
SEMA6D	80031	hgsc.bcm.edu	37	15	48055213	48055213	+	Splice_Site	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr15:48055213A>T	ENST00000316364.5	+	9	1098	c.659A>T	c.(658-660)gAg>gTg	p.E220V	SEMA6D_ENST00000389428.3_Splice_Site_p.E220V|SEMA6D_ENST00000358066.4_Splice_Site_p.E220V|SEMA6D_ENST00000389432.2_Splice_Site_p.E220V|SEMA6D_ENST00000389433.2_Splice_Site_p.E220V|SEMA6D_ENST00000355997.3_Splice_Site_p.E220V|SEMA6D_ENST00000558816.1_Splice_Site_p.E220V|SEMA6D_ENST00000558014.1_Splice_Site_p.E220V|SEMA6D_ENST00000354744.4_Splice_Site_p.E220V|SEMA6D_ENST00000389425.3_Splice_Site_p.E220V|SEMA6D_ENST00000536845.2_Splice_Site_p.E220V|SEMA6D_ENST00000537942.1_Splice_Site_p.E220V	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	220	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TTTCTTTCAGAGCCACACTTT	0.358																																					p.E220V		Atlas-SNP	.											.	SEMA6D	322	.	0			c.A659T						.						61.0	58.0	59.0					15																	48055213		2198	4296	6494	SO:0001630	splice_region_variant	80031	exon9			TTTCAGAGCCACA	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.659-1A>T	chr15.hg19:g.48055213A>T		58.0	0.0		47.0	22.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	hg19	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	A	31	5.078560	0.94050	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73;1.73	5.8	5.8	0.92144	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.60792	0.2296	M	0.91038	3.17	0.80722	D	1	D;D;D;P;D	0.89917	1.0;1.0;1.0;0.688;1.0	D;D;D;P;D	0.97110	0.999;1.0;0.999;0.872;0.999	T	0.70055	-0.4977	9	.	.	.	.	16.1596	0.81693	1.0:0.0:0.0:0.0	.	220;220;220;220;220	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	V	220	ENSP00000442040:E220V;ENSP00000446152:E220V;ENSP00000324857:E220V;ENSP00000374084:E220V;ENSP00000374083:E220V;ENSP00000346786:E220V;ENSP00000350770:E220V;ENSP00000374079:E220V;ENSP00000348276:E220V;ENSP00000374076:E220V	.	E	+	2	0	SEMA6D	45842505	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	8.962000	0.93254	2.216000	0.71823	0.533000	0.62120	GAG	.	.		0.358	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	Missense_Mutation
SLCO3A1	28232	hgsc.bcm.edu	37	15	92647605	92647605	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr15:92647605T>A	ENST00000318445.6	+	4	1056	c.842T>A	c.(841-843)tTg>tAg	p.L281*	SLCO3A1_ENST00000555549.1_3'UTR|SLCO3A1_ENST00000424469.2_Nonsense_Mutation_p.L281*	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	281					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	TCTTCCCTCTTGATGTTTGGG	0.597																																					p.L281X		Atlas-SNP	.											.	SLCO3A1	84	.	0			c.T842A						.						189.0	160.0	170.0					15																	92647605		2198	4298	6496	SO:0001587	stop_gained	28232	exon4			CCCTCTTGATGTT	AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.842T>A	chr15.hg19:g.92647605T>A	ENSP00000320634:p.Leu281*	50.0	0.0		64.0	18.0	NM_013272	A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Nonsense_Mutation	SNP	ENST00000318445.6	hg19	CCDS10371.1	.	.	.	.	.	.	.	.	.	.	T	38	6.927826	0.97940	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000556649	.	.	.	5.12	3.98	0.46160	.	0.236375	0.35235	N	0.003352	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	5.5318	0.16989	0.0:0.1149:0.1706:0.7146	.	.	.	.	X	281;281;74	.	ENSP00000320634:L281X	L	+	2	0	SLCO3A1	90448609	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.725000	0.54970	0.755000	0.32990	0.533000	0.62120	TTG	.	.		0.597	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313529.1	NM_013272	
AXIN1	8312	hgsc.bcm.edu	37	16	347192	347192	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr16:347192T>A	ENST00000262320.3	-	7	2190	c.1819A>T	c.(1819-1821)Aag>Tag	p.K607*	AXIN1_ENST00000354866.3_Nonsense_Mutation_p.K607*|AXIN1_ENST00000481769.1_5'Flank	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	607	Interaction with PPP2CA.|Interaction with RNF111.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TCAGCCTTCTTGGCATTTCTT	0.622																																					p.K607X		Atlas-SNP	.											.	AXIN1	290	.	0			c.A1819T						.						175.0	172.0	173.0					16																	347192		2203	4300	6503	SO:0001587	stop_gained	8312	exon7			CCTTCTTGGCATT	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1819A>T	chr16.hg19:g.347192T>A	ENSP00000262320:p.Lys607*	14.0	0.0		13.0	6.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Nonsense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	T	38	7.197489	0.98129	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	5.16	5.16	0.70880	.	0.179987	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.082	14.9761	0.71273	0.0:0.0:0.0:1.0	.	.	.	.	X	607	.	ENSP00000262320:K607X	K	-	1	0	AXIN1	287193	1.000000	0.71417	0.921000	0.36526	0.296000	0.27459	4.580000	0.60942	1.959000	0.56917	0.391000	0.25812	AAG	.	.		0.622	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
RAB26	25837	hgsc.bcm.edu	37	16	2203207	2203207	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr16:2203207T>C	ENST00000210187.6	+	8	812	c.652T>C	c.(652-654)Ttc>Ctc	p.F218L	RAB26_ENST00000541451.1_Missense_Mutation_p.F152L|SNORD60_ENST00000383903.1_RNA|TRAF7_ENST00000326181.6_5'Flank|RP11-304L19.5_ENST00000563192.1_lincRNA	NM_014353.4	NP_055168.2	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family	218					exocrine system development (GO:0035272)|Golgi to plasma membrane protein transport (GO:0043001)|regulated secretory pathway (GO:0045055)|regulation of exocytosis (GO:0017157)|small GTPase mediated signal transduction (GO:0007264)	Golgi membrane (GO:0000139)|intrinsic component of plasma membrane (GO:0031226)|secretory granule membrane (GO:0030667)	GMP binding (GO:0019002)|GTP binding (GO:0005525)			kidney(1)|large_intestine(1)|lung(3)	5						GGACTTGGCCTTCACAGCCAT	0.607																																					p.F218L		Atlas-SNP	.											.	RAB26	9	.	0			c.T652C						.						60.0	56.0	57.0					16																	2203207		2197	4300	6497	SO:0001583	missense	25837	exon8			TTGGCCTTCACAG	AB027137	CCDS10460.1	16p13.3	2008-07-28			ENSG00000167964	ENSG00000167964		"""RAB, member RAS oncogene"""	14259	protein-coding gene	gene with protein product		605455				11043516	Standard	NM_014353		Approved		uc002cou.3	Q9ULW5	OTTHUMG00000128829	ENST00000210187.6:c.652T>C	chr16.hg19:g.2203207T>C	ENSP00000210187:p.Phe218Leu	126.0	0.0		141.0	50.0	NM_014353	B2RAA6|Q3L6K5|Q6NXS7	Missense_Mutation	SNP	ENST00000210187.6	hg19	CCDS10460.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.648179	0.87958	.	.	ENSG00000167964	ENST00000541451;ENST00000210187	D;D	0.82526	-1.62;-1.62	4.22	4.22	0.49857	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	D	0.92189	0.7523	M	0.92077	3.27	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93348	0.6716	10	0.87932	D	0	.	11.2799	0.49188	0.0:0.0:0.0:1.0	.	218	Q9ULW5	RAB26_HUMAN	L	152;218	ENSP00000441580:F152L;ENSP00000210187:F218L	ENSP00000210187:F218L	F	+	1	0	RAB26	2143208	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	7.519000	0.81809	1.775000	0.52247	0.260000	0.18958	TTC	.	.		0.607	RAB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250767.2		
USP7	7874	hgsc.bcm.edu	37	16	8989502	8989502	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr16:8989502T>C	ENST00000344836.4	-	27	3114	c.2916A>G	c.(2914-2916)atA>atG	p.I972M	USP7_ENST00000535863.1_Missense_Mutation_p.I873M|USP7_ENST00000381886.4_Missense_Mutation_p.I956M	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	972					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						CAGATACCTCTATTCGAAACG	0.408																																					p.I972M		Atlas-SNP	.											.	USP7	116	.	0			c.A2916G						.						75.0	74.0	74.0					16																	8989502		2197	4300	6497	SO:0001583	missense	7874	exon27			TACCTCTATTCGA	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.2916A>G	chr16.hg19:g.8989502T>C	ENSP00000343535:p.Ile972Met	71.0	0.0		92.0	25.0	NM_003470	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	hg19	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.077420	0.76528	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863	T;T	0.08282	3.11;3.13	5.5	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.24160	0.0585	M	0.66939	2.045	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.64776	0.929;0.929	T	0.00470	-1.1720	10	0.66056	D	0.02	.	12.6896	0.56966	0.0:0.0:0.1379:0.8621	.	972;956	Q93009;B7Z815	UBP7_HUMAN;.	M	972;980;873	ENSP00000343535:I972M;ENSP00000443646:I873M	ENSP00000343535:I972M	I	-	3	3	USP7	8897003	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	5.048000	0.64238	0.904000	0.36572	0.454000	0.30748	ATA	.	.		0.408	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
MYO1C	4641	hgsc.bcm.edu	37	17	1384146	1384146	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:1384146G>C	ENST00000575158.1	-	6	732	c.556C>G	c.(556-558)Ctc>Gtc	p.L186V	MYO1C_ENST00000361007.2_Missense_Mutation_p.L186V|MYO1C_ENST00000573198.1_5'UTR|MYO1C_ENST00000545534.2_Missense_Mutation_p.L197V|MYO1C_ENST00000359786.5_Missense_Mutation_p.L221V|MYO1C_ENST00000438665.2_Missense_Mutation_p.L202V			Q12965	MYO1E_HUMAN	myosin IC	193	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|endocytosis (GO:0006897)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|glomerular visceral epithelial cell development (GO:0072015)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic hemopoiesis (GO:0035166)|vasculogenesis (GO:0001570)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	17				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		TTTTCCAGGAGGTAACTGAGG	0.627																																					p.L221V		Atlas-SNP	.											.	MYO1C	57	.	0			c.C661G						.						89.0	88.0	89.0					17																	1384146		2203	4300	6503	SO:0001583	missense	4641	exon6			CCAGGAGGTAACT	X98507	CCDS11003.1, CCDS42226.1, CCDS45562.1	17p13.3	2011-09-27			ENSG00000197879	ENSG00000197879		"""Myosins / Myosin superfamily : Class I"""	7597	protein-coding gene	gene with protein product		606538				9119401	Standard	NM_001080779		Approved	myr2	uc002fsp.3	O00159	OTTHUMG00000090323	ENST00000575158.1:c.556C>G	chr17.hg19:g.1384146G>C	ENSP00000459174:p.Leu186Val	48.0	0.0		71.0	18.0	NM_001080779	Q14778	Missense_Mutation	SNP	ENST00000575158.1	hg19	CCDS11003.1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.671955	0.88348	.	.	ENSG00000197879	ENST00000359786;ENST00000438665;ENST00000535856;ENST00000361007;ENST00000545534;ENST00000535421	T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11	4.96	4.96	0.65561	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.92570	0.7640	H	0.98089	4.145	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.997	D;D;D	0.72982	0.951;0.979;0.919	D	0.95199	0.8315	10	0.87932	D	0	.	17.366	0.87364	0.0:0.0:1.0:0.0	.	197;221;202	B7Z3E5;O00159;O00159-3	.;MYO1C_HUMAN;.	V	221;202;202;186;197;186	ENSP00000352834:L221V;ENSP00000412197:L202V;ENSP00000354283:L186V;ENSP00000437685:L197V	ENSP00000352834:L221V	L	-	1	0	MYO1C	1330896	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.608000	0.74168	2.575000	0.86900	0.462000	0.41574	CTC	.	.		0.627	MYO1C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438694.2		
MYH13	8735	hgsc.bcm.edu	37	17	10216060	10216060	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:10216060T>A	ENST00000418404.3	-	30	4359	c.4196A>T	c.(4195-4197)cAg>cTg	p.Q1399L	RP11-401O9.4_ENST00000609088.1_RNA|MYH13_ENST00000252172.4_Missense_Mutation_p.Q1399L			Q9UKX3	MYH13_HUMAN	myosin, heavy chain 13, skeletal muscle	1399					cellular response to starvation (GO:0009267)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)	extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(3)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(21)|lung(48)|ovary(7)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	108						CTGGAGCCTCTGGGCCAGTTT	0.493																																					p.Q1399L		Atlas-SNP	.											.	MYH13	533	.	0			c.A4196T						.						39.0	41.0	40.0					17																	10216060		2128	4267	6395	SO:0001583	missense	8735	exon31			AGCCTCTGGGCCA	AF075248	CCDS45613.1	17p13	2011-09-27	2006-09-29			ENSG00000006788		"""Myosins / Myosin superfamily : Class II"""	7571	protein-coding gene	gene with protein product	"""extraocular muscle myosin heavy chain"", ""extraocular myosin heavy chain"""	603487	"""myosin, heavy polypeptide 13, skeletal muscle"""			9806854	Standard	NM_003802		Approved	MyHC-eo	uc002gmk.1	Q9UKX3		ENST00000418404.3:c.4196A>T	chr17.hg19:g.10216060T>A	ENSP00000404570:p.Gln1399Leu	56.0	0.0		99.0	28.0	NM_003802	O95252|Q9P0U8	Missense_Mutation	SNP	ENST00000418404.3	hg19	CCDS45613.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963096	0.53507	.	.	ENSG00000006788	ENST00000252172	T	0.78924	-1.22	3.96	3.96	0.45880	Myosin tail (1);	.	.	.	.	T	0.73094	0.3543	M	0.62154	1.92	0.36937	D	0.892184	B	0.06786	0.001	B	0.17979	0.02	T	0.71111	-0.4687	9	0.18276	T	0.48	.	13.3004	0.60321	0.0:0.0:0.0:1.0	.	1399	Q9UKX3	MYH13_HUMAN	L	1399	ENSP00000252172:Q1399L	ENSP00000252172:Q1399L	Q	-	2	0	MYH13	10156785	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.023000	0.70848	1.792000	0.52537	0.379000	0.24179	CAG	.	.		0.493	MYH13-003	KNOWN	alternative_3_UTR|alternative_5_UTR|NMD_exception|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442255.1	NM_003802	
MYO18A	399687	hgsc.bcm.edu	37	17	27448104	27448104	+	Silent	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:27448104A>G	ENST00000527372.1	-	6	1677	c.1497T>C	c.(1495-1497)agT>agC	p.S499S	MYO18A_ENST00000354329.4_Silent_p.S499S|MYO18A_ENST00000531253.1_Silent_p.S499S|MYO18A_ENST00000533112.1_Silent_p.S499S	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	499	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CACTGCCACTACTGCCCAGGA	0.607																																					p.S499S	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.T1497C						.						48.0	50.0	49.0					17																	27448104		2123	4243	6366	SO:0001819	synonymous_variant	399687	exon6			GCCACTACTGCCC	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.1497T>C	chr17.hg19:g.27448104A>G		56.0	0.0		62.0	22.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	hg19	CCDS45642.1																																																																																			.	.		0.607	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
ASIC2	40	hgsc.bcm.edu	37	17	31618817	31618817	+	Intron	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:31618817T>C	ENST00000359872.6	-	2	1317				ASIC2_ENST00000448983.1_5'Flank|ASIC2_ENST00000225823.2_Missense_Mutation_p.N106S	NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2						central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GAGCAAGCGGTTCGAGGACCA	0.667																																					p.N106S		Atlas-SNP	.											.	.	.	.	0			c.A317G						.						36.0	36.0	36.0					17																	31618817		2203	4297	6500	SO:0001627	intron_variant	40	exon1			AAGCGGTTCGAGG	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.556-179732A>G	chr17.hg19:g.31618817T>C		39.0	0.0		78.0	23.0	NM_183377	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Missense_Mutation	SNP	ENST00000359872.6	hg19	CCDS42296.1	.	.	.	.	.	.	.	.	.	.	T	11.08	1.534177	0.27475	.	.	ENSG00000108684	ENST00000225823	T	0.62639	0.01	4.73	4.73	0.59995	.	0.461095	0.23722	N	0.045219	T	0.48447	0.1500	L	0.39085	1.19	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.38478	-0.9659	10	0.09590	T	0.72	-27.1555	12.1572	0.54083	0.0:0.0:0.0:1.0	.	106	E9PBX2	.	S	106	ENSP00000225823:N106S	ENSP00000225823:N106S	N	-	2	0	ACCN1	28642930	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	4.905000	0.63286	1.744000	0.51775	0.260000	0.18958	AAC	.	.		0.667	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
KRT32	3882	hgsc.bcm.edu	37	17	39623382	39623382	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:39623382A>T	ENST00000225899.3	-	1	299	c.196T>A	c.(196-198)Tat>Aat	p.Y66N	RNU2-32P_ENST00000411193.1_RNA	NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	66	Head.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				CTGGATAGATAGGTTTTGGAG	0.627																																					p.Y66N		Atlas-SNP	.											.	KRT32	57	.	0			c.T196A						.						36.0	40.0	39.0					17																	39623382		2203	4300	6503	SO:0001583	missense	3882	exon1			ATAGATAGGTTTT	X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.196T>A	chr17.hg19:g.39623382A>T	ENSP00000225899:p.Tyr66Asn	83.0	0.0		124.0	52.0	NM_002278		Missense_Mutation	SNP	ENST00000225899.3	hg19	CCDS11393.1	.	.	.	.	.	.	.	.	.	.	A	6.574	0.474274	0.12521	.	.	ENSG00000108759	ENST00000225899	D	0.88975	-2.45	5.26	1.73	0.24493	.	0.223489	0.22850	N	0.054868	D	0.83917	0.5358	M	0.64404	1.975	0.27161	N	0.961166	B	0.26400	0.148	B	0.22601	0.04	T	0.70400	-0.4882	10	0.28530	T	0.3	.	7.8978	0.29717	0.7555:0.0:0.2445:0.0	.	66	Q14532	K1H2_HUMAN	N	66	ENSP00000225899:Y66N	ENSP00000225899:Y66N	Y	-	1	0	KRT32	36876908	0.119000	0.22226	0.180000	0.23079	0.178000	0.23041	1.687000	0.37680	0.064000	0.16427	0.460000	0.39030	TAT	.	.		0.627	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257293.1	NM_002278	
KRT15	3866	hgsc.bcm.edu	37	17	39670928	39670928	+	Splice_Site	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:39670928T>A	ENST00000254043.3	-	7	4833		c.e7-2		KRT15_ENST00000393974.3_Splice_Site|KRT15_ENST00000393981.3_3'UTR|KRT15_ENST00000393976.2_Splice_Site	NM_002275.3	NP_002266	P19012	K1C15_HUMAN	keratin 15						epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16		Breast(137;0.000286)				CCAGCCATCCTGAAAGAAAGA	0.517																																					.		Atlas-SNP	.											.	KRT15	60	.	0			c.1248-2A>T						.						84.0	67.0	73.0					17																	39670928		2203	4300	6503	SO:0001630	splice_region_variant	3866	exon8			CCATCCTGAAAGA		CCDS11398.1	17q21.2	2013-06-20			ENSG00000171346	ENSG00000171346		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6421	protein-coding gene	gene with protein product	"""keratin-15, basic"", ""keratin-15, beta"", ""type I cytoskeletal 15"", ""cytokeratin 15"""	148030				16831889	Standard	NM_002275		Approved	K15, CK15, K1CO	uc002hwy.3	P19012	OTTHUMG00000133435	ENST00000254043.3:c.1248-2A>T	chr17.hg19:g.39670928T>A		94.0	0.0		98.0	34.0	NM_002275	B3KQY1|B3KRA2|E0CX14|Q53XV8|Q9BUG4	Splice_Site	SNP	ENST00000254043.3	hg19	CCDS11398.1	.	.	.	.	.	.	.	.	.	.	T	12.18	1.860716	0.32884	.	.	ENSG00000171346	ENST00000254043;ENST00000393974;ENST00000393976	.	.	.	4.22	4.22	0.49857	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.0071	0.41964	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT15	36924454	1.000000	0.71417	1.000000	0.80357	0.425000	0.31504	3.093000	0.50217	2.119000	0.64992	0.528000	0.53228	.	.	.		0.517	KRT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257301.1	NM_002275	Intron
SPATA20	64847	hgsc.bcm.edu	37	17	48627450	48627450	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:48627450G>A	ENST00000356488.4	+	7	1002	c.919G>A	c.(919-921)Ggg>Agg	p.G307R	SPATA20_ENST00000006658.6_Missense_Mutation_p.G323R|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000393244.3_Missense_Mutation_p.G263R	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	307					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)	p.G323W(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			GATGGCTAACGGGGGCATCCG	0.642																																					p.G323R		Atlas-SNP	.											.	SPATA20	59	.	1	Substitution - Missense(1)	lung(1)	c.G967A						.						111.0	121.0	118.0					17																	48627450		2203	4300	6503	SO:0001583	missense	64847	exon8			GCTAACGGGGGCA		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.919G>A	chr17.hg19:g.48627450G>A	ENSP00000348878:p.Gly307Arg	42.0	0.0		52.0	20.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	hg19	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	G	31	5.083012	0.94050	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.32272	1.46;1.46;1.46	5.53	5.53	0.82687	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);	0.000000	0.85682	D	0.000000	T	0.67363	0.2885	M	0.92738	3.34	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.75838	-0.3176	10	0.87932	D	0	-7.5395	19.4936	0.95062	0.0:0.0:1.0:0.0	.	333;307;323	B4DZC5;Q8TB22;Q8TB22-2	.;SPT20_HUMAN;.	R	323;307;263	ENSP00000006658:G323R;ENSP00000348878:G307R;ENSP00000376935:G263R	ENSP00000006658:G323R	G	+	1	0	SPATA20	45982449	1.000000	0.71417	0.967000	0.41034	0.983000	0.72400	9.869000	0.99810	2.605000	0.88082	0.655000	0.94253	GGG	.	.		0.642	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
SDK2	54549	hgsc.bcm.edu	37	17	71429982	71429982	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr17:71429982C>T	ENST00000392650.3	-	10	1201	c.1201G>A	c.(1201-1203)Gcc>Acc	p.A401T	SDK2_ENST00000388726.3_Missense_Mutation_p.A401T	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	401					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						ATGTTAGGGGCGATGCCTGCA	0.647																																					p.A401T		Atlas-SNP	.											.	SDK2	219	.	0			c.G1201A						.						43.0	34.0	37.0					17																	71429982		2203	4300	6503	SO:0001583	missense	54549	exon10			TAGGGGCGATGCC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1201G>A	chr17.hg19:g.71429982C>T	ENSP00000376421:p.Ala401Thr	72.0	0.0		90.0	25.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	hg19	CCDS45769.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.3|22.3	4.265838|4.265838	0.80358|0.80358	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893|ENST00000416616	D;D|.	0.96427|.	-4.01;-4.01|.	4.8|4.8	4.8|4.8	0.61643|0.61643	Immunoglobulin-like fold (1);|.	0.195205|.	0.43747|.	D|.	0.000521|.	T|T	0.74989|0.74989	0.3789|0.3789	M|M	0.71920|0.71920	2.185|2.185	0.80722|0.80722	D|D	1|1	P;P|.	0.45396|.	0.857;0.776|.	B;B|.	0.42462|.	0.388;0.217|.	T|T	0.75311|0.75311	-0.3362|-0.3362	10|5	0.72032|.	D|.	0.01|.	.|.	17.8294|17.8294	0.88676|0.88676	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	401;401|.	Q58EX2-2;Q58EX2|.	.;SDK2_HUMAN|.	T|H	25;401;401;401|305	ENSP00000376421:A401T;ENSP00000373378:A401T|.	ENSP00000324967:A401T|.	A|R	-|-	1|2	0|0	SDK2|SDK2	68941577|68941577	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.939000|0.939000	0.58152|0.58152	6.685000|6.685000	0.74543|0.74543	2.375000|2.375000	0.81037|0.81037	0.462000|0.462000	0.41574|0.41574	GCC|CGC	.	.		0.647	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
COLEC12	81035	hgsc.bcm.edu	37	18	335067	335067	+	Silent	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr18:335067G>A	ENST00000400256.3	-	6	1698	c.1491C>T	c.(1489-1491)ggC>ggT	p.G497G		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	497	Collagen-like 2.				carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				ATCCTTTGCCGCCACGCTCTC	0.692																																					p.G497G		Atlas-SNP	.											.	COLEC12	121	.	0			c.C1491T						.						27.0	30.0	29.0					18																	335067		2186	4263	6449	SO:0001819	synonymous_variant	81035	exon6			TTTGCCGCCACGC	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.1491C>T	chr18.hg19:g.335067G>A		53.0	0.0		71.0	32.0	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000400256.3	hg19	CCDS32782.1																																																																																			.	.		0.692	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
COLEC12	81035	hgsc.bcm.edu	37	18	346985	346985	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr18:346985G>T	ENST00000400256.3	-	5	844	c.637C>A	c.(637-639)Cag>Aag	p.Q213K		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	213					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				TGCTGCACCTGGGTCAGGTTC	0.493																																					p.Q213K		Atlas-SNP	.											.	COLEC12	121	.	0			c.C637A						.						117.0	117.0	117.0					18																	346985		2203	4300	6503	SO:0001583	missense	81035	exon5			GCACCTGGGTCAG	AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.637C>A	chr18.hg19:g.346985G>T	ENSP00000383115:p.Gln213Lys	48.0	0.0		76.0	26.0	NM_130386	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	ENST00000400256.3	hg19	CCDS32782.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.476247	0.63737	.	.	ENSG00000158270	ENST00000400256	D	0.97161	-4.27	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	D	0.96833	0.8966	L	0.34521	1.04	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.92617	0.6104	10	0.02654	T	1	-14.6472	20.6634	0.99662	0.0:0.0:1.0:0.0	.	213	Q5KU26	COL12_HUMAN	K	213	ENSP00000383115:Q213K	ENSP00000383115:Q213K	Q	-	1	0	COLEC12	336985	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.414000	0.97362	2.894000	0.99253	0.655000	0.94253	CAG	.	.		0.493	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440746.1		
ANKRD12	23253	hgsc.bcm.edu	37	18	9255216	9255216	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr18:9255216A>G	ENST00000262126.4	+	9	2191	c.1951A>G	c.(1951-1953)Aaa>Gaa	p.K651E	ANKRD12_ENST00000400020.3_Missense_Mutation_p.K628E|ANKRD12_ENST00000383440.2_Missense_Mutation_p.K628E	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	651						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						taaaacattaaaaaaacataa	0.279																																					p.K651E		Atlas-SNP	.											.	ANKRD12	167	.	0			c.A1951G						.						33.0	37.0	36.0					18																	9255216		2192	4281	6473	SO:0001583	missense	23253	exon9			ACATTAAAAAAAC	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.1951A>G	chr18.hg19:g.9255216A>G	ENSP00000262126:p.Lys651Glu	264.0	0.0		397.0	125.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	16.68	3.190666	0.58017	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158	D;D	0.92397	-3.03;-3.03	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	D	0.94771	0.8312	M	0.78637	2.42	0.58432	D	0.999999	P;P;P	0.51537	0.946;0.946;0.911	P;P;B	0.55667	0.781;0.636;0.432	D	0.95405	0.8493	10	0.87932	D	0	-0.7563	15.4212	0.75011	1.0:0.0:0.0:0.0	.	278;628;651	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	E	628;651;358	ENSP00000372932:K628E;ENSP00000262126:K651E	ENSP00000262126:K651E	K	+	1	0	ANKRD12	9245216	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.910000	0.92685	2.110000	0.64415	0.377000	0.23210	AAA	.	.		0.279	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
MOCOS	55034	hgsc.bcm.edu	37	18	33846710	33846710	+	Splice_Site	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr18:33846710A>T	ENST00000261326.5	+	14	2430		c.e14-1		MOCOS_ENST00000588132.1_Splice_Site	NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CTCACCTGCCAGGTTTTGGGG	0.498																																					.		Atlas-SNP	.											.	MOCOS	84	.	0			c.2410-2A>T						.						87.0	77.0	80.0					18																	33846710		2203	4300	6503	SO:0001630	splice_region_variant	55034	exon14			CCTGCCAGGTTTT	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.2410-1A>T	chr18.hg19:g.33846710A>T		62.0	0.0		91.0	4.0	NM_017947		Splice_Site	SNP	ENST00000261326.5	hg19	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	A	19.60	3.857716	0.71834	.	.	ENSG00000075643	ENST00000261326	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6765	0.56897	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MOCOS	32100708	1.000000	0.71417	0.994000	0.49952	0.788000	0.44548	5.511000	0.67024	2.242000	0.73789	0.528000	0.53228	.	.	.		0.498	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		Intron
HAUS1	115106	hgsc.bcm.edu	37	18	43703316	43703316	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr18:43703316G>T	ENST00000282058.6	+	6	732	c.652G>T	c.(652-654)Gta>Tta	p.V218L	HAUS1_ENST00000588704.1_3'UTR|HAUS1_ENST00000585518.1_Missense_Mutation_p.S86I|RNU6-1278P_ENST00000516130.1_RNA	NM_138443.3	NP_612452.1	Q96CS2	HAUS1_HUMAN	HAUS augmin-like complex, subunit 1	218					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	7						TCAGTCCTTAGTAGCACTATC	0.333																																					p.V218L	NSCLC(79;183 1423 5813 15597 38427)	Atlas-SNP	.											.	HAUS1	22	.	0			c.G652T						.						101.0	108.0	106.0					18																	43703316		2203	4300	6503	SO:0001583	missense	115106	exon6			TCCTTAGTAGCAC	AY360137	CCDS11928.1	18q21.1	2013-10-11	2009-04-20	2009-04-20	ENSG00000152240	ENSG00000152240		"""HAUS augmin-like complex subunits"""	25174	protein-coding gene	gene with protein product		608775	"""coiled-coil domain containing 5 (spindle associated)"""	CCDC5		19427217	Standard	NR_026978		Approved	HEI-C, HsT1461, FLJ40084	uc002lbu.3	Q96CS2	OTTHUMG00000132638	ENST00000282058.6:c.652G>T	chr18.hg19:g.43703316G>T	ENSP00000282058:p.Val218Leu	242.0	0.0		320.0	86.0	NM_138443	B2RDM7|Q8N837	Missense_Mutation	SNP	ENST00000282058.6	hg19	CCDS11928.1	.	.	.	.	.	.	.	.	.	.	G	4.461	0.085435	0.08583	.	.	ENSG00000152240	ENST00000282058	.	.	.	5.28	0.983	0.19767	.	0.424643	0.25352	N	0.031289	T	0.25644	0.0624	L	0.31420	0.93	0.09310	N	1	B	0.12630	0.006	B	0.13407	0.009	T	0.20338	-1.0278	9	0.16420	T	0.52	-0.6034	9.0297	0.36252	0.0:0.2588:0.477:0.2643	.	218	Q96CS2	HAUS1_HUMAN	L	218	.	ENSP00000282058:V218L	V	+	1	0	HAUS1	41957314	0.999000	0.42202	0.023000	0.16930	0.286000	0.27126	1.331000	0.33793	0.258000	0.21686	0.563000	0.77884	GTA	.	.		0.333	HAUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255885.1	NM_138443	
HMSD	284293	hgsc.bcm.edu	37	18	61627540	61627540	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr18:61627540A>G	ENST00000408945.3	+	4	573	c.371A>G	c.(370-372)aAt>aGt	p.N124S	HMSD_ENST00000481726.1_Intron	NM_001123366.1	NP_001116838.1	A8MTL9	HMSD_HUMAN	histocompatibility (minor) serpin domain containing	124						extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(2)|lung(2)|stomach(1)	6						TATTTCGATAATATTTTAAAC	0.294																																					p.N124S		Atlas-SNP	.											.	HMSD	16	.	0			c.A371G						.						40.0	38.0	38.0					18																	61627540		1567	3580	5147	SO:0001583	missense	284293	exon4			TCGATAATATTTT	AC009802	CCDS42441.1	18q21.33	2008-02-04			ENSG00000221887	ENSG00000221887			23037	protein-coding gene	gene with protein product		612086		C18orf53		17409267	Standard	NM_001123366		Approved	ACC-6	uc010dqj.3	A8MTL9	OTTHUMG00000060593	ENST00000408945.3:c.371A>G	chr18.hg19:g.61627540A>G	ENSP00000386207:p.Asn124Ser	105.0	0.0		158.0	75.0	NM_001123366		Missense_Mutation	SNP	ENST00000408945.3	hg19	CCDS42441.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.150598	0.00328	.	.	ENSG00000221887	ENST00000408945	T	0.80304	-1.36	1.57	0.297	0.15762	.	.	.	.	.	T	0.52386	0.1731	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.42481	-0.9449	9	0.02654	T	1	.	3.3694	0.07215	0.7507:0.0:0.2493:0.0	.	124	A8MTL9	HMSD_HUMAN	S	124	ENSP00000386207:N124S	ENSP00000386207:N124S	N	+	2	0	HMSD	59778520	0.001000	0.12720	0.004000	0.12327	0.008000	0.06430	-0.130000	0.10498	-0.077000	0.12752	0.260000	0.18958	AAT	.	.		0.294	HMSD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134010.2	XM_209104	
BRD4	23476	hgsc.bcm.edu	37	19	15355195	15355195	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:15355195G>A	ENST00000263377.2	-	13	2649	c.2428C>T	c.(2428-2430)Ccc>Tcc	p.P810S		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	810					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGGAGCTGGGGCTCCAGGACG	0.721			T	C15orf55	lethal midline carcinoma of young people																																p.P810S		Atlas-SNP	.		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	.	BRD4	172	.	0			c.C2428T						.						13.0	17.0	16.0					19																	15355195		2193	4295	6488	SO:0001583	missense	23476	exon13			GCTGGGGCTCCAG	Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.2428C>T	chr19.hg19:g.15355195G>A	ENSP00000263377:p.Pro810Ser	56.0	0.0		75.0	28.0	NM_058243	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	ENST00000263377.2	hg19	CCDS12328.1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753235	0.31046	.	.	ENSG00000141867	ENST00000263377	T	0.28069	1.63	4.43	4.43	0.53597	.	0.111296	0.39687	N	0.001286	T	0.16981	0.0408	N	0.08118	0	0.80722	D	1	B	0.17038	0.02	B	0.17433	0.018	T	0.06445	-1.0826	10	0.26408	T	0.33	-12.9085	13.977	0.64279	0.0:0.0:1.0:0.0	.	810	O60885	BRD4_HUMAN	S	810	ENSP00000263377:P810S	ENSP00000263377:P810S	P	-	1	0	BRD4	15216195	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.677000	0.46892	2.020000	0.59435	0.561000	0.74099	CCC	.	.		0.721	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465800.3	NM_058243	
ZNF506	440515	hgsc.bcm.edu	37	19	19905366	19905366	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:19905366T>C	ENST00000540806.2	-	4	1418	c.1330A>G	c.(1330-1332)Aga>Gga	p.R444G	CTC-559E9.6_ENST00000591884.1_RNA|CTC-559E9.6_ENST00000589657.1_RNA|ZNF506_ENST00000450683.2_Missense_Mutation_p.R412G|ZNF506_ENST00000587461.1_Intron|CTC-559E9.4_ENST00000590274.1_lincRNA|ZNF506_ENST00000443905.2_Missense_Mutation_p.R444G			Q5JVG8	ZN506_HUMAN	zinc finger protein 506	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(7)|lung(3)|skin(1)|stomach(1)	14						ATGAATTATCTTATGCTTATT	0.338																																					p.R444G		Atlas-SNP	.											.	ZNF506	36	.	0			c.A1330G						.						57.0	62.0	60.0					19																	19905366		2089	4248	6337	SO:0001583	missense	440515	exon4			ATTATCTTATGCT	AK095575	CCDS42531.1, CCDS46027.1	19p13.11	2013-01-08				ENSG00000081665		"""Zinc fingers, C2H2-type"", ""-"""	23780	protein-coding gene	gene with protein product							Standard	NM_001099269		Approved	DKFZp761G1812	uc010eci.2	Q5JVG8		ENST00000540806.2:c.1330A>G	chr19.hg19:g.19905366T>C	ENSP00000440625:p.Arg444Gly	80.0	0.0		87.0	25.0	NM_001099269	B3KTH6	Missense_Mutation	SNP	ENST00000540806.2	hg19	CCDS42531.1	.	.	.	.	.	.	.	.	.	.	t	9.845	1.192068	0.21954	.	.	ENSG00000081665	ENST00000443905;ENST00000540806;ENST00000450683	T;T;T	0.06371	3.38;3.38;3.31	1.01	1.01	0.19927	.	.	.	.	.	T	0.02571	0.0078	N	0.08118	0	0.22531	N	0.999018	B;P	0.44344	0.198;0.833	B;B	0.32022	0.007;0.139	T	0.43637	-0.9379	9	0.87932	D	0	.	5.7935	0.18373	0.0:0.0:0.0:1.0	.	444;412	Q5JVG8;Q5JVG8-2	ZN506_HUMAN;.	G	444;444;412	ENSP00000393835:R444G;ENSP00000440625:R444G;ENSP00000408892:R412G	ENSP00000393835:R444G	R	-	1	2	ZNF506	19766366	0.000000	0.05858	0.269000	0.24586	0.236000	0.25371	-0.621000	0.05559	0.363000	0.24346	0.352000	0.21897	AGA	.	.		0.338	ZNF506-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460794.1	XM_036218	
ZNF714	148206	hgsc.bcm.edu	37	19	21300669	21300669	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:21300669A>T	ENST00000596143.1	+	5	1524	c.1199A>T	c.(1198-1200)gAa>gTa	p.E400V	ZNF714_ENST00000596053.1_Intron|ZNF714_ENST00000291770.7_3'UTR|ZNF714_ENST00000601416.1_3'UTR	NM_182515.3	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	400					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|urinary_tract(2)	18						AAATGTGAAGAATGTGGCAAA	0.353																																					p.E400V		Atlas-SNP	.											.	ZNF714	121	.	0			c.A1199T						.						36.0	39.0	38.0					19																	21300669		2154	4272	6426	SO:0001583	missense	148206	exon5			GTGAAGAATGTGG	AK056006	CCDS54239.1	19p12	2013-01-08				ENSG00000160352		"""Zinc fingers, C2H2-type"""	27124	protein-coding gene	gene with protein product						12477932	Standard	NM_182515		Approved		uc002npo.4	Q96N38		ENST00000596143.1:c.1199A>T	chr19.hg19:g.21300669A>T	ENSP00000472368:p.Glu400Val	48.0	0.0		58.0	16.0	NM_182515	Q49AI1|Q86W65|Q8ND40	Missense_Mutation	SNP	ENST00000596143.1	hg19	CCDS54239.1	.	.	.	.	.	.	.	.	.	.	.	6.544	0.468560	0.12461	.	.	ENSG00000160352	ENST00000343332;ENST00000291770	.	.	.	1.05	1.05	0.20165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32346	0.0826	N	0.10618	0.005	0.09310	N	1	B;D;B	0.55800	0.144;0.973;0.073	B;D;B	0.62955	0.206;0.909;0.089	T	0.16012	-1.0417	8	0.59425	D	0.04	.	7.01	0.24857	1.0:0.0:0.0:0.0	.	401;400;401	Q96N38-2;A6NEM4;Q96N38	.;.;ZN714_HUMAN	V	400	.	ENSP00000291770:E400V	E	+	2	0	ZNF714	21092509	0.012000	0.17670	0.802000	0.32245	0.779000	0.44077	1.171000	0.31896	0.389000	0.25086	0.379000	0.24179	GAA	.	.		0.353	ZNF714-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463930.1	NM_182515	
CEACAM16	388551	hgsc.bcm.edu	37	19	45209000	45209000	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:45209000G>C	ENST00000405314.2	+	4	899	c.802G>C	c.(802-804)Ggg>Cgg	p.G268R	CTB-171A8.1_ENST00000590796.1_RNA|CEACAM16_ENST00000587331.1_Missense_Mutation_p.G268R			Q2WEN9	CEA16_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 16	268	Ig-like C2-type 2.				sensory perception of sound (GO:0007605)	extracellular region (GO:0005576)|stereocilium bundle tip (GO:0032426)				endometrium(3)|large_intestine(2)|lung(3)|ovary(1)	9	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)				GACCTTCAACGGGCAGGCCCT	0.582																																					p.G268R		Atlas-SNP	.											.	CEACAM16	56	.	0			c.G802C						.						91.0	101.0	98.0					19																	45209000		2122	4240	6362	SO:0001583	missense	388551	exon5			TTCAACGGGCAGG		CCDS54278.1	19q13.31	2014-01-27			ENSG00000213892	ENSG00000213892		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31948	protein-coding gene	gene with protein product		614591				21368133	Standard	NM_001039213		Approved	DFNA4B	uc010xxd.2	Q2WEN9	OTTHUMG00000151519	ENST00000405314.2:c.802G>C	chr19.hg19:g.45209000G>C	ENSP00000385576:p.Gly268Arg	119.0	0.0		171.0	57.0	NM_001039213	A7LI12	Missense_Mutation	SNP	ENST00000405314.2	hg19	CCDS54278.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061686	0.76187	.	.	ENSG00000213892	ENST00000396750;ENST00000405314	T	0.55588	0.51	5.21	5.21	0.72293	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.31760	U	0.007107	T	0.74053	0.3666	M	0.83312	2.635	0.37763	D	0.926391	D	0.89917	1.0	D	0.85130	0.997	T	0.80677	-0.1276	10	0.87932	D	0	-33.0405	14.3179	0.66465	0.0:0.0:1.0:0.0	.	327	Q2WEN9	CEA16_HUMAN	R	333;268	ENSP00000385576:G268R	ENSP00000379974:G333R	G	+	1	0	CEACAM16	49900840	1.000000	0.71417	0.997000	0.53966	0.900000	0.52787	4.752000	0.62176	2.436000	0.82500	0.555000	0.69702	GGG	.	.		0.582	CEACAM16-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding		XM_371177	
TPRX1	284355	hgsc.bcm.edu	37	19	48305519	48305519	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:48305519A>G	ENST00000322175.3	-	2	904	c.749T>C	c.(748-750)cTg>cCg	p.L250P	TPRX1_ENST00000543508.1_Missense_Mutation_p.L240P|TPRX1_ENST00000535759.1_Missense_Mutation_p.L347P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	250	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		gcctgggatcaggcctgggtt	0.672																																					p.L250P	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-SNP	.											.	TPRX1	46	.	0			c.T749C						.																																			SO:0001583	missense	284355	exon2			GGGATCAGGCCTG		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.749T>C	chr19.hg19:g.48305519A>G	ENSP00000323455:p.Leu250Pro	54.0	0.0		93.0	7.0	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	hg19	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	a	0.003	-2.494356	0.00159	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.91237	-1.66;-2.81	0.557	-1.11	0.09840	.	.	.	.	.	T	0.69815	0.3153	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49551	-0.8928	8	0.08179	T	0.78	.	.	.	.	.	250	Q8N7U7	TPRX1_HUMAN	P	250;347;240	ENSP00000323455:L250P;ENSP00000438832:L347P	ENSP00000323455:L250P	L	-	2	0	TPRX1	52997331	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.179000	0.00569	-3.493000	0.00153	-3.917000	0.00016	CTG	.	.		0.672	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
TPRX1	284355	hgsc.bcm.edu	37	19	48305570	48305570	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:48305570C>A	ENST00000322175.3	-	2	853	c.698G>T	c.(697-699)gGc>gTc	p.G233V	TPRX1_ENST00000543508.1_Missense_Mutation_p.G223V|TPRX1_ENST00000535759.1_Missense_Mutation_p.G330V	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	233	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		tgggttcgggcctgagattgg	0.652																																					p.G233V	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-SNP	.											.	TPRX1	46	.	0			c.G698T						.						10.0	8.0	9.0					19																	48305570		2038	4017	6055	SO:0001583	missense	284355	exon2			TTCGGGCCTGAGA		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.698G>T	chr19.hg19:g.48305570C>A	ENSP00000323455:p.Gly233Val	70.0	0.0		75.0	6.0	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	hg19	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	c	0.438	-0.900130	0.02472	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	D;D	0.91894	-1.78;-2.93	0.401	-0.802	0.10889	.	.	.	.	.	T	0.80412	0.4618	N	0.14661	0.345	0.09310	N	1	B	0.19817	0.039	B	0.11329	0.006	T	0.64236	-0.6455	8	0.26408	T	0.33	.	.	.	.	.	233	Q8N7U7	TPRX1_HUMAN	V	233;330;223	ENSP00000323455:G233V;ENSP00000438832:G330V	ENSP00000323455:G233V	G	-	2	0	TPRX1	52997382	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-1.696000	0.01912	-0.668000	0.05296	-0.694000	0.03704	GGC	.	.		0.652	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
MYH14	79784	hgsc.bcm.edu	37	19	50766619	50766619	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:50766619G>T	ENST00000596571.1	+	19	2513	c.2513G>T	c.(2512-2514)cGg>cTg	p.R838L	MYH14_ENST00000262269.8_Missense_Mutation_p.R879L|MYH14_ENST00000598205.1_Missense_Mutation_p.R846L|MYH14_ENST00000425460.1_Missense_Mutation_p.R846L|MYH14_ENST00000376970.2_Missense_Mutation_p.R871L|MYH14_ENST00000601313.1_Missense_Mutation_p.R879L|MYH14_ENST00000440075.2_Missense_Mutation_p.R879L			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	838					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		GTGATGCAGCGGAACTGCGCG	0.657																																					p.R879L		Atlas-SNP	.											.	MYH14	261	.	0			c.G2636T						.						20.0	24.0	22.0					19																	50766619		2189	4294	6483	SO:0001583	missense	79784	exon22			TGCAGCGGAACTG	AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.2513G>T	chr19.hg19:g.50766619G>T	ENSP00000472819:p.Arg838Leu	99.0	0.0		117.0	44.0	NM_001145809	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	ENST00000596571.1	hg19	CCDS59411.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.059632	0.76074	.	.	ENSG00000105357	ENST00000301415;ENST00000440075;ENST00000376970;ENST00000425460;ENST00000376965;ENST00000262269	T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66	3.43	3.43	0.39272	.	.	.	.	.	D	0.86142	0.5862	H	0.95950	3.745	0.58432	D	0.999998	D;P;D	0.61697	0.99;0.954;0.973	P;P;P	0.61003	0.882;0.64;0.803	D	0.88474	0.3064	9	0.39692	T	0.17	.	12.7358	0.57222	0.0:0.0:1.0:0.0	.	879;838;846	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	L	838;879;871;846;838;879	ENSP00000406273:R879L;ENSP00000366169:R871L;ENSP00000407879:R846L;ENSP00000262269:R879L	ENSP00000262269:R879L	R	+	2	0	MYH14	55458431	1.000000	0.71417	0.993000	0.49108	0.696000	0.40369	9.440000	0.97547	1.924000	0.55735	0.313000	0.20887	CGG	.	.		0.657	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464710.2	NM_024729	
KLK7	5650	hgsc.bcm.edu	37	19	51485634	51485634	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:51485634G>T	ENST00000391807.1	-	2	123	c.22C>A	c.(22-24)Ccc>Acc	p.P8T	KLK7_ENST00000595638.1_5'UTR|KLK7_ENST00000597707.1_Intron|KLK7_ENST00000595820.1_Missense_Mutation_p.P8T|CTB-147C22.9_ENST00000594512.1_RNA|KLK7_ENST00000336317.4_5'UTR	NM_139277.2	NP_644806.1	P49862	KLK7_HUMAN	kallikrein-related peptidase 7	8					epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	epidermal lamellar body (GO:0097209)|extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(2)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00382)|GBM - Glioblastoma multiforme(134;0.00895)		ATCTGCAGGGGCAGGAGAAGG	0.587																																					p.A50D		Atlas-SNP	.											.	KLK7	40	.	0			c.C149A						.						55.0	42.0	47.0					19																	51485634		2203	4297	6500	SO:0001583	missense	5650	exon2			GCAGGGGCAGGAG	L33404	CCDS12812.1, CCDS59414.1	19q13.33	2011-09-07	2006-10-27			ENSG00000169035		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6368	protein-coding gene	gene with protein product		604438	"""kallikrein 7 (chymotryptic, stratum corneum)"""	PRSS6		8034709, 16800724, 16800723	Standard	NM_005046		Approved	SCCE	uc021uyj.1	P49862		ENST00000391807.1:c.22C>A	chr19.hg19:g.51485634G>T	ENSP00000375683:p.Pro8Thr	42.0	0.0		61.0	16.0	NM_001243126	A8K0U5|Q8N5N9|Q8NFV7	Missense_Mutation	SNP	ENST00000391807.1	hg19	CCDS12812.1	.	.	.	.	.	.	.	.	.	.	g	9.416	1.081784	0.20309	.	.	ENSG00000169035	ENST00000304045;ENST00000391807	D	0.87650	-2.28	3.43	-4.3	0.03710	.	.	.	.	.	T	0.66346	0.2780	N	0.08118	0	0.21445	N	0.999681	B	0.06786	0.001	B	0.08055	0.003	T	0.53472	-0.8434	9	0.17832	T	0.49	.	3.8095	0.08791	0.1027:0.4442:0.3011:0.1519	.	8	P49862	KLK7_HUMAN	T	8	ENSP00000375683:P8T	ENSP00000304791:P8T	P	-	1	0	KLK7	56177446	0.000000	0.05858	0.000000	0.03702	0.320000	0.28249	-2.201000	0.01236	-0.815000	0.04346	-0.163000	0.13421	CCC	.	.		0.587	KLK7-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464344.1	NM_005046	
NLRP12	91662	hgsc.bcm.edu	37	19	54314495	54314495	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr19:54314495T>A	ENST00000324134.6	-	3	586	c.418A>T	c.(418-420)Atg>Ttg	p.M140L	NLRP12_ENST00000354278.3_Missense_Mutation_p.M140L|NLRP12_ENST00000391775.3_Missense_Mutation_p.M140L|NLRP12_ENST00000535162.1_Missense_Mutation_p.M140L|NLRP12_ENST00000345770.5_Missense_Mutation_p.M140L|NLRP12_ENST00000351894.4_Missense_Mutation_p.M140L|NLRP12_ENST00000391773.1_Missense_Mutation_p.M140L|NLRP12_ENST00000391772.1_Missense_Mutation_p.M140L	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	140					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CGGTCTTCCATGAGCCGGAAT	0.557																																					p.R140C		Atlas-SNP	.											.	NLRP12	236	.	0			c.C418T						.						90.0	88.0	89.0					19																	54314495		2203	4300	6503	SO:0001583	missense	91662	exon3			CTTCCATGAGCCG	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.418A>T	chr19.hg19:g.54314495T>A	ENSP00000319377:p.Met140Leu	86.0	0.0		98.0	31.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Missense_Mutation	SNP	ENST00000324134.6	hg19	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	T	10.79	1.448917	0.26074	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	D;D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	4.47	3.37	0.38596	.	0.125142	0.36555	N	0.002522	T	0.80160	0.4572	M	0.71581	2.175	0.58432	D	0.999997	B;B;B;B	0.24533	0.085;0.085;0.085;0.105	B;B;B;B	0.15870	0.006;0.01;0.01;0.014	T	0.77568	-0.2539	10	0.48119	T	0.1	.	4.9088	0.13811	0.1835:0.0:0.1902:0.6263	.	140;140;140;140	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	L	140	ENSP00000319377:M140L;ENSP00000438030:M140L;ENSP00000340473:M140L;ENSP00000346231:M140L;ENSP00000375655:M140L;ENSP00000375653:M140L;ENSP00000375652:M140L	ENSP00000319377:M140L	M	-	1	0	NLRP12	59006307	0.001000	0.12720	0.996000	0.52242	0.919000	0.55068	0.047000	0.14056	1.808000	0.52836	0.254000	0.18369	ATG	.	.		0.557	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
SLC52A3	113278	hgsc.bcm.edu	37	20	746252	746252	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr20:746252A>C	ENST00000217254.7	-	2	408	c.167T>G	c.(166-168)cTc>cGc	p.L56R	SLC52A3_ENST00000473664.1_5'UTR|SLC52A3_ENST00000381944.3_Missense_Mutation_p.L56R	NM_033409.3	NP_212134.3	Q9NQ40	S52A3_HUMAN	solute carrier family 52 (riboflavin transporter), member 3	56					cellular response to heat (GO:0034605)|riboflavin metabolic process (GO:0006771)|riboflavin transport (GO:0032218)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	riboflavin transporter activity (GO:0032217)										GGTGACCAGGAGGGGCCCGAT	0.632																																					p.L56R		Atlas-SNP	.											.	.	.	.	0			c.T167G						.						40.0	35.0	37.0					20																	746252		2199	4299	6498	SO:0001583	missense	113278	exon2			ACCAGGAGGGGCC	AL118502	CCDS13007.1	20p13	2013-07-17	2013-07-17	2012-02-29	ENSG00000101276	ENSG00000101276		"""Solute carriers"""	16187	protein-coding gene	gene with protein product	"""hypothetical protein LOC113278"""	613350	"""chromosome 20 open reading frame 54"""	C20orf54		11780052, 19122205	Standard	NM_033409		Approved	bA371L19.1, hRFT2, RFVT3	uc002wed.4	Q9NQ40	OTTHUMG00000031647	ENST00000217254.7:c.167T>G	chr20.hg19:g.746252A>C	ENSP00000217254:p.Leu56Arg	83.0	0.0		211.0	134.0	NM_033409	A8K6P1|Q5W1A0|Q5W1A1|Q8NCL7|Q96GD5	Missense_Mutation	SNP	ENST00000217254.7	hg19	CCDS13007.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.737964	0.89573	.	.	ENSG00000101276	ENST00000217254;ENST00000381944	T;T	0.79352	-1.26;-1.26	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.89276	0.6669	M	0.87456	2.885	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	D	0.91048	0.4876	10	0.87932	D	0	-23.016	14.9652	0.71184	1.0:0.0:0.0:0.0	.	56;56	Q9NQ40-2;Q9NQ40	.;RFT2_HUMAN	R	56	ENSP00000217254:L56R;ENSP00000371370:L56R	ENSP00000217254:L56R	L	-	2	0	C20orf54	694252	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.267000	0.95665	2.218000	0.71995	0.533000	0.62120	CTC	.	.		0.632	SLC52A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077482.2	NM_033409	
NKX2-4	644524	hgsc.bcm.edu	37	20	21377078	21377078	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr20:21377078A>C	ENST00000351817.4	-	2	1164	c.536T>G	c.(535-537)cTg>cGg	p.L179R	RP11-227D2.3_ENST00000552439.1_RNA|RP11-227D2.3_ENST00000419666.2_RNA	NM_033176.1	NP_149416.1	Q9H2Z4	NKX24_HUMAN	NK2 homeobox 4	179					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|upper_aerodigestive_tract(1)	3						CGCCGCGTGCAGCGGGCCCAG	0.721																																					p.L179R		Atlas-SNP	.											.	NKX2-4	7	.	0			c.T536G						.						2.0	3.0	3.0					20																	21377078		1708	3550	5258	SO:0001583	missense	644524	exon2			GCGTGCAGCGGGC		CCDS42855.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125816	ENSG00000125816		"""Homeoboxes / ANTP class : NKL subclass"""	7837	protein-coding gene	gene with protein product		607808	"""NK-2 (Drosophila) homolog D"", ""NK2 transcription factor related, locus 4 (Drosophila)"""	NKX2D		1346742, 10818213	Standard	NM_033176		Approved	NKX2.4	uc010gcz.3	Q9H2Z4	OTTHUMG00000032022	ENST00000351817.4:c.536T>G	chr20.hg19:g.21377078A>C	ENSP00000345147:p.Leu179Arg	38.0	0.0		78.0	39.0	NM_033176	Q5VZV8	Missense_Mutation	SNP	ENST00000351817.4	hg19	CCDS42855.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.581905	0.28180	.	.	ENSG00000125816	ENST00000351817	D	0.92249	-3.0	3.41	2.25	0.28309	Homeodomain-like (1);	0.000000	0.48286	U	0.000194	D	0.92828	0.7719	M	0.64170	1.965	0.43355	D	0.995426	D	0.65815	0.995	D	0.66602	0.945	D	0.88518	0.3094	10	0.13853	T	0.58	.	8.6391	0.33966	0.8055:0.1944:0.0:0.0	.	179	Q9H2Z4	NKX24_HUMAN	R	179	ENSP00000345147:L179R	ENSP00000345147:L179R	L	-	2	0	NKX2-4	21325078	0.997000	0.39634	0.385000	0.26158	0.216000	0.24613	5.550000	0.67268	0.195000	0.20347	0.341000	0.21757	CTG	.	.		0.721	NKX2-4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078270.2		
COX4I2	84701	hgsc.bcm.edu	37	20	30227900	30227900	+	Splice_Site	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr20:30227900T>A	ENST00000376075.3	+	3	322	c.247T>A	c.(247-249)Ttg>Atg	p.L83M	COX4I2_ENST00000490030.1_3'UTR	NM_032609.2	NP_115998.2	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2 (lung)	83					cellular respiration (GO:0045333)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)	mitochondrial respiratory chain complex IV (GO:0005751)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	11	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			AAAGGTGGCCTGTAAGTGTCA	0.597																																					p.L83M		Atlas-SNP	.											.	COX4I2	18	.	0			c.T247A						.						29.0	21.0	24.0					20																	30227900		2203	4299	6502	SO:0001630	splice_region_variant	84701	exon3			GTGGCCTGTAAGT	AF257180	CCDS13187.1	20q11.21	2011-07-04	2004-08-11		ENSG00000131055	ENSG00000131055		"""Mitochondrial respiratory chain complex / Complex IV"""	16232	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit IV-like 2"""	607976	"""cytochrome c oxidase subunit IV isoform 2"""	COX4L2		11311561, 17937768	Standard	NM_032609		Approved	COXIV-2, COX4B, dJ857M17.2, COX4-2	uc002wwj.1	Q96KJ9	OTTHUMG00000032180	ENST00000376075.3:c.247+1T>A	chr20.hg19:g.30227900T>A		873.0	0.0		1684.0	344.0	NM_032609	Q6GTF4|Q9H0Z4	Missense_Mutation	SNP	ENST00000376075.3	hg19	CCDS13187.1	.	.	.	.	.	.	.	.	.	.	T	11.48	1.651643	0.29336	.	.	ENSG00000131055	ENST00000376075	T	0.63096	-0.02	4.74	-3.43	0.04810	.	0.090669	0.43260	D	0.000595	T	0.76090	0.3939	M	0.89658	3.05	0.42482	D	0.992862	D	0.76494	0.999	D	0.77557	0.99	T	0.73678	-0.3907	10	0.72032	D	0.01	-7.9709	7.1919	0.25831	0.0:0.4269:0.1298:0.4433	.	83	Q96KJ9	COX42_HUMAN	M	83	ENSP00000365243:L83M	ENSP00000365243:L83M	L	+	1	2	COX4I2	29691561	0.854000	0.29725	0.955000	0.39395	0.009000	0.06853	-0.276000	0.08514	-0.955000	0.03636	-2.547000	0.00178	TTG	.	.		0.597	COX4I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078548.1	NM_032609	Missense_Mutation
TOP1	7150	hgsc.bcm.edu	37	20	39709835	39709835	+	Silent	SNP	A	A	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr20:39709835A>G	ENST00000361337.2	+	7	712	c.462A>G	c.(460-462)acA>acG	p.T154T		NM_003286.2	NP_003277.1	P11387	TOP1_HUMAN	topoisomerase (DNA) I	154	Lys-rich.				chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|DNA topological change (GO:0006265)|embryonic cleavage (GO:0040016)|phosphorylation (GO:0016310)|programmed cell death (GO:0012501)|response to drug (GO:0042493)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|replication fork protection complex (GO:0031298)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|poly(A) RNA binding (GO:0044822)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(115;0.00878)			Irinotecan(DB00762)|Lucanthone(DB04967)|Sodium stibogluconate(DB05630)|Topotecan(DB01030)	AAATTAAAACAGAAGATACCA	0.368			T	NUP98	AML*																																p.T154T		Atlas-SNP	.		Dom	yes		20	20q12-q13.1	7150	topoisomerase (DNA) I		L	.	TOP1	71	.	0			c.A462G						.						79.0	84.0	82.0					20																	39709835		2203	4300	6503	SO:0001819	synonymous_variant	7150	exon7			TAAAACAGAAGAT		CCDS13312.1	20q12-q13.1	1990-06-22			ENSG00000198900	ENSG00000198900	5.99.1.2		11986	protein-coding gene	gene with protein product		126420					Standard	NM_003286		Approved		uc010ggd.1	P11387	OTTHUMG00000033057	ENST00000361337.2:c.462A>G	chr20.hg19:g.39709835A>G		175.0	0.0		498.0	84.0	NM_003286	A8KA78|E1P5W3|O43256|Q12855|Q12856|Q15610|Q5TFY3|Q9UJN0	Silent	SNP	ENST00000361337.2	hg19	CCDS13312.1																																																																																			.	.		0.368	TOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080397.2		
SYCP2	10388	hgsc.bcm.edu	37	20	58468254	58468254	+	Splice_Site	SNP	C	C	G			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr20:58468254C>G	ENST00000357552.3	-	22	1961	c.1736G>C	c.(1735-1737)aGt>aCt	p.S579T	SYCP2_ENST00000371001.2_Splice_Site_p.S579T			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	579					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTGGAGTTCACCtaaataaaa	0.328																																					p.S579T		Atlas-SNP	.											.	SYCP2	204	.	0			c.G1736C						.						73.0	68.0	70.0					20																	58468254		2201	4295	6496	SO:0001630	splice_region_variant	10388	exon21			AGTTCACCTAAAT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1736-1G>C	chr20.hg19:g.58468254C>G		43.0	0.0		91.0	5.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Missense_Mutation	SNP	ENST00000357552.3	hg19	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	C	11.41	1.630458	0.28978	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	T;T;T	0.17528	2.53;2.53;2.27	5.77	-4.28	0.03732	.	0.655321	0.15182	N	0.276047	T	0.09423	0.0232	L	0.29908	0.895	0.09310	N	1	B	0.18310	0.027	B	0.13407	0.009	T	0.18272	-1.0342	10	0.35671	T	0.21	.	7.3728	0.26810	0.1247:0.4707:0.0:0.4046	.	579	Q9BX26	SYCP2_HUMAN	T	579	ENSP00000360040:S579T;ENSP00000350162:S579T;ENSP00000402456:S579T	ENSP00000350162:S579T	S	-	2	0	SYCP2	57901649	0.928000	0.31464	0.019000	0.16419	0.801000	0.45260	-0.058000	0.11750	-1.024000	0.03338	-0.324000	0.08512	AGT	.	.		0.328	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	Missense_Mutation
BAGE2	85319	hgsc.bcm.edu	37	21	11058295	11058295	+	RNA	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr21:11058295G>T	ENST00000470054.1	-	0	352							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTGATAGTGGCTCCAAAGTG	0.408																																					p.P49T		Atlas-SNP	.											.	.	.	.	0			c.C145A						.						132.0	98.0	109.0					21																	11058295		692	1591	2283			85318	exon3			ATAGTGGCTCCAA	AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		chr21.hg19:g.11058295G>T		281.0	0.0		334.0	18.0	NM_182481	A8K925|Q08ER0	Missense_Mutation	SNP	ENST00000470054.1	hg19																																																																																				.	.		0.408	BAGE2-001	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000157417.3	NM_182482	
TMPRSS15	5651	hgsc.bcm.edu	37	21	19666622	19666622	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr21:19666622A>T	ENST00000284885.3	-	21	2484	c.2451T>A	c.(2449-2451)agT>agA	p.S817R		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	817	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						CCAGCCAGTCACTGCTGACGA	0.582																																					p.S817R		Atlas-SNP	.											.	TMPRSS15	189	.	0			c.T2451A						.						70.0	71.0	71.0					21																	19666622		2203	4300	6503	SO:0001583	missense	5651	exon21			CCAGTCACTGCTG		CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2451T>A	chr21.hg19:g.19666622A>T	ENSP00000284885:p.Ser817Arg	75.0	0.0		85.0	31.0	NM_002772	Q2NKL7	Missense_Mutation	SNP	ENST00000284885.3	hg19	CCDS13571.1	.	.	.	.	.	.	.	.	.	.	A	6.139	0.393914	0.11638	.	.	ENSG00000154646	ENST00000284885	D	0.93019	-3.15	5.79	-11.6	0.00059	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.061660	0.07143	N	0.847745	D	0.82953	0.5149	L	0.39326	1.205	0.20196	N	0.999924	B	0.06786	0.001	B	0.10450	0.005	T	0.66650	-0.5870	9	.	.	.	.	0.3432	0.00337	0.232:0.255:0.193:0.3199	.	817	P98073	ENTK_HUMAN	R	817	ENSP00000284885:S817R	.	S	-	3	2	TMPRSS15	18588493	0.000000	0.05858	0.001000	0.08648	0.905000	0.53344	-2.453000	0.01005	-2.252000	0.00699	-0.332000	0.08345	AGT	.	.		0.582	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158231.2	NM_002772	
SMARCB1	6598	hgsc.bcm.edu	37	22	24135767	24135767	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr22:24135767C>A	ENST00000263121.7	+	3	450	c.254C>A	c.(253-255)gCc>gAc	p.A85D	SMARCB1_ENST00000407422.3_Missense_Mutation_p.A76D|SMARCB1_ENST00000407082.3_Missense_Mutation_p.A85D|SMARCB1_ENST00000344921.6_Missense_Mutation_p.A76D	NM_003073.3	NP_003064.2	Q12824	SNF5_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	85					ATP-dependent chromatin remodeling (GO:0043044)|blastocyst hatching (GO:0001835)|cell differentiation (GO:0030154)|chromatin remodeling (GO:0006338)|DNA integration (GO:0015074)|DNA repair (GO:0006281)|mitotic cell cycle phase transition (GO:0044772)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|single stranded viral RNA replication via double stranded DNA intermediate (GO:0039692)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	p53 binding (GO:0002039)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)	p.?(2)		bone(4)|central_nervous_system(198)|endometrium(4)|haematopoietic_and_lymphoid_tissue(25)|kidney(3)|large_intestine(5)|liver(2)|lung(5)|meninges(5)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|soft_tissue(194)	458		Medulloblastoma(6;2.2e-09)|all_neural(6;2.73e-05)				ACGACTCTAGCCACCAGTGTG	0.547			"""D, N, F, S"""		malignant rhabdoid	malignant rhabdoid																															p.A85D		Atlas-SNP	.	yes	Rec	yes	Rhabdoid predisposition syndrome	22	22q11	6598	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1"""		M	.	SMARCB1	586	.	2	Unknown(2)	soft_tissue(2)	c.C254A						.						186.0	165.0	172.0					22																	24135767		2203	4300	6503	SO:0001583	missense	6598	exon3			CTCTAGCCACCAG	U04847	CCDS13817.1, CCDS46671.1	22q11.23	2014-09-17			ENSG00000099956	ENSG00000099956			11103	protein-coding gene	gene with protein product	"""sucrose nonfermenting, yeast, homolog-like 1"", ""integrase interactor 1"", ""malignant rhabdoid tumor suppressor"", ""protein phosphatase 1, regulatory subunit 144"""	601607		SNF5L1		7801128, 10319872, 10365963	Standard	NM_003073		Approved	BAF47, Ini1, Snr1, hSNFS, Sfh1p, RDT, PPP1R144	uc002zyb.3	Q12824	OTTHUMG00000150737	ENST00000263121.7:c.254C>A	chr22.hg19:g.24135767C>A	ENSP00000263121:p.Ala85Asp	87.0	0.0		73.0	38.0	NM_003073	O75784|O95474|Q17S11|Q38GA1|Q76N08|Q9UBH2	Missense_Mutation	SNP	ENST00000263121.7	hg19	CCDS13817.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.030608	0.75504	.	.	ENSG00000099956	ENST00000417137;ENST00000344921;ENST00000263121;ENST00000407422;ENST00000407082	D;D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25;-3.25	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.96349	0.8809	M	0.67953	2.075	0.80722	D	1	D;D;P;P;B;B;D	0.89917	1.0;0.997;0.946;0.454;0.148;0.399;0.999	D;D;P;B;B;B;D	0.91635	0.999;0.933;0.809;0.36;0.147;0.147;0.991	D	0.95811	0.8841	10	0.54805	T	0.06	-35.2187	19.2602	0.93964	0.0:1.0:0.0:0.0	.	76;85;35;76;76;85;85	B4E117;B4DRT1;Q86WI7;G5E975;Q17S11;Q12824;C9JTA6	.;.;.;.;.;SNF5_HUMAN;.	D	85;76;85;76;85	ENSP00000388489:A85D;ENSP00000340883:A76D;ENSP00000263121:A85D;ENSP00000383984:A76D;ENSP00000385226:A85D	ENSP00000263121:A85D	A	+	2	0	SMARCB1	22465767	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	7.729000	0.84864	2.875000	0.98604	0.644000	0.83932	GCC	.	.		0.547	SMARCB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319872.1	NM_003073	
NF2	4771	hgsc.bcm.edu	37	22	30035159	30035160	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr22:30035159_30035160GG>TT	ENST00000338641.4	+	3	762_763	c.321_322GG>TT	c.(319-324)gaGGag>gaTTag	p.107_108EE>D*	NF2_ENST00000403999.3_Nonsense_Mutation_p.107_108EE>D*|NF2_ENST00000397789.3_Nonsense_Mutation_p.107_108EE>D*|NF2_ENST00000361452.4_Intron|NF2_ENST00000413209.2_Nonsense_Mutation_p.107_108EE>D*|NF2_ENST00000361166.4_Nonsense_Mutation_p.107_108EE>D*|NF2_ENST00000353887.4_Intron|NF2_ENST00000361676.4_Nonsense_Mutation_p.65_66EE>D*|NF2_ENST00000334961.7_Intron|NF2_ENST00000403435.1_Nonsense_Mutation_p.107_108EE>D*|NF2_ENST00000347330.5_Intron	NM_000268.3|NM_016418.5|NM_181832.2	NP_000259.1|NP_057502.2|NP_861970.1	P35240	MERL_HUMAN	neurofibromin 2 (merlin)	107	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton organization (GO:0030036)|cell-cell junction organization (GO:0045216)|ectoderm development (GO:0007398)|hippocampus development (GO:0021766)|lens fiber cell differentiation (GO:0070306)|mesoderm formation (GO:0001707)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of DNA replication (GO:0008156)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell differentiation (GO:0045597)|positive regulation of stress fiber assembly (GO:0051496)|regulation of hippo signaling (GO:0035330)|regulation of neural precursor cell proliferation (GO:2000177)|regulation of protein localization to nucleus (GO:1900180)|regulation of protein stability (GO:0031647)|Schwann cell proliferation (GO:0014010)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|cleavage furrow (GO:0032154)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|early endosome (GO:0005769)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)		p.?(3)|p.H95fs*3(1)|p.V86_Q111>E(1)|p.A105fs*20(1)|p.L97fs*17(1)		NS(1)|bone(2)|breast(5)|central_nervous_system(21)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(17)|large_intestine(9)|liver(1)|lung(9)|meninges(372)|ovary(2)|pituitary(1)|pleura(9)|prostate(1)|skin(7)|soft_tissue(303)|stomach(2)|thyroid(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	776						ATGCTGAAGAGGAGCTGGTTCA	0.45			"""D, Mis, N, F, S, O"""		"""meningioma, acoustic neuroma, renal """	"""meningioma, acoustic neuroma"""			Neurofibromatosis, type 2																												p.E107D|p.E108X		Atlas-SNP	.	yes	Rec	yes	Neurofibromatosis type 2	22	22q12.2	4771	neurofibromatosis type 2 gene		O	.	NF2	1312	.	7	Unknown(3)|Deletion - Frameshift(3)|Complex - deletion inframe(1)	soft_tissue(3)|stomach(1)|large_intestine(1)|lung(1)|kidney(1)	c.G321T|c.G322T						.																																			SO:0001587	stop_gained	4771	exon3	Familial Cancer Database	NF2, Central Neurofibromatosis, Bilateral Acoustic Neurofibromatosis	TGAAGAGGAGCTG|GAAGAGGAGCTGG	L11353	CCDS13861.1, CCDS13862.1, CCDS13863.1, CCDS13864.1, CCDS13865.1, CCDS54516.1	22q12.2	2014-09-17	2007-12-17		ENSG00000186575	ENSG00000186575		"""A-kinase anchor proteins"""	7773	protein-coding gene	gene with protein product	"""moesin-ezrin-radixin like"", ""schwannomin"""	607379	"""neurofibromin 2 (bilateral acoustic neuroma)"""			10591208	Standard	NM_000268		Approved	merlin	uc003age.4	P35240	OTTHUMG00000030727	Exception_encountered	chr22.hg19:g.30035159_30035160delinsTT	ENSP00000344666:p.E107_E108delinsD*	81.0|79.0	0.0		80.0|77.0	47.0|46.0	NM_000268	O95683|Q8WUJ2|Q969N0|Q969Q3|Q96T30|Q96T31|Q96T32|Q96T33|Q9BTW3|Q9UNG9|Q9UNH3|Q9UNH4	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000338641.4	hg19	CCDS13861.1																																																																																			.	.		0.450	NF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075615.3	NM_000268	
WNT7B	7477	hgsc.bcm.edu	37	22	46327010	46327010	+	Missense_Mutation	SNP	T	T	A	rs200797257		TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr22:46327010T>A	ENST00000339464.4	-	3	912	c.538A>T	c.(538-540)Atg>Ttg	p.M180L	WNT7B_ENST00000409496.3_Missense_Mutation_p.M184L|WNT7B_ENST00000410058.1_Missense_Mutation_p.M180L|WNT7B_ENST00000410089.1_Missense_Mutation_p.M164L	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	180					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		TGCAGGTTCATGAGGCGCCGC	0.662																																					p.M180L		Atlas-SNP	.											.	WNT7B	45	.	0			c.A538T						.						32.0	32.0	32.0					22																	46327010		2203	4300	6503	SO:0001583	missense	7477	exon3			GGTTCATGAGGCG	AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.538A>T	chr22.hg19:g.46327010T>A	ENSP00000341032:p.Met180Leu	19.0	0.0		12.0	7.0	NM_058238	B8A596|Q96Q12	Missense_Mutation	SNP	ENST00000339464.4	hg19	CCDS33667.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.612380	0.87258	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496;ENST00000410058	T;T;T;T	0.77098	-1.07;-1.07;-1.07;-1.07	3.16	3.16	0.36331	.	0.000000	0.85682	U	0.000000	D	0.83714	0.5314	M	0.80028	2.48	0.58432	D	0.999999	P;P	0.44816	0.752;0.844	P;P	0.53518	0.519;0.728	D	0.85183	0.1005	10	0.66056	D	0.02	.	10.7516	0.46213	0.0:0.0:0.0:1.0	.	184;180	A8K0G1;P56706	.;WNT7B_HUMAN	L	180;164;184;180	ENSP00000341032:M180L;ENSP00000386781:M164L;ENSP00000386546:M184L;ENSP00000387217:M180L	ENSP00000341032:M180L	M	-	1	0	WNT7B	44705674	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	7.480000	0.81109	1.314000	0.45095	0.260000	0.18958	ATG	.	T|1.000;C|0.000		0.662	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336418.1	NM_058238	
IQSEC2	23096	hgsc.bcm.edu	37	X	53272572	53272572	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chrX:53272572T>A	ENST00000375368.5	-	8	3001	c.2801A>T	c.(2800-2802)aAc>aTc	p.N934I	IQSEC2_ENST00000396435.3_Missense_Mutation_p.N944I|IQSEC2_ENST00000375365.2_Missense_Mutation_p.N739I			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	934					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ATGGTCATCGTTGGTCCGCAG	0.597																																					p.N944I		Atlas-SNP	.											.	IQSEC2	195	.	0			c.A2831T						.						81.0	51.0	61.0					X																	53272572		2173	4210	6383	SO:0001583	missense	23096	exon9			TCATCGTTGGTCC	AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2801A>T	chrX.hg19:g.53272572T>A	ENSP00000364517:p.Asn934Ile	46.0	0.0		66.0	50.0	NM_001111125	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	ENST00000375368.5	hg19		.	.	.	.	.	.	.	.	.	.	T	26.4	4.730092	0.89390	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.13778	2.56;2.56;2.61	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.26629	0.0651	L	0.58101	1.795	0.80722	D	1	B;P	0.44478	0.274;0.836	B;P	0.52343	0.242;0.696	T	0.00986	-1.1490	10	0.87932	D	0	.	13.4239	0.61013	0.0:0.0:0.0:1.0	.	944;739	Q5JU85-2;Q5JU85-3	.;.	I	944;934;739	ENSP00000379712:N944I;ENSP00000364517:N934I;ENSP00000364514:N739I	ENSP00000364514:N739I	N	-	2	0	IQSEC2	53289297	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.123000	0.64703	1.882000	0.54519	0.477000	0.44152	AAC	.	.		0.597	IQSEC2-201	KNOWN	basic	protein_coding	protein_coding		XM_291345	
EDA	1896	hgsc.bcm.edu	37	X	69255445	69255445	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chrX:69255445G>T	ENST00000374552.4	+	8	1404	c.1162G>T	c.(1162-1164)Gcc>Tcc	p.A388S	EDA_ENST00000374553.2_Missense_Mutation_p.A386S|EDA_ENST00000524573.1_Missense_Mutation_p.A383S	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A	388					cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						GCTGGGTGAAGCCCCTGCATC	0.587																																					p.A388S		Atlas-SNP	.											.	EDA	61	.	0			c.G1162T						.						125.0	95.0	105.0					X																	69255445		2203	4300	6503	SO:0001583	missense	1896	exon8			GGTGAAGCCCCTG	U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.1162G>T	chrX.hg19:g.69255445G>T	ENSP00000363680:p.Ala388Ser	53.0	0.0		66.0	39.0	NM_001399	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	Missense_Mutation	SNP	ENST00000374552.4	hg19	CCDS14394.1	.	.	.	.	.	.	.	.	.	.	G	29.5	5.013923	0.93404	.	.	ENSG00000158813	ENST00000374552;ENST00000374553;ENST00000524573	D;D;D	0.99462	-5.94;-5.94;-5.94	5.42	5.42	0.78866	Tumour necrosis factor-like (2);	0.000000	0.85682	D	0.000000	D	0.98998	0.9658	N	0.24115	0.695	0.80722	D	1	D;P;D	0.55605	0.972;0.953;0.972	D;D;D	0.77557	0.99;0.978;0.99	D	0.99936	1.1365	10	0.87932	D	0	-10.1592	17.1546	0.86787	0.0:0.0:1.0:0.0	.	383;388;386	Q92838-9;Q92838;Q92838-3	.;EDA_HUMAN;.	S	388;386;383	ENSP00000363680:A388S;ENSP00000363681:A386S;ENSP00000432585:A383S	ENSP00000363680:A388S	A	+	1	0	EDA	69172170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.125000	0.94402	2.261000	0.74972	0.529000	0.55759	GCC	.	.		0.587	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057048.2	NM_001399	
ATG4A	115201	hgsc.bcm.edu	37	X	107381369	107381369	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chrX:107381369A>T	ENST00000372232.3	+	9	921	c.762A>T	c.(760-762)ttA>ttT	p.L254F	ATG4A_ENST00000545696.1_Intron|ATG4A_ENST00000372254.3_Missense_Mutation_p.L230F|ATG4A_ENST00000345734.3_Intron	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	254					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)			endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						CACAGTCTTTAGGGGCATTAG	0.458																																					p.L254F		Atlas-SNP	.											.	ATG4A	68	.	0			c.A762T						.						202.0	178.0	186.0					X																	107381369		2203	4300	6503	SO:0001583	missense	115201	exon9			GTCTTTAGGGGCA	AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.762A>T	chrX.hg19:g.107381369A>T	ENSP00000361306:p.Leu254Phe	125.0	0.0		198.0	54.0	NM_052936	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Missense_Mutation	SNP	ENST00000372232.3	hg19	CCDS14538.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.46|17.46	3.395185|3.395185	0.62066|0.62066	.|.	.|.	ENSG00000101844|ENSG00000101844	ENST00000372232;ENST00000372254;ENST00000457035|ENST00000394892	T;T|.	0.50813|.	0.73;0.74|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.180131|.	0.38605|.	N|.	0.001638|.	T|.	0.77260|.	0.4104|.	M|M	0.90369|0.90369	3.11|3.11	0.80722|0.80722	D|D	1|1	P|.	0.44986|.	0.847|.	P|.	0.58077|.	0.832|.	T|.	0.80507|.	-0.1352|.	10|.	0.72032|.	D|.	0.01|.	-6.9712|-6.9712	7.2132|7.2132	0.25945|0.25945	0.8535:0.0:0.1465:0.0|0.8535:0.0:0.1465:0.0	.|.	254|.	Q8WYN0|.	ATG4A_HUMAN|.	F|L	254;230;177|227	ENSP00000361306:L254F;ENSP00000361328:L230F|.	ENSP00000361306:L254F|.	L|X	+|+	3|2	2|0	ATG4A|ATG4A	107268025|107268025	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.775000|2.775000	0.47702|0.47702	1.796000|1.796000	0.52611|0.52611	0.451000|0.451000	0.29950|0.29950	TTA|TAG	.	.		0.458	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057860.1	NM_052936	
MCF2	4168	hgsc.bcm.edu	37	X	138733894	138733894	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chrX:138733894T>C	ENST00000519895.1	-	2	175	c.10A>G	c.(10-12)Atc>Gtc	p.I4V	MCF2_ENST00000414978.1_Missense_Mutation_p.I4V|MCF2_ENST00000520602.1_Missense_Mutation_p.I4V|MCF2_ENST00000370578.4_Missense_Mutation_p.I89V	NM_001171876.1	NP_001165347.1	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	0	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				apoptotic signaling pathway (GO:0097190)|dendrite development (GO:0016358)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|cervix(2)|endometrium(4)|kidney(2)|large_intestine(15)|lung(34)|pancreas(1)|pleura(1)|prostate(1)	62	Acute lymphoblastic leukemia(192;0.000127)					AAGAAGGCGATGTCTTGCATT	0.353																																					p.I4V		Atlas-SNP	.											.	MCF2	432	.	0			c.A10G						.						72.0	63.0	66.0					X																	138733894		1841	3996	5837	SO:0001583	missense	4168	exon2			AGGCGATGTCTTG		CCDS14667.1, CCDS48175.1, CCDS55514.1, CCDS55515.1, CCDS55516.1, CCDS55517.1	Xq26.3-q27.1	2012-07-24			ENSG00000101977	ENSG00000101977		"""Rho guanine nucleotide exchange factors"""	6940	protein-coding gene	gene with protein product	"""Oncogene MCF2 (oncogene DBL)"""	311030				2577874, 1611909	Standard	NM_001099855		Approved	DBL, ARHGEF21	uc011mwo.1	P10911	OTTHUMG00000022537	ENST00000519895.1:c.10A>G	chrX.hg19:g.138733894T>C	ENSP00000430276:p.Ile4Val	317.0	2.0		429.0	313.0	NM_001171876	B7Z3Y5|B7Z869|B7ZAV1|E9PH77|F5H091|P14919|Q5JYJ2|Q5JYJ3|Q5JYJ4|Q8IUF3|Q8IUF4|Q9UJB3	Missense_Mutation	SNP	ENST00000519895.1	hg19	CCDS55517.1	.	.	.	.	.	.	.	.	.	.	T	8.094	0.775064	0.16051	.	.	ENSG00000101977	ENST00000520602;ENST00000370578;ENST00000414978;ENST00000519895	T;T;T;T	0.31247	1.5;1.55;1.5;1.55	4.3	3.01	0.34805	.	0.503584	0.19821	N	0.105309	T	0.10723	0.0262	N	0.04880	-0.145	0.24048	N	0.996055	B;B;B	0.22746	0.074;0.061;0.06	B;B;B	0.21917	0.037;0.026;0.03	T	0.31724	-0.9933	10	0.07325	T	0.83	.	3.9056	0.09180	0.2117:0.0:0.2151:0.5731	.	4;89;89	E9PH77;B7Z3Z2;Q5JYJ7	.;.;.	V	4;89;4;4	ENSP00000427745:I4V;ENSP00000359610:I89V;ENSP00000397055:I4V;ENSP00000430276:I4V	ENSP00000359610:I89V	I	-	1	0	MCF2	138561560	1.000000	0.71417	0.925000	0.36789	0.750000	0.42670	1.042000	0.30303	1.662000	0.50781	0.430000	0.28490	ATC	.	.		0.353	MCF2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377602.1	NM_005369	
ARL13B	200894	hgsc.bcm.edu	37	3	93755562	93755562	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr3:93755562delA	ENST00000394222.3	+	5	928	c.653delA	c.(652-654)gaafs	p.E218fs	ARL13B_ENST00000471138.1_Frame_Shift_Del_p.E218fs|ARL13B_ENST00000535334.1_Frame_Shift_Del_p.E115fs|ARL13B_ENST00000303097.7_Frame_Shift_Del_p.E111fs|ARL13B_ENST00000539730.1_5'UTR|ARL13B_ENST00000486562.1_3'UTR	NM_001174150.1	NP_001167621.1	Q3SXY8	AR13B_HUMAN	ADP-ribosylation factor-like 13B	218					cilium assembly (GO:0042384)|dorsal/ventral pattern formation (GO:0009953)|formation of radial glial scaffolds (GO:0021943)|heart looping (GO:0001947)|interneuron migration from the subpallium to the cortex (GO:0021830)|left/right axis specification (GO:0070986)|neural tube patterning (GO:0021532)|nonmotile primary cilium assembly (GO:0035058)|small GTPase mediated signal transduction (GO:0007264)|smoothened signaling pathway (GO:0007224)	ciliary membrane (GO:0060170)|cilium (GO:0005929)|intracellular (GO:0005622)|primary cilium (GO:0072372)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(2)	10						GAGAAACAAGAAAGAGCTGAA	0.373																																					p.E218fs		Atlas-INDEL	.											.	ARL13B	52	.	0			c.652delG						.						63.0	61.0	61.0					3																	93755562		2203	4300	6503	SO:0001589	frameshift_variant	200894	exon5			.	AL713789	CCDS2924.1, CCDS2925.1, CCDS54615.1	3q11	2014-05-09	2005-11-18	2005-11-18	ENSG00000169379	ENSG00000169379		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	25419	protein-coding gene	gene with protein product		608922	"""ADP-ribosylation factor-like 2-like 1"""	ARL2L1		15314642, 18674751	Standard	NR_033427		Approved	DKFZp761H079, JBTS8	uc003drf.3	Q3SXY8	OTTHUMG00000159012	ENST00000394222.3:c.653delA	chr3.hg19:g.93755562delA	ENSP00000377769:p.Glu218fs	341.0	0.0		486.0	166.0	NM_001174150	D3DN29|G3V1S8|Q504W8|Q8TCL5	Frame_Shift_Del	DEL	ENST00000394222.3	hg19	CCDS2925.1																																																																																			.	.		0.373	ARL13B-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352904.1	NM_182896	
A2ML1	144568	hgsc.bcm.edu	37	12	8998818	8998818	+	Splice_Site	DEL	G	G	-			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:8998818delG	ENST00000299698.7	+	14	1863	c.1683delG	c.(1681-1683)cag>ca	p.Q561fs	A2ML1_ENST00000539547.1_Splice_Site_p.Q70fs|A2ML1_ENST00000540049.1_3'UTR	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TTGACAATCAGGTAAAATGAT	0.448																																					p.Q561fs		Atlas-INDEL	.											.	A2ML1	199	.	0			c.1682delA						.						106.0	92.0	96.0					12																	8998818		1910	4133	6043	SO:0001630	splice_region_variant	144568	exon14			.	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1683+1G>-	chr12.hg19:g.8998818delG		100.0	0.0		132.0	47.0	NM_144670		Frame_Shift_Del	DEL	ENST00000299698.7	hg19	CCDS8596.2																																																																																			.	.		0.448	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	Frame_Shift_Del
CEMIP	57214	hgsc.bcm.edu	37	15	81225646	81225646	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr15:81225646delG	ENST00000394685.3	+	23	3273	c.2854delG	c.(2854-2856)gggfs	p.G952fs	KIAA1199_ENST00000356249.5_Frame_Shift_Del_p.G952fs|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000220244.3_Frame_Shift_Del_p.G952fs			Q8WUJ3	CEMIP_HUMAN		952					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GGACATGGATGGGGATAAGAC	0.557																																					p.D951fs		Atlas-INDEL	.											.	KIAA1199	118	.	0			c.2853delT						.						121.0	109.0	113.0					15																	81225646		2203	4300	6503	SO:0001589	frameshift_variant	57214	exon22			.																												ENST00000394685.3:c.2854delG	chr15.hg19:g.81225646delG	ENSP00000378177:p.Gly952fs	128.0	0.0		156.0	41.0	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Frame_Shift_Del	DEL	ENST00000394685.3	hg19	CCDS10315.1																																																																																			.	.		0.557	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
DHX35	60625	hgsc.bcm.edu	37	20	37597805	37597806	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr20:37597805_37597806insT	ENST00000252011.3	+	2	155_156	c.122_123insT	c.(121-126)ccttatfs	p.Y42fs	DHX35_ENST00000373325.2_Frame_Shift_Ins_p.Y42fs|DHX35_ENST00000373323.4_Frame_Shift_Ins_p.Y42fs	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	42					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				GTTTACAACCCTTATGCTGCCC	0.48																																					p.P41fs		Atlas-INDEL	.											.	DHX35	82	.	0			c.122_123insT						.																																			SO:0001589	frameshift_variant	60625	exon2			.	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.124dupT	chr20.hg19:g.37597807_37597807dupT	ENSP00000252011:p.Tyr42fs	82.0	0.0		156.0	23.0	NM_021931	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Frame_Shift_Ins	INS	ENST00000252011.3	hg19	CCDS13310.1																																																																																			.	.		0.480	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
ZBTB44	29068	hgsc.bcm.edu	37	11	130131553	130131587	+	Frame_Shift_Del	DEL	CAACACATTCTTGTTCTCATCCTCGGCTTGGCCTA	CAACACATTCTTGTTCTCATCCTCGGCTTGGCCTA	-	rs529557692|rs373677642|rs146574096	byFrequency	TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	CAACACATTCTTGTTCTCATCCTCGGCTTGGCCTA	CAACACATTCTTGTTCTCATCCTCGGCTTGGCCTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr11:130131553_130131587delCAACACATTCTTGTTCTCATCCTCGGCTTGGCCTA	ENST00000357899.4	-	2	454_488	c.182_216delTAGGCCAAGCCGAGGATGAGAACAAGAATGTGTTG	c.(181-216)gtaggccaagccgaggatgagaacaagaatgtgttgfs	p.VGQAEDENKNVL61fs	ZBTB44_ENST00000530205.1_Frame_Shift_Del_p.VGQAEDENKNVL61fs|ZBTB44_ENST00000525842.1_Frame_Shift_Del_p.VGQAEDENKNVL61fs|ZBTB44_ENST00000397753.1_Frame_Shift_Del_p.VGQAEDENKNVL61fs			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	61	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		GATGCAGATCCAACACATTCTTGTTCTCATCCTCGGCTTGGCCTACAAGTTTGGT	0.404																																					p.61_73del		Atlas-INDEL	.											.	ZBTB44	41	.	0			c.183_217del						.																																			SO:0001589	frameshift_variant	29068	exon2			.	AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.182_216delTAGGCCAAGCCGAGGATGAGAACAAGAATGTGTTG	chr11.hg19:g.130131553_130131587delCAACACATTCTTGTTCTCATCCTCGGCTTGGCCTA	ENSP00000350574:p.Val61fs	111.0	0.0		142.0	12.0	NM_014155	Q6IPT8|Q86VJ7|Q86XX5	Frame_Shift_Del	DEL	ENST00000357899.4	hg19																																																																																				.	.		0.404	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000386126.1	NM_014155	
ICE1	23379	hgsc.bcm.edu	37	5	5462373	5462374	+	Frame_Shift_Ins	INS	-	-	CA			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr5:5462373_5462374insCA	ENST00000296564.7	+	13	3148_3149	c.2926_2927insCA	c.(2926-2928)gcafs	p.A976fs		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		976					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						GAGAGAAGCTGCAGTGCAGGGA	0.47																																					p.A976fs		Atlas-INDEL	.											.	KIAA0947	301	.	0			c.2926_2927insCA						.																																			SO:0001589	frameshift_variant	23379	exon13			.																												ENST00000296564.7:c.2927_2928dupCA	chr5.hg19:g.5462374_5462375dupCA	ENSP00000296564:p.Ala976fs	103.0	0.0		128.0	39.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Frame_Shift_Ins	INS	ENST00000296564.7	hg19	CCDS47187.1																																																																																			.	.		0.470	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
SLC6A13	6540	hgsc.bcm.edu	37	12	351921	351936	+	Splice_Site	DEL	CTGCGGGGAAACTGCA	CTGCGGGGAAACTGCA	-	rs372831595	byFrequency	TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	CTGCGGGGAAACTGCA	CTGCGGGGAAACTGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr12:351921_351936delCTGCGGGGAAACTGCA	ENST00000343164.4	-	4	390		c.e4-1		SLC6A13_ENST00000445055.2_Intron	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13						neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TAGCCAATGCCTGCGGGGAAACTGCAGAATTGGGCT	0.546																																					p.113_113del		Atlas-INDEL	.											.	SLC6A13	62	.	0			c.338_338del						.																																			SO:0001630	splice_region_variant	6540	exon4			.	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.338-1TGCAGTTTCCCCGCAG>-	chr12.hg19:g.351921_351936delCTGCGGGGAAACTGCA		54.0	0.0		58.0	19.0	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Frame_Shift_Del	DEL	ENST00000343164.4	hg19	CCDS8502.1																																																																																			.	.		0.546	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	Intron
FRYL	285527	hgsc.bcm.edu	37	4	48542570	48542570	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AADS-01A-11D-A40R-10	TCGA-DD-AADS-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d7b0cb1-f476-4c50-91ab-d79564809fb8	7d48f285-d87c-41ed-881c-9dd20e9953dc	g.chr4:48542570delT	ENST00000503238.1	-	43	6094	c.6095delA	c.(6094-6096)catfs	p.H2032fs	FRYL_ENST00000358350.4_Frame_Shift_Del_p.H2032fs|FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Frame_Shift_Del_p.H2032fs			O94915	FRYL_HUMAN	FRY-like	2032					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						CAAAGGCAAATGGATAAGCAG	0.378																																					p.H2032fs		Atlas-INDEL	.											.	FRYL	242	.	0			c.6096delT						.						100.0	91.0	94.0					4																	48542570		1846	4088	5934	SO:0001589	frameshift_variant	285527	exon46			.	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.6095delA	chr4.hg19:g.48542570delT	ENSP00000426064:p.His2032fs	135.0	0.0		149.0	50.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Frame_Shift_Del	DEL	ENST00000503238.1	hg19	CCDS43227.1																																																																																			.	.		0.378	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
