#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIF17	57576	hgsc.bcm.edu	37	1	21011489	21011489	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr1:21011489C>A	ENST00000247986.2	-	10	2354	c.2044G>T	c.(2044-2046)Gcc>Tcc	p.A682S	KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000375044.1_Missense_Mutation_p.A582S|KIF17_ENST00000400463.3_Missense_Mutation_p.A682S			Q9P2E2	KIF17_HUMAN	kinesin family member 17	682					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		ACCTCTAAGGCCACTTCCGAG	0.672																																					p.A682S		Atlas-SNP	.											.	KIF17	130	.	0			c.G2044T						.						30.0	27.0	28.0					1																	21011489		2203	4299	6502	SO:0001583	missense	57576	exon10			CTAAGGCCACTTC	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.2044G>T	chr1.hg19:g.21011489C>A	ENSP00000247986:p.Ala682Ser	193.0	0.0		151.0	50.0	NM_001122819	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	hg19	CCDS213.1	.	.	.	.	.	.	.	.	.	.	C	8.992	0.977947	0.18812	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986;ENST00000321188	T;T;T	0.71341	-0.56;-0.44;-0.44	4.01	-1.17	0.09648	.	0.636018	0.12020	U	0.507021	T	0.50309	0.1608	L	0.36672	1.1	0.09310	N	1	B;B;B	0.29301	0.067;0.241;0.118	B;B;B	0.28011	0.027;0.085;0.018	T	0.31668	-0.9935	10	0.14656	T	0.56	.	3.3664	0.07204	0.1805:0.4086:0.0:0.4109	.	682;682;682	B0I1R5;Q9P2E2-3;Q9P2E2	.;.;KIF17_HUMAN	S	582;682;682;63	ENSP00000364184:A582S;ENSP00000383311:A682S;ENSP00000247986:A682S	ENSP00000247986:A682S	A	-	1	0	KIF17	20884076	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.533000	0.06157	-0.216000	0.10048	0.655000	0.94253	GCC	.	.		0.672	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
DOCK7	85440	hgsc.bcm.edu	37	1	62923216	62923216	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr1:62923216A>C	ENST00000340370.5	-	48	6297	c.6280T>G	c.(6280-6282)Tgc>Ggc	p.C2094G	DOCK7_ENST00000251157.5_Missense_Mutation_p.C2114G	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	2125	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						TACCTGTGGCAGGTGACAGGC	0.413																																					p.C2114G		Atlas-SNP	.											.	DOCK7	184	.	0			c.T6340G						.						132.0	126.0	128.0					1																	62923216		2203	4300	6503	SO:0001583	missense	85440	exon48			TGTGGCAGGTGAC		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.6280T>G	chr1.hg19:g.62923216A>C	ENSP00000340742:p.Cys2094Gly	112.0	0.0		87.0	31.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	hg19	CCDS30734.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.33|12.33	1.904386|1.904386	0.33628|0.33628	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370|ENST00000454575	T;T|.	0.13307|.	2.6;2.6|.	5.99|5.99	3.48|3.48	0.39840|0.39840	.|.	0.234704|.	0.34338|.	N|.	0.004043|.	T|T	0.32436|0.32436	0.0829|0.0829	N|N	0.03608|0.03608	-0.345|-0.345	0.54753|0.54753	D|D	0.999983|0.999983	B;B;B;B;B;B|.	0.02656|.	0.0;0.0;0.0;0.0;0.0;0.0|.	B;B;B;B;B;B|.	0.01281|.	0.0;0.0;0.0;0.0;0.0;0.0|.	T|T	0.11060|0.11060	-1.0603|-1.0603	10|5	0.27082|.	T|.	0.32|.	.|.	14.0669|14.0669	0.64837|0.64837	0.7521:0.2479:0.0:0.0|0.7521:0.2479:0.0:0.0	.|.	2125;2114;2094;2083;2085;2116|.	Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6|.	DOCK7_HUMAN;.;.;.;.;.|.	G|R	2125;2114;2094|1287	ENSP00000251157:C2114G;ENSP00000340742:C2094G|.	ENSP00000251157:C2114G|.	C|L	-|-	1|2	0|0	DOCK7|DOCK7	62695804|62695804	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.761000|5.761000	0.68801|0.68801	1.054000|1.054000	0.40438|0.40438	0.533000|0.533000	0.62120|0.62120	TGC|CTG	.	.		0.413	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
FLG	2312	hgsc.bcm.edu	37	1	152277558	152277558	+	Silent	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr1:152277558T>A	ENST00000368799.1	-	3	9839	c.9804A>T	c.(9802-9804)gcA>gcT	p.A3268A	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3268	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGAGCGGTCTGCAGAGTGCC	0.577									Ichthyosis																												p.A3268A		Atlas-SNP	.											.	FLG	900	.	0			c.A9804T						.						286.0	286.0	286.0					1																	152277558		2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GCGGTCTGCAGAG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9804A>T	chr1.hg19:g.152277558T>A		120.0	0.0		103.0	41.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	hg19	CCDS30860.1																																																																																			.	.		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
NOS1AP	9722	hgsc.bcm.edu	37	1	162302830	162302830	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr1:162302830C>A	ENST00000361897.5	+	5	770	c.368C>A	c.(367-369)tCc>tAc	p.S123Y	NOS1AP_ENST00000530878.1_Missense_Mutation_p.S118Y	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	123	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			TCTCATGATTCCCAAGACTTG	0.413																																					p.S123Y		Atlas-SNP	.											.	NOS1AP	139	.	0			c.C368A						.						119.0	111.0	114.0					1																	162302830		2203	4300	6503	SO:0001583	missense	9722	exon5			ATGATTCCCAAGA	AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.368C>A	chr1.hg19:g.162302830C>A	ENSP00000355133:p.Ser123Tyr	126.0	0.0		145.0	27.0	NM_014697	B7ZLF5|O43564|Q3T551|Q5VU95	Missense_Mutation	SNP	ENST00000361897.5	hg19	CCDS1237.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.673183	0.88445	.	.	ENSG00000198929	ENST00000530878;ENST00000361897	T;T	0.15139	2.45;2.45	5.42	5.42	0.78866	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.049412	0.85682	D	0.000000	T	0.42607	0.1210	M	0.89214	3.015	.	.	.	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.997	T	0.51880	-0.8649	9	0.72032	D	0.01	.	16.7056	0.85371	0.0:1.0:0.0:0.0	.	118;118;123	E9PSG0;B7ZLF5;O75052	.;.;CAPON_HUMAN	Y	118;123	ENSP00000431586:S118Y;ENSP00000355133:S123Y	ENSP00000355133:S123Y	S	+	2	0	NOS1AP	160569454	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.028000	0.76470	2.520000	0.84964	0.655000	0.94253	TCC	.	.		0.413	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060555.2	NM_014697	
AXDND1	126859	hgsc.bcm.edu	37	1	179497542	179497542	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr1:179497542T>A	ENST00000367618.3	+	23	3078	c.2691T>A	c.(2689-2691)ttT>ttA	p.F897L		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	897	Glu-rich.									NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						AACCTCTATTTGAAACAGATG	0.363																																					p.F897L		Atlas-SNP	.											.	AXDND1	142	.	0			c.T2691A						.						115.0	103.0	107.0					1																	179497542		2203	4300	6503	SO:0001583	missense	126859	exon23			TCTATTTGAAACA	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2691T>A	chr1.hg19:g.179497542T>A	ENSP00000356590:p.Phe897Leu	86.0	0.0		102.0	20.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.821552	0.32237	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000359183;ENST00000434088	T;T	0.21361	2.01;2.01	4.12	-3.53	0.04667	.	1.091970	0.07137	N	0.846623	T	0.12774	0.0310	L	0.44542	1.39	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.38023	-0.9680	10	0.26408	T	0.33	1.2625	0.0912	0.00040	0.3115:0.1974:0.1597:0.3314	.	781;897	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	L	897;781;129;757	ENSP00000356590:F897L;ENSP00000391716:F757L	ENSP00000352107:F129L	F	+	3	2	AXDND1	177764165	0.003000	0.15002	0.000000	0.03702	0.126000	0.20510	0.013000	0.13310	-0.364000	0.08088	-0.327000	0.08410	TTT	.	.		0.363	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
BRINP3	339479	hgsc.bcm.edu	37	1	190195446	190195446	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr1:190195446G>T	ENST00000367462.3	-	6	958	c.727C>A	c.(727-729)Ctt>Att	p.L243I	BRINP3_ENST00000463404.1_5'Flank|BRINP3_ENST00000534846.1_Missense_Mutation_p.L141I	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	243	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											AGTACTTGAAGCCCTTGAAGA	0.299																																					p.L243I		Atlas-SNP	.											.	FAM5C	343	.	0			c.C727A						.						52.0	50.0	51.0					1																	190195446		2203	4300	6503	SO:0001583	missense	339479	exon6			CTTGAAGCCCTTG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.727C>A	chr1.hg19:g.190195446G>T	ENSP00000356432:p.Leu243Ile	77.0	0.0		78.0	56.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	hg19	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.492434	0.44352	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.27104	1.92;1.69	5.81	4.9	0.64082	Membrane attack complex component/perforin (MACPF) domain (1);	0.065493	0.64402	D	0.000011	T	0.47746	0.1462	M	0.69358	2.11	0.47374	D	0.999408	D;D	0.67145	0.996;0.993	D;D	0.72625	0.978;0.952	T	0.49093	-0.8975	10	0.66056	D	0.02	.	12.723	0.57152	0.0792:0.0:0.9208:0.0	.	141;243	B7Z260;Q76B58	.;FAM5C_HUMAN	I	243;141	ENSP00000356432:L243I;ENSP00000438022:L141I	ENSP00000356432:L243I	L	-	1	0	FAM5C	188462069	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.490000	0.53245	1.461000	0.47929	0.655000	0.94253	CTT	.	.		0.299	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
RGS18	64407	hgsc.bcm.edu	37	1	192127859	192127859	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr1:192127859A>G	ENST00000367460.3	+	1	273	c.92A>G	c.(91-93)gAa>gGa	p.E31G	RGS18_ENST00000481707.1_3'UTR	NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	31					G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TCAGGAAAAGAAGAAACAAGC	0.289																																					p.E31G		Atlas-SNP	.											.	RGS18	54	.	0			c.A92G						.						48.0	52.0	51.0					1																	192127859		2202	4290	6492	SO:0001583	missense	64407	exon1			GAAAAGAAGAAAC	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.92A>G	chr1.hg19:g.192127859A>G	ENSP00000356430:p.Glu31Gly	818.0	0.0		1014.0	225.0	NM_130782	B2RD23	Missense_Mutation	SNP	ENST00000367460.3	hg19	CCDS1374.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.053198	0.55218	.	.	ENSG00000150681	ENST00000367460	T	0.53423	0.62	6.06	4.94	0.65067	.	0.258414	0.45867	D	0.000340	T	0.45856	0.1363	M	0.65975	2.015	0.46654	D	0.999146	B	0.16603	0.018	B	0.17722	0.019	T	0.40346	-0.9568	10	0.51188	T	0.08	.	9.8871	0.41268	0.9227:0.0:0.0773:0.0	.	31	Q9NS28	RGS18_HUMAN	G	31	ENSP00000356430:E31G	ENSP00000356430:E31G	E	+	2	0	RGS18	190394482	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.752000	0.55172	1.119000	0.41883	0.528000	0.53228	GAA	.	.		0.289	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086382.1	NM_130782	
TPO	7173	hgsc.bcm.edu	37	2	1437364	1437364	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr2:1437364T>C	ENST00000345913.4	+	4	425	c.334T>C	c.(334-336)Tca>Cca	p.S112P	TPO_ENST00000329066.4_Missense_Mutation_p.S112P|TPO_ENST00000382269.3_Missense_Mutation_p.S112P|TPO_ENST00000346956.3_Missense_Mutation_p.S112P|TPO_ENST00000539820.1_Missense_Mutation_p.S112P|TPO_ENST00000349624.3_Missense_Mutation_p.S112P|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Missense_Mutation_p.S112P|TPO_ENST00000382201.3_Missense_Mutation_p.S112P|TPO_ENST00000337415.3_Missense_Mutation_p.S112P	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	112					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	AACTCAACAATCACAGCATCC	0.517																																					p.S112P		Atlas-SNP	.											.	TPO	224	.	0			c.T334C						.						95.0	80.0	85.0					2																	1437364		2203	4300	6503	SO:0001583	missense	7173	exon4			CAACAATCACAGC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.334T>C	chr2.hg19:g.1437364T>C	ENSP00000318820:p.Ser112Pro	290.0	0.0		226.0	66.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	hg19	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	T	7.773	0.707798	0.15239	.	.	ENSG00000115705	ENST00000382269;ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000539820;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36;0.36	4.26	-1.21	0.09524	.	1.528620	0.04080	N	0.309399	T	0.49779	0.1577	L	0.36672	1.1	0.09310	N	1	P;P;D;P;P	0.56035	0.89;0.899;0.974;0.89;0.725	P;P;P;P;B	0.55391	0.527;0.571;0.775;0.527;0.327	T	0.36456	-0.9747	10	0.31617	T	0.26	-0.7739	0.8062	0.01084	0.1611:0.1911:0.1665:0.4813	.	112;112;112;112;112	P07202-4;P07202-5;E9PFM6;P07202-2;P07202	.;.;.;.;PERT_HUMAN	P	112;112;112;112;112;112;112;112;112;112;41	ENSP00000371704:S112P;ENSP00000337263:S112P;ENSP00000318820:S112P;ENSP00000263886:S112P;ENSP00000332044:S112P;ENSP00000444840:S112P;ENSP00000329869:S112P;ENSP00000371636:S112P;ENSP00000390994:S112P;ENSP00000371633:S112P;ENSP00000405788:S41P	ENSP00000329869:S112P	S	+	1	0	TPO	1416371	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.374000	0.20501	-0.150000	0.11195	0.460000	0.39030	TCA	.	.		0.517	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
MYT1L	23040	hgsc.bcm.edu	37	2	1844609	1844609	+	Silent	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr2:1844609T>A	ENST00000399161.2	-	20	3528	c.2781A>T	c.(2779-2781)tcA>tcT	p.S927S	MYT1L_ENST00000407844.1_5'UTR|MYT1L_ENST00000428368.2_Silent_p.S925S|MYT1L_ENST00000471668.1_5'UTR	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	927					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TTGGGCAACCTGAAAGGCTAA	0.408																																					p.S925S		Atlas-SNP	.											.	MYT1L	241	.	0			c.A2775T						.						137.0	122.0	127.0					2																	1844609		1728	3731	5459	SO:0001819	synonymous_variant	23040	exon20			GCAACCTGAAAGG	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2781A>T	chr2.hg19:g.1844609T>A		57.0	0.0		44.0	13.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	ENST00000399161.2	hg19																																																																																				.	.		0.408	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
DTNB	1838	hgsc.bcm.edu	37	2	25656837	25656837	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr2:25656837T>A	ENST00000406818.3	-	13	1534	c.1285A>T	c.(1285-1287)Aac>Tac	p.N429Y	DTNB_ENST00000404103.3_Missense_Mutation_p.N429Y|DTNB_ENST00000545439.1_Missense_Mutation_p.N225Y|DTNB_ENST00000407186.1_Missense_Mutation_p.N399Y|DTNB_ENST00000407038.3_Missense_Mutation_p.N399Y|DTNB_ENST00000407661.3_Missense_Mutation_p.N429Y|DTNB_ENST00000496972.2_Missense_Mutation_p.N372Y|DTNB_ENST00000405222.1_Missense_Mutation_p.N399Y|DTNB_ENST00000288642.8_Missense_Mutation_p.N429Y	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	429	Syntrophin-binding region.					cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCATCAAAGTTAAAGCTCAAG	0.423																																					p.N429Y		Atlas-SNP	.											.	DTNB	43	.	0			c.A1285T						.						217.0	204.0	208.0					2																	25656837		1876	4111	5987	SO:0001583	missense	1838	exon13			CAAAGTTAAAGCT	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.1285A>T	chr2.hg19:g.25656837T>A	ENSP00000384084:p.Asn429Tyr	135.0	0.0		100.0	36.0	NM_021907	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Missense_Mutation	SNP	ENST00000406818.3	hg19	CCDS46237.1	.	.	.	.	.	.	.	.	.	.	T	17.89	3.499072	0.64298	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000407038;ENST00000405222;ENST00000407186;ENST00000288642;ENST00000545439;ENST00000535791	T;T;T;T;T;T;T;T;T	0.46819	2.18;2.17;2.17;2.18;2.19;2.2;2.2;2.17;0.86	5.74	5.74	0.90152	.	0.198714	0.56097	D	0.000034	T	0.40743	0.1129	L	0.34521	1.04	0.80722	D	1	B;B;B;B;B;B;B;B;B;B;B;B;B	0.13594	0.003;0.005;0.008;0.008;0.005;0.005;0.001;0.002;0.002;0.008;0.008;0.001;0.005	B;B;B;B;B;B;B;B;B;B;B;B;B	0.20184	0.005;0.008;0.019;0.028;0.008;0.008;0.004;0.005;0.007;0.019;0.019;0.003;0.008	T	0.23619	-1.0183	10	0.56958	D	0.05	-16.8472	14.8548	0.70329	0.0:0.0:0.0:1.0	.	429;225;372;429;429;372;399;399;399;429;429;429;429	E7EVB6;B7Z202;F5GZG4;O60941-3;B7Z6A9;B7Z733;E9PEY4;Q96AW0;O60941-2;O60941-4;G5E9F6;O60941;Q86VR4	.;.;.;.;.;.;.;.;.;.;.;DTNB_HUMAN;.	Y	372;429;429;429;399;399;399;429;225;282	ENSP00000444463:N372Y;ENSP00000384084:N429Y;ENSP00000385482:N429Y;ENSP00000385193:N429Y;ENSP00000384767:N399Y;ENSP00000384787:N399Y;ENSP00000385784:N399Y;ENSP00000288642:N429Y;ENSP00000444961:N225Y	ENSP00000288642:N429Y	N	-	1	0	DTNB	25510341	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.670000	0.83925	2.180000	0.69256	0.533000	0.62120	AAC	.	.		0.423	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147	
SLC8A1	6546	hgsc.bcm.edu	37	2	40656383	40656383	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr2:40656383T>C	ENST00000403092.1	-	2	1071	c.1038A>G	c.(1036-1038)atA>atG	p.I346M	SLC8A1_ENST00000405269.1_Missense_Mutation_p.I346M|SLC8A1_ENST00000406785.2_Missense_Mutation_p.I346M|SLC8A1_ENST00000408028.2_Missense_Mutation_p.I346M|SLC8A1_ENST00000405901.3_Missense_Mutation_p.I346M|SLC8A1_ENST00000332839.4_Missense_Mutation_p.I346M|SLC8A1_ENST00000406391.2_Missense_Mutation_p.I346M|SLC8A1_ENST00000542756.1_Missense_Mutation_p.I346M|SLC8A1_ENST00000402441.1_Missense_Mutation_p.I346M|SLC8A1_ENST00000542024.1_Missense_Mutation_p.I346M			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	346					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.I346M(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TAGCTAATTCTATTAATTGCT	0.403																																					p.I346M		Atlas-SNP	.											SLC8A1,NS,carcinoma,0,1	SLC8A1	221	.	1	Substitution - Missense(1)	lung(1)	c.A1038G						.						165.0	166.0	166.0					2																	40656383		2203	4300	6503	SO:0001583	missense	6546	exon1			TAATTCTATTAAT		CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1038A>G	chr2.hg19:g.40656383T>C	ENSP00000384763:p.Ile346Met	101.0	1.0		113.0	62.0	NM_001252624	A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	ENST00000403092.1	hg19	CCDS1806.1	.	.	.	.	.	.	.	.	.	.	T	8.898	0.955541	0.18507	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.28666	1.6;1.64;1.65;1.64;1.6;1.6;1.65;1.61;1.6;1.6	6.17	-0.778	0.10977	Heat shock protein DnaJ, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.33381	0.0861	L	0.28014	0.82	0.58432	D	0.999995	B;D;B;B;B	0.65815	0.41;0.995;0.41;0.196;0.124	B;D;B;B;B	0.80764	0.257;0.994;0.257;0.072;0.031	T	0.06058	-1.0848	10	0.45353	T	0.12	.	6.7316	0.23387	0.4667:0.0:0.2404:0.293	.	346;346;346;346;346	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	M	346	ENSP00000383886:I346M;ENSP00000440727:I346M;ENSP00000384763:I346M;ENSP00000385678:I346M;ENSP00000385188:I346M;ENSP00000385535:I346M;ENSP00000332931:I346M;ENSP00000384908:I346M;ENSP00000385811:I346M;ENSP00000443515:I346M	ENSP00000332931:I346M	I	-	3	3	SLC8A1	40509887	0.006000	0.16342	0.949000	0.38748	0.996000	0.88848	-1.357000	0.02607	-0.343000	0.08351	0.533000	0.62120	ATA	.	.		0.403	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326065.1	NM_021097	
PCBP1	5093	hgsc.bcm.edu	37	2	70314990	70314990	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr2:70314990A>C	ENST00000303577.5	+	1	406	c.115A>C	c.(115-117)Atc>Ctc	p.I39L	PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000596665.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	39	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						GGTTAAGAGGATCCGCGAGGA	0.517																																					p.I39L	Colon(85;1146 1307 3484 18706 25380)	Atlas-SNP	.											.	PCBP1	28	.	0			c.A115C						.						112.0	115.0	114.0					2																	70314990		2203	4300	6503	SO:0001583	missense	5093	exon1			AAGAGGATCCGCG		CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.115A>C	chr2.hg19:g.70314990A>C	ENSP00000305556:p.Ile39Leu	169.0	0.0		222.0	58.0	NM_006196	Q13157|Q14975	Missense_Mutation	SNP	ENST00000303577.5	hg19	CCDS1898.1	.	.	.	.	.	.	.	.	.	.	A	12.63	1.996869	0.35226	.	.	ENSG00000169564	ENST00000303577	T	0.48836	0.8	4.22	4.22	0.49857	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.204106	0.49305	D	0.000160	T	0.30103	0.0754	N	0.25992	0.78	0.36171	D	0.848796	B	0.10296	0.003	B	0.20577	0.03	T	0.18681	-1.0329	10	0.02654	T	1	.	11.9582	0.52993	1.0:0.0:0.0:0.0	.	39	Q15365	PCBP1_HUMAN	L	39	ENSP00000305556:I39L	ENSP00000305556:I39L	I	+	1	0	PCBP1	70168494	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.003000	0.63959	2.145000	0.66743	0.529000	0.55759	ATC	.	.		0.517	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251844.1	NM_006196	
POTEF	728378	hgsc.bcm.edu	37	2	130832582	130832582	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr2:130832582C>A	ENST00000409914.2	-	17	2862	c.2463G>T	c.(2461-2463)caG>caT	p.Q821H	POTEF_ENST00000357462.5_Missense_Mutation_p.Q821H	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	821	Actin-like.				retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						CAAACATGATCTGGGTCATCT	0.592																																					p.Q821H		Atlas-SNP	.											.	POTEF	140	.	0			c.G2463T						.						112.0	127.0	122.0					2																	130832582		2203	4299	6502	SO:0001583	missense	728378	exon17			CATGATCTGGGTC	EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.2463G>T	chr2.hg19:g.130832582C>A	ENSP00000386786:p.Gln821His	196.0	1.0		251.0	143.0	NM_001099771	A6NC34	Missense_Mutation	SNP	ENST00000409914.2	hg19	CCDS46409.1	.	.	.	.	.	.	.	.	.	.	.	15.81	2.943980	0.53079	.	.	ENSG00000196604	ENST00000357462;ENST00000409914	D;D	0.97688	-4.49;-4.49	.	.	.	.	.	.	.	.	D	0.98476	0.9492	H	0.99940	5	0.26212	N	0.979286	B	0.27192	0.171	B	0.30782	0.12	D	0.96697	0.9515	8	0.87932	D	0	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	821	A5A3E0	POTEF_HUMAN	H	821	ENSP00000350052:Q821H;ENSP00000386786:Q821H	ENSP00000350052:Q821H	Q	-	3	2	POTEF	130549052	1.000000	0.71417	0.366000	0.25914	0.368000	0.29767	5.244000	0.65400	0.119000	0.18210	0.121000	0.15741	CAG	.	.		0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331889.2	NM_001099771	
ACVR2A	92	hgsc.bcm.edu	37	2	148674942	148674942	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr2:148674942C>T	ENST00000241416.7	+	6	1399	c.763C>T	c.(763-765)Cga>Tga	p.R255*	ACVR2A_ENST00000535787.1_Nonsense_Mutation_p.R147*|ACVR2A_ENST00000404590.1_Nonsense_Mutation_p.R255*	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	255	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TGCAGAAAAACGAGGCACCAG	0.398																																					p.R255X		Atlas-SNP	.											ACVR2A,caecum,carcinoma,0,1	ACVR2A	125	.	0			c.C763T						.						116.0	96.0	103.0					2																	148674942		2202	4299	6501	SO:0001587	stop_gained	92	exon6			GAAAAACGAGGCA		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.763C>T	chr2.hg19:g.148674942C>T	ENSP00000241416:p.Arg255*	265.0	0.0		294.0	80.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Nonsense_Mutation	SNP	ENST00000241416.7	hg19	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	C	41	9.153642	0.99084	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	.	.	.	5.68	2.53	0.30540	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.0985	0.65039	0.501:0.499:0.0:0.0	.	.	.	.	X	255;147;255	.	ENSP00000241416:R255X	R	+	1	2	ACVR2A	148391412	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.544000	0.36158	1.360000	0.45960	0.655000	0.94253	CGA	.	.		0.398	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
RAD18	56852	hgsc.bcm.edu	37	3	8988966	8988966	+	Silent	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:8988966T>A	ENST00000264926.2	-	4	320	c.204A>T	c.(202-204)acA>acT	p.T68T	RAD18_ENST00000495087.1_5'UTR	NM_020165.3	NP_064550.3	Q9NS91	RAD18_HUMAN	RAD18 E3 ubiquitin protein ligase	68					DNA repair (GO:0006281)|negative regulation of DNA recombination (GO:0045910)|protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|spermatogenesis (GO:0007283)	chromatin (GO:0000785)|nucleus (GO:0005634)|replication fork (GO:0005657)|XY body (GO:0001741)	damaged DNA binding (GO:0003684)|ligase activity (GO:0016874)|polyubiquitin binding (GO:0031593)|ubiquitin protein ligase binding (GO:0031625)|Y-form DNA binding (GO:0000403)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)|skin(3)	15				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		GATCCGGCTCTGTGACAGTCT	0.338								Rad6 pathway																													p.T68T		Atlas-SNP	.											.	RAD18	52	.	0			c.A204T						.						164.0	173.0	170.0					3																	8988966		2202	4300	6502	SO:0001819	synonymous_variant	56852	exon4			CGGCTCTGTGACA		CCDS2571.1	3p25-p24	2014-08-04	2014-08-04		ENSG00000070950	ENSG00000070950		"""RING-type (C3HC4) zinc fingers"""	18278	protein-coding gene	gene with protein product		605256	"""RAD18 homolog (S. cerevisiae)"""			10884424, 10908344	Standard	NM_020165		Approved	RNF73	uc003brd.3	Q9NS91	OTTHUMG00000090545	ENST00000264926.2:c.204A>T	chr3.hg19:g.8988966T>A		136.0	0.0		138.0	33.0	NM_020165	Q58F55|Q9NRT6	Silent	SNP	ENST00000264926.2	hg19	CCDS2571.1																																																																																			.	.		0.338	RAD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207071.2	NM_020165	
ATP2B2	491	hgsc.bcm.edu	37	3	10392219	10392219	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:10392219C>A	ENST00000352432.4	-	14	2248	c.2179G>T	c.(2179-2181)Gtc>Ttc	p.V727F	ATP2B2_ENST00000360273.2_Missense_Mutation_p.V727F|ATP2B2_ENST00000343816.4_Missense_Mutation_p.V713F|ATP2B2_ENST00000397077.1_Missense_Mutation_p.V682F|ATP2B2_ENST00000383800.4_Missense_Mutation_p.V682F			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	727					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ACCATGCGGACCGTGATGCCT	0.647																																					p.V727F	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											.	ATP2B2	304	.	0			c.G2179T						.						96.0	85.0	89.0					3																	10392219		2203	4300	6503	SO:0001583	missense	491	exon15			TGCGGACCGTGAT	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2179G>T	chr3.hg19:g.10392219C>A	ENSP00000324172:p.Val727Phe	41.0	0.0		44.0	27.0	NM_001001331	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	hg19	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768671	0.90020	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.97041	-4.22;-4.22;-4.22;-4.22;-4.22;-4.22	4.18	4.18	0.49190	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.99158	0.9709	H	0.99425	4.56	0.80722	D	1	D;D;D	0.67145	0.996;0.979;0.992	P;P;D	0.64776	0.89;0.867;0.929	D	0.98722	1.0709	10	0.87932	D	0	-42.772	16.8604	0.86016	0.0:1.0:0.0:0.0	.	662;694;727	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	F	727;682;682;727;713;662;583;727	ENSP00000324172:V727F;ENSP00000373311:V682F;ENSP00000380267:V682F;ENSP00000353414:V727F;ENSP00000344677:V713F;ENSP00000414854:V583F	ENSP00000342954:V727F	V	-	1	0	ATP2B2	10367219	1.000000	0.71417	0.822000	0.32727	0.981000	0.71138	7.808000	0.86044	2.022000	0.59522	0.491000	0.48974	GTC	.	.		0.647	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T41A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,1	CTNNB1	4904	.	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	c.A121G						.						89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCCACTACCACAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	chr3.hg19:g.41266124A>G	ENSP00000344456:p.Thr41Ala	177.0	0.0		167.0	97.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	CTNNB1	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	.	.		0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LAMB2	3913	hgsc.bcm.edu	37	3	49161489	49161489	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:49161489G>A	ENST00000418109.1	-	25	3633	c.3469C>T	c.(3469-3471)Cgc>Tgc	p.R1157C	LAMB2_ENST00000305544.4_Missense_Mutation_p.R1157C|LAMB2_ENST00000464891.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1157	Laminin EGF-like 13. {ECO:0000255|PROSITE-ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCTGTGAAGCGGTGACACTGA	0.572																																					p.R1157C		Atlas-SNP	.											.	LAMB2	156	.	0			c.C3469T						.						69.0	69.0	69.0					3																	49161489		2203	4300	6503	SO:0001583	missense	3913	exon24			TGAAGCGGTGACA		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.3469C>T	chr3.hg19:g.49161489G>A	ENSP00000388325:p.Arg1157Cys	43.0	0.0		55.0	12.0	NM_002292	Q16321	Missense_Mutation	SNP	ENST00000418109.1	hg19	CCDS2789.1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.322275	0.60634	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.62364	0.03;0.03	5.84	4.95	0.65309	EGF-like, laminin (3);	0.108012	0.64402	D	0.000009	T	0.80849	0.4702	M	0.92219	3.285	0.80722	D	1	D	0.76494	0.999	P	0.61201	0.885	D	0.84883	0.0832	10	0.72032	D	0.01	.	11.7847	0.52034	0.0:0.1334:0.7279:0.1388	.	1157	P55268	LAMB2_HUMAN	C	1157	ENSP00000388325:R1157C;ENSP00000307156:R1157C	ENSP00000307156:R1157C	R	-	1	0	LAMB2	49136493	1.000000	0.71417	0.945000	0.38365	0.976000	0.68499	3.663000	0.54518	1.454000	0.47793	0.561000	0.74099	CGC	.	.		0.572	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
SLC9C1	285335	hgsc.bcm.edu	37	3	111993747	111993747	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:111993747A>T	ENST00000305815.5	-	6	862	c.610T>A	c.(610-612)Tta>Ata	p.L204I	SLC9C1_ENST00000487372.1_Missense_Mutation_p.L204I	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	204					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TACTTACCTAAGGTATGGTTT	0.269																																					p.L204I		Atlas-SNP	.											.	.	.	.	0			c.T610A						.						33.0	38.0	36.0					3																	111993747		2169	4263	6432	SO:0001583	missense	285335	exon6			TACCTAAGGTATG	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.610T>A	chr3.hg19:g.111993747A>T	ENSP00000306627:p.Leu204Ile	309.0	0.0		286.0	92.0	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	hg19	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	A	6.320	0.427209	0.11987	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	T;T	0.15139	2.45;2.45	5.16	-10.3	0.00346	Cation/H+ exchanger (1);	0.969423	0.08432	N	0.946751	T	0.07143	0.0181	N	0.25647	0.755	0.09310	N	1	B;B	0.19817	0.01;0.039	B;B	0.25506	0.011;0.061	T	0.22695	-1.0209	10	0.19147	T	0.46	.	1.6945	0.02859	0.2835:0.0888:0.1853:0.4423	.	204;204	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	I	204	ENSP00000306627:L204I;ENSP00000420688:L204I	ENSP00000306627:L204I	L	-	1	2	SLC9A10	113476437	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.698000	0.05092	-2.934000	0.00299	-1.685000	0.00733	TTA	.	.		0.269	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
SEC61A1	29927	hgsc.bcm.edu	37	3	127788431	127788431	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:127788431A>G	ENST00000243253.3	+	12	1541	c.1357A>G	c.(1357-1359)Atc>Gtc	p.I453V	SEC61A1_ENST00000464451.1_Missense_Mutation_p.I459V|SEC61A1_ENST00000424880.2_Missense_Mutation_p.I333V|SEC61A1_ENST00000483956.1_3'UTR|RUVBL1_ENST00000464873.1_Intron	NM_013336.3	NP_037468.1	P61619	S61A1_HUMAN	Sec61 alpha 1 subunit (S. cerevisiae)	453					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell growth (GO:0016049)|endoplasmic reticulum organization (GO:0007029)|posttranslational protein targeting to membrane (GO:0006620)|protein targeting to ER (GO:0045047)|response to interferon-gamma (GO:0034341)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)			central_nervous_system(1)|kidney(1)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|prostate(4)	21						CGCAGTCACAATCATCTACCA	0.602																																					p.I453V		Atlas-SNP	.											.	SEC61A1	39	.	0			c.A1357G						.						105.0	113.0	110.0					3																	127788431		2203	4300	6503	SO:0001583	missense	29927	exon12			GTCACAATCATCT	AF077032	CCDS3046.1	3q21.3	2008-02-05			ENSG00000058262	ENSG00000058262			18276	protein-coding gene	gene with protein product		609213					Standard	NM_013336		Approved		uc003ekb.3	P61619	OTTHUMG00000159624	ENST00000243253.3:c.1357A>G	chr3.hg19:g.127788431A>G	ENSP00000243253:p.Ile453Val	88.0	0.0		73.0	44.0	NM_013336	P38378|P57726|Q5JPF8|Q8N0Z4|Q8N3U3|Q8NC71|Q9BU16|Q9Y2R3	Missense_Mutation	SNP	ENST00000243253.3	hg19	CCDS3046.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.489634	0.44249	.	.	ENSG00000058262	ENST00000464451;ENST00000243253;ENST00000424880	.	.	.	5.96	5.96	0.96718	SecY subunit domain (2);	0.000000	0.85682	D	0.000000	T	0.70979	0.3286	M	0.71036	2.16	0.80722	D	1	B	0.12630	0.006	B	0.31547	0.132	T	0.68424	-0.5412	9	0.54805	T	0.06	.	16.4343	0.83869	1.0:0.0:0.0:0.0	.	453	P61619	S61A1_HUMAN	V	459;453;333	.	ENSP00000243253:I453V	I	+	1	0	SEC61A1	129271121	1.000000	0.71417	0.958000	0.39756	0.002000	0.02628	9.339000	0.96797	2.285000	0.76669	0.528000	0.53228	ATC	.	.		0.602	SEC61A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356541.2	NM_013336	
MBD4	8930	hgsc.bcm.edu	37	3	129150366	129150366	+	Missense_Mutation	SNP	T	T	A	rs370417942		TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:129150366T>A	ENST00000249910.1	-	8	1896	c.1721A>T	c.(1720-1722)cAt>cTt	p.H574L	EFCAB12_ENST00000326085.3_5'Flank|MBD4_ENST00000503197.1_3'UTR|EFCAB12_ENST00000505956.1_5'Flank|MBD4_ENST00000429544.2_Missense_Mutation_p.H568L|MBD4_ENST00000393278.2_Missense_Mutation_p.H256L|MBD4_ENST00000509587.1_5'Flank	NM_003925.1	NP_003916.1	O95243	MBD4_HUMAN	methyl-CpG binding domain protein 4	574					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)	22						TAATTTTTCATGATTTTCCCA	0.358								Base excision repair (BER), DNA glycosylases																													p.H574L		Atlas-SNP	.											.	MBD4	53	.	0			c.A1721T						.	T	LEU/HIS	0,4406		0,0,2203	192.0	202.0	198.0		1721	5.1	1.0	3		198	1,8599	1.2+/-3.3	0,1,4299	no	missense	MBD4	NM_003925.1	99	0,1,6502	AA,AT,TT		0.0116,0.0,0.0077	possibly-damaging	574/581	129150366	1,13005	2203	4300	6503	SO:0001583	missense	8930	exon8			TTTTCATGATTTT	AF072250	CCDS3058.1, CCDS63766.1, CCDS63767.1, CCDS63768.1, CCDS63769.1	3q21.3	2004-03-02			ENSG00000129071	ENSG00000129071			6919	protein-coding gene	gene with protein product		603574				9774669, 10097147	Standard	NM_003925		Approved	MED1	uc003emh.2	O95243	OTTHUMG00000159463	ENST00000249910.1:c.1721A>T	chr3.hg19:g.129150366T>A	ENSP00000249910:p.His574Leu	63.0	0.0		57.0	6.0	NM_003925	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000249910.1	hg19	CCDS3058.1	.	.	.	.	.	.	.	.	.	.	T	16.81	3.225794	0.58668	0.0	1.16E-4	ENSG00000129071	ENST00000429544;ENST00000249910;ENST00000393278	T;T;T	0.42131	0.98;0.98;0.98	5.12	5.12	0.69794	DNA glycosylase (2);	0.107611	0.64402	D	0.000007	T	0.35364	0.0929	L	0.39898	1.24	0.53005	D	0.999967	P;P;P	0.39847	0.536;0.691;0.565	B;B;B	0.39771	0.251;0.309;0.163	T	0.20405	-1.0276	10	0.51188	T	0.08	-6.5319	10.4915	0.44754	0.0:0.0787:0.0:0.9213	.	256;568;574	Q2MD36;O95243-2;O95243	.;.;MBD4_HUMAN	L	568;574;256	ENSP00000394080:H568L;ENSP00000249910:H574L;ENSP00000376959:H256L	ENSP00000249910:H574L	H	-	2	0	MBD4	130633056	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.739000	0.55075	2.078000	0.62432	0.529000	0.55759	CAT	.	.		0.358	MBD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355529.1	NM_003925	
UBA5	79876	hgsc.bcm.edu	37	3	132389819	132389819	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr3:132389819T>G	ENST00000356232.4	+	6	1577	c.505T>G	c.(505-507)Tta>Gta	p.L169V	UBA5_ENST00000494238.2_Missense_Mutation_p.L113V|UBA5_ENST00000264991.4_Missense_Mutation_p.L113V|UBA5_ENST00000493720.2_Missense_Mutation_p.L169V|UBA5_ENST00000473651.1_Missense_Mutation_p.L169V	NM_024818.3	NP_079094.1	Q9GZZ9	UBA5_HUMAN	ubiquitin-like modifier activating enzyme 5	169					protein ufmylation (GO:0071569)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|UFM1 activating enzyme activity (GO:0071566)			breast(2)|endometrium(4)|kidney(4)|large_intestine(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						TAATGGTGGGTTAGAAGAAGG	0.338																																					p.L169V		Atlas-SNP	.											.	UBA5	33	.	0			c.T505G						.						181.0	179.0	180.0					3																	132389819		2203	4300	6503	SO:0001583	missense	79876	exon6			GGTGGGTTAGAAG	AY253672	CCDS3076.1, CCDS3077.1	3q22	2007-11-30	2007-11-30	2007-11-30	ENSG00000081307	ENSG00000081307		"""Ubiquitin-like modifier activating enzymes"""	23230	protein-coding gene	gene with protein product	"""UBA5, ubiquitin-activating enzyme E1 homolog (yeast)"""	610552	"""ubiquitin-activating enzyme E1-domain containing 1"""	UBE1DC1		11230166, 15071506	Standard	NM_198329		Approved	FLJ23251	uc003epa.4	Q9GZZ9	OTTHUMG00000159759	ENST00000356232.4:c.505T>G	chr3.hg19:g.132389819T>G	ENSP00000348565:p.Leu169Val	107.0	0.0		122.0	61.0	NM_024818	A6NJL3|D3DNC8|Q96ST1	Missense_Mutation	SNP	ENST00000356232.4	hg19	CCDS3076.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.725365	0.30593	.	.	ENSG00000081307	ENST00000264991;ENST00000356232;ENST00000493720;ENST00000473651;ENST00000494238;ENST00000464068	D;D;D;D;D	0.85339	-1.9;-1.94;-1.97;-1.97;-1.9	5.58	3.01	0.34805	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.134693	0.50627	D	0.000117	T	0.77505	0.4140	L	0.55103	1.725	0.50813	D	0.999894	B;B	0.12013	0.005;0.005	B;B	0.14578	0.01;0.011	T	0.69394	-0.5157	10	0.36615	T	0.2	-5.278	3.8234	0.08845	0.2821:0.14:0.0:0.578	.	169;169	E7EWE1;Q9GZZ9	.;UBA5_HUMAN	V	113;169;169;169;113;79	ENSP00000264991:L113V;ENSP00000348565:L169V;ENSP00000417879:L169V;ENSP00000424984:L169V;ENSP00000418807:L113V	ENSP00000264991:L113V	L	+	1	2	UBA5	133872509	0.060000	0.20803	0.998000	0.56505	0.996000	0.88848	0.372000	0.20467	0.901000	0.36495	0.533000	0.62120	TTA	.	.		0.338	UBA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357187.2	NM_024818	
GC	2638	hgsc.bcm.edu	37	4	72649749	72649749	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr4:72649749A>T	ENST00000504199.1	-	2	138	c.44T>A	c.(43-45)cTc>cAc	p.L15H	GC_ENST00000273951.8_5'UTR|GC_ENST00000513476.1_5'UTR	NM_001204307.1	NP_001191236.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)	0					small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	TCTACCAGAGAGTCTTGCAGC	0.408																																					p.L15H		Atlas-SNP	.											.	GC	132	.	0			c.T44A						.						77.0	76.0	76.0					4																	72649749		2203	4300	6503	SO:0001583	missense	2638	exon2			CCAGAGAGTCTTG	L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000504199.1:c.44T>A	chr4.hg19:g.72649749A>T	ENSP00000421725:p.Leu15His	373.0	0.0		257.0	91.0	NM_001204307	B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	Missense_Mutation	SNP	ENST00000504199.1	hg19	CCDS56332.1	.	.	.	.	.	.	.	.	.	.	.	11.03	1.519869	0.27211	.	.	ENSG00000145321	ENST00000504199	T	0.59772	0.24	4.73	-2.29	0.06805	.	.	.	.	.	T	0.33585	0.0868	N	0.08118	0	0.09310	N	1	P	0.39964	0.697	B	0.40901	0.343	T	0.28138	-1.0053	9	0.87932	D	0	.	5.1955	0.15233	0.4817:0.1575:0.3609:0.0	.	15	D6RAK8	.	H	15	ENSP00000421725:L15H	ENSP00000421725:L15H	L	-	2	0	GC	72868613	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	1.699000	0.37804	-0.208000	0.10171	-0.271000	0.10264	CTC	.	.		0.408	GC-006	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362266.1		
ALB	213	hgsc.bcm.edu	37	4	74275109	74275109	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr4:74275109T>C	ENST00000503124.1	+	3	277	c.70T>C	c.(70-72)Tat>Cat	p.Y24H	ALB_ENST00000401494.3_Missense_Mutation_p.Y59H|ALB_ENST00000509063.1_Missense_Mutation_p.Y174H|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000415165.2_Intron|ALB_ENST00000295897.4_Missense_Mutation_p.Y174H			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TCCTTACTTTTATGCCCCGGA	0.348																																					p.Y174H		Atlas-SNP	.											.	ALB	132	.	0			c.T520C						.						67.0	72.0	71.0					4																	74275109		2203	4299	6502	SO:0001583	missense	213	exon5			TACTTTTATGCCC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.70T>C	chr4.hg19:g.74275109T>C	ENSP00000421027:p.Tyr24His	307.0	0.0		184.0	66.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.0|24.0	4.479187|4.479187	0.84747|0.84747	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000511370|ENST00000441319;ENST00000295897;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	.|T;T;T;T;T	.|0.74737	.|-0.87;-0.87;0.87;-0.87;0.87	5.55|5.55	5.55|5.55	0.83447|0.83447	.|Serum albumin-like (1);Serum albumin, N-terminal (3);	.|0.159919	.|0.44097	.|D	.|0.000493	D|D	0.87517|0.87517	0.6197|0.6197	M|M	0.86953|0.86953	2.85|2.85	0.44055|0.44055	D|D	0.996798|0.996798	.|D;D;P;D	.|0.76494	.|0.998;0.999;0.861;0.968	.|D;D;P;D	.|0.77557	.|0.99;0.99;0.831;0.931	D|D	0.89592|0.89592	0.3828|0.3828	5|10	.|0.87932	.|D	.|0	-32.146|-32.146	14.6717|14.6717	0.68948|0.68948	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|59;24;174;174	.|B7WNR0;D6RHD5;A6NBZ8;P02768	.|.;.;.;ALBU_HUMAN	S|H	18|176;174;24;174;59;183	.|ENSP00000392541:Y176H;ENSP00000295897:Y174H;ENSP00000421027:Y24H;ENSP00000422784:Y174H;ENSP00000384695:Y59H	.|ENSP00000295897:Y174H	L|Y	+|+	2|1	0|0	ALB|ALB	74493973|74493973	0.996000|0.996000	0.38824|0.38824	0.997000|0.997000	0.53966|0.53966	0.938000|0.938000	0.57974|0.57974	2.327000|2.327000	0.43858|0.43858	2.333000|2.333000	0.79357|0.79357	0.482000|0.482000	0.46254|0.46254	TTA|TAT	.	.		0.348	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
DSPP	1834	hgsc.bcm.edu	37	4	88533640	88533640	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr4:88533640A>T	ENST00000282478.7	+	3	335	c.302A>T	c.(301-303)aAc>aTc	p.N101I	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.N101I			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	101					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		ACATTAGCAAACGAAGAGGGG	0.438																																					p.N101I		Atlas-SNP	.											.	DSPP	174	.	0			c.A302T						.						95.0	93.0	93.0					4																	88533640		1913	4124	6037	SO:0001583	missense	1834	exon4			TAGCAAACGAAGA	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.302A>T	chr4.hg19:g.88533640A>T	ENSP00000282478:p.Asn101Ile	449.0	0.0		328.0	123.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	12.91	2.078154	0.36662	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.91407	-2.84;-2.84	5.24	2.85	0.33270	.	0.486802	0.15166	N	0.276902	D	0.85283	0.5661	L	0.34521	1.04	0.09310	N	1	B	0.32467	0.372	B	0.36989	0.238	T	0.77940	-0.2399	10	0.87932	D	0	-11.2723	7.4067	0.26995	0.8187:0.0:0.1813:0.0	.	101	Q9NZW4	DSPP_HUMAN	I	101	ENSP00000382213:N101I;ENSP00000282478:N101I	ENSP00000282478:N101I	N	+	2	0	DSPP	88752664	0.023000	0.18921	0.002000	0.10522	0.035000	0.12851	2.741000	0.47426	0.837000	0.34925	0.377000	0.23210	AAC	.	.		0.438	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
ADH1A	124	hgsc.bcm.edu	37	4	100201407	100201407	+	Silent	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr4:100201407T>C	ENST00000209668.2	-	7	971	c.858A>G	c.(856-858)gcA>gcG	p.A286A	RP11-696N14.1_ENST00000500358.2_RNA|RP11-696N14.1_ENST00000506160.1_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	286					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TTGTGCCACATGCCTCATGAC	0.448																																					p.A286A		Atlas-SNP	.											.	ADH1A	49	.	0			c.A858G						.						251.0	221.0	231.0					4																	100201407		2203	4300	6503	SO:0001819	synonymous_variant	124	exon7			GCCACATGCCTCA	M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.858A>G	chr4.hg19:g.100201407T>C		137.0	0.0		80.0	22.0	NM_000667	A8K3E3|Q17R68	Silent	SNP	ENST00000209668.2	hg19	CCDS3648.1																																																																																			.	.		0.448	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253669.1	NM_000667	
DCHS2	54798	hgsc.bcm.edu	37	4	155411056	155411056	+	Silent	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr4:155411056G>A	ENST00000339452.1	-	1	1812	c.1452C>T	c.(1450-1452)ggC>ggT	p.G484G	DCHS2_ENST00000456341.2_Silent_p.G477G|DCHS2_ENST00000443500.1_Silent_p.G484G	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1643	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CCCCTGGGGGGCCGCCGGGTA	0.632																																					p.G484G		Atlas-SNP	.											.	DCHS2	594	.	0			c.C1452T						.						17.0	22.0	21.0					4																	155411056		692	1591	2283	SO:0001819	synonymous_variant	54798	exon1			TGGGGGGCCGCCG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1452C>T	chr4.hg19:g.155411056G>A		53.0	0.0		51.0	24.0	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000339452.1	hg19	CCDS47150.1																																																																																			.	.		0.632	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
WDR17	116966	hgsc.bcm.edu	37	4	177056301	177056301	+	Missense_Mutation	SNP	G	G	A	rs140987021		TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr4:177056301G>A	ENST00000280190.4	+	9	1369	c.1213G>A	c.(1213-1215)Gat>Aat	p.D405N	WDR17_ENST00000393643.2_Missense_Mutation_p.D381N|WDR17_ENST00000508596.1_Missense_Mutation_p.D381N|WDR17_ENST00000507824.2_Missense_Mutation_p.D388N			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	405										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CAAACCTGACGATCCTAATCT	0.353																																					p.D405N		Atlas-SNP	.											.	WDR17	198	.	0			c.G1213A						.	G	ASN/ASP,ASN/ASP	0,4406		0,0,2203	121.0	122.0	122.0		1213,1141	2.4	1.0	4	dbSNP_134	122	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	WDR17	NM_170710.4,NM_181265.3	23,23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	405/1323,381/1284	177056301	1,13005	2203	4300	6503	SO:0001583	missense	116966	exon9			CCTGACGATCCTA	AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.1213G>A	chr4.hg19:g.177056301G>A	ENSP00000280190:p.Asp405Asn	341.0	0.0		296.0	107.0	NM_170710	E7EQX0|Q0QD35	Missense_Mutation	SNP	ENST00000280190.4	hg19	CCDS3825.1	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326502	0.24080	0.0	1.16E-4	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.58652	0.35;3.58;0.32	5.5	2.42	0.29668	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (2);WD40-repeat-containing domain (1);	0.265065	0.38164	N	0.001790	T	0.30324	0.0761	N	0.13198	0.31	0.48571	D	0.999678	B;B	0.19445	0.036;0.036	B;B	0.18871	0.023;0.023	T	0.15150	-1.0447	10	0.05525	T	0.97	-17.5458	6.7154	0.23300	0.433:0.0:0.567:0.0	.	381;405	E7EQX0;Q8IZU2	.;WDR17_HUMAN	N	381;381;405;388	ENSP00000422763:D381N;ENSP00000377258:D381N;ENSP00000280190:D405N	ENSP00000280190:D405N	D	+	1	0	WDR17	177293295	1.000000	0.71417	0.998000	0.56505	0.740000	0.42216	3.339000	0.52135	0.703000	0.31848	0.650000	0.86243	GAT	.	G|1.000;A|0.000		0.353	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362334.2		
ZFP42	132625	hgsc.bcm.edu	37	4	188924482	188924482	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr4:188924482A>T	ENST00000326866.4	+	4	929	c.521A>T	c.(520-522)aAg>aTg	p.K174M	ZFP42_ENST00000509524.1_Missense_Mutation_p.K174M	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	174					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TTTGCTAGAAAGAAGCCCCCC	0.468																																					p.K174M		Atlas-SNP	.											.	ZFP42	87	.	0			c.A521T						.						97.0	110.0	106.0					4																	188924482		2203	4300	6503	SO:0001583	missense	132625	exon4			CTAGAAAGAAGCC	AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.521A>T	chr4.hg19:g.188924482A>T	ENSP00000317686:p.Lys174Met	77.0	0.0		66.0	34.0	NM_174900	D3DP65|Q8WXE2	Missense_Mutation	SNP	ENST00000326866.4	hg19	CCDS3849.1	.	.	.	.	.	.	.	.	.	.	A	7.168	0.587067	0.13812	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	T;T	0.63744	-0.06;-0.06	4.27	0.326	0.15908	.	0.051145	0.85682	U	0.000000	T	0.36276	0.0961	N	0.21194	0.64	0.20196	N	0.999921	B	0.34103	0.437	B	0.23716	0.048	T	0.14282	-1.0478	10	0.36615	T	0.2	.	5.3096	0.15823	0.4679:0.3591:0.0:0.173	.	174	Q96MM3	ZFP42_HUMAN	M	174	ENSP00000317686:K174M;ENSP00000424662:K174M	ENSP00000317686:K174M	K	+	2	0	ZFP42	189161476	0.000000	0.05858	0.124000	0.21820	0.126000	0.20510	-0.423000	0.07034	0.070000	0.16634	0.533000	0.62120	AAG	.	.		0.468	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359794.1	NM_174900	
ZCCHC9	84240	hgsc.bcm.edu	37	5	80604841	80604841	+	Silent	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr5:80604841A>G	ENST00000254037.2	+	3	3767	c.612A>G	c.(610-612)aaA>aaG	p.K204K	ZCCHC9_ENST00000380199.5_Silent_p.K204K|ZCCHC9_ENST00000407610.3_Silent_p.K204K|ZCCHC9_ENST00000438268.2_Silent_p.K204K|ZCCHC9_ENST00000506458.1_3'UTR			Q8N567	ZCHC9_HUMAN	zinc finger, CCHC domain containing 9	204					negative regulation of phosphatase activity (GO:0010923)		poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)	13		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;8.18e-45)|Epithelial(54;2.72e-39)|all cancers(79;7.33e-34)		ATAATCCCAAAGGACTCTATG	0.383																																					p.K204K		Atlas-SNP	.											.	ZCCHC9	26	.	0			c.A612G						.						116.0	103.0	107.0					5																	80604841		2203	4300	6503	SO:0001819	synonymous_variant	84240	exon4			TCCCAAAGGACTC	BC014841	CCDS4054.1	5q14.1	2013-01-09			ENSG00000131732	ENSG00000131732		"""Zinc fingers, CCHC domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25424	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 41"""					12477932	Standard	NM_032280		Approved	DKFZp761J139, PPP1R41	uc003khi.3	Q8N567	OTTHUMG00000119014	ENST00000254037.2:c.612A>G	chr5.hg19:g.80604841A>G		147.0	0.0		117.0	68.0	NM_001131036	B2RAE7|Q9H027	Silent	SNP	ENST00000254037.2	hg19	CCDS4054.1																																																																																			.	.		0.383	ZCCHC9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239213.1	NM_032280	
PSD2	84249	hgsc.bcm.edu	37	5	139213348	139213348	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr5:139213348G>A	ENST00000274710.3	+	8	1536	c.1331G>A	c.(1330-1332)gGc>gAc	p.G444D		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	444	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGAATGATGGCCAAGACTTT	0.493																																					p.G444D		Atlas-SNP	.											.	PSD2	88	.	0			c.G1331A						.						227.0	201.0	210.0					5																	139213348		2203	4300	6503	SO:0001583	missense	84249	exon8			ATGATGGCCAAGA	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.1331G>A	chr5.hg19:g.139213348G>A	ENSP00000274710:p.Gly444Asp	78.0	0.0		111.0	30.0	NM_032289	D3DQD3|Q8N3J8	Missense_Mutation	SNP	ENST00000274710.3	hg19	CCDS4216.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.656086	0.88056	.	.	ENSG00000146005	ENST00000274710	T	0.35605	1.3	5.07	5.07	0.68467	SEC7-like, alpha orthogonal bundle (1);SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.66528	0.2798	M	0.89287	3.02	0.80722	D	1	D	0.71674	0.998	D	0.72075	0.976	T	0.74016	-0.3800	10	0.87932	D	0	.	16.9996	0.86378	0.0:0.0:1.0:0.0	.	444	Q9BQI7	PSD2_HUMAN	D	444	ENSP00000274710:G444D	ENSP00000274710:G444D	G	+	2	0	PSD2	139193532	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.671000	0.91174	2.518000	0.84900	0.542000	0.68232	GGC	.	.		0.493	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
ZNF451	26036	hgsc.bcm.edu	37	6	56966810	56966810	+	Intron	SNP	A	A	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr6:56966810A>C	ENST00000370706.4	+	3	430				ZNF451_ENST00000491832.2_Intron|ZNF451_ENST00000357489.3_Intron|ZNF451_ENST00000370708.4_Missense_Mutation_p.K532N|ZNF451_ENST00000370702.1_Intron	NM_001031623.2	NP_001026794.1	Q9Y4E5	ZN451_HUMAN	zinc finger protein 451						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32	Lung NSC(77;0.145)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GATACTCCAAAGGGGATTGGT	0.353																																					p.K532N		Atlas-SNP	.											.	ZNF451	181	.	0			c.A1596C						.																																			SO:0001627	intron_variant	26036	exon4			CTCCAAAGGGGAT	AB011148	CCDS4960.1, CCDS43477.1, CCDS59026.1	6p12.1	2012-08-08			ENSG00000112200	ENSG00000112200		"""Zinc fingers, C2H2-type"""	21091	protein-coding gene	gene with protein product		615708				9628581	Standard	NM_001031623		Approved	KIAA0576, COASTER, dJ417I1.1, KIAA1702	uc003pdm.2	Q9Y4E5	OTTHUMG00000014916	ENST00000370706.4:c.186+2871A>C	chr6.hg19:g.56966810A>C		182.0	0.0		114.0	38.0	NM_001257273	Q5VVE9|Q5VVF1|Q86YE4|Q8N380|Q8TD15|Q9C0G1|Q9NQM1	Missense_Mutation	SNP	ENST00000370706.4	hg19	CCDS43477.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.505858	0.44558	.	.	ENSG00000112200	ENST00000370708	T	0.68025	-0.3	4.4	4.4	0.53042	.	.	.	.	.	T	0.40791	0.1131	.	.	.	0.80722	D	1	B	0.34290	0.447	B	0.32022	0.139	T	0.44997	-0.9291	8	0.37606	T	0.19	.	10.361	0.43994	1.0:0.0:0.0:0.0	.	532	Q9Y4E5-4	.	N	532	ENSP00000359742:K532N	ENSP00000359742:K532N	K	+	3	2	ZNF451	57074769	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.218000	0.42889	2.208000	0.71279	0.529000	0.55759	AAA	.	.		0.353	ZNF451-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041035.2	NM_015555	
IKZF1	10320	hgsc.bcm.edu	37	7	50455094	50455094	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr7:50455094G>T	ENST00000331340.3	+	6	796	c.641G>T	c.(640-642)aGc>aTc	p.S214I	IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000438033.1_Missense_Mutation_p.S127I|IKZF1_ENST00000349824.4_Intron|IKZF1_ENST00000439701.1_Intron|IKZF1_ENST00000357364.4_Intron|IKZF1_ENST00000440768.2_Intron|IKZF1_ENST00000359197.5_Intron|IKZF1_ENST00000343574.5_Missense_Mutation_p.S127I	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	214				S -> T (in Ref. 2; AAB50683). {ECO:0000305}.	B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				AAACAGCGAAGCTCTTTAGAG	0.498			"""D,T"""	BCL6	"""ALL, DLBCL"""																																p.S214I		Atlas-SNP	.		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	.	IKZF1	613	.	131	Unknown(131)	haematopoietic_and_lymphoid_tissue(131)	c.G641T						.						46.0	48.0	48.0					7																	50455094		1868	4100	5968	SO:0001583	missense	10320	exon6			AGCGAAGCTCTTT	U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.641G>T	chr7.hg19:g.50455094G>T	ENSP00000331614:p.Ser214Ile	415.0	1.0		278.0	110.0	NM_006060	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	ENST00000331340.3	hg19		.	.	.	.	.	.	.	.	.	.	G	32	5.171940	0.94807	.	.	ENSG00000185811	ENST00000343574;ENST00000331340;ENST00000438033	T;T;T	0.62788	2.22;0.0;2.22	5.77	5.77	0.91146	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.71484	0.3345	.	.	.	0.80722	D	1	P;P	0.50819	0.939;0.831	P;B	0.49361	0.608;0.235	T	0.74627	-0.3602	9	0.87932	D	0	-7.2507	19.9886	0.97358	0.0:0.0:1.0:0.0	.	127;214	Q13422-2;Q13422	.;IKZF1_HUMAN	I	127;214;127	ENSP00000342750:S127I;ENSP00000331614:S214I;ENSP00000396554:S127I	ENSP00000331614:S214I	S	+	2	0	IKZF1	50422588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.823000	0.99369	2.726000	0.93360	0.655000	0.94253	AGC	.	.		0.498	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000342242.1	NM_006060	
PCLO	27445	hgsc.bcm.edu	37	7	82584094	82584094	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr7:82584094G>C	ENST00000333891.9	-	5	6512	c.6175C>G	c.(6175-6177)Cta>Gta	p.L2059V	PCLO_ENST00000423517.2_Missense_Mutation_p.L2059V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCAGCATCTAGTAGTTTCCTT	0.438																																					p.L2059V		Atlas-SNP	.											.	PCLO	1506	.	0			c.C6175G						.						92.0	86.0	88.0					7																	82584094		1907	4118	6025	SO:0001583	missense	27445	exon5			CATCTAGTAGTTT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.6175C>G	chr7.hg19:g.82584094G>C	ENSP00000334319:p.Leu2059Val	90.0	0.0		75.0	27.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	1.998	-0.430087	0.04701	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.26067	1.76;1.77	5.64	-2.76	0.05896	.	.	.	.	.	T	0.37073	0.0990	L	0.54323	1.7	0.36908	D	0.890731	D;D	0.65815	0.99;0.995	P;P	0.59825	0.864;0.864	T	0.43669	-0.9377	9	0.87932	D	0	.	12.274	0.54724	0.4997:0.0:0.5003:0.0	.	2059;2059	Q9Y6V0-5;Q9Y6V0-6	.;.	V	1990;2059;2059	ENSP00000334319:L2059V;ENSP00000388393:L2059V	ENSP00000334319:L2059V	L	-	1	2	PCLO	82422030	0.963000	0.33076	0.003000	0.11579	0.619000	0.37552	1.756000	0.38390	-0.790000	0.04492	0.561000	0.74099	CTA	.	.		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
SEMA3E	9723	hgsc.bcm.edu	37	7	83037763	83037763	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr7:83037763G>C	ENST00000307792.3	-	6	1058	c.591C>G	c.(589-591)agC>agG	p.S197R	SEMA3E_ENST00000427262.1_Missense_Mutation_p.S137R	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	197	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				CAGCGTCTCTGCTCCAGTAGT	0.453																																					p.S197R		Atlas-SNP	.											.	SEMA3E	125	.	0			c.C591G						.						58.0	53.0	55.0					7																	83037763		2203	4300	6503	SO:0001583	missense	9723	exon6			GTCTCTGCTCCAG	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.591C>G	chr7.hg19:g.83037763G>C	ENSP00000303212:p.Ser197Arg	174.0	0.0		112.0	41.0	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	hg19	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	G	12.46	1.945456	0.34377	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514;ENST00000442159	T;T;T	0.23754	1.89;1.89;1.89	5.9	1.59	0.23543	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.157402	0.56097	D	0.000023	T	0.17874	0.0429	L	0.38175	1.15	0.23515	N	0.997512	B	0.18610	0.029	B	0.30495	0.116	T	0.20605	-1.0270	10	0.87932	D	0	.	2.1226	0.03730	0.1541:0.1013:0.4231:0.3215	.	197	O15041	SEM3E_HUMAN	R	197;137;197;137	ENSP00000303212:S197R;ENSP00000405052:S137R;ENSP00000412867:S137R	ENSP00000303212:S197R	S	-	3	2	SEMA3E	82875699	0.895000	0.30542	0.993000	0.49108	0.145000	0.21501	-0.038000	0.12144	0.850000	0.35239	0.591000	0.81541	AGC	.	.		0.453	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
CNOT4	4850	hgsc.bcm.edu	37	7	135080633	135080633	+	Silent	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr7:135080633T>A	ENST00000315544.5	-	9	1161	c.882A>T	c.(880-882)atA>atT	p.I294I	CNOT4_ENST00000423368.2_Silent_p.I294I|CNOT4_ENST00000361528.4_Silent_p.I291I|CNOT4_ENST00000541284.1_Silent_p.I294I|CNOT4_ENST00000414802.1_Silent_p.I294I|CNOT4_ENST00000356162.4_Silent_p.I294I|CNOT4_ENST00000428680.2_Silent_p.I291I|CNOT4_ENST00000451834.1_Silent_p.I291I	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	294					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						CACTGTTAGATATCTGAATAA	0.348																																					p.I294I	Ovarian(51;766 1130 5502 35047 50875)	Atlas-SNP	.											.	CNOT4	146	.	0			c.A882T						.						137.0	122.0	127.0					7																	135080633		1860	4097	5957	SO:0001819	synonymous_variant	4850	exon9			GTTAGATATCTGA	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.882A>T	chr7.hg19:g.135080633T>A		110.0	0.0		87.0	30.0	NM_001190850	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Silent	SNP	ENST00000315544.5	hg19	CCDS55166.1																																																																																			.	.		0.348	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
TBXAS1	6916	hgsc.bcm.edu	37	7	139719869	139719869	+	Silent	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr7:139719869T>C	ENST00000336425.5	+	17	1961	c.1572T>C	c.(1570-1572)aaT>aaC	p.N524N	TBXAS1_ENST00000458722.1_Silent_p.N570N|TBXAS1_ENST00000263552.6_Silent_p.N525N|TBXAS1_ENST00000425687.1_Silent_p.N457N|TBXAS1_ENST00000411653.1_3'UTR|TBXAS1_ENST00000448866.1_Silent_p.N524N|TBXAS1_ENST00000436047.2_Silent_p.N525N|TBXAS1_ENST00000416849.2_Silent_p.N571N|TBXAS1_ENST00000414508.2_3'UTR			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	524					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	GTCCAAAAAATGGTGTCTATA	0.443																																					p.N571N		Atlas-SNP	.											.	TBXAS1	121	.	0			c.T1713C						.						86.0	88.0	87.0					7																	139719869		2203	4300	6503	SO:0001819	synonymous_variant	6916	exon14			AAAAAATGGTGTC	L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.1572T>C	chr7.hg19:g.139719869T>C		61.0	0.0		50.0	25.0	NM_001166253	B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Silent	SNP	ENST00000336425.5	hg19																																																																																				.	.		0.443	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000348373.1		
ZBED6CL	113763	hgsc.bcm.edu	37	7	150027750	150027750	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr7:150027750A>C	ENST00000343855.4	+	1	813	c.257A>C	c.(256-258)gAg>gCg	p.E86A	LRRC61_ENST00000493307.1_Intron|LRRC61_ENST00000323078.7_Intron|LRRC61_ENST00000359623.4_Intron	NM_138434.2	NP_612443.1	Q96FA7	ZB6CL_HUMAN	ZBED6 C-terminal like	86																	GGGAAGATTGAGGCCATCCTG	0.557																																					p.E86A		Atlas-SNP	.											.	C7orf29	18	.	0			c.A257C						.						77.0	77.0	77.0					7																	150027750		2203	4300	6503	SO:0001583	missense	113763	exon1			AGATTGAGGCCAT	BC011406	CCDS5900.1	7q35	2013-05-03	2013-05-03	2013-05-03	ENSG00000188707	ENSG00000188707			21720	protein-coding gene	gene with protein product		615252	"""chromosome 7 open reading frame 29"""	C7orf29		23533661	Standard	NM_138434		Approved			Q96FA7	OTTHUMG00000158328	ENST00000343855.4:c.257A>C	chr7.hg19:g.150027750A>C	ENSP00000343242:p.Glu86Ala	64.0	0.0		70.0	24.0	NM_138434		Missense_Mutation	SNP	ENST00000343855.4	hg19	CCDS5900.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.738198	0.49045	.	.	ENSG00000188707	ENST00000343855	.	.	.	3.75	3.75	0.43078	.	0.000000	0.43260	U	0.000598	T	0.43700	0.1259	L	0.32530	0.975	0.26147	N	0.980192	D	0.57257	0.979	P	0.54924	0.764	T	0.29243	-1.0018	9	0.66056	D	0.02	.	11.1273	0.48325	1.0:0.0:0.0:0.0	.	86	Q96FA7	CG029_HUMAN	A	86	.	ENSP00000343242:E86A	E	+	2	0	C7orf29	149658683	0.997000	0.39634	0.940000	0.37924	0.385000	0.30292	2.125000	0.42016	1.674000	0.50907	0.456000	0.33151	GAG	.	.		0.557	ZBED6CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350702.1	NM_138434	
RP1L1	94137	hgsc.bcm.edu	37	8	10467581	10467581	+	Missense_Mutation	SNP	C	C	T	rs143686100		TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr8:10467581C>T	ENST00000382483.3	-	4	4250	c.4027G>A	c.(4027-4029)Gaa>Aaa	p.E1343K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1359	8 X 16 AA approximate tandem repeats of T-E-E-G-L-Q-E-E-G-V-Q-L-E-E-T-K.		Missing (in allele RP1L1-1).|Missing (in allele RP1L1-2).		cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ccttctgtttctttagtttcc	0.488																																					p.E1343K		Atlas-SNP	.											.	RP1L1	453	.	0			c.G4027A						.						89.0	80.0	83.0					8																	10467581		1937	4126	6063	SO:0001583	missense	94137	exon4			CTGTTTCTTTAGT	AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.4027G>A	chr8.hg19:g.10467581C>T	ENSP00000371923:p.Glu1343Lys	40.0	0.0		90.0	11.0	NM_178857	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	ENST00000382483.3	hg19	CCDS43708.1	.	.	.	.	.	.	.	.	.	.	C	7.887	0.731481	0.15507	.	.	ENSG00000183638	ENST00000382483	T	0.04809	3.55	1.84	1.84	0.25277	.	.	.	.	.	T	0.02970	0.0088	N	0.08118	0	0.09310	N	1	B	0.24258	0.1	B	0.19391	0.025	T	0.43845	-0.9366	9	0.42905	T	0.14	.	10.4378	0.44445	0.0:1.0:0.0:0.0	.	1343	A6NKC6	.	K	1343	ENSP00000371923:E1343K	ENSP00000371923:E1343K	E	-	1	0	RP1L1	10504991	0.163000	0.22920	0.005000	0.12908	0.169000	0.22640	2.372000	0.44257	0.986000	0.38683	0.205000	0.17691	GAA	.	.		0.488	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375673.1		
TOX	9760	hgsc.bcm.edu	37	8	59851985	59851985	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr8:59851985A>T	ENST00000361421.1	-	3	507	c.287T>A	c.(286-288)cTg>cAg	p.L96Q		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	96						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GGGGTGACACAGAGAATGGTA	0.488																																					p.L96Q	Pancreas(161;610 1969 17913 21374 22725)	Atlas-SNP	.											.	TOX	83	.	0			c.T287A						.						153.0	131.0	139.0					8																	59851985		2203	4300	6503	SO:0001583	missense	9760	exon3			TGACACAGAGAAT		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.287T>A	chr8.hg19:g.59851985A>T	ENSP00000354842:p.Leu96Gln	189.0	0.0		313.0	111.0	NM_014729	Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	hg19	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.067270	0.76301	.	.	ENSG00000198846	ENST00000361421	T	0.59906	0.23	5.51	5.51	0.81932	.	0.072542	0.56097	D	0.000025	T	0.64627	0.2615	M	0.73598	2.24	0.58432	D	0.999998	D	0.61080	0.989	P	0.47573	0.55	T	0.68379	-0.5424	9	.	.	.	.	15.6313	0.76912	1.0:0.0:0.0:0.0	.	96	O94900	TOX_HUMAN	Q	96	ENSP00000354842:L96Q	.	L	-	2	0	TOX	60014539	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.726000	0.84824	2.105000	0.64084	0.482000	0.46254	CTG	.	.		0.488	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
EEF1D	1936	hgsc.bcm.edu	37	8	144663449	144663449	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr8:144663449A>G	ENST00000529272.1	-	4	639	c.239T>C	c.(238-240)cTc>cCc	p.L80P	NAPRT1_ENST00000426292.3_5'Flank|EEF1D_ENST00000317198.6_Missense_Mutation_p.L80P|EEF1D_ENST00000419152.2_Missense_Mutation_p.L80P|EEF1D_ENST00000442189.2_Missense_Mutation_p.L446P|EEF1D_ENST00000423316.2_Missense_Mutation_p.L446P|EEF1D_ENST00000528610.1_Missense_Mutation_p.L56P|EEF1D_ENST00000531621.1_Intron|EEF1D_ENST00000532400.1_Intron|RP11-661A12.7_ENST00000529247.1_RNA|EEF1D_ENST00000532741.1_Missense_Mutation_p.L496P|NAPRT1_ENST00000449291.2_5'Flank|EEF1D_ENST00000526838.1_Intron|EEF1D_ENST00000524624.1_Missense_Mutation_p.L56P|NAPRT1_ENST00000276844.7_5'Flank|NAPRT1_ENST00000435154.3_5'Flank|EEF1D_ENST00000395119.3_Missense_Mutation_p.L80P			P29692	EF1D_HUMAN	eukaryotic translation elongation factor 1 delta (guanine nucleotide exchange protein)	80	Leucine-zipper.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|cervix(1)|endometrium(1)|kidney(4)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.239)			CCGGACGACGAGCTCACCGTG	0.692																																					p.L446P		Atlas-SNP	.											.	EEF1D	48	.	0			c.T1337C						.						28.0	27.0	27.0					8																	144663449		2202	4293	6495	SO:0001583	missense	1936	exon6			ACGACGAGCTCAC	AK024550	CCDS6404.1, CCDS6405.1, CCDS47930.1, CCDS56559.1	8q24	2011-09-15			ENSG00000104529	ENSG00000104529			3211	protein-coding gene	gene with protein product		130592				8334168	Standard	NM_001960		Approved	EF-1D, FLJ20897	uc003yyt.3	P29692	OTTHUMG00000165191	ENST00000529272.1:c.239T>C	chr8.hg19:g.144663449A>G	ENSP00000434872:p.Leu80Pro	90.0	0.0		269.0	143.0	NM_001130053	B4DDU4|D3DWK3|E9PBQ9|Q4VBZ6|Q969J1|Q96I38	Missense_Mutation	SNP	ENST00000529272.1	hg19	CCDS6405.1	.	.	.	.	.	.	.	.	.	.	A	16.04	3.009247	0.54361	.	.	ENSG00000104529	ENST00000419152;ENST00000532741;ENST00000442189;ENST00000528610;ENST00000395119;ENST00000529272;ENST00000423316;ENST00000356793;ENST00000317198;ENST00000337369;ENST00000524624;ENST00000534380;ENST00000534377;ENST00000533204;ENST00000530191;ENST00000531218;ENST00000533494;ENST00000530445;ENST00000533749	.	.	.	4.64	4.64	0.57946	.	0.066972	0.56097	D	0.000023	T	0.76442	0.3988	M	0.66378	2.025	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.998;0.999;0.999;0.999;0.999	T	0.79533	-0.1764	9	0.87932	D	0	.	13.5304	0.61619	1.0:0.0:0.0:0.0	.	446;374;80;496;446	D3DWK1;F8W934;P29692;E9PRY8;P29692-2	.;.;EF1D_HUMAN;.;.	P	80;496;446;56;80;80;446;374;80;446;56;80;56;80;80;80;80;80;96	.	ENSP00000317399:L80P	L	-	2	0	EEF1D	144734592	1.000000	0.71417	0.847000	0.33407	0.008000	0.06430	6.529000	0.73812	1.861000	0.53984	0.443000	0.29094	CTC	.	.		0.692	EEF1D-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382592.2	NM_032378	
ZNF7	7553	hgsc.bcm.edu	37	8	146067920	146067920	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr8:146067920A>C	ENST00000528372.1	+	5	1668	c.1428A>C	c.(1426-1428)aaA>aaC	p.K476N	ZNF7_ENST00000446747.2_Missense_Mutation_p.K487N|ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000544249.1_Missense_Mutation_p.K380N|ZNF7_ENST00000325217.5_Intron|ZNF7_ENST00000325241.6_Missense_Mutation_p.K476N			P17097	ZNF7_HUMAN	zinc finger protein 7	476					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		AGTGTGGCAAAGGCTTTGTTC	0.443																																					p.K476N		Atlas-SNP	.											.	ZNF7	62	.	0			c.A1428C						.						82.0	73.0	76.0					8																	146067920		2203	4300	6503	SO:0001583	missense	7553	exon5			TGGCAAAGGCTTT	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.1428A>C	chr8.hg19:g.146067920A>C	ENSP00000432724:p.Lys476Asn	121.0	0.0		265.0	76.0	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Missense_Mutation	SNP	ENST00000528372.1	hg19	CCDS6435.1	.	.	.	.	.	.	.	.	.	.	A	18.16	3.561310	0.65538	.	.	ENSG00000147789	ENST00000325241;ENST00000446747;ENST00000544249;ENST00000528372	T;T;T;T	0.35973	1.28;3.15;3.15;1.28	4.93	-3.21	0.05140	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49916	D	0.000136	T	0.63546	0.2520	M	0.93638	3.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.995	T	0.72004	-0.4421	9	.	.	.	-26.092	13.3195	0.60424	0.3947:0.0:0.6053:0.0	.	487;476	B4DT08;P17097	.;ZNF7_HUMAN	N	476;487;380;476	ENSP00000320627:K476N;ENSP00000393260:K487N;ENSP00000439424:K380N;ENSP00000432724:K476N	.	K	+	3	2	ZNF7	146038724	0.013000	0.17824	0.867000	0.34043	0.967000	0.64934	-0.419000	0.07071	-0.455000	0.07054	0.533000	0.62120	AAA	.	.		0.443	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
PRUNE2	158471	hgsc.bcm.edu	37	9	79321163	79321163	+	Silent	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr9:79321163T>C	ENST00000376718.3	-	8	6150	c.6027A>G	c.(6025-6027)acA>acG	p.T2009T	PRUNE2_ENST00000428286.1_Silent_p.T1650T	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2009					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TGCTTGAATTTGTCATCTCAC	0.418																																					p.T2009T		Atlas-SNP	.											.	PRUNE2	331	.	0			c.A6027G						.						111.0	97.0	101.0					9																	79321163		1568	3582	5150	SO:0001819	synonymous_variant	158471	exon8			TGAATTTGTCATC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6027A>G	chr9.hg19:g.79321163T>C		150.0	0.0		121.0	44.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	hg19	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	T	0.011	-1.710157	0.00712	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.74	2.04	0.26737	.	.	.	.	.	T	0.31389	0.0795	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.21895	-1.0232	4	.	.	.	-1.8315	6.0531	0.19796	0.1215:0.1328:0.0:0.7457	.	.	.	.	E	1331	.	.	K	-	1	0	PRUNE2	78510983	0.004000	0.15560	0.001000	0.08648	0.021000	0.10359	0.944000	0.29043	0.156000	0.19299	0.459000	0.35465	AAA	.	.		0.418	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123239658	123239658	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr9:123239658T>C	ENST00000349780.4	-	15	1876	c.1697A>G	c.(1696-1698)cAt>cGt	p.H566R	CDK5RAP2_ENST00000360190.4_Missense_Mutation_p.H566R|CDK5RAP2_ENST00000359309.3_Missense_Mutation_p.H566R|CDK5RAP2_ENST00000360822.3_Missense_Mutation_p.H566R	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	566					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TTTGACCAGATGGGTATAGAT	0.433											OREG0019439	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H566R		Atlas-SNP	.											.	CDK5RAP2	157	.	0			c.A1697G						.						241.0	194.0	210.0					9																	123239658		2203	4300	6503	SO:0001583	missense	55755	exon15			ACCAGATGGGTAT	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.1697A>G	chr9.hg19:g.123239658T>C	ENSP00000343818:p.His566Arg	45.0	0.0	1525	44.0	15.0	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Missense_Mutation	SNP	ENST00000349780.4	hg19	CCDS6823.1	.	.	.	.	.	.	.	.	.	.	T	9.546	1.114769	0.20795	.	.	ENSG00000136861	ENST00000360822;ENST00000359309;ENST00000349780;ENST00000360190;ENST00000345313	T;T;T;T	0.03801	3.91;3.8;3.91;3.82	5.91	2.39	0.29439	.	0.881349	0.09865	N	0.745673	T	0.02970	0.0088	N	0.17082	0.46	0.18873	N	0.999982	B;B;B;B	0.15473	0.002;0.001;0.013;0.001	B;B;B;B	0.13407	0.003;0.003;0.009;0.001	T	0.48885	-0.8995	10	0.09843	T	0.71	.	6.2371	0.20768	0.0:0.3166:0.0:0.6834	.	367;566;566;566	Q6MZT4;Q96SN8-2;Q96SN8-4;Q96SN8	.;.;.;CK5P2_HUMAN	R	566;566;566;566;568	ENSP00000354065:H566R;ENSP00000352258:H566R;ENSP00000343818:H566R;ENSP00000353317:H566R	ENSP00000341695:H568R	H	-	2	0	CDK5RAP2	122279479	0.836000	0.29430	0.748000	0.31131	0.995000	0.86356	0.986000	0.29590	0.501000	0.28013	0.533000	0.62120	CAT	.	.		0.433	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
FCN1	2219	hgsc.bcm.edu	37	9	137804942	137804942	+	Missense_Mutation	SNP	C	C	A	rs143987379		TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr9:137804942C>A	ENST00000371806.3	-	6	479	c.388G>T	c.(388-390)Ggc>Tgc	p.G130C		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	130	A domain; contributes to trimerization.|Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)			endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		GTGTGCCAGCCGCTCAGGAAA	0.677																																					p.G130C		Atlas-SNP	.											.	FCN1	62	.	0			c.G388T						.						44.0	43.0	43.0					9																	137804942		2203	4300	6503	SO:0001583	missense	2219	exon6			GCCAGCCGCTCAG	D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.388G>T	chr9.hg19:g.137804942C>A	ENSP00000360871:p.Gly130Cys	119.0	0.0		83.0	23.0	NM_002003	Q5VYV5|Q92596	Missense_Mutation	SNP	ENST00000371806.3	hg19	CCDS6985.1	.	.	.	.	.	.	.	.	.	.	C	8.367	0.834333	0.16820	.	.	ENSG00000085265	ENST00000371807;ENST00000371806;ENST00000308299	T	0.37584	1.19	3.39	1.5	0.22942	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	.	.	.	.	T	0.71550	0.3353	H	0.99312	4.51	0.40125	D	0.976645	D	0.89917	1.0	D	0.97110	1.0	T	0.73780	-0.3875	9	0.87932	D	0	.	7.7609	0.28951	0.0:0.7863:0.0:0.2137	.	130	O00602	FCN1_HUMAN	C	130;130;118	ENSP00000360871:G130C	ENSP00000308877:G118C	G	-	1	0	FCN1	136944763	0.938000	0.31826	0.294000	0.24946	0.000000	0.00434	1.907000	0.39897	0.249000	0.21456	-1.114000	0.02060	GGC	.	C|1.000;T|0.000		0.677	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054963.1	NM_002003	
PTF1A	256297	hgsc.bcm.edu	37	10	23481461	23481461	+	Start_Codon_SNP	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr10:23481461T>A	ENST00000376504.3	+	1	206	c.2T>A	c.(1-3)aTg>aAg	p.M1K		NM_178161.2	NP_835455.1	Q7RTS3	PTF1A_HUMAN	pancreas specific transcription factor, 1a	1					amacrine cell differentiation (GO:0035881)|cerebellum development (GO:0021549)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|exocrine pancreas development (GO:0031017)|neuron fate commitment (GO:0048663)|pancreas development (GO:0031016)|regulation of neural retina development (GO:0061074)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|retinoic acid receptor signaling pathway (GO:0048384)|tissue development (GO:0009888)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						GCGGCGAGCATGGACGCGGTG	0.657																																					p.M1K		Atlas-SNP	.											.	PTF1A	24	.	0			c.T2A						.						41.0	41.0	41.0					10																	23481461		2203	4300	6503	SO:0001582	initiator_codon_variant	256297	exon1			CGAGCATGGACGC	BK000272	CCDS7143.1	10p12.31	2013-05-21			ENSG00000168267	ENSG00000168267		"""Basic helix-loop-helix proteins"""	23734	protein-coding gene	gene with protein product		607194				8703005	Standard	NM_178161		Approved	PTF1-p48, bHLHa29	uc001irp.3	Q7RTS3	OTTHUMG00000017815	ENST00000376504.3:c.2T>A	chr10.hg19:g.23481461T>A	ENSP00000365687:p.Met1Lys	711.0	2.0		673.0	246.0	NM_178161	Q9HC25	Missense_Mutation	SNP	ENST00000376504.3	hg19	CCDS7143.1	.	.	.	.	.	.	.	.	.	.	T	13.55	2.270630	0.40194	.	.	ENSG00000168267	ENST00000376504	D	0.95518	-3.73	2.96	2.96	0.34315	.	0.000000	0.85682	U	0.000000	D	0.96651	0.8907	.	.	.	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	D	0.96469	0.9347	9	0.87932	D	0	-20.2831	10.8942	0.47012	0.0:0.0:0.0:1.0	.	1	Q7RTS3	PTF1A_HUMAN	K	1	ENSP00000365687:M1K	ENSP00000365687:M1K	M	+	2	0	PTF1A	23521467	1.000000	0.71417	0.981000	0.43875	0.321000	0.28281	4.424000	0.59868	1.222000	0.43521	0.260000	0.18958	ATG	.	.		0.657	PTF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047210.1	NM_178161	Missense_Mutation
MAT1A	4143	hgsc.bcm.edu	37	10	82036146	82036146	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr10:82036146T>C	ENST00000372213.3	-	6	1014	c.754A>G	c.(754-756)Atc>Gtc	p.I252V	MAT1A_ENST00000485270.1_5'Flank	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	252					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	GGACCTCCGATGACAAACCGC	0.567																																					p.I252V		Atlas-SNP	.											.	MAT1A	52	.	0			c.A754G						.						84.0	80.0	81.0					10																	82036146		2203	4300	6503	SO:0001583	missense	4143	exon6			CTCCGATGACAAA		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.754A>G	chr10.hg19:g.82036146T>C	ENSP00000361287:p.Ile252Val	98.0	0.0		83.0	27.0	NM_000429	D3DWD5|Q5QP09	Missense_Mutation	SNP	ENST00000372213.3	hg19	CCDS7365.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.097254	0.56075	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.98012	-4.66	4.84	4.84	0.62591	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.045801	0.85682	D	0.000000	D	0.95677	0.8594	L	0.50333	1.59	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	D	0.93686	0.7003	10	0.59425	D	0.04	-26.2772	12.7009	0.57032	0.0:0.0:0.0:1.0	.	252	Q00266	METK1_HUMAN	V	252	ENSP00000361287:I252V	ENSP00000361280:I252V	I	-	1	0	MAT1A	82026126	1.000000	0.71417	0.999000	0.59377	0.966000	0.64601	5.799000	0.69101	2.164000	0.68074	0.533000	0.62120	ATC	.	.		0.567	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
MUC5B	727897	hgsc.bcm.edu	37	11	1270921	1270921	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:1270921T>A	ENST00000529681.1	+	31	12869	c.12811T>A	c.(12811-12813)Tcc>Acc	p.S4271T	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.S4274T	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4271	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CACCCCGTCCTCCACCCCGGG	0.647																																					p.S4271T		Atlas-SNP	.											.	MUC5B	473	.	0			c.T12811A						.						121.0	139.0	133.0					11																	1270921		2088	4186	6274	SO:0001583	missense	727897	exon31			CCGTCCTCCACCC	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.12811T>A	chr11.hg19:g.1270921T>A	ENSP00000436812:p.Ser4271Thr	155.0	0.0		148.0	53.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	t	3.957	-0.011147	0.07727	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000535652	T;T	0.16324	2.35;2.54	2.45	-4.9	0.03094	.	.	.	.	.	T	0.11410	0.0278	L	0.46157	1.445	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.01281	0.0;0.0	T	0.32955	-0.9887	9	0.87932	D	0	.	0.9881	0.01451	0.4119:0.2771:0.1154:0.1956	.	4744;4274	A7Y9J9;E9PBJ0	.;.	T	4271;4274;4215;4121;50	ENSP00000436812:S4271T;ENSP00000415793:S4274T	ENSP00000343037:S4215T	S	+	1	0	MUC5B	1227497	0.000000	0.05858	0.000000	0.03702	0.221000	0.24807	-5.990000	0.00086	-2.221000	0.00728	0.055000	0.15244	TCC	.	.		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
OR51I2	390064	hgsc.bcm.edu	37	11	5475217	5475217	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:5475217C>A	ENST00000341449.2	+	1	580	c.499C>A	c.(499-501)Cct>Act	p.P167T	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_001004754.2	NP_001004754.1	Q9H344	O51I2_HUMAN	olfactory receptor, family 51, subfamily I, member 2	167					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.09e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TAAGAGGCTGCCTATCTGCAG	0.478																																					p.P167T		Atlas-SNP	.											.	OR51I2	76	.	0			c.C499A						.						169.0	154.0	159.0					11																	5475217		2201	4297	6498	SO:0001583	missense	390064	exon1			AGGCTGCCTATCT	BK004381	CCDS31383.1	11p15.4	2012-08-09			ENSG00000187918	ENSG00000187918		"""GPCR / Class A : Olfactory receptors"""	15201	protein-coding gene	gene with protein product							Standard	NM_001004754		Approved		uc010qzf.2	Q9H344	OTTHUMG00000066902	ENST00000341449.2:c.499C>A	chr11.hg19:g.5475217C>A	ENSP00000341987:p.Pro167Thr	57.0	0.0		22.0	13.0	NM_001004754	Q6IF81	Missense_Mutation	SNP	ENST00000341449.2	hg19	CCDS31383.1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405677	0.42715	.	.	ENSG00000187918	ENST00000341449	T	0.37915	1.17	5.58	4.68	0.58851	GPCR, rhodopsin-like superfamily (1);	0.095559	0.47093	D	0.000252	T	0.57080	0.2029	M	0.76727	2.345	0.28427	N	0.917453	D	0.89917	1.0	D	0.91635	0.999	T	0.54761	-0.8245	10	0.51188	T	0.08	.	10.3938	0.44188	0.0:0.844:0.0:0.156	.	167	Q9H344	O51I2_HUMAN	T	167	ENSP00000341987:P167T	ENSP00000341987:P167T	P	+	1	0	OR51I2	5431793	0.001000	0.12720	0.999000	0.59377	0.634000	0.38068	0.500000	0.22562	1.602000	0.50124	-0.140000	0.14226	CCT	.	.		0.478	OR51I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143385.1	NM_001004754	
PTPN5	84867	hgsc.bcm.edu	37	11	18751293	18751293	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:18751293C>A	ENST00000358540.2	-	13	1832	c.1402G>T	c.(1402-1404)Gcc>Tcc	p.A468S	PTPN5_ENST00000396168.1_Missense_Mutation_p.A444S|PTPN5_ENST00000396171.4_Missense_Mutation_p.A468S|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000396167.2_Missense_Mutation_p.A436S|PTPN5_ENST00000396170.1_Missense_Mutation_p.A436S|PTPN5_ENST00000396166.3_Missense_Mutation_p.A74S|PTPN5_ENST00000477854.1_Missense_Mutation_p.A272S	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	468	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						AGTGGGGGGGCCCGGTCTGGG	0.677																																					p.A468S		Atlas-SNP	.											.	PTPN5	163	.	0			c.G1402T						.						38.0	48.0	45.0					11																	18751293		2115	4250	6365	SO:0001583	missense	84867	exon13			GGGGGGCCCGGTC	BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.1402G>T	chr11.hg19:g.18751293C>A	ENSP00000351342:p.Ala468Ser	53.0	0.0		52.0	12.0	NM_032781	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	ENST00000358540.2	hg19	CCDS7845.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.354673	0.82243	.	.	ENSG00000110786	ENST00000477854;ENST00000358540;ENST00000396166;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	D;D;T;D;D;D;D	0.83250	-1.7;-1.7;2.54;-1.7;-1.7;-1.7;-1.7	4.26	4.26	0.50523	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.88713	0.6511	L	0.52011	1.625	0.80722	D	1	P;D	0.65815	0.805;0.995	D;D	0.83275	0.914;0.996	D	0.90226	0.4275	10	0.87932	D	0	-10.1039	16.8635	0.86024	0.0:1.0:0.0:0.0	.	468;436	P54829;B3KXG7	PTN5_HUMAN;.	S	272;468;74;436;468;436;444	ENSP00000435056:A272S;ENSP00000351342:A468S;ENSP00000379469:A74S;ENSP00000379473:A436S;ENSP00000379474:A468S;ENSP00000379470:A436S;ENSP00000379471:A444S	ENSP00000351342:A468S	A	-	1	0	PTPN5	18707869	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	5.674000	0.68117	2.210000	0.71456	0.655000	0.94253	GCC	.	.		0.677	PTPN5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259196.2	NM_001039970	
SLC5A12	159963	hgsc.bcm.edu	37	11	26714081	26714081	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:26714081G>A	ENST00000396005.3	-	9	1417	c.1108C>T	c.(1108-1110)Cct>Tct	p.P370S	SLC5A12_ENST00000280467.6_Missense_Mutation_p.P370S	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	370					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						GAGAGATGAGGAAAACAGCTC	0.438																																					p.P370S		Atlas-SNP	.											.	SLC5A12	134	.	0			c.C1108T						.						122.0	106.0	111.0					11																	26714081		2203	4299	6502	SO:0001583	missense	159963	exon9			GATGAGGAAAACA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1108C>T	chr11.hg19:g.26714081G>A	ENSP00000379326:p.Pro370Ser	104.0	0.0		91.0	31.0	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	G	16.56	3.157459	0.57259	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.88431	-2.38;-2.38	5.88	5.88	0.94601	.	0.123303	0.53938	D	0.000042	D	0.88658	0.6496	L	0.42632	1.34	0.36380	D	0.86188	B;P	0.37276	0.185;0.589	B;P	0.46208	0.281;0.507	D	0.90535	0.4498	10	0.51188	T	0.08	.	13.9114	0.63869	0.0:0.0:0.8476:0.1524	.	370;370	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	S	370	ENSP00000379326:P370S;ENSP00000280467:P370S	ENSP00000280467:P370S	P	-	1	0	SLC5A12	26670657	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	2.049000	0.41288	2.789000	0.95967	0.591000	0.81541	CCT	.	.		0.438	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
EXT2	2132	hgsc.bcm.edu	37	11	44193161	44193161	+	Splice_Site	SNP	G	G	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:44193161G>C	ENST00000343631.3	+	8	1303	c.1174G>C	c.(1174-1176)Gcc>Ccc	p.A392P	EXT2_ENST00000533608.1_Splice_Site_p.A392P|EXT2_ENST00000395673.3_Splice_Site_p.A425P|EXT2_ENST00000358681.4_Intron			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	392					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						TTCTTTATAGGCCCGGTGGTT	0.443			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																												p.A425P		Atlas-SNP	.	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	.	EXT2	129	.	0			c.G1273C	GRCh37	CS063301	EXT2	S		.						98.0	99.0	99.0					11																	44193161		2203	4299	6502	SO:0001630	splice_region_variant	2132	exon8	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	TTATAGGCCCGGT		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.1174-1G>C	chr11.hg19:g.44193161G>C		74.0	0.0		56.0	29.0	NM_000401	B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	ENST00000343631.3	hg19	CCDS7908.1	.	.	.	.	.	.	.	.	.	.	G	19.06	3.753082	0.69648	.	.	ENSG00000151348	ENST00000533608;ENST00000395673;ENST00000343631	D;D;D	0.95069	-3.59;-3.6;-3.59	5.5	5.5	0.81552	.	.	.	.	.	D	0.91764	0.7395	L	0.48642	1.525	0.80722	D	1	B;B;P	0.35821	0.303;0.232;0.523	B;B;B	0.31547	0.132;0.125;0.125	D	0.90257	0.4298	8	.	.	.	0.8123	19.405	0.94644	0.0:0.0:1.0:0.0	.	392;392;405	Q6NUL1;Q93063;D3DR24	.;EXT2_HUMAN;.	P	392;425;392	ENSP00000431173:A392P;ENSP00000379032:A425P;ENSP00000342656:A392P	.	A	+	1	0	EXT2	44149737	1.000000	0.71417	0.999000	0.59377	0.804000	0.45430	9.624000	0.98398	2.579000	0.87056	0.655000	0.94253	GCC	.	.		0.443	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390074.1	NM_000401	Missense_Mutation
OR5D14	219436	hgsc.bcm.edu	37	11	55563595	55563595	+	Silent	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:55563595T>A	ENST00000335605.1	+	1	564	c.564T>A	c.(562-564)tcT>tcA	p.S188S		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	188						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S188S(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CTCTCATCTCTGTGTCTGGCT	0.448																																					p.S188S		Atlas-SNP	.											OR5D14,NS,carcinoma,0,1	OR5D14	116	.	1	Substitution - coding silent(1)	prostate(1)	c.T564A						.						220.0	215.0	217.0					11																	55563595		2200	4296	6496	SO:0001819	synonymous_variant	219436	exon1			CATCTCTGTGTCT	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.564T>A	chr11.hg19:g.55563595T>A		125.0	0.0		94.0	28.0	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Silent	SNP	ENST00000335605.1	hg19	CCDS31508.1																																																																																			.	.		0.448	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
DYNC2H1	79659	hgsc.bcm.edu	37	11	103325984	103325984	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:103325984C>T	ENST00000375735.2	+	86	12671	c.12527C>T	c.(12526-12528)cCa>cTa	p.P4176L	DYNC2H1_ENST00000334267.7_Missense_Mutation_p.P789L|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.P4183L	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	4176					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTTTTCCATCCAGACACATTT	0.368																																					p.P4183L		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.C12548T						.						91.0	85.0	87.0					11																	103325984		1828	4082	5910	SO:0001583	missense	79659	exon87			TCCATCCAGACAC	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.12527C>T	chr11.hg19:g.103325984C>T	ENSP00000364887:p.Pro4176Leu	91.0	0.0		59.0	16.0	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.936953	0.92458	.	.	ENSG00000187240	ENST00000375735;ENST00000334267;ENST00000398093;ENST00000540621;ENST00000533197	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.84	5.84	0.93424	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.52917	0.1764	M	0.89534	3.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.994;0.999	T	0.60172	-0.7315	10	0.72032	D	0.01	.	19.7245	0.96157	0.0:1.0:0.0:0.0	.	789;4176;4183	Q8NCM8-3;Q8NCM8;Q8NCM8-2	.;DYHC2_HUMAN;.	L	4176;789;4183;422;93	ENSP00000364887:P4176L;ENSP00000334021:P789L;ENSP00000381167:P4183L;ENSP00000436736:P93L	ENSP00000334021:P789L	P	+	2	0	DYNC2H1	102831194	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	6.895000	0.75660	2.758000	0.94735	0.591000	0.81541	CCA	.	.		0.368	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
PANX3	116337	hgsc.bcm.edu	37	11	124482989	124482989	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr11:124482989G>A	ENST00000284288.2	+	2	362	c.295G>A	c.(295-297)Gac>Aac	p.D99N		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	99					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		GCCTGGCCAGGACAAAATGAA	0.557																																					p.D99N		Atlas-SNP	.											.	PANX3	52	.	0			c.G295A						.						64.0	59.0	60.0					11																	124482989		2201	4299	6500	SO:0001583	missense	116337	exon2			GGCCAGGACAAAA	AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.295G>A	chr11.hg19:g.124482989G>A	ENSP00000284288:p.Asp99Asn	54.0	0.0		51.0	13.0	NM_052959		Missense_Mutation	SNP	ENST00000284288.2	hg19	CCDS8447.1	.	.	.	.	.	.	.	.	.	.	G	5.606	0.296592	0.10622	.	.	ENSG00000154143	ENST00000284288	T	0.28666	1.6	5.31	-2.59	0.06209	.	1.185740	0.05722	N	0.597974	T	0.12050	0.0293	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17410	-1.0370	10	0.26408	T	0.33	-0.5417	0.0165	0.00002	0.3028:0.1926:0.2128:0.2918	.	99	Q96QZ0	PANX3_HUMAN	N	99	ENSP00000284288:D99N	ENSP00000284288:D99N	D	+	1	0	PANX3	123988199	0.000000	0.05858	0.003000	0.11579	0.387000	0.30353	-0.307000	0.08167	-0.660000	0.05352	-1.334000	0.01262	GAC	.	.		0.557	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387064.1		
FGF23	8074	hgsc.bcm.edu	37	12	4479524	4479524	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr12:4479524G>C	ENST00000237837.1	-	3	886	c.741C>G	c.(739-741)ttC>ttG	p.F247L		NM_020638.2	NP_065689.1	Q9GZV9	FGF23_HUMAN	fibroblast growth factor 23	247					cell differentiation (GO:0030154)|cellular phosphate ion homeostasis (GO:0030643)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bone mineralization (GO:0030502)|negative regulation of hormone secretion (GO:0046888)|negative regulation of osteoblast differentiation (GO:0045668)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphate ion homeostasis (GO:0055062)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vitamin D 24-hydroxylase activity (GO:0010980)|regulation of phosphate transport (GO:0010966)|vitamin D catabolic process (GO:0042369)	extracellular region (GO:0005576)|extracellular space (GO:0005615)		p.F247F(1)		NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	22			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)|STAD - Stomach adenocarcinoma(119;0.206)			TGAACTTGGCGAAGGGGCGGC	0.627																																					p.F247L		Atlas-SNP	.											FGF23,NS,carcinoma,0,1	FGF23	57	.	1	Substitution - coding silent(1)	prostate(1)	c.C741G						.						60.0	67.0	64.0					12																	4479524		2203	4300	6503	SO:0001583	missense	8074	exon3			CTTGGCGAAGGGG	AF263537	CCDS8526.1	12p13	2008-07-04			ENSG00000118972	ENSG00000118972			3680	protein-coding gene	gene with protein product		605380				11032749, 18310961	Standard	NM_020638		Approved		uc001qmq.1	Q9GZV9	OTTHUMG00000168241	ENST00000237837.1:c.741C>G	chr12.hg19:g.4479524G>C	ENSP00000237837:p.Phe247Leu	160.0	0.0		117.0	26.0	NM_020638	Q4V758	Missense_Mutation	SNP	ENST00000237837.1	hg19	CCDS8526.1	.	.	.	.	.	.	.	.	.	.	G	19.30	3.800786	0.70567	.	.	ENSG00000118972	ENST00000237837	T	0.80824	-1.42	4.58	0.437	0.16555	.	0.533484	0.17200	N	0.183163	T	0.64494	0.2603	L	0.29908	0.895	0.09310	N	1	B	0.26258	0.145	B	0.20955	0.032	T	0.55082	-0.8196	10	0.59425	D	0.04	-0.3054	4.4985	0.11853	0.2943:0.1638:0.5418:0.0	.	247	Q9GZV9	FGF23_HUMAN	L	247	ENSP00000237837:F247L	ENSP00000237837:F247L	F	-	3	2	FGF23	4349785	0.858000	0.29795	0.047000	0.18901	0.180000	0.23129	0.827000	0.27421	0.143000	0.18926	0.549000	0.68633	TTC	.	.		0.627	FGF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398936.1		
NDUFA9	4704	hgsc.bcm.edu	37	12	4794433	4794433	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr12:4794433C>T	ENST00000266544.5	+	10	925	c.905C>T	c.(904-906)gCa>gTa	p.A302V	RP11-234B24.6_ENST00000544741.2_Missense_Mutation_p.A61V|NDUFA9_ENST00000540688.1_Missense_Mutation_p.A61V	NM_005002.4	NP_004993.1	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9, 39kDa	302					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|sodium ion transport (GO:0006814)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)|NADH dehydrogenase activity (GO:0003954)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	21						AGATGGGTAGCAAGAGTCTTT	0.468																																					p.A302V	Colon(75;996 1244 23946 25294 29232)	Atlas-SNP	.											.	NDUFA9	45	.	0			c.C905T						.						124.0	113.0	117.0					12																	4794433		2203	4300	6503	SO:0001583	missense	4704	exon10			GGGTAGCAAGAGT	AF050641	CCDS8532.1	12p13.3	2011-09-14	2002-08-29		ENSG00000139180	ENSG00000139180		"""Mitochondrial respiratory chain complex / Complex I"", ""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	7693	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 22E, member 1"", ""complex I 39kDa subunit"""	603834	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 9 (39kD)"""	NDUFS2L		8486360, 19027726	Standard	NM_005002		Approved	SDR22E1, CI-39k	uc001qnc.3	Q16795		ENST00000266544.5:c.905C>T	chr12.hg19:g.4794433C>T	ENSP00000266544:p.Ala302Val	159.0	0.0		106.0	29.0	NM_005002	Q14076|Q2NKX0	Missense_Mutation	SNP	ENST00000266544.5	hg19	CCDS8532.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.279405	0.59758	.	.	ENSG00000139180	ENST00000266544;ENST00000540688	T;D	0.83755	-1.42;-1.76	5.06	-0.223	0.13118	.	0.159674	0.56097	D	0.000035	T	0.77519	0.4142	M	0.69463	2.115	0.21386	N	0.999701	B	0.33883	0.43	B	0.29267	0.1	T	0.67241	-0.5720	10	0.51188	T	0.08	-12.09	11.8854	0.52600	0.0:0.4152:0.5143:0.0705	.	302	Q16795	NDUA9_HUMAN	V	302;61	ENSP00000266544:A302V;ENSP00000439818:A61V	ENSP00000266544:A302V	A	+	2	0	NDUFA9	4664694	0.273000	0.24181	0.004000	0.12327	0.070000	0.16714	0.780000	0.26760	-0.253000	0.09514	-0.122000	0.15005	GCA	.	.		0.468	NDUFA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398900.2	NM_005002	
NR4A1	3164	hgsc.bcm.edu	37	12	52452485	52452485	+	Silent	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr12:52452485G>A	ENST00000243050.1	+	8	1868	c.1554G>A	c.(1552-1554)ctG>ctA	p.L518L	NR4A1_ENST00000545748.1_Silent_p.L572L|NR4A1_ENST00000394825.1_Silent_p.L518L|RP11-1100L3.8_ENST00000564363.1_lincRNA|NR4A1_ENST00000550082.1_Silent_p.L531L|NR4A1_ENST00000394824.2_Silent_p.L518L|NR4A1_ENST00000360284.3_Silent_p.L531L	NM_002135.4	NP_002126.2	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	518					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell chemotaxis (GO:0035767)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)	16				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GGCATGGGCTGCAGGAGCCGC	0.682																																					p.L531L		Atlas-SNP	.											.	NR4A1	77	.	0			c.G1593A						.						7.0	8.0	8.0					12																	52452485		2065	4101	6166	SO:0001819	synonymous_variant	3164	exon8			TGGGCTGCAGGAG	L13740	CCDS8818.1, CCDS55828.1, CCDS73471.1	12q13	2013-01-16			ENSG00000123358	ENSG00000123358		"""Nuclear hormone receptors"""	7980	protein-coding gene	gene with protein product		139139		HMR, GFRP1		2626032	Standard	NM_002135		Approved	TR3, N10, NAK-1, NGFIB, NUR77	uc001rzt.3	P22736	OTTHUMG00000150393	ENST00000243050.1:c.1554G>A	chr12.hg19:g.52452485G>A		93.0	0.0		65.0	4.0	NM_001202233	B4DML7|Q15627|Q53Y00|Q6IBU8	Silent	SNP	ENST00000243050.1	hg19	CCDS8818.1																																																																																			.	.		0.682	NR4A1-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317922.2		
KNTC1	9735	hgsc.bcm.edu	37	12	123106426	123106426	+	Splice_Site	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr12:123106426A>T	ENST00000333479.7	+	61	6456		c.e61-1		HCAR1_ENST00000356987.2_Intron|KNTC1_ENST00000537348.1_Splice_Site|KNTC1_ENST00000534995.1_Splice_Site|KNTC1_ENST00000450485.2_Splice_Site|KNTC1_ENST00000436959.3_Splice_Site	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		ATTTTTCTCTAGAATTTTCTG	0.373																																					.		Atlas-SNP	.											.	KNTC1	182	.	0			c.6280-2A>T						.						40.0	37.0	38.0					12																	123106426		1794	4064	5858	SO:0001630	splice_region_variant	9735	exon61			TTCTCTAGAATTT		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.6280-1A>T	chr12.hg19:g.123106426A>T		146.0	0.0		86.0	30.0	NM_014708	A7E2C4|B3KSG2	Splice_Site	SNP	ENST00000333479.7	hg19	CCDS45002.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.466323	0.63625	.	.	ENSG00000184445	ENST00000450485;ENST00000333479;ENST00000436959;ENST00000534995	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9059	0.63836	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KNTC1	121672379	1.000000	0.71417	0.932000	0.37286	0.686000	0.39977	7.258000	0.78371	2.163000	0.67991	0.533000	0.62120	.	.	.		0.373	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		Intron
SMAD9	4093	hgsc.bcm.edu	37	13	37453684	37453684	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr13:37453684T>A	ENST00000399275.2	-	1	282	c.143A>T	c.(142-144)aAg>aTg	p.K48M	SMAD9_ENST00000350148.5_Missense_Mutation_p.K48M|SMAD9_ENST00000379826.4_Missense_Mutation_p.K48M|SMAD9_ENST00000483941.1_5'UTR			O15198	SMAD9_HUMAN	SMAD family member 9	48	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.|Poly-Lys.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		GGCTCCCTTCTTCTTCTTTAA	0.592																																					p.K48M		Atlas-SNP	.											.	SMAD9	91	.	0			c.A143T						.						82.0	88.0	86.0					13																	37453684		2203	4300	6503	SO:0001583	missense	4093	exon2			CCCTTCTTCTTCT		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.143A>T	chr13.hg19:g.37453684T>A	ENSP00000382216:p.Lys48Met	66.0	0.0		63.0	25.0	NM_005905	A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	ENST00000399275.2	hg19	CCDS45032.1	.	.	.	.	.	.	.	.	.	.	T	18.75	3.691371	0.68271	.	.	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	T;T;T	0.79554	-1.28;-1.28;-1.28	5.47	5.47	0.80525	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.91157	0.7215	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;0.994	D;D	0.76071	0.959;0.987	D	0.92935	0.6367	10	0.87932	D	0	.	14.7184	0.69286	0.0:0.0:0.0:1.0	.	48;48	O15198-2;O15198	.;SMAD9_HUMAN	M	48	ENSP00000382216:K48M;ENSP00000239885:K48M;ENSP00000369154:K48M	ENSP00000239885:K48M	K	-	2	0	SMAD9	36351684	1.000000	0.71417	1.000000	0.80357	0.470000	0.32858	6.247000	0.72411	2.073000	0.62155	0.421000	0.28195	AAG	.	.		0.592	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905	
MAGEL2	54551	hgsc.bcm.edu	37	15	23890781	23890781	+	Silent	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr15:23890781C>T	ENST00000532292.1	-	1	394	c.300G>A	c.(298-300)gcG>gcA	p.A100A		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	0					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		GAAAATTTGCCGCTGCTACCG	0.627																																					p.A703A		Atlas-SNP	.											MAGEL2_ENST00000532292,NS,carcinoma,0,1	MAGEL2	108	.	0			c.G2109A						.						13.0	14.0	14.0					15																	23890781		1848	4080	5928	SO:0001819	synonymous_variant	54551	exon1			ATTTGCCGCTGCT	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.300G>A	chr15.hg19:g.23890781C>T		149.0	1.0		200.0	56.0	NM_019066		Silent	SNP	ENST00000532292.1	hg19		.	.	.	.	.	.	.	.	.	.	c	0.603	-0.828333	0.02734	.	.	ENSG00000254585	ENST00000532292	T	0.05580	3.42	3.42	-0.854	0.10705	.	.	.	.	.	T	0.03348	0.0097	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.44128	-0.9348	5	.	.	.	.	0.5344	0.00634	0.1778:0.2978:0.1744:0.3501	.	.	.	.	Q	132	ENSP00000433433:R132Q	.	R	-	2	0	MAGEL2	21441874	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.426000	0.02443	-0.161000	0.10983	0.486000	0.48141	CGG	.	.		0.627	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
ACTC1	70	hgsc.bcm.edu	37	15	35084456	35084456	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr15:35084456T>A	ENST00000290378.4	-	5	1298	c.643A>T	c.(643-645)Aaa>Taa	p.K215*	RP11-814P5.1_ENST00000558707.1_RNA|ACTC1_ENST00000557860.1_5'UTR|RP11-814P5.1_ENST00000503496.1_RNA	NM_005159.4	NP_005150.1	P68032	ACTC_HUMAN	actin, alpha, cardiac muscle 1	215					actin filament-based movement (GO:0030048)|actin-myosin filament sliding (GO:0033275)|actomyosin structure organization (GO:0031032)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|heart contraction (GO:0060047)|muscle filament sliding (GO:0030049)|negative regulation of apoptotic process (GO:0043066)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|skeletal muscle thin filament assembly (GO:0030240)	actin filament (GO:0005884)|actomyosin, actin portion (GO:0042643)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|I band (GO:0031674)|membrane (GO:0016020)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|myosin binding (GO:0017022)			central_nervous_system(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	31		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AGCTTCTCTTTAATGTCACGG	0.473																																					p.K215X		Atlas-SNP	.											.	ACTC1	75	.	0			c.A643T						.						71.0	68.0	69.0					15																	35084456		2201	4298	6499	SO:0001587	stop_gained	70	exon5			TCTCTTTAATGTC	BC009978	CCDS10041.1	15q14	2014-09-17	2006-08-24	2006-08-24	ENSG00000159251	ENSG00000159251			143	protein-coding gene	gene with protein product		102540	"""actin, alpha, cardiac muscle"""	ACTC		1639426	Standard	NM_005159		Approved	CMD1R	uc001ziu.1	P68032	OTTHUMG00000129675	ENST00000290378.4:c.643A>T	chr15.hg19:g.35084456T>A	ENSP00000290378:p.Lys215*	145.0	0.0		126.0	72.0	NM_005159	P04270	Nonsense_Mutation	SNP	ENST00000290378.4	hg19	CCDS10041.1	.	.	.	.	.	.	.	.	.	.	T	44	10.905651	0.99486	.	.	ENSG00000159251	ENST00000290378;ENST00000544062	.	.	.	4.94	4.94	0.65067	.	0.000000	0.56097	U	0.000039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.0473	0.71838	0.0:0.0:0.0:1.0	.	.	.	.	X	215;180	.	ENSP00000290378:K215X	K	-	1	0	ACTC1	32871748	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.868000	0.87116	2.206000	0.71126	0.533000	0.62120	AAA	.	.		0.473	ACTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251876.3	NM_005159	
UBR1	197131	hgsc.bcm.edu	37	15	43269020	43269020	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr15:43269020C>A	ENST00000290650.4	-	39	4342	c.4264G>T	c.(4264-4266)Gtt>Ttt	p.V1422F	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1422					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		TGCAGATCAACAGGGTCATCC	0.393																																					p.V1422F		Atlas-SNP	.											.	UBR1	124	.	0			c.G4264T						.						138.0	114.0	122.0					15																	43269020		2203	4299	6502	SO:0001583	missense	197131	exon39			GATCAACAGGGTC		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.4264G>T	chr15.hg19:g.43269020C>A	ENSP00000290650:p.Val1422Phe	195.0	0.0		172.0	47.0	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	hg19	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670624	0.88348	.	.	ENSG00000159459	ENST00000290650	T	0.49720	0.77	5.2	5.2	0.72013	.	0.059779	0.64402	D	0.000003	T	0.63379	0.2506	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.55786	-0.8086	10	0.10111	T	0.7	-12.0873	18.6835	0.91556	0.0:1.0:0.0:0.0	.	1422	Q8IWV7	UBR1_HUMAN	F	1422	ENSP00000290650:V1422F	ENSP00000290650:V1422F	V	-	1	0	UBR1	41056312	1.000000	0.71417	0.943000	0.38184	0.884000	0.51177	4.148000	0.58085	2.576000	0.86940	0.585000	0.79938	GTT	.	.		0.393	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
GATM	2628	hgsc.bcm.edu	37	15	45661556	45661556	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr15:45661556A>G	ENST00000396659.3	-	3	791	c.452T>C	c.(451-453)tTg>tCg	p.L151S	GATM_ENST00000558336.1_Missense_Mutation_p.L151S	NM_001482.2	NP_001473.1	P50440	GATM_HUMAN	glycine amidinotransferase (L-arginine:glycine amidinotransferase)	151					cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|embryo development (GO:0009790)|response to mercury ion (GO:0046689)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)|tissue regeneration (GO:0042246)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)	glycine amidinotransferase activity (GO:0015068)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amidines (GO:0016813)			biliary_tract(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	15		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Glycine(DB00145)|L-Ornithine(DB00129)	TTTATACTTCAATGACCAGTC	0.378																																					p.L151S		Atlas-SNP	.											.	GATM	34	.	0			c.T452C						.						109.0	106.0	107.0					15																	45661556		2198	4298	6496	SO:0001583	missense	2628	exon3			TACTTCAATGACC	S68805	CCDS10122.1	15q15.1	2007-12-06			ENSG00000171766	ENSG00000171766	2.1.4.1		4175	protein-coding gene	gene with protein product		602360				8313955	Standard	NM_001482		Approved	AGAT	uc001zvc.3	P50440	OTTHUMG00000131427	ENST00000396659.3:c.452T>C	chr15.hg19:g.45661556A>G	ENSP00000379895:p.Leu151Ser	158.0	0.0		112.0	36.0	NM_001482	B4DH99|B4DPI3|Q53EQ4	Missense_Mutation	SNP	ENST00000396659.3	hg19	CCDS10122.1	.	.	.	.	.	.	.	.	.	.	A	6.102	0.387150	0.11581	.	.	ENSG00000171766	ENST00000396659	T	0.09911	2.93	6.07	4.93	0.64822	.	0.903013	0.09674	N	0.770774	T	0.08447	0.0210	L	0.28115	0.83	0.29918	N	0.822997	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.32903	-0.9889	10	0.09843	T	0.71	1.1468	10.8433	0.46728	0.8586:0.0:0.0:0.1414	.	151;151	P50440-3;P50440	.;GATM_HUMAN	S	151	ENSP00000379895:L151S	ENSP00000379895:L151S	L	-	2	0	GATM	43448848	0.806000	0.28996	0.124000	0.21820	0.976000	0.68499	5.828000	0.69307	1.067000	0.40740	0.533000	0.62120	TTG	.	.		0.378	GATM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254220.2	NM_001482	
UNC13C	440279	hgsc.bcm.edu	37	15	54308039	54308039	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr15:54308039A>T	ENST00000260323.11	+	1	2939	c.2939A>T	c.(2938-2940)tAt>tTt	p.Y980F	UNC13C_ENST00000537900.1_Missense_Mutation_p.Y980F|UNC13C_ENST00000545554.1_Missense_Mutation_p.Y980F	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	980					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTAAGGGCCTATAAAAAGCAA	0.388																																					p.Y980F		Atlas-SNP	.											.	UNC13C	674	.	0			c.A2939T						.						56.0	55.0	56.0					15																	54308039		1843	4095	5938	SO:0001583	missense	440279	exon1			GGGCCTATAAAAA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2939A>T	chr15.hg19:g.54308039A>T	ENSP00000260323:p.Tyr980Phe	196.0	0.0		192.0	114.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	hg19	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	A	19.00	3.742735	0.69418	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.82526	-1.62;-1.51;-1.62	5.58	5.58	0.84498	.	.	.	.	.	D	0.85526	0.5717	L	0.29908	0.895	0.45129	D	0.99814	D	0.69078	0.997	D	0.75020	0.985	D	0.85251	0.1044	9	0.38643	T	0.18	.	14.9285	0.70898	1.0:0.0:0.0:0.0	.	980	Q8NB66	UN13C_HUMAN	F	980	ENSP00000260323:Y980F;ENSP00000438156:Y980F;ENSP00000442569:Y980F	ENSP00000260323:Y980F	Y	+	2	0	UNC13C	52095331	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.962000	0.93254	2.128000	0.65567	0.528000	0.53228	TAT	.	.		0.388	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
TBC1D10B	26000	hgsc.bcm.edu	37	16	30380742	30380742	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr16:30380742C>A	ENST00000409939.3	-	1	843	c.763G>T	c.(763-765)Ggc>Tgc	p.G255C		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	255					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			CCAGAGATGCCAGGTCCCAGG	0.627																																					p.G255C		Atlas-SNP	.											.	TBC1D10B	32	.	0			c.G763T						.						31.0	36.0	34.0					16																	30380742		692	1591	2283	SO:0001583	missense	26000	exon1			AGATGCCAGGTCC	BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.763G>T	chr16.hg19:g.30380742C>A	ENSP00000386538:p.Gly255Cys	59.0	0.0		46.0	22.0	NM_015527	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	ENST00000409939.3	hg19	CCDS10676.2	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695014	0.68386	.	.	ENSG00000169221	ENST00000409939	T	0.06933	3.24	3.91	2.91	0.33838	.	.	.	.	.	T	0.15522	0.0374	L	0.43152	1.355	0.30844	N	0.735383	D	0.69078	0.997	P	0.56865	0.808	T	0.03957	-1.0989	9	0.62326	D	0.03	.	10.514	0.44879	0.0:0.8018:0.1981:0.0	.	255	Q4KMP7	TB10B_HUMAN	C	255	ENSP00000386538:G255C	ENSP00000386538:G255C	G	-	1	0	TBC1D10B	30288243	0.995000	0.38212	0.998000	0.56505	0.992000	0.81027	2.306000	0.43673	0.810000	0.34279	0.491000	0.48974	GGC	.	.		0.627	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255527.3	NM_015527	
USP6	9098	hgsc.bcm.edu	37	17	5041492	5041492	+	Silent	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr17:5041492C>T	ENST00000574788.1	+	21	3232	c.1002C>T	c.(1000-1002)aaC>aaT	p.N334N	USP6_ENST00000332776.4_Silent_p.N334N|USP6_ENST00000250066.6_Silent_p.N334N|USP6_ENST00000304328.5_5'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	334					cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GGGCCATGAACGATGACACCG	0.577			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.N334N		Atlas-SNP	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	USP6_ENST00000250066,caecum,carcinoma,0,4	USP6	213	.	0			c.C1002T						.						146.0	143.0	144.0					17																	5041492		2203	4300	6503	SO:0001819	synonymous_variant	9098	exon13			CATGAACGATGAC	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.1002C>T	chr17.hg19:g.5041492C>T		77.0	0.0		58.0	11.0	NM_004505	Q15634|Q86WP6|Q8IWT4	Silent	SNP	ENST00000574788.1	hg19	CCDS11069.2																																																																																			.	.		0.577	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
PPP1R1B	84152	hgsc.bcm.edu	37	17	37791909	37791909	+	Silent	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr17:37791909C>T	ENST00000254079.4	+	6	964	c.495C>T	c.(493-495)cgC>cgT	p.R165R	STARD3_ENST00000544210.2_5'Flank|STARD3_ENST00000394250.4_5'Flank|PPP1R1B_ENST00000580825.1_Silent_p.R165R|STARD3_ENST00000580611.1_5'Flank|PPP1R1B_ENST00000579000.1_Silent_p.R132R|PPP1R1B_ENST00000394267.2_Silent_p.R129R|PPP1R1B_ENST00000394265.1_Silent_p.R129R|STARD3_ENST00000336308.5_5'Flank	NM_032192.3	NP_115568.2	Q9UD71	PPR1B_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 1B	165					intracellular signal transduction (GO:0035556)|negative regulation of catalytic activity (GO:0043086)|negative regulation of female receptivity (GO:0007621)|negative regulation of protein kinase activity (GO:0006469)|regulation of catalytic activity (GO:0050790)|response to amphetamine (GO:0001975)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	protein kinase inhibitor activity (GO:0004860)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 1 regulator activity (GO:0008599)			kidney(1)|large_intestine(1)|liver(1)|lung(2)	5	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCTGGGAGCGCCCACCCCCTC	0.582																																					p.R165R		Atlas-SNP	.											.	PPP1R1B	9	.	0			c.C495T						.						67.0	76.0	73.0					17																	37791909		2203	4300	6503	SO:0001819	synonymous_variant	84152	exon6			GGAGCGCCCACCC	AI124650	CCDS11339.1, CCDS11340.1	17q12	2012-04-17	2008-07-31		ENSG00000131771	ENSG00000131771	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9287	protein-coding gene	gene with protein product	"""dopamine and cAMP regulated phosphoprotein"""	604399				8120638	Standard	NM_032192		Approved	DARPP-32, FLJ20940	uc002hrz.3	Q9UD71	OTTHUMG00000133210	ENST00000254079.4:c.495C>T	chr17.hg19:g.37791909C>T		125.0	0.0		127.0	69.0	NM_032192	Q547V9|Q547W0|Q9H7G1	Silent	SNP	ENST00000254079.4	hg19	CCDS11339.1																																																																																			.	.		0.582	PPP1R1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256925.2	NM_032192	
GFAP	2670	hgsc.bcm.edu	37	17	42992812	42992812	+	Missense_Mutation	SNP	C	C	T	rs146698039		TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr17:42992812C>T	ENST00000253408.5	-	1	108	c.43G>A	c.(43-45)Gtc>Atc	p.V15I	GFAP_ENST00000435360.2_Missense_Mutation_p.V15I|GFAP_ENST00000586793.1_Missense_Mutation_p.V15I|GFAP_ENST00000588735.1_Missense_Mutation_p.V15I|GFAP_ENST00000591327.1_5'UTR	NM_002055.4	NP_002046.1	P14136	GFAP_HUMAN	glial fibrillary acidic protein	15	Head.				astrocyte development (GO:0014002)|Bergmann glial cell differentiation (GO:0060020)|extracellular matrix organization (GO:0030198)|intermediate filament organization (GO:0045109)|long-term synaptic potentiation (GO:0060291)|negative regulation of neuron projection development (GO:0010977)|neuron projection regeneration (GO:0031102)|positive regulation of Schwann cell proliferation (GO:0010625)|regulation of neurotransmitter uptake (GO:0051580)|response to wounding (GO:0009611)	astrocyte projection (GO:0097449)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|membrane (GO:0016020)	structural constituent of cytoskeleton (GO:0005200)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(11)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23		Prostate(33;0.0959)				CCTGAGGAGACGTAGGAGCGG	0.667																																					p.V15I		Atlas-SNP	.											.	GFAP	88	.	0			c.G43A						.	C	ILE/VAL,ILE/VAL,ILE/VAL	1,4387		0,1,2193	14.0	16.0	16.0		43,43,43	-2.1	0.0	17	dbSNP_134	16	0,8566		0,0,4283	no	missense,missense,missense	GFAP	NM_001131019.2,NM_001242376.1,NM_002055.4	29,29,29	0,1,6476	TT,TC,CC		0.0,0.0228,0.0077	benign,benign,benign	15/432,15/439,15/433	42992812	1,12953	2194	4283	6477	SO:0001583	missense	2670	exon1			AGGAGACGTAGGA	S40719	CCDS11491.1, CCDS45708.1, CCDS59296.1	17q21	2013-01-16						"""Intermediate filaments type III"""	4235	protein-coding gene	gene with protein product	"""intermediate filament protein"""	137780				9693047	Standard	NM_002055		Approved	FLJ45472	uc002ihq.3	P14136		ENST00000253408.5:c.43G>A	chr17.hg19:g.42992812C>T	ENSP00000253408:p.Val15Ile	117.0	0.0		127.0	68.0	NM_001131019	B2RD44|D3DX59|E9PAX3|Q53H98|Q5D055|Q6ZQS3|Q7Z5J6|Q7Z5J7|Q96KS4|Q96P18|Q9UFD0	Missense_Mutation	SNP	ENST00000253408.5	hg19	CCDS11491.1	.	.	.	.	.	.	.	.	.	.	C	2.850	-0.238536	0.05944	2.28E-4	0.0	ENSG00000131095	ENST00000253408;ENST00000435360;ENST00000376990	D;D;D	0.87491	-1.82;-1.76;-2.26	4.9	-2.12	0.07165	.	1.415560	0.04661	N	0.408830	T	0.73908	0.3647	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.57705	-0.7765	10	0.11794	T	0.64	.	5.0585	0.14546	0.0:0.3589:0.1553:0.4859	.	15;15	E9PAX3;P14136	.;GFAP_HUMAN	I	15	ENSP00000253408:V15I;ENSP00000403962:V15I;ENSP00000366189:V15I	ENSP00000253408:V15I	V	-	1	0	GFAP	40348338	0.000000	0.05858	0.003000	0.11579	0.067000	0.16453	-0.095000	0.11077	-0.537000	0.06290	-1.134000	0.01955	GTC	.	C|1.000;T|0.000		0.667	GFAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448701.1	NM_002055	
LRRC37A3	374819	hgsc.bcm.edu	37	17	62892812	62892812	+	Silent	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr17:62892812A>G	ENST00000584306.1	-	3	1094	c.564T>C	c.(562-564)gaT>gaC	p.D188D	RP11-927P21.1_ENST00000584131.1_RNA|LRRC37A3_ENST00000319651.5_Silent_p.D188D|RP11-927P21.1_ENST00000584959.1_RNA|LRRC37A3_ENST00000339474.5_Intron|RP11-927P21.1_ENST00000577938.1_RNA|LRRC37A3_ENST00000577487.1_5'Flank|LRRC37A3_ENST00000400877.3_Intron	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	188						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						GATACGGTGTATCTGTACTGG	0.488																																					p.D188D		Atlas-SNP	.											.	LRRC37A3	75	.	0			c.T564C						.						57.0	98.0	85.0					17																	62892812		1417	3199	4616	SO:0001819	synonymous_variant	374819	exon3			CGGTGTATCTGTA	AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.564T>C	chr17.hg19:g.62892812A>G		233.0	0.0		239.0	55.0	NM_199340	Q49A01|Q49A80|Q8NB33	Silent	SNP	ENST00000584306.1	hg19	CCDS32708.1																																																																																			.	.		0.488	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445377.1	NM_199340	
GNA13	10672	hgsc.bcm.edu	37	17	63014400	63014400	+	Silent	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr17:63014400G>A	ENST00000439174.2	-	3	777	c.532C>T	c.(532-534)Ctg>Ttg	p.L178L	GNA13_ENST00000541118.1_Silent_p.L83L	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	178					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						AAGTTATCCAGGAAATATTTT	0.328																																					p.L178L		Atlas-SNP	.											.	GNA13	69	.	0			c.C532T						.						122.0	128.0	126.0					17																	63014400		2202	4299	6501	SO:0001819	synonymous_variant	10672	exon3			TATCCAGGAAATA	L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.532C>T	chr17.hg19:g.63014400G>A		372.0	0.0		415.0	106.0	NM_006572	B2R977|B7Z7R0|F5H1G8|Q8TD70	Silent	SNP	ENST00000439174.2	hg19	CCDS11661.1																																																																																			.	.		0.328	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445720.1	NM_006572	
HELZ	9931	hgsc.bcm.edu	37	17	65174838	65174838	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr17:65174838T>C	ENST00000358691.5	-	13	1533	c.1367A>G	c.(1366-1368)tAt>tGt	p.Y456C	HELZ_ENST00000580168.1_Missense_Mutation_p.Y456C	NM_014877.3	NP_055692	P42694	HELZ_HUMAN	helicase with zinc finger	456						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(5)|endometrium(9)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CCGTGACTGATAGTTGCTCTT	0.368																																					p.Y456C		Atlas-SNP	.											.	HELZ	160	.	0			c.A1367G						.						134.0	127.0	129.0					17																	65174838		1851	4101	5952	SO:0001583	missense	9931	exon13			GACTGATAGTTGC	D29677	CCDS42374.1	17q24.2	2013-01-18			ENSG00000198265	ENSG00000198265		"""Zinc fingers, CCCH-type domain containing"""	16878	protein-coding gene	gene with protein product	"""down-regulated in human cancers"""	606699				10471385, 12691822	Standard	NM_014877		Approved	KIAA0054, HUMORF5, DHRC	uc002jfx.4	P42694	OTTHUMG00000179555	ENST00000358691.5:c.1367A>G	chr17.hg19:g.65174838T>C	ENSP00000351524:p.Tyr456Cys	136.0	0.0		137.0	36.0	NM_014877	I6L9H4	Missense_Mutation	SNP	ENST00000358691.5	hg19	CCDS42374.1	.	.	.	.	.	.	.	.	.	.	T	14.29	2.492146	0.44352	.	.	ENSG00000198265	ENST00000358691	D	0.91740	-2.9	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.96030	0.8707	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.99;0.998	D	0.96377	0.9278	10	0.87932	D	0	-17.6497	16.635	0.85050	0.0:0.0:0.0:1.0	.	456;456	B7ZLW2;P42694	.;HELZ_HUMAN	C	456	ENSP00000351524:Y456C	ENSP00000351524:Y456C	Y	-	2	0	HELZ	62605300	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.618000	0.83043	2.330000	0.79161	0.477000	0.44152	TAT	.	.		0.368	HELZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000447068.1	NM_014877	
PSMD12	5718	hgsc.bcm.edu	37	17	65340883	65340883	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr17:65340883G>C	ENST00000356126.3	-	9	1029	c.922C>G	c.(922-924)Ctt>Gtt	p.L308V	PSMD12_ENST00000357146.4_Missense_Mutation_p.L288V	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	308	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					GTGGTAAAAAGCTTTAAAAGA	0.323																																					p.L308V		Atlas-SNP	.											.	PSMD12	32	.	0			c.C922G						.						52.0	50.0	51.0					17																	65340883		2203	4300	6503	SO:0001583	missense	5718	exon9			TAAAAAGCTTTAA	AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.922C>G	chr17.hg19:g.65340883G>C	ENSP00000348442:p.Leu308Val	425.0	0.0		407.0	97.0	NM_002816	A6NP15|Q53HA2|Q6P053	Missense_Mutation	SNP	ENST00000356126.3	hg19	CCDS11669.1	.	.	.	.	.	.	.	.	.	.	G	15.65	2.895874	0.52121	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	T;T	0.30182	1.54;1.54	5.72	4.75	0.60458	Proteasome component (PCI) domain (1);	0.055741	0.64402	D	0.000001	T	0.33469	0.0864	L	0.49778	1.585	0.54753	D	0.999981	B;B	0.25850	0.013;0.136	B;B	0.37731	0.133;0.257	T	0.07177	-1.0786	10	0.26408	T	0.33	-14.4196	12.4585	0.55718	0.132:0.0:0.868:0.0	.	288;308	A6NP15;O00232	.;PSD12_HUMAN	V	308;288	ENSP00000348442:L308V;ENSP00000349667:L288V	ENSP00000348442:L308V	L	-	1	0	PSMD12	62771345	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.522000	0.60539	2.693000	0.91896	0.585000	0.79938	CTT	.	.		0.323	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277103.1	NM_002816, NM_174871	
LOXHD1	125336	hgsc.bcm.edu	37	18	44184173	44184173	+	5'Flank	SNP	C	C	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr18:44184173C>G	ENST00000398722.4	-	0	0				LOXHD1_ENST00000536736.1_Missense_Mutation_p.G260A|LOXHD1_ENST00000441551.2_Missense_Mutation_p.G260A			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1						calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TCTTTTGTTCCCAATATCTTC	0.468																																					p.G260A		Atlas-SNP	.											.	LOXHD1	367	.	0			c.G779C						.						108.0	97.0	100.0					18																	44184173		692	1591	2283	SO:0001631	upstream_gene_variant	125336	exon7			TTGTTCCCAATAT	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644		chr18.hg19:g.44184173C>G	Exception_encountered	74.0	0.0		60.0	33.0	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.67|12.67	2.006718|2.006718	0.35415|0.35415	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000536736|ENST00000441551	T|.	0.62232|.	0.04|.	5.78|5.78	3.97|3.97	0.46021|0.46021	.|.	.|.	.|.	.|.	.|.	T|T	0.58264|0.58264	0.2110|0.2110	L|L	0.39085|0.39085	1.19|1.19	0.80722|0.80722	D|D	1|1	B|.	0.25048|.	0.117|.	B|.	0.23018|.	0.043|.	T|T	0.52902|0.52902	-0.8513|-0.8513	9|5	0.07813|.	T|.	0.8|.	.|.	16.3749|16.3749	0.83382|0.83382	0.0:0.7368:0.2632:0.0|0.0:0.7368:0.2632:0.0	.|.	260|.	F5GZB4|.	.|.	A|C	260|240	ENSP00000444586:G260A|.	ENSP00000444586:G260A|.	G|W	-|-	2|3	0|0	LOXHD1|LOXHD1	42438171|42438171	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.050000|4.050000	0.57404|0.57404	0.763000|0.763000	0.33175|0.33175	0.561000|0.561000	0.74099|0.74099	GGG|TGG	.	.		0.468	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
SMAD4	4089	hgsc.bcm.edu	37	18	48575189	48575189	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr18:48575189T>C	ENST00000342988.3	+	3	921	c.383T>C	c.(382-384)gTg>gCg	p.V128A	RP11-729L2.2_ENST00000590722.2_3'UTR|SMAD4_ENST00000398417.2_Missense_Mutation_p.V128A|SMAD4_ENST00000588745.1_Missense_Mutation_p.V128A|SMAD4_ENST00000452201.2_Missense_Mutation_p.V128A	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	128	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		AGTGTCTGTGTGAATCCATAT	0.373																																					p.V128A		Atlas-SNP	.											SMAD4,rectum,carcinoma,0,1	SMAD4	822	.	40	Whole gene deletion(36)|Unknown(4)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	c.T383C						.						152.0	136.0	141.0					18																	48575189		2203	4300	6503	SO:0001583	missense	4089	exon3			TCTGTGTGAATCC	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.383T>C	chr18.hg19:g.48575189T>C	ENSP00000341551:p.Val128Ala	172.0	1.0		97.0	43.0	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	hg19	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.855079	0.91355	.	.	ENSG00000141646	ENST00000452201;ENST00000342988;ENST00000544926;ENST00000398417	T;T;T	0.80566	-1.39;-1.39;-1.39	5.48	5.48	0.80851	MAD homology, MH1 (3);MAD homology 1, Dwarfin-type (2);	0.000000	0.85682	D	0.000000	D	0.90410	0.6998	M	0.88377	2.95	0.58432	D	0.999999	D	0.63046	0.992	D	0.66196	0.942	D	0.92229	0.5791	10	0.87932	D	0	.	14.5339	0.67947	0.0:0.0:0.0:1.0	.	128	Q13485	SMAD4_HUMAN	A	128	ENSP00000409551:V128A;ENSP00000341551:V128A;ENSP00000381452:V128A	ENSP00000341551:V128A	V	+	2	0	SMAD4	46829187	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.014000	0.88676	2.053000	0.61076	0.477000	0.44152	GTG	.	.		0.373	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
DYNAP	284254	hgsc.bcm.edu	37	18	52258515	52258515	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr18:52258515T>C	ENST00000321600.1	+	1	126	c.80T>C	c.(79-81)aTg>aCg	p.M27T	DYNAP_ENST00000585973.1_Missense_Mutation_p.M30T	NM_173629.1	NP_775900.1	Q8N1N2	DYNAP_HUMAN	dynactin associated protein	27					activation of protein kinase B activity (GO:0032148)|cellular response to ergosterol (GO:1901625)|positive regulation of cell proliferation (GO:0008284)|regulation of apoptotic process (GO:0042981)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											AGCTCAAGAATGGACAGAAAG	0.383																																					p.M27T		Atlas-SNP	.											.	.	.	.	0			c.T80C						.						131.0	131.0	131.0					18																	52258515		2203	4300	6503	SO:0001583	missense	284254	exon1			CAAGAATGGACAG	AK096425	CCDS11957.1	18q21.2	2012-10-24	2012-10-24	2012-10-24	ENSG00000178690	ENSG00000178690			26808	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 26"""	C18orf26		20978158	Standard	NM_173629		Approved	FLJ39106	uc002lfq.1	Q8N1N2	OTTHUMG00000132709	ENST00000321600.1:c.80T>C	chr18.hg19:g.52258515T>C	ENSP00000315265:p.Met27Thr	136.0	0.0		93.0	38.0	NM_173629		Missense_Mutation	SNP	ENST00000321600.1	hg19	CCDS11957.1	.	.	.	.	.	.	.	.	.	.	.	14.54	2.564726	0.45694	.	.	ENSG00000178690	ENST00000321600	T	0.22539	1.95	5.21	5.21	0.72293	.	0.000000	0.64402	D	0.000003	T	0.40347	0.1113	L	0.55481	1.735	0.30285	N	0.790906	D	0.76494	0.999	D	0.85130	0.997	T	0.40040	-0.9584	10	0.87932	D	0	-9.2421	11.7662	0.51933	0.0:0.0:0.0:1.0	.	27	Q8N1N2	CR026_HUMAN	T	27	ENSP00000315265:M27T	ENSP00000315265:M27T	M	+	2	0	C18orf26	50409513	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	3.531000	0.53546	2.097000	0.63578	0.496000	0.49642	ATG	.	.		0.383	DYNAP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256007.1	NM_173629	
SALL3	27164	hgsc.bcm.edu	37	18	76757080	76757080	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr18:76757080A>T	ENST00000537592.2	+	3	3661	c.3661A>T	c.(3661-3663)Aac>Tac	p.N1221Y	SALL3_ENST00000536229.3_Missense_Mutation_p.N1016Y|SALL3_ENST00000575389.2_Missense_Mutation_p.N1149Y	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	1221					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		AGCCATCACTAACGGGCTCGC	0.592																																					p.N1221Y		Atlas-SNP	.											.	SALL3	162	.	0			c.A3661T						.						107.0	98.0	101.0					18																	76757080		2203	4300	6503	SO:0001583	missense	27164	exon3			ATCACTAACGGGC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.3661A>T	chr18.hg19:g.76757080A>T	ENSP00000441823:p.Asn1221Tyr	180.0	0.0		151.0	10.0	NM_171999	Q9UGH1	Missense_Mutation	SNP	ENST00000537592.2	hg19	CCDS12013.1	.	.	.	.	.	.	.	.	.	.	A	5.766	0.325731	0.10900	.	.	ENSG00000256463	ENST00000537592;ENST00000536229;ENST00000543056	T	0.54866	0.55	5.09	5.09	0.68999	.	0.000000	0.64402	D	0.000010	T	0.74435	0.3716	M	0.84433	2.695	0.52099	D	0.999941	D;D	0.89917	0.999;1.0	D;D	0.71184	0.969;0.972	T	0.79667	-0.1708	10	0.72032	D	0.01	-29.8556	14.8958	0.70644	1.0:0.0:0.0:0.0	.	881;1221	F5GXY4;Q9BXA9	.;SALL3_HUMAN	Y	1221;1149;881	ENSP00000441823:N1221Y	ENSP00000299466:N1221Y	N	+	1	0	SALL3	74858068	1.000000	0.71417	0.251000	0.24312	0.134000	0.20937	7.398000	0.79919	1.906000	0.55180	0.459000	0.35465	AAC	.	.		0.592	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
MUC16	94025	hgsc.bcm.edu	37	19	9086539	9086539	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:9086539T>A	ENST00000397910.4	-	1	5479	c.5276A>T	c.(5275-5277)gAt>gTt	p.D1759V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1759	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAATTCCACATCAGGAGTTGT	0.502																																					p.D1759V		Atlas-SNP	.											.	MUC16	4315	.	0			c.A5276T						.						117.0	109.0	111.0					19																	9086539		1968	4148	6116	SO:0001583	missense	94025	exon1			TCCACATCAGGAG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5276A>T	chr19.hg19:g.9086539T>A	ENSP00000381008:p.Asp1759Val	119.0	0.0		87.0	28.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	1.752	-0.488950	0.04352	.	.	ENSG00000181143	ENST00000397910	T	0.03065	4.06	1.33	-0.964	0.10326	.	.	.	.	.	T	0.01695	0.0054	N	0.08118	0	.	.	.	P	0.50710	0.938	B	0.37451	0.25	T	0.46091	-0.9216	8	0.87932	D	0	.	4.2255	0.10579	0.0:0.4969:0.0:0.5031	.	1759	B5ME49	.	V	1759	ENSP00000381008:D1759V	ENSP00000381008:D1759V	D	-	2	0	MUC16	8947539	0.000000	0.05858	0.000000	0.03702	0.074000	0.17049	-1.804000	0.01738	-0.417000	0.07461	0.260000	0.18958	GAT	.	.		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF253	56242	hgsc.bcm.edu	37	19	20003048	20003048	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:20003048A>G	ENST00000589717.1	+	4	1084	c.992A>G	c.(991-993)aAg>aGg	p.K331R	AC011477.1_ENST00000578823.1_RNA|ZNF253_ENST00000355650.4_Missense_Mutation_p.K255R|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	331				Missing (in Ref. 1; AAC26844). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACTATACATAAGAGAATTCAT	0.388																																					p.K331R		Atlas-SNP	.											.	ZNF253	99	.	0			c.A992G						.						40.0	45.0	43.0					19																	20003048		2145	4271	6416	SO:0001583	missense	56242	exon4			TACATAAGAGAAT	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.992A>G	chr19.hg19:g.20003048A>G	ENSP00000468720:p.Lys331Arg	135.0	0.0		123.0	64.0	NM_021047	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Missense_Mutation	SNP	ENST00000589717.1	hg19	CCDS42532.1	.	.	.	.	.	.	.	.	.	.	a	11.12	1.544823	0.27563	.	.	ENSG00000256771	ENST00000355650	.	.	.	0.876	0.876	0.19138	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.26122	0.0637	N	0.04260	-0.245	0.21984	N	0.999437	D	0.89917	1.0	D	0.83275	0.996	T	0.15896	-1.0421	7	.	.	.	.	5.5788	0.17238	1.0:0.0:0.0:0.0	.	331	O75346	ZN253_HUMAN	R	331	.	.	K	+	2	0	ZNF253	19864048	0.000000	0.05858	0.129000	0.21949	0.128000	0.20619	-0.190000	0.09615	0.251000	0.21505	0.248000	0.18094	AAG	.	.		0.388	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
ZNF99	7652	hgsc.bcm.edu	37	19	22940398	22940398	+	Silent	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:22940398C>T	ENST00000596209.1	-	4	2403	c.2313G>A	c.(2311-2313)aaG>aaA	p.K771K	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Silent_p.K680K	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	771					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CTGAGAAATGCTTAAAAGCTT	0.358																																					p.K771K		Atlas-SNP	.											ZNF99,NS,carcinoma,0,1	ZNF99	273	.	0			c.G2313A						.						30.0	32.0	32.0					19																	22940398		1951	4133	6084	SO:0001819	synonymous_variant	7652	exon4			GAAATGCTTAAAA	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2313G>A	chr19.hg19:g.22940398C>T		35.0	1.0		27.0	4.0	NM_001080409	M0R335	Silent	SNP	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.		0.358	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
DMKN	93099	hgsc.bcm.edu	37	19	36003608	36003608	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:36003608G>T	ENST00000339686.3	-	2	687	c.511C>A	c.(511-513)Ccg>Acg	p.P171T	DMKN_ENST00000418261.1_Missense_Mutation_p.P171T|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.P171T|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000429837.1_Missense_Mutation_p.P171T|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000467637.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.P171T|DMKN_ENST00000419602.1_Missense_Mutation_p.P171T|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.P171T|DMKN_ENST00000424570.2_Missense_Mutation_p.P171T|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000414866.2_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	171	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			TGGACCCACGGAGTCCCCAGA	0.582																																					p.P171T		Atlas-SNP	.											.	DMKN	116	.	0			c.C511A						.						53.0	56.0	55.0					19																	36003608		2203	4300	6503	SO:0001583	missense	93099	exon2			CCCACGGAGTCCC	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.511C>A	chr19.hg19:g.36003608G>T	ENSP00000342012:p.Pro171Thr	58.0	0.0		51.0	18.0	NM_001190347	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	hg19	CCDS12463.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195756	0.38806	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.46063	1.59;1.45;1.37;0.88;0.99;1.01;1.0;1.07	4.22	0.547	0.17202	.	0.195238	0.25657	N	0.029177	T	0.48840	0.1522	L	0.49126	1.545	0.09310	N	1	P;D;D;P;B;B;B	0.76494	0.582;0.999;0.999;0.582;0.192;0.192;0.324	B;D;D;B;B;B;B	0.80764	0.225;0.994;0.994;0.225;0.135;0.135;0.225	T	0.21415	-1.0246	10	0.46703	T	0.11	-3.2671	4.6633	0.12653	0.1057:0.0:0.5129:0.3814	.	171;171;171;171;171;171;171	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	T	171	ENSP00000342012:P171T;ENSP00000405503:P171T;ENSP00000391036:P171T;ENSP00000394908:P171T;ENSP00000415277:P171T;ENSP00000414743:P171T;ENSP00000388404:P171T;ENSP00000409513:P171T	ENSP00000342012:P171T	P	-	1	0	DMKN	40695448	0.054000	0.20591	0.002000	0.10522	0.016000	0.09150	1.098000	0.31000	0.508000	0.28173	0.655000	0.94253	CCG	.	.		0.582	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
KIRREL2	84063	hgsc.bcm.edu	37	19	36348363	36348363	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:36348363G>A	ENST00000360202.5	+	2	376	c.178G>A	c.(178-180)Ggg>Agg	p.G60R	KIRREL2_ENST00000592409.1_Missense_Mutation_p.G60R|KIRREL2_ENST00000262625.7_Missense_Mutation_p.G60R|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000347900.6_Intron	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	60	Ig-like C2-type 1.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GACTAAGAGTGGGCTGGCCCT	0.652																																					p.G60R		Atlas-SNP	.											.	KIRREL2	170	.	0			c.G178A						.						46.0	54.0	52.0					19																	36348363		2203	4299	6502	SO:0001583	missense	84063	exon2			AAGAGTGGGCTGG	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.178G>A	chr19.hg19:g.36348363G>A	ENSP00000353331:p.Gly60Arg	183.0	0.0		157.0	63.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	hg19	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958270	0.92726	.	.	ENSG00000126259	ENST00000262625;ENST00000360202;ENST00000341658	T;T	0.71461	-0.57;-0.57	5.35	5.35	0.76521	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.48767	D	0.000177	D	0.85737	0.5766	M	0.86502	2.82	0.48511	D	0.999667	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.87838	0.2649	10	0.87932	D	0	-20.4166	14.9787	0.71296	0.0:0.0:1.0:0.0	.	60;60;60	F1T0I2;Q6UWL6;Q6UWL6-2	.;KIRR2_HUMAN;.	R	60	ENSP00000262625:G60R;ENSP00000353331:G60R	ENSP00000262625:G60R	G	+	1	0	KIRREL2	41040203	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	7.901000	0.87382	2.672000	0.90937	0.650000	0.86243	GGG	.	.		0.652	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
GGN	199720	hgsc.bcm.edu	37	19	38876402	38876402	+	Silent	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:38876402T>C	ENST00000334928.6	-	3	1632	c.1500A>G	c.(1498-1500)ccA>ccG	p.P500P	GGN_ENST00000591809.1_Intron|AC005789.9_ENST00000585411.1_RNA|SPRED3_ENST00000587013.1_5'Flank	NM_152657.3	NP_689870.3	Q86UU5	GGN_HUMAN	gametogenetin	500	Interactions with ZNF403/GGNBP2 and OAZ3. {ECO:0000250}.|Pro-rich.				cell differentiation (GO:0030154)|gamete generation (GO:0007276)|multicellular organismal development (GO:0007275)|protein localization (GO:0008104)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			cggtgggagctggagccgggg	0.746																																					p.P500P		Atlas-SNP	.											.	GGN	50	.	0			c.A1500G						.						4.0	6.0	5.0					19																	38876402		1834	3724	5558	SO:0001819	synonymous_variant	199720	exon3			GGGAGCTGGAGCC	AF538035	CCDS12516.1	19q13.2	2008-09-04				ENSG00000179168			18869	protein-coding gene	gene with protein product		609966				12574169	Standard	NM_152657		Approved	FLJ35713, MGC33369	uc002oij.1	Q86UU5		ENST00000334928.6:c.1500A>G	chr19.hg19:g.38876402T>C		47.0	0.0		55.0	7.0	NM_152657	Q7RTU6|Q86UU4|Q8NAA1	Silent	SNP	ENST00000334928.6	hg19	CCDS12516.1																																																																																			.	.		0.746	GGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459205.1	NM_152657	
PNMAL1	55228	hgsc.bcm.edu	37	19	46973527	46973527	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:46973527G>T	ENST00000313683.10	-	2	1071	c.766C>A	c.(766-768)Ccc>Acc	p.P256T	PNMAL1_ENST00000438932.2_Missense_Mutation_p.P256T|PNMAL1_ENST00000602246.1_Intron	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	256										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		TTTTTCCAGGGCACTGCTTCC	0.522																																					p.P256T		Atlas-SNP	.											.	PNMAL1	87	.	0			c.C766A						.						97.0	100.0	99.0					19																	46973527		2203	4300	6503	SO:0001583	missense	55228	exon2			TCCAGGGCACTGC	BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.766C>A	chr19.hg19:g.46973527G>T	ENSP00000318131:p.Pro256Thr	54.0	0.0		28.0	9.0	NM_018215	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	ENST00000313683.10	hg19	CCDS33059.1	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606520	0.28623	.	.	ENSG00000182013	ENST00000438932;ENST00000313683	T;T	0.09163	3.01;3.01	3.94	-6.07	0.02158	.	1.605380	0.03609	N	0.234529	T	0.07279	0.0184	L	0.27053	0.805	0.09310	N	1	B;B	0.28636	0.218;0.218	B;B	0.28139	0.086;0.086	T	0.33624	-0.9861	10	0.45353	T	0.12	-5.1354	6.0109	0.19575	0.4279:0.4008:0.1713:0.0	.	256;256	Q86V59-2;Q86V59	.;PNML1_HUMAN	T	256	ENSP00000410273:P256T;ENSP00000318131:P256T	ENSP00000318131:P256T	P	-	1	0	PNMAL1	51665367	0.002000	0.14202	0.000000	0.03702	0.293000	0.27360	-0.069000	0.11542	-1.137000	0.02888	-0.136000	0.14681	CCC	.	.		0.522	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403929.1	NM_018215	
ZNF347	84671	hgsc.bcm.edu	37	19	53652039	53652039	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr19:53652039T>C	ENST00000334197.7	-	4	234	c.166A>G	c.(166-168)Att>Gtt	p.I56V	ZNF347_ENST00000452676.2_Missense_Mutation_p.I57V|ZNF347_ENST00000601469.2_Missense_Mutation_p.I57V|ZNF347_ENST00000601804.1_5'UTR	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		ATAGAGATAATACTGAGGTCA	0.433																																					p.I57V	Melanoma(64;205 1597 17324 45721)	Atlas-SNP	.											.	ZNF347	87	.	0			c.A169G						.						174.0	163.0	167.0					19																	53652039		2203	4300	6503	SO:0001583	missense	84671	exon4			AGATAATACTGAG	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.166A>G	chr19.hg19:g.53652039T>C	ENSP00000334146:p.Ile56Val	169.0	0.0		128.0	45.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	ENST00000334197.7	hg19	CCDS33097.1	.	.	.	.	.	.	.	.	.	.	T	0.117	-1.130250	0.01756	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.00737	5.76;5.76	1.82	-3.63	0.04529	Krueppel-associated box (3);	.	.	.	.	T	0.00356	0.0011	N	0.02247	-0.625	0.09310	N	1	B;B	0.13145	0.007;0.003	B;B	0.06405	0.002;0.0	T	0.40887	-0.9539	9	0.02654	T	1	.	7.2768	0.26290	0.0:0.6547:0.0:0.3453	.	57;56	G5E9N4;Q96SE7	.;ZN347_HUMAN	V	56;57	ENSP00000334146:I56V;ENSP00000405218:I57V	ENSP00000334146:I56V	I	-	1	0	ZNF347	58343851	0.000000	0.05858	0.000000	0.03702	0.040000	0.13550	-0.818000	0.04467	-1.195000	0.02680	-0.334000	0.08254	ATT	.	.		0.433	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
BACH1	571	hgsc.bcm.edu	37	21	30698823	30698823	+	Silent	SNP	A	A	G			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr21:30698823A>G	ENST00000399921.1	+	3	921	c.678A>G	c.(676-678)aaA>aaG	p.K226K	BACH1_ENST00000286800.3_Silent_p.K226K	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						TATGCCCCAAATACAGAAAAT	0.453																																					p.K226K		Atlas-SNP	.											.	BACH1	66	.	0			c.A678G						.						92.0	94.0	93.0					21																	30698823		2203	4300	6503	SO:0001819	synonymous_variant	571	exon3			CCCCAAATACAGA	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.678A>G	chr21.hg19:g.30698823A>G		137.0	0.0		97.0	33.0	NM_206866	Q3MJE2|Q8NCI5	Silent	SNP	ENST00000399921.1	hg19	CCDS13585.1																																																																																			.	.		0.453	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
COL6A1	1291	hgsc.bcm.edu	37	21	47412121	47412121	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr21:47412121C>T	ENST00000361866.3	+	17	1340	c.1226C>T	c.(1225-1227)gCg>gTg	p.A409V		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	409	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		AAAGGAGAGGCGGGCGACGAG	0.637																																					p.A409V		Atlas-SNP	.											.	COL6A1	101	.	0			c.C1226T						.						47.0	57.0	53.0					21																	47412121		2201	4300	6501	SO:0001583	missense	1291	exon17			GAGAGGCGGGCGA	M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.1226C>T	chr21.hg19:g.47412121C>T	ENSP00000355180:p.Ala409Val	86.0	0.0		69.0	25.0	NM_001848	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Missense_Mutation	SNP	ENST00000361866.3	hg19	CCDS13727.1	.	.	.	.	.	.	.	.	.	.	C	8.164	0.790074	0.16258	.	.	ENSG00000142156	ENST00000361866;ENST00000538397	D	0.93712	-3.27	4.7	2.66	0.31614	.	0.456851	0.21370	N	0.075656	D	0.84692	0.5528	N	0.25380	0.74	0.09310	N	1	B	0.34313	0.448	B	0.29440	0.102	T	0.75539	-0.3282	10	0.35671	T	0.21	-21.1888	6.855	0.24036	0.2251:0.6731:0.0:0.1017	.	409	P12109	CO6A1_HUMAN	V	409	ENSP00000355180:A409V	ENSP00000355180:A409V	A	+	2	0	COL6A1	46236549	0.820000	0.29190	0.849000	0.33467	0.054000	0.15201	1.441000	0.35035	2.162000	0.67917	0.467000	0.42956	GCG	.	.		0.637	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206877.1	NM_001848	
RFPL3	10738	hgsc.bcm.edu	37	22	32754272	32754272	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr22:32754272C>A	ENST00000249007.4	+	1	419	c.214C>A	c.(214-216)Cat>Aat	p.H72N	RFPL3_ENST00000397468.1_Missense_Mutation_p.H43N|RFPL3S_ENST00000461833.1_5'Flank|RFPL3_ENST00000382088.3_Missense_Mutation_p.H43N	NM_001098535.1	NP_001092005.1	O75679	RFPL3_HUMAN	ret finger protein-like 3	72							zinc ion binding (GO:0008270)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(2)|stomach(1)	15						GAAGGAGCCCCATGGGGAGGA	0.537																																					p.H72N		Atlas-SNP	.											.	RFPL3	91	.	0			c.C214A						.						122.0	115.0	117.0					22																	32754272		2203	4300	6503	SO:0001583	missense	10738	exon1			GAGCCCCATGGGG	AJ010232	CCDS13904.1, CCDS43011.1	22q12	2006-04-25			ENSG00000128276	ENSG00000128276			9980	protein-coding gene	gene with protein product		605970				10508838	Standard	NM_006604		Approved		uc010gwn.3	O75679	OTTHUMG00000030290	ENST00000249007.4:c.214C>A	chr22.hg19:g.32754272C>A	ENSP00000249007:p.His72Asn	160.0	0.0		125.0	50.0	NM_001098535	A2A279|Q6IC03|Q6IC04|Q6NSX3|Q8N5R4	Missense_Mutation	SNP	ENST00000249007.4	hg19	CCDS43011.1	.	.	.	.	.	.	.	.	.	.	C	0.045	-1.268673	0.01433	.	.	ENSG00000128276	ENST00000397468;ENST00000249007;ENST00000382088	D;T;D	0.92699	-3.09;2.37;-3.09	0.851	-1.7	0.08159	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);RDM domain, Ret finger protein-like (1);	.	.	.	.	T	0.76912	0.4054	N	0.04880	-0.145	0.09310	N	1	B	0.06786	0.001	B	0.12156	0.007	T	0.61874	-0.6973	9	0.17832	T	0.49	.	2.7544	0.05289	0.3012:0.3977:0.3011:0.0	.	72	O75679	RFPL3_HUMAN	N	43;72;43	ENSP00000380609:H43N;ENSP00000249007:H72N;ENSP00000371520:H43N	ENSP00000249007:H72N	H	+	1	0	RFPL3	31084272	0.001000	0.12720	0.002000	0.10522	0.100000	0.18952	0.253000	0.18296	-1.117000	0.02965	0.194000	0.17425	CAT	.	.		0.537	RFPL3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000075172.3	NM_006604	
DDX53	168400	hgsc.bcm.edu	37	X	23018432	23018432	+	Silent	SNP	C	C	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chrX:23018432C>T	ENST00000327968.5	+	1	346	c.258C>T	c.(256-258)aaC>aaT	p.N86N	RP11-40F8.2_ENST00000455399.1_lincRNA	NM_182699.3	NP_874358.2	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	86	KH. {ECO:0000255|PROSITE- ProRule:PRU00117}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|RNA binding (GO:0003723)			breast(2)|endometrium(5)|kidney(4)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	35						AGATCATAAACGGGGAATCTG	0.338																																					p.N86N		Atlas-SNP	.											.	DDX53	76	.	0			c.C258T						.						71.0	75.0	74.0					X																	23018432		2203	4300	6503	SO:0001819	synonymous_variant	168400	exon1			CATAAACGGGGAA	AY039237	CCDS35214.1	Xp22.13	2009-03-25			ENSG00000184735	ENSG00000184735		"""DEAD-boxes"""	20083	protein-coding gene	gene with protein product	"""cancer associated gene"", ""cancer/testis antigen 26"""						Standard	NM_182699		Approved	CAGE, CT26	uc004daj.3	Q86TM3	OTTHUMG00000021248	ENST00000327968.5:c.258C>T	chrX.hg19:g.23018432C>T		203.0	0.0		147.0	118.0	NM_182699	Q0D2N2|Q6NVV4	Silent	SNP	ENST00000327968.5	hg19	CCDS35214.1																																																																																			.	.		0.338	DDX53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056043.1	NM_182699	
RBM41	55285	hgsc.bcm.edu	37	X	106359256	106359256	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chrX:106359256G>A	ENST00000372479.3	-	3	184	c.154C>T	c.(154-156)Cct>Tct	p.P52S	RBM41_ENST00000203616.8_Missense_Mutation_p.P52S|RBM41_ENST00000372487.1_Missense_Mutation_p.P52S|RBM41_ENST00000471079.1_5'UTR	NM_018301.3	NP_060771.3	Q96IZ5	RBM41_HUMAN	RNA binding motif protein 41	52							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	13						ATAGTACCAGGAGCAAAGCTC	0.448																																					p.P52S		Atlas-SNP	.											.	RBM41	34	.	0			c.C154T						.						74.0	64.0	67.0					X																	106359256		2203	4300	6503	SO:0001583	missense	55285	exon3			TACCAGGAGCAAA	BC006986	CCDS14526.1, CCDS55472.1	Xq22.3	2013-02-12			ENSG00000089682	ENSG00000089682		"""RNA binding motif (RRM) containing"""	25617	protein-coding gene	gene with protein product						12477932	Standard	NM_001171080		Approved	FLJ11016	uc004emz.3	Q96IZ5	OTTHUMG00000022156	ENST00000372479.3:c.154C>T	chrX.hg19:g.106359256G>A	ENSP00000361557:p.Pro52Ser	187.0	1.0		138.0	115.0	NM_001171080	Q5JSN7|Q5JSN8|Q9H8F7|Q9NV04	Missense_Mutation	SNP	ENST00000372479.3	hg19	CCDS14526.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.12|17.12	3.307170|3.307170	0.60305|0.60305	.|.	.|.	ENSG00000089682|ENSG00000089682	ENST00000372487;ENST00000372479;ENST00000203616;ENST00000372482|ENST00000434854	T;T|.	0.25250|.	1.81;1.82|.	5.5|5.5	4.64|4.64	0.57946|0.57946	.|.	0.115218|.	0.64402|.	N|.	0.000012|.	T|T	0.39253|0.39253	0.1071|0.1071	N|N	0.17082|0.17082	0.46|0.46	0.45690|0.45690	D|D	0.998605|0.998605	D|.	0.89917|.	1.0|.	D|.	0.72075|.	0.976|.	T|T	0.17137|0.17137	-1.0379|-1.0379	10|5	0.40728|.	T|.	0.16|.	.|.	9.2521|9.2521	0.37562|0.37562	0.1016:0.0:0.8984:0.0|0.1016:0.0:0.8984:0.0	.|.	52|.	Q96IZ5|.	RBM41_HUMAN|.	S|F	52|49	ENSP00000361565:P52S;ENSP00000361557:P52S|.	ENSP00000203616:P52S|.	P|S	-|-	1|2	0|0	RBM41|RBM41	106245912|106245912	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	8.431000|8.431000	0.90285|0.90285	1.089000|1.089000	0.41292|0.41292	0.468000|0.468000	0.43344|0.43344	CCT|TCC	.	.		0.448	RBM41-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057819.1	NM_018301	
RNF113A	7737	hgsc.bcm.edu	37	X	119005199	119005199	+	Silent	SNP	T	T	C			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chrX:119005199T>C	ENST00000371442.2	-	1	592	c.378A>G	c.(376-378)aaA>aaG	p.K126K	NDUFA1_ENST00000371437.4_5'Flank	NM_006978.2	NP_008909.1	O15541	R113A_HUMAN	ring finger protein 113A	126							zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(6)	15						CATCGCGCTCTTTCTCTGTGT	0.542																																					p.K126K		Atlas-SNP	.											.	RNF113A	39	.	0			c.A378G						.						259.0	246.0	250.0					X																	119005199		2203	4300	6503	SO:0001819	synonymous_variant	7737	exon1			GCGCTCTTTCTCT	X98253	CCDS14589.1	Xq24	2013-10-22	2005-03-22	2005-03-22	ENSG00000125352	ENSG00000125352		"""RING-type (C3HC4) zinc fingers"""	12974	protein-coding gene	gene with protein product			"""zinc finger protein 183 (RING finger, C3HC4 type)"""	ZNF183		9224902	Standard	NM_006978		Approved	RNF113, Cwc24	uc004esb.3	O15541	OTTHUMG00000022283	ENST00000371442.2:c.378A>G	chrX.hg19:g.119005199T>C		34.0	0.0		25.0	20.0	NM_006978	B2RBR7	Silent	SNP	ENST00000371442.2	hg19	CCDS14589.1																																																																																			.	.		0.542	RNF113A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058071.1	NM_006978	
ATP2B3	492	hgsc.bcm.edu	37	X	152801801	152801801	+	Silent	SNP	G	G	T	rs202115287		TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chrX:152801801G>T	ENST00000349466.2	+	2	422	c.96G>T	c.(94-96)gcG>gcT	p.A32A	ATP2B3_ENST00000370186.1_Silent_p.A32A|ATP2B3_ENST00000393842.1_Silent_p.A32A|ATP2B3_ENST00000359149.3_Silent_p.A32A|ATP2B3_ENST00000263519.4_Silent_p.A32A|ATP2B3_ENST00000370181.2_Silent_p.A32A			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	32					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GCACGCTGGCGGAGCTGCGCA	0.667																																					p.A32A		Atlas-SNP	.											.	ATP2B3	552	.	0			c.G96T						.						35.0	29.0	31.0					X																	152801801		2188	4289	6477	SO:0001819	synonymous_variant	492	exon1			GCTGGCGGAGCTG	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.96G>T	chrX.hg19:g.152801801G>T		127.0	0.0		80.0	65.0	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	ENST00000349466.2	hg19	CCDS35440.1																																																																																			.	G|0.999;A|0.001		0.667	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
C4A	720	hgsc.bcm.edu	37	6	31951924	31951925	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr6:31951924_31951925insT	ENST00000428956.2	+	8	965_966	c.881_882insT	c.(880-885)actttcfs	p.TF294fs	C4A_ENST00000537134.1_Frame_Shift_Ins_p.TF214fs|C4A_ENST00000498271.1_Frame_Shift_Ins_p.TF294fs|C4A_ENST00000467948.1_Intron	NM_007293.2	NP_009224.2	P0C0L4	CO4A_HUMAN	complement component 4A (Rodgers blood group)	294					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement component C1q binding (GO:0001849)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	GGTAAGAAGACTTTCTTTCGGG	0.579																																					p.T294fs		Atlas-INDEL	.											.	C4A	15	.	0			c.881_882insT						.																																			SO:0001589	frameshift_variant	720	exon8			.	L26261, M14823, X77491, AY224378	CCDS47404.1, CCDS59005.1	6p21.3	2014-09-17	2006-01-19		ENSG00000244731	ENSG00000244731		"""Blood group antigens"", ""Complement system"""	1323	protein-coding gene	gene with protein product		120810	"""complement component 4A"""				Standard	NM_001252204		Approved	CPAMD2, C4S, CO4, C4, C4A3, C4A2, C4A4, C4A6, C4B, RG		P0C0L4	OTTHUMG00000031186	ENST00000428956.2:c.884dupT	chr6.hg19:g.31951927_31951927dupT	ENSP00000396688:p.Thr294fs	163.0	0.0		149.0	27.0	NM_007293	A6H8M8|A6NHJ5|A7E2V2|B0QZR6|B0V2C8|B2RUT6|B7ZVZ6|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q4LE82|Q5JNX2|Q5JQM8|Q6P4R1|Q6U2E5|Q6U2E8|Q6U2F0|Q6U2F3|Q6U2F4|Q6U2F6|Q6U2F8|Q6U2G0|Q96EG2|Q96SA8|Q9NPK5|Q9UIP5	Frame_Shift_Ins	INS	ENST00000428956.2	hg19	CCDS47404.1																																																																																			.	.		0.579	C4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076364.3	NM_007293	
RHCG	51458	hgsc.bcm.edu	37	15	90016014	90016014	+	Frame_Shift_Del	DEL	G	G	-	rs562119923	byFrequency	TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr15:90016014delG	ENST00000268122.4	-	10	1460	c.1392delC	c.(1390-1392)cccfs	p.P464fs	RHCG_ENST00000544600.1_Intron	NM_016321.1	NP_057405.1	Q9UBD6	RHCG_HUMAN	Rh family, C glycoprotein	464					amine transport (GO:0015837)|ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|cellular ion homeostasis (GO:0006873)|epithelial cell differentiation (GO:0030855)|homeostatic process (GO:0042592)|regulation of pH (GO:0006885)|transepithelial ammonium transport (GO:0070634)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ammonium transmembrane transporter activity (GO:0008519)|ankyrin binding (GO:0030506)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(78;0.0237)|all_lung(78;0.0478)					GGGACACCATgggtactgagg	0.592																																					p.M465fs		Atlas-INDEL	.											.	RHCG	49	.	0			c.1393delA						.						130.0	92.0	105.0					15																	90016014		2199	4294	6493	SO:0001589	frameshift_variant	51458	exon10			.	AF081497	CCDS10351.1	15q25	2013-05-22	2006-02-23		ENSG00000140519	ENSG00000140519		"""Solute carriers"""	18140	protein-coding gene	gene with protein product		605381	"""chromosome 15 open reading frame 6"", ""Rhesus blood group, C glycoprotein"""	C15orf6		10852913	Standard	NM_016321		Approved	RHGK, PDRC2, SLC42A3	uc002bnz.2	Q9UBD6	OTTHUMG00000149647	ENST00000268122.4:c.1392delC	chr15.hg19:g.90016014delG	ENSP00000268122:p.Pro464fs	129.0	0.0		129.0	31.0	NM_016321	A8K4D4|Q6X3Y4	Frame_Shift_Del	DEL	ENST00000268122.4	hg19	CCDS10351.1																																																																																			.	.		0.592	RHCG-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000312855.2	NM_016321	
FAM13B	51306	hgsc.bcm.edu	37	5	137275835	137275835	+	3'UTR	DEL	A	A	-			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr5:137275835delA	ENST00000033079.3	-	0	3278				PKD2L2_ENST00000502810.1_3'UTR|PKD2L2_ENST00000508638.1_3'UTR|PKD2L2_ENST00000290431.5_Stop_Codon_Del|PKD2L2_ENST00000508883.1_Intron	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						AAACGAATTTAAGTACCAGCC	0.378																																					p.X614K		Atlas-INDEL	.											.	PKD2L2	68	.	0			c.1840delT						.						137.0	137.0	137.0					5																	137275835		2203	4300	6503	SO:0001624	3_prime_UTR_variant	27039	exon14			.	AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.*79T>-	chr5.hg19:g.137275835delA		170.0	0.0		232.0	86.0	NM_014386	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Frame_Shift_Del	DEL	ENST00000033079.3	hg19	CCDS4195.1																																																																																			.	.		0.378	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251279.1		
C4B	721	hgsc.bcm.edu	37	6	31984662	31984663	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr6:31984662_31984663insT	ENST00000435363.2	+	8	965_966	c.881_882insT	c.(880-885)actttcfs	p.TF294fs	C4B_ENST00000485543.1_Intron|C4B_ENST00000425700.2_Frame_Shift_Ins_p.TF294fs	NM_001002029.3	NP_001002029.3	P0C0L5	CO4B_HUMAN	complement component 4B (Chido blood group)	294					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|detection of molecule of bacterial origin (GO:0032490)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|complement binding (GO:0001848)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	GGTAAGAAGACTTTCTTTCGGG	0.579																																					p.T294fs		Atlas-INDEL	.											.	C4A	15	.	0			c.881_882insT						.																																			SO:0001589	frameshift_variant	720	exon8			.	AF019413	CCDS47405.1	6p21.3	2014-09-17	2009-01-06		ENSG00000224389	ENSG00000224389		"""Blood group antigens"", ""Complement system"""	1324	protein-coding gene	gene with protein product		120820	"""complement component 4B"""				Standard	NM_001002029		Approved	CPAMD3, C4F, CO4, C4B1, C4B3, CH	uc011jpm.2	P0C0L5	OTTHUMG00000031187	ENST00000435363.2:c.884dupT	chr6.hg19:g.31984665_31984665dupT	ENSP00000415941:p.Thr294fs	191.0	0.0		136.0	19.0	NM_007293	A2BHY4|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q6U2E9|Q6U2G1|Q6U2I5|Q6U2L1|Q6U2L7|Q6U2L9|Q6U2M5|Q6VCV8|Q96SA7|Q9NPK5|Q9UIP5	Frame_Shift_Ins	INS	ENST00000435363.2	hg19	CCDS47405.1																																																																																			.	.		0.579	C4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076368.5	NM_001002029	
CHTF8	54921	hgsc.bcm.edu	37	16	69152319	69152344	+	3'UTR	DEL	CGGAAGCATGGTCCGTTCACCAACGC	CGGAAGCATGGTCCGTTCACCAACGC	-	rs113161750|rs375441522|rs533106531|rs368710507	byFrequency	TCGA-DD-AADU-01A-11D-A40R-10	TCGA-DD-AADU-10A-01D-A40U-10	CGGAAGCATGGTCCGTTCACCAACGC	CGGAAGCATGGTCCGTTCACCAACGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	0d049bc2-80dc-4a61-b310-2c0eb6e10e9d	8e8307fc-2b03-455d-9aa9-83626768011c	g.chr16:69152319_69152344delCGGAAGCATGGTCCGTTCACCAACGC	ENST00000448552.2	-	0	2471_2496				CHTF8_ENST00000523421.1_3'UTR|HAS3_ENST00000219322.3_Frame_Shift_Del_p.TEAWSVHQR267fs|CHTF8_ENST00000518041.1_3'UTR|CHTF8_ENST00000306585.6_3'UTR	NM_001039690.3|NM_001040146.3	NP_001034779.1|NP_001035236.1	P0CG13	CTF8_HUMAN	CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)						cell cycle (GO:0007049)|DNA replication (GO:0006260)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.T267M(1)									GTCAGAGCTACGGAAGCATGGTCCGTTCACCAACGCCACGTTTCTA	0.54																																					p.267_275del		Atlas-INDEL	.											.	HAS3	61	.	1	Substitution - Missense(1)	large_intestine(1)	c.799_824del						.																																			SO:0001624	3_prime_UTR_variant	3038	exon4			.		CCDS42185.1	16q22.1	2009-01-14				ENSG00000168802			24353	protein-coding gene	gene with protein product		613202				12766176	Standard	NM_001039690		Approved	FLJ20400, CTF8, DERPC	uc002ewo.2	P0CG12		ENST00000448552.2:c.*2009GCGTTGGTGAACGGACCATGCTTCCG>-	chr16.hg19:g.69152319_69152344delCGGAAGCATGGTCCGTTCACCAACGC		112.0	0.0		104.0	32.0	NM_138612	A8MYX8|Q71E72|Q8NDH8|Q8WV66|Q9NX73	Frame_Shift_Del	DEL	ENST00000448552.2	hg19	CCDS42185.1																																																																																			.	.		0.540	CHTF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376352.2	NM_017804	
