#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EIF4G3	8672	hgsc.bcm.edu	37	1	21183930	21183930	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr1:21183930A>G	ENST00000264211.8	-	19	3331	c.3137T>C	c.(3136-3138)gTa>gCa	p.V1046A	EIF4G3_ENST00000602326.1_Missense_Mutation_p.V1052A|EIF4G3_ENST00000374937.3_Missense_Mutation_p.V1052A|EIF4G3_ENST00000400422.1_Missense_Mutation_p.V1046A|EIF4G3_ENST00000537738.1_Missense_Mutation_p.V536A|EIF4G3_ENST00000374935.3_Missense_Mutation_p.V766A|EIF4G3_ENST00000536266.1_Missense_Mutation_p.V650A	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1046					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		GGGGTCCAGTACCCGACTGTT	0.458																																					p.V1082A		Atlas-SNP	.											.	EIF4G3	300	.	0			c.T3245C						.						264.0	264.0	264.0					1																	21183930		2203	4300	6503	SO:0001583	missense	8672	exon23			TCCAGTACCCGAC	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3137T>C	chr1.hg19:g.21183930A>G	ENSP00000264211:p.Val1046Ala	88.0	0.0		74.0	24.0	NM_001198801	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	hg19	CCDS214.1	.	.	.	.	.	.	.	.	.	.	A	18.10	3.548365	0.65311	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.06449	3.87;3.87;3.69;3.3;3.87;3.56	5.84	5.84	0.93424	.	0.119534	0.64402	D	0.000020	T	0.07413	0.0187	N	0.22421	0.69	0.80722	D	1	D;B;P;P;P	0.54047	0.964;0.406;0.73;0.905;0.575	P;B;B;B;B	0.50162	0.633;0.108;0.406;0.292;0.195	T	0.19192	-1.0313	10	0.05525	T	0.97	-12.0631	16.2159	0.82217	1.0:0.0:0.0:0.0	.	1241;766;650;1052;1046	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	A	1046;1242;1046;766;536;1052;650	ENSP00000264211:V1046A;ENSP00000383274:V1046A;ENSP00000364071:V766A;ENSP00000442010:V536A;ENSP00000364073:V1052A;ENSP00000444693:V650A	ENSP00000264211:V1046A	V	-	2	0	EIF4G3	21056517	1.000000	0.71417	0.948000	0.38648	0.988000	0.76386	5.170000	0.64990	2.243000	0.73865	0.533000	0.62120	GTA	.	.		0.458	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
AHDC1	27245	hgsc.bcm.edu	37	1	27877569	27877569	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr1:27877569G>A	ENST00000247087.5	-	5	1654	c.1058C>T	c.(1057-1059)cCc>cTc	p.P353L	AHDC1_ENST00000374011.2_Missense_Mutation_p.P353L			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	353	Pro-rich.						DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GTGCCCCAGGGGCTGCTGGGG	0.711																																					p.P353L		Atlas-SNP	.											.	AHDC1	98	.	0			c.C1058T						.						6.0	6.0	6.0					1																	27877569		1972	3949	5921	SO:0001583	missense	27245	exon6			CCCAGGGGCTGCT	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1058C>T	chr1.hg19:g.27877569G>A	ENSP00000247087:p.Pro353Leu	88.0	0.0		70.0	16.0	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Missense_Mutation	SNP	ENST00000247087.5	hg19	CCDS30652.1	.	.	.	.	.	.	.	.	.	.	G	17.58	3.425948	0.62733	.	.	ENSG00000126705	ENST00000247087;ENST00000374011	T;T	0.44482	0.92;0.92	5.05	5.05	0.67936	.	0.414010	0.17632	U	0.167352	T	0.29556	0.0737	N	0.14661	0.345	0.44061	D	0.996806	P	0.50819	0.939	P	0.47206	0.541	T	0.04885	-1.0920	10	0.02654	T	1	-3.7732	15.4245	0.75041	0.0:0.0:1.0:0.0	.	353	Q5TGY3	AHDC1_HUMAN	L	353	ENSP00000247087:P353L;ENSP00000363123:P353L	ENSP00000247087:P353L	P	-	2	0	AHDC1	27750156	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	2.750000	0.47500	2.630000	0.89119	0.591000	0.81541	CCC	.	.		0.711	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
IFI44L	10964	hgsc.bcm.edu	37	1	79095456	79095456	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr1:79095456C>A	ENST00000370751.5	+	4	758	c.579C>A	c.(577-579)gaC>gaA	p.D193E	IFI44L_ENST00000342282.3_De_novo_Start_InFrame|IFI44L_ENST00000476521.1_3'UTR	NM_006820.2	NP_006811.2	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	193					defense response to virus (GO:0051607)|immune response (GO:0006955)	cytoplasm (GO:0005737)				endometrium(4)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	22						CCTATGCAGACTTGGTTTCAG	0.398																																					p.D193E		Atlas-SNP	.											.	IFI44L	93	.	0			c.C579A						.						124.0	123.0	123.0					1																	79095456		2203	4300	6503	SO:0001583	missense	10964	exon4			TGCAGACTTGGTT	AB000115	CCDS687.2	1p22.3	2008-07-18	2004-11-12	2004-11-12	ENSG00000137959	ENSG00000137959			17817	protein-coding gene	gene with protein product		613975	"""chromosome 1 open reading frame 29"""	C1orf29			Standard	NM_006820		Approved	GS3686	uc010oro.2	Q53G44	OTTHUMG00000009724	ENST00000370751.5:c.579C>A	chr1.hg19:g.79095456C>A	ENSP00000359787:p.Asp193Glu	54.0	0.0		68.0	28.0	NM_006820	Q86TE1|Q96B64|Q99984	Missense_Mutation	SNP	ENST00000370751.5	hg19	CCDS687.2	.	.	.	.	.	.	.	.	.	.	C	9.473	1.096031	0.20552	.	.	ENSG00000137959	ENST00000370751;ENST00000450498	T;T	0.13307	2.79;2.6	2.95	-0.198	0.13224	.	0.993614	0.08173	N	0.986682	T	0.02767	0.0083	L	0.36672	1.1	0.09310	N	0.999998	B	0.24258	0.1	B	0.18263	0.021	T	0.45483	-0.9258	10	0.36615	T	0.2	-0.0486	3.224	0.06725	0.0:0.3998:0.2142:0.386	.	193	Q53G44	IF44L_HUMAN	E	193;170	ENSP00000359787:D193E;ENSP00000400784:D170E	ENSP00000359787:D193E	D	+	3	2	IFI44L	78868044	0.000000	0.05858	0.001000	0.08648	0.064000	0.16182	-0.388000	0.07352	-0.030000	0.13804	-0.362000	0.07510	GAC	.	.		0.398	IFI44L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026834.3	NM_006820	
SLC22A15	55356	hgsc.bcm.edu	37	1	116574049	116574049	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr1:116574049C>T	ENST00000369503.4	+	6	921	c.791C>T	c.(790-792)gCg>gTg	p.A264V	SLC22A15_ENST00000369502.1_3'UTR	NM_018420.2	NP_060890.2	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15	264					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			endometrium(1)|large_intestine(2)|lung(12)|prostate(1)|urinary_tract(1)	17	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GCTGAAGAGGCGCTGTACCTC	0.483																																					p.A264V		Atlas-SNP	.											.	SLC22A15	65	.	0			c.C791T						.						93.0	94.0	93.0					1																	116574049		1997	4174	6171	SO:0001583	missense	55356	exon6			AAGAGGCGCTGTA	AY145501	CCDS44198.1	1p12	2013-05-22	2008-01-11		ENSG00000163393	ENSG00000163393		"""Solute carriers"""	20301	protein-coding gene	gene with protein product		608275	"""solute carrier family 22 (organic cation transporter), member 15"""			12372408	Standard	NM_018420		Approved	FLIPT1	uc001egb.4	Q8IZD6	OTTHUMG00000012008	ENST00000369503.4:c.791C>T	chr1.hg19:g.116574049C>T	ENSP00000358515:p.Ala264Val	116.0	0.0		81.0	24.0	NM_018420	A8MUR3|Q6UXP5|Q8TAL9|Q9NSH5	Missense_Mutation	SNP	ENST00000369503.4	hg19	CCDS44198.1	.	.	.	.	.	.	.	.	.	.	C	3.565	-0.088817	0.07097	.	.	ENSG00000163393	ENST00000369503	T	0.58940	0.3	4.81	4.81	0.61882	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.174931	0.51477	D	0.000084	T	0.12050	0.0293	N	0.00152	-1.975	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.11470	-1.0586	10	0.41790	T	0.15	.	18.0583	0.89369	0.0:1.0:0.0:0.0	.	264	Q8IZD6	S22AF_HUMAN	V	264	ENSP00000358515:A264V	ENSP00000358515:A264V	A	+	2	0	SLC22A15	116375572	0.994000	0.37717	0.091000	0.20842	0.575000	0.36095	3.396000	0.52565	2.498000	0.84270	0.655000	0.94253	GCG	.	.		0.483	SLC22A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033220.2	NM_018420	
IQGAP3	128239	hgsc.bcm.edu	37	1	156521882	156521882	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr1:156521882A>G	ENST00000361170.2	-	14	1464	c.1454T>C	c.(1453-1455)tTc>tCc	p.F485S		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	485					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGGGCATCGAAGTAACTGGC	0.542																																					p.F485S		Atlas-SNP	.											.	IQGAP3	146	.	0			c.T1454C						.						84.0	68.0	74.0					1																	156521882		2203	4300	6503	SO:0001583	missense	128239	exon14			GCATCGAAGTAAC	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.1454T>C	chr1.hg19:g.156521882A>G	ENSP00000354451:p.Phe485Ser	49.0	0.0		127.0	16.0	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	hg19	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.807783	0.50421	.	.	ENSG00000183856	ENST00000361170	T	0.06768	3.26	4.44	4.44	0.53790	.	0.000000	0.85682	D	0.000000	T	0.15565	0.0375	M	0.73598	2.24	0.50813	D	0.999891	D	0.71674	0.998	D	0.75484	0.986	T	0.05886	-1.0858	10	0.22109	T	0.4	-10.4453	12.688	0.56958	1.0:0.0:0.0:0.0	.	485	Q86VI3	IQGA3_HUMAN	S	485	ENSP00000354451:F485S	ENSP00000354451:F485S	F	-	2	0	IQGAP3	154788506	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.779000	0.85648	1.867000	0.54127	0.379000	0.24179	TTC	.	.		0.542	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
ADCY10	55811	hgsc.bcm.edu	37	1	167830128	167830128	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr1:167830128T>C	ENST00000367851.4	-	15	1974	c.1790A>G	c.(1789-1791)aAt>aGt	p.N597S	ADCY10_ENST00000545172.1_Missense_Mutation_p.N444S|ADCY10_ENST00000367848.1_Missense_Mutation_p.N505S	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	597					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						GAAAATGTCATTAAGAAGACA	0.408																																					p.N597S		Atlas-SNP	.											.	ADCY10	175	.	0			c.A1790G						.						187.0	172.0	177.0					1																	167830128		2203	4300	6503	SO:0001583	missense	55811	exon15			ATGTCATTAAGAA	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.1790A>G	chr1.hg19:g.167830128T>C	ENSP00000356825:p.Asn597Ser	103.0	0.0		221.0	40.0	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	ENST00000367851.4	hg19	CCDS1265.1	.	.	.	.	.	.	.	.	.	.	T	15.11	2.736613	0.49045	.	.	ENSG00000143199	ENST00000545172;ENST00000367851;ENST00000367848	T;T;T	0.37411	1.2;1.23;1.22	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000002	T	0.46521	0.1397	M	0.76328	2.33	0.29253	N	0.871829	D;D;D	0.89917	0.998;1.0;0.999	D;D;D	0.83275	0.994;0.996;0.991	T	0.47824	-0.9087	9	0.22109	T	0.4	-31.5119	12.3958	0.55384	0.0:0.0:0.0:1.0	.	444;505;597	F5GWS5;Q96PN6-2;Q96PN6	.;.;ADCYA_HUMAN	S	444;597;505	ENSP00000441992:N444S;ENSP00000356825:N597S;ENSP00000356822:N505S	ENSP00000356822:N505S	N	-	2	0	ADCY10	166096752	1.000000	0.71417	0.719000	0.30619	0.214000	0.24535	3.942000	0.56614	2.237000	0.73441	0.460000	0.39030	AAT	.	.		0.408	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
LRRN2	10446	hgsc.bcm.edu	37	1	204589034	204589034	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr1:204589034G>A	ENST00000367175.1	-	1	2299	c.87C>T	c.(85-87)tgC>tgT	p.C29C	LRRN2_ENST00000367176.3_Silent_p.C29C|LRRN2_ENST00000496057.1_5'UTR|LRRN2_ENST00000367177.3_Silent_p.C29C			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	29	LRRNT.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			ACTGAGGGGGGCAGGGAACAT	0.647																																					p.C29C		Atlas-SNP	.											.	LRRN2	81	.	0			c.C87T						.						24.0	27.0	26.0					1																	204589034		2203	4300	6503	SO:0001819	synonymous_variant	10446	exon3			AGGGGGGCAGGGA	AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.87C>T	chr1.hg19:g.204589034G>A		90.0	0.0		139.0	25.0	NM_006338	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Silent	SNP	ENST00000367175.1	hg19	CCDS1448.1																																																																																			.	.		0.647	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089894.1	NM_006338	
ADI1	55256	hgsc.bcm.edu	37	2	3523232	3523232	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr2:3523232G>A	ENST00000327435.6	-	1	275	c.27C>T	c.(25-27)gaC>gaT	p.D9D	AC142528.1_ENST00000450917.1_RNA|ADI1_ENST00000382093.5_5'Flank	NM_018269.3	NP_060739.2			acireductone dioxygenase 1											breast(2)|large_intestine(2)|lung(4)|ovary(1)|stomach(1)	10	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0729)|Epithelial(75;0.173)|all cancers(51;0.228)		CGCCCGGGGCGTCGTCCATAT	0.721																																					p.D9D		Atlas-SNP	.											.	ADI1	12	.	0			c.C27T						.						3.0	4.0	4.0					2																	3523232		1891	3818	5709	SO:0001819	synonymous_variant	55256	exon1			CGGGGCGTCGTCC		CCDS1653.1	2p25.2	2013-05-29			ENSG00000182551	ENSG00000182551	1.13.11.54		30576	protein-coding gene	gene with protein product	"""membrane-type 1 matrix metalloproteinase cytoplasmic tail binding protein-1"""	613400				14718544, 15938715	Standard	NM_018269		Approved	SIPL, MTCBP-1, ARD, APL1, FLJ10913, HMFT1638, mtnD	uc002qxp.4	Q9BV57	OTTHUMG00000112441	ENST00000327435.6:c.27C>T	chr2.hg19:g.3523232G>A		95.0	0.0		64.0	15.0	NM_018269		Silent	SNP	ENST00000327435.6	hg19	CCDS1653.1																																																																																			.	.		0.721	ADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000231914.6	NM_018269	
DRC1	92749	hgsc.bcm.edu	37	2	26652600	26652600	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr2:26652600G>A	ENST00000288710.2	+	5	719	c.645G>A	c.(643-645)atG>atA	p.M215I		NM_145038.2	NP_659475.2	Q96MC2	DRC1_HUMAN	dynein regulatory complex subunit 1	215					axonemal dynein complex assembly (GO:0070286)|bacterial-type flagellum-dependent cell motility (GO:0071973)|cilium-dependent cell motility (GO:0060285)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)											AGAATGTGATGAAAACCTTTC	0.468																																					p.M215I		Atlas-SNP	.											.	CCDC164	84	.	0			c.G645A						.						115.0	114.0	115.0					2																	26652600		2203	4300	6503	SO:0001583	missense	92749	exon5			TGTGATGAAAACC	AL833892	CCDS1723.1	2p23.3	2014-07-18	2014-07-18	2013-03-14	ENSG00000157856	ENSG00000157856			24245	protein-coding gene	gene with protein product		615288	"""chromosome 2 open reading frame 39"", ""coiled-coil domain containing 164"", ""dynein regulatory complex subunit 1 homolog (Chlamydomonas)"""	C2orf39, CCDC164		23354437	Standard	NM_145038		Approved	MGC16372, FLJ32660, CILD21	uc002rhg.2	Q96MC2	OTTHUMG00000125531	ENST00000288710.2:c.645G>A	chr2.hg19:g.26652600G>A	ENSP00000288710:p.Met215Ile	102.0	0.0		99.0	28.0	NM_145038	A8K1N8|Q53R91|Q53TA3|Q8NDI5	Missense_Mutation	SNP	ENST00000288710.2	hg19	CCDS1723.1	.	.	.	.	.	.	.	.	.	.	G	6.623	0.483423	0.12581	.	.	ENSG00000157856	ENST00000288710	T	0.14144	2.53	5.35	2.97	0.34412	.	0.547632	0.21139	N	0.079515	T	0.06096	0.0158	N	0.04043	-0.29	0.09310	N	0.999995	B	0.10296	0.003	B	0.11329	0.006	T	0.29640	-1.0005	10	0.37606	T	0.19	-26.4115	9.1544	0.36983	0.0871:0.2939:0.619:0.0	.	215	Q96MC2	CC164_HUMAN	I	215	ENSP00000288710:M215I	ENSP00000288710:M215I	M	+	3	0	CCDC164	26506104	0.980000	0.34600	0.450000	0.26969	0.673000	0.39480	0.508000	0.22692	2.506000	0.84524	0.563000	0.77884	ATG	.	.		0.468	DRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246862.1	NM_145038	
SLC5A6	8884	hgsc.bcm.edu	37	2	27435079	27435079	+	5'UTR	SNP	C	C	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr2:27435079C>G	ENST00000310574.3	-	0	75				ATRAID_ENST00000405489.3_5'Flank|ATRAID_ENST00000380171.3_Missense_Mutation_p.T3S|ATRAID_ENST00000606999.1_5'Flank|SLC5A6_ENST00000408041.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6						biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CGCATGAAGACCAGCGCAGAG	0.687																																					p.T3S		Atlas-SNP	.											.	.	.	.	0			c.C8G						.						5.0	7.0	7.0					2																	27435079		2097	4100	6197	SO:0001623	5_prime_UTR_variant	51374	exon1			TGAAGACCAGCGC	AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.-399G>C	chr2.hg19:g.27435079C>G		254.0	0.0		272.0	21.0	NM_080592	B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	ENST00000310574.3	hg19	CCDS1740.1	.	.	.	.	.	.	.	.	.	.	C	12.63	1.995925	0.35226	.	.	ENSG00000138085	ENST00000380171	T	0.47528	0.84	4.37	-6.28	0.02020	.	1.080330	0.07297	N	0.873370	T	0.25344	0.0616	N	0.19112	0.55	0.09310	N	0.999995	B	0.18610	0.029	B	0.18871	0.023	T	0.26985	-1.0087	10	0.87932	D	0	-0.3751	2.4066	0.04414	0.361:0.1478:0.3724:0.1188	.	3	Q6UW56-3	.	S	3	ENSP00000369518:T3S	ENSP00000369518:T3S	T	+	2	0	C2orf28	27288583	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.582000	0.02117	-1.325000	0.02269	-0.367000	0.07326	ACC	.	.		0.687	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214194.1	NM_021095	
LRP1B	53353	hgsc.bcm.edu	37	2	141200109	141200109	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr2:141200109G>A	ENST00000389484.3	-	66	11349	c.10378C>T	c.(10378-10380)Cca>Tca	p.P3460S		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3460	LDL-receptor class A 24. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCACAGTCTGGATCCTCGTCA	0.478										TSP Lung(27;0.18)																											p.P3460S	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.C10378T						.						157.0	144.0	149.0					2																	141200109		2203	4300	6503	SO:0001583	missense	53353	exon66			AGTCTGGATCCTC	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10378C>T	chr2.hg19:g.141200109G>A	ENSP00000374135:p.Pro3460Ser	102.0	0.0		93.0	18.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	G	17.01	3.280604	0.59758	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.95518	-3.73	5.33	4.45	0.53987	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.144839	0.47093	U	0.000253	D	0.90010	0.6881	L	0.28608	0.87	0.39828	D	0.972933	P	0.39352	0.669	B	0.38378	0.272	D	0.86729	0.1947	10	0.18710	T	0.47	.	8.8307	0.35082	0.0754:0.0:0.7758:0.1488	.	3460	Q9NZR2	LRP1B_HUMAN	S	3460;3398	ENSP00000374135:P3460S	ENSP00000374135:P3460S	P	-	1	0	LRP1B	140916579	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	5.446000	0.66600	1.238000	0.43771	0.557000	0.71058	CCA	.	.		0.478	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
KIF5C	3800	hgsc.bcm.edu	37	2	149806841	149806841	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr2:149806841C>T	ENST00000435030.1	+	10	1201	c.833C>T	c.(832-834)cCa>cTa	p.P278L	KIF5C_ENST00000464066.1_3'UTR|KIF5C_ENST00000414838.2_Missense_Mutation_p.P183L|KIF5C_ENST00000397413.1_Missense_Mutation_p.P46L			O60282	KIF5C_HUMAN	kinesin family member 5C	278	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		ACACATGTGCCATACCGGGAC	0.448																																					p.P278L		Atlas-SNP	.											.	KIF5C	166	.	0			c.C833T						.						104.0	101.0	102.0					2																	149806841		1898	4134	6032	SO:0001583	missense	3800	exon10			ATGTGCCATACCG	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.833C>T	chr2.hg19:g.149806841C>T	ENSP00000393379:p.Pro278Leu	45.0	0.0		62.0	5.0	NM_004522	O95079|Q2YDC5	Missense_Mutation	SNP	ENST00000435030.1	hg19		.	.	.	.	.	.	.	.	.	.	C	32	5.178799	0.94846	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436;ENST00000397413	D;D;D	0.83335	-1.71;-1.71;-1.71	5.65	5.65	0.86999	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.91935	0.7446	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92016	0.5622	9	0.87932	D	0	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	278	O60282	KIF5C_HUMAN	L	278;183;181;46	ENSP00000393379:P278L;ENSP00000410115:P183L;ENSP00000380560:P46L	ENSP00000334176:P181L	P	+	2	0	KIF5C	149515087	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.651000	0.83577	2.941000	0.99782	0.655000	0.94253	CCA	.	.		0.448	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
ZNF148	7707	hgsc.bcm.edu	37	3	124951547	124951547	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr3:124951547G>A	ENST00000360647.4	-	9	2508	c.2023C>T	c.(2023-2025)Cac>Tac	p.H675Y	ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000468369.1_Intron|ZNF148_ENST00000492394.1_Missense_Mutation_p.H675Y|ZNF148_ENST00000485866.1_Missense_Mutation_p.H675Y|ZNF148_ENST00000484491.1_Missense_Mutation_p.H675Y|ZNF148_ENST00000544464.1_Intron|SLC12A8_ENST00000423114.2_Intron	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	675					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						AGTCCAAAGTGGGACTTATCT	0.438																																					p.H675Y		Atlas-SNP	.											.	ZNF148	84	.	0			c.C2023T						.						189.0	173.0	178.0					3																	124951547		2203	4300	6503	SO:0001583	missense	7707	exon9			CAAAGTGGGACTT	U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.2023C>T	chr3.hg19:g.124951547G>A	ENSP00000353863:p.His675Tyr	86.0	0.0		92.0	51.0	NM_021964	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	ENST00000360647.4	hg19	CCDS3031.1	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514902	0.44763	.	.	ENSG00000163848	ENST00000360647;ENST00000484491;ENST00000492394;ENST00000485866	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.14	5.14	0.70334	.	0.047476	0.85682	D	0.000000	T	0.46444	0.1393	L	0.52573	1.65	0.80722	D	1	B	0.32573	0.376	B	0.31614	0.133	T	0.50056	-0.8872	10	0.62326	D	0.03	-8.9776	18.7876	0.91961	0.0:0.0:1.0:0.0	.	675	Q9UQR1	ZN148_HUMAN	Y	675	ENSP00000353863:H675Y;ENSP00000420335:H675Y;ENSP00000419322:H675Y;ENSP00000420448:H675Y	ENSP00000353863:H675Y	H	-	1	0	ZNF148	126434237	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	6.045000	0.71020	2.673000	0.90976	0.591000	0.81541	CAC	.	.		0.438	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	NM_021964	
MGLL	11343	hgsc.bcm.edu	37	3	127414028	127414028	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr3:127414028G>A	ENST00000434178.2	-	7	1472	c.576C>T	c.(574-576)gaC>gaT	p.D192D	MGLL_ENST00000453507.2_Silent_p.D172D|MGLL_ENST00000476682.1_5'UTR|MGLL_ENST00000398104.1_Silent_p.D192D|MGLL_ENST00000398101.3_Silent_p.D166D|MGLL_ENST00000265052.5_Silent_p.D202D			Q99685	MGLL_HUMAN	monoglyceride lipase	192					acylglycerol acyl-chain remodeling (GO:0036155)|acylglycerol catabolic process (GO:0046464)|arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|fatty acid biosynthetic process (GO:0006633)|glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|long term synaptic depression (GO:0060292)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|regulation of endocannabinoid signaling pathway (GO:2000124)|regulation of inflammatory response (GO:0050727)|regulation of sensory perception of pain (GO:0051930)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acylglycerol lipase activity (GO:0047372)|lipid binding (GO:0008289)|lysophospholipase activity (GO:0004622)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6						AGTTATAAATGTCGACCTGGA	0.582																																					p.D202D		Atlas-SNP	.											.	MGLL	19	.	0			c.C606T						.						36.0	39.0	38.0					3																	127414028		2003	4168	6171	SO:0001819	synonymous_variant	11343	exon7			ATAAATGTCGACC	BC000551	CCDS43148.1, CCDS46902.1, CCDS58852.1	3p13-q13.33	2014-03-14			ENSG00000074416	ENSG00000074416	3.1.1.23		17038	protein-coding gene	gene with protein product		609699				9495531	Standard	NM_007283		Approved	HU-K5, MGL	uc003ejx.4	Q99685	OTTHUMG00000159641	ENST00000434178.2:c.576C>T	chr3.hg19:g.127414028G>A		159.0	0.0		137.0	29.0	NM_007283	B3KRC2|B7Z9D1|Q6IBG9|Q96AA5	Silent	SNP	ENST00000434178.2	hg19	CCDS43148.1	.	.	.	.	.	.	.	.	.	.	G	8.059	0.767785	0.15983	.	.	ENSG00000074416	ENST00000496306	.	.	.	5.02	2.78	0.32641	.	.	.	.	.	T	0.46927	0.1418	.	.	.	0.47441	D	0.999428	.	.	.	.	.	.	T	0.37079	-0.9721	4	.	.	.	-46.3044	3.7869	0.08704	0.1224:0.3846:0.3614:0.1315	.	.	.	.	I	98	.	.	T	-	2	0	MGLL	128896718	0.012000	0.17670	0.235000	0.24058	0.419000	0.31324	0.032000	0.13732	1.056000	0.40484	0.591000	0.81541	ACA	.	.		0.582	MGLL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356637.2	NM_007283	
MED12L	116931	hgsc.bcm.edu	37	3	151107778	151107778	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr3:151107778G>T	ENST00000474524.1	+	36	5396	c.5358G>T	c.(5356-5358)caG>caT	p.Q1786H	MED12L_ENST00000273432.4_Missense_Mutation_p.Q1646H	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1786						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			AATATCCACAGAGCAACATAT	0.423																																					p.Q1786H		Atlas-SNP	.											.	MED12L	271	.	0			c.G5358T						.						139.0	130.0	133.0					3																	151107778		2203	4300	6503	SO:0001583	missense	116931	exon36			TCCACAGAGCAAC	AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5358G>T	chr3.hg19:g.151107778G>T	ENSP00000417235:p.Gln1786His	64.0	0.0		63.0	7.0	NM_053002	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	ENST00000474524.1	hg19	CCDS33876.1	.	.	.	.	.	.	.	.	.	.	G	8.970	0.972808	0.18736	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.60797	0.39;0.16	5.63	4.67	0.58626	.	0.225303	0.38111	N	0.001808	T	0.60274	0.2256	N	0.19112	0.55	0.37475	D	0.915769	P;D	0.57571	0.699;0.98	B;D	0.66979	0.192;0.948	T	0.67684	-0.5607	10	0.62326	D	0.03	-5.0896	12.1613	0.54105	0.0866:0.0:0.9134:0.0	.	1646;1786	F8WAE6;Q86YW9	.;MD12L_HUMAN	H	1786;1646	ENSP00000417235:Q1786H;ENSP00000273432:Q1646H	ENSP00000273432:Q1646H	Q	+	3	2	MED12L	152590468	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.800000	0.47900	1.223000	0.43536	0.561000	0.74099	CAG	.	.		0.423	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357707.2	NM_053002	
ABCC5	10057	hgsc.bcm.edu	37	3	183667774	183667774	+	Silent	SNP	C	C	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr3:183667774C>A	ENST00000334444.6	-	21	3324	c.3084G>T	c.(3082-3084)ctG>ctT	p.L1028L	ABCC5_ENST00000265586.6_Silent_p.L1028L	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1028	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	AGACAATGTGCAGGACTGAAA	0.537																																					p.L1028L		Atlas-SNP	.											.	ABCC5	142	.	0			c.G3084T						.						64.0	71.0	68.0					3																	183667774		2096	4225	6321	SO:0001819	synonymous_variant	10057	exon21			AATGTGCAGGACT	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3084G>T	chr3.hg19:g.183667774C>A		157.0	0.0		151.0	34.0	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Silent	SNP	ENST00000334444.6	hg19	CCDS43176.1																																																																																			.	.		0.537	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
SLIT2	9353	hgsc.bcm.edu	37	4	20533635	20533635	+	Silent	SNP	T	T	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr4:20533635T>C	ENST00000504154.1	+	17	1894	c.1642T>C	c.(1642-1644)Ttg>Ctg	p.L548L	SLIT2_ENST00000503823.1_Silent_p.L540L|SLIT2_ENST00000273739.5_Silent_p.L552L|SLIT2_ENST00000503837.1_Silent_p.L544L	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	548					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						ATTTACCGTGTTGGAAGCCAC	0.303																																					p.L548L		Atlas-SNP	.											.	SLIT2	290	.	0			c.T1642C						.						49.0	49.0	49.0					4																	20533635		2203	4295	6498	SO:0001819	synonymous_variant	9353	exon17			ACCGTGTTGGAAG	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1642T>C	chr4.hg19:g.20533635T>C		374.0	0.0		265.0	88.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	ENST00000504154.1	hg19	CCDS3426.1																																																																																			.	.		0.303	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
PALLD	23022	hgsc.bcm.edu	37	4	169602487	169602487	+	Silent	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr4:169602487C>T	ENST00000505667.1	+	4	1265	c.1092C>T	c.(1090-1092)gcC>gcT	p.A364A	PALLD_ENST00000333488.4_Silent_p.A241A|PALLD_ENST00000335742.7_5'UTR|PALLD_ENST00000512127.1_5'UTR|PALLD_ENST00000261509.6_Silent_p.A364A			Q8WX93	PALLD_HUMAN	palladin, cytoskeletal associated protein	364					cytoskeleton organization (GO:0007010)	actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	muscle alpha-actinin binding (GO:0051371)			breast(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(18)|ovary(3)|prostate(3)|skin(4)	48		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		TCCCAGGTGCCAGTTCAACAG	0.323									Pancreatic Cancer, Familial Clustering of																												p.A364A	Esophageal Squamous(109;1482 1532 18347 40239 51172)	Atlas-SNP	.											.	PALLD	179	.	0			c.C1092T						.						83.0	82.0	83.0					4																	169602487		2203	4300	6503	SO:0001819	synonymous_variant	23022	exon4	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1	AGGTGCCAGTTCA	AB023209	CCDS34098.1, CCDS54818.1, CCDS54819.1, CCDS54820.1	4q32.3	2013-01-11			ENSG00000129116	ENSG00000129116		"""Immunoglobulin superfamily / I-set domain containing"""	17068	protein-coding gene	gene with protein product		608092				10231032, 10931874	Standard	NM_001166108		Approved	KIAA0992, SIH002, CGI-151	uc011cjx.2	Q8WX93	OTTHUMG00000161097	ENST00000505667.1:c.1092C>T	chr4.hg19:g.169602487C>T		53.0	0.0		29.0	13.0	NM_001166108	B3KTG2|B5MD56|B7ZMM5|Q7L3E0|Q7Z3W0|Q86WE8|Q8N1M2|Q9UGA0|Q9UQF5|Q9Y2J6|Q9Y3E9	Silent	SNP	ENST00000505667.1	hg19	CCDS54818.1																																																																																			.	.		0.323	PALLD-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000363762.1	NM_016081	
RXFP3	51289	hgsc.bcm.edu	37	5	33937055	33937055	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr5:33937055G>A	ENST00000330120.3	+	1	565	c.210G>A	c.(208-210)ggG>ggA	p.G70G		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	70					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						GCAGCGGCGGGGCAGAGAGCG	0.697																																					p.G70G		Atlas-SNP	.											.	RXFP3	114	.	0			c.G210A						.						39.0	51.0	47.0					5																	33937055		2201	4297	6498	SO:0001819	synonymous_variant	51289	exon1			CGGCGGGGCAGAG	D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.210G>A	chr5.hg19:g.33937055G>A		92.0	0.0		104.0	7.0	NM_016568	Q14DA5	Silent	SNP	ENST00000330120.3	hg19	CCDS3900.1																																																																																			.	.		0.697	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207369.1	NM_016568	
RAD50	10111	hgsc.bcm.edu	37	5	131893023	131893023	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr5:131893023C>G	ENST00000265335.6	+	1	394	c.7C>G	c.(7-9)Cgg>Ggg	p.R3G	RAD50_ENST00000378823.3_5'UTR			Q92878	RAD50_HUMAN	RAD50 homolog (S. cerevisiae)	3					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	membrane (GO:0016020)|Mre11 complex (GO:0030870)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|nuclease activity (GO:0004518)|protein binding, bridging (GO:0030674)|zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		all_cancers(142;0.0368)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			AAACATGTCCCGGATCGAAAA	0.502								Homologous recombination																													p.R3G		Atlas-SNP	.											.	RAD50	246	.	0			c.C7G						.						96.0	98.0	97.0					5																	131893023		2203	4300	6503	SO:0001583	missense	10111	exon1			ATGTCCCGGATCG	Z75311	CCDS34233.1	5q23-q31	2008-05-30	2001-11-28		ENSG00000113522	ENSG00000113522			9816	protein-coding gene	gene with protein product		604040	"""RAD50 (S. cerevisiae) homolog"""			8756642, 9705271	Standard	NM_005732		Approved	hRad50, RAD50-2	uc003kxi.3	Q92878	OTTHUMG00000059613	ENST00000265335.6:c.7C>G	chr5.hg19:g.131893023C>G	ENSP00000265335:p.Arg3Gly	168.0	0.0		178.0	50.0	NM_005732	B9EGF5|O43254|Q6GMT7|Q6P5X3|Q9UP86	Missense_Mutation	SNP	ENST00000265335.6	hg19	CCDS34233.1	.	.	.	.	.	.	.	.	.	.	C	16.05	3.013975	0.54468	.	.	ENSG00000113522	ENST00000265335;ENST00000453394	T;T	0.07567	3.18;3.18	5.72	3.73	0.42828	.	0.098210	0.64402	D	0.000002	T	0.06962	0.0177	L	0.32530	0.975	0.80722	D	1	B	0.27932	0.194	B	0.22386	0.039	T	0.29640	-1.0005	10	0.39692	T	0.17	-11.9627	10.9171	0.47142	0.5095:0.4905:0.0:0.0	.	3	Q92878	RAD50_HUMAN	G	3	ENSP00000265335:R3G;ENSP00000400049:R3G	ENSP00000265335:R3G	R	+	1	2	RAD50	131920922	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.755000	0.47540	1.377000	0.46286	0.655000	0.94253	CGG	.	.		0.502	RAD50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132566.5	NM_005732	
PCDHGA1	56114	hgsc.bcm.edu	37	5	140711458	140711458	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr5:140711458C>T	ENST00000517417.1	+	1	1207	c.1207C>T	c.(1207-1209)Cgt>Tgt	p.R403C	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Missense_Mutation_p.R403C	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	403	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R403C(2)		breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAATTATTACCGTTTAGTGAC	0.398																																					p.R403C		Atlas-SNP	.											PCDHGA1_ENST00000517417,NS,carcinoma,-1,4	PCDHGA1	397	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1207T						.						74.0	72.0	73.0					5																	140711458		2203	4300	6503	SO:0001583	missense	56114	exon1			TATTACCGTTTAG	AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1207C>T	chr5.hg19:g.140711458C>T	ENSP00000431083:p.Arg403Cys	91.0	0.0		95.0	21.0	NM_018912	Q2M273|Q9Y5D6	Missense_Mutation	SNP	ENST00000517417.1	hg19	CCDS54922.1	.	.	.	.	.	.	.	.	.	.	C	10.00	1.233128	0.22626	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.01787	4.64;4.64	3.85	1.97	0.26223	Cadherin (4);Cadherin-like (1);	0.789993	0.10576	U	0.658525	T	0.03390	0.0098	M	0.79926	2.475	0.09310	N	1	B;B	0.32893	0.133;0.389	B;B	0.30646	0.073;0.118	T	0.30090	-0.9990	10	0.87932	D	0	.	6.4861	0.22089	0.3189:0.5898:0.0:0.0913	.	403;403	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	C	403	ENSP00000431083:R403C;ENSP00000367345:R403C	ENSP00000367345:R403C	R	+	1	0	PCDHGA1	140691642	0.000000	0.05858	0.998000	0.56505	0.992000	0.81027	-0.112000	0.10791	0.925000	0.37094	0.650000	0.86243	CGT	.	.		0.398	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374737.1	NM_018912	
PDGFRB	5159	hgsc.bcm.edu	37	5	149504387	149504387	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr5:149504387G>A	ENST00000261799.4	-	13	2284	c.1815C>T	c.(1813-1815)acC>acT	p.T605T		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	605	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CAGAGCCGAGGGTGCGTCCTG	0.647			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																p.T605T		Atlas-SNP	.		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	.	PDGFRB	142	.	0			c.C1815T						.						39.0	38.0	38.0					5																	149504387		2203	4300	6503	SO:0001819	synonymous_variant	5159	exon13			GCCGAGGGTGCGT	M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1815C>T	chr5.hg19:g.149504387G>A		21.0	0.0		25.0	13.0	NM_002609	B5A957|Q8N5L4	Silent	SNP	ENST00000261799.4	hg19	CCDS4303.1																																																																																			.	.		0.647	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252332.1	NM_002609	
PRRC2A	7916	hgsc.bcm.edu	37	6	31600194	31600194	+	Silent	SNP	T	T	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr6:31600194T>G	ENST00000376033.2	+	16	3978	c.3744T>G	c.(3742-3744)gcT>gcG	p.A1248A	PRRC2A_ENST00000376007.4_Silent_p.A1248A	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1248	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						ATGGGAGGGCTCAGCAGCAGG	0.642																																					p.A1248A		Atlas-SNP	.											.	PRRC2A	152	.	0			c.T3744G						.						74.0	76.0	75.0					6																	31600194		1511	2709	4220	SO:0001819	synonymous_variant	7916	exon16			GAGGGCTCAGCAG	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3744T>G	chr6.hg19:g.31600194T>G		54.0	0.0		69.0	16.0	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	ENST00000376033.2	hg19	CCDS4708.1																																																																																			.	.		0.642	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
PRDM13	59336	hgsc.bcm.edu	37	6	100061211	100061211	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr6:100061211G>A	ENST00000369215.4	+	4	1005	c.700G>A	c.(700-702)Gcg>Acg	p.A234T		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	234					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		GGCCTCTTCCGCGCCCTCGGC	0.726																																					p.A234T		Atlas-SNP	.											.	PRDM13	65	.	0			c.G700A						.						5.0	7.0	7.0					6																	100061211		1908	3999	5907	SO:0001583	missense	59336	exon4			TCTTCCGCGCCCT	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.700G>A	chr6.hg19:g.100061211G>A	ENSP00000358217:p.Ala234Thr	43.0	0.0		54.0	10.0	NM_021620	Q5TGC1|Q5TGC2	Missense_Mutation	SNP	ENST00000369215.4	hg19	CCDS43487.1	.	.	.	.	.	.	.	.	.	.	G	8.017	0.758807	0.15846	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	T;T	0.06142	3.34;3.35	4.59	2.63	0.31362	.	0.222694	0.22930	N	0.053909	T	0.00998	0.0033	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48222	-0.9054	10	0.13853	T	0.58	-3.8548	4.8876	0.13710	0.1098:0.0:0.6658:0.2244	.	234	Q9H4Q3	PRD13_HUMAN	T	234;244	ENSP00000358217:A234T;ENSP00000358216:A244T	ENSP00000358216:A244T	A	+	1	0	PRDM13	100167932	.	.	0.001000	0.08648	0.220000	0.24768	.	.	1.143000	0.42306	0.462000	0.41574	GCG	.	.		0.726	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2		
FIG4	9896	hgsc.bcm.edu	37	6	110085143	110085143	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr6:110085143G>A	ENST00000230124.3	+	13	1516	c.1392G>A	c.(1390-1392)tgG>tgA	p.W464*	FIG4_ENST00000441478.2_Nonsense_Mutation_p.W187*	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	464	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		AACACAGGTGGAATGAACTAG	0.328																																					p.W464X		Atlas-SNP	.											.	FIG4	77	.	0			c.G1392A						.						89.0	88.0	88.0					6																	110085143		2203	4300	6503	SO:0001587	stop_gained	9896	exon13			CAGGTGGAATGAA	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.1392G>A	chr6.hg19:g.110085143G>A	ENSP00000230124:p.Trp464*	90.0	0.0		131.0	55.0	NM_014845	Q53H49|Q5TCS6	Nonsense_Mutation	SNP	ENST00000230124.3	hg19	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	G	38	6.966328	0.97967	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	.	.	.	5.12	4.25	0.50352	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-9.7436	13.354	0.60617	0.0761:0.0:0.9239:0.0	.	.	.	.	X	187;464	.	ENSP00000230124:W464X	W	+	3	0	FIG4	110191836	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	6.155000	0.71833	1.156000	0.42514	0.551000	0.68910	TGG	.	.		0.328	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845	
THEMIS	387357	hgsc.bcm.edu	37	6	128134119	128134119	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr6:128134119C>T	ENST00000368248.2	-	4	1815	c.1667G>A	c.(1666-1668)cGc>cAc	p.R556H	THEMIS_ENST00000368250.1_Missense_Mutation_p.R477H|THEMIS_ENST00000537166.1_Missense_Mutation_p.R521H|THEMIS_ENST00000543064.1_Missense_Mutation_p.R556H	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	556					negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TTTCGGAGGGCGAGGTGGGGG	0.493																																					p.R556H		Atlas-SNP	.											.	THEMIS	168	.	0			c.G1667A						.						111.0	114.0	113.0					6																	128134119		2203	4300	6503	SO:0001583	missense	387357	exon4			GGAGGGCGAGGTG	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.1667G>A	chr6.hg19:g.128134119C>T	ENSP00000357231:p.Arg556His	75.0	0.0		93.0	18.0	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation	SNP	ENST00000368248.2	hg19	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294707	0.60086	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166	T;T;T;T	0.32988	1.43;1.58;1.48;1.44	5.83	2.91	0.33838	.	0.258158	0.36482	N	0.002576	T	0.38904	0.1058	M	0.65498	2.005	0.36638	D	0.876665	D;D	0.89917	1.0;0.999	D;P	0.63597	0.916;0.763	T	0.46261	-0.9204	10	0.72032	D	0.01	-0.4145	14.6116	0.68519	0.3819:0.6181:0.0:0.0	.	556;556	F5H1J9;Q8N1K5	.;THMS1_HUMAN	H	477;556;556;521	ENSP00000357233:R477H;ENSP00000439594:R556H;ENSP00000357231:R556H;ENSP00000439863:R521H	ENSP00000357231:R556H	R	-	2	0	THEMIS	128175812	0.985000	0.35326	0.907000	0.35723	0.898000	0.52572	2.713000	0.47194	0.293000	0.22520	0.563000	0.77884	CGC	.	.		0.493	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
THEMIS	387357	hgsc.bcm.edu	37	6	128135074	128135074	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr6:128135074G>A	ENST00000368248.2	-	4	860	c.712C>T	c.(712-714)Cga>Tga	p.R238*	THEMIS_ENST00000368250.1_Nonsense_Mutation_p.R159*|THEMIS_ENST00000537166.1_Nonsense_Mutation_p.R203*|THEMIS_ENST00000543064.1_Nonsense_Mutation_p.R238*	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	238	CABIT 1.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						ATATCTTTTCGAACTAAAAAG	0.333																																					p.R238X		Atlas-SNP	.											THEMIS,NS,carcinoma,0,3	THEMIS	168	.	0			c.C712T						.						58.0	63.0	61.0					6																	128135074		2128	4283	6411	SO:0001587	stop_gained	387357	exon4			CTTTTCGAACTAA	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.712C>T	chr6.hg19:g.128135074G>A	ENSP00000357231:p.Arg238*	59.0	0.0		60.0	18.0	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Nonsense_Mutation	SNP	ENST00000368248.2	hg19	CCDS34534.1	.	.	.	.	.	.	.	.	.	.	G	37	6.242014	0.97408	.	.	ENSG00000172673	ENST00000368250;ENST00000543064;ENST00000368248;ENST00000537166;ENST00000434358	.	.	.	5.73	1.82	0.25136	.	0.466331	0.22107	N	0.064531	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.6297	16.0043	0.80349	0.0:0.0:0.6002:0.3998	.	.	.	.	X	159;238;238;203;6	.	ENSP00000357231:R238X	R	-	1	2	THEMIS	128176767	0.924000	0.31332	0.030000	0.17652	0.941000	0.58515	2.332000	0.43903	0.042000	0.15717	0.557000	0.71058	CGA	.	.		0.333	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
KDELR2	11014	hgsc.bcm.edu	37	7	6509351	6509351	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr7:6509351T>C	ENST00000258739.4	-	3	411	c.227A>G	c.(226-228)tAc>tGc	p.Y76C	KDELR2_ENST00000490996.1_Missense_Mutation_p.Y76C|DAGLB_ENST00000436575.1_Intron|KDELR2_ENST00000463747.1_Intron	NM_006854.3	NP_006845.1	P33947	ERD22_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2	76					intracellular protein transport (GO:0006886)|protein retention in ER lumen (GO:0006621)|vesicle-mediated transport (GO:0016192)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	KDEL sequence binding (GO:0005046)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		GTAGATCAGGTACACTGTGGC	0.458																																					p.Y76C		Atlas-SNP	.											.	KDELR2	31	.	0			c.A227G						.						87.0	82.0	84.0					7																	6509351		2203	4300	6503	SO:0001583	missense	11014	exon3			ATCAGGTACACTG	X63745	CCDS5351.1, CCDS43550.1	7p	2008-05-02			ENSG00000136240	ENSG00000136240			6305	protein-coding gene	gene with protein product		609024				1316805, 1325562	Standard	NM_006854		Approved	ELP-1, ERD2.2	uc003sqe.4	P33947	OTTHUMG00000023103	ENST00000258739.4:c.227A>G	chr7.hg19:g.6509351T>C	ENSP00000258739:p.Tyr76Cys	150.0	0.0		246.0	18.0	NM_001100603	A4D2P4|Q6IPC5|Q96E30	Missense_Mutation	SNP	ENST00000258739.4	hg19	CCDS5351.1	.	.	.	.	.	.	.	.	.	.	T	19.92	3.915870	0.73098	.	.	ENSG00000136240	ENST00000258739;ENST00000490996	T	0.52526	0.66	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.74756	0.3758	H	0.94385	3.53	0.80722	D	1	D;D	0.76494	0.999;0.994	D;D	0.74023	0.982;0.928	T	0.81152	-0.1063	10	0.87932	D	0	-0.3987	10.4834	0.44706	0.0:0.0726:0.0:0.9274	.	76;76	P33947-2;P33947	.;ERD22_HUMAN	C	76	ENSP00000258739:Y76C	ENSP00000258739:Y76C	Y	-	2	0	KDELR2	6475876	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.197000	0.58413	2.268000	0.75426	0.455000	0.32223	TAC	.	.		0.458	KDELR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059424.2		
ABCB5	340273	hgsc.bcm.edu	37	7	20689688	20689688	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr7:20689688T>A	ENST00000404938.2	+	12	1902	c.1250T>A	c.(1249-1251)gTc>gAc	p.V417D	ABCB5_ENST00000406935.1_5'UTR|ABCB5_ENST00000258738.6_5'UTR|ABCB5_ENST00000477094.1_3'UTR|ABCB5_ENST00000443026.2_5'UTR	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	417	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						GGAGAGACAGTCGCCTTGGTC	0.438																																					p.V417D		Atlas-SNP	.											.	ABCB5	357	.	0			c.T1250A						.						87.0	76.0	80.0					7																	20689688		1568	3582	5150	SO:0001583	missense	340273	exon12			AGACAGTCGCCTT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1250T>A	chr7.hg19:g.20689688T>A	ENSP00000384881:p.Val417Asp	88.0	0.0		116.0	25.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	hg19	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	T	17.97	3.517602	0.64634	.	.	ENSG00000004846	ENST00000404938	D	0.95069	-3.6	5.14	5.14	0.70334	.	.	.	.	.	D	0.97974	0.9333	H	0.96365	3.81	0.52099	D	0.999946	D	0.56035	0.974	D	0.65233	0.933	D	0.99215	1.0877	9	0.87932	D	0	.	14.8407	0.70220	0.0:0.0:0.0:1.0	.	417	A7BKA4	.	D	417	ENSP00000384881:V417D	ENSP00000384881:V417D	V	+	2	0	ABCB5	20656213	0.730000	0.28100	0.782000	0.31804	0.787000	0.44495	2.124000	0.42006	2.239000	0.73571	0.528000	0.53228	GTC	.	.		0.438	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
MUC17	140453	hgsc.bcm.edu	37	7	100681533	100681533	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr7:100681533C>A	ENST00000306151.4	+	3	6900	c.6836C>A	c.(6835-6837)aCt>aAt	p.T2279N		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2279	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGGAACGACTCCATTAACA	0.478																																					p.T2279N		Atlas-SNP	.											.	MUC17	804	.	0			c.C6836A						.																																			SO:0001583	missense	140453	exon3			GAACGACTCCATT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6836C>A	chr7.hg19:g.100681533C>A	ENSP00000302716:p.Thr2279Asn	58.0	0.0		67.0	7.0	NM_001040105	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	ENST00000306151.4	hg19	CCDS34711.1	.	.	.	.	.	.	.	.	.	.	C	2.491	-0.317530	0.05386	.	.	ENSG00000169876	ENST00000306151	T	0.02472	4.28	0.762	0.762	0.18454	.	.	.	.	.	T	0.03390	0.0098	N	0.19112	0.55	0.09310	N	1	P	0.51933	0.949	P	0.51297	0.665	T	0.49679	-0.8914	9	0.35671	T	0.21	.	6.9517	0.24548	0.0:0.9999:0.0:1.0E-4	.	2279	Q685J3	MUC17_HUMAN	N	2279	ENSP00000302716:T2279N	ENSP00000302716:T2279N	T	+	2	0	MUC17	100468253	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.068000	0.14531	0.132000	0.18615	0.134000	0.15878	ACT	.	.		0.478	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
RBM28	55131	hgsc.bcm.edu	37	7	127979340	127979340	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr7:127979340T>C	ENST00000223073.2	-	3	427	c.313A>G	c.(313-315)Aaa>Gaa	p.K105E	RBM28_ENST00000415472.2_Intron	NM_018077.2	NP_060547.2	Q9NW13	RBM28_HUMAN	RNA binding motif protein 28	105					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(7)|large_intestine(3)|lung(8)|ovary(2)	21						TTGGCTTTTTTAGCCTTCGGC	0.393																																					p.K105E		Atlas-SNP	.											.	RBM28	71	.	0			c.A313G						.						193.0	201.0	198.0					7																	127979340		2202	4300	6502	SO:0001583	missense	55131	exon3			CTTTTTTAGCCTT	AK001239	CCDS5801.1, CCDS55159.1	7q32.2	2013-02-12			ENSG00000106344	ENSG00000106344		"""RNA binding motif (RRM) containing"""	21863	protein-coding gene	gene with protein product		612074					Standard	NM_018077		Approved	FLJ10377	uc003vmp.2	Q9NW13	OTTHUMG00000157711	ENST00000223073.2:c.313A>G	chr7.hg19:g.127979340T>C	ENSP00000223073:p.Lys105Glu	58.0	0.0		48.0	11.0	NM_018077	A4D100|B4DU52|E9PDD9|Q53H65|Q96CV3	Missense_Mutation	SNP	ENST00000223073.2	hg19	CCDS5801.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.712690	0.89112	.	.	ENSG00000106344	ENST00000223073;ENST00000478061;ENST00000459726	T;T;T	0.31510	2.98;2.19;1.49	5.86	4.68	0.58851	Nucleotide-binding, alpha-beta plait (1);	0.362222	0.33515	N	0.004835	T	0.29458	0.0734	L	0.32530	0.975	0.80722	D	1	P	0.39535	0.677	P	0.47673	0.554	T	0.03706	-1.1011	10	0.19147	T	0.46	-6.6855	9.9242	0.41483	0.0:0.0:0.1712:0.8288	.	105	Q9NW13	RBM28_HUMAN	E	105;105;139	ENSP00000223073:K105E;ENSP00000418071:K105E;ENSP00000420503:K139E	ENSP00000223073:K105E	K	-	1	0	RBM28	127766576	0.999000	0.42202	0.321000	0.25320	0.875000	0.50365	3.001000	0.49488	1.014000	0.39417	0.477000	0.44152	AAA	.	.		0.393	RBM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349442.2	NM_018077	
CYP11B1	1584	hgsc.bcm.edu	37	8	143961168	143961168	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr8:143961168G>A	ENST00000292427.4	-	1	94	c.62C>T	c.(61-63)gCa>gTa	p.A21V	CYP11B1_ENST00000517471.1_Missense_Mutation_p.A21V|CYP11B1_ENST00000377675.3_Missense_Mutation_p.A21V	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	21					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	CAGTGCCTGTGCCCTTTGCAG	0.637									Familial Hyperaldosteronism type I																												p.A21V		Atlas-SNP	.											.	CYP11B1	128	.	0			c.C62T						.						96.0	94.0	95.0					8																	143961168		2203	4300	6503	SO:0001583	missense	1584	exon1	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	GCCTGTGCCCTTT	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.62C>T	chr8.hg19:g.143961168G>A	ENSP00000292427:p.Ala21Val	48.0	0.0		98.0	22.0	NM_000497	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	hg19	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	G	11.80	1.747966	0.30955	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;D;T	0.83837	-1.0;-1.77;-1.34	2.96	2.06	0.26882	.	0.550372	0.13718	N	0.367597	T	0.75910	0.3914	L	0.54323	1.7	0.09310	N	1	B;B;P	0.44734	0.018;0.209;0.842	B;B;B	0.40982	0.012;0.03;0.345	T	0.62909	-0.6754	10	0.30078	T	0.28	.	6.32	0.21213	0.1561:0.0:0.8439:0.0	.	21;21;21	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	V	21	ENSP00000292427:A21V;ENSP00000428043:A21V;ENSP00000366903:A21V	ENSP00000292427:A21V	A	-	2	0	CYP11B1	143958170	0.001000	0.12720	0.001000	0.08648	0.011000	0.07611	0.386000	0.20702	0.514000	0.28300	0.305000	0.20034	GCA	.	.		0.637	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
FOXE1	2304	hgsc.bcm.edu	37	9	100616728	100616728	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr9:100616728G>A	ENST00000375123.3	+	1	1193	c.532G>A	c.(532-534)Gcc>Acc	p.A178T		NM_004473.3	NP_004464.2	O00358	FOXE1_HUMAN	forkhead box E1 (thyroid transcription factor 2)	178	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|cell migration (GO:0016477)|embryonic organ morphogenesis (GO:0048562)|hair follicle morphogenesis (GO:0031069)|hard palate development (GO:0060022)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pharynx development (GO:0060465)|positive regulation of transcription, DNA-templated (GO:0045893)|soft palate development (GO:0060023)|thymus development (GO:0048538)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|lung(2)|upper_aerodigestive_tract(1)	5		Acute lymphoblastic leukemia(62;0.158)				cgccgccgccgccgccATCTT	0.791																																					p.A178T		Atlas-SNP	.											.	FOXE1	19	.	0			c.G532A						.						2.0	2.0	2.0					9																	100616728		529	1359	1888	SO:0001583	missense	2304	exon1			GCCGCCGCCGCCA	U89995	CCDS35078.1	9q22	2008-09-05			ENSG00000178919	ENSG00000178919		"""Forkhead boxes"""	3806	protein-coding gene	gene with protein product		602617	"""forkhead box E2"""	FKHL15, TITF2, FOXE2		9169137, 9697705	Standard	NM_004473		Approved	TTF-2, HFKH4	uc004axu.3	O00358	OTTHUMG00000020333	ENST00000375123.3:c.532G>A	chr9.hg19:g.100616728G>A	ENSP00000364265:p.Ala178Thr	162.0	0.0		211.0	15.0	NM_004473	O75765|Q5T109|Q99526	Missense_Mutation	SNP	ENST00000375123.3	hg19	CCDS35078.1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930555	0.52866	.	.	ENSG00000178919	ENST00000375123	D	0.93953	-3.32	3.94	3.02	0.34903	.	0.612880	0.14474	U	0.317365	D	0.83087	0.5178	L	0.34521	1.04	0.22571	N	0.998979	P	0.47253	0.892	B	0.30251	0.113	T	0.72969	-0.4130	10	0.13108	T	0.6	.	6.9037	0.24297	0.0993:0.1791:0.7216:0.0	.	178	O00358	FOXE1_HUMAN	T	178	ENSP00000364265:A178T	ENSP00000364265:A178T	A	+	1	0	FOXE1	99656549	0.087000	0.21565	0.898000	0.35279	0.822000	0.46500	0.422000	0.21296	0.758000	0.33059	0.557000	0.71058	GCC	.	.		0.791	FOXE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053341.1		
SGPL1	8879	hgsc.bcm.edu	37	10	72633292	72633292	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr10:72633292G>A	ENST00000373202.3	+	12	1444	c.1244G>A	c.(1243-1245)gGc>gAc	p.G415D		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	415					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						GGTGAGAACGGCTATGTTGAA	0.522																																					p.G415D	Colon(151;1054 2458 6676 40971)	Atlas-SNP	.											.	SGPL1	37	.	0			c.G1244A						.						142.0	126.0	132.0					10																	72633292		2203	4300	6503	SO:0001583	missense	8879	exon12			AGAACGGCTATGT	AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.1244G>A	chr10.hg19:g.72633292G>A	ENSP00000362298:p.Gly415Asp	49.0	0.0		65.0	14.0	NM_003901	B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	ENST00000373202.3	hg19	CCDS31216.1	.	.	.	.	.	.	.	.	.	.	G	34	5.316187	0.95655	.	.	ENSG00000166224	ENST00000373202	T	0.45276	0.9	5.73	5.73	0.89815	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.79173	0.4401	H	0.97783	4.075	0.80722	D	1	D	0.71674	0.998	D	0.73380	0.98	D	0.86721	0.1942	10	0.87932	D	0	-19.149	19.9064	0.97008	0.0:0.0:1.0:0.0	.	415	O95470	SGPL1_HUMAN	D	415	ENSP00000362298:G415D	ENSP00000362298:G415D	G	+	2	0	SGPL1	72303298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.615000	0.83006	2.693000	0.91896	0.655000	0.94253	GGC	.	.		0.522	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048533.1	NM_003901	
TCTN3	26123	hgsc.bcm.edu	37	10	97442541	97442541	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr10:97442541C>T	ENST00000371217.5	-	12	1342	c.1319G>A	c.(1318-1320)aGc>aAc	p.S440N	TCTN3_ENST00000265993.9_Missense_Mutation_p.S458N|TCTN3_ENST00000430368.2_Missense_Mutation_p.S292N			Q6NUS6	TECT3_HUMAN	tectonic family member 3	440					apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		CTGCAAGTGGCTGCAGTCTGC	0.443																																					p.S440N		Atlas-SNP	.											.	TCTN3	66	.	0			c.G1319A						.						162.0	162.0	162.0					10																	97442541		2203	4300	6503	SO:0001583	missense	26123	exon12			AAGTGGCTGCAGT	AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.1319G>A	chr10.hg19:g.97442541C>T	ENSP00000360261:p.Ser440Asn	46.0	0.0		45.0	22.0	NM_015631	A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Missense_Mutation	SNP	ENST00000371217.5	hg19	CCDS31258.2	.	.	.	.	.	.	.	.	.	.	C	11.85	1.760209	0.31137	.	.	ENSG00000119977	ENST00000265993;ENST00000430368;ENST00000371217;ENST00000343162	D	0.84146	-1.81	5.64	2.26	0.28386	.	0.784973	0.12599	N	0.454872	T	0.78246	0.4253	M	0.66506	2.035	0.09310	N	1	P;B;B	0.45176	0.852;0.012;0.069	B;B;B	0.34180	0.177;0.009;0.056	T	0.66956	-0.5792	10	0.36615	T	0.2	-26.1162	6.1477	0.20294	0.0:0.649:0.16:0.1911	.	292;440;262	B4DR81;Q6NUS6;Q6NUS6-3	.;TECT3_HUMAN;.	N	440;292;458;262	ENSP00000265993:S440N	ENSP00000265993:S440N	S	-	2	0	TCTN3	97432531	0.529000	0.26322	0.335000	0.25508	0.792000	0.44763	0.777000	0.26718	0.711000	0.32018	0.563000	0.77884	AGC	.	.		0.443	TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000471858.1	NM_015631	
OR5AP2	338675	hgsc.bcm.edu	37	11	56409796	56409796	+	Silent	SNP	G	G	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr11:56409796G>T	ENST00000302981.1	-	1	119	c.120C>A	c.(118-120)atC>atA	p.I40I	OR5AP2_ENST00000544374.1_Silent_p.I41I	NM_001002925.1	NP_001002925.1	Q8NGF4	O5AP2_HUMAN	olfactory receptor, family 5, subfamily AP, member 2	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	29						TTGCCATATAGATCAACAGAA	0.408																																					p.I40I		Atlas-SNP	.											.	OR5AP2	69	.	0			c.C120A						.						104.0	96.0	99.0					11																	56409796		2201	4296	6497	SO:0001819	synonymous_variant	338675	exon1			CATATAGATCAAC	AB065854	CCDS31534.1	11q11	2012-08-09			ENSG00000172464	ENSG00000172464		"""GPCR / Class A : Olfactory receptors"""	15258	protein-coding gene	gene with protein product							Standard	NM_001002925		Approved		uc001njb.1	Q8NGF4	OTTHUMG00000166865	ENST00000302981.1:c.120C>A	chr11.hg19:g.56409796G>T		62.0	0.0		100.0	43.0	NM_001002925	B2RNM8	Silent	SNP	ENST00000302981.1	hg19	CCDS31534.1																																																																																			.	.		0.408	OR5AP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391613.1	NM_001002925	
SLC25A45	283130	hgsc.bcm.edu	37	11	65147644	65147644	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr11:65147644C>T	ENST00000527174.1	-	2	95	c.40G>A	c.(40-42)Gct>Act	p.A14T	SLC25A45_ENST00000360662.3_Missense_Mutation_p.A14T|SLC25A45_ENST00000294187.6_5'UTR|SLC25A45_ENST00000417511.2_5'UTR|SLC25A45_ENST00000526432.1_Missense_Mutation_p.A14T|SLC25A45_ENST00000398802.1_Missense_Mutation_p.A14T|SLC25A45_ENST00000534028.1_Missense_Mutation_p.A14T|SLC25A45_ENST00000377152.2_5'UTR			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	14					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						AAGCCCAGAGCGCCTGTGGTG	0.567																																					p.A14T		Atlas-SNP	.											.	SLC25A45	23	.	0			c.G40A						.						113.0	120.0	118.0					11																	65147644		1995	4177	6172	SO:0001583	missense	283130	exon3			CCAGAGCGCCTGT	BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.40G>A	chr11.hg19:g.65147644C>T	ENSP00000435489:p.Ala14Thr	94.0	0.0		108.0	55.0	NM_182556	Q6PL49|Q8IW29	Missense_Mutation	SNP	ENST00000527174.1	hg19	CCDS41670.1	.	.	.	.	.	.	.	.	.	.	C	33	5.265812	0.95399	.	.	ENSG00000162241	ENST00000527174;ENST00000534028;ENST00000398802;ENST00000360662;ENST00000526432;ENST00000530936	T;T;T;T;T;T	0.81163	-1.46;-1.28;-1.46;-1.28;-1.46;-1.46	4.38	4.38	0.52667	Mitochondrial carrier domain (2);	0.263149	0.28989	N	0.013500	D	0.84665	0.5522	L	0.47716	1.5	0.80722	D	1	D;D;P	0.89917	1.0;0.991;0.951	D;P;P	0.69142	0.962;0.856;0.819	D	0.85095	0.0954	10	0.54805	T	0.06	-0.0071	12.3081	0.54914	0.0:1.0:0.0:0.0	.	14;14;14	E9PJQ3;Q8N413-4;Q8N413	.;.;S2545_HUMAN	T	14	ENSP00000435489:A14T;ENSP00000431769:A14T;ENSP00000381782:A14T;ENSP00000353879:A14T;ENSP00000435547:A14T;ENSP00000431642:A14T	ENSP00000353879:A14T	A	-	1	0	SLC25A45	64904220	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	5.091000	0.64505	2.251000	0.74343	0.561000	0.74099	GCT	.	.		0.567	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388744.3	NM_182556	
OR10S1	219873	hgsc.bcm.edu	37	11	123847876	123847876	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr11:123847876A>C	ENST00000531945.1	-	1	612	c.523T>G	c.(523-525)Tcc>Gcc	p.S175A		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		AAGGTGAGGGAGGTGTGGATT	0.567																																					p.S175A		Atlas-SNP	.											.	OR10S1	78	.	0			c.T523G						.						109.0	95.0	100.0					11																	123847876		2202	4299	6501	SO:0001583	missense	219873	exon1			TGAGGGAGGTGTG	BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.523T>G	chr11.hg19:g.123847876A>C	ENSP00000431914:p.Ser175Ala	76.0	0.0		115.0	28.0	NM_001004474	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	ENST00000531945.1	hg19	CCDS31701.1	.	.	.	.	.	.	.	.	.	.	A	2.309	-0.358464	0.05138	.	.	ENSG00000196248	ENST00000531945	T	0.36699	1.24	4.71	0.886	0.19194	GPCR, rhodopsin-like superfamily (1);	0.181219	0.26680	U	0.023059	T	0.17619	0.0423	N	0.20610	0.595	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26121	-1.0112	10	0.12430	T	0.62	-16.6409	6.7698	0.23587	0.3981:0.3651:0.0:0.2367	.	175	Q8NGN2	O10S1_HUMAN	A	175	ENSP00000431914:S175A	ENSP00000431914:S175A	S	-	1	0	OR10S1	123353086	0.000000	0.05858	0.525000	0.27900	0.669000	0.39330	-0.899000	0.04101	-0.008000	0.14320	-0.511000	0.04467	TCC	.	.		0.567	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387265.2	NM_001004474	
IGSF9B	22997	hgsc.bcm.edu	37	11	133816010	133816010	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr11:133816010G>C	ENST00000321016.8	-	2	438	c.208C>G	c.(208-210)Cct>Gct	p.P70A	IGSF9B_ENST00000533871.2_Missense_Mutation_p.P70A			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	70	Ig-like 1.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		ATGAAGATAGGGATGGGGACC	0.617																																					p.P70A		Atlas-SNP	.											.	IGSF9B	290	.	0			c.C208G						.						54.0	65.0	61.0					11																	133816010		2100	4207	6307	SO:0001583	missense	22997	exon2			AGATAGGGATGGG	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.208C>G	chr11.hg19:g.133816010G>C	ENSP00000317980:p.Pro70Ala	110.0	0.0		140.0	64.0	NM_014987	G5EA26	Missense_Mutation	SNP	ENST00000321016.8	hg19		.	.	.	.	.	.	.	.	.	.	G	23.0	4.360763	0.82353	.	.	ENSG00000080854	ENST00000321016;ENST00000527648;ENST00000533160;ENST00000526663	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	5.68	4.77	0.60923	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.081500	0.48767	D	0.000164	T	0.81370	0.4808	M	0.77486	2.375	0.58432	D	0.999994	D	0.64830	0.994	D	0.78314	0.991	D	0.83727	0.0196	10	0.66056	D	0.02	.	14.3176	0.66463	0.0722:0.0:0.9278:0.0	.	70	Q9UPX0	TUTLB_HUMAN	A	70;70;60;117	ENSP00000317980:P70A;ENSP00000436576:P70A;ENSP00000434026:P60A;ENSP00000435989:P117A	ENSP00000317980:P70A	P	-	1	0	IGSF9B	133321220	1.000000	0.71417	1.000000	0.80357	0.767000	0.43475	9.738000	0.98835	1.415000	0.47037	0.655000	0.94253	CCT	.	.		0.617	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
CS	1431	hgsc.bcm.edu	37	12	56676233	56676233	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr12:56676233G>A	ENST00000351328.3	-	6	749	c.559C>T	c.(559-561)Cag>Tag	p.Q187*	CS_ENST00000548567.1_Nonsense_Mutation_p.Q121*|CS_ENST00000542324.2_Nonsense_Mutation_p.Q174*	NM_004077.2	NP_004068.2	O75390	CISY_HUMAN	citrate synthase	187				Q -> R (in Ref. 1; AAC25560). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	citrate (Si)-synthase activity (GO:0004108)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	17		Myeloproliferative disorder(1001;0.000374)		BRCA - Breast invasive adenocarcinoma(357;6.17e-07)		CTGATACCCTGTGCATATGCT	0.507																																					p.Q187X		Atlas-SNP	.											.	CS	44	.	0			c.C559T						.						102.0	77.0	86.0					12																	56676233		2203	4300	6503	SO:0001587	stop_gained	1431	exon6			TACCCTGTGCATA		CCDS8913.1	12q13.2	2012-10-02				ENSG00000062485	2.3.3.1		2422	protein-coding gene	gene with protein product		118950					Standard	NM_004077		Approved		uc001sks.1	O75390	OTTHUMG00000170344	ENST00000351328.3:c.559C>T	chr12.hg19:g.56676233G>A	ENSP00000342056:p.Gln187*	103.0	0.0		132.0	8.0	NM_004077	Q71UT9|Q7KZH0|Q96FZ8|Q9BWN8	Nonsense_Mutation	SNP	ENST00000351328.3	hg19	CCDS8913.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444473	0.83993	.	.	ENSG00000062485	ENST00000548567;ENST00000351328;ENST00000542324;ENST00000549221;ENST00000546930;ENST00000551936;ENST00000550734;ENST00000551253;ENST00000552688;ENST00000546554	.	.	.	4.79	2.95	0.34219	.	0.098661	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.4858	14.6063	0.68481	0.0:0.7188:0.2812:0.0	.	.	.	.	X	121;187;174;112;121;121;121;121;151;137	.	ENSP00000342056:Q187X	Q	-	1	0	CS	54962500	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.603000	0.61105	0.695000	0.31675	-0.139000	0.14373	CAG	.	.		0.507	CS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408588.2	NM_004077	
RNF17	56163	hgsc.bcm.edu	37	13	25433221	25433221	+	Silent	SNP	A	A	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr13:25433221A>G	ENST00000255324.5	+	26	3745	c.3693A>G	c.(3691-3693)aaA>aaG	p.K1231K	RNF17_ENST00000339524.3_Silent_p.K283K|RNF17_ENST00000381921.1_Silent_p.K1231K	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1231	Tudor 3. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TCTGGAAAAAAGGAGAAGCAT	0.368																																					p.K1231K		Atlas-SNP	.											.	RNF17	259	.	0			c.A3693G						.						100.0	98.0	99.0					13																	25433221		2203	4300	6503	SO:0001819	synonymous_variant	56163	exon26			GAAAAAAGGAGAA	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3693A>G	chr13.hg19:g.25433221A>G		107.0	0.0		78.0	4.0	NM_031277	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Silent	SNP	ENST00000255324.5	hg19	CCDS9308.2																																																																																			.	.		0.368	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
FLT1	2321	hgsc.bcm.edu	37	13	29012442	29012442	+	Silent	SNP	G	G	A	rs537466636		TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr13:29012442G>A	ENST00000282397.4	-	4	680	c.429C>T	c.(427-429)ccC>ccT	p.P143P	FLT1_ENST00000539099.1_Silent_p.P143P|FLT1_ENST00000541932.1_Silent_p.P143P	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	143					blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GTATAATTTCGGGGATTTCAC	0.378																																					p.P143P		Atlas-SNP	.											.	FLT1	393	.	0			c.C429T						.						114.0	97.0	103.0					13																	29012442		2203	4300	6503	SO:0001819	synonymous_variant	2321	exon4			AATTTCGGGGATT	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.429C>T	chr13.hg19:g.29012442G>A		55.0	0.0		39.0	15.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	hg19	CCDS9330.1																																																																																			.	.		0.378	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
ARHGEF40	55701	hgsc.bcm.edu	37	14	21541244	21541244	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr14:21541244C>T	ENST00000298694.4	+	2	171	c.44C>T	c.(43-45)gCc>gTc	p.A15V	NDRG2_ENST00000403829.3_5'Flank|ARHGEF40_ENST00000298693.3_Missense_Mutation_p.A15V			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	15						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						AGCACTCTCGCCGCCCTGTAT	0.592																																					p.A15V		Atlas-SNP	.											.	ARHGEF40	84	.	0			c.C44T						.						112.0	97.0	102.0					14																	21541244		2203	4300	6503	SO:0001583	missense	55701	exon2			CTCTCGCCGCCCT		CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.44C>T	chr14.hg19:g.21541244C>T	ENSP00000298694:p.Ala15Val	55.0	0.0		46.0	9.0	NM_018071	A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	ENST00000298694.4	hg19	CCDS32041.1	.	.	.	.	.	.	.	.	.	.	C	33	5.200573	0.94997	.	.	ENSG00000165801	ENST00000298694;ENST00000555038;ENST00000298693	T;T	0.02890	4.17;4.12	5.03	5.03	0.67393	.	0.144353	0.31949	N	0.006808	T	0.09113	0.0225	L	0.52573	1.65	0.40116	D	0.976549	P;D	0.55605	0.792;0.972	B;P	0.56398	0.326;0.797	T	0.01448	-1.1352	10	0.72032	D	0.01	.	15.8973	0.79344	0.0:1.0:0.0:0.0	.	15;15	Q8TER5;G3V3N2	ARH40_HUMAN;.	V	15	ENSP00000298694:A15V;ENSP00000298693:A15V	ENSP00000298693:A15V	A	+	2	0	ARHGEF40	20611084	0.766000	0.28496	0.237000	0.24090	0.948000	0.59901	3.986000	0.56937	2.627000	0.88993	0.455000	0.32223	GCC	.	.		0.592	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413122.1		
HERC2	8924	hgsc.bcm.edu	37	15	28421672	28421672	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr15:28421672G>A	ENST00000261609.7	-	63	9696	c.9588C>T	c.(9586-9588)ccC>ccT	p.P3196P		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CAATGTTCTGGGGAATGTTAC	0.502																																					p.P3196P		Atlas-SNP	.											.	HERC2	501	.	0			c.C9588T						.						82.0	86.0	85.0					15																	28421672		2203	4300	6503	SO:0001819	synonymous_variant	8924	exon63			GTTCTGGGGAATG	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9588C>T	chr15.hg19:g.28421672G>A		153.0	0.0		118.0	26.0	NM_004667		Silent	SNP	ENST00000261609.7	hg19	CCDS10021.1																																																																																			.	.		0.502	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
HDC	3067	hgsc.bcm.edu	37	15	50549685	50549685	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr15:50549685C>T	ENST00000267845.3	-	4	780	c.378G>A	c.(376-378)atG>atA	p.M126I	HDC_ENST00000543581.1_Missense_Mutation_p.M126I	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		GAAGTCCCAGCATTTTTGCCA	0.582																																					p.M126I	GBM(95;1627 1936 6910 9570)	Atlas-SNP	.											.	HDC	86	.	0			c.G378A						.						140.0	117.0	125.0					15																	50549685		2196	4295	6491	SO:0001583	missense	3067	exon4			TCCCAGCATTTTT		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.378G>A	chr15.hg19:g.50549685C>T	ENSP00000267845:p.Met126Ile	42.0	0.0		44.0	28.0	NM_002112		Missense_Mutation	SNP	ENST00000267845.3	hg19	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	C	13.96	2.393593	0.42410	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.37411	1.2;1.2	5.13	5.13	0.70059	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.094456	0.64402	D	0.000001	T	0.55178	0.1904	M	0.69248	2.105	0.49299	D	0.999777	P;D	0.54047	0.909;0.964	P;P	0.56278	0.795;0.769	T	0.58747	-0.7582	10	0.87932	D	0	-31.9222	18.7731	0.91900	0.0:1.0:0.0:0.0	.	126;126	B7ZM01;P19113	.;DCHS_HUMAN	I	126	ENSP00000267845:M126I;ENSP00000440252:M126I	ENSP00000267845:M126I	M	-	3	0	HDC	48336977	1.000000	0.71417	1.000000	0.80357	0.217000	0.24651	2.305000	0.43664	2.675000	0.91044	0.655000	0.94253	ATG	.	.		0.582	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
ZSCAN10	84891	hgsc.bcm.edu	37	16	3139523	3139523	+	Nonsense_Mutation	SNP	C	C	A	rs540283059		TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr16:3139523C>A	ENST00000252463.2	-	5	1834	c.1747G>T	c.(1747-1749)Gag>Tag	p.E583*	RP11-473M20.9_ENST00000571404.1_lincRNA|ZSCAN10_ENST00000575108.1_Nonsense_Mutation_p.E244*|ZSCAN10_ENST00000538082.2_Nonsense_Mutation_p.E501*	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	583					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						TCACCGCACTCGCTGCAGCGG	0.706																																					p.E583X		Atlas-SNP	.											.	ZSCAN10	63	.	0			c.G1747T						.						14.0	15.0	15.0					16																	3139523		2187	4279	6466	SO:0001587	stop_gained	84891	exon5			CGCACTCGCTGCA	AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.1747G>T	chr16.hg19:g.3139523C>A	ENSP00000252463:p.Glu583*	74.0	0.0		44.0	15.0	NM_032805	B3KQD3|H0YFS6|Q1WWM2	Nonsense_Mutation	SNP	ENST00000252463.2	hg19	CCDS10493.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739384	0.89573	.	.	ENSG00000130182	ENST00000538082;ENST00000252463	.	.	.	5.34	2.17	0.27698	.	0.275958	0.25813	N	0.028126	.	.	.	.	.	.	0.44985	D	0.998	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-16.2039	14.5971	0.68415	0.0:0.544:0.456:0.0	.	.	.	.	X	516;583	.	ENSP00000252463:E583X	E	-	1	0	ZSCAN10	3079524	0.000000	0.05858	0.978000	0.43139	0.875000	0.50365	-0.103000	0.10940	0.201000	0.20466	0.561000	0.74099	GAG	.	.		0.706	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437124.2	NM_032805	
TRAP1	10131	hgsc.bcm.edu	37	16	3713465	3713465	+	Silent	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr16:3713465C>T	ENST00000246957.5	-	14	1756	c.1668G>A	c.(1666-1668)gtG>gtA	p.V556V	DNASE1_ENST00000414110.2_Intron|TRAP1_ENST00000538171.1_Silent_p.V503V|TRAP1_ENST00000573872.1_5'Flank|DNASE1_ENST00000575152.1_3'UTR|TRAP1_ENST00000575671.1_Silent_p.V347V	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	556					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				TGTAGTGATCCACGACTATGT	0.557																																					p.V556V		Atlas-SNP	.											.	TRAP1	53	.	0			c.G1668A						.						144.0	130.0	135.0					16																	3713465		2197	4300	6497	SO:0001819	synonymous_variant	10131	exon14			GTGATCCACGACT	AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1668G>A	chr16.hg19:g.3713465C>T		64.0	0.0		39.0	19.0	NM_016292	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Silent	SNP	ENST00000246957.5	hg19	CCDS10508.1																																																																																			.	.		0.557	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251586.2	NM_016292	
ITGAD	3681	hgsc.bcm.edu	37	16	31422687	31422687	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr16:31422687G>A	ENST00000389202.2	+	14	1605	c.1556G>A	c.(1555-1557)cGc>cAc	p.R519H		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	519					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CCCTGGGGCCGCTTTGGGGCA	0.632																																					p.R519H		Atlas-SNP	.											.	ITGAD	154	.	0			c.G1556A						.						106.0	108.0	108.0					16																	31422687		2197	4300	6497	SO:0001583	missense	3681	exon14			GGGGCCGCTTTGG	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.1556G>A	chr16.hg19:g.31422687G>A	ENSP00000373854:p.Arg519His	110.0	0.0		81.0	23.0	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	hg19	CCDS32438.1	.	.	.	.	.	.	.	.	.	.	G	16.24	3.066233	0.55539	.	.	ENSG00000156886	ENST00000444228;ENST00000389202	T	0.26518	1.73	4.41	4.41	0.53225	.	.	.	.	.	T	0.34948	0.0915	M	0.87971	2.92	0.48830	D	0.999716	P;P	0.41159	0.74;0.74	B;B	0.37422	0.249;0.249	T	0.48007	-0.9072	9	0.87932	D	0	.	12.4936	0.55914	0.0:0.0:1.0:0.0	.	535;519	Q59H14;Q13349	.;ITAD_HUMAN	H	535;519	ENSP00000373854:R519H	ENSP00000373854:R519H	R	+	2	0	ITGAD	31330188	1.000000	0.71417	1.000000	0.80357	0.718000	0.41266	4.641000	0.61375	1.979000	0.57680	0.407000	0.27541	CGC	.	.		0.632	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
PMFBP1	83449	hgsc.bcm.edu	37	16	72198723	72198723	+	Silent	SNP	T	T	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr16:72198723T>C	ENST00000237353.10	-	3	366	c.105A>G	c.(103-105)agA>agG	p.R35R	PMFBP1_ENST00000537465.1_Silent_p.R35R|PMFBP1_ENST00000543746.1_5'UTR|PMFBP1_ENST00000355636.6_5'UTR	NM_031293.2	NP_112583.2	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	35						cytoplasm (GO:0005737)				NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	45		Ovarian(137;0.179)				TCTTCCTCTGTCTCTTGCAGA	0.552																																					p.R35R		Atlas-SNP	.											.	PMFBP1	101	.	0			c.A105G						.						118.0	98.0	105.0					16																	72198723		2198	4300	6498	SO:0001819	synonymous_variant	83449	exon3			CCTCTGTCTCTTG	AF239683	CCDS32483.1	16q23.1	2008-08-04			ENSG00000118557	ENSG00000118557			17728	protein-coding gene	gene with protein product						11468771	Standard	NM_031293		Approved		uc002fcd.3	Q8TBY8	OTTHUMG00000167827	ENST00000237353.10:c.105A>G	chr16.hg19:g.72198723T>C		45.0	0.0		37.0	29.0	NM_031293	B3KVI9|H7BY07|Q8NA09|Q9BY16|Q9H0H4	Silent	SNP	ENST00000237353.10	hg19	CCDS32483.1																																																																																			.	.		0.552	PMFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396473.2	NM_031293	
CDT1	81620	hgsc.bcm.edu	37	16	88871218	88871218	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr16:88871218G>C	ENST00000301019.4	+	3	1019	c.400G>C	c.(400-402)Ggg>Cgg	p.G134R		NM_030928.3	NP_112190.2			chromatin licensing and DNA replication factor 1											central_nervous_system(1)|endometrium(2)|kidney(1)|lung(3)	7				BRCA - Breast invasive adenocarcinoma(80;0.0476)		CCGGGAGCTGGGGGCAAGAGT	0.697																																					p.G134R	Melanoma(159;511 3380 30971)	Atlas-SNP	.											.	CDT1	30	.	0			c.G400C						.						24.0	26.0	26.0					16																	88871218		2192	4296	6488	SO:0001583	missense	81620	exon3			GAGCTGGGGGCAA	AF070552	CCDS32510.1	16q24.3	2014-08-12			ENSG00000167513	ENSG00000167513			24576	protein-coding gene	gene with protein product		605525				11896191, 11555648	Standard	NM_030928		Approved	DUP, RIS2	uc002flu.3	Q9H211	OTTHUMG00000173467	ENST00000301019.4:c.400G>C	chr16.hg19:g.88871218G>C	ENSP00000301019:p.Gly134Arg	88.0	0.0		87.0	66.0	NM_030928		Missense_Mutation	SNP	ENST00000301019.4	hg19	CCDS32510.1	.	.	.	.	.	.	.	.	.	.	G	14.62	2.588602	0.46110	.	.	ENSG00000167513	ENST00000301019	T	0.61392	0.11	4.26	4.26	0.50523	.	0.642546	0.15873	N	0.240431	T	0.64360	0.2591	M	0.69823	2.125	0.30075	N	0.809704	D	0.61697	0.99	P	0.50754	0.649	T	0.62859	-0.6765	10	0.17369	T	0.5	.	15.6733	0.77295	0.0:0.0:1.0:0.0	.	134	Q9H211	CDT1_HUMAN	R	134	ENSP00000301019:G134R	ENSP00000301019:G134R	G	+	1	0	CDT1	87398719	0.997000	0.39634	0.935000	0.37517	0.055000	0.15305	2.272000	0.43373	2.106000	0.64143	0.449000	0.29647	GGG	.	.		0.697	CDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000423215.1	NM_030928	
TP53	7157	hgsc.bcm.edu	37	17	7577524	7577524	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr17:7577524T>C	ENST00000269305.4	-	7	946	c.757A>G	c.(757-759)Acc>Gcc	p.T253A	TP53_ENST00000420246.2_Missense_Mutation_p.T253A|TP53_ENST00000455263.2_Missense_Mutation_p.T253A|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.T253A|TP53_ENST00000413465.2_Missense_Mutation_p.T253A|TP53_ENST00000445888.2_Missense_Mutation_p.T253A	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	253	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.T253S(5)|p.L252_I254delLTI(4)|p.I251_T253delILT(4)|p.T253P(3)|p.T253A(3)|p.T253fs*91(2)|p.T253_I255del(2)|p.L252_T253delLT(1)|p.?(1)|p.P250_T253delPILT(1)|p.T253del(1)|p.T253fs*11(1)|p.R249_T256delRPILTIIT(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGATGATGGTGAGGATGGGC	0.582		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.T253A	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000413465,NS,carcinoma,+1,1	TP53	33396	.	37	Deletion - In frame(14)|Substitution - Missense(11)|Whole gene deletion(8)|Deletion - Frameshift(2)|Insertion - Frameshift(1)|Unknown(1)	large_intestine(9)|upper_aerodigestive_tract(6)|breast(4)|bone(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|skin(2)|stomach(1)|small_intestine(1)|kidney(1)|peritoneum(1)|lung(1)|ovary(1)	c.A757G						.						151.0	109.0	123.0					17																	7577524		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TGATGGTGAGGAT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.757A>G	chr17.hg19:g.7577524T>C	ENSP00000269305:p.Thr253Ala	77.0	0.0		62.0	38.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	15.86	2.957685	0.53400	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99771	-6.71;-6.71;-6.71;-6.71;-6.71;-6.71;-6.71	4.62	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.050471	0.85682	D	0.000000	D	0.99579	0.9848	L	0.59436	1.845	0.49051	D	0.999748	P;B;P;D;D	0.89917	0.936;0.017;0.948;0.999;1.0	P;B;D;D;D	0.97110	0.813;0.082;0.95;1.0;0.997	D	0.97646	1.0151	10	0.72032	D	0.01	-33.513	12.3101	0.54924	0.0:0.0:0.0:1.0	.	253;253;253;253;253	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	A	253;253;253;253;253;253;242;121	ENSP00000410739:T253A;ENSP00000352610:T253A;ENSP00000269305:T253A;ENSP00000398846:T253A;ENSP00000391127:T253A;ENSP00000391478:T253A;ENSP00000425104:T121A	ENSP00000269305:T253A	T	-	1	0	TP53	7518249	1.000000	0.71417	1.000000	0.80357	0.375000	0.29983	4.030000	0.57260	2.074000	0.62210	0.379000	0.24179	ACC	.	.		0.582	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRT10	3858	hgsc.bcm.edu	37	17	38975319	38975319	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr17:38975319C>T	ENST00000269576.5	-	7	1477	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	490	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgtggccgccgccgtgg	0.791																																					p.G490S		Atlas-SNP	.											.	KRT10	56	.	0			c.G1468A						.																																			SO:0001583	missense	3858	exon7			CGTGGCCGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1468G>A	chr17.hg19:g.38975319C>T	ENSP00000269576:p.Gly490Ser	62.0	0.0		143.0	9.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546565	0.86022	.	.	ENSG00000186395	ENST00000269576	D	0.96587	-4.06	4.38	4.38	0.52667	.	0.845686	0.09879	N	0.743932	D	0.94778	0.8314	N	0.08118	0	0.27860	N	0.940431	D	0.89917	1.0	D	0.76071	0.987	D	0.87790	0.2618	10	0.18710	T	0.47	.	12.7512	0.57310	0.0:1.0:0.0:0.0	.	490	P13645	K1C10_HUMAN	S	490	ENSP00000269576:G490S	ENSP00000269576:G490S	G	-	1	0	KRT10	36228845	0.019000	0.18553	0.876000	0.34364	0.184000	0.23303	0.448000	0.21726	2.739000	0.93911	0.603000	0.83216	GGC	.	.		0.791	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
KRT9	3857	hgsc.bcm.edu	37	17	39726179	39726179	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr17:39726179A>T	ENST00000246662.4	-	3	879	c.814T>A	c.(814-816)Tct>Act	p.S272T	KRT9_ENST00000588431.1_Missense_Mutation_p.S39T	NM_000226.3	NP_000217.2	P35527	K1C9_HUMAN	keratin 9	272	Coil 1B.|Rod.				epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		Breast(137;0.000307)				TCCAGGTCAGACTTCTCCATG	0.542																																					p.S272T		Atlas-SNP	.											.	KRT9	78	.	0			c.T814A						.						90.0	92.0	91.0					17																	39726179		2203	4300	6503	SO:0001583	missense	3857	exon3			GGTCAGACTTCTC		CCDS32654.1	17q21.2	2013-06-20	2008-08-01		ENSG00000171403	ENSG00000171403		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6447	protein-coding gene	gene with protein product	"""cytokeratin 9"", ""type I cytoskeletal 9"", ""epidermolytic palmoplantar keratoderma"""	607606				7512862, 16831889	Standard	NM_000226		Approved	EPPK, K9, CK-9	uc002hxe.4	P35527	OTTHUMG00000133599	ENST00000246662.4:c.814T>A	chr17.hg19:g.39726179A>T	ENSP00000246662:p.Ser272Thr	66.0	0.0		86.0	47.0	NM_000226	O00109|Q0IJ47|Q14665	Missense_Mutation	SNP	ENST00000246662.4	hg19	CCDS32654.1	.	.	.	.	.	.	.	.	.	.	A	11.63	1.695699	0.30052	.	.	ENSG00000171403	ENST00000246662	D	0.88509	-2.39	4.96	-1.29	0.09288	Filament (1);	0.282712	0.19284	N	0.118085	T	0.77565	0.4149	N	0.21545	0.675	0.09310	N	1	B	0.22080	0.064	B	0.28553	0.091	T	0.62714	-0.6796	10	0.21540	T	0.41	.	7.2841	0.26328	0.4118:0.3829:0.0:0.2053	.	272	P35527	K1C9_HUMAN	T	272	ENSP00000246662:S272T	ENSP00000246662:S272T	S	-	1	0	KRT9	36979705	0.000000	0.05858	0.411000	0.26484	0.828000	0.46876	-1.554000	0.02172	-0.094000	0.12374	0.402000	0.26972	TCT	.	.		0.542	KRT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257707.1	NM_000226	
ARHGAP27	201176	hgsc.bcm.edu	37	17	43480082	43480082	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr17:43480082C>T	ENST00000428638.1	-	9	1740	c.1741G>A	c.(1741-1743)Gag>Aag	p.E581K	ARHGAP27_ENST00000528384.1_Missense_Mutation_p.E213K|ARHGAP27_ENST00000532891.2_Missense_Mutation_p.E559K|ARHGAP27_ENST00000582826.1_5'UTR|ARHGAP27_ENST00000442348.1_Missense_Mutation_p.E554K|ARHGAP27_ENST00000532038.1_Missense_Mutation_p.E359K|ARHGAP27_ENST00000455881.1_Missense_Mutation_p.E240K|ARHGAP27_ENST00000376922.2_Missense_Mutation_p.E240K			Q6ZUM4	RHG27_HUMAN	Rho GTPase activating protein 27	581	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of Rac GTPase activity (GO:0032855)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|SH3 domain binding (GO:0017124)			endometrium(4)|large_intestine(9)|lung(3)|skin(1)	17	Renal(3;0.0405)					CCACTCACCTCCAGCACATTC	0.567																																					p.E240K		Atlas-SNP	.											.	ARHGAP27	37	.	0			c.G718A						.						66.0	66.0	66.0					17																	43480082		2203	4300	6503	SO:0001583	missense	201176	exon9			TCACCTCCAGCAC	AK125535	CCDS11498.1, CCDS74082.1	17q21.31	2013-01-10			ENSG00000159314	ENSG00000159314		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	31813	protein-coding gene	gene with protein product		610591	"""SH3 domain containing 20"""	SH3D20		15147912	Standard	NM_199282		Approved	CAMGAP1, FLJ43547, SH3P20	uc002iix.3	Q6ZUM4	OTTHUMG00000166982	ENST00000428638.1:c.1741G>A	chr17.hg19:g.43480082C>T	ENSP00000403323:p.Glu581Lys	32.0	0.0		61.0	19.0	NM_199282	A4FU35|A8K3N5|C9JTF3|Q494U0|Q6NWZ8|Q8WY58	Missense_Mutation	SNP	ENST00000428638.1	hg19		.	.	.	.	.	.	.	.	.	.	C	29.2	4.981708	0.93044	.	.	ENSG00000159314	ENST00000532038;ENST00000376922;ENST00000528384;ENST00000532891;ENST00000428638;ENST00000442348;ENST00000455881	T;T;T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.93;-0.93;-0.93	5.01	3.99	0.46301	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.78451	0.4285	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.993;0.996	T	0.78250	-0.2277	10	0.48119	T	0.1	.	13.3841	0.60785	0.0:0.8419:0.1581:0.0	.	359;554;581	B7Z6T0;F8WBX1;Q6ZUM4	.;.;RHG27_HUMAN	K	359;240;213;559;581;554;240	ENSP00000432762:E359K;ENSP00000366121:E240K;ENSP00000431591:E213K;ENSP00000433942:E559K;ENSP00000403323:E581K;ENSP00000409330:E554K;ENSP00000408235:E240K	ENSP00000366121:E240K	E	-	1	0	ARHGAP27	40835865	0.998000	0.40836	1.000000	0.80357	0.899000	0.52679	3.757000	0.55212	2.603000	0.88011	0.455000	0.32223	GAG	.	.		0.567	ARHGAP27-202	KNOWN	basic	protein_coding	protein_coding		NM_199282	
NACA2	342538	hgsc.bcm.edu	37	17	59668029	59668029	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr17:59668029G>A	ENST00000521764.1	-	1	534	c.513C>T	c.(511-513)gtC>gtT	p.V171V		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	171					myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					CTGTTTCATCGACCTCTTCCT	0.448																																					p.V171V		Atlas-SNP	.											.	NACA2	33	.	0			c.C513T						.						300.0	271.0	281.0					17																	59668029		2203	4300	6503	SO:0001819	synonymous_variant	342538	exon1			TTCATCGACCTCT	BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.513C>T	chr17.hg19:g.59668029G>A		67.0	0.0		63.0	7.0	NM_199290	Q2VIR9	Silent	SNP	ENST00000521764.1	hg19	CCDS11630.1																																																																																			.	.		0.448	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255437.2	NM_199290	
SLMO1	10650	hgsc.bcm.edu	37	18	12427045	12427045	+	Silent	SNP	A	A	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr18:12427045A>G	ENST00000440960.1	+	4	377	c.297A>G	c.(295-297)acA>acG	p.T99T	SLMO1_ENST00000590956.1_Silent_p.T9T|SLMO1_ENST00000587735.1_Silent_p.T9T|SLMO1_ENST00000592149.1_Silent_p.T78T|SLMO1_ENST00000336990.4_Silent_p.T99T	NM_001142405.1	NP_001135877.1	Q96N28	SLMO1_HUMAN	slowmo homolog 1 (Drosophila)	99	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(1)	1						TTAAGATCACACTCACAAATT	0.393																																					p.T99T		Atlas-SNP	.											.	SLMO1	11	.	0			c.A297G						.						64.0	59.0	60.0					18																	12427045		2203	4300	6503	SO:0001819	synonymous_variant	10650	exon4			GATCACACTCACA	AK056046	CCDS11860.1	18p11.21	2007-02-20	2007-02-06	2007-02-06	ENSG00000141391	ENSG00000141391			24639	protein-coding gene	gene with protein product	"""erythroid differentiation and denucleation factor 1"""		"""chromosome 18 open reading frame 43"""	C18orf43			Standard	NM_006553		Approved	HFL-EDDG1, FLJ31484, PRELID3A	uc010wzu.2	Q96N28	OTTHUMG00000131694	ENST00000440960.1:c.297A>G	chr18.hg19:g.12427045A>G		110.0	0.0		105.0	52.0	NM_001142405	B0YJ10|B4E0C9|D3DUJ1|Q6AHX2	Silent	SNP	ENST00000440960.1	hg19	CCDS11860.1																																																																																			.	.		0.393	SLMO1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254602.2	NM_006553	
ZNF521	25925	hgsc.bcm.edu	37	18	22804905	22804905	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr18:22804905A>T	ENST00000361524.3	-	4	3125	c.2977T>A	c.(2977-2979)Tgc>Agc	p.C993S	ZNF521_ENST00000538137.2_Missense_Mutation_p.C993S|ZNF521_ENST00000584787.1_Missense_Mutation_p.C773S|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	993					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					GGCATCTTGCAAATCCGGCAG	0.483			T	PAX5	ALL																																p.C993S		Atlas-SNP	.		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	.	ZNF521	269	.	0			c.T2977A						.						63.0	62.0	62.0					18																	22804905		2203	4300	6503	SO:0001583	missense	25925	exon4			TCTTGCAAATCCG	AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2977T>A	chr18.hg19:g.22804905A>T	ENSP00000354794:p.Cys993Ser	43.0	0.0		50.0	19.0	NM_015461	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	ENST00000361524.3	hg19	CCDS32806.1	.	.	.	.	.	.	.	.	.	.	A	11.79	1.743010	0.30865	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.39056	1.1;1.4	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.54581	0.1867	L	0.29908	0.895	0.48511	D	0.999665	D	0.89917	1.0	D	0.85130	0.997	T	0.58120	-0.7692	10	0.87932	D	0	-25.0859	16.4473	0.83942	1.0:0.0:0.0:0.0	.	993	Q96K83	ZN521_HUMAN	S	993;1027;993	ENSP00000354794:C993S;ENSP00000382352:C993S	ENSP00000354794:C993S	C	-	1	0	ZNF521	21058903	1.000000	0.71417	0.982000	0.44146	0.998000	0.95712	8.962000	0.93254	2.281000	0.76405	0.533000	0.62120	TGC	.	.		0.483	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446781.2	NM_015461	
SMAD4	4089	hgsc.bcm.edu	37	18	48591919	48591919	+	Missense_Mutation	SNP	G	G	A	rs377767347		TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr18:48591919G>A	ENST00000342988.3	+	9	1620	c.1082G>A	c.(1081-1083)cGc>cAc	p.R361H	SMAD4_ENST00000588745.1_Missense_Mutation_p.R265H|SMAD4_ENST00000398417.2_Missense_Mutation_p.R361H	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	361	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		R -> C (in JPS; dbSNP:rs80338963). {ECO:0000269|PubMed:9811934}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.R361H(12)|p.?(2)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GGAGGAGATCGCTTTTGTTTG	0.413																																					p.R361H		Atlas-SNP	.											SMAD4,caecum,carcinoma,+1,22	SMAD4	822	.	50	Whole gene deletion(36)|Substitution - Missense(12)|Unknown(2)	pancreas(26)|large_intestine(13)|lung(3)|breast(3)|upper_aerodigestive_tract(2)|stomach(2)|oesophagus(1)	c.G1082A	GRCh37	CM004254	SMAD4	M		.						167.0	138.0	148.0					18																	48591919		2203	4300	6503	SO:0001583	missense	4089	exon9			GAGATCGCTTTTG	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1082G>A	chr18.hg19:g.48591919G>A	ENSP00000341551:p.Arg361His	85.0	0.0		57.0	21.0	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	hg19	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	35	5.477304	0.96291	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.98120	-4.73;-4.73	5.86	5.86	0.93980	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.98852	0.9612	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99741	1.1015	10	0.87932	D	0	.	18.9646	0.92691	0.0:0.0:1.0:0.0	.	361	Q13485	SMAD4_HUMAN	H	361	ENSP00000341551:R361H;ENSP00000381452:R361H	ENSP00000341551:R361H	R	+	2	0	SMAD4	46845917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.828000	0.86729	2.771000	0.95319	0.563000	0.77884	CGC	.	.		0.413	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
CCDC102B	79839	hgsc.bcm.edu	37	18	66504069	66504069	+	Silent	SNP	T	T	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr18:66504069T>A	ENST00000360242.5	+	2	186	c.69T>A	c.(67-69)atT>atA	p.I23I	CCDC102B_ENST00000584156.1_Silent_p.I23I|CCDC102B_ENST00000319445.6_Silent_p.I23I|CCDC102B_ENST00000577772.1_3'UTR|CCDC102B_ENST00000358653.5_Silent_p.I23I	NM_024781.2	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	23										breast(2)|endometrium(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|stomach(1)	36		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)				AATCATCAATTAAGTCACGCG	0.423																																					p.I23I		Atlas-SNP	.											.	CCDC102B	92	.	0			c.T69A						.						62.0	63.0	63.0					18																	66504069		1948	4115	6063	SO:0001819	synonymous_variant	79839	exon4			ATCAATTAAGTCA	AK027247	CCDS11996.2	18q22.1	2007-11-14	2006-04-10	2006-04-10	ENSG00000150636	ENSG00000150636			26295	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 14"", ""aminoacylase 1-like"""	C18orf14, ACY1L		14702039	Standard	NM_001093729		Approved	FLJ23594, HsT1731, AN	uc002lkk.2	Q68D86	OTTHUMG00000132808	ENST00000360242.5:c.69T>A	chr18.hg19:g.66504069T>A		69.0	0.0		36.0	5.0	NM_001093729	Q7Z467|Q8NDK7|Q9H5C1	Silent	SNP	ENST00000360242.5	hg19	CCDS11996.2																																																																																			.	.		0.423	CCDC102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256225.2	NM_024781	
C2CD4C	126567	hgsc.bcm.edu	37	19	407984	407984	+	Silent	SNP	A	A	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:407984A>G	ENST00000332235.6	-	2	551	c.378T>C	c.(376-378)acT>acC	p.T126T		NM_001136263.1	NP_001129735.1	Q8TF44	C2C4C_HUMAN	C2 calcium-dependent domain containing 4C	126										large_intestine(1)|pancreas(1)	2						GGTCGGCGTCAGTGGCCTCCT	0.682																																					p.T126T		Atlas-SNP	.											.	C2CD4C	13	.	0			c.T378C						.						9.0	12.0	11.0					19																	407984		686	1577	2263	SO:0001819	synonymous_variant	126567	exon2			GGCGTCAGTGGCC	AB075837	CCDS45890.1	19p13.3	2009-09-28	2009-09-28	2009-09-28		ENSG00000183186			29417	protein-coding gene	gene with protein product	"""nuclear localized factor 3"""	610336	"""KIAA1957"", ""family with sequence similarity 148, member C"""	KIAA1957, FAM148C		11853319	Standard	NM_001136263		Approved	NLF3	uc002loo.3	Q8TF44		ENST00000332235.6:c.378T>C	chr19.hg19:g.407984A>G		127.0	0.0		162.0	73.0	NM_001136263	Q8N3H7	Silent	SNP	ENST00000332235.6	hg19	CCDS45890.1																																																																																			.	.		0.682	C2CD4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451789.2	XM_065166	
CD97	976	hgsc.bcm.edu	37	19	14501784	14501784	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:14501784C>T	ENST00000242786.5	+	4	319	c.239C>T	c.(238-240)tCg>tTg	p.S80L	CD97_ENST00000587728.1_3'UTR|CD97_ENST00000357355.3_Missense_Mutation_p.S80L|CD97_ENST00000358600.3_Missense_Mutation_p.S80L	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	80	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						GGAAAATTCTCGGACTGCTGG	0.522																																					p.S80L		Atlas-SNP	.											.	CD97	86	.	0			c.C239T						.						132.0	102.0	113.0					19																	14501784		2203	4300	6503	SO:0001583	missense	976	exon4			AATTCTCGGACTG		CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.239C>T	chr19.hg19:g.14501784C>T	ENSP00000242786:p.Ser80Leu	111.0	0.0		160.0	31.0	NM_078481	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	ENST00000242786.5	hg19	CCDS32929.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590001	0.46214	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	D;D;D	0.92149	-2.98;-2.98;-2.98	4.39	4.39	0.52855	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.91616	0.7351	L	0.41961	1.31	0.09310	N	1	D;B;D	0.54397	0.966;0.441;0.96	B;B;P	0.51895	0.382;0.124;0.683	D	0.85321	0.1084	9	0.87932	D	0	.	12.3432	0.55105	0.0:1.0:0.0:0.0	.	80;80;80	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	L	80;80;80;79	ENSP00000242786:S80L;ENSP00000349918:S80L;ENSP00000351413:S80L	ENSP00000242786:S80L	S	+	2	0	CD97	14362784	0.294000	0.24380	0.019000	0.16419	0.002000	0.02628	3.269000	0.51592	2.288000	0.76882	0.563000	0.77884	TCG	.	.		0.522	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459821.2	NM_078481	
HPN	3249	hgsc.bcm.edu	37	19	35540393	35540393	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:35540393A>T	ENST00000262626.2	+	4	958	c.133A>T	c.(133-135)Agg>Tgg	p.R45W	HPN_ENST00000597419.1_Intron|HPN_ENST00000392226.1_Missense_Mutation_p.R45W	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	45					basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	TGTTCTCCTCAGGAGTGACCA	0.657																																					p.R45W		Atlas-SNP	.											.	HPN	45	.	0			c.A133T						.						26.0	24.0	24.0					19																	35540393		2202	4294	6496	SO:0001583	missense	3249	exon4			CTCCTCAGGAGTG		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.133A>T	chr19.hg19:g.35540393A>T	ENSP00000262626:p.Arg45Trp	39.0	0.0		42.0	8.0	NM_182983	B2RDS4	Missense_Mutation	SNP	ENST00000262626.2	hg19	CCDS32993.1	.	.	.	.	.	.	.	.	.	.	A	14.79	2.641344	0.47153	.	.	ENSG00000105707	ENST00000262626;ENST00000392226	D;D	0.88586	-2.4;-2.4	4.33	2.07	0.26955	.	1.069870	0.07249	N	0.865552	T	0.79405	0.4440	N	0.19112	0.55	0.80722	D	1	P	0.39831	0.69	B	0.32393	0.145	T	0.67745	-0.5591	10	0.72032	D	0.01	.	8.3089	0.32060	0.6337:0.3663:0.0:0.0	.	45	P05981	HEPS_HUMAN	W	45	ENSP00000262626:R45W;ENSP00000376060:R45W	ENSP00000262626:R45W	R	+	1	2	HPN	40232233	0.847000	0.29606	0.945000	0.38365	0.967000	0.64934	1.512000	0.35812	0.243000	0.21327	0.260000	0.18958	AGG	.	.		0.657	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151	
LRFN3	79414	hgsc.bcm.edu	37	19	36431682	36431682	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:36431682C>G	ENST00000588831.1	+	3	2409	c.1355C>G	c.(1354-1356)cCg>cGg	p.P452R	LRFN3_ENST00000246529.3_Missense_Mutation_p.P452R			Q9BTN0	LRFN3_HUMAN	leucine rich repeat and fibronectin type III domain containing 3	452	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				cervix(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	12	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CGGCCTATCCCGGGCATCCGC	0.642																																					p.P452R		Atlas-SNP	.											.	LRFN3	43	.	0			c.C1355G						.						29.0	27.0	28.0					19																	36431682		2203	4300	6503	SO:0001583	missense	79414	exon2			CTATCCCGGGCAT	BC003578	CCDS12483.1	19q13.13	2013-02-11				ENSG00000126243		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	28370	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 1"""	612809				12975309, 16495444, 16828986	Standard	NM_024509		Approved	MGC2656, SALM4, FIGLER1	uc002oco.3	Q9BTN0		ENST00000588831.1:c.1355C>G	chr19.hg19:g.36431682C>G	ENSP00000466989:p.Pro452Arg	73.0	0.0		92.0	36.0	NM_024509	Q6UY10	Missense_Mutation	SNP	ENST00000588831.1	hg19	CCDS12483.1	.	.	.	.	.	.	.	.	.	.	C	19.30	3.802005	0.70682	.	.	ENSG00000126243	ENST00000246529	T	0.54866	0.55	4.77	4.77	0.60923	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.32952	N	0.005448	T	0.73466	0.3590	M	0.87547	2.89	0.58432	D	0.999996	D	0.60160	0.987	D	0.63597	0.916	T	0.76953	-0.2768	10	0.42905	T	0.14	.	15.3027	0.73966	0.0:1.0:0.0:0.0	.	452	Q9BTN0	LRFN3_HUMAN	R	452	ENSP00000246529:P452R	ENSP00000246529:P452R	P	+	2	0	LRFN3	41123522	0.993000	0.37304	0.986000	0.45419	0.982000	0.71751	3.970000	0.56824	2.204000	0.70986	0.591000	0.81541	CCG	.	.		0.642	LRFN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457403.2	NM_024509	
CYP2A13	1553	hgsc.bcm.edu	37	19	41599545	41599545	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:41599545A>G	ENST00000330436.3	+	6	842	c.842A>G	c.(841-843)aAc>aGc	p.N281S		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	281					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	GAGGAGAAGAACCCCAACACA	0.552																																					p.N281S		Atlas-SNP	.											.	CYP2A13	90	.	0			c.A842G						.						99.0	83.0	89.0					19																	41599545		2203	4300	6503	SO:0001583	missense	1553	exon6			AGAAGAACCCCAA	U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.842A>G	chr19.hg19:g.41599545A>G	ENSP00000332679:p.Asn281Ser	116.0	0.0		150.0	32.0	NM_000766	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	ENST00000330436.3	hg19	CCDS12571.1	.	.	.	.	.	.	.	.	.	.	.	9.708	1.156267	0.21454	.	.	ENSG00000197838	ENST00000330436	T	0.69306	-0.39	4.58	4.58	0.56647	.	0.587256	0.16530	N	0.210418	T	0.54886	0.1886	N	0.17922	0.545	0.09310	N	1	B	0.29886	0.26	B	0.34931	0.192	T	0.52953	-0.8506	10	0.45353	T	0.12	.	13.1064	0.59249	1.0:0.0:0.0:0.0	.	281	Q16696	CP2AD_HUMAN	S	281	ENSP00000332679:N281S	ENSP00000332679:N281S	N	+	2	0	CYP2A13	46291385	0.001000	0.12720	0.527000	0.27925	0.434000	0.31775	1.754000	0.38369	1.945000	0.56424	0.397000	0.26171	AAC	.	.		0.552	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463505.1	NM_000766	
ATP1A3	478	hgsc.bcm.edu	37	19	42485722	42485722	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:42485722C>T	ENST00000302102.5	-	11	1519	c.1369G>A	c.(1369-1371)Gtg>Atg	p.V457M	ATP1A3_ENST00000545399.1_Missense_Mutation_p.V470M|ATP1A3_ENST00000602133.1_Missense_Mutation_p.V427M|ATP1A3_ENST00000543770.1_Missense_Mutation_p.V468M	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	457					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						ATCAGCTTCACGGAGCCAGAG	0.557																																					p.V470M		Atlas-SNP	.											.	ATP1A3	117	.	0			c.G1408A						.						105.0	88.0	93.0					19																	42485722		2203	4300	6503	SO:0001583	missense	478	exon11			GCTTCACGGAGCC		CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.1369G>A	chr19.hg19:g.42485722C>T	ENSP00000302397:p.Val457Met	60.0	0.0		80.0	33.0	NM_001256214	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	ENST00000302102.5	hg19	CCDS12594.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.992148	0.74703	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.96265	-3.96;-3.96;-3.96;-3.96	3.88	3.88	0.44766	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.97542	0.9195	M	0.69523	2.12	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.993;0.996;0.998;0.996	D	0.97776	1.0229	10	0.87932	D	0	.	14.1403	0.65316	0.0:1.0:0.0:0.0	.	470;468;457;457	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	M	457;457;470;427;201;468	ENSP00000302397:V457M;ENSP00000411503:V457M;ENSP00000444688:V470M;ENSP00000437577:V468M	ENSP00000302397:V457M	V	-	1	0	ATP1A3	47177562	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.852000	0.69488	2.449000	0.82847	0.561000	0.74099	GTG	.	.		0.557	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268107.1	NM_152296	
IGFL2	147920	hgsc.bcm.edu	37	19	46663963	46663963	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:46663963G>A	ENST00000377693.4	+	3	202	c.166G>A	c.(166-168)Gcc>Acc	p.A56T	AC007193.6_ENST00000597989.1_lincRNA|IGFL2_ENST00000600243.1_3'UTR|IGFL2_ENST00000434646.2_Missense_Mutation_p.A67T	NM_001135113.1	NP_001128585.1	Q6UWQ7	IGFL2_HUMAN	IGF-like family member 2	56						extracellular region (GO:0005576)				cervix(1)|lung(5)	6		Ovarian(192;0.0908)|all_neural(266;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(486;0.031)|Epithelial(262;0.247)		TTACAATGACGCCATCGTGTC	0.592																																					p.A67T		Atlas-SNP	.											.	IGFL2	15	.	0			c.G199A						.						177.0	187.0	184.0					19																	46663963		2201	4299	6500	SO:0001583	missense	147920	exon4			AATGACGCCATCG	AY672112	CCDS46121.1, CCDS46122.1	19q13.32	2006-07-14							32929	protein-coding gene	gene with protein product		610545				14702039	Standard	NM_001002915		Approved	UNQ645	uc010xxv.2	Q6UWQ7		ENST00000377693.4:c.166G>A	chr19.hg19:g.46663963G>A	ENSP00000366922:p.Ala56Thr	61.0	0.0		71.0	19.0	NM_001002915	E9PAV1|Q6B9Z3	Missense_Mutation	SNP	ENST00000377693.4	hg19	CCDS46121.1	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.405869	0.01155	.	.	ENSG00000204866	ENST00000434646;ENST00000377693	T;T	0.21734	1.99;1.99	2.83	-0.555	0.11807	.	.	.	.	.	T	0.06645	0.0170	N	0.04636	-0.2	0.09310	N	1	B;B	0.28178	0.1;0.202	B;B	0.14578	0.011;0.008	T	0.39623	-0.9605	9	0.10377	T	0.69	-24.227	5.7655	0.18224	0.567:0.0:0.433:0.0	.	56;67	Q6UWQ7;Q6UWQ7-2	IGFL2_HUMAN;.	T	67;56	ENSP00000395219:A67T;ENSP00000366922:A56T	ENSP00000366922:A56T	A	+	1	0	IGFL2	51355803	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.282000	0.08445	-0.193000	0.10415	-0.491000	0.04670	GCC	.	.		0.592	IGFL2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000461705.1	NM_001002915	
SBK2	646643	hgsc.bcm.edu	37	19	56041657	56041657	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr19:56041657C>T	ENST00000413299.1	-	4	527	c.490G>A	c.(490-492)Gcc>Acc	p.A164T	SBK2_ENST00000344158.3_Missense_Mutation_p.A164T	NM_001101401.2	NP_001094871.2	P0C263	SBK2_HUMAN	SH3 domain binding kinase family, member 2	164	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9						AGCTGGGCGGCGCAGCGGTGC	0.746																																					p.A164T		Atlas-SNP	.											.	SBK2	26	.	0			c.G490A						.						2.0	2.0	2.0					19																	56041657		1484	2983	4467	SO:0001583	missense	646643	exon4			GGGCGGCGCAGCG		CCDS42631.1	19q13.42	2013-09-27	2013-09-27		ENSG00000187550	ENSG00000187550			34416	protein-coding gene	gene with protein product			"""SH3-binding domain kinase family, member 2"""				Standard	NM_001101401		Approved	SGK069	uc010ygc.2	P0C263	OTTHUMG00000155830	ENST00000413299.1:c.490G>A	chr19.hg19:g.56041657C>T	ENSP00000389015:p.Ala164Thr	31.0	0.0		42.0	11.0	NM_001101401		Missense_Mutation	SNP	ENST00000413299.1	hg19	CCDS42631.1	.	.	.	.	.	.	.	.	.	.	C	13.16	2.155645	0.38021	.	.	ENSG00000187550	ENST00000413299;ENST00000344158	T;T	0.67698	-0.28;-0.28	3.95	2.89	0.33648	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.120890	0.53938	D	0.000041	T	0.49779	0.1577	L	0.39085	1.19	0.25420	N	0.988275	P	0.35959	0.53	B	0.34180	0.177	T	0.34079	-0.9843	10	0.28530	T	0.3	-24.1753	6.919	0.24376	0.2008:0.6045:0.1947:0.0	.	164	P0C263	SBK2_HUMAN	T	164	ENSP00000389015:A164T;ENSP00000345044:A164T	ENSP00000345044:A164T	A	-	1	0	SBK2	60733469	0.043000	0.20138	0.052000	0.19188	0.785000	0.44390	2.939000	0.48995	0.975000	0.38392	0.462000	0.41574	GCC	.	.		0.746	SBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341919.1	NM_001101401	
CHD6	84181	hgsc.bcm.edu	37	20	40050514	40050514	+	Silent	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr20:40050514G>A	ENST00000373233.3	-	31	4938	c.4761C>T	c.(4759-4761)ggC>ggT	p.G1587G		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1587					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GTTTGGCAGTGCCGATGAGCA	0.557																																					p.G1587G		Atlas-SNP	.											.	CHD6	312	.	0			c.C4761T						.						110.0	74.0	86.0					20																	40050514		2203	4300	6503	SO:0001819	synonymous_variant	84181	exon31			GGCAGTGCCGATG	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4761C>T	chr20.hg19:g.40050514G>A		67.0	0.0		155.0	21.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	hg19	CCDS13317.1																																																																																			.	.		0.557	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
ZNF831	128611	hgsc.bcm.edu	37	20	57769145	57769145	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr20:57769145G>A	ENST00000371030.2	+	1	3071	c.3071G>A	c.(3070-3072)gGg>gAg	p.G1024E		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1024							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CAGTTGGGGGGGGACAAGGGG	0.677																																					p.G1024E		Atlas-SNP	.											.	ZNF831	287	.	0			c.G3071A						.						19.0	23.0	22.0					20																	57769145		2004	4182	6186	SO:0001583	missense	128611	exon1			TGGGGGGGGACAA	AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.3071G>A	chr20.hg19:g.57769145G>A	ENSP00000360069:p.Gly1024Glu	21.0	0.0		59.0	9.0	NM_178457	Q5TDR4|Q8TCP0	Missense_Mutation	SNP	ENST00000371030.2	hg19	CCDS42894.1	.	.	.	.	.	.	.	.	.	.	G	3.188	-0.166469	0.06461	.	.	ENSG00000124203	ENST00000371030	T	0.03745	3.82	4.49	-4.43	0.03568	.	1.727610	0.02789	N	0.121858	T	0.02304	0.0071	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43702	-0.9375	10	0.13853	T	0.58	-0.2863	0.4471	0.00495	0.3612:0.2516:0.1321:0.2551	.	1024	Q5JPB2	ZN831_HUMAN	E	1024	ENSP00000360069:G1024E	ENSP00000360069:G1024E	G	+	2	0	ZNF831	57202540	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.418000	0.07080	-0.313000	0.08728	0.411000	0.27672	GGG	.	.		0.677	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000079916.2	NM_178457	
IL2RB	3560	hgsc.bcm.edu	37	22	37524403	37524403	+	Silent	SNP	G	G	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr22:37524403G>T	ENST00000216223.5	-	10	1587	c.1389C>A	c.(1387-1389)gtC>gtA	p.V463V		NM_000878.3	NP_000869.1	P14784	IL2RB_HUMAN	interleukin 2 receptor, beta	463					cytokine-mediated signaling pathway (GO:0019221)|interleukin-2-mediated signaling pathway (GO:0038110)|negative regulation of apoptotic process (GO:0043066)|protein complex assembly (GO:0006461)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-2 binding (GO:0019976)|interleukin-2 receptor activity (GO:0004911)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(5)	23					Aldesleukin(DB00041)|Basiliximab(DB00074)|Daclizumab(DB00111)|Denileukin diftitox(DB00004)	AGTCTCTGGGGACTCTTTCTT	0.677																																					p.V463V		Atlas-SNP	.											.	IL2RB	44	.	0			c.C1389A						.						12.0	16.0	15.0					22																	37524403		2080	4100	6180	SO:0001819	synonymous_variant	3560	exon10			TCTGGGGACTCTT	M26062	CCDS13942.1	22q13	2011-02-15			ENSG00000100385	ENSG00000100385		"""Interleukins and interleukin receptors"", ""CD molecules"""	6009	protein-coding gene	gene with protein product		146710	"""interleukin 15 receptor, beta"""	IL15RB			Standard	NM_000878		Approved	CD122	uc003aqv.1	P14784	OTTHUMG00000150534	ENST00000216223.5:c.1389C>A	chr22.hg19:g.37524403G>T		57.0	0.0		96.0	13.0	NM_000878	B2R765	Silent	SNP	ENST00000216223.5	hg19	CCDS13942.1																																																																																			.	.		0.677	IL2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318792.1		
EP300	2033	hgsc.bcm.edu	37	22	41547912	41547912	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr22:41547912C>G	ENST00000263253.7	+	15	4112	c.2893C>G	c.(2893-2895)Cag>Gag	p.Q965E		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	965					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						AGTGAATTCTCAGGCCATTGC	0.478			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																												p.Q965E		Atlas-SNP	.		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	.	EP300	367	.	0			c.C2893G						.						120.0	121.0	120.0					22																	41547912		2203	4300	6503	SO:0001583	missense	2033	exon15	Familial Cancer Database	Broad Thumb-Hallux syndrome	AATTCTCAGGCCA	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.2893C>G	chr22.hg19:g.41547912C>G	ENSP00000263253:p.Gln965Glu	115.0	0.0		208.0	39.0	NM_001429	B1AKC2	Missense_Mutation	SNP	ENST00000263253.7	hg19	CCDS14010.1	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898112	0.72639	.	.	ENSG00000100393	ENST00000263253	D	0.83419	-1.72	5.52	5.52	0.82312	.	0.000000	0.46442	D	0.000298	T	0.82204	0.4986	M	0.66939	2.045	0.40698	D	0.982455	P	0.38535	0.635	B	0.36464	0.225	T	0.81017	-0.1123	10	0.25751	T	0.34	-6.5865	19.4296	0.94759	0.0:1.0:0.0:0.0	.	965	Q09472	EP300_HUMAN	E	965	ENSP00000263253:Q965E	ENSP00000263253:Q965E	Q	+	1	0	EP300	39877858	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.084000	0.76866	2.587000	0.87381	0.557000	0.71058	CAG	.	.		0.478	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320600.1	NM_001429	
FAM47A	158724	hgsc.bcm.edu	37	X	34149816	34149816	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chrX:34149816T>C	ENST00000346193.3	-	1	631	c.580A>G	c.(580-582)Act>Gct	p.T194A		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	194	Pro-rich.									NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						GACACCGGAGTCTCGGGAGGC	0.617																																					p.T194A		Atlas-SNP	.											.	FAM47A	249	.	0			c.A580G						.						57.0	60.0	59.0					X																	34149816		2199	4295	6494	SO:0001583	missense	158724	exon1			CCGGAGTCTCGGG	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.580A>G	chrX.hg19:g.34149816T>C	ENSP00000345029:p.Thr194Ala	105.0	0.0		80.0	28.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	T	7.059	0.566003	0.13560	.	.	ENSG00000185448	ENST00000346193	T	0.17691	2.26	0.603	0.603	0.17541	.	.	.	.	.	T	0.28400	0.0702	L	0.61218	1.895	0.09310	N	1	D	0.56521	0.976	P	0.59012	0.85	T	0.12811	-1.0533	8	0.30854	T	0.27	.	.	.	.	.	194	Q5JRC9	FA47A_HUMAN	A	194	ENSP00000345029:T194A	ENSP00000345029:T194A	T	-	1	0	FAM47A	34059737	0.622000	0.27085	0.013000	0.15412	0.013000	0.08279	0.461000	0.21940	0.451000	0.26802	0.441000	0.28932	ACT	.	.		0.617	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
KLHL4	56062	hgsc.bcm.edu	37	X	86887268	86887268	+	Silent	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chrX:86887268C>T	ENST00000373119.4	+	7	1528	c.1383C>T	c.(1381-1383)acC>acT	p.T461T	KLHL4_ENST00000373114.4_Silent_p.T461T	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	461						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						ATATTGGCACCATGAATGGCC	0.388																																					p.T461T		Atlas-SNP	.											.	KLHL4	263	.	0			c.C1383T						.						98.0	83.0	88.0					X																	86887268		2203	4300	6503	SO:0001819	synonymous_variant	56062	exon7			TGGCACCATGAAT	AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.1383C>T	chrX.hg19:g.86887268C>T		278.0	0.0		204.0	30.0	NM_019117	B2RTW2|Q9Y3J5	Silent	SNP	ENST00000373119.4	hg19	CCDS14457.1																																																																																			.	.		0.388	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057413.1		
RNF128	79589	hgsc.bcm.edu	37	X	105970508	105970508	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chrX:105970508G>A	ENST00000255499.2	+	1	615	c.365G>A	c.(364-366)cGc>cAc	p.R122H	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	122	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						CTCATCCAACGCGGCGGGGGC	0.617																																					p.R122H		Atlas-SNP	.											.	RNF128	74	.	0			c.G365A						.						39.0	38.0	38.0					X																	105970508		2203	4300	6503	SO:0001583	missense	79589	exon1			TCCAACGCGGCGG	AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.365G>A	chrX.hg19:g.105970508G>A	ENSP00000255499:p.Arg122His	222.0	0.0		169.0	44.0	NM_194463	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	ENST00000255499.2	hg19	CCDS14521.1	.	.	.	.	.	.	.	.	.	.	G	26.5	4.744402	0.89663	.	.	ENSG00000133135	ENST00000255499	T	0.10099	2.91	4.31	4.31	0.51392	Protease-associated domain, PA (1);	0.000000	0.85682	D	0.000000	T	0.37293	0.0998	M	0.92026	3.265	0.58432	D	0.999998	D	0.69078	0.997	P	0.62740	0.906	T	0.49283	-0.8956	10	0.72032	D	0.01	.	13.1327	0.59391	0.0:0.0:1.0:0.0	.	122	Q8TEB7	RN128_HUMAN	H	122	ENSP00000255499:R122H	ENSP00000255499:R122H	R	+	2	0	RNF128	105857164	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.017000	0.76399	1.907000	0.55213	0.513000	0.50165	CGC	.	.		0.617	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057804.1	NM_024539	
STAG2	10735	hgsc.bcm.edu	37	X	123205074	123205074	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chrX:123205074C>T	ENST00000371160.1	+	25	2724	c.2434C>T	c.(2434-2436)Cca>Tca	p.P812S	STAG2_ENST00000371144.3_Missense_Mutation_p.P812S|STAG2_ENST00000371145.3_Missense_Mutation_p.P812S|STAG2_ENST00000371157.3_Missense_Mutation_p.P812S|STAG2_ENST00000354548.5_Missense_Mutation_p.P743S|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.P812S	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	812					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						CATGTTAGAGCCATTAGTGTA	0.373																																					p.P812S		Atlas-SNP	.											.	STAG2	309	.	0			c.C2434T						.						226.0	198.0	207.0					X																	123205074		2203	4300	6503	SO:0001583	missense	10735	exon25			TTAGAGCCATTAG	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2434C>T	chrX.hg19:g.123205074C>T	ENSP00000360202:p.Pro812Ser	87.0	0.0		79.0	13.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	hg19	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809530	0.50421	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49;1.49	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.30417	0.0764	L	0.55103	1.725	0.80722	D	1	B;P	0.36282	0.016;0.546	B;B	0.34873	0.02;0.191	T	0.07462	-1.0771	10	0.12766	T	0.61	-11.7106	18.3649	0.90388	0.0:1.0:0.0:0.0	.	812;812	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	S	812;743;812;812;812;812	ENSP00000218089:P812S;ENSP00000346555:P743S;ENSP00000360202:P812S;ENSP00000360199:P812S;ENSP00000360187:P812S;ENSP00000360186:P812S	ENSP00000218089:P812S	P	+	1	0	STAG2	123032755	1.000000	0.71417	1.000000	0.80357	0.839000	0.47603	6.003000	0.70701	2.278000	0.76064	0.538000	0.68166	CCA	.	.		0.373	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
AFF2	2334	hgsc.bcm.edu	37	X	147919196	147919196	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chrX:147919196C>T	ENST00000370460.2	+	5	1591	c.1112C>T	c.(1111-1113)cCt>cTt	p.P371L	AFF2_ENST00000342251.3_Intron|AFF2_ENST00000370457.5_Intron|AFF2_ENST00000370458.1_Intron|AFF2_ENST00000286437.5_Intron	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	371					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					TGGCCTACTCCTCTCACTTCC	0.418																																					p.P371L		Atlas-SNP	.											.	AFF2	679	.	0			c.C1112T						.						171.0	135.0	147.0					X																	147919196		2203	4300	6503	SO:0001583	missense	2334	exon5			CTACTCCTCTCAC	U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.1112C>T	chrX.hg19:g.147919196C>T	ENSP00000359489:p.Pro371Leu	82.0	0.0		65.0	17.0	NM_002025	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	ENST00000370460.2	hg19	CCDS14684.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346685	0.82022	.	.	ENSG00000155966	ENST00000370460	D	0.82619	-1.63	5.42	5.42	0.78866	.	0.065748	0.64402	D	0.000010	D	0.85146	0.5630	L	0.43152	1.355	0.80722	D	1	D;D	0.56968	0.973;0.978	P;P	0.54590	0.642;0.756	D	0.86287	0.1671	10	0.56958	D	0.05	.	16.5254	0.84329	0.0:1.0:0.0:0.0	.	367;371	P51816-5;P51816	.;AFF2_HUMAN	L	371	ENSP00000359489:P371L	ENSP00000359489:P371L	P	+	2	0	AFF2	147726888	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	5.494000	0.66905	2.273000	0.75805	0.600000	0.82982	CCT	.	.		0.418	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058673.2	NM_002025	
STRBP	55342	hgsc.bcm.edu	37	9	125874203	125874204	+	Intron	INS	-	-	CTC			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr9:125874203_125874204insCTC	ENST00000530364.1	-	2	31				MIR600HG_ENST00000385007.1_RNA			Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein						cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						CCCAGGGGCAACTCTTCCTTCT	0.505																																					.		Atlas-INDEL	.											.	.	.	.	0			.						.																																			SO:0001627	intron_variant	81571	.			.	AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000530364.1:c.255-2171->GAG	chr9.hg19:g.125874204_125874206dupCTC		63.0	0.0		61.0	30.0	.	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	RNA	INS	ENST00000530364.1	hg19																																																																																				.	.		0.505	STRBP-009	PUTATIVE	basic	processed_transcript	protein_coding	OTTHUMT00000392598.1		
NYAP1	222950	hgsc.bcm.edu	37	7	100086313	100086313	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr7:100086313delC	ENST00000300179.2	+	4	1128	c.969delC	c.(967-969)atcfs	p.I323fs	NYAP1_ENST00000423930.1_Frame_Shift_Del_p.I323fs|NYAP1_ENST00000454988.1_Frame_Shift_Del_p.I266fs	NM_173564.2	NP_775835.2	Q6ZVC0	NYAP1_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 1	323	Pro-rich.				neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												CTTGTGAAATCCCCCCGCCCT	0.682																																					p.I323fs		Atlas-INDEL	.											.	.	.	.	0			c.968delT						.						51.0	50.0	51.0					7																	100086313		2201	4298	6499	SO:0001589	frameshift_variant	222950	exon4			.	AK094857	CCDS5696.1	7q22.1	2011-11-30	2011-11-30	2011-11-30	ENSG00000166924	ENSG00000166924			22009	protein-coding gene	gene with protein product		615477	"""chromosome 7 open reading frame 51"", ""KIAA1486-like"""	C7orf51, KIAA1486L		21946561	Standard	NM_173564		Approved	FLJ37538	uc003uvd.2	Q6ZVC0	OTTHUMG00000155290	ENST00000300179.2:c.969delC	chr7.hg19:g.100086313delC	ENSP00000300179:p.Ile323fs	98.0	0.0		94.0	21.0	NM_173564	Q6U9Y3|Q8N1V0	Frame_Shift_Del	DEL	ENST00000300179.2	hg19	CCDS5696.1																																																																																			.	.		0.682	NYAP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339335.2	NM_173564	
SMAD4	4089	hgsc.bcm.edu	37	18	48575093	48575093	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr18:48575093delC	ENST00000342988.3	+	3	825	c.287delC	c.(286-288)gccfs	p.A96fs	SMAD4_ENST00000452201.2_Frame_Shift_Del_p.A96fs|SMAD4_ENST00000588745.1_Frame_Shift_Del_p.A96fs|SMAD4_ENST00000398417.2_Frame_Shift_Del_p.A96fs|RP11-729L2.2_ENST00000590722.2_3'UTR	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	96	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.?(4)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		GTGATCTATGCCCGTCTCTGG	0.368																																					p.A96fs		Atlas-INDEL	.											.	SMAD4	822	.	40	Whole gene deletion(36)|Unknown(4)	pancreas(26)|large_intestine(3)|stomach(3)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|NS(1)	c.286delG						.						155.0	142.0	147.0					18																	48575093		2203	4300	6503	SO:0001589	frameshift_variant	4089	exon3			.	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.287delC	chr18.hg19:g.48575093delC	ENSP00000341551:p.Ala96fs	107.0	0.0		74.0	12.0	NM_005359	A8K405	Frame_Shift_Del	DEL	ENST00000342988.3	hg19	CCDS11950.1																																																																																			.	.		0.368	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
FEZF2	55079	hgsc.bcm.edu	37	3	62358214	62358215	+	In_Frame_Ins	INS	-	-	CCGCCG			TCGA-DD-AAE0-01A-11D-A40R-10	TCGA-DD-AAE0-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2a18f024-178d-46d9-880b-a751edf71b67	42e0aa56-bad8-4d28-adb6-4f956cbaf658	g.chr3:62358214_62358215insCCGCCG	ENST00000283268.3	-	2	623_624	c.329_330insCGGCGG	c.(328-330)ggt>ggCGGCGGt	p.110_110G>GGG	FEZF2_ENST00000475839.1_In_Frame_Ins_p.110_110G>GGG|FEZF2_ENST00000486811.1_In_Frame_Ins_p.110_110G>GGG	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	110	Gly-rich.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		cgccgccgccaccgccgccgcc	0.728																																					p.G110delinsGGG	NSCLC(170;1772 2053 12525 15604 23984)	Atlas-INDEL	.											.	FEZF2	46	.	0			c.330_331insCGGCGG						.																																			SO:0001652	inframe_insertion	55079	exon2			.	AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.324_329dupCGGCGG	chr3.hg19:g.62358215_62358220dupCCGCCG	ENSP00000283268:p.GlyGly116dup	33.0	0.0		46.0	16.0	NM_018008	A8K349|Q9BZ91|Q9NWB9	In_Frame_Ins	INS	ENST00000283268.3	hg19	CCDS2897.1																																																																																			.	.		0.728	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
