#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EBNA1BP2	10969	hgsc.bcm.edu	37	1	43637724	43637724	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr1:43637724C>T	ENST00000236051.2	-	1	207	c.66G>A	c.(64-66)gaG>gaA	p.E22E	EBNA1BP2_ENST00000431635.2_Splice_Site_p.E77E|WDR65_ENST00000372492.4_5'Flank|WDR65_ENST00000528956.1_5'Flank|EBNA1BP2_ENST00000472982.1_5'UTR	NM_006824.2	NP_006815.2	Q99848	EBP2_HUMAN	EBNA1 binding protein 2	22					ribosome biogenesis (GO:0042254)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)	16	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGACACCTACCTCTCTGTCTG	0.607																																					p.E77E		Atlas-SNP	.											.	EBNA1BP2	37	.	0			c.G231A						.						64.0	55.0	58.0					1																	43637724		2203	4300	6503	SO:0001630	splice_region_variant	10969	exon2			ACCTACCTCTCTG	U86602	CCDS478.1, CCDS53308.1	1p35-p33	2011-02-10	2001-11-28		ENSG00000117395	ENSG00000117395			15531	protein-coding gene	gene with protein product		614443	"""EBNA1-binding protein 2"""			10074103, 11438656	Standard	NM_001159936		Approved	NOBP, EBP2, P40	uc010ojx.2	Q99848	OTTHUMG00000007284	ENST00000236051.2:c.66+1G>A	chr1.hg19:g.43637724C>T		75.0	0.0		48.0	31.0	NM_001159936	Q96A66	Silent	SNP	ENST00000236051.2	hg19	CCDS478.1																																																																																			.	.		0.607	EBNA1BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019015.1		Silent
OLFML2B	25903	hgsc.bcm.edu	37	1	161989734	161989734	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr1:161989734C>T	ENST00000294794.3	-	2	836	c.413G>A	c.(412-414)cGg>cAg	p.R138Q	OLFML2B_ENST00000367940.2_Missense_Mutation_p.R138Q	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	138					extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			GTCTGCCTCCCGCAGCTTCTG	0.582																																					p.R138Q		Atlas-SNP	.											.	OLFML2B	114	.	0			c.G413A						.						51.0	51.0	51.0					1																	161989734		2203	4300	6503	SO:0001583	missense	25903	exon2			GCCTCCCGCAGCT	BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.413G>A	chr1.hg19:g.161989734C>T	ENSP00000294794:p.Arg138Gln	73.0	0.0		164.0	107.0	NM_015441	B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	ENST00000294794.3	hg19	CCDS1236.1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819074	0.50633	.	.	ENSG00000162745	ENST00000294794;ENST00000367940	T;T	0.42900	0.96;0.96	4.64	3.72	0.42706	.	.	.	.	.	T	0.13586	0.0329	L	0.34521	1.04	0.41621	D	0.988967	P;P	0.45044	0.669;0.849	B;B	0.31442	0.076;0.13	T	0.03374	-1.1043	8	0.36615	T	0.2	.	12.8355	0.57771	0.0:0.8344:0.1656:0.0	.	138;138	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	Q	138	ENSP00000294794:R138Q;ENSP00000356917:R138Q	ENSP00000294794:R138Q	R	-	2	0	OLFML2B	160256358	1.000000	0.71417	0.993000	0.49108	0.891000	0.51852	3.485000	0.53208	1.303000	0.44873	0.561000	0.74099	CGG	.	.		0.582	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060552.2	NM_015441	
CFHR2	3080	hgsc.bcm.edu	37	1	196881942	196881942	+	Intron	SNP	A	A	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr1:196881942A>T	ENST00000367421.3	+	2	135				CFHR4_ENST00000251424.4_Missense_Mutation_p.N110I|CFHR4_ENST00000608469.1_Missense_Mutation_p.N39I|CFHR4_ENST00000367416.2_Missense_Mutation_p.N356I|CFHR4_ENST00000367418.2_Missense_Mutation_p.N110I			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						tatattttaaataaagaaata	0.289																																					p.N357I		Atlas-SNP	.											.	CFHR4	141	.	0			c.A1070T						.						23.0	27.0	25.0					1																	196881942		2113	4247	6360	SO:0001627	intron_variant	10877	exon7			TTTTAAATAAAGA	X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-36643A>T	chr1.hg19:g.196881942A>T		571.0	0.0		1144.0	198.0	NM_001201550	Q14310|Q5T9T1	Missense_Mutation	SNP	ENST00000367421.3	hg19		.	.	.	.	.	.	.	.	.	.	A	13.37	2.216141	0.39201	.	.	ENSG00000134365	ENST00000367416;ENST00000367418;ENST00000251424;ENST00000538553	T;T;T	0.66995	-0.24;-0.24;-0.24	2.11	2.11	0.27256	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.81616	0.4860	M	0.89601	3.045	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.78314	0.989;0.991;0.972	T	0.67296	-0.5706	9	0.87932	D	0	.	6.1801	0.20465	1.0:0.0:0.0:0.0	.	356;357;110	C9J7J7;Q5DVJ7;Q92496	.;.;FHR4_HUMAN	I	356;110;110;110	ENSP00000356386:N356I;ENSP00000356388:N110I;ENSP00000251424:N110I	ENSP00000251424:N110I	N	+	2	0	CFHR4	195148565	0.025000	0.19082	0.024000	0.17045	0.370000	0.29829	2.161000	0.42358	1.210000	0.43336	0.172000	0.16884	AAT	.	.		0.289	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_005666	
CACNA1S	779	hgsc.bcm.edu	37	1	201018205	201018205	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr1:201018205C>T	ENST00000362061.3	-	35	4490	c.4264G>A	c.(4264-4266)Gtg>Atg	p.V1422M	CACNA1S_ENST00000367338.3_Missense_Mutation_p.V1403M	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1422					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGGTCACCACGTCCAGGTGT	0.577																																					p.V1422M		Atlas-SNP	.											.	CACNA1S	249	.	0			c.G4264A						.						39.0	37.0	37.0					1																	201018205		2203	4300	6503	SO:0001583	missense	779	exon35			TCACCACGTCCAG	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.4264G>A	chr1.hg19:g.201018205C>T	ENSP00000355192:p.Val1422Met	25.0	0.0		80.0	42.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Missense_Mutation	SNP	ENST00000362061.3	hg19	CCDS1407.1	.	.	.	.	.	.	.	.	.	.	.	22.7	4.322536	0.81580	.	.	ENSG00000081248	ENST00000362061;ENST00000367338	T;T	0.10005	2.92;2.92	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.23171	0.0560	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.02026	-1.1227	10	0.31617	T	0.26	.	18.8773	0.92343	0.0:1.0:0.0:0.0	.	1422	Q13698	CAC1S_HUMAN	M	1422;1403	ENSP00000355192:V1422M;ENSP00000356307:V1403M	ENSP00000355192:V1422M	V	-	1	0	CACNA1S	199284828	1.000000	0.71417	0.994000	0.49952	0.930000	0.56654	7.773000	0.85462	2.520000	0.84964	0.655000	0.94253	GTG	.	.		0.577	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
ZNF678	339500	hgsc.bcm.edu	37	1	227843476	227843476	+	Silent	SNP	A	A	C			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr1:227843476A>C	ENST00000343776.5	+	4	1870	c.1525A>C	c.(1525-1527)Aga>Cga	p.R509R	ZNF678_ENST00000397097.3_Silent_p.R564R|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	509					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				TAAGTATAAGAGAATTTATAC	0.323																																					p.R564R		Atlas-SNP	.											.	ZNF678	137	.	0			c.A1690C						.						43.0	48.0	46.0					1																	227843476		2201	4295	6496	SO:0001819	synonymous_variant	339500	exon4			TATAAGAGAATTT	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1525A>C	chr1.hg19:g.227843476A>C		253.0	0.0		404.0	82.0	NM_178549	Q8IVQ9	Silent	SNP	ENST00000343776.5	hg19																																																																																				.	.		0.323	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549	
VIT	5212	hgsc.bcm.edu	37	2	36982071	36982071	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr2:36982071C>A	ENST00000389975.3	+	5	585	c.283C>A	c.(283-285)Ctt>Att	p.L95I	VIT_ENST00000404084.1_Missense_Mutation_p.L73I|VIT_ENST00000401530.1_Missense_Mutation_p.L95I|VIT_ENST00000379242.3_Missense_Mutation_p.L95I|VIT_ENST00000379241.3_Missense_Mutation_p.L95I|VIT_ENST00000457137.2_Missense_Mutation_p.L95I|VIT_ENST00000497382.1_De_novo_Start_OutOfFrame	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	95	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				TAGTGGTGTGCTTGATAATTC	0.393																																					p.L95I		Atlas-SNP	.											.	VIT	138	.	0			c.C283A						.						151.0	141.0	145.0					2																	36982071		2203	4300	6503	SO:0001583	missense	5212	exon5			GGTGTGCTTGATA	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.283C>A	chr2.hg19:g.36982071C>A	ENSP00000374625:p.Leu95Ile	78.0	0.0		89.0	49.0	NM_001177969	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	ENST00000389975.3	hg19	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	C	2.304	-0.359469	0.05138	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000402257;ENST00000457137;ENST00000404084;ENST00000379241;ENST00000401530	D;D;D;D;D;D	0.88046	-2.33;-2.33;-2.33;-2.33;-2.33;-2.33	5.63	2.71	0.32032	LCCL (5);	0.222388	0.44483	N	0.000452	T	0.55737	0.1939	N	0.00436	-1.5	0.32797	N	0.500406	B;B;B;B;B;B	0.26400	0.057;0.07;0.025;0.017;0.057;0.148	B;B;B;B;B;B	0.27380	0.045;0.078;0.046;0.078;0.046;0.079	T	0.62407	-0.6861	10	0.02654	T	1	-9.3344	7.8166	0.29263	0.402:0.2966:0.3014:0.0	.	95;95;95;95;95;95	B4DRU4;E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4;Q6UXI7-3	.;.;.;VITRN_HUMAN;.;.	I	95;95;95;95;73;95;95	ENSP00000368544:L95I;ENSP00000374625:L95I;ENSP00000393561:L95I;ENSP00000384154:L73I;ENSP00000368543:L95I;ENSP00000385658:L95I	ENSP00000368543:L95I	L	+	1	0	VIT	36835575	1.000000	0.71417	0.979000	0.43373	0.802000	0.45316	1.296000	0.33389	0.700000	0.31782	0.655000	0.94253	CTT	.	.		0.393	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
AOX1	316	hgsc.bcm.edu	37	2	201526345	201526345	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr2:201526345G>C	ENST00000374700.2	+	30	3660	c.3419G>C	c.(3418-3420)gGa>gCa	p.G1140A	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	1140					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TCAGCTGTTGGATACTTCAGG	0.423																																					p.G1140A		Atlas-SNP	.											.	AOX1	152	.	0			c.G3419C						.						139.0	131.0	134.0					2																	201526345		2203	4300	6503	SO:0001583	missense	316	exon30			CTGTTGGATACTT	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.3419G>C	chr2.hg19:g.201526345G>C	ENSP00000363832:p.Gly1140Ala	80.0	0.0		74.0	33.0	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	hg19	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290947	0.59976	.	.	ENSG00000138356	ENST00000374700;ENST00000260930	T;T	0.35048	1.33;1.33	5.35	4.47	0.54385	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.113680	0.64402	D	0.000012	T	0.61261	0.2333	M	0.84683	2.71	0.80722	D	1	D	0.57257	0.979	P	0.62491	0.903	T	0.69837	-0.5037	10	0.87932	D	0	-47.6364	14.6375	0.68699	0.0699:0.0:0.9301:0.0	.	1140	Q06278	ADO_HUMAN	A	1140;26	ENSP00000363832:G1140A;ENSP00000260930:G26A	ENSP00000260930:G26A	G	+	2	0	AOX1	201234590	1.000000	0.71417	0.983000	0.44433	0.417000	0.31264	5.884000	0.69729	1.626000	0.50381	0.655000	0.94253	GGA	.	.		0.423	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
PTPRN	5798	hgsc.bcm.edu	37	2	220172166	220172166	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr2:220172166C>A	ENST00000295718.2	-	3	520	c.280G>T	c.(280-282)Gga>Tga	p.G94*	PTPRN_ENST00000409251.3_Splice_Site_p.G94*|PTPRN_ENST00000423636.2_Splice_Site_p.G4*	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	94					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CAGACCTTACCTTGGGACATG	0.547																																					p.G94X		Atlas-SNP	.											.	PTPRN	138	.	0			c.G280T						.						63.0	60.0	61.0					2																	220172166		2203	4300	6503	SO:0001630	splice_region_variant	5798	exon3			CCTTACCTTGGGA		CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.280+1G>T	chr2.hg19:g.220172166C>A		49.0	0.0		54.0	17.0	NM_002846	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Nonsense_Mutation	SNP	ENST00000295718.2	hg19	CCDS2440.1	.	.	.	.	.	.	.	.	.	.	C	36	5.846029	0.97016	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666;ENST00000536579;ENST00000412847;ENST00000446182;ENST00000440552;ENST00000442029;ENST00000451506	.	.	.	5.24	5.24	0.73138	.	0.000000	0.52532	D	0.000070	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7372	0.77853	0.0:1.0:0.0:0.0	.	.	.	.	X	94;94;94;4;94;4;4;61;4;4	.	.	G	-	1	0	PTPRN	219880410	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.933000	0.63484	2.436000	0.82500	0.460000	0.39030	GGA	.	.		0.547	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256819.2		Nonsense_Mutation
LAP3	51056	hgsc.bcm.edu	37	4	17586622	17586622	+	Silent	SNP	A	A	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr4:17586622A>T	ENST00000226299.4	+	6	841	c.567A>T	c.(565-567)ggA>ggT	p.G189G	AC006160.5_ENST00000511010.1_RNA|LAP3_ENST00000606142.1_Silent_p.G158G	NM_015907.2	NP_056991.2	P28838	AMPL_HUMAN	leucine aminopeptidase 3	189					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|urinary_tract(1)	20						GGCAGAAAGGAGTCCTGTTTG	0.493																																					p.G189G		Atlas-SNP	.											.	LAP3	50	.	0			c.A567T						.						70.0	65.0	67.0					4																	17586622		2203	4300	6503	SO:0001819	synonymous_variant	51056	exon6			GAAAGGAGTCCTG	AF061738	CCDS3422.1	4p15.33	2012-07-25	2003-09-12		ENSG00000002549	ENSG00000002549	3.4.11.1		18449	protein-coding gene	gene with protein product		170250	"""peptidase S"""	PEPS		6350155, 689684	Standard	NM_015907		Approved	LAPEP, LAP	uc003gph.1	P28838	OTTHUMG00000048214	ENST00000226299.4:c.567A>T	chr4.hg19:g.17586622A>T		97.0	0.0		73.0	33.0	NM_015907	B3KMQ3|Q6IAM6|Q6P0L6|Q9UQE3	Silent	SNP	ENST00000226299.4	hg19	CCDS3422.1																																																																																			.	.		0.493	LAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250365.1		
CTNND2	1501	hgsc.bcm.edu	37	5	11732327	11732327	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr5:11732327C>T	ENST00000304623.8	-	2	284	c.95G>A	c.(94-96)aGc>aAc	p.S32N	CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.S32N	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	32					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						TAAGCCGGGGCTCAGGGAACT	0.502																																					p.S32N		Atlas-SNP	.											.	CTNND2	289	.	0			c.G95A						.						128.0	128.0	128.0					5																	11732327		2203	4300	6503	SO:0001583	missense	1501	exon2			CCGGGGCTCAGGG	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.95G>A	chr5.hg19:g.11732327C>T	ENSP00000307134:p.Ser32Asn	74.0	0.0		51.0	24.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	hg19	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838180	0.91117	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000502551;ENST00000508761	T;T	0.77358	-1.03;-1.09	5.91	5.91	0.95273	.	0.000000	0.52532	D	0.000061	T	0.64940	0.2644	N	0.08118	0	0.80722	D	1	P	0.42827	0.791	B	0.40782	0.34	T	0.72377	-0.4312	10	0.72032	D	0.01	-18.3546	17.7899	0.88548	0.0:1.0:0.0:0.0	.	32	Q9UQB3	CTND2_HUMAN	N	32;32;18;18	ENSP00000307134:S32N;ENSP00000352661:S32N	ENSP00000307134:S32N	S	-	2	0	CTNND2	11785327	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.517000	0.53443	2.796000	0.96246	0.643000	0.83706	AGC	.	.		0.502	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
AP3B1	8546	hgsc.bcm.edu	37	5	77471662	77471662	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr5:77471662C>A	ENST00000255194.6	-	10	1216	c.1041G>T	c.(1039-1041)agG>agT	p.R347S	AP3B1_ENST00000519295.1_Splice_Site_p.R298S	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	347					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		ACTGCACCTCCCTAGAAATCA	0.308									Hermansky-Pudlak syndrome																												p.R347S		Atlas-SNP	.											.	AP3B1	94	.	0			c.G1041T						.						127.0	136.0	133.0					5																	77471662		2202	4296	6498	SO:0001630	splice_region_variant	8546	exon10	Familial Cancer Database	HPS, HPS1-8	CACCTCCCTAGAA	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.1041-1G>T	chr5.hg19:g.77471662C>A		135.0	0.0		138.0	55.0	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	ENST00000255194.6	hg19	CCDS4041.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530675	0.27387	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.25579	1.79;1.79	4.82	4.82	0.62117	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.20292	0.0488	L	0.38175	1.15	0.53688	D	0.999977	P	0.42123	0.771	B	0.41135	0.348	T	0.01874	-1.1256	10	0.30854	T	0.27	.	9.0996	0.36660	0.1479:0.7728:0.0:0.0793	.	347	O00203	AP3B1_HUMAN	S	347;298;347;251	ENSP00000255194:R347S;ENSP00000430597:R298S	ENSP00000255194:R347S	R	-	3	2	AP3B1	77507418	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.253000	0.43205	2.214000	0.71695	0.467000	0.42956	AGG	.	.		0.308	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		Missense_Mutation
PCDHB12	56124	hgsc.bcm.edu	37	5	140589015	140589015	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr5:140589015A>T	ENST00000239450.2	+	1	725	c.536A>T	c.(535-537)cAc>cTc	p.H179L	PCDHB12_ENST00000541609.1_Intron	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	179	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTCATTTCCACGTTAAAATA	0.423																																					p.H179L		Atlas-SNP	.											.	PCDHB12	179	.	0			c.A536T						.						69.0	70.0	70.0					5																	140589015		2203	4300	6503	SO:0001583	missense	56124	exon1			ATTTCCACGTTAA	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.536A>T	chr5.hg19:g.140589015A>T	ENSP00000239450:p.His179Leu	116.0	0.0		130.0	58.0	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	hg19	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	A	0.980	-0.697271	0.03279	.	.	ENSG00000120328	ENST00000239450	T	0.50548	0.74	4.16	-1.3	0.09259	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.39835	0.1093	L	0.51422	1.61	0.09310	N	1	P	0.41848	0.763	B	0.42163	0.378	T	0.31251	-0.9950	9	0.54805	T	0.06	.	5.9815	0.19409	0.4081:0.3506:0.2413:0.0	.	179	Q9Y5F1	PCDBC_HUMAN	L	179	ENSP00000239450:H179L	ENSP00000239450:H179L	H	+	2	0	PCDHB12	140569199	0.000000	0.05858	0.068000	0.19968	0.001000	0.01503	-1.625000	0.02036	-0.139000	0.11414	-0.415000	0.06103	CAC	.	.		0.423	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
KIAA0141	9812	hgsc.bcm.edu	37	5	141318088	141318088	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr5:141318088C>T	ENST00000432126.2	+	12	1446	c.1312C>T	c.(1312-1314)Ccg>Tcg	p.P438S	KIAA0141_ENST00000194118.4_Missense_Mutation_p.P438S	NM_001142603.1|NM_014773.3	NP_001136075.1|NP_055588.3	Q14154	DELE_HUMAN	KIAA0141	438					extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	mitochondrion (GO:0005739)				endometrium(3)|large_intestine(4)|lung(5)|skin(1)|urinary_tract(3)	16		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTTGTAGCCCCGGGGCCCAG	0.547																																					p.P438S		Atlas-SNP	.											.	KIAA0141	44	.	0			c.C1312T						.						80.0	85.0	83.0					5																	141318088		2203	4300	6503	SO:0001583	missense	9812	exon12			GTAGCCCCGGGGC	BC011269	CCDS4268.1	5q31	2011-05-05			ENSG00000081791	ENSG00000081791			28969	protein-coding gene	gene with protein product	"""death ligand signal enhancer"""	615741				20563667	Standard	XM_005268549		Approved	DELE	uc003llt.3	Q14154	OTTHUMG00000129662	ENST00000432126.2:c.1312C>T	chr5.hg19:g.141318088C>T	ENSP00000396225:p.Pro438Ser	58.0	0.0		60.0	25.0	NM_001142603	Q969R4|Q96EU9	Missense_Mutation	SNP	ENST00000432126.2	hg19	CCDS4268.1	.	.	.	.	.	.	.	.	.	.	C	14.41	2.527415	0.44969	.	.	ENSG00000081791	ENST00000432126;ENST00000194118	T;T	0.13538	2.58;2.58	4.97	0.899	0.19271	.	0.989048	0.08213	N	0.980326	T	0.08179	0.0204	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.43956	-0.9359	10	0.14252	T	0.57	3.0E-4	6.1209	0.20151	0.0:0.5348:0.0:0.4652	.	438	Q14154	DELE_HUMAN	S	438	ENSP00000396225:P438S;ENSP00000194118:P438S	ENSP00000194118:P438S	P	+	1	0	KIAA0141	141298272	0.005000	0.15991	0.004000	0.12327	0.040000	0.13550	-0.026000	0.12392	0.289000	0.22422	0.561000	0.74099	CCG	.	.		0.547	KIAA0141-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251863.2	NM_014773	
ABCB5	340273	hgsc.bcm.edu	37	7	20683148	20683148	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr7:20683148A>G	ENST00000404938.2	+	7	1223	c.571A>G	c.(571-573)Act>Gct	p.T191A		NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	191	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AAACATGTCTACTTTTTCGAT	0.418																																					p.T191A		Atlas-SNP	.											.	ABCB5	357	.	0			c.A571G						.						200.0	175.0	182.0					7																	20683148		1568	3582	5150	SO:0001583	missense	340273	exon7			ATGTCTACTTTTT	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.571A>G	chr7.hg19:g.20683148A>G	ENSP00000384881:p.Thr191Ala	160.0	0.0		124.0	47.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	hg19	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	A	10.10	1.258598	0.23051	.	.	ENSG00000004846	ENST00000404938	D	0.90900	-2.75	3.85	2.71	0.32032	.	.	.	.	.	D	0.84183	0.5416	L	0.48260	1.515	0.80722	D	1	P	0.36125	0.538	B	0.33121	0.158	T	0.79105	-0.1940	9	0.37606	T	0.19	.	6.9932	0.24767	0.8838:0.0:0.1162:0.0	.	191	A7BKA4	.	A	191	ENSP00000384881:T191A	ENSP00000384881:T191A	T	+	1	0	ABCB5	20649673	1.000000	0.71417	0.998000	0.56505	0.233000	0.25261	5.254000	0.65457	0.849000	0.35215	0.460000	0.39030	ACT	.	.		0.418	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
TONSL	4796	hgsc.bcm.edu	37	8	145668159	145668159	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr8:145668159A>G	ENST00000409379.3	-	5	508	c.479T>C	c.(478-480)aTg>aCg	p.M160T	AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	160					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GCGGGTCCTCATCTCATTCAG	0.572																																					p.M160T		Atlas-SNP	.											.	TONSL	128	.	0			c.T479C						.						91.0	88.0	89.0					8																	145668159		2203	4300	6503	SO:0001583	missense	4796	exon5			GTCCTCATCTCAT		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.479T>C	chr8.hg19:g.145668159A>G	ENSP00000386239:p.Met160Thr	59.0	0.0		127.0	37.0	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	hg19	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	A	19.49	3.837127	0.71373	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.75260	-0.92	4.92	4.92	0.64577	.	0.078660	0.85682	D	0.000000	D	0.86230	0.5883	M	0.85542	2.76	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	D	0.88017	0.2766	10	0.62326	D	0.03	-29.1779	12.5443	0.56190	1.0:0.0:0.0:0.0	.	160	Q96HA7	TONSL_HUMAN	T	160	ENSP00000386239:M160T	ENSP00000386239:M160T	M	-	2	0	TONSL	145638967	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	8.802000	0.91910	1.854000	0.53819	0.533000	0.62120	ATG	.	.		0.572	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
KIAA0020	9933	hgsc.bcm.edu	37	9	2810431	2810431	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr9:2810431G>T	ENST00000397885.2	-	16	1842	c.1636C>A	c.(1636-1638)Ctt>Att	p.L546I		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	546						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		GCAATGTGAAGCTATGAAGGG	0.338																																					p.L546I		Atlas-SNP	.											KIAA0020,NS,carcinoma,0,1	KIAA0020	56	.	0			c.C1636A						.						160.0	142.0	148.0					9																	2810431		2203	4300	6503	SO:0001630	splice_region_variant	9933	exon16			TGTGAAGCTATGA	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1636-1C>A	chr9.hg19:g.2810431G>T		69.0	0.0		53.0	3.0	NM_014878	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	ENST00000397885.2	hg19	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818191	0.50633	.	.	ENSG00000080608	ENST00000397885	T	0.14893	2.47	5.95	5.05	0.67936	CPL (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.111432	0.64402	D	0.000010	T	0.27900	0.0687	M	0.80183	2.485	0.54753	D	0.999984	B;B	0.30727	0.292;0.24	B;B	0.38921	0.237;0.285	T	0.02313	-1.1178	10	0.22706	T	0.39	-0.9536	13.7718	0.63029	0.0716:0.0:0.9284:0.0	.	406;546	B2RDG4;Q15397	.;K0020_HUMAN	I	546	ENSP00000380982:L546I	ENSP00000380982:L546I	L	-	1	0	KIAA0020	2800431	1.000000	0.71417	1.000000	0.80357	0.452000	0.32318	6.182000	0.71995	2.827000	0.97445	0.650000	0.86243	CTT	.	.		0.338	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878	Missense_Mutation
BICD2	23299	hgsc.bcm.edu	37	9	95481421	95481421	+	Silent	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr9:95481421C>T	ENST00000375512.3	-	5	1573	c.1506G>A	c.(1504-1506)ctG>ctA	p.L502L	BICD2_ENST00000356884.6_Silent_p.L502L	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	502					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						GCTCCTTCTCCAGCCGGGCCA	0.652																																					p.L502L		Atlas-SNP	.											.	BICD2	68	.	0			c.G1506A						.						57.0	56.0	56.0					9																	95481421		2203	4300	6503	SO:0001819	synonymous_variant	23299	exon5			CTTCTCCAGCCGG	AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.1506G>A	chr9.hg19:g.95481421C>T		38.0	0.0		45.0	23.0	NM_001003800	O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Silent	SNP	ENST00000375512.3	hg19	CCDS6700.1																																																																																			.	.		0.652	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055508.1	NM_015250	
OGDHL	55753	hgsc.bcm.edu	37	10	50950948	50950948	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr10:50950948C>A	ENST00000374103.4	-	15	2023	c.1938G>T	c.(1936-1938)atG>atT	p.M646I	OGDHL_ENST00000419399.1_Missense_Mutation_p.M589I|OGDHL_ENST00000432695.1_Missense_Mutation_p.M437I	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	646					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						AGCCAAAGGCCATGTACTCTG	0.642																																					p.M646I		Atlas-SNP	.											OGDHL,NS,carcinoma,0,1	OGDHL	149	.	0			c.G1938T						.						99.0	75.0	83.0					10																	50950948		2203	4300	6503	SO:0001583	missense	55753	exon15			AAAGGCCATGTAC	AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.1938G>T	chr10.hg19:g.50950948C>A	ENSP00000363216:p.Met646Ile	35.0	0.0		53.0	19.0	NM_018245	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	ENST00000374103.4	hg19	CCDS7234.1	.	.	.	.	.	.	.	.	.	.	c	22.7	4.321244	0.81580	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	D;D;D	0.91521	-2.86;-2.86;-2.86	5.22	5.22	0.72569	Transketolase-like, pyrimidine-binding domain (2);	0.000000	0.85682	D	0.000000	D	0.89347	0.6689	L	0.51853	1.615	0.80722	D	1	B;B;B	0.10296	0.003;0.002;0.001	B;B;B	0.20384	0.029;0.008;0.021	D	0.85868	0.1414	10	0.87932	D	0	.	19.1492	0.93481	0.0:1.0:0.0:0.0	.	589;437;646	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	I	646;589;437	ENSP00000363216:M646I;ENSP00000401356:M589I;ENSP00000390240:M437I	ENSP00000363216:M646I	M	-	3	0	OGDHL	50620954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.009000	0.57110	2.583000	0.87209	0.651000	0.88453	ATG	.	.		0.642	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048007.1	NM_018245	
ZNF143	7702	hgsc.bcm.edu	37	11	9522758	9522758	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr11:9522758G>A	ENST00000396602.2	+	11	1207	c.1088G>A	c.(1087-1089)gGa>gAa	p.G363E	ZNF143_ENST00000530463.1_Missense_Mutation_p.G362E|ZNF143_ENST00000396604.1_Missense_Mutation_p.G362E|ZNF143_ENST00000299606.2_Missense_Mutation_p.G335E|ZNF143_ENST00000396597.3_Missense_Mutation_p.G332E	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143	363					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		ACAGAGCCAGGATGTGGGAGG	0.438																																					p.G363E		Atlas-SNP	.											.	ZNF143	38	.	0			c.G1088A						.						156.0	144.0	148.0					11																	9522758		2201	4294	6495	SO:0001583	missense	7702	exon11			AGCCAGGATGTGG	U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.1088G>A	chr11.hg19:g.9522758G>A	ENSP00000379847:p.Gly363Glu	81.0	0.0		112.0	56.0	NM_003442	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	ENST00000396602.2	hg19	CCDS7799.2	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111644	0.77210	.	.	ENSG00000166478	ENST00000396604;ENST00000396602;ENST00000530463;ENST00000396597;ENST00000299606	T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74	5.66	5.66	0.87406	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000001	T	0.53706	0.1813	L	0.36672	1.1	0.80722	D	1	D;D;D	0.58620	0.979;0.983;0.983	P;P;P	0.52793	0.675;0.709;0.709	T	0.52786	-0.8529	10	0.52906	T	0.07	.	19.7617	0.96321	0.0:0.0:1.0:0.0	.	332;362;363	P52747-2;E7ER34;P52747	.;.;ZN143_HUMAN	E	362;363;362;332;335	ENSP00000379849:G362E;ENSP00000379847:G363E;ENSP00000432154:G362E;ENSP00000379843:G332E;ENSP00000299606:G335E	ENSP00000299606:G335E	G	+	2	0	ZNF143	9479334	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.631000	0.83237	2.671000	0.90904	0.655000	0.94253	GGA	.	.		0.438	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313921.2	NM_003442	
DCDC1	341019	hgsc.bcm.edu	37	11	31312362	31312362	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr11:31312362C>T	ENST00000452803.1	-	7	993	c.792G>A	c.(790-792)atG>atA	p.M264I	DCDC1_ENST00000597505.1_Missense_Mutation_p.M264I	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	264					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TCAACCCATTCATTGTCCAAG	0.338																																					p.M264I		Atlas-SNP	.											.	DCDC1	74	.	0			c.G792A						.						84.0	83.0	84.0					11																	31312362		2202	4299	6501	SO:0001583	missense	341019	exon7			CCCATTCATTGTC	AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.792G>A	chr11.hg19:g.31312362C>T	ENSP00000389792:p.Met264Ile	174.0	0.0		194.0	83.0	NM_181807	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	ENST00000452803.1	hg19	CCDS7872.1	.	.	.	.	.	.	.	.	.	.	C	13.10	2.135286	0.37728	.	.	ENSG00000188682	ENST00000452803	T	0.31769	1.48	5.78	4.87	0.63330	Doublecortin domain (1);	0.106346	0.41605	D	0.000848	T	0.32882	0.0844	M	0.65975	2.015	0.26534	N	0.974205	B	0.25904	0.137	B	0.28011	0.085	T	0.19484	-1.0304	10	0.21014	T	0.42	-2.9769	13.4351	0.61079	0.0:0.9272:0.0:0.0728	.	264	P59894	DCDC1_HUMAN	I	264	ENSP00000389792:M264I	ENSP00000389792:M264I	M	-	3	0	DCDC1	31268938	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.859000	0.48364	1.434000	0.47414	0.655000	0.94253	ATG	.	.		0.338	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316531.1	NM_181807	
PGA5	5222	hgsc.bcm.edu	37	11	61017209	61017209	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr11:61017209C>G	ENST00000312403.5	+	7	1027	c.842C>G	c.(841-843)tCt>tGt	p.S281C	CTD-2331C18.5_ENST00000537594.1_RNA|PGA5_ENST00000541528.1_Missense_Mutation_p.S21C|PGA5_ENST00000451616.2_Missense_Mutation_p.S127C|PGA4_ENST00000422676.2_Missense_Mutation_p.S281C	NM_014224.2	NP_055039.1	P0DJD9	PEPA5_HUMAN	pepsinogen 5, group I (pepsinogen A)	281					digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)			large_intestine(1)|skin(1)	2						ACCGGCACCTCTCTGCTGACC	0.607																																					p.S281C		Atlas-SNP	.											.	PGA5	20	.	0			c.C842G						.						131.0	134.0	133.0					11																	61017209		2202	4299	6501	SO:0001583	missense	5222	exon7			GCACCTCTCTGCT	BC029055	CCDS8001.1	11q13	2012-10-02			ENSG00000256713	ENSG00000256713	3.4.23.1		8887	protein-coding gene	gene with protein product		169730					Standard	NM_014224		Approved		uc001nqz.3	P0DJD9	OTTHUMG00000168075	ENST00000312403.5:c.842C>G	chr11.hg19:g.61017209C>G	ENSP00000309542:p.Ser281Cys	168.0	0.0		178.0	65.0	NM_014224	A8K749|B7ZW62|B7ZW75|P00790|Q7M4R0|Q8N1E3	Missense_Mutation	SNP	ENST00000312403.5	hg19	CCDS8001.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.956258	0.92726	.	.	ENSG00000229183;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713;ENSG00000256713	ENST00000422676;ENST00000312403;ENST00000537359;ENST00000544083;ENST00000451616;ENST00000541528	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	2.91	2.91	0.33838	.	0.000000	0.64402	D	0.000002	D	0.87708	0.6245	H	0.99740	4.74	0.38447	D	0.946869	D	0.89917	1.0	D	0.91635	0.999	D	0.93319	0.6691	10	0.87932	D	0	.	13.8637	0.63576	0.0:1.0:0.0:0.0	.	281	B7ZW62	.	C	281;281;238;140;127;21	ENSP00000395402:S281C;ENSP00000309542:S281C;ENSP00000408739:S127C;ENSP00000441981:S21C	ENSP00000395402:S281C	S	+	2	0	PGA4;PGA5	60773785	1.000000	0.71417	0.533000	0.28001	0.966000	0.64601	6.051000	0.71072	1.991000	0.58162	0.420000	0.28162	TCT	.	.		0.607	PGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397972.1	NM_014224	
ZNF202	7753	hgsc.bcm.edu	37	11	123600489	123600489	+	Silent	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr11:123600489C>T	ENST00000529691.1	-	3	666	c.447G>A	c.(445-447)acG>acA	p.T149T	ZNF202_ENST00000530393.1_Silent_p.T149T|ZNF202_ENST00000336139.4_Silent_p.T149T			O95125	ZN202_HUMAN	zinc finger protein 202	149					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		CTAAATGCACCGTCTCCTCTG	0.542																																					p.T149T		Atlas-SNP	.											.	ZNF202	72	.	0			c.G447A						.						79.0	72.0	74.0					11																	123600489		2202	4299	6501	SO:0001819	synonymous_variant	7753	exon5			ATGCACCGTCTCC	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.447G>A	chr11.hg19:g.123600489C>T		41.0	0.0		55.0	10.0	NM_003455	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Silent	SNP	ENST00000529691.1	hg19	CCDS8443.1																																																																																			.	.		0.542	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387419.1	NM_003455	
FGD4	121512	hgsc.bcm.edu	37	12	32751494	32751494	+	Missense_Mutation	SNP	G	G	A	rs528790143	byFrequency	TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr12:32751494G>A	ENST00000427716.2	+	5	1088	c.664G>A	c.(664-666)Gtc>Atc	p.V222I	FGD4_ENST00000534526.2_Missense_Mutation_p.V359I|FGD4_ENST00000266482.3_5'UTR|FGD4_ENST00000531134.1_Missense_Mutation_p.V307I|FGD4_ENST00000525053.1_Missense_Mutation_p.V334I|FGD4_ENST00000546442.1_Missense_Mutation_p.V129I|FGD4_ENST00000381025.3_5'UTR	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	222	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					AAGAGCTTATGTCAACCGACT	0.299													G|||	2	0.000399361	0.0	0.0	5008	,	,		18345	0.0		0.0	False		,,,				2504	0.002				p.V222I		Atlas-SNP	.											.	FGD4	86	.	0			c.G664A						.						90.0	89.0	89.0					12																	32751494		2203	4299	6502	SO:0001583	missense	121512	exon5			GCTTATGTCAACC	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.664G>A	chr12.hg19:g.32751494G>A	ENSP00000394487:p.Val222Ile	91.0	0.0		97.0	40.0	NM_139241	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	hg19	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327431	0.81690	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000546442;ENST00000525053	T;T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46;-0.46	4.91	4.91	0.64330	Dbl homology (DH) domain (5);	0.000000	0.46758	D	0.000267	D	0.83622	0.5294	M	0.82193	2.58	0.80722	D	1	D;D;D	0.89917	0.995;0.995;1.0	D;D;D	0.87578	0.98;0.98;0.998	D	0.86446	0.1770	10	0.87932	D	0	-15.6004	18.4768	0.90795	0.0:0.0:1.0:0.0	.	334;307;222	E9PJX4;B7Z493;Q96M96	.;.;FGD4_HUMAN	I	359;307;222;129;334	ENSP00000449273:V359I;ENSP00000431323:V307I;ENSP00000394487:V222I;ENSP00000446695:V129I;ENSP00000433666:V334I	ENSP00000379089:V222I	V	+	1	0	FGD4	32642761	1.000000	0.71417	0.987000	0.45799	0.853000	0.48598	7.219000	0.78000	2.426000	0.82243	0.655000	0.94253	GTC	.	.		0.299	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
ACACB	32	hgsc.bcm.edu	37	12	109614034	109614034	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr12:109614034A>T	ENST00000338432.7	+	9	1522	c.1403A>T	c.(1402-1404)gAg>gTg	p.E468V	ACACB_ENST00000377854.5_Missense_Mutation_p.E468V|ACACB_ENST00000377848.3_Missense_Mutation_p.E468V|ACACB_ENST00000543080.1_3'UTR			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	468	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CGGAAGGCTGAGAGTGCGGAG	0.493																																					p.E468V		Atlas-SNP	.											.	ACACB	330	.	0			c.A1403T						.						225.0	234.0	231.0					12																	109614034		2203	4300	6503	SO:0001583	missense	32	exon8			AGGCTGAGAGTGC	U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.1403A>T	chr12.hg19:g.109614034A>T	ENSP00000341044:p.Glu468Val	118.0	0.0		151.0	54.0	NM_001093	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	ENST00000338432.7	hg19	CCDS31898.1	.	.	.	.	.	.	.	.	.	.	A	17.75	3.465504	0.63513	.	.	ENSG00000076555	ENST00000338432;ENST00000377848;ENST00000377854	D;D;D	0.97831	-4.56;-4.56;-4.56	5.91	5.91	0.95273	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.046253	0.85682	D	0.000000	D	0.98185	0.9400	M	0.64404	1.975	0.80722	D	1	D	0.61697	0.99	D	0.66497	0.944	D	0.98485	1.0607	10	0.44086	T	0.13	.	16.3512	0.83208	1.0:0.0:0.0:0.0	.	468	O00763	ACACB_HUMAN	V	468	ENSP00000341044:E468V;ENSP00000367079:E468V;ENSP00000367085:E468V	ENSP00000341044:E468V	E	+	2	0	ACACB	108098417	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	7.252000	0.78309	2.266000	0.75297	0.533000	0.62120	GAG	.	.		0.493	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403077.1	NM_001093	
PCCA	5095	hgsc.bcm.edu	37	13	100861682	100861682	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr13:100861682G>T	ENST00000376285.1	+	7	603	c.565G>T	c.(565-567)Gtt>Ttt	p.V189F	PCCA_ENST00000376279.3_Missense_Mutation_p.V189F|PCCA_ENST00000376286.4_Missense_Mutation_p.V163F	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	189	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.|Biotin carboxylation.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	GAAAGCAGAGGTTAATACAAT	0.373																																					p.V189F		Atlas-SNP	.											.	PCCA	59	.	0			c.G565T						.						146.0	132.0	137.0					13																	100861682		2203	4300	6503	SO:0001583	missense	5095	exon7			GCAGAGGTTAATA	X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.565G>T	chr13.hg19:g.100861682G>T	ENSP00000365462:p.Val189Phe	90.0	0.0		112.0	44.0	NM_001178004	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	ENST00000376285.1	hg19	CCDS9496.2	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672029	0.88348	.	.	ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285	D;D;D	0.98044	-4.68;-4.68;-4.68	5.02	5.02	0.67125	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);Biotin carboxylation domain (1);	0.000000	0.85682	D	0.000000	D	0.99381	0.9782	H	0.99104	4.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.995;0.999	D	0.98196	1.0465	10	0.87932	D	0	.	18.3367	0.90290	0.0:0.0:1.0:0.0	.	189;163;189	C9JPQ8;P05165-2;P05165	.;.;PCCA_HUMAN	F	163;189;189	ENSP00000365463:V163F;ENSP00000365456:V189F;ENSP00000365462:V189F	ENSP00000365456:V189F	V	+	1	0	PCCA	99659683	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.617000	0.98361	2.323000	0.78572	0.655000	0.94253	GTT	.	.		0.373	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045627.2		
TEP1	7011	hgsc.bcm.edu	37	14	20852626	20852626	+	Missense_Mutation	SNP	T	T	C	rs201494870		TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr14:20852626T>C	ENST00000262715.5	-	23	3303	c.3263A>G	c.(3262-3264)tAt>tGt	p.Y1088C	TEP1_ENST00000556935.1_Missense_Mutation_p.Y980C|TEP1_ENST00000545983.1_5'Flank	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1088					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		CCCGCCAACATAGGGCCGGCC	0.587																																					p.Y1088C		Atlas-SNP	.											.	TEP1	224	.	0			c.A3263G						.	T	CYS/TYR	0,4406		0,0,2203	111.0	131.0	124.0		3263	4.0	1.0	14		124	3,8597	3.0+/-9.4	0,3,4297	no	missense	TEP1	NM_007110.4	194	0,3,6500	CC,CT,TT		0.0349,0.0,0.0231	probably-damaging	1088/2628	20852626	3,13003	2203	4300	6503	SO:0001583	missense	7011	exon23			CCAACATAGGGCC		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.3263A>G	chr14.hg19:g.20852626T>C	ENSP00000262715:p.Tyr1088Cys	42.0	0.0		63.0	26.0	NM_007110	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	hg19	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	T	12.08	1.829857	0.32329	0.0	3.49E-4	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.16897	2.31;2.31	5.21	3.99	0.46301	.	0.190149	0.47455	D	0.000233	T	0.35566	0.0936	M	0.74881	2.28	0.80722	D	1	D;B;D	0.89917	1.0;0.009;1.0	D;B;D	0.74023	0.982;0.022;0.956	T	0.09335	-1.0679	10	0.52906	T	0.07	-5.2177	6.5259	0.22301	0.1534:0.0:0.1591:0.6875	.	980;438;1088	G3V5X7;G3V2A4;Q99973	.;.;TEP1_HUMAN	C	1088;1088;980	ENSP00000262715:Y1088C;ENSP00000452574:Y980C	ENSP00000262715:Y1088C	Y	-	2	0	TEP1	19922466	1.000000	0.71417	0.995000	0.50966	0.851000	0.48451	3.314000	0.51943	1.971000	0.57363	0.379000	0.24179	TAT	.	T|0.999;C|0.001		0.587	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
ZNF219	51222	hgsc.bcm.edu	37	14	21561409	21561409	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr14:21561409G>A	ENST00000360947.3	-	3	458	c.47C>T	c.(46-48)tCg>tTg	p.S16L	ZNF219_ENST00000451119.2_Missense_Mutation_p.S16L|RP11-998D10.7_ENST00000554733.2_lincRNA|ZNF219_ENST00000556101.1_5'Flank|ZNF219_ENST00000421093.2_Missense_Mutation_p.S16L	NM_016423.2	NP_057507.2	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	16					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of neurotransmitter levels (GO:0001505)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histamine receptor activity (GO:0004969)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(2)	8	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		AGCCGGCGGCGACGGCGCTAA	0.652											OREG0022565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S16L		Atlas-SNP	.											.	ZNF219	28	.	0			c.C47T						.						10.0	12.0	11.0					14																	21561409		2157	4192	6349	SO:0001583	missense	51222	exon3			GGCGGCGACGGCG	AB015427	CCDS9568.1	14q11	2013-01-08			ENSG00000165804	ENSG00000165804		"""Zinc fingers, C2H2-type"""	13011	protein-coding gene	gene with protein product		605036				10819330	Standard	NM_016423		Approved		uc001vzs.2	Q9P2Y4	OTTHUMG00000029647	ENST00000360947.3:c.47C>T	chr14.hg19:g.21561409G>A	ENSP00000354206:p.Ser16Leu	25.0	0.0	749	18.0	10.0	NM_001102454	D3DS16|Q53Y57|Q8IYC1|Q9BW28	Missense_Mutation	SNP	ENST00000360947.3	hg19	CCDS9568.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176369	0.78564	.	.	ENSG00000165804	ENST00000360947;ENST00000451119;ENST00000421093;ENST00000555270;ENST00000554478;ENST00000556174;ENST00000554923;ENST00000553296;ENST00000555697	T;T;T;T;T;T;T;T	0.10477	3.16;3.16;3.16;3.5;2.96;3.11;2.87;3.03	4.84	4.84	0.62591	.	0.377447	0.21121	N	0.079804	T	0.06554	0.0168	N	0.14661	0.345	0.18873	N	0.999981	B	0.26363	0.147	B	0.17979	0.02	T	0.21552	-1.0242	10	0.72032	D	0.01	-14.0205	8.9496	0.35781	0.0979:0.0:0.9021:0.0	.	16	Q9P2Y4	ZN219_HUMAN	L	16;16;16;16;62;16;53;16;16	ENSP00000354206:S16L;ENSP00000388558:S16L;ENSP00000392401:S16L;ENSP00000450803:S16L;ENSP00000451212:S62L;ENSP00000450609:S16L;ENSP00000451890:S53L;ENSP00000450900:S16L	ENSP00000354206:S16L	S	-	2	0	ZNF219	20631249	0.076000	0.21285	0.810000	0.32431	0.995000	0.86356	2.223000	0.42936	2.520000	0.84964	0.655000	0.94253	TCG	.	.		0.652	ZNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073931.2		
EML5	161436	hgsc.bcm.edu	37	14	89202828	89202828	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr14:89202828A>G	ENST00000380664.5	-	7	928	c.929T>C	c.(928-930)gTg>gCg	p.V310A	EML5_ENST00000352093.5_Missense_Mutation_p.V310A|EML5_ENST00000554922.1_Missense_Mutation_p.V310A			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	310						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						TCTTTCTTGCACCACAATTTC	0.403																																					p.V310A		Atlas-SNP	.											.	EML5	141	.	0			c.T929C						.						163.0	162.0	162.0					14																	89202828		1904	4105	6009	SO:0001583	missense	161436	exon7			TCTTGCACCACAA	AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.929T>C	chr14.hg19:g.89202828A>G	ENSP00000370039:p.Val310Ala	167.0	0.0		202.0	89.0	NM_183387	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	ENST00000380664.5	hg19	CCDS45148.1	.	.	.	.	.	.	.	.	.	.	A	17.36	3.370939	0.61624	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.01369	4.97;4.97;4.98	5.15	5.15	0.70609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.072805	0.53938	D	0.000042	T	0.02929	0.0087	L	0.39633	1.23	0.58432	D	0.999996	D	0.61080	0.989	P	0.52343	0.696	T	0.70371	-0.4890	10	0.15952	T	0.53	-13.2347	15.1382	0.72586	1.0:0.0:0.0:0.0	.	310	Q05BV3	EMAL5_HUMAN	A	310	ENSP00000451998:V310A;ENSP00000298315:V310A;ENSP00000370039:V310A	ENSP00000298315:V310A	V	-	2	0	EML5	88272581	1.000000	0.71417	0.976000	0.42696	0.983000	0.72400	8.761000	0.91691	2.166000	0.68216	0.533000	0.62120	GTG	.	.		0.403	EML5-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410491.1		
RYR3	6263	hgsc.bcm.edu	37	15	34021159	34021159	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr15:34021159A>G	ENST00000389232.4	+	47	7205	c.7135A>G	c.(7135-7137)Act>Gct	p.T2379A	RYR3_ENST00000415757.3_Missense_Mutation_p.T2379A	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2379	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TAAGGATCAAACTTTTCTGCT	0.448																																					p.T2379A		Atlas-SNP	.											.	RYR3	760	.	0			c.A7135G						.						78.0	77.0	78.0					15																	34021159		1866	4093	5959	SO:0001583	missense	6263	exon47			GATCAAACTTTTC		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7135A>G	chr15.hg19:g.34021159A>G	ENSP00000373884:p.Thr2379Ala	84.0	0.0		60.0	10.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324018	0.41096	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.96265	-3.96;-3.96	4.85	1.19	0.21007	.	0.109027	0.64402	D	0.000014	D	0.88695	0.6506	N	0.14661	0.345	0.25400	N	0.988452	B;B	0.19706	0.038;0.007	B;B	0.17979	0.02;0.002	T	0.78758	-0.2079	10	0.32370	T	0.25	.	5.1189	0.14851	0.6363:0.1421:0.2216:0.0	.	2379;2379	Q15413-2;Q15413	.;RYR3_HUMAN	A	2379	ENSP00000373884:T2379A;ENSP00000399610:T2379A	ENSP00000354735:T2379A	T	+	1	0	RYR3	31808451	0.993000	0.37304	0.992000	0.48379	0.986000	0.74619	1.732000	0.38146	0.097000	0.17492	0.460000	0.39030	ACT	.	.		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
AXIN1	8312	hgsc.bcm.edu	37	16	396740	396740	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr16:396740G>A	ENST00000262320.3	-	2	657	c.286C>T	c.(286-288)Caa>Taa	p.Q96*	AXIN1_ENST00000354866.3_Nonsense_Mutation_p.Q96*|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	96	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				ATCCCATCTTGGTCATCCAGC	0.592											OREG0003698	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.Q96X		Atlas-SNP	.											.	AXIN1	290	.	0			c.C286T						.						42.0	38.0	39.0					16																	396740		2203	4300	6503	SO:0001587	stop_gained	8312	exon2			CATCTTGGTCATC	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.286C>T	chr16.hg19:g.396740G>A	ENSP00000262320:p.Gln96*	54.0	0.0	588	28.0	21.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Nonsense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	G	38	6.685887	0.97764	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-17.008	19.4141	0.94688	0.0:0.0:1.0:0.0	.	.	.	.	X	96	.	ENSP00000262320:Q96X	Q	-	1	0	AXIN1	336741	1.000000	0.71417	0.992000	0.48379	0.803000	0.45373	9.726000	0.98782	2.605000	0.88082	0.655000	0.94253	CAA	.	.		0.592	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
KRT17	3872	hgsc.bcm.edu	37	17	39777023	39777023	+	Missense_Mutation	SNP	G	G	A	rs374932182		TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr17:39777023G>A	ENST00000311208.8	-	6	1136	c.1069C>T	c.(1069-1071)Cgc>Tgc	p.R357C	JUP_ENST00000540235.1_Missense_Mutation_p.R516C	NM_000422.2	NP_000413.1	Q04695	K1C17_HUMAN	keratin 17	357	Coil 2.|Rod.			R -> L (in Ref. 4; AL353997/AC022596). {ECO:0000305}.	epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinization (GO:0031424)|morphogenesis of an epithelium (GO:0002009)|positive regulation of cell growth (GO:0030307)|positive regulation of hair follicle development (GO:0051798)|positive regulation of translation (GO:0045727)|signal transduction (GO:0007165)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	MHC class II protein binding (GO:0042289)|MHC class II receptor activity (GO:0032395)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	12		Breast(137;0.000307)				ATCTCGCAGCGAAGCTGGGCC	0.627																																					p.R357C	Pancreas(92;1242 2086 39193 50508)	Atlas-SNP	.											KRT17,right_upper_lobe,carcinoma,0,1	KRT17	57	.	0			c.C1069T						.	G	CYS/ARG	0,4406		0,0,2203	57.0	59.0	58.0		1069	4.0	1.0	17		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT17	NM_000422.2	180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	357/433	39777023	1,13005	2203	4300	6503	SO:0001583	missense	3872	exon6			CGCAGCGAAGCTG	X62571	CCDS11402.1	17q21.2	2014-06-12			ENSG00000128422	ENSG00000128422		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6427	protein-coding gene	gene with protein product		148069		PCHC1		7539673, 1281771, 16831889	Standard	NM_000422		Approved		uc002hxh.2	Q04695	OTTHUMG00000133505	ENST00000311208.8:c.1069C>T	chr17.hg19:g.39777023G>A	ENSP00000308452:p.Arg357Cys	136.0	0.0		130.0	52.0	NM_000422	A5Z1M9|A5Z1N0|A5Z1N1|A5Z1N2|A6NDV6|A6NKQ2|Q6IP98|Q8N1P6	Missense_Mutation	SNP	ENST00000311208.8	hg19	CCDS11402.1	.	.	.	.	.	.	.	.	.	.	G	19.29	3.799287	0.70567	0.0	1.16E-4	ENSG00000128422;ENSG00000173801	ENST00000311208;ENST00000540235	D;D	0.91521	-2.86;-2.86	4.02	4.02	0.46733	Filament (1);	0.000000	0.47852	D	0.000202	D	0.94594	0.8258	H	0.98738	4.315	0.45528	D	0.998482	B	0.24963	0.115	B	0.30316	0.114	D	0.94808	0.7976	10	0.87932	D	0	.	12.6993	0.57022	0.0:0.0:0.8349:0.1651	.	357	Q04695	K1C17_HUMAN	C	357;516	ENSP00000308452:R357C;ENSP00000441751:R516C	ENSP00000441751:R516C	R	-	1	0	JUP;KRT17	37030549	0.821000	0.29204	1.000000	0.80357	0.807000	0.45602	1.433000	0.34947	2.246000	0.74042	0.561000	0.74099	CGC	.	.		0.627	KRT17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257460.1	NM_000422	
SDK2	54549	hgsc.bcm.edu	37	17	71390374	71390374	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr17:71390374G>T	ENST00000392650.3	-	26	3682	c.3682C>A	c.(3682-3684)Cgc>Agc	p.R1228S	SDK2_ENST00000388726.3_Missense_Mutation_p.R1228S	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1228	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						AGCCCGTTGCGATCAGCCTCG	0.657																																					p.R1228S		Atlas-SNP	.											.	SDK2	219	.	0			c.C3682A						.						42.0	37.0	38.0					17																	71390374		2203	4300	6503	SO:0001583	missense	54549	exon26			CGTTGCGATCAGC	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.3682C>A	chr17.hg19:g.71390374G>T	ENSP00000376421:p.Arg1228Ser	42.0	0.0		58.0	24.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	hg19	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	13.38	2.219981	0.39201	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893	T;T;T	0.56776	0.44;0.44;0.44	5.19	5.19	0.71726	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.055776	0.64402	D	0.000001	T	0.51176	0.1659	L	0.42245	1.32	0.48632	D	0.999681	P;P;P	0.44309	0.795;0.832;0.798	P;P;B	0.46796	0.515;0.527;0.392	T	0.47509	-0.9112	10	0.35671	T	0.21	.	13.0785	0.59100	0.0799:0.0:0.9201:0.0	.	1228;1228;1228	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	S	852;1228;1228;404;1228	ENSP00000376421:R1228S;ENSP00000373378:R1228S;ENSP00000407098:R404S	ENSP00000324967:R1228S	R	-	1	0	SDK2	68901969	0.665000	0.27466	0.951000	0.38953	0.024000	0.10985	2.830000	0.48136	2.426000	0.82243	0.313000	0.20887	CGC	.	.		0.657	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
SLC38A10	124565	hgsc.bcm.edu	37	17	79257223	79257223	+	Silent	SNP	G	G	A	rs138694564	byFrequency	TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr17:79257223G>A	ENST00000374759.3	-	4	726	c.343C>T	c.(343-345)Ctg>Ttg	p.L115L	SLC38A10_ENST00000288439.5_Silent_p.L115L|SLC38A10_ENST00000546352.1_5'Flank	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	115					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			AACCCGAACAGCCGGGCAAAG	0.607																																					p.L115L		Atlas-SNP	.											.	SLC38A10	133	.	0			c.C343T						.						83.0	57.0	66.0					17																	79257223		2201	4299	6500	SO:0001819	synonymous_variant	124565	exon4			CGAACAGCCGGGC	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.343C>T	chr17.hg19:g.79257223G>A		96.0	0.0		74.0	15.0	NM_001037984	Q6ZRC5|Q8NA99|Q96C66	Silent	SNP	ENST00000374759.3	hg19	CCDS42397.1																																																																																			.	G|0.999;T|0.001		0.607	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570	
MC4R	4160	hgsc.bcm.edu	37	18	58039334	58039334	+	Silent	SNP	G	G	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr18:58039334G>T	ENST00000299766.3	-	1	667	c.249C>A	c.(247-249)atC>atA	p.I83I		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	83					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				CCAAGCTGCAGATGAAAAAGT	0.428																																					p.I83I		Atlas-SNP	.											.	MC4R	49	.	0			c.C249A						.						101.0	98.0	99.0					18																	58039334		2203	4300	6503	SO:0001819	synonymous_variant	4160	exon1			GCTGCAGATGAAA	AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.249C>A	chr18.hg19:g.58039334G>T		92.0	0.0		72.0	5.0	NM_005912	B2RAC3|Q16317|Q3MIJ6	Silent	SNP	ENST00000299766.3	hg19	CCDS11976.1																																																																																			.	.		0.428	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256139.1	NM_005912	
CBLN2	147381	hgsc.bcm.edu	37	18	70209069	70209069	+	Silent	SNP	G	G	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr18:70209069G>A	ENST00000269503.4	-	3	1100	c.327C>T	c.(325-327)agC>agT	p.S109S	CBLN2_ENST00000585159.1_Silent_p.S109S|CBLN2_ENST00000581073.1_Intron|CBLN2_ENST00000584764.1_Intron|CBLN2_ENST00000583651.1_Intron	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	109	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				TGGTGCGGTTGCTCATCTCGG	0.721																																					p.S109S		Atlas-SNP	.											.	CBLN2	41	.	0			c.C327T						.						41.0	33.0	36.0					18																	70209069		2203	4300	6503	SO:0001819	synonymous_variant	147381	exon3			GCGGTTGCTCATC	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.327C>T	chr18.hg19:g.70209069G>A		29.0	0.0		34.0	9.0	NM_182511	Q53Z56	Silent	SNP	ENST00000269503.4	hg19	CCDS11999.1																																																																																			.	.		0.721	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
MBP	4155	hgsc.bcm.edu	37	18	74817196	74817196	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr18:74817196G>A	ENST00000397860.3	-	2	236	c.22C>T	c.(22-24)Cga>Tga	p.R8*	MBP_ENST00000487778.1_5'UTR|MBP_ENST00000579129.1_Nonsense_Mutation_p.R8*|MBP_ENST00000397863.1_Nonsense_Mutation_p.R8*|MBP_ENST00000580402.1_Nonsense_Mutation_p.R8*|MBP_ENST00000355994.2_Nonsense_Mutation_p.R8*	NM_001025100.1	NP_001020271.1	P13727	PRG2_HUMAN	myelin basic protein	0					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	TTTAATTCTCGTTTGCCTGCG	0.448																																					p.R8X	NSCLC(17;72 1131 19392)	Atlas-SNP	.											.	MBP	45	.	0			c.C22T						.						238.0	182.0	201.0					18																	74817196		2203	4300	6503	SO:0001587	stop_gained	4155	exon2			ATTCTCGTTTGCC		CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397860.3:c.22C>T	chr18.hg19:g.74817196G>A	ENSP00000380958:p.Arg8*	100.0	0.0		83.0	30.0	NM_001025100	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Nonsense_Mutation	SNP	ENST00000397860.3	hg19	CCDS42450.1	.	.	.	.	.	.	.	.	.	.	G	38	6.950281	0.97956	.	.	ENSG00000197971	ENST00000355994;ENST00000397863;ENST00000397860	.	.	.	3.26	1.37	0.22104	.	0.000000	0.47093	D	0.000244	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0652	8.0449	0.30542	0.0:0.0:0.5636:0.4364	.	.	.	.	X	8	.	ENSP00000348273:R8X	R	-	1	2	MBP	72946184	0.978000	0.34361	0.167000	0.22817	0.006000	0.05464	0.767000	0.26575	0.362000	0.24319	0.563000	0.77884	CGA	.	.		0.448	MBP-005	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000267945.1	NM_001025081	
WIZ	58525	hgsc.bcm.edu	37	19	15538111	15538111	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr19:15538111T>C	ENST00000389282.4	-	6	3547	c.3334A>G	c.(3334-3336)Aag>Gag	p.K1112E	WIZ_ENST00000599910.2_Missense_Mutation_p.K429E|WIZ_ENST00000545156.1_Missense_Mutation_p.K426E|WIZ_ENST00000263381.7_Missense_Mutation_p.K255E|WIZ_ENST00000599686.3_Missense_Mutation_p.K296E			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	1112	Pro-rich.				positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CCCATCATCTTGGCCAGGGCT	0.657																																					p.K255E		Atlas-SNP	.											.	WIZ	152	.	0			c.A763G						.						27.0	31.0	29.0					19																	15538111		1988	4156	6144	SO:0001583	missense	58525	exon4			TCATCTTGGCCAG	AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.3334A>G	chr19.hg19:g.15538111T>C	ENSP00000373933:p.Lys1112Glu	78.0	0.0		79.0	35.0	NM_021241	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	ENST00000389282.4	hg19		.	.	.	.	.	.	.	.	.	.	T	13.73	2.325004	0.41197	.	.	ENSG00000011451	ENST00000389282;ENST00000263381;ENST00000416927;ENST00000545156	T	0.02709	4.19	5.67	5.67	0.87782	.	0.192780	0.45126	D	0.000400	T	0.04634	0.0126	N	0.24115	0.695	0.28153	N	0.929293	P;D;P	0.60575	0.462;0.988;0.918	B;P;P	0.56163	0.091;0.793;0.53	T	0.45571	-0.9252	10	0.15499	T	0.54	-32.7876	11.397	0.49847	0.0:0.0:0.1512:0.8488	.	1112;255;296	O95785;O95785-2;B3KVH1	WIZ_HUMAN;.;.	E	1112;255;296;426	ENSP00000373933:K1112E	ENSP00000263381:K255E	K	-	1	0	WIZ	15399111	1.000000	0.71417	1.000000	0.80357	0.355000	0.29361	4.629000	0.61290	2.155000	0.67459	0.459000	0.35465	AAG	.	.		0.657	WIZ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_021241	
VSTM2B	342865	hgsc.bcm.edu	37	19	30054814	30054814	+	Missense_Mutation	SNP	G	G	C	rs140018368		TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr19:30054814G>C	ENST00000335523.7	+	5	916	c.831G>C	c.(829-831)aaG>aaC	p.K277N		NM_001146339.1	NP_001139811.1	A6NLU5	VTM2B_HUMAN	V-set and transmembrane domain containing 2B	277						integral component of membrane (GO:0016021)				breast(2)	2						CTCTGCATAAGTTCCTGCGCC	0.592																																					p.K277N		Atlas-SNP	.											.	VSTM2B	15	.	0			c.G831C						.						184.0	150.0	160.0					19																	30054814		692	1591	2283	SO:0001583	missense	342865	exon5			GCATAAGTTCCTG		CCDS46034.1	19q12	2013-01-11			ENSG00000187135	ENSG00000187135		"""Immunoglobulin superfamily / V-set domain containing"""	33595	protein-coding gene	gene with protein product							Standard	NM_001146339		Approved		uc010xrl.1	A6NLU5		ENST00000335523.7:c.831G>C	chr19.hg19:g.30054814G>C	ENSP00000335038:p.Lys277Asn	53.0	0.0		75.0	23.0	NM_001146339		Missense_Mutation	SNP	ENST00000335523.7	hg19	CCDS46034.1	.	.	.	.	.	.	.	.	.	.	G	9.758	1.169391	0.21621	.	.	ENSG00000187135	ENST00000335523	T	0.11495	2.77	5.69	4.63	0.57726	.	.	.	.	.	T	0.09949	0.0244	L	0.27053	0.805	0.35195	D	0.773766	B	0.26400	0.148	B	0.22152	0.038	T	0.10965	-1.0607	9	0.62326	D	0.03	.	15.6236	0.76829	0.0:0.1378:0.8622:0.0	.	277	A6NLU5	VTM2B_HUMAN	N	277	ENSP00000335038:K277N	ENSP00000335038:K277N	K	+	3	2	VSTM2B	34746654	1.000000	0.71417	0.003000	0.11579	0.023000	0.10783	6.738000	0.74822	1.369000	0.46134	0.462000	0.41574	AAG	.	G|1.000;T|0.000		0.592	VSTM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458601.1	NM_001146339	
KIRREL2	84063	hgsc.bcm.edu	37	19	36351887	36351887	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr19:36351887G>A	ENST00000360202.5	+	8	1203	c.1005G>A	c.(1003-1005)tgG>tgA	p.W335*	KIRREL2_ENST00000347900.6_Nonsense_Mutation_p.W285*|KIRREL2_ENST00000592409.1_Nonsense_Mutation_p.W335*|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000262625.7_Nonsense_Mutation_p.W335*	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	335	Ig-like C2-type 4.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTGCGCCTGGCGCGGGAACC	0.662																																					p.W335X		Atlas-SNP	.											.	KIRREL2	170	.	0			c.G1005A						.						12.0	15.0	14.0					19																	36351887		2189	4283	6472	SO:0001587	stop_gained	84063	exon8			CGCCTGGCGCGGG	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1005G>A	chr19.hg19:g.36351887G>A	ENSP00000353331:p.Trp335*	45.0	0.0		62.0	32.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Nonsense_Mutation	SNP	ENST00000360202.5	hg19	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	g	39	7.551198	0.98352	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	.	.	.	4.5	4.5	0.54988	.	0.000000	0.44688	D	0.000422	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.156	12.6669	0.56848	0.0:0.0:1.0:0.0	.	.	.	.	X	335;285;335;315	.	ENSP00000262625:W335X	W	+	3	0	KIRREL2	41043727	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	8.354000	0.90080	2.362000	0.80069	0.494000	0.49563	TGG	.	.		0.662	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
CA11	770	hgsc.bcm.edu	37	19	49143044	49143044	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr19:49143044C>T	ENST00000084798.4	-	5	1247		c.e5+1		DBP_ENST00000222122.5_5'Flank|SEC1P_ENST00000430145.2_RNA|DBP_ENST00000601104.1_5'Flank	NM_001217.3	NP_001208.2	O75493	CAH11_HUMAN	carbonic anhydrase XI							basolateral plasma membrane (GO:0016323)|extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	14		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)	Zonisamide(DB00909)	CCTCCGCTCACGTTGACAAAG	0.632																																					.		Atlas-SNP	.											CA11,NS,carcinoma,0,1	CA11	29	.	0			c.567+1G>A						.						58.0	62.0	61.0					19																	49143044		2203	4300	6503	SO:0001630	splice_region_variant	770	exon6			CGCTCACGTTGAC	AF067662	CCDS12729.1	19q13.3	2012-07-02			ENSG00000063180	ENSG00000063180		"""Carbonic anhydrases"""	1370	protein-coding gene	gene with protein product	"""CA-RP XI"", ""carbonic anhydrase-related protein XI"", ""carbonic anhydrase-related protein 2"""	604644				9878252	Standard	XR_243956		Approved	CARP2, CARPX1	uc002pjz.1	O75493		ENST00000084798.4:c.567+1G>A	chr19.hg19:g.49143044C>T		92.0	0.0		106.0	45.0	NM_001217	O60596|Q6FHI1|Q9UEC4	Splice_Site	SNP	ENST00000084798.4	hg19	CCDS12729.1	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058724	0.55325	.	.	ENSG00000063180	ENST00000084798	.	.	.	3.63	3.63	0.41609	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0057	0.47633	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CA11	53834856	1.000000	0.71417	0.998000	0.56505	0.687000	0.40016	3.235000	0.51328	2.055000	0.61198	0.462000	0.41574	.	.	.		0.632	CA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466172.1	NM_001217	Intron
ZNF329	79673	hgsc.bcm.edu	37	19	58639289	58639289	+	Silent	SNP	G	G	T	rs143513293	byFrequency	TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr19:58639289G>T	ENST00000598312.1	-	4	1815	c.1582C>A	c.(1582-1584)Cga>Aga	p.R528R	ZNF329_ENST00000358067.4_Silent_p.R528R	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	528					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		CTTTGATGTCGAACAAGGGAT	0.522																																					p.R528R		Atlas-SNP	.											ZNF329,caecum,carcinoma,0,1	ZNF329	70	.	0			c.C1582A						.						185.0	160.0	168.0					19																	58639289		2203	4300	6503	SO:0001819	synonymous_variant	79673	exon4			GATGTCGAACAAG	AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.1582C>A	chr19.hg19:g.58639289G>T		98.0	0.0		116.0	39.0	NM_024620	B3KR32|Q9H9R7	Silent	SNP	ENST00000598312.1	hg19	CCDS12972.1																																																																																			.	G|1.000;A|0.000		0.522	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466724.1	NM_024620	
BPIFA2	140683	hgsc.bcm.edu	37	20	31767467	31767467	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr20:31767467G>T	ENST00000253362.2	+	7	849	c.703G>T	c.(703-705)Gtc>Ttc	p.V235F	BPIFA2_ENST00000354932.5_Missense_Mutation_p.V235F			Q96DR5	BPIA2_HUMAN	BPI fold containing family A, member 2	235						extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	lipopolysaccharide binding (GO:0001530)										CATTCAGCAGGTCGTCGGTAA	0.557																																					p.V235F		Atlas-SNP	.											.	.	.	.	0			c.G703T						.						154.0	148.0	150.0					20																	31767467		2203	4300	6503	SO:0001583	missense	140683	exon7			CAGCAGGTCGTCG	AF432917	CCDS13214.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131050	ENSG00000131050		"""BPI fold containing"""	16203	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 70"""	C20orf70		11971875	Standard	NM_080574		Approved	bA49G10.1, SPLUNC2, PSP	uc002wyo.1	Q96DR5	OTTHUMG00000032244	ENST00000253362.2:c.703G>T	chr20.hg19:g.31767467G>T	ENSP00000253362:p.Val235Phe	50.0	0.0		65.0	25.0	NM_080574	Q9BQQ0	Missense_Mutation	SNP	ENST00000253362.2	hg19	CCDS13214.1	.	.	.	.	.	.	.	.	.	.	G	2.546	-0.305279	0.05495	.	.	ENSG00000131050	ENST00000253362;ENST00000354932	T;T	0.04502	3.61;3.61	3.31	-6.62	0.01813	.	2.312150	0.02219	N	0.063839	T	0.03959	0.0111	N	0.14661	0.345	0.09310	N	1	B	0.29716	0.255	B	0.25405	0.06	T	0.38972	-0.9636	10	0.72032	D	0.01	-19.194	12.7692	0.57410	0.1092:0.5034:0.3874:0.0	.	235	Q96DR5	BPIA2_HUMAN	F	235	ENSP00000253362:V235F;ENSP00000347012:V235F	ENSP00000253362:V235F	V	+	1	0	BPIFA2	31231128	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.940000	0.00329	-4.847000	0.00029	-2.230000	0.00291	GTC	.	.		0.557	BPIFA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257117.1	NM_080574	
ACTL10	170487	hgsc.bcm.edu	37	20	32255993	32255993	+	Silent	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr20:32255993C>T	ENST00000330271.4	+	1	1690	c.690C>T	c.(688-690)gcC>gcT	p.A230A	NECAB3_ENST00000375238.4_Intron|NECAB3_ENST00000246190.6_Intron	NM_001024675.1	NP_001019846.1	Q5JWF8	ACL10_HUMAN	actin-like 10	230																	TAACTCGGGCCATGTACCAGG	0.642																																					p.A230A		Atlas-SNP	.											.	.	.	.	0			c.C690T						.						25.0	29.0	28.0					20																	32255993		2203	4300	6503	SO:0001819	synonymous_variant	170487	exon1			TCGGGCCATGTAC	AL121906	CCDS33463.1	20q11.22	2011-11-24	2011-11-24	2011-11-24	ENSG00000182584	ENSG00000182584			16127	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 134"""	C20orf134			Standard	NM_001024675		Approved		uc002wzt.3	Q5JWF8	OTTHUMG00000032262	ENST00000330271.4:c.690C>T	chr20.hg19:g.32255993C>T		64.0	0.0		82.0	38.0	NM_001024675	B9EH76	Silent	SNP	ENST00000330271.4	hg19	CCDS33463.1																																																																																			.	.		0.642	ACTL10-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078713.1		
RALY	22913	hgsc.bcm.edu	37	20	32664877	32664877	+	Silent	SNP	C	C	T	rs539352667	byFrequency	TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr20:32664877C>T	ENST00000246194.3	+	8	1204	c.702C>T	c.(700-702)ggC>ggT	p.G234G	RALY_ENST00000375114.3_Silent_p.G218G	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	234	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						gcggcggcggcggtggtggtg	0.667																																					p.G234G		Atlas-SNP	.											.	RALY	44	.	0			c.C702T						.						5.0	7.0	7.0					20																	32664877		2080	4086	6166	SO:0001819	synonymous_variant	22913	exon8			CGGCGGCGGTGGT	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.702C>T	chr20.hg19:g.32664877C>T		110.0	0.0		127.0	6.0	NM_016732	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	ENST00000246194.3	hg19	CCDS13230.1																																																																																			.	.		0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078753.1		
ZNF280B	140883	hgsc.bcm.edu	37	22	22842492	22842492	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr22:22842492C>A	ENST00000406426.1	-	4	1974	c.1232G>T	c.(1231-1233)aGa>aTa	p.R411I	ZNF280B_ENST00000360412.2_Missense_Mutation_p.R411I			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GACCGACGATCTATAATGGCA	0.398																																					p.R411I		Atlas-SNP	.											.	ZNF280B	67	.	0			c.G1232T						.						130.0	121.0	124.0					22																	22842492		2203	4300	6503	SO:0001583	missense	140883	exon4			GACGATCTATAAT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.1232G>T	chr22.hg19:g.22842492C>A	ENSP00000385998:p.Arg411Ile	148.0	0.0		173.0	77.0	NM_080764		Missense_Mutation	SNP	ENST00000406426.1	hg19	CCDS13799.1	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482626	0.63962	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.28255	1.62;1.62	4.85	3.83	0.44106	Zinc finger, C2H2-like (1);	.	.	.	.	T	0.57242	0.2040	M	0.85542	2.76	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.64032	-0.6502	9	0.87932	D	0	-20.0009	11.4142	0.49943	0.0:0.9114:0.0:0.0886	.	411	Q86YH2	Z280B_HUMAN	I	411	ENSP00000385998:R411I;ENSP00000353586:R411I	ENSP00000353586:R411I	R	-	2	0	ZNF280B	21172492	1.000000	0.71417	0.981000	0.43875	0.534000	0.34807	6.799000	0.75160	1.410000	0.46936	0.655000	0.94253	AGA	.	.		0.398	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
CXorf40A	91966	hgsc.bcm.edu	37	X	148627336	148627336	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chrX:148627336C>T	ENST00000441248.1	+	3	1747	c.160C>T	c.(160-162)Cgg>Tgg	p.R54W	CXorf40A_ENST00000359293.5_Missense_Mutation_p.R54W|RP5-937E21.8_ENST00000431993.1_RNA|CXorf40A_ENST00000434353.2_Missense_Mutation_p.R54W|CXorf40A_ENST00000428236.1_5'UTR|CXorf40A_ENST00000422892.2_Missense_Mutation_p.R54W|CXorf40A_ENST00000423540.2_Missense_Mutation_p.R54W|CXorf40A_ENST00000423421.1_Missense_Mutation_p.R54W|CXorf40A_ENST00000514208.1_Missense_Mutation_p.R54W|CXorf40A_ENST00000450602.2_Missense_Mutation_p.R54W|CXorf40A_ENST00000393985.3_Missense_Mutation_p.R54W			Q8TE69	CX04A_HUMAN	chromosome X open reading frame 40A	54										breast(1)|endometrium(3)|large_intestine(1)|lung(2)	7	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					CGATGCCTGGCGGGAGCTGCT	0.597																																					p.R54W		Atlas-SNP	.											.	CXorf40A	15	.	0			c.C160T						.						87.0	58.0	68.0					X																	148627336		2203	4299	6502	SO:0001583	missense	91966	exon4			GCCTGGCGGGAGC	AF011889	CCDS14687.1, CCDS55522.1	Xq28	2010-03-16	2005-09-13	2005-09-13	ENSG00000197620	ENSG00000197620			28089	protein-coding gene	gene with protein product	"""endothelial-overexpressed lipopolysaccharide-associated factor 1"""		"""chromosome X open reading frame 40"""	CXorf40		8717057, 9147653, 16383041	Standard	XM_005278212		Approved	EOLA1	uc004fdg.3	Q8TE69	OTTHUMG00000022622	ENST00000441248.1:c.160C>T	chrX.hg19:g.148627336C>T	ENSP00000423099:p.Arg54Trp	232.0	0.0		274.0	234.0	NM_178124	A8K784|B7Z6H6|B7ZL96|D6RA72|E7ENU3|Q2M3E9	Missense_Mutation	SNP	ENST00000441248.1	hg19	CCDS14687.1	.	.	.	.	.	.	.	.	.	.	C	5.916	0.353153	0.11182	.	.	ENSG00000197620	ENST00000450602;ENST00000441248;ENST00000393985;ENST00000423421;ENST00000423540;ENST00000434353;ENST00000514208;ENST00000422892;ENST00000359293	D;D;D;D;D;D;D;D;D	0.92348	-3.02;-3.02;-3.02;-3.02;-3.02;-3.02;-3.02;-3.02;-3.02	3.71	-5.12	0.02893	PUA-like domain (1);	0.670247	0.14108	N	0.340893	D	0.84938	0.5583	L	0.46157	1.445	0.19300	N	0.999975	B;B;B	0.15141	0.012;0.012;0.001	B;B;B	0.12837	0.008;0.008;0.001	T	0.71487	-0.4578	10	0.54805	T	0.06	.	6.1611	0.20364	0.516:0.2898:0.0:0.1942	.	54;54;54	Q8TE69;E7ENU3;D6RA72	CX04A_HUMAN;.;.	W	54	ENSP00000427540:R54W;ENSP00000423099:R54W;ENSP00000421745:R54W;ENSP00000422512:R54W;ENSP00000425520:R54W;ENSP00000423160:R54W;ENSP00000423708:R54W;ENSP00000422312:R54W;ENSP00000420882:R54W	ENSP00000420882:R54W	R	+	1	2	CXorf40A	148435241	0.004000	0.15560	0.001000	0.08648	0.005000	0.04900	0.006000	0.13152	-0.959000	0.03618	0.455000	0.32223	CGG	.	.		0.597	CXorf40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058699.3	NM_178124	
IRS1	3667	hgsc.bcm.edu	37	2	227661977	227661994	+	In_Frame_Del	DEL	CGGTGGCCATTGCCACCC	CGGTGGCCATTGCCACCC	-			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	CGGTGGCCATTGCCACCC	CGGTGGCCATTGCCACCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr2:227661977_227661994delCGGTGGCCATTGCCACCC	ENST00000305123.5	-	1	2481_2498	c.1461_1478delGGGTGGCAATGGCCACCG	c.(1459-1479)cggggtggcaatggccaccgc>cgc	p.487_493RGGNGHR>R	IRS1_ENST00000498335.1_5'Flank|RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	487					cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		TGGGGTGCAGCGGTGGCCATTGCCACCCCGAGACAAAA	0.606											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.488_493del		Atlas-INDEL	.											.	IRS1	141	.	0			c.1462_1479del						.																																			SO:0001651	inframe_deletion	3667	exon1			.		CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.1461_1478delGGGTGGCAATGGCCACCG	chr2.hg19:g.227661977_227661994delCGGTGGCCATTGCCACCC	ENSP00000304895:p.Arg487_His492del	77.0	0.0	2321	71.0	19.0	NM_005544		In_Frame_Del	DEL	ENST00000305123.5	hg19	CCDS2463.1																																																																																			.	.		0.606	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256886.3	NM_005544	
PAQR8	85315	hgsc.bcm.edu	37	6	52268597	52268611	+	In_Frame_Del	DEL	TATGCCAAATATCGT	TATGCCAAATATCGT	-	rs17852802		TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	TATGCCAAATATCGT	TATGCCAAATATCGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr6:52268597_52268611delTATGCCAAATATCGT	ENST00000442253.2	+	2	760_774	c.586_600delTATGCCAAATATCGT	c.(586-600)tatgccaaatatcgtdel	p.YAKYR196del	PAQR8_ENST00000360726.3_In_Frame_Del_p.YAKYR196del	NM_133367.4	NP_588608.1	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member VIII	196					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			endometrium(1)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(2)	17	Lung NSC(77;0.0875)					TGGCTGTTGCTATGCCAAATATCGTTACCGGAGGC	0.53																																					p.195_200del		Atlas-INDEL	.											.	PAQR8	31	.	0			c.585_599del						.																																			SO:0001651	inframe_deletion	85315	exon2			.	AF347029	CCDS4941.1	6p12	2012-08-10	2005-05-20	2005-05-20	ENSG00000170915	ENSG00000170915			15708	protein-coding gene	gene with protein product		607780	"""chromosome 6 open reading frame 33"""	C6orf33		11676489, 12574519	Standard	NM_133367		Approved	LMPB1, MPRB	uc003pao.4	Q8TEZ7	OTTHUMG00000014846	ENST00000442253.2:c.586_600delTATGCCAAATATCGT	chr6.hg19:g.52268597_52268611delTATGCCAAATATCGT	ENSP00000406197:p.Tyr196_Arg200del	78.0	0.0		86.0	25.0	NM_133367	B2RCF6|Q86WL0|Q8N6D3|Q9HD02	In_Frame_Del	DEL	ENST00000442253.2	hg19	CCDS4941.1																																																																																			.	.		0.530	PAQR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040903.2	NM_133367	
ITGB3	3690	hgsc.bcm.edu	37	17	45367587	45367591	+	Frame_Shift_Del	DEL	GTTCT	GTTCT	-			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	GTTCT	GTTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr17:45367587_45367591delGTTCT	ENST00000559488.1	+	8	1088_1092	c.1072_1076delGTTCT	c.(1072-1077)gttctgfs	p.VL358fs	ITGB3_ENST00000571680.1_Frame_Shift_Del_p.VL358fs|ITGB3_ENST00000435993.2_Frame_Shift_Del_p.VL311fs|ITGB3_ENST00000560629.1_Frame_Shift_Del_p.GS346fs	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	358	VWFA.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	CACAGTTGGGGTTCTGTCCATGGAT	0.502																																					p.357_359del		Atlas-INDEL	.											.	ITGB3	157	.	0			c.1071_1075del						.																																			SO:0001589	frameshift_variant	3690	exon8			.		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.1072_1076delGTTCT	chr17.hg19:g.45367587_45367591delGTTCT	ENSP00000452786:p.Val358fs	68.0	0.0		59.0	29.0	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Frame_Shift_Del	DEL	ENST00000559488.1	hg19	CCDS11511.1																																																																																			.	.		0.502	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
SVEP1	79987	hgsc.bcm.edu	37	9	113137745	113137746	+	Splice_Site	INS	-	-	AAAAAA	rs386415855|rs71373993		TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr9:113137745_113137746insAAAAAA	ENST00000401783.2	-	46	10841		c.e46-2		SVEP1_ENST00000297826.5_Splice_Site|SVEP1_ENST00000374469.1_Splice_Site	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1						cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGCAGATTGCTaaaaaaaaaaa	0.46																																					.		Atlas-INDEL	.											.	SVEP1	326	.	0			c.10505-2->TTTTTT						.																																			SO:0001630	splice_region_variant	79987	exon47			.	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10505-2->TTTTTT	chr9.hg19:g.113137746_113137751dupAAAAAA		119.0	0.0		154.0	11.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Splice_Site	INS	ENST00000401783.2	hg19	CCDS48004.1																																																																																			.	.		0.460	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			Intron
NEFH	4744	hgsc.bcm.edu	37	22	29885591	29885592	+	In_Frame_Ins	INS	-	-	CCTGAGAAGGCCAAGTCC	rs200984527|rs267607533		TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr22:29885591_29885592insCCTGAGAAGGCCAAGTCC	ENST00000310624.6	+	4	1995_1996	c.1962_1963insCCTGAGAAGGCCAAGTCC	c.(1963-1965)cca>CCTGAGAAGGCCAAGTCCcca	p.655_655P>PEKAKSP		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	661	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGCCAAGTCCCCAGAGAAGGA	0.559																																					p.S654delinsSPEKAKS		Atlas-INDEL	.											.,2	NEFH	178	.	0			c.1962_1963insCCTGAGAAGGCCAAGTCC						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1945_1962dupCCTGAGAAGGCCAAGTCC	chr22.hg19:g.29885591_29885592insCCTGAGAAGGCCAAGTCC	ENSP00000311997:p.GluLysAlaLysSerPro655dup	217.0	0.0		256.0	126.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.559	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
A2M	2	hgsc.bcm.edu	37	12	9227372	9227384	+	Splice_Site	DEL	AGAGTTGTCTTAA	AGAGTTGTCTTAA	-			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	AGAGTTGTCTTAA	AGAGTTGTCTTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr12:9227372_9227384delAGAGTTGTCTTAA	ENST00000318602.7	-	29	3840_3847	c.3533_3540delTTAAGACAACTCT	c.(3532-3540)gttaagaca>g	p.VKT1178fs	A2M_ENST00000542567.1_5'Flank	NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	1178					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	CCCAATGGACAGAGTTGTCTTAAAGATGAGAAA	0.441																																					p.1178_1181del		Atlas-INDEL	.											.	A2M	180	.	0			c.3533_3541del						.																																			SO:0001630	splice_region_variant	2	exon29			.	BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.3533-1TTAAGACAACTCT>-	chr12.hg19:g.9227372_9227384delAGAGTTGTCTTAA		116.0	0.0		112.0	33.0	NM_000014	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	In_Frame_Del	DEL	ENST00000318602.7	hg19	CCDS44827.1																																																																																			.	.		0.441	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317233.2	NM_000014	Frame_Shift_Del
KCTD20	222658	hgsc.bcm.edu	37	6	36454696	36454698	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	CTG	CTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr6:36454696_36454698delCTG	ENST00000373731.2	+	8	1395_1397	c.1004_1006delCTG	c.(1003-1008)cctggc>cgc	p.335_336PG>R	KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000536244.1_In_Frame_Del_p.190_191PG>R|KCTD20_ENST00000449081.2_In_Frame_Del_p.169_170PG>R|KCTD20_ENST00000544295.1_In_Frame_Del_p.89_90PG>R	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	335					protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						AAGAGAAGGCCTGGCGGCCGGTC	0.448																																					p.335_335del		Atlas-INDEL	.											.	KCTD20	37	.	0			c.1003_1005del						.																																			SO:0001651	inframe_deletion	222658	exon8			.	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.1004_1006delCTG	chr6.hg19:g.36454696_36454698delCTG	ENSP00000362836:p.Pro335_Gly336delinsArg	95.0	0.0		88.0	25.0	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	In_Frame_Del	DEL	ENST00000373731.2	hg19	CCDS4821.1																																																																																			.	.		0.448	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
KCTD20	222658	hgsc.bcm.edu	37	6	36454686	36454694	+	In_Frame_Del	DEL	AAGAGAAGG	AAGAGAAGG	-	rs149081694		TCGA-DD-AAE1-01A-11D-A40R-10	TCGA-DD-AAE1-10A-01D-A40U-10	AAGAGAAGG	AAGAGAAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	55f49128-beb9-408f-8a1b-737659403573	9109a16c-3ae7-492e-8de3-bece8e8322d0	g.chr6:36454686_36454694delAAGAGAAGG	ENST00000373731.2	+	8	1385_1393	c.994_1002delAAGAGAAGG	c.(994-1002)aagagaaggdel	p.KRR332del	KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000536244.1_In_Frame_Del_p.KRR187del|KCTD20_ENST00000449081.2_In_Frame_Del_p.KRR166del|KCTD20_ENST00000544295.1_In_Frame_Del_p.KRR86del	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	332					protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						AGAAAAAATTAAGAGAAGGCCTGGCGGCC	0.445																																					p.331_334del		Atlas-INDEL	.											.	KCTD20	37	.	0			c.993_1001del						.																																			SO:0001651	inframe_deletion	222658	exon8			.	BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.994_1002delAAGAGAAGG	chr6.hg19:g.36454686_36454694delAAGAGAAGG	ENSP00000362836:p.Lys332_Arg334del	94.0	0.0		89.0	25.0	NM_173562	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	In_Frame_Del	DEL	ENST00000373731.2	hg19	CCDS4821.1																																																																																			.	.		0.445	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040345.2	NM_173562	
