#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CALML6	163688	hgsc.bcm.edu	37	1	1848609	1848609	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:1848609G>T	ENST00000307786.3	+	6	977	c.523G>T	c.(523-525)Gag>Tag	p.E175*		NM_138705.2	NP_619650.2	Q8TD86	CALL6_HUMAN	calmodulin-like 6	175	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|lung(1)|prostate(2)	7	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.94e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.83e-23)|GBM - Glioblastoma multiforme(42;3.23e-08)|Colorectal(212;3.98e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00437)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		GATGACGGGGGAGTCCTTCAA	0.701																																					p.E175X		Atlas-SNP	.											.	CALML6	18	.	0			c.G523T						.						30.0	29.0	30.0					1																	1848609		2192	4295	6487	SO:0001587	stop_gained	163688	exon6			ACGGGGGAGTCCT	AF490905	CCDS30566.1	1p36.33	2013-01-10			ENSG00000169885	ENSG00000169885		"""EF-hand domain containing"""	24193	protein-coding gene	gene with protein product		610171					Standard	NM_138705		Approved	CAGLP	uc001aih.1	Q8TD86	OTTHUMG00000000943	ENST00000307786.3:c.523G>T	chr1.hg19:g.1848609G>T	ENSP00000304643:p.Glu175*	89.0	0.0		82.0	35.0	NM_138705	A2A2M3|Q6Q2C4	Nonsense_Mutation	SNP	ENST00000307786.3	hg19	CCDS30566.1	.	.	.	.	.	.	.	.	.	.	.	14.20	2.465376	0.43839	.	.	ENSG00000169885	ENST00000307786;ENST00000378604	.	.	.	3.43	1.52	0.23074	.	.	.	.	.	.	.	.	.	.	.	0.40228	D	0.977814	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.5098	0.16874	0.2675:0.0:0.7325:0.0	.	.	.	.	X	175;158	.	ENSP00000304643:E175X	E	+	1	0	CALML6	1838469	1.000000	0.71417	0.928000	0.36995	0.174000	0.22865	1.203000	0.32284	0.278000	0.22164	0.313000	0.20887	GAG	.	.		0.701	CALML6-004	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276929.1	NM_138705	
KIF1B	23095	hgsc.bcm.edu	37	1	10316355	10316355	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:10316355G>A	ENST00000377086.1	+	3	359	c.157G>A	c.(157-159)Gac>Aac	p.D53N	KIF1B_ENST00000377081.1_Missense_Mutation_p.D53N|KIF1B_ENST00000263934.6_Missense_Mutation_p.D53N|KIF1B_ENST00000377083.1_Missense_Mutation_p.D53N|KIF1B_ENST00000377093.4_Missense_Mutation_p.D53N			O60333	KIF1B_HUMAN	kinesin family member 1B	53	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTTCAGCTTCGACTATTCCTA	0.413																																					p.D53N		Atlas-SNP	.											.	KIF1B	242	.	0			c.G157A						.						121.0	106.0	111.0					1																	10316355		2203	4300	6503	SO:0001583	missense	23095	exon3			AGCTTCGACTATT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.157G>A	chr1.hg19:g.10316355G>A	ENSP00000366290:p.Asp53Asn	50.0	0.0		64.0	9.0	NM_183416	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	hg19		.	.	.	.	.	.	.	.	.	.	G	36	5.675438	0.96764	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63	5.31	5.31	0.75309	Kinesin, motor domain (4);	0.000000	0.85682	D	0.000000	D	0.93517	0.7931	M	0.92555	3.32	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.999;0.995;0.998;0.987;0.984;0.993	D	0.94668	0.7854	10	0.87932	D	0	.	19.3421	0.94347	0.0:0.0:1.0:0.0	.	53;53;53;53;53;53;53	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	N	53	ENSP00000263934:D53N;ENSP00000366297:D53N;ENSP00000366290:D53N;ENSP00000366287:D53N;ENSP00000366284:D53N	ENSP00000263934:D53N	D	+	1	0	KIF1B	10238942	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.642000	0.89623	0.650000	0.86243	GAC	.	.		0.413	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
FAM46B	115572	hgsc.bcm.edu	37	1	27333377	27333377	+	Silent	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:27333377G>A	ENST00000289166.5	-	2	501	c.336C>T	c.(334-336)agC>agT	p.S112S		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	112										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		GCAGCACGTGGCTGGCAGCTG	0.632																																					p.S112S		Atlas-SNP	.											.	FAM46B	44	.	0			c.C336T						.						79.0	68.0	72.0					1																	27333377		2203	4300	6503	SO:0001819	synonymous_variant	115572	exon2			CACGTGGCTGGCA	AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.336C>T	chr1.hg19:g.27333377G>A		84.0	0.0		112.0	51.0	NM_052943		Silent	SNP	ENST00000289166.5	hg19	CCDS294.2																																																																																			.	.		0.632	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012347.2	NM_052943	
EIF2B3	8891	hgsc.bcm.edu	37	1	45345676	45345676	+	Silent	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:45345676G>A	ENST00000360403.2	-	8	915	c.789C>T	c.(787-789)atC>atT	p.I263I	EIF2B3_ENST00000372183.3_Silent_p.I263I	NM_001261418.1|NM_020365.4	NP_001248347.1|NP_065098.1	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa	263					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|positive regulation of GTPase activity (GO:0043547)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	guanyl-nucleotide exchange factor activity (GO:0005085)|nucleotidyltransferase activity (GO:0016779)|translation initiation factor activity (GO:0003743)			endometrium(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)	17	Acute lymphoblastic leukemia(166;0.155)					TAAAACTGTAGATATCTTCAG	0.408																																					p.I263I	Colon(26;357 658 2581 11857 12657)	Atlas-SNP	.											.	EIF2B3	43	.	0			c.C789T						.						51.0	52.0	52.0					1																	45345676		2203	4300	6503	SO:0001819	synonymous_variant	8891	exon8			ACTGTAGATATCT	AF257077	CCDS517.1, CCDS53313.1, CCDS72775.1	1p34.1	2008-02-05	2002-08-29		ENSG00000070785	ENSG00000070785			3259	protein-coding gene	gene with protein product		606273	"""eukaryotic translation initiation factor 2B, subunit 3 (gamma, 58kD)"""			10900014	Standard	NM_020365		Approved	EIF2Bgamma, EIF-2B	uc001cmt.3	Q9NR50	OTTHUMG00000008585	ENST00000360403.2:c.789C>T	chr1.hg19:g.45345676G>A		117.0	0.0		124.0	49.0	NM_020365	B2RBH8|D3DPZ2|Q5QP89|Q5QP90|Q8NDB5|Q8WV57|Q9H850	Silent	SNP	ENST00000360403.2	hg19	CCDS517.1	.	.	.	.	.	.	.	.	.	.	G	7.460	0.644566	0.14451	.	.	ENSG00000070785	ENST00000439363	.	.	.	5.56	4.44	0.53790	.	.	.	.	.	T	0.59335	0.2186	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55648	-0.8108	4	.	.	.	-10.0142	8.6969	0.34301	0.8526:0.0:0.1474:0.0	.	.	.	.	F	84	.	.	S	-	2	0	EIF2B3	45118263	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	1.204000	0.32296	0.950000	0.37743	-0.361000	0.07541	TCT	.	.		0.408	EIF2B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023724.1	NM_020365	
COL11A1	1301	hgsc.bcm.edu	37	1	103496781	103496781	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:103496781A>G	ENST00000370096.3	-	5	983	c.671T>C	c.(670-672)tTg>tCg	p.L224S	COL11A1_ENST00000358392.2_Missense_Mutation_p.L224S|COL11A1_ENST00000512756.1_Missense_Mutation_p.L224S|COL11A1_ENST00000353414.4_Missense_Mutation_p.L224S	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	224	Laminin G-like.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ACCTGTGATCAAAAACTGCTG	0.423																																					p.L224S		Atlas-SNP	.											.,2	COL11A1	972	.	0			c.T671C						.						71.0	65.0	67.0					1																	103496781		2203	4300	6503	SO:0001583	missense	1301	exon5			GTGATCAAAAACT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.671T>C	chr1.hg19:g.103496781A>G	ENSP00000359114:p.Leu224Ser	46.0	0.0		25.0	7.0	NM_001854	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	A	18.40	3.615497	0.66672	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239;ENST00000447608	T;T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08;-1.08	5.59	5.59	0.84812	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);Laminin G, thrombospondin-type, N-terminal (1);Laminin G, subdomain 2 (1);	0.000000	0.64402	D	0.000003	D	0.88358	0.6415	M	0.90145	3.09	0.58432	D	0.999994	D;D;D;D	0.89917	0.997;0.999;1.0;0.999	D;D;D;D	0.87578	0.995;0.996;0.997;0.998	D	0.90023	0.4129	10	0.52906	T	0.07	.	15.7618	0.78087	1.0:0.0:0.0:0.0	.	224;224;224;224	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	S	224;224;224;224;224;151	ENSP00000359114:L224S;ENSP00000351163:L224S;ENSP00000302551:L224S;ENSP00000426533:L224S;ENSP00000408640:L224S;ENSP00000410177:L151S	ENSP00000302551:L224S	L	-	2	0	COL11A1	103269369	1.000000	0.71417	0.976000	0.42696	0.996000	0.88848	8.820000	0.92003	2.125000	0.65367	0.450000	0.29827	TTG	.	.		0.423	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
CRB1	23418	hgsc.bcm.edu	37	1	197313448	197313448	+	Silent	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:197313448C>T	ENST00000367400.3	+	3	825	c.690C>T	c.(688-690)tcC>tcT	p.S230S	CRB1_ENST00000538660.1_Silent_p.S230S|CRB1_ENST00000367399.2_Intron|CRB1_ENST00000535699.1_Silent_p.S161S|CRB1_ENST00000543483.1_5'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	230	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						AATGTTGGTCCCAGCCTTGTT	0.423																																					p.S230S		Atlas-SNP	.											.	CRB1	284	.	0			c.C690T						.						221.0	217.0	219.0					1																	197313448		2203	4300	6503	SO:0001819	synonymous_variant	23418	exon3			TTGGTCCCAGCCT		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.690C>T	chr1.hg19:g.197313448C>T		126.0	0.0		80.0	52.0	NM_001257966	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Silent	SNP	ENST00000367400.3	hg19	CCDS1390.1																																																																																			.	.		0.423	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
WNT9A	7483	hgsc.bcm.edu	37	1	228111870	228111870	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:228111870A>C	ENST00000272164.5	-	3	594	c.584T>G	c.(583-585)gTg>gGg	p.V195G		NM_003395.2	NP_003386.1	O14904	WNT9A_HUMAN	wingless-type MMTV integration site family, member 9A	195					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cornea development in camera-type eye (GO:0061303)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal system morphogenesis (GO:0048704)|iris morphogenesis (GO:0061072)|mitotic cell cycle checkpoint (GO:0007093)|multicellular organismal development (GO:0007275)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of smoothened signaling pathway (GO:0045880)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Prostate(94;0.0405)				GTGGAAGTCCACACGGGCTCG	0.627																																					p.V195G		Atlas-SNP	.											.	WNT9A	39	.	0			c.T584G						.						77.0	71.0	73.0					1																	228111870		2203	4300	6503	SO:0001583	missense	7483	exon3			AAGTCCACACGGG	AB060283	CCDS31045.1	1q42	2008-02-05	2003-03-11	2003-03-14	ENSG00000143816	ENSG00000143816		"""Wingless-type MMTV integration sites"""	12778	protein-coding gene	gene with protein product		602863	"""wingless-type MMTV integration site family, member 14"""	WNT14		9441749	Standard	NM_003395		Approved		uc001hri.2	O14904	OTTHUMG00000037592	ENST00000272164.5:c.584T>G	chr1.hg19:g.228111870A>C	ENSP00000272164:p.Val195Gly	185.0	0.0		197.0	73.0	NM_003395	A6NLW2|Q2M2J3|Q5VWU0|Q96S50	Missense_Mutation	SNP	ENST00000272164.5	hg19	CCDS31045.1	.	.	.	.	.	.	.	.	.	.	A	17.22	3.333593	0.60853	.	.	ENSG00000143816	ENST00000272164	T	0.78246	-1.16	4.78	4.78	0.61160	.	0.069953	0.64402	D	0.000020	T	0.78233	0.4251	M	0.74546	2.27	0.80722	D	1	B	0.13145	0.007	B	0.23574	0.047	T	0.77621	-0.2519	10	0.87932	D	0	.	13.503	0.61469	1.0:0.0:0.0:0.0	.	195	O14904	WNT9A_HUMAN	G	195	ENSP00000272164:V195G	ENSP00000272164:V195G	V	-	2	0	WNT9A	226178493	1.000000	0.71417	0.990000	0.47175	0.955000	0.61496	9.194000	0.94962	1.782000	0.52362	0.402000	0.26972	GTG	.	.		0.627	WNT9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091646.1	NM_003395	
FMN2	56776	hgsc.bcm.edu	37	1	240256917	240256917	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:240256917T>A	ENST00000319653.9	+	1	1738	c.1508T>A	c.(1507-1509)cTg>cAg	p.L503Q		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	503					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCGCACCTGCTGGAGCGCGGG	0.771																																					p.L503Q		Atlas-SNP	.											.	FMN2	451	.	0			c.T1508A						.						3.0	4.0	4.0					1																	240256917		1646	3506	5152	SO:0001583	missense	56776	exon1			ACCTGCTGGAGCG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.1508T>A	chr1.hg19:g.240256917T>A	ENSP00000318884:p.Leu503Gln	41.0	0.0		39.0	4.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	T	11.30	1.598778	0.28445	.	.	ENSG00000155816	ENST00000319653	D	0.81579	-1.51	4.72	1.1	0.20463	.	0.489196	0.16737	N	0.201597	T	0.79191	0.4404	L	0.29908	0.895	0.80722	D	1	D	0.64830	0.994	P	0.60173	0.87	T	0.75476	-0.3304	10	0.62326	D	0.03	.	8.7195	0.34432	0.0:0.2224:0.0:0.7776	.	503	Q9NZ56	FMN2_HUMAN	Q	503	ENSP00000318884:L503Q	ENSP00000318884:L503Q	L	+	2	0	FMN2	238323540	1.000000	0.71417	0.450000	0.26969	0.831000	0.47069	3.614000	0.54160	0.017000	0.15025	-0.371000	0.07208	CTG	.	.		0.771	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
FMN2	56776	hgsc.bcm.edu	37	1	240371332	240371332	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:240371332A>T	ENST00000319653.9	+	5	3450	c.3220A>T	c.(3220-3222)Ata>Tta	p.I1074L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1074	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CGGAGCGGGCATACCCCCTCC	0.726																																					p.I1074L		Atlas-SNP	.											.	FMN2	451	.	0			c.A3220T						.						2.0	3.0	3.0					1																	240371332		1343	2760	4103	SO:0001583	missense	56776	exon5			GCGGGCATACCCC	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3220A>T	chr1.hg19:g.240371332A>T	ENSP00000318884:p.Ile1074Leu	122.0	0.0		143.0	28.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	a	8.983	0.975887	0.18736	.	.	ENSG00000155816	ENST00000319653	T	0.60040	0.22	3.04	-2.66	0.06077	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (2);	0.499468	0.18421	N	0.141758	T	0.47192	0.1432	M	0.82056	2.57	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.39563	-0.9608	9	.	.	.	.	1.0252	0.01526	0.3297:0.2818:0.2496:0.1389	.	1074	Q9NZ56	FMN2_HUMAN	L	1074	ENSP00000318884:I1074L	.	I	+	1	0	FMN2	238437955	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.084000	0.14891	-0.417000	0.07461	0.397000	0.26171	ATA	.	.		0.726	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
MYT1L	23040	hgsc.bcm.edu	37	2	1893081	1893081	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr2:1893081C>A	ENST00000399161.2	-	16	3199	c.2452G>T	c.(2452-2454)Gac>Tac	p.D818Y	MYT1L_ENST00000428368.2_Missense_Mutation_p.D816Y	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	818					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ACGGGCAAGTCCCAGCAGTCG	0.567																																					p.D816Y		Atlas-SNP	.											.	MYT1L	241	.	0			c.G2446T						.						82.0	87.0	86.0					2																	1893081		2013	4156	6169	SO:0001583	missense	23040	exon16			GCAAGTCCCAGCA	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.2452G>T	chr2.hg19:g.1893081C>A	ENSP00000382114:p.Asp818Tyr	55.0	0.0		52.0	23.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	c	21.1	4.100877	0.76983	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.54479	0.57;0.57	4.77	3.88	0.44766	Myelin transcription factor 1 (1);	0.090356	0.85682	D	0.000000	T	0.70465	0.3227	M	0.76574	2.34	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.68943	0.961;0.912	T	0.74708	-0.3574	10	0.62326	D	0.03	-25.9023	14.7817	0.69772	0.0:0.8543:0.1457:0.0	.	818;816	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	Y	818;764;816	ENSP00000382114:D818Y;ENSP00000396103:D816Y	ENSP00000295067:D764Y	D	-	1	0	MYT1L	1872088	1.000000	0.71417	0.995000	0.50966	0.943000	0.58893	7.713000	0.84693	1.113000	0.41760	-0.290000	0.09829	GAC	.	.		0.567	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
SCN5A	6331	hgsc.bcm.edu	37	3	38651412	38651412	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr3:38651412C>G	ENST00000333535.4	-	7	896	c.747G>C	c.(745-747)aaG>aaC	p.K249N	SCN5A_ENST00000425664.1_Missense_Mutation_p.K249N|SCN5A_ENST00000443581.1_Missense_Mutation_p.K249N|SCN5A_ENST00000455624.2_Missense_Mutation_p.K249N|SCN5A_ENST00000423572.2_Missense_Mutation_p.K249N|SCN5A_ENST00000414099.2_Missense_Mutation_p.K249N|SCN5A_ENST00000450102.2_Missense_Mutation_p.K249N|SCN5A_ENST00000413689.1_Missense_Mutation_p.K249N|SCN5A_ENST00000451551.2_Missense_Mutation_p.K249N|SCN5A_ENST00000449557.2_Missense_Mutation_p.K249N			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	249					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CATCAGCCAGCTTCTTCACAG	0.602																																					p.K249N		Atlas-SNP	.											.	SCN5A	634	.	0			c.G747C						.						85.0	92.0	89.0					3																	38651412		2185	4290	6475	SO:0001583	missense	6331	exon7			AGCCAGCTTCTTC	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.747G>C	chr3.hg19:g.38651412C>G	ENSP00000328968:p.Lys249Asn	144.0	0.0		139.0	40.0	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	hg19	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527921	0.64860	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557;ENST00000399254	D;D;D;D;D;D;D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01;-5.01	5.34	3.53	0.40419	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97688	0.9242	L	0.46741	1.465	0.41869	D	0.990269	D;D;D;D;D;D;D	0.89917	0.998;1.0;1.0;0.999;0.998;1.0;0.999	D;D;D;D;D;D;D	0.91635	0.947;0.996;0.998;0.947;0.947;0.999;0.913	D	0.95788	0.8822	10	0.33141	T	0.24	.	6.4426	0.21859	0.0:0.6098:0.0:0.3902	.	249;249;249;249;249;249;249	E9PEF3;Q14524-3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	N	249;249;249;249;249;249;249;249;249;249;59	ENSP00000398962:K249N;ENSP00000398266:K249N;ENSP00000410257:K249N;ENSP00000388797:K249N;ENSP00000397915:K249N;ENSP00000416634:K249N;ENSP00000328968:K249N;ENSP00000399524:K249N;ENSP00000403355:K249N;ENSP00000413996:K249N	ENSP00000328968:K249N	K	-	3	2	SCN5A	38626416	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.458000	0.21892	0.800000	0.34041	0.655000	0.94253	AAG	.	.		0.602	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
MCM2	4171	hgsc.bcm.edu	37	3	127338035	127338035	+	Missense_Mutation	SNP	G	G	T	rs2307313	byFrequency	TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr3:127338035G>T	ENST00000265056.7	+	13	2423	c.2179G>T	c.(2179-2181)Gcc>Tcc	p.A727S	MCM2_ENST00000468414.1_3'UTR	NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	727			A -> T (in dbSNP:rs2307313). {ECO:0000269|PubMed:15489334, ECO:0000269|Ref.3}.		cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						CATCATCTACGCCAAGGAGAG	0.602																																					p.A727S		Atlas-SNP	.											.	MCM2	79	.	0			c.G2179T						.						105.0	83.0	90.0					3																	127338035		2203	4300	6503	SO:0001583	missense	4171	exon13			ATCTACGCCAAGG	X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.2179G>T	chr3.hg19:g.127338035G>T	ENSP00000265056:p.Ala727Ser	168.0	0.0		168.0	74.0	NM_004526	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	ENST00000265056.7	hg19	CCDS3043.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.110380	0.77210	.	.	ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142	T	0.10099	2.91	5.61	5.61	0.85477	.	0.048197	0.85682	D	0.000000	T	0.23572	0.0570	M	0.79123	2.44	0.80722	D	1	B;B;P	0.34684	0.347;0.272;0.463	B;B;B	0.43331	0.074;0.416;0.372	T	0.00662	-1.1621	10	0.54805	T	0.06	-35.0091	14.4675	0.67494	0.0:0.0:0.8529:0.1471	.	777;597;727	F5H1E9;B4DSV5;P49736	.;.;MCM2_HUMAN	S	727;631;777	ENSP00000265056:A727S	ENSP00000265056:A727S	A	+	1	0	MCM2	128820725	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.327000	0.79147	2.640000	0.89533	0.591000	0.81541	GCC	.	G|0.994;A|0.006		0.602	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356612.1		
PRR23A	729627	hgsc.bcm.edu	37	3	138724398	138724398	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr3:138724398G>A	ENST00000383163.2	-	1	712	c.713C>T	c.(712-714)cCg>cTg	p.P238L	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	238	Pro-rich.									endometrium(3)|kidney(1)|lung(7)	11						CCCCACGCGCGGAGAGGGAGG	0.657																																					p.P238L		Atlas-SNP	.											.	PRR23A	35	.	0			c.C713T						.						22.0	24.0	24.0					3																	138724398		692	1591	2283	SO:0001583	missense	729627	exon1			ACGCGCGGAGAGG		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.713C>T	chr3.hg19:g.138724398G>A	ENSP00000372649:p.Pro238Leu	158.0	0.0		191.0	11.0	NM_001134659		Missense_Mutation	SNP	ENST00000383163.2	hg19	CCDS46923.1	.	.	.	.	.	.	.	.	.	.	G	11.81	1.749066	0.30955	.	.	ENSG00000206260	ENST00000383163	.	.	.	3.23	2.35	0.29111	.	0.000000	0.41823	D	0.000820	T	0.36552	0.0971	M	0.68593	2.085	0.09310	N	1	P	0.52061	0.95	P	0.45946	0.498	T	0.23368	-1.0190	9	0.54805	T	0.06	.	6.4995	0.22160	0.1346:0.0:0.8654:0.0	.	238	A6NEV1	PR23A_HUMAN	L	238	.	ENSP00000372649:P238L	P	-	2	0	PRR23A	140207088	0.246000	0.23909	0.008000	0.14137	0.002000	0.02628	1.117000	0.31234	0.943000	0.37553	0.591000	0.81541	CCG	.	.		0.657	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	
GYG1	2992	hgsc.bcm.edu	37	3	148714621	148714621	+	Silent	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr3:148714621C>T	ENST00000345003.4	+	4	711	c.411C>T	c.(409-411)ttC>ttT	p.F137F	GYG1_ENST00000483267.1_Silent_p.F137F|GYG1_ENST00000484197.1_Silent_p.F137F|GYG1_ENST00000296048.6_Silent_p.F137F	NM_004130.3	NP_004121.2	P46976	GLYG_HUMAN	glycogenin 1	137					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogenin glucosyltransferase activity (GO:0008466)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			CCGGAGTCTTCGTTTATCAGC	0.418																																					p.F137F		Atlas-SNP	.											.	GYG1	29	.	0			c.C411T						.						80.0	76.0	77.0					3																	148714621		2203	4300	6503	SO:0001819	synonymous_variant	2992	exon4			AGTCTTCGTTTAT	AF087942	CCDS3139.1, CCDS54654.1, CCDS54655.1	3q24-q25.1	2013-02-22	2005-11-04	2005-11-04	ENSG00000163754	ENSG00000163754	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4699	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	603942	"""glycogenin"""	GYG		8602861	Standard	NM_004130		Approved		uc003ewn.3	P46976	OTTHUMG00000159533	ENST00000345003.4:c.411C>T	chr3.hg19:g.148714621C>T		69.0	0.0		83.0	5.0	NM_004130	D3DNH0|D3DNH1|D3DNH2|Q6FHZ1|Q9UNV0	Silent	SNP	ENST00000345003.4	hg19	CCDS3139.1																																																																																			.	.		0.418	GYG1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000356046.1	NM_004130	
IGSF10	285313	hgsc.bcm.edu	37	3	151161667	151161667	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr3:151161667C>T	ENST00000282466.3	-	5	5067	c.5068G>A	c.(5068-5070)Gat>Aat	p.D1690N		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	1690	Ig-like C2-type 3.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)		p.D1690H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTAGATAAATCAAGTCCTGAG	0.398																																					p.D1690N		Atlas-SNP	.											IGSF10,NS,carcinoma,0,1	IGSF10	279	.	1	Substitution - Missense(1)	prostate(1)	c.G5068A						.						34.0	33.0	33.0					3																	151161667		2203	4300	6503	SO:0001583	missense	285313	exon5			ATAAATCAAGTCC	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.5068G>A	chr3.hg19:g.151161667C>T	ENSP00000282466:p.Asp1690Asn	93.0	0.0		104.0	34.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	hg19	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768630	0.49680	.	.	ENSG00000152580	ENST00000282466;ENST00000544042	T	0.68181	-0.31	5.25	4.36	0.52297	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.654694	0.13322	N	0.396619	T	0.54351	0.1853	N	0.14661	0.345	0.09310	N	1	P	0.41080	0.737	P	0.45971	0.499	T	0.41893	-0.9483	9	.	.	.	.	10.4078	0.44274	0.0:0.9077:0.0:0.0923	.	1690	Q6WRI0	IGS10_HUMAN	N	1690;317	ENSP00000282466:D1690N	.	D	-	1	0	IGSF10	152644357	0.073000	0.21202	0.980000	0.43619	0.967000	0.64934	1.982000	0.40638	2.458000	0.83093	0.585000	0.79938	GAT	.	.		0.398	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
CC2D2A	57545	hgsc.bcm.edu	37	4	15482406	15482406	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr4:15482406C>G	ENST00000503292.1	+	5	382	c.202C>G	c.(202-204)Ccc>Gcc	p.P68A	CC2D2A_ENST00000438599.2_Missense_Mutation_p.A103G|CC2D2A_ENST00000511544.1_Missense_Mutation_p.A103G|CC2D2A_ENST00000507954.1_Missense_Mutation_p.P68A|CC2D2A_ENST00000413206.1_Missense_Mutation_p.P68A|CC2D2A_ENST00000424120.1_Missense_Mutation_p.P68A|CC2D2A_ENST00000503658.1_Missense_Mutation_p.A103G|CC2D2A_ENST00000389652.5_Missense_Mutation_p.P19A|CC2D2A_ENST00000515124.1_Missense_Mutation_p.P68A|CC2D2A_ENST00000513811.1_3'UTR	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	68					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						GCAGGAGGAGCCCAAGACCCG	0.572																																					p.A103G		Atlas-SNP	.											.	CC2D2A	158	.	0			c.C308G						.						30.0	33.0	32.0					4																	15482406		1900	4107	6007	SO:0001583	missense	57545	exon6			GAGGAGCCCAAGA	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.202C>G	chr4.hg19:g.15482406C>G	ENSP00000421809:p.Pro68Ala	292.0	0.0		347.0	119.0	NM_020785	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Missense_Mutation	SNP	ENST00000503292.1	hg19	CCDS47026.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.615|9.615	1.132257|1.132257	0.21041|0.21041	.|.	.|.	ENSG00000048342|ENSG00000048342	ENST00000438599;ENST00000511544;ENST00000503658|ENST00000424120;ENST00000413206;ENST00000426932;ENST00000510333;ENST00000512702;ENST00000507954;ENST00000515124;ENST00000503292;ENST00000389652	T;T;T|T;T;T;T;T;T;T	0.67865|0.21734	-0.29;-0.29;-0.29|1.99;1.99;1.99;1.99;1.99;1.99;1.99	4.66|4.66	0.838|0.838	0.18902|0.18902	.|.	.|0.389572	.|0.19244	.|N	.|0.119086	T|T	0.14570|0.14570	0.0352|0.0352	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	P;P|B;B;P;P	0.46512|0.46912	0.879;0.782|0.0;0.03;0.573;0.886	B;B|B;B;B;B	0.42738|0.42555	0.396;0.199|0.001;0.015;0.272;0.391	T|T	0.11299|0.11299	-1.0593|-1.0593	9|10	0.87932|0.49607	D|T	0|0.09	.|.	6.5476|6.5476	0.22414|0.22414	0.0:0.5676:0.0:0.4324|0.0:0.5676:0.0:0.4324	.|.	64;103|68;19;68;68	Q8WVL8;E7EP21|Q9P2K1;Q9P2K1-2;C9JKY6;D6RB72	.;.|C2D2A_HUMAN;.;.;.	G|A	103|68;68;19;19;68;68;68;68;19	ENSP00000401154:A103G;ENSP00000426109:A103G;ENSP00000426846:A103G|ENSP00000403465:P68A;ENSP00000398391:P68A;ENSP00000422875:P68A;ENSP00000427221:P68A;ENSP00000424368:P68A;ENSP00000421809:P68A;ENSP00000374303:P19A	ENSP00000401154:A103G|ENSP00000374303:P19A	A|P	+|+	2|1	0|0	CC2D2A|CC2D2A	15091504|15091504	0.001000|0.001000	0.12720|0.12720	0.004000|0.004000	0.12327|0.12327	0.047000|0.047000	0.14425|0.14425	-0.031000|-0.031000	0.12287|0.12287	0.246000|0.246000	0.21394|0.21394	-0.254000|-0.254000	0.11334|0.11334	GCC|CCC	.	.		0.572	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
TBC1D1	23216	hgsc.bcm.edu	37	4	38055878	38055878	+	Missense_Mutation	SNP	C	C	T	rs140253816		TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr4:38055878C>T	ENST00000261439.4	+	12	2324	c.1969C>T	c.(1969-1971)Cgg>Tgg	p.R657W	TBC1D1_ENST00000508802.1_Missense_Mutation_p.R751W	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1	657					membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						TGTGAAGACCCGGAGGCATTC	0.488																																					p.R751W		Atlas-SNP	.											.	TBC1D1	94	.	0			c.C2251T						.	C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	106.0	117.0	113.0		1969	4.8	0.7	4	dbSNP_134	113	0,8600		0,0,4300	yes	missense	TBC1D1	NM_015173.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	657/1169	38055878	1,13005	2203	4300	6503	SO:0001583	missense	23216	exon14			AAGACCCGGAGGC	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.1969C>T	chr4.hg19:g.38055878C>T	ENSP00000261439:p.Arg657Trp	92.0	0.0		99.0	31.0	NM_001253912	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Missense_Mutation	SNP	ENST00000261439.4	hg19	CCDS33972.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.1|22.1	4.245743|4.245743	0.80024|0.80024	2.27E-4|2.27E-4	0.0|0.0	ENSG00000065882|ENSG00000065882	ENST00000510573|ENST00000508802;ENST00000261439;ENST00000446803;ENST00000421339	.|T;T;T;T	.|0.54675	.|3.28;0.56;0.56;0.56	5.64|5.64	4.77|4.77	0.60923|0.60923	.|.	.|0.000000	.|0.52532	.|D	.|0.000079	T|T	0.73737|0.73737	0.3625|0.3625	M|M	0.79926|0.79926	2.475|2.475	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.76575	.|0.978;0.964;0.988;0.978	T|T	0.78550|0.78550	-0.2161|-0.2161	5|10	.|0.87932	.|D	.|0	-26.7085|-26.7085	15.5654|15.5654	0.76287|0.76287	0.139:0.861:0.0:0.0|0.139:0.861:0.0:0.0	.|.	.|657;751;389;657	.|B9A6J6;E9PGH8;Q6PJJ8;Q86TI0	.|.;.;.;TBCD1_HUMAN	L|W	344|751;657;528;125	.|ENSP00000423651:R751W;ENSP00000261439:R657W;ENSP00000396877:R528W;ENSP00000410167:R125W	.|ENSP00000261439:R657W	P|R	+|+	2|1	0|2	TBC1D1|TBC1D1	37732273|37732273	0.955000|0.955000	0.32602|0.32602	0.735000|0.735000	0.30896|0.30896	0.786000|0.786000	0.44442|0.44442	5.556000|5.556000	0.67307|0.67307	1.312000|1.312000	0.45043|0.45043	0.655000|0.655000	0.94253|0.94253	CCG|CGG	.	C|1.000;G|0.000		0.488	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173	
ADAD1	132612	hgsc.bcm.edu	37	4	123301299	123301299	+	Silent	SNP	A	A	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr4:123301299A>T	ENST00000296513.2	+	3	260	c.75A>T	c.(73-75)ccA>ccT	p.P25P	ADAD1_ENST00000388725.2_Silent_p.P7P|ADAD1_ENST00000388724.2_Silent_p.P25P	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	25					multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						AGAACCTGCCAGTTCAACCAG	0.483																																					p.P25P		Atlas-SNP	.											.	ADAD1	94	.	0			c.A75T						.						91.0	76.0	81.0					4																	123301299		2203	4300	6503	SO:0001819	synonymous_variant	132612	exon3			CCTGCCAGTTCAA	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.75A>T	chr4.hg19:g.123301299A>T		186.0	0.0		197.0	83.0	NM_139243	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Silent	SNP	ENST00000296513.2	hg19	CCDS34058.1																																																																																			.	.		0.483	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	
ADAD1	132612	hgsc.bcm.edu	37	4	123305084	123305084	+	Silent	SNP	A	A	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr4:123305084A>G	ENST00000296513.2	+	5	677	c.492A>G	c.(490-492)caA>caG	p.Q164Q	ADAD1_ENST00000492454.1_3'UTR|ADAD1_ENST00000388725.2_Silent_p.Q146Q|ADAD1_ENST00000388724.2_Silent_p.Q164Q	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	164	DRBM. {ECO:0000255|PROSITE- ProRule:PRU00266}.				multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						AGCTTCTACAACTGGATGAAC	0.363																																					p.Q164Q		Atlas-SNP	.											.	ADAD1	94	.	0			c.A492G						.						90.0	89.0	89.0					4																	123305084		2203	4300	6503	SO:0001819	synonymous_variant	132612	exon5			TCTACAACTGGAT	AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.492A>G	chr4.hg19:g.123305084A>G		236.0	0.0		227.0	92.0	NM_139243	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Silent	SNP	ENST00000296513.2	hg19	CCDS34058.1																																																																																			.	.		0.363	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316452.1	NM_139243	
BBS12	166379	hgsc.bcm.edu	37	4	123663998	123663998	+	Silent	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr4:123663998T>A	ENST00000314218.3	+	2	1144	c.951T>A	c.(949-951)acT>acA	p.T317T	BBS12_ENST00000542236.1_Silent_p.T317T	NM_152618.2	NP_689831.2	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	317					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|eating behavior (GO:0042755)|intraciliary transport (GO:0042073)|negative regulation of fat cell differentiation (GO:0045599)|photoreceptor cell maintenance (GO:0045494)	cilium (GO:0005929)	ATP binding (GO:0005524)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|prostate(4)	21						GAATTTTCACTTGCTGTCTAC	0.378									Bardet-Biedl syndrome																												p.T317T		Atlas-SNP	.											.	BBS12	63	.	0			c.T951A						.						82.0	70.0	74.0					4																	123663998		2203	4300	6503	SO:0001819	synonymous_variant	166379	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TTTCACTTGCTGT	AK123553	CCDS3728.1	4q27	2014-06-17	2006-12-13	2006-12-13	ENSG00000181004	ENSG00000181004		"""Heat Shock Proteins / Chaperonins"""	26648	protein-coding gene	gene with protein product		610683	"""chromosome 4 open reading frame 24"""	C4orf24		17160889	Standard	NM_001178007		Approved	FLJ35630, FLJ41559	uc003ieu.3	Q6ZW61	OTTHUMG00000133070	ENST00000314218.3:c.951T>A	chr4.hg19:g.123663998T>A		152.0	0.0		159.0	57.0	NM_001178007	D3DNX5|Q7Z342|Q7Z482|Q8NAB8	Silent	SNP	ENST00000314218.3	hg19	CCDS3728.1																																																																																			.	.		0.378	BBS12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256710.1	NM_152618	
FAM198B	51313	hgsc.bcm.edu	37	4	159048727	159048727	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr4:159048727G>C	ENST00000296530.8	-	5	2013	c.1392C>G	c.(1390-1392)caC>caG	p.H464Q	FAM198B_ENST00000393807.5_Missense_Mutation_p.H472Q|FAM198B_ENST00000585682.1_Missense_Mutation_p.H464Q	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	464						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						TCTGCCGTAAGTGCTGGCTCT	0.373																																					p.H472Q		Atlas-SNP	.											.	FAM198B	134	.	0			c.C1416G						.						70.0	70.0	70.0					4																	159048727		2203	4300	6503	SO:0001583	missense	51313	exon6			CCGTAAGTGCTGG		CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.1392C>G	chr4.hg19:g.159048727G>C	ENSP00000296530:p.His464Gln	89.0	0.0		119.0	55.0	NM_001031700	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	ENST00000296530.8	hg19	CCDS3798.1	.	.	.	.	.	.	.	.	.	.	G	13.57	2.278114	0.40294	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807;ENST00000505460	T;T	0.28454	1.61;1.61	5.67	4.83	0.62350	.	0.162849	0.53938	D	0.000051	T	0.31827	0.0809	L	0.54323	1.7	0.80722	D	1	P;P	0.49090	0.919;0.839	P;P	0.49252	0.604;0.497	T	0.11275	-1.0594	10	0.25751	T	0.34	-11.4025	5.2163	0.15344	0.205:0.1663:0.6288:0.0	.	472;464	Q6UWH4-2;Q6UWH4	.;F198B_HUMAN	Q	464;464;472;170	ENSP00000296530:H464Q;ENSP00000377396:H472Q	ENSP00000296530:H464Q	H	-	3	2	FAM198B	159268177	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.760000	0.26475	1.423000	0.47198	0.650000	0.86243	CAC	.	.		0.373	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365230.1	NM_001031700, NM_016613	
GALNT7	51809	hgsc.bcm.edu	37	4	174223196	174223196	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr4:174223196A>T	ENST00000265000.4	+	7	1231		c.e7-1			NM_017423.2	NP_059119.2	Q86SF2	GALT7_HUMAN	polypeptide N-acetylgalactosaminyltransferase 7						carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|kidney(3)|large_intestine(5)|liver(1)|lung(9)	19		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;1.87e-18)|Epithelial(43;3.44e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-09)|STAD - Stomach adenocarcinoma(60;0.0019)|GBM - Glioblastoma multiforme(59;0.0119)|LUSC - Lung squamous cell carcinoma(193;0.0199)		TCTTTTTCTTAGGTCCCCAGC	0.438																																					.		Atlas-SNP	.											.	GALNT7	61	.	0			c.1149-2A>T						.						220.0	224.0	223.0					4																	174223196		2203	4300	6503	SO:0001630	splice_region_variant	51809	exon7			TTTCTTAGGTCCC	AJ002744	CCDS3815.1	4q31.1	2014-03-13	2014-03-13		ENSG00000109586	ENSG00000109586		"""Glycosyltransferase family 2 domain containing"""	4129	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 7"""	605005	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)"""			10544240	Standard	NM_017423		Approved	GALNAC-T7	uc003isz.4	Q86SF2	OTTHUMG00000160817	ENST00000265000.4:c.1149-1A>T	chr4.hg19:g.174223196A>T		89.0	0.0		104.0	38.0	NM_017423	B3KQU3|Q7Z5W7|Q9UJ28	Splice_Site	SNP	ENST00000265000.4	hg19	CCDS3815.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.489052	0.84962	.	.	ENSG00000109586	ENST00000265000;ENST00000505308;ENST00000458613	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4473	0.83942	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNT7	174459771	1.000000	0.71417	0.963000	0.40424	0.937000	0.57800	9.228000	0.95250	2.281000	0.76405	0.533000	0.62120	.	.	.		0.438	GALNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362456.2	NM_017423	Intron
MAST4	375449	hgsc.bcm.edu	37	5	66386029	66386029	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:66386029G>C	ENST00000403625.2	+	6	1098	c.803G>C	c.(802-804)aGt>aCt	p.S268T	MAST4_ENST00000405643.1_Missense_Mutation_p.S86T|MAST4_ENST00000261569.7_Missense_Mutation_p.S74T|MAST4_ENST00000490016.2_Missense_Mutation_p.S79T|MAST4_ENST00000404260.3_Missense_Mutation_p.S268T|MAST4_ENST00000403666.1_Missense_Mutation_p.S79T	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	268						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TTCTCCCCCAGTGCCTCAGCC	0.413																																					p.S268T		Atlas-SNP	.											.	MAST4	218	.	0			c.G803C						.						80.0	74.0	76.0					5																	66386029		1844	4094	5938	SO:0001583	missense	375449	exon6			CCCCCAGTGCCTC	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.803G>C	chr5.hg19:g.66386029G>C	ENSP00000385727:p.Ser268Thr	68.0	0.0		72.0	29.0	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	G	27.7	4.852748	0.91355	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000432426;ENST00000380908;ENST00000261569;ENST00000436277;ENST00000432399	T;T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45;1.45	5.82	5.82	0.92795	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.160309	0.38381	U	0.001702	T	0.62792	0.2457	M	0.85099	2.735	0.37734	D	0.925364	D;D;D;D;P	0.67145	0.987;0.996;0.984;0.984;0.542	D;D;P;D;P	0.72338	0.95;0.977;0.888;0.932;0.489	T	0.69101	-0.5234	10	0.66056	D	0.02	-3.6989	20.0958	0.97842	0.0:0.0:1.0:0.0	.	86;268;74;79;79	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	T	268;268;79;79;86;59;86;74;74;74	ENSP00000385048:S268T;ENSP00000385727:S268T;ENSP00000421739:S79T;ENSP00000384313:S79T;ENSP00000384099:S86T;ENSP00000261569:S74T;ENSP00000392478:S74T	ENSP00000261569:S74T	S	+	2	0	MAST4	66421785	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.274000	0.78538	2.759000	0.94783	0.637000	0.83480	AGT	.	.		0.413	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
TRPC7	57113	hgsc.bcm.edu	37	5	135693062	135693062	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:135693062C>G	ENST00000513104.1	-	2	296	c.14G>C	c.(13-15)aGc>aCc	p.S5T	TRPC7_ENST00000355180.3_Missense_Mutation_p.S5T|TRPC7_ENST00000426057.2_Missense_Mutation_p.S5T	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	5					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TTTGAAGGTGCTGTTCCTCAA	0.537																																					p.S5T		Atlas-SNP	.											TRPC7,NS,carcinoma,0,2	TRPC7	126	.	0			c.G14C						.						28.0	31.0	30.0					5																	135693062		2073	4209	6282	SO:0001583	missense	57113	exon2			AAGGTGCTGTTCC	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.14G>C	chr5.hg19:g.135693062C>G	ENSP00000426070:p.Ser5Thr	12.0	0.0		25.0	6.0	NM_001167576	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	hg19	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.624|7.624	0.677419|0.677419	0.14841|0.14841	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753|ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	.|T;T;T	.|0.78126	.|-0.97;-1.15;-1.07	5.38|5.38	0.433|0.433	0.16534|0.16534	.|.	.|0.557442	.|0.22250	.|N	.|0.062569	T|T	0.58666|0.58666	0.2138|0.2138	N|N	0.19112|0.19112	0.55|0.55	0.20638|0.20638	N|N	0.999872|0.999872	.|B	.|0.09022	.|0.002	.|B	.|0.06405	.|0.002	T|T	0.39502|0.39502	-0.9611|-0.9611	5|10	.|0.20519	.|T	.|0.43	-6.311|-6.311	9.9072|9.9072	0.41384|0.41384	0.0:0.5753:0.0:0.4247|0.0:0.5753:0.0:0.4247	.|.	.|5	.|Q9HCX4	.|TRPC7_HUMAN	H|T	4|5	.|ENSP00000347312:S5T;ENSP00000441628:S5T;ENSP00000426070:S5T	.|ENSP00000265193:S5T	Q|S	-|-	3|2	2|0	TRPC7|TRPC7	135720961|135720961	0.969000|0.969000	0.33509|0.33509	0.985000|0.985000	0.45067|0.45067	0.971000|0.971000	0.66376|0.66376	0.241000|0.241000	0.18065|0.18065	-0.113000|-0.113000	0.11958|0.11958	0.655000|0.655000	0.94253|0.94253	CAG|AGC	.	.		0.537	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
CDC25C	995	hgsc.bcm.edu	37	5	137627755	137627755	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:137627755G>T	ENST00000323760.6	-	8	944	c.666C>A	c.(664-666)aaC>aaA	p.N222K	CDC25C_ENST00000348983.3_Missense_Mutation_p.N149K|CDC25C_ENST00000356505.3_Missense_Mutation_p.N192K|CDC25C_ENST00000514555.1_Missense_Mutation_p.N192K|CDC25C_ENST00000415130.2_Missense_Mutation_p.N149K|CDC25C_ENST00000513970.1_Missense_Mutation_p.N222K|CDC25C_ENST00000357274.3_Missense_Mutation_p.N179K	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	222					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GTCTTGGCCTGTTCAAGTTCT	0.438																																					p.N222K		Atlas-SNP	.											.	CDC25C	37	.	0			c.C666A						.						149.0	155.0	153.0					5																	137627755		2203	4300	6503	SO:0001583	missense	995	exon8			TGGCCTGTTCAAG	M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.666C>A	chr5.hg19:g.137627755G>T	ENSP00000321656:p.Asn222Lys	108.0	0.0		121.0	48.0	NM_001790	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	ENST00000323760.6	hg19	CCDS4202.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.138|0.138	-1.105629|-1.105629	0.01828|0.01828	.|.	.|.	ENSG00000158402|ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555;ENST00000503022|ENST00000514017	T;T;T;T;T;T;T;T|.	0.22336|.	1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96|.	3.09|3.09	0.0358|0.0358	0.14189|0.14189	.|.	0.375132|.	0.25192|.	N|.	0.032454|.	T|T	0.39358|0.39358	0.1075|0.1075	L|L	0.46157|0.46157	1.445|1.445	0.24654|0.24654	N|N	0.993506|0.993506	B;B;D;B|.	0.64830|.	0.187;0.187;0.994;0.224|.	B;B;P;B|.	0.57425|.	0.058;0.058;0.82;0.096|.	T|T	0.34378|0.34378	-0.9831|-0.9831	10|5	0.07325|.	T|.	0.83|.	-14.8135|-14.8135	9.974|9.974	0.41772|0.41772	0.2308:0.0:0.7692:0.0|0.2308:0.0:0.7692:0.0	.|.	239;192;149;222|.	G3V1P6;P30307-2;P30307-4;P30307|.	.;.;.;MPIP3_HUMAN|.	K|K	222;192;179;149;149;222;239;192;222|17	ENSP00000321656:N222K;ENSP00000348898:N192K;ENSP00000349821:N179K;ENSP00000345205:N149K;ENSP00000392631:N149K;ENSP00000424795:N222K;ENSP00000425470:N192K;ENSP00000427251:N222K|.	ENSP00000321656:N222K|.	N|Q	-|-	3|1	2|0	CDC25C|CDC25C	137655654|137655654	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.413000|0.413000	0.31143|0.31143	0.784000|0.784000	0.26816|0.26816	-0.024000|-0.024000	0.13941|0.13941	-1.334000|-1.334000	0.01262|0.01262	AAC|CAG	.	.		0.438	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251280.1		
CTNNA1	1495	hgsc.bcm.edu	37	5	138223237	138223237	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:138223237T>C	ENST00000302763.7	+	9	1292	c.1202T>C	c.(1201-1203)cTt>cCt	p.L401P	CTNNA1_ENST00000520400.1_3'UTR|CTNNA1_ENST00000540387.1_Missense_Mutation_p.L31P|CTNNA1_ENST00000355078.5_Missense_Mutation_p.L298P|CTNNA1_ENST00000518825.1_Missense_Mutation_p.L401P	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	401					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AATGTTCCACTTTTGGTATTG	0.358																																					p.L401P		Atlas-SNP	.											.	CTNNA1	114	.	0			c.T1202C						.						123.0	121.0	122.0					5																	138223237		2203	4300	6503	SO:0001583	missense	1495	exon9			TTCCACTTTTGGT	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1202T>C	chr5.hg19:g.138223237T>C	ENSP00000304669:p.Leu401Pro	202.0	0.0		190.0	89.0	NM_001903	Q12795|Q8N1C0	Missense_Mutation	SNP	ENST00000302763.7	hg19	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	T	24.3	4.513295	0.85389	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000518381;ENST00000522013;ENST00000520260;ENST00000523298;ENST00000520865;ENST00000519634;ENST00000517533;ENST00000523685;ENST00000517656;ENST00000521683;ENST00000521640;ENST00000519116;ENST00000540387;ENST00000520522	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56611	0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45;0.45	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.73729	0.3624	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.78290	-0.2261	10	0.87932	D	0	-8.9879	14.8558	0.70335	0.0:0.0:0.0:1.0	.	401;278;401	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	P	298;401;401;386;401;31;31;31;31;31;31;31;31;31;31;31;31;31;31	ENSP00000347190:L298P;ENSP00000304669:L401P;ENSP00000427821:L401P;ENSP00000429738:L31P;ENSP00000430379:L31P;ENSP00000429569:L31P;ENSP00000428044:L31P;ENSP00000430841:L31P;ENSP00000428088:L31P;ENSP00000431118:L31P;ENSP00000430240:L31P;ENSP00000430177:L31P;ENSP00000430981:L31P;ENSP00000430623:L31P;ENSP00000428894:L31P;ENSP00000438476:L31P;ENSP00000428710:L31P	ENSP00000304669:L401P	L	+	2	0	CTNNA1	138251136	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	1.994000	0.58287	0.533000	0.62120	CTT	.	.		0.358	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
CTNNA1	1495	hgsc.bcm.edu	37	5	138223240	138223240	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:138223240T>A	ENST00000302763.7	+	9	1295	c.1205T>A	c.(1204-1206)tTg>tAg	p.L402*	CTNNA1_ENST00000520400.1_3'UTR|CTNNA1_ENST00000540387.1_Nonsense_Mutation_p.L32*|CTNNA1_ENST00000355078.5_Nonsense_Mutation_p.L299*|CTNNA1_ENST00000518825.1_Nonsense_Mutation_p.L402*	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	402					adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GTTCCACTTTTGGTATTGATT	0.363																																					p.L402X		Atlas-SNP	.											.	CTNNA1	114	.	0			c.T1205A						.						123.0	122.0	122.0					5																	138223240		2203	4300	6503	SO:0001587	stop_gained	1495	exon9			CACTTTTGGTATT	D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1205T>A	chr5.hg19:g.138223240T>A	ENSP00000304669:p.Leu402*	203.0	0.0		194.0	91.0	NM_001903	Q12795|Q8N1C0	Nonsense_Mutation	SNP	ENST00000302763.7	hg19	CCDS34243.1	.	.	.	.	.	.	.	.	.	.	T	36	5.906240	0.97087	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000518381;ENST00000522013;ENST00000520260;ENST00000523298;ENST00000520865;ENST00000519634;ENST00000517533;ENST00000523685;ENST00000517656;ENST00000521683;ENST00000521640;ENST00000519116;ENST00000540387;ENST00000520522	.	.	.	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-5.0133	14.8558	0.70335	0.0:0.0:0.0:1.0	.	.	.	.	X	299;402;402;387;402;32;32;32;32;32;32;32;32;32;32;32;32;32;32	.	ENSP00000304669:L402X	L	+	2	0	CTNNA1	138251139	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.040000	0.89188	1.994000	0.58287	0.533000	0.62120	TTG	.	.		0.363	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373868.1	NM_001903	
PCDHB3	56132	hgsc.bcm.edu	37	5	140482111	140482111	+	Silent	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:140482111C>T	ENST00000231130.2	+	1	1878	c.1878C>T	c.(1876-1878)acC>acT	p.T626T	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	626	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AAGTGCGCACCGCCAGGCTGC	0.701																																					p.T626T		Atlas-SNP	.											PCDHB3,NS,carcinoma,0,1	PCDHB3	208	.	0			c.C1878T						.						30.0	32.0	31.0					5																	140482111		2145	4158	6303	SO:0001819	synonymous_variant	56132	exon1			GCGCACCGCCAGG	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1878C>T	chr5.hg19:g.140482111C>T		54.0	0.0		60.0	5.0	NM_018937	B2R8P2	Silent	SNP	ENST00000231130.2	hg19	CCDS4245.1																																																																																			.	.		0.701	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB10	56126	hgsc.bcm.edu	37	5	140574260	140574260	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:140574260C>T	ENST00000239446.4	+	1	2319	c.2135C>T	c.(2134-2136)gCg>gTg	p.A712V		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	712					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTGGCGGTGCGGCTG	0.692																																					p.A712V		Atlas-SNP	.											.	PCDHB10	177	.	0			c.C2135T						.						39.0	49.0	46.0					5																	140574260		2081	4055	6136	SO:0001583	missense	56126	exon1			TCGTGGCGGTGCG	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.2135C>T	chr5.hg19:g.140574260C>T	ENSP00000239446:p.Ala712Val	60.0	0.0		70.0	30.0	NM_018930	Q96T99	Missense_Mutation	SNP	ENST00000239446.4	hg19	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	c	16.09	3.025734	0.54683	.	.	ENSG00000120324	ENST00000239446	T	0.15603	2.41	3.18	1.2	0.21068	.	.	.	.	.	T	0.26629	0.0651	M	0.91768	3.24	0.09310	N	1	P	0.48162	0.906	B	0.40506	0.331	T	0.19418	-1.0306	9	0.44086	T	0.13	.	8.9805	0.35961	0.0:0.5249:0.4751:0.0	.	712	Q9UN67	PCDBA_HUMAN	V	712	ENSP00000239446:A712V	ENSP00000239446:A712V	A	+	2	0	PCDHB10	140554444	0.000000	0.05858	0.854000	0.33618	0.880000	0.50808	-2.879000	0.00716	0.149000	0.19098	0.298000	0.19748	GCG	.	.		0.692	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
PCDHGA10	56106	hgsc.bcm.edu	37	5	140794696	140794696	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr5:140794696G>T	ENST00000398610.2	+	1	1954	c.1954G>T	c.(1954-1956)Gac>Tac	p.D652Y	PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB7_ENST00000398594.2_5'Flank|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018913.2|NM_032090.1	NP_061736.1|NP_114479.1	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10	652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGCCGTCCAGGACCACGGCCA	0.701																																					p.D652Y		Atlas-SNP	.											.	PCDHGA10	114	.	0			c.G1954T						.						40.0	50.0	47.0					5																	140794696		2199	4295	6494	SO:0001583	missense	56106	exon1			GTCCAGGACCACG		CCDS47292.1, CCDS75343.1	5q31	2010-01-26			ENSG00000253846	ENSG00000253846		"""Cadherins / Protocadherins : Clustered"""	8697	other	protocadherin		606297				10380929	Standard	NM_018913		Approved	PCDH-GAMMA-A10		Q9Y5H3	OTTHUMG00000163688	ENST00000398610.2:c.1954G>T	chr5.hg19:g.140794696G>T	ENSP00000381611:p.Asp652Tyr	135.0	0.0		146.0	12.0	NM_032090	Q9Y5E0	Missense_Mutation	SNP	ENST00000398610.2	hg19	CCDS47292.1	.	.	.	.	.	.	.	.	.	.	g	22.2	4.259825	0.80246	.	.	ENSG00000253846	ENST00000398610	T	0.68903	-0.36	5.39	5.39	0.77823	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.91088	0.7195	H	0.99855	4.85	0.47659	D	0.999483	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95258	0.8366	9	0.87932	D	0	.	18.8436	0.92194	0.0:0.0:1.0:0.0	.	652;652	Q9Y5H3-2;Q9Y5H3	.;PCDGA_HUMAN	Y	652	ENSP00000381611:D652Y	ENSP00000381611:D652Y	D	+	1	0	PCDHGA10	140774880	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.498000	0.97972	2.548000	0.85928	0.556000	0.70494	GAC	.	.		0.701	PCDHGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374747.1	NM_018913	
PHF3	23469	hgsc.bcm.edu	37	6	64395611	64395611	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr6:64395611T>A	ENST00000262043.3	+	4	2328	c.1988T>A	c.(1987-1989)cTg>cAg	p.L663Q	PHF3_ENST00000393387.1_Missense_Mutation_p.L663Q|PHF3_ENST00000509330.1_Missense_Mutation_p.L663Q			Q92576	PHF3_HUMAN	PHD finger protein 3	663					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAACTGAAACTGAAAAAACCT	0.438																																					p.L663Q	GBM(135;136 1820 29512 34071 46235)	Atlas-SNP	.											.	PHF3	191	.	0			c.T1988A						.						69.0	72.0	71.0					6																	64395611		2203	4300	6503	SO:0001583	missense	23469	exon3			TGAAACTGAAAAA	AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.1988T>A	chr6.hg19:g.64395611T>A	ENSP00000262043:p.Leu663Gln	192.0	0.0		166.0	70.0	NM_015153	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Missense_Mutation	SNP	ENST00000262043.3	hg19	CCDS4966.1	.	.	.	.	.	.	.	.	.	.	T	4.313	0.057488	0.08339	.	.	ENSG00000118482	ENST00000506783;ENST00000481385;ENST00000262043;ENST00000494284;ENST00000509330;ENST00000393387	T;T;T;T;T;T	0.50813	2.16;1.8;2.16;1.82;0.73;2.16	5.55	1.72	0.24424	.	0.976716	0.08285	N	0.969314	T	0.14056	0.0340	L	0.29908	0.895	0.09310	N	1	B;B	0.28350	0.067;0.208	B;B	0.25291	0.013;0.059	T	0.30357	-0.9981	10	0.52906	T	0.07	-0.0249	3.9807	0.09493	0.2612:0.157:0.0:0.5818	.	663;663	Q92576;D6R9X2	PHF3_HUMAN;.	Q	477;575;663;616;663;663	ENSP00000424694:L477Q;ENSP00000425227:L575Q;ENSP00000262043:L663Q;ENSP00000424078:L616Q;ENSP00000422841:L663Q;ENSP00000377048:L663Q	ENSP00000262043:L663Q	L	+	2	0	PHF3	64453570	0.097000	0.21791	0.245000	0.24217	0.855000	0.48748	1.612000	0.36889	0.052000	0.16007	0.482000	0.46254	CTG	.	.		0.438	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041086.2		
PTPRK	5796	hgsc.bcm.edu	37	6	128540089	128540089	+	Silent	SNP	A	A	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr6:128540089A>G	ENST00000368215.3	-	6	845	c.846T>C	c.(844-846)aaT>aaC	p.N282N	PTPRK_ENST00000368210.3_Silent_p.N282N|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368207.3_Silent_p.N282N|PTPRK_ENST00000368213.5_Silent_p.N282N|PTPRK_ENST00000368226.4_Silent_p.N282N|PTPRK_ENST00000368227.3_Silent_p.N282N|PTPRK_ENST00000532331.1_Silent_p.N282N			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	282					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		GTTGAGCAAAATTGGACACAC	0.398																																					p.N282N		Atlas-SNP	.											PTPRK_ENST00000368213,caecum,carcinoma,0,2	PTPRK	330	.	0			c.T846C						.						148.0	132.0	137.0					6																	128540089		2203	4300	6503	SO:0001819	synonymous_variant	5796	exon6			AGCAAAATTGGAC	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.846T>C	chr6.hg19:g.128540089A>G		133.0	0.0		114.0	50.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	ENST00000368215.3	hg19		.	.	.	.	.	.	.	.	.	.	A	9.789	1.177495	0.21787	.	.	ENSG00000152894	ENST00000490332	.	.	.	4.89	3.57	0.40892	.	.	.	.	.	T	0.44393	0.1291	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.37220	-0.9715	4	.	.	.	.	8.7167	0.34416	0.7636:0.0:0.2364:0.0	.	.	.	.	T	99	.	.	I	-	2	0	PTPRK	128581782	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.961000	0.49168	0.600000	0.29862	0.374000	0.22700	ATT	.	.		0.398	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
EPDR1	54749	hgsc.bcm.edu	37	7	37989827	37989827	+	Silent	SNP	A	A	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:37989827A>T	ENST00000199448.4	+	3	883	c.504A>T	c.(502-504)acA>acT	p.T168T	EPDR1_ENST00000476620.1_Silent_p.T66T|EPDR1_ENST00000559325.1_Silent_p.T288T|EPDR1_ENST00000425345.1_Silent_p.T107T|EPDR1_ENST00000423717.1_3'UTR	NM_017549.4	NP_060019.2	Q9UM22	EPDR1_HUMAN	ependymin related 1	168					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	calcium ion binding (GO:0005509)			breast(1)|endometrium(1)|large_intestine(2)|lung(9)|ovary(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	22						GCATCTATACAGTCAAGGATT	0.368																																					p.T168T		Atlas-SNP	.											.	EPDR1	48	.	0			c.A504T						.						55.0	57.0	56.0					7																	37989827		2203	4300	6503	SO:0001819	synonymous_variant	54749	exon3			CTATACAGTCAAG	BC018299	CCDS5454.1, CCDS5454.2, CCDS59051.1, CCDS59052.1	7p14.1	2013-07-31	2013-07-31		ENSG00000086289	ENSG00000086289			17572	protein-coding gene	gene with protein product			"""ependymin related protein 1 (zebrafish)"""			11749721, 11248421	Standard	NM_001242946		Approved	MERP-1, MERP1, UCC1, EPDR	uc003tfp.4	Q9UM22	OTTHUMG00000102187	ENST00000199448.4:c.504A>T	chr7.hg19:g.37989827A>T		165.0	0.0		131.0	48.0	NM_017549	A8K4C0|C9JYS3|Q06BL0|Q99M77	Silent	SNP	ENST00000199448.4	hg19	CCDS5454.2																																																																																			.	.		0.368	EPDR1-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220037.3	NM_017549	
ABCA13	154664	hgsc.bcm.edu	37	7	48313535	48313535	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:48313535C>A	ENST00000435803.1	+	17	4296	c.4272C>A	c.(4270-4272)ttC>ttA	p.F1424L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1424					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TGGGGAATTTCAGAGATATAG	0.284																																					p.F1424L		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C4272A						.						32.0	31.0	31.0					7																	48313535		1793	4057	5850	SO:0001583	missense	154664	exon17			GAATTTCAGAGAT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.4272C>A	chr7.hg19:g.48313535C>A	ENSP00000411096:p.Phe1424Leu	165.0	0.0		150.0	51.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	5.620	0.299056	0.10622	.	.	ENSG00000179869	ENST00000435803	D	0.86562	-2.14	5.04	3.2	0.36748	.	0.264539	0.26840	N	0.022226	T	0.79064	0.4383	L	0.39397	1.21	0.20403	N	0.9999	B	0.22080	0.064	B	0.17722	0.019	T	0.63269	-0.6675	9	.	.	.	.	8.2588	0.31773	0.0:0.8129:0.0:0.1871	.	1424	Q86UQ4	ABCAD_HUMAN	L	1424	ENSP00000411096:F1424L	.	F	+	3	2	ABCA13	48284081	0.005000	0.15991	0.012000	0.15200	0.115000	0.19883	0.214000	0.17541	0.615000	0.30124	0.462000	0.41574	TTC	.	.		0.284	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
VKORC1L1	154807	hgsc.bcm.edu	37	7	65338522	65338522	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:65338522G>T	ENST00000360768.3	+	1	269	c.164G>T	c.(163-165)tGg>tTg	p.W55L	VKORC1L1_ENST00000434382.2_Missense_Mutation_p.W55L	NM_001284342.1|NM_173517.4	NP_001271271.1|NP_775788.2	Q8N0U8	VKORL_HUMAN	vitamin K epoxide reductase complex, subunit 1-like 1	55					cellular response to oxidative stress (GO:0034599)|peptidyl-glutamic acid carboxylation (GO:0017187)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			large_intestine(1)|prostate(1)	2		Lung NSC(55;0.197)			Menadione(DB00170)	CTGGGGCCCTGGGTGAAGTGC	0.726																																					p.W55L		Atlas-SNP	.											.	VKORC1L1	14	.	0			c.G164T						.						8.0	11.0	10.0					7																	65338522		2186	4269	6455	SO:0001583	missense	154807	exon1			GGCCCTGGGTGAA		CCDS5529.1, CCDS64663.1	7q11.21	2013-10-07			ENSG00000196715	ENSG00000196715			21492	protein-coding gene	gene with protein product		608838				23928358	Standard	NM_001284342		Approved		uc003tul.3	Q8N0U8	OTTHUMG00000129449	ENST00000360768.3:c.164G>T	chr7.hg19:g.65338522G>T	ENSP00000353998:p.Trp55Leu	65.0	0.0		75.0	26.0	NM_173517	B4E222|E7ETM5|Q6AHW9|Q6TEK6	Missense_Mutation	SNP	ENST00000360768.3	hg19	CCDS5529.1	.	.	.	.	.	.	.	.	.	.	G	9.265	1.044246	0.19748	.	.	ENSG00000196715	ENST00000360768;ENST00000434382	D;D	0.97831	-4.56;-4.56	2.09	1.15	0.20763	Vitamin K epoxide reductase (2);	0.333535	0.29212	U	0.012803	D	0.93562	0.7945	L	0.36672	1.1	0.34352	D	0.690028	P;B	0.43826	0.818;0.013	B;B	0.41374	0.355;0.026	D	0.91614	0.5305	10	0.11182	T	0.66	.	9.5774	0.39465	0.0:0.2172:0.7828:0.0	.	55;55	E7ETM5;Q8N0U8	.;VKORL_HUMAN	L	55	ENSP00000353998:W55L;ENSP00000403077:W55L	ENSP00000353998:W55L	W	+	2	0	VKORC1L1	64975957	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	4.401000	0.59716	0.202000	0.20498	-0.914000	0.02751	TGG	.	.		0.726	VKORC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251612.3	NM_173517	
CYP3A5	1577	hgsc.bcm.edu	37	7	99247819	99247819	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:99247819T>C	ENST00000222982.4	-	12	1389	c.1290A>G	c.(1288-1290)atA>atG	p.I430M	CYP3A5_ENST00000343703.5_Missense_Mutation_p.I420M|CYP3A5_ENST00000339843.2_3'UTR	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	430					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	AGGGTGTGTATATGTAAGGAT	0.388																																					p.I430M		Atlas-SNP	.											.	CYP3A5	46	.	0			c.A1290G						.						317.0	274.0	289.0					7																	99247819		2203	4300	6503	SO:0001583	missense	1577	exon12			TGTGTATATGTAA	L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.1290A>G	chr7.hg19:g.99247819T>C	ENSP00000222982:p.Ile430Met	197.0	0.0		194.0	50.0	NM_000777	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Missense_Mutation	SNP	ENST00000222982.4	hg19	CCDS5672.1	.	.	.	.	.	.	.	.	.	.	T	9.903	1.207392	0.22205	.	.	ENSG00000106258	ENST00000222982;ENST00000343703	T;T	0.68331	-0.32;-0.32	4.73	-2.44	0.06502	.	0.843399	0.10613	N	0.654227	T	0.46308	0.1386	L	0.29908	0.895	0.58432	D	0.999997	B;B;B	0.19331	0.028;0.009;0.035	B;B;B	0.27887	0.051;0.052;0.084	T	0.39057	-0.9632	10	0.34782	T	0.22	.	1.1507	0.01785	0.141:0.275:0.2885:0.2955	.	420;430;430	F5H4S0;B2R9K2;P20815	.;.;CP3A5_HUMAN	M	430;420	ENSP00000222982:I430M;ENSP00000342969:I420M	ENSP00000222982:I430M	I	-	3	3	CYP3A5	99085755	0.000000	0.05858	0.036000	0.18154	0.983000	0.72400	-4.100000	0.00295	-0.077000	0.12752	0.459000	0.35465	ATA	.	.		0.388	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1		
HBP1	26959	hgsc.bcm.edu	37	7	106827063	106827063	+	Silent	SNP	T	T	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:106827063T>G	ENST00000222574.4	+	6	888	c.702T>G	c.(700-702)gtT>gtG	p.V234V	HBP1_ENST00000461963.1_3'UTR|HBP1_ENST00000468410.1_Silent_p.V234V|HBP1_ENST00000485846.1_Silent_p.V234V	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	234	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						GGCAAGATGTTGAAGATTTTG	0.363																																					p.V244V		Atlas-SNP	.											.	HBP1	31	.	0			c.T732G						.						146.0	143.0	144.0					7																	106827063		2203	4300	6503	SO:0001819	synonymous_variant	26959	exon6			AGATGTTGAAGAT	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.702T>G	chr7.hg19:g.106827063T>G		230.0	0.0		216.0	99.0	NM_001244262	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Silent	SNP	ENST00000222574.4	hg19	CCDS5741.1																																																																																			.	.		0.363	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
HBP1	26959	hgsc.bcm.edu	37	7	106827072	106827072	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:106827072T>G	ENST00000222574.4	+	6	897	c.711T>G	c.(709-711)ttT>ttG	p.F237L	HBP1_ENST00000461963.1_3'UTR|HBP1_ENST00000468410.1_Missense_Mutation_p.F237L|HBP1_ENST00000485846.1_Missense_Mutation_p.F237L	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	237	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						TTGAAGATTTTGCTAGAGCTG	0.358																																					p.F247L		Atlas-SNP	.											.	HBP1	31	.	0			c.T741G						.						149.0	145.0	146.0					7																	106827072		2203	4300	6503	SO:0001583	missense	26959	exon6			AGATTTTGCTAGA	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.711T>G	chr7.hg19:g.106827072T>G	ENSP00000222574:p.Phe237Leu	239.0	0.0		218.0	98.0	NM_001244262	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	ENST00000222574.4	hg19	CCDS5741.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.143703	0.37825	.	.	ENSG00000105856	ENST00000468410;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.98249	-4.82;-4.82;-4.82	5.95	5.95	0.96441	Ataxin, AXH domain (1);Ataxin-1/HBP1 module (AXH) (3);	0.092388	0.85682	D	0.000000	D	0.93370	0.7886	N	0.04132	-0.27	0.58432	D	0.999999	B;B;B	0.09022	0.001;0.002;0.002	B;B;B	0.12837	0.008;0.003;0.004	D	0.90952	0.4806	10	0.13470	T	0.59	-3.2057	16.4323	0.83853	0.0:0.0:0.0:1.0	.	247;237;237	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	L	237;237;237;229	ENSP00000420500:F237L;ENSP00000222574:F237L;ENSP00000418738:F237L	ENSP00000222574:F237L	F	+	3	2	HBP1	106614308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.503000	0.53340	2.281000	0.76405	0.528000	0.53228	TTT	.	.		0.358	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
HBP1	26959	hgsc.bcm.edu	37	7	106827075	106827075	+	Silent	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:106827075T>C	ENST00000222574.4	+	6	900	c.714T>C	c.(712-714)gcT>gcC	p.A238A	HBP1_ENST00000461963.1_3'UTR|HBP1_ENST00000468410.1_Silent_p.A238A|HBP1_ENST00000485846.1_Silent_p.A238A	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	238	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						AAGATTTTGCTAGAGCTGAAG	0.358																																					p.A248A		Atlas-SNP	.											.	HBP1	31	.	0			c.T744C						.						150.0	146.0	147.0					7																	106827075		2203	4300	6503	SO:0001819	synonymous_variant	26959	exon6			TTTTGCTAGAGCT	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.714T>C	chr7.hg19:g.106827075T>C		243.0	0.0		214.0	96.0	NM_001244262	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Silent	SNP	ENST00000222574.4	hg19	CCDS5741.1																																																																																			.	.		0.358	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
COG5	10466	hgsc.bcm.edu	37	7	106843989	106843989	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr7:106843989A>T	ENST00000347053.3	-	21	2542	c.2492T>A	c.(2491-2493)cTt>cAt	p.L831H	COG5_ENST00000297135.3_Missense_Mutation_p.L852H	NM_181733.2	NP_859422.2	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5	831					intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|skin(4)|stomach(1)	40						AGCCTTTTGAAGCAGCTGAAC	0.403																																					p.L852H		Atlas-SNP	.											.	COG5	78	.	0			c.T2555A						.						146.0	131.0	136.0					7																	106843989		2203	4300	6503	SO:0001583	missense	10466	exon22			TTTTGAAGCAGCT	AF058718	CCDS5742.1, CCDS5743.1, CCDS55152.1	7q31	2010-06-24	2001-12-07	2002-05-10	ENSG00000164597	ENSG00000164597		"""Components of oligomeric golgi complex"""	14857	protein-coding gene	gene with protein product		606821	"""golgi transport complex 1 (90 kDa subunit)"""	GOLTC1		9792665, 11980916	Standard	NM_006348		Approved	GTC90	uc003vec.2	Q9UP83	OTTHUMG00000023895	ENST00000347053.3:c.2492T>A	chr7.hg19:g.106843989A>T	ENSP00000334703:p.Leu831His	93.0	0.0		88.0	27.0	NM_006348	A4D0R6|A4D0R7|O14555|O95008|Q6NUL5	Missense_Mutation	SNP	ENST00000347053.3	hg19	CCDS5743.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.583591	0.86748	.	.	ENSG00000164597	ENST00000347053;ENST00000297135	T;T	0.34275	1.45;1.37	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.64046	0.2563	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68484	-0.5396	10	0.87932	D	0	-15.5482	16.5582	0.84512	1.0:0.0:0.0:0.0	.	831;852	Q9UP83;Q9UP83-2	COG5_HUMAN;.	H	831;852	ENSP00000334703:L831H;ENSP00000297135:L852H	ENSP00000297135:L852H	L	-	2	0	COG5	106631225	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	8.160000	0.89653	2.308000	0.77769	0.533000	0.62120	CTT	.	.		0.403	COG5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000060216.4		
TUSC3	7991	hgsc.bcm.edu	37	8	15508269	15508269	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr8:15508269C>G	ENST00000503731.1	+	3	520	c.372C>G	c.(370-372)aaC>aaG	p.N124K	TUSC3_ENST00000382020.4_Missense_Mutation_p.N124K|TUSC3_ENST00000503191.1_Intron|TUSC3_ENST00000506802.1_Missense_Mutation_p.N124K|TUSC3_ENST00000509380.1_Missense_Mutation_p.N124K	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	124	Thioredoxin.				cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		CTTTTTGTAACAAGCTCTTCT	0.383																																					p.N124K		Atlas-SNP	.											.	TUSC3	98	.	0			c.C372G						.						247.0	241.0	243.0					8																	15508269		2203	4300	6503	SO:0001583	missense	7991	exon3			TTGTAACAAGCTC	AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.372C>G	chr8.hg19:g.15508269C>G	ENSP00000424544:p.Asn124Lys	97.0	0.0		91.0	46.0	NM_178234	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	ENST00000503731.1	hg19	CCDS5994.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.223332	0.79464	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.22	4.34	0.51931	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.040366	0.85682	D	0.000000	T	0.51312	0.1667	L	0.58302	1.8	0.54753	D	0.999985	D;D;D;B;P;D	0.61080	0.969;0.988;0.989;0.198;0.943;0.98	D;D;D;B;P;P	0.72982	0.968;0.95;0.979;0.304;0.867;0.76	T	0.45425	-0.9262	10	0.15066	T	0.55	-11.5749	13.0719	0.59066	0.0:0.9221:0.0:0.0779	.	124;124;124;124;124;124	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	K	124	ENSP00000371450:N124K;ENSP00000425777:N124K;ENSP00000423426:N124K;ENSP00000424544:N124K	ENSP00000221167:N124K	N	+	3	2	TUSC3	15552640	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.777000	0.55364	1.327000	0.45338	0.655000	0.94253	AAC	.	.		0.383	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000365367.1	NM_006765	
IMPA1	3612	hgsc.bcm.edu	37	8	82598148	82598148	+	Intron	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr8:82598148C>T	ENST00000256108.5	-	1	442				IMPA1_ENST00000311489.4_Intron|IMPA1_ENST00000449740.2_Start_Codon_SNP_p.M1I|IMPA1_ENST00000523710.1_Intron	NM_005536.3	NP_005527.1	P29218	IMPA1_HUMAN	inositol(myo)-1(or 4)-monophosphatase 1						inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|inositol monophosphate phosphatase activity (GO:0052834)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|large_intestine(4)|lung(7)|prostate(2)|skin(2)|stomach(1)	18					Lithium(DB01356)	GGCGCTGCCCCATCACTTAGA	0.587																																					p.M1I		Atlas-SNP	.											.	IMPA1	46	.	0			c.G3A						.						34.0	30.0	31.0					8																	82598148		692	1591	2283	SO:0001627	intron_variant	3612	exon2			CTGCCCCATCACT		CCDS6231.1, CCDS47883.1, CCDS47884.1	8q21.1-q21.3	2008-01-28			ENSG00000133731	ENSG00000133731	3.1.3.25		6050	protein-coding gene	gene with protein product		602064		IMPA		1377913	Standard	NM_005536		Approved		uc011lfq.1	P29218	OTTHUMG00000164682	ENST00000256108.5:c.23+338G>A	chr8.hg19:g.82598148C>T		140.0	0.0		144.0	53.0	NM_001144878	B2R733|B4DLN3|B7Z6Q4|J3KQT7|Q9UK71	Missense_Mutation	SNP	ENST00000256108.5	hg19	CCDS6231.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.757120	0.31137	.	.	ENSG00000133731	ENST00000449740;ENST00000522997	T;T	0.31769	1.52;1.48	2.61	-0.624	0.11552	.	.	.	.	.	T	0.24314	0.0589	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08889	-1.0700	8	0.87932	D	0	.	10.0238	0.42059	0.0:0.4069:0.5931:0.0	.	1	B7Z6Q4	.	I	1	ENSP00000408526:M1I;ENSP00000430081:M1I	ENSP00000408526:M1I	M	-	3	0	IMPA1	82760703	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-0.735000	0.04888	-0.147000	0.11254	0.555000	0.69702	ATG	.	.		0.587	IMPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379723.1		
SLC25A32	81034	hgsc.bcm.edu	37	8	104427489	104427489	+	5'Flank	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr8:104427489C>T	ENST00000297578.4	-	0	0				SLC25A32_ENST00000543107.1_5'Flank|DCAF13_ENST00000521971.1_5'Flank|DCAF13_ENST00000297579.5_Missense_Mutation_p.L91F|DCAF13_ENST00000521716.1_5'Flank|DCAF13_ENST00000519682.1_5'Flank	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32						folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	AGAACCGCCCCTTGCTAACGT	0.642																																					p.L91F		Atlas-SNP	.											.	DCAF13	66	.	0			c.C271T						.						61.0	72.0	68.0					8																	104427489		2203	4300	6503	SO:0001631	upstream_gene_variant	25879	exon1			CCGCCCCTTGCTA	AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790		chr8.hg19:g.104427489C>T	Exception_encountered	181.0	0.0		173.0	10.0	NM_015420	Q96JZ6|Q96SU7	Missense_Mutation	SNP	ENST00000297578.4	hg19	CCDS6300.1	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371761	0.42003	.	.	ENSG00000164934	ENST00000297579	T	0.78364	-1.17	4.3	2.42	0.29668	.	2.440800	0.02262	N	0.067632	T	0.81361	0.4806	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65047	-0.6263	7	0.72032	D	0.01	0.1487	8.1959	0.31396	0.1897:0.6474:0.1629:0.0	.	.	.	.	F	91	ENSP00000297579:L91F	ENSP00000297579:L91F	L	+	1	0	DCAF13	104496665	0.095000	0.21747	0.758000	0.31321	0.009000	0.06853	0.654000	0.24918	0.525000	0.28522	-0.257000	0.10917	CTT	.	.		0.642	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380290.2	NM_030780	
COL14A1	7373	hgsc.bcm.edu	37	8	121228707	121228707	+	Missense_Mutation	SNP	C	C	A	rs150549316		TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr8:121228707C>A	ENST00000297848.3	+	14	1985	c.1715C>A	c.(1714-1716)gCa>gAa	p.A572E	COL14A1_ENST00000537875.1_3'UTR|COL14A1_ENST00000432943.2_3'UTR|COL14A1_ENST00000247781.3_Missense_Mutation_p.A477E|COL14A1_ENST00000309791.4_Missense_Mutation_p.A572E	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1									p.A572G(1)		NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TATAACAATGCAGATGGGACT	0.388																																					p.A572E		Atlas-SNP	.											COL14A1,NS,carcinoma,0,1	COL14A1	292	.	1	Substitution - Missense(1)	lung(1)	c.C1715A						.						117.0	110.0	113.0					8																	121228707		2203	4300	6503	SO:0001583	missense	7373	exon14			ACAATGCAGATGG		CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.1715C>A	chr8.hg19:g.121228707C>A	ENSP00000297848:p.Ala572Glu	121.0	0.0		131.0	35.0	NM_021110		Missense_Mutation	SNP	ENST00000297848.3	hg19	CCDS34938.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.335|1.335	-0.595712|-0.595712	0.03771|0.03771	.|.	.|.	ENSG00000187955|ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781;ENST00000434620|ENST00000523142	T;T;T;T|.	0.56444|.	0.46;0.46;0.46;0.46|.	5.29|5.29	0.286|0.286	0.15710|0.15710	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	0.295671|.	0.35495|.	N|.	0.003169|.	T|.	0.31575|.	0.0801|.	L|L	0.37630|0.37630	1.12|1.12	0.26804|0.26804	N|N	0.969144|0.969144	P;B|.	0.35684|.	0.515;0.324|.	B;B|.	0.38954|.	0.286;0.174|.	T|.	0.27971|.	-1.0058|.	10|.	0.25751|.	T|.	0.34|.	.|.	5.2277|5.2277	0.15404|0.15404	0.299:0.5183:0.1097:0.0729|0.299:0.5183:0.1097:0.0729	.|.	572;572|.	Q05707-2;Q05707|.	.;COEA1_HUMAN|.	E|X	572;572;477;385|328	ENSP00000311809:A572E;ENSP00000297848:A572E;ENSP00000247781:A477E;ENSP00000409461:A385E|.	ENSP00000247781:A477E|.	A|C	+|+	2|3	0|2	COL14A1|COL14A1	121297888|121297888	0.675000|0.675000	0.27558|0.27558	0.127000|0.127000	0.21898|0.21898	0.095000|0.095000	0.18619|0.18619	1.551000|1.551000	0.36233|0.36233	0.141000|0.141000	0.18875|0.18875	0.655000|0.655000	0.94253|0.94253	GCA|TGC	.	C|1.000;T|0.000		0.388	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313657.2	NM_021110	
CNTLN	54875	hgsc.bcm.edu	37	9	17416135	17416135	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr9:17416135A>G	ENST00000380647.3	+	18	3146	c.3062A>G	c.(3061-3063)cAt>cGt	p.H1021R	CNTLN_ENST00000262360.5_Missense_Mutation_p.H1021R|CNTLN_ENST00000425824.1_Missense_Mutation_p.H1021R			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1021					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AAGCTCCTCCATCAACAGCAA	0.333																																					p.H1021R		Atlas-SNP	.											.	CNTLN	128	.	0			c.A3062G						.						85.0	80.0	81.0					9																	17416135		1829	4086	5915	SO:0001583	missense	54875	exon18			TCCTCCATCAACA	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3062A>G	chr9.hg19:g.17416135A>G	ENSP00000370021:p.His1021Arg	276.0	0.0		274.0	112.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	hg19	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	A	8.148	0.786759	0.16189	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.16897	2.31;2.31;2.57	5.13	5.13	0.70059	.	.	.	.	.	T	0.17365	0.0417	L	0.54323	1.7	0.26237	N	0.97893	B;B;B	0.20988	0.05;0.034;0.034	B;B;B	0.22601	0.037;0.04;0.025	T	0.16394	-1.0404	9	0.20519	T	0.43	.	9.9837	0.41828	0.7784:0.2216:0.0:0.0	.	1021;1021;1021	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	R	1021	ENSP00000370021:H1021R;ENSP00000392798:H1021R;ENSP00000262360:H1021R	ENSP00000262360:H1021R	H	+	2	0	CNTLN	17406135	0.977000	0.34250	1.000000	0.80357	0.990000	0.78478	1.796000	0.38794	2.051000	0.60960	0.383000	0.25322	CAT	.	.		0.333	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
STXBP1	6812	hgsc.bcm.edu	37	9	130434340	130434340	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr9:130434340G>A	ENST00000373299.1	+	12	1089	c.974G>A	c.(973-975)cGg>cAg	p.R325Q	STXBP1_ENST00000373302.3_Missense_Mutation_p.R325Q|STXBP1_ENST00000481942.1_3'UTR	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1	325					axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						ACCACCATGCGGGACCTGTCC	0.498																																					p.R325Q		Atlas-SNP	.											.	STXBP1	99	.	0			c.G974A						.						124.0	114.0	117.0					9																	130434340		2203	4300	6503	SO:0001583	missense	6812	exon12			CCATGCGGGACCT	AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.974G>A	chr9.hg19:g.130434340G>A	ENSP00000362396:p.Arg325Gln	73.0	0.0		89.0	43.0	NM_001032221	B1AM97|Q28208|Q62759|Q64320|Q96TG8	Missense_Mutation	SNP	ENST00000373299.1	hg19	CCDS35146.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537102	0.85812	.	.	ENSG00000136854	ENST00000535154;ENST00000373302;ENST00000541198;ENST00000373299	T;T	0.79845	-1.31;-1.31	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.83275	0.5219	M	0.64404	1.975	0.58432	D	0.999999	D;D	0.55800	0.973;0.967	P;P	0.49276	0.605;0.469	D	0.85083	0.0947	10	0.62326	D	0.03	-21.1243	17.0456	0.86501	0.0:0.0:1.0:0.0	.	325;325	P61764;P61764-2	STXB1_HUMAN;.	Q	279;325;157;325	ENSP00000362399:R325Q;ENSP00000362396:R325Q	ENSP00000362396:R325Q	R	+	2	0	STXBP1	129474161	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	5.687000	0.68219	2.689000	0.91719	0.561000	0.74099	CGG	.	.		0.498	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054229.1	NM_003165	
MYO3A	53904	hgsc.bcm.edu	37	10	26359123	26359123	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr10:26359123G>A	ENST00000265944.5	+	13	1420	c.1254G>A	c.(1252-1254)atG>atA	p.M418I	MYO3A_ENST00000543632.1_Missense_Mutation_p.M418I	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	418	Myosin motor.			M -> I (in Ref. 1 and 2). {ECO:0000305}.	ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						ATCAATCTATGATAACATATA	0.333																																					p.M418I		Atlas-SNP	.											.	MYO3A	371	.	0			c.G1254A						.						61.0	63.0	62.0					10																	26359123		2203	4297	6500	SO:0001583	missense	53904	exon13			ATCTATGATAACA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1254G>A	chr10.hg19:g.26359123G>A	ENSP00000265944:p.Met418Ile	199.0	0.0		237.0	18.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	29.7	5.025320	0.93518	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	D;D	0.89343	-2.5;-2.5	5.79	5.79	0.91817	Myosin head, motor domain (2);	0.034508	0.85682	D	0.000000	D	0.95918	0.8671	M	0.91196	3.185	0.80722	D	1	D;D;D	0.59767	0.97;0.976;0.986	D;D;D	0.72338	0.961;0.977;0.93	D	0.96081	0.9054	10	0.72032	D	0.01	.	20.0275	0.97527	0.0:0.0:1.0:0.0	.	418;418;418	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	I	418	ENSP00000265944:M418I;ENSP00000445909:M418I	ENSP00000265944:M418I	M	+	3	0	MYO3A	26399129	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.649000	0.83500	2.727000	0.93392	0.650000	0.86243	ATG	.	.		0.333	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
CPEB3	22849	hgsc.bcm.edu	37	10	94000049	94000049	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr10:94000049T>C	ENST00000265997.4	-	2	231	c.59A>G	c.(58-60)cAg>cGg	p.Q20R	CPEB3_ENST00000412050.4_Missense_Mutation_p.Q20R	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	20	Gln-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				ctgctgccgctgctgctgctg	0.587																																					p.Q20R		Atlas-SNP	.											.	CPEB3	43	.	0			c.A59G						.						7.0	7.0	7.0					10																	94000049		1886	3756	5642	SO:0001583	missense	22849	exon2			TGCCGCTGCTGCT	AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.59A>G	chr10.hg19:g.94000049T>C	ENSP00000265997:p.Gln20Arg	134.0	0.0		120.0	6.0	NM_014912	Q5T389|Q9NQJ7|Q9Y2E9	Missense_Mutation	SNP	ENST00000265997.4	hg19	CCDS31246.1	.	.	.	.	.	.	.	.	.	.	T	4.523	0.097129	0.08681	.	.	ENSG00000107864	ENST00000394210;ENST00000412050;ENST00000265997	T;T	0.45668	0.89;0.9	2.23	-0.797	0.10909	.	0.992584	0.08182	N	0.985229	T	0.36193	0.0958	L	0.39898	1.24	0.29270	N	0.870753	P;P;P	0.42039	0.659;0.659;0.769	B;B;P	0.49332	0.403;0.403;0.607	T	0.34229	-0.9837	10	0.09590	T	0.72	-0.8246	4.7766	0.13182	0.0:0.3177:0.0:0.6823	.	20;20;20	Q8NE35;Q5QP71;Q8NE35-2	CPEB3_HUMAN;.;.	R	20	ENSP00000398310:Q20R;ENSP00000265997:Q20R	ENSP00000265997:Q20R	Q	-	2	0	CPEB3	93990029	0.982000	0.34865	0.981000	0.43875	0.924000	0.55760	0.234000	0.17930	-0.200000	0.10300	0.254000	0.18369	CAG	.	.		0.587	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049387.2	NM_014912	
FAM196A	642938	hgsc.bcm.edu	37	10	128974496	128974496	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr10:128974496G>A	ENST00000522781.1	-	4	719	c.164C>T	c.(163-165)gCa>gTa	p.A55V	DOCK1_ENST00000280333.6_Intron|FAM196A_ENST00000424811.2_Missense_Mutation_p.A55V	NM_001039762.2	NP_001034851.1	Q6ZSG2	F196A_HUMAN	family with sequence similarity 196, member A	55										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30						CTCATTCTGTGCCTCGCAGAT	0.592																																					p.A55V		Atlas-SNP	.											.	FAM196A	55	.	0			c.C164T						.						118.0	116.0	117.0					10																	128974496		2203	4300	6503	SO:0001583	missense	642938	exon4			TTCTGTGCCTCGC		CCDS31312.1	10q26.2	2009-09-11	2009-09-11	2009-09-11		ENSG00000188916			33859	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 141"""	C10orf141			Standard	NM_001039762		Approved	FLJ45557	uc001ljv.1	Q6ZSG2		ENST00000522781.1:c.164C>T	chr10.hg19:g.128974496G>A	ENSP00000429763:p.Ala55Val	78.0	0.0		46.0	37.0	NM_001039762	B2RNT4|B7ZME7	Missense_Mutation	SNP	ENST00000522781.1	hg19	CCDS31312.1	.	.	.	.	.	.	.	.	.	.	G	32	5.172041	0.94807	.	.	ENSG00000188916	ENST00000522781;ENST00000424811	T;T	0.52295	0.67;0.67	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.61098	0.2320	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.63265	-0.6676	10	0.66056	D	0.02	.	19.3815	0.94540	0.0:0.0:1.0:0.0	.	55;55	B7ZME7;Q6ZSG2	.;F196A_HUMAN	V	55	ENSP00000429763:A55V;ENSP00000428730:A55V	ENSP00000428730:A55V	A	-	2	0	FAM196A	128864486	1.000000	0.71417	0.982000	0.44146	0.855000	0.48748	9.476000	0.97823	2.655000	0.90218	0.462000	0.41574	GCA	.	.		0.592	FAM196A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050978.2	NM_001039762	
PSMC3	5702	hgsc.bcm.edu	37	11	47441913	47441913	+	Silent	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr11:47441913G>A	ENST00000298852.3	-	10	1186	c.1029C>T	c.(1027-1029)ctC>ctT	p.L343L	PSMC3_ENST00000530912.1_Silent_p.L301L|PSMC3_ENST00000602866.1_Silent_p.L327L	NM_002804.4	NP_002795.2	P17980	PRS6A_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 3	343					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of RNA biosynthetic process (GO:2001141)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(4)|urinary_tract(1)	17				Lung(87;0.0932)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGCCCGAGCGGAGGAGGGCGG	0.572																																					p.L343L		Atlas-SNP	.											.	PSMC3	35	.	0			c.C1029T						.						42.0	46.0	45.0					11																	47441913		2201	4298	6499	SO:0001819	synonymous_variant	5702	exon10			CGAGCGGAGGAGG	M34079	CCDS7935.1	11p11.2	2010-04-21			ENSG00000165916	ENSG00000165916		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9549	protein-coding gene	gene with protein product		186852				9048938, 9473509	Standard	NM_002804		Approved	TBP1, TBP-1	uc001nfh.2	P17980	OTTHUMG00000167692	ENST00000298852.3:c.1029C>T	chr11.hg19:g.47441913G>A		54.0	0.0		50.0	20.0	NM_002804	B2R8V1|Q3B757|Q3B865|Q53HU5|Q6GPG8|Q6IBS1|Q96HD3	Silent	SNP	ENST00000298852.3	hg19	CCDS7935.1																																																																																			.	.		0.572	PSMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395660.2	NM_002804	
DAGLA	747	hgsc.bcm.edu	37	11	61511629	61511629	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr11:61511629C>G	ENST00000257215.5	+	20	2913	c.2797C>G	c.(2797-2799)Ctc>Gtc	p.L933V	RP11-467L20.10_ENST00000536405.1_lincRNA	NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	933					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CTTCCAAGACCTCTACTGCAT	0.632																																					p.L933V		Atlas-SNP	.											.	DAGLA	109	.	0			c.C2797G						.						70.0	63.0	65.0					11																	61511629		2202	4298	6500	SO:0001583	missense	747	exon20			CAAGACCTCTACT	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2797C>G	chr11.hg19:g.61511629C>G	ENSP00000257215:p.Leu933Val	98.0	0.0		142.0	61.0	NM_006133	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	hg19	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	C	12.95	2.092162	0.36952	.	.	ENSG00000134780	ENST00000257215	T	0.34275	1.37	3.97	3.97	0.46021	.	0.072132	0.56097	D	0.000028	T	0.25494	0.0620	N	0.24115	0.695	0.42799	D	0.99392	B	0.15473	0.013	B	0.13407	0.009	T	0.11131	-1.0600	10	0.72032	D	0.01	-28.411	11.6837	0.51472	0.2274:0.7726:0.0:0.0	.	933	Q9Y4D2	DGLA_HUMAN	V	933	ENSP00000257215:L933V	ENSP00000257215:L933V	L	+	1	0	DAGLA	61268205	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.229000	0.32600	1.942000	0.56320	0.462000	0.41574	CTC	.	.		0.632	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
C2CD3	26005	hgsc.bcm.edu	37	11	73824881	73824881	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr11:73824881T>A	ENST00000334126.7	-	11	2013	c.1787A>T	c.(1786-1788)aAg>aTg	p.K596M	C2CD3_ENST00000313663.7_Missense_Mutation_p.K596M			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	596					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					CAAAGCTGTCTTTCCCAATCC	0.373																																					p.K596M		Atlas-SNP	.											.	C2CD3	288	.	0			c.A1787T						.						124.0	121.0	122.0					11																	73824881		2200	4293	6493	SO:0001583	missense	26005	exon11			GCTGTCTTTCCCA	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1787A>T	chr11.hg19:g.73824881T>A	ENSP00000334379:p.Lys596Met	93.0	0.0		92.0	22.0	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	hg19		.	.	.	.	.	.	.	.	.	.	T	23.0	4.368627	0.82463	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681	T;T	0.11821	2.74;2.75	5.49	5.49	0.81192	C2 calcium-dependent membrane targeting (1);	0.353444	0.32868	N	0.005555	T	0.32224	0.0822	L	0.57536	1.79	0.36827	D	0.886714	D;D	0.89917	0.998;1.0	D;D	0.67548	0.922;0.952	T	0.26849	-1.0091	10	0.72032	D	0.01	-16.6348	13.821	0.63320	0.0:0.0:0.0:1.0	.	596;596	Q4AC94;Q4AC94-1	C2CD3_HUMAN;.	M	596	ENSP00000334379:K596M;ENSP00000323339:K596M	ENSP00000323339:K596M	K	-	2	0	C2CD3	73502529	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.064000	0.57506	2.089000	0.63090	0.374000	0.22700	AAG	.	.		0.373	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
CREBZF	58487	hgsc.bcm.edu	37	11	85375725	85375725	+	Silent	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr11:85375725G>A	ENST00000527447.1	-	1	421	c.195C>T	c.(193-195)gcC>gcT	p.A65A	CREBZF_ENST00000398294.2_5'Flank|CREBZF_ENST00000531515.1_Intron|CREBZF_ENST00000534224.1_Intron	NM_001039618.2	NP_001034707.1	Q9NS37	ZHANG_HUMAN	CREB/ATF bZIP transcription factor	65					negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)				TCCCCCTCCCGGCTTCCAACT	0.731																																					p.A65A	NSCLC(172;674 2044 9050 18334 41735)	Atlas-SNP	.											.	CREBZF	26	.	0			c.C195T						.						22.0	26.0	25.0					11																	85375725		1834	4052	5886	SO:0001819	synonymous_variant	58487	exon1			CCTCCCGGCTTCC	AF039942	CCDS41697.1	11q14.1	2013-01-10			ENSG00000137504	ENSG00000137504		"""basic leucine zipper proteins"""	24905	protein-coding gene	gene with protein product	"""Zhangfei"""	606444				10871379	Standard	NM_001039618		Approved	ZF	uc001pas.2	Q9NS37	OTTHUMG00000133648	ENST00000527447.1:c.195C>T	chr11.hg19:g.85375725G>A		118.0	0.0		101.0	43.0	NM_001039618	B2R8Q9|Q0P5U9|Q52LT3	Silent	SNP	ENST00000527447.1	hg19	CCDS41697.1																																																																																			.	.		0.731	CREBZF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390191.2	NM_001039618	
CNTN5	53942	hgsc.bcm.edu	37	11	99715619	99715619	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr11:99715619C>A	ENST00000524871.1	+	5	603	c.313C>A	c.(313-315)Cca>Aca	p.P105T	CNTN5_ENST00000527185.1_Missense_Mutation_p.P105T|CNTN5_ENST00000528682.1_Missense_Mutation_p.P105T|CNTN5_ENST00000418526.2_Missense_Mutation_p.P31T|CNTN5_ENST00000279463.3_Missense_Mutation_p.P105T	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	105	Ig-like C2-type 1.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		TGTGCAAGAACCAGATGATAT	0.353																																					p.P105T		Atlas-SNP	.											.	CNTN5	324	.	0			c.C313A						.						157.0	144.0	148.0					11																	99715619		1839	4083	5922	SO:0001583	missense	53942	exon4			CAAGAACCAGATG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.313C>A	chr11.hg19:g.99715619C>A	ENSP00000435637:p.Pro105Thr	179.0	0.0		152.0	56.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	C	19.72	3.880447	0.72294	.	.	ENSG00000149972	ENST00000527185;ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76	5.33	5.33	0.75918	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	M	0.90425	3.115	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.80917	-0.1168	10	0.87932	D	0	.	18.3699	0.90403	0.0:1.0:0.0:0.0	.	105;31;105	E9PKE8;O94779-2;O94779	.;.;CNTN5_HUMAN	T	105;105;105;31;105	ENSP00000433575:P105T;ENSP00000436185:P105T;ENSP00000435637:P105T;ENSP00000393229:P31T;ENSP00000279463:P105T	ENSP00000279463:P105T	P	+	1	0	CNTN5	99220829	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.330000	0.65899	2.653000	0.90120	0.650000	0.86243	CCA	.	.		0.353	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
CAPRIN2	65981	hgsc.bcm.edu	37	12	30863221	30863221	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr12:30863221A>C	ENST00000298892.5	-	17	3599	c.2849T>G	c.(2848-2850)tTc>tGc	p.F950C	CAPRIN2_ENST00000251071.5_Missense_Mutation_p.F1000C|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.F666C|CAPRIN2_ENST00000395805.2_3'UTR	NM_023925.3	NP_076414.2			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					GGCTGCTGAGAAGGCAACTCG	0.498																																					p.F1000C		Atlas-SNP	.											.	CAPRIN2	109	.	0			c.T2999G						.						152.0	153.0	153.0					12																	30863221		2203	4300	6503	SO:0001583	missense	65981	exon18			GCTGAGAAGGCAA	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2849T>G	chr12.hg19:g.30863221A>C	ENSP00000298892:p.Phe950Cys	155.0	0.0		126.0	48.0	NM_001002259		Missense_Mutation	SNP	ENST00000298892.5	hg19	CCDS8720.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.389397	0.82902	.	.	ENSG00000110888	ENST00000298892;ENST00000251071;ENST00000308433	D;D;D	0.98585	-5.01;-5.01;-5.01	5.7	5.7	0.88788	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.85682	D	0.000000	D	0.99312	0.9759	H	0.96175	3.78	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98745	1.0718	10	0.87932	D	0	-9.0122	15.9561	0.79889	1.0:0.0:0.0:0.0	.	1000;950	Q6IMN6;Q6IMN6-2	CAPR2_HUMAN;.	C	950;1000;666	ENSP00000298892:F950C;ENSP00000251071:F1000C;ENSP00000309785:F666C	ENSP00000251071:F1000C	F	-	2	0	CAPRIN2	30754488	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.097000	0.94193	2.166000	0.68216	0.533000	0.62120	TTC	.	.		0.498	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402778.1	NM_023925	
KRT5	3852	hgsc.bcm.edu	37	12	52908953	52908953	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr12:52908953G>A	ENST00000252242.4	-	9	1936	c.1546C>T	c.(1546-1548)Ctt>Ttt	p.L516F		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	516	Tail.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		ccgccgccaagacctccaccg	0.622																																					p.L516F		Atlas-SNP	.											KRT5,NS,carcinoma,0,1	KRT5	88	.	0			c.C1546T						.						37.0	35.0	36.0					12																	52908953		2203	4300	6503	SO:0001583	missense	3852	exon9			CGCCAAGACCTCC		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.1546C>T	chr12.hg19:g.52908953G>A	ENSP00000252242:p.Leu516Phe	1390.0	1.0		1449.0	550.0	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	hg19	CCDS8830.1	.	.	.	.	.	.	.	.	.	.	g	4.947	0.175944	0.09443	.	.	ENSG00000186081	ENST00000252242;ENST00000456000	D	0.87412	-2.25	5.56	-2.58	0.06228	.	7739.210000	0.00166	N	0.000002	T	0.74145	0.3678	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.60244	-0.7301	10	0.11182	T	0.66	.	2.4696	0.04561	0.3299:0.2581:0.3175:0.0945	.	516	P13647	K2C5_HUMAN	F	516;481	ENSP00000252242:L516F	ENSP00000252242:L516F	L	-	1	0	KRT5	51195220	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-2.265000	0.01172	-0.172000	0.10779	-0.119000	0.15052	CTT	.	.		0.622	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
HSD17B6	8630	hgsc.bcm.edu	37	12	57180920	57180920	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr12:57180920A>G	ENST00000554643.1	+	6	1097	c.748A>G	c.(748-750)Atg>Gtg	p.M250V	HSD17B6_ENST00000555159.1_Missense_Mutation_p.M250V|HSD17B6_ENST00000554150.1_Missense_Mutation_p.M250V|HSD17B6_ENST00000322165.1_Missense_Mutation_p.M250V|HSD17B6_ENST00000555805.1_Missense_Mutation_p.M250V			O14756	H17B6_HUMAN	hydroxysteroid (17-beta) dehydrogenase 6	250					androgen biosynthetic process (GO:0006702)|androgen catabolic process (GO:0006710)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|intracellular (GO:0005622)|membrane (GO:0016020)	catalytic activity (GO:0003824)|electron carrier activity (GO:0009055)|estradiol 17-beta-dehydrogenase activity (GO:0004303)|oxidoreductase activity (GO:0016491)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			endometrium(1)|large_intestine(2)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10					Succinic acid(DB00139)	TTACAATATCATGAAGGAAGG	0.398																																					p.M250V		Atlas-SNP	.											.	HSD17B6	26	.	0			c.A748G						.						104.0	100.0	101.0					12																	57180920		2203	4300	6503	SO:0001583	missense	8630	exon5			AATATCATGAAGG	AF016509	CCDS8925.1	12q13.3	2012-12-07	2012-12-07		ENSG00000025423	ENSG00000025423	1.1.1.62, 1.1.1.63, 1.1.1.105	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	23316	protein-coding gene	gene with protein product	"""oxidative 3-alpha-hydroxysteroid-dehydrogenase"", ""3(alpha->beta)-hydroxysteroid epimerasel"", ""retinol dehydrogenase"", ""oxidoreductase"", ""NAD+ -dependent 3 alpha-hydroxysteroid dehydrogenase"", ""3-hydroxysteroid epimerase"", ""short chain dehydrogenase/reductase family 9C, member 6"""	606623	"""hydroxysteroid (17-beta) dehydrogenase 6"", ""hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse)"""			11165032, 19027726	Standard	XM_005269207		Approved	HSE, RODH, SDR9C6	uc001smg.1	O14756	OTTHUMG00000170854	ENST00000554643.1:c.748A>G	chr12.hg19:g.57180920A>G	ENSP00000451406:p.Met250Val	74.0	0.0		120.0	23.0	NM_003725	O43275	Missense_Mutation	SNP	ENST00000554643.1	hg19	CCDS8925.1	.	.	.	.	.	.	.	.	.	.	a	1.679	-0.506891	0.04231	.	.	ENSG00000025423	ENST00000555159;ENST00000555805;ENST00000554643;ENST00000554150;ENST00000322165	D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82	4.34	-6.18	0.02085	NAD(P)-binding domain (1);	3.604020	0.00664	N	0.000617	T	0.63070	0.2480	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.56980	-0.7889	10	0.17369	T	0.5	.	3.3838	0.07264	0.3233:0.4237:0.1473:0.1057	.	250	O14756	H17B6_HUMAN	V	250	ENSP00000450698:M250V;ENSP00000451753:M250V;ENSP00000451406:M250V;ENSP00000452273:M250V;ENSP00000318631:M250V	ENSP00000318631:M250V	M	+	1	0	HSD17B6	55467187	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.014000	0.13333	-0.836000	0.04229	0.529000	0.55759	ATG	.	.		0.398	HSD17B6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410714.1	NM_003725	
WSCD2	9671	hgsc.bcm.edu	37	12	108600076	108600076	+	Silent	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr12:108600076C>A	ENST00000332082.4	+	4	1211	c.393C>A	c.(391-393)atC>atA	p.I131I	WSCD2_ENST00000547525.1_Silent_p.I131I|WSCD2_ENST00000549903.1_Silent_p.I131I|WSCD2_ENST00000261400.3_Silent_p.I131I			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	131	WSC 1. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)		p.I131I(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CCAAGTACATCGGCTGCTACC	0.517																																					p.I131I		Atlas-SNP	.											WSCD2,NS,haematopoietic_neoplasm,+2,1	WSCD2	125	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C393A						.						81.0	80.0	80.0					12																	108600076		1936	4142	6078	SO:0001819	synonymous_variant	9671	exon3			GTACATCGGCTGC		CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.393C>A	chr12.hg19:g.108600076C>A		90.0	0.0		107.0	44.0	NM_014653	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Silent	SNP	ENST00000332082.4	hg19	CCDS41828.1																																																																																			.	.		0.517	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405554.1	NM_014653	
ATXN2	6311	hgsc.bcm.edu	37	12	111951302	111951302	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr12:111951302T>A	ENST00000377617.3	-	11	2058	c.1897A>T	c.(1897-1899)Aat>Tat	p.N633Y	ATXN2_ENST00000608853.1_Missense_Mutation_p.N473Y|ATXN2_ENST00000542287.2_Missense_Mutation_p.N368Y|ATXN2_ENST00000550104.1_Missense_Mutation_p.N633Y|ATXN2_ENST00000389153.4_Missense_Mutation_p.N368Y|ATXN2_ENST00000535949.1_Missense_Mutation_p.N344Y	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	633	Pro-rich.				cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						ACTCTGTGATTTCGAGGATGT	0.483																																					p.N633Y		Atlas-SNP	.											.	ATXN2	99	.	0			c.A1897T						.						74.0	64.0	68.0					12																	111951302		2203	4300	6503	SO:0001583	missense	6311	exon11			TGTGATTTCGAGG	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1897A>T	chr12.hg19:g.111951302T>A	ENSP00000366843:p.Asn633Tyr	108.0	0.0		118.0	7.0	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	hg19	CCDS31902.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.27|18.27	3.586768|3.586768	0.66105|0.66105	.|.	.|.	ENSG00000204842|ENSG00000204842	ENST00000481331|ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949;ENST00000492467;ENST00000550236	.|T;T	.|0.65178	.|-0.12;-0.14	5.53|5.53	4.4|4.4	0.53042|0.53042	.|.	.|0.338965	.|0.34291	.|N	.|0.004087	T|T	0.39911|0.39911	0.1096|0.1096	N|N	0.14661|0.14661	0.345|0.345	0.32238|0.32238	N|N	0.573072|0.573072	.|P;P;B;P	.|0.48162	.|0.761;0.906;0.327;0.875	.|B;B;B;B	.|0.39771	.|0.123;0.188;0.087;0.309	T|T	0.52609|0.52609	-0.8553|-0.8553	6|10	0.87932|0.41790	D|T	0|0.15	-13.0562|-13.0562	7.3836|7.3836	0.26870|0.26870	0.0:0.184:0.0:0.816|0.0:0.184:0.0:0.816	.|.	.|368;633;344;368	.|B3KT59;Q99700;Q24JQ7;F8VQP2	.|.;ATX2_HUMAN;.;.	D|Y	16|368;633;633;368;344;23;48	.|ENSP00000366843:N633Y;ENSP00000446576:N633Y	ENSP00000449850:E16D|ENSP00000366843:N633Y	E|N	-|-	3|1	2|0	ATXN2|ATXN2	110435685|110435685	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	1.119000|1.119000	0.31258|0.31258	2.105000|2.105000	0.64084|0.64084	0.528000|0.528000	0.53228|0.53228	GAA|AAT	.	.		0.483	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
MAPKAPK5	8550	hgsc.bcm.edu	37	12	112308139	112308139	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr12:112308139A>G	ENST00000551404.2	+	6	566	c.458A>G	c.(457-459)aAt>aGt	p.N153S	MAPKAPK5_ENST00000550735.2_Missense_Mutation_p.N153S			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	153	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(11)|ovary(1)	13						AAGCCTGAAAATCTGCTTTTT	0.423																																					p.N153S		Atlas-SNP	.											.	MAPKAPK5	56	.	0			c.A458G						.						131.0	119.0	123.0					12																	112308139		1886	4106	5992	SO:0001583	missense	8550	exon6			CTGAAAATCTGCT	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.458A>G	chr12.hg19:g.112308139A>G	ENSP00000449381:p.Asn153Ser	109.0	0.0		131.0	45.0	NM_139078	B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Missense_Mutation	SNP	ENST00000551404.2	hg19	CCDS44975.1	.	.	.	.	.	.	.	.	.	.	A	31	5.088999	0.94100	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000551404	D;D	0.91945	-2.94;-2.94	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.97698	0.9245	H	0.98005	4.125	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.974	D;D;D	0.97110	1.0;0.998;0.953	D	0.99289	1.0898	10	0.87932	D	0	.	15.8035	0.78473	1.0:0.0:0.0:0.0	.	147;153;153	C9J458;Q8IW41;Q8IW41-2	.;MAPK5_HUMAN;.	S	153	ENSP00000449667:N153S;ENSP00000449381:N153S	ENSP00000202788:N153S	N	+	2	0	MAPKAPK5	110792522	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.320000	0.96346	2.130000	0.65690	0.482000	0.46254	AAT	.	.		0.423	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078	
GCN1L1	10985	hgsc.bcm.edu	37	12	120616729	120616729	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr12:120616729G>T	ENST00000300648.6	-	6	463	c.451C>A	c.(451-453)Ctg>Atg	p.L151M		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	151					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGCACCTCCAGCAAGAGCAGG	0.592																																					p.L151M		Atlas-SNP	.											.	GCN1L1	207	.	0			c.C451A						.						38.0	42.0	40.0					12																	120616729		2131	4239	6370	SO:0001583	missense	10985	exon6			CCTCCAGCAAGAG	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.451C>A	chr12.hg19:g.120616729G>T	ENSP00000300648:p.Leu151Met	44.0	0.0		33.0	11.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Missense_Mutation	SNP	ENST00000300648.6	hg19	CCDS41847.1	.	.	.	.	.	.	.	.	.	.	G	11.09	1.536881	0.27475	.	.	ENSG00000089154	ENST00000300648	T	0.15834	2.39	5.79	-3.67	0.04476	Armadillo-like helical (1);Armadillo-type fold (1);	0.356004	0.29403	N	0.012243	T	0.06188	0.0160	N	0.12182	0.205	0.26124	N	0.98052	B	0.19817	0.039	B	0.09377	0.004	T	0.13150	-1.0520	10	0.42905	T	0.14	-0.0228	3.5793	0.07946	0.3794:0.3567:0.1734:0.0905	.	151	Q92616	GCN1L_HUMAN	M	151	ENSP00000300648:L151M	ENSP00000300648:L151M	L	-	1	2	GCN1L1	119101112	0.011000	0.17503	0.900000	0.35374	0.683000	0.39861	-0.080000	0.11339	-0.759000	0.04684	-0.251000	0.11542	CTG	.	.		0.592	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
IRG1	730249	hgsc.bcm.edu	37	13	77531639	77531639	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr13:77531639C>A	ENST00000377462.1	+	5	1027	c.965C>A	c.(964-966)cCc>cAc	p.P322H	IRG1_ENST00000449753.1_Missense_Mutation_p.P322H	NM_001258406.1	NP_001245335.1	A6NK06	IRG1_HUMAN	immunoresponsive 1 homolog (mouse)	322					cellular response to interferon-beta (GO:0035458)|cellular response to interferon-gamma (GO:0071346)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to molecule of bacterial origin (GO:0071219)|cellular response to progesterone stimulus (GO:0071393)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of type I interferon production (GO:0032480)|positive regulation of antimicrobial humoral response (GO:0002760)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|propionate catabolic process (GO:0019543)|tolerance induction to lipopolysaccharide (GO:0072573)	mitochondrion (GO:0005739)	2-methylcitrate dehydratase activity (GO:0047547)|aconitate decarboxylase activity (GO:0047613)										GTAAACAGGCCCTTTCCAGTT	0.488																																					p.P318H		Atlas-SNP	.											.	IRG1	1	.	0			c.C953A						.																																			SO:0001583	missense	730249	exon4			ACAGGCCCTTTCC		CCDS58299.1	13q22.3	2013-04-29			ENSG00000102794	ENSG00000102794			33904	protein-coding gene	gene with protein product		615275				23610393	Standard	NM_001258406		Approved		uc031qmi.1	A6NK06	OTTHUMG00000017098	ENST00000377462.1:c.965C>A	chr13.hg19:g.77531639C>A	ENSP00000366682:p.Pro322His	80.0	0.0		98.0	44.0	NM_001258406		Missense_Mutation	SNP	ENST00000377462.1	hg19	CCDS58299.1	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673505	0.47781	.	.	ENSG00000102794	ENST00000377462;ENST00000449753	.	.	.	5.91	5.91	0.95273	.	0.046198	0.85682	D	0.000000	T	0.78000	0.4215	M	0.83012	2.62	0.47778	D	0.99951	.	.	.	.	.	.	T	0.77923	-0.2406	7	0.44086	T	0.13	-26.9393	15.8535	0.78956	0.1362:0.8638:0.0:0.0	.	.	.	.	H	322	.	ENSP00000366682:P322H	P	+	2	0	IRG1	76429640	1.000000	0.71417	1.000000	0.80357	0.088000	0.18126	5.618000	0.67722	2.813000	0.96785	0.655000	0.94253	CCC	.	.		0.488	IRG1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045311.1	XM_001133269	
FARP1	10160	hgsc.bcm.edu	37	13	99040698	99040698	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr13:99040698A>G	ENST00000319562.6	+	9	1086	c.821A>G	c.(820-822)aAg>aGg	p.K274R	FARP1_ENST00000376586.2_Missense_Mutation_p.K274R|FARP1_ENST00000595437.1_Missense_Mutation_p.K274R	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	274	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			TTCAAGAGGAAGCGCTTTCTC	0.537																																					p.K274R		Atlas-SNP	.											.	FARP1	207	.	0			c.A821G						.						84.0	76.0	79.0					13																	99040698		2203	4300	6503	SO:0001583	missense	10160	exon9			AGAGGAAGCGCTT	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.821A>G	chr13.hg19:g.99040698A>G	ENSP00000322926:p.Lys274Arg	83.0	0.0		102.0	40.0	NM_005766	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	hg19	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.932456	0.92458	.	.	ENSG00000152767	ENST00000376586;ENST00000319562	D;D	0.91792	-2.91;-2.91	6.17	6.17	0.99709	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.048155	0.85682	D	0.000000	D	0.94155	0.8125	L	0.48174	1.505	0.80722	D	1	B;D	0.55605	0.219;0.972	B;D	0.64877	0.054;0.93	D	0.93642	0.6965	10	0.42905	T	0.14	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	274;274	Q9Y4F1;C9JME2	FARP1_HUMAN;.	R	274	ENSP00000365771:K274R;ENSP00000322926:K274R	ENSP00000322926:K274R	K	+	2	0	FARP1	97838699	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	AAG	.	.		0.537	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
TM9SF1	10548	hgsc.bcm.edu	37	14	24661413	24661413	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr14:24661413C>T	ENST00000261789.4	-	4	1475	c.1117G>A	c.(1117-1119)Gtg>Atg	p.V373M	TM9SF1_ENST00000556387.1_Missense_Mutation_p.V582M|TM9SF1_ENST00000396854.4_Missense_Mutation_p.V373M|TM9SF1_ENST00000528669.1_Missense_Mutation_p.V373M|RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000524835.1_Missense_Mutation_p.V286M|TM9SF1_ENST00000530611.1_Missense_Mutation_p.V582M	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	373					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		ATGTTCCACACCCAACGCTCG	0.532																																					p.V373M		Atlas-SNP	.											.	TM9SF1	58	.	0			c.G1117A						.						151.0	146.0	148.0					14																	24661413		2203	4300	6503	SO:0001583	missense	10548	exon4			TCCACACCCAACG	U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1117G>A	chr14.hg19:g.24661413C>T	ENSP00000261789:p.Val373Met	244.0	0.0		221.0	70.0	NM_001014842	D3DS65|Q86SZ6|Q96FI8	Missense_Mutation	SNP	ENST00000261789.4	hg19	CCDS9617.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.345819	0.82022	.	.	ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000100926;ENSG00000254692	ENST00000261789;ENST00000528669;ENST00000556387;ENST00000524835;ENST00000396854;ENST00000530611	T;T;T;T;D;T	0.81908	0.93;0.93;0.93;0.3;-1.55;0.93	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	D	0.89880	0.6843	M	0.75150	2.29	0.80722	D	1	D;P;P	0.56287	0.975;0.8;0.514	D;P;B	0.64410	0.925;0.474;0.326	D	0.89477	0.3747	10	0.46703	T	0.11	-10.5377	16.1986	0.82053	0.0:1.0:0.0:0.0	.	373;373;373	E9PJM1;Q86SZ6;O15321	.;.;TM9S1_HUMAN	M	373;373;582;286;373;582	ENSP00000261789:V373M;ENSP00000432997:V373M;ENSP00000451949:V582M;ENSP00000434387:V286M;ENSP00000380063:V373M;ENSP00000433967:V582M	ENSP00000433967:V582M	V	-	1	0	TM9SF1;RP11-468E2.1	23731253	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.915000	0.75770	2.699000	0.92147	0.655000	0.94253	GTG	.	.		0.532	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000073136.2	NM_006405	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36017745	36017745	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr14:36017745C>A	ENST00000389698.3	-	40	6494		c.e40-1		RALGAPA1_ENST00000258840.6_Splice_Site|RALGAPA1_ENST00000307138.6_Intron|RALGAPA1_ENST00000382366.3_Splice_Site	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)						activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATTTAATGATCTAAAGAGGGA	0.328																																					.		Atlas-SNP	.											.	RALGAPA1	289	.	0			c.6104-1G>T						.						81.0	87.0	85.0					14																	36017745		2203	4299	6502	SO:0001630	splice_region_variant	253959	exon41			AATGATCTAAAGA	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.6104-1G>T	chr14.hg19:g.36017745C>A		109.0	0.0		69.0	30.0	NM_014990	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Splice_Site	SNP	ENST00000389698.3	hg19	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.368716	0.61624	.	.	ENSG00000174373	ENST00000389698;ENST00000258840;ENST00000382366;ENST00000553892	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2786	0.98501	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RALGAPA1	35087496	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.138000	0.58017	2.868000	0.98415	0.557000	0.71058	.	.	.		0.328	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	Intron
TBPL2	387332	hgsc.bcm.edu	37	14	55907152	55907152	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr14:55907152T>C	ENST00000247219.5	-	1	182	c.112A>G	c.(112-114)Acc>Gcc	p.T38A		NM_199047.2	NP_950248.1			TATA box binding protein like 2											endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	8						TCCAGGTAGGTCTCCTCCTGC	0.682																																					p.T38A		Atlas-SNP	.											.	TBPL2	27	.	0			c.A112G						.						43.0	44.0	44.0					14																	55907152		2186	4277	6463	SO:0001583	missense	387332	exon1			GGTAGGTCTCCTC	AY457923	CCDS9724.1	14q22.2	2004-06-03			ENSG00000182521	ENSG00000182521			19841	protein-coding gene	gene with protein product		608964				14634207	Standard	NM_199047		Approved	TRF3, TBP2	uc001xby.3	Q6SJ96	OTTHUMG00000140313	ENST00000247219.5:c.112A>G	chr14.hg19:g.55907152T>C	ENSP00000247219:p.Thr38Ala	175.0	0.0		174.0	61.0	NM_199047		Missense_Mutation	SNP	ENST00000247219.5	hg19	CCDS9724.1	.	.	.	.	.	.	.	.	.	.	t	12.22	1.872330	0.33069	.	.	ENSG00000182521	ENST00000247219	T	0.41758	0.99	4.93	-4.48	0.03515	.	0.777902	0.12141	N	0.495828	T	0.21590	0.0520	L	0.36672	1.1	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.21552	-1.0242	10	0.20519	T	0.43	0.6616	1.449	0.02371	0.1948:0.2517:0.3574:0.1961	.	38	Q6SJ96	TBPL2_HUMAN	A	38	ENSP00000247219:T38A	ENSP00000247219:T38A	T	-	1	0	TBPL2	54976905	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.534000	0.06150	-0.349000	0.08274	-0.520000	0.04383	ACC	.	.		0.682	TBPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276916.1	NM_199047	
ARID4A	5926	hgsc.bcm.edu	37	14	58830925	58830925	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr14:58830925A>C	ENST00000355431.3	+	20	2491	c.2118A>C	c.(2116-2118)ttA>ttC	p.L706F	ARID4A_ENST00000348476.3_Missense_Mutation_p.L706F|ARID4A_ENST00000395168.3_Missense_Mutation_p.L706F|ARID4A_ENST00000431317.2_Missense_Mutation_p.L706F	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	706					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AAGATGCTTTAGAAAAGAATT	0.239																																					p.L706F		Atlas-SNP	.											.	ARID4A	222	.	0			c.A2118C						.						18.0	19.0	19.0					14																	58830925		1876	4046	5922	SO:0001583	missense	5926	exon20			TGCTTTAGAAAAG	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2118A>C	chr14.hg19:g.58830925A>C	ENSP00000347602:p.Leu706Phe	390.0	0.0		382.0	154.0	NM_002892	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	hg19	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	A	11.48	1.652507	0.29336	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.15718	2.46;2.46;2.46;2.46;2.4	5.8	-2.49	0.06403	Chromo domain-like (1);	0.354280	0.29646	N	0.011578	T	0.07908	0.0198	N	0.19112	0.55	0.29904	N	0.824135	P;P;P	0.45474	0.859;0.498;0.859	B;B;B	0.42422	0.387;0.146;0.387	T	0.20907	-1.0261	10	0.56958	D	0.05	-2.1234	1.0552	0.01589	0.3591:0.0968:0.2706:0.2735	.	706;706;706	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	F	706;706;706;706;384	ENSP00000347602:L706F;ENSP00000344556:L706F;ENSP00000378597:L706F;ENSP00000397368:L706F;ENSP00000416053:L384F	ENSP00000344556:L706F	L	+	3	2	ARID4A	57900678	0.994000	0.37717	0.974000	0.42286	0.931000	0.56810	0.182000	0.16900	-0.326000	0.08564	0.528000	0.53228	TTA	.	.		0.239	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
CATSPERB	79820	hgsc.bcm.edu	37	14	92185810	92185810	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr14:92185810T>G	ENST00000256343.3	-	5	478	c.322A>C	c.(322-324)Att>Ctt	p.I108L		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	108					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AACCACAAAATCCGATCACTG	0.318																																					p.I108L		Atlas-SNP	.											.	CATSPERB	114	.	0			c.A322C						.						79.0	69.0	73.0					14																	92185810		2203	4299	6502	SO:0001583	missense	79820	exon5			ACAAAATCCGATC	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.322A>C	chr14.hg19:g.92185810T>G	ENSP00000256343:p.Ile108Leu	100.0	0.0		118.0	40.0	NM_024764	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	hg19	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	T	0.245	-1.010944	0.02095	.	.	ENSG00000133962	ENST00000256343;ENST00000553329	T	0.41758	0.99	3.62	-6.09	0.02145	.	1.359100	0.05149	N	0.495740	T	0.19485	0.0468	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.14839	-1.0458	10	0.15066	T	0.55	-0.9497	1.5037	0.02482	0.1194:0.3043:0.2371:0.3392	.	108	Q9H7T0	CTSRB_HUMAN	L	108;61	ENSP00000256343:I108L	ENSP00000256343:I108L	I	-	1	0	CATSPERB	91255563	0.000000	0.05858	0.000000	0.03702	0.207000	0.24258	-1.012000	0.03649	-1.542000	0.01725	-1.245000	0.01525	ATT	.	.		0.318	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
TRIP11	9321	hgsc.bcm.edu	37	14	92470139	92470139	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr14:92470139T>A	ENST00000267622.4	-	11	4554	c.4181A>T	c.(4180-4182)gAa>gTa	p.E1394V		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1394					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CTGCTTGATTTCTGAATCGGT	0.373			T	PDGFRB	AML																																p.E1394V	Ovarian(84;609 1888 9852 42686)	Atlas-SNP	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11	184	.	0			c.A4181T						.						112.0	111.0	111.0					14																	92470139		2203	4300	6503	SO:0001583	missense	9321	exon11			TTGATTTCTGAAT	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.4181A>T	chr14.hg19:g.92470139T>A	ENSP00000267622:p.Glu1394Val	144.0	0.0		101.0	36.0	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	hg19	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.81|13.81	2.348803|2.348803	0.41599|0.41599	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000267622;ENST00000542257|ENST00000554357	T|.	0.11495|.	2.77|.	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	0.127973|.	0.49916|.	D|.	0.000124|.	T|T	0.62332|0.62332	0.2419|0.2419	L|L	0.59436|0.59436	1.845|1.845	0.44523|0.44523	D|D	0.997471|0.997471	D;D|.	0.89917|.	0.996;1.0|.	P;D|.	0.77004|.	0.885;0.989|.	T|T	0.61768|0.61768	-0.6995|-0.6995	10|5	0.49607|.	T|.	0.09|.	.|.	9.8053|9.8053	0.40789|0.40789	0.0:0.0773:0.0:0.9227|0.0:0.0773:0.0:0.9227	.|.	1130;1394|.	F5H1Z0;Q15643|.	.;TRIPB_HUMAN|.	V|S	1394;1130|1109	ENSP00000267622:E1394V|.	ENSP00000267622:E1394V|.	E|R	-|-	2|3	0|2	TRIP11|TRIP11	91539892|91539892	1.000000|1.000000	0.71417|0.71417	0.080000|0.080000	0.20451|0.20451	0.152000|0.152000	0.21847|0.21847	7.747000|7.747000	0.85070|0.85070	2.018000|2.018000	0.59344|0.59344	0.379000|0.379000	0.24179|0.24179	GAA|AGA	.	.		0.373	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
CHP1	11261	hgsc.bcm.edu	37	15	41571555	41571555	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr15:41571555G>A	ENST00000334660.5	+	7	796	c.556G>A	c.(556-558)Gaa>Aaa	p.E186K	CHP1_ENST00000560397.1_Missense_Mutation_p.E145K|CHP1_ENST00000558351.1_3'UTR	NM_007236.4	NP_009167.1	Q99653	CHP1_HUMAN	calcineurin-like EF-hand protein 1	186	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion-dependent exocytosis (GO:0017156)|cellular response to acidic pH (GO:0071468)|cytoplasmic microtubule organization (GO:0031122)|membrane docking (GO:0022406)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|microtubule bundle formation (GO:0001578)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatase activity (GO:0010923)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein import into nucleus (GO:0042308)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein glycosylation (GO:0060050)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of protein transport (GO:0051222)|positive regulation of sodium:proton antiporter activity (GO:0032417)|potassium ion transport (GO:0006813)|protein export from nucleus (GO:0006611)|protein oligomerization (GO:0051259)|protein stabilization (GO:0050821)|regulation of intracellular pH (GO:0051453)|small GTPase mediated signal transduction (GO:0007264)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|kinase binding (GO:0019900)|microtubule binding (GO:0008017)|potassium channel regulator activity (GO:0015459)|protein kinase inhibitor activity (GO:0004860)|transporter activity (GO:0005215)										GGTGGATGTAGAACAGAAAAT	0.403																																					p.E186K		Atlas-SNP	.											.	.	.	.	0			c.G556A						.						118.0	103.0	108.0					15																	41571555		2203	4300	6503	SO:0001583	missense	11261	exon7			GATGTAGAACAGA		CCDS10073.1	15q13.3	2013-01-11	2013-01-11		ENSG00000187446	ENSG00000187446		"""EF-hand domain containing"""	17433	protein-coding gene	gene with protein product	"""calcineurin homologous protein"""	606988				15987692, 20720019	Standard	NM_007236		Approved	Sid470p, CHP, SLC9A1BP, p22, p24	uc001znl.3	Q99653	OTTHUMG00000130233	ENST00000334660.5:c.556G>A	chr15.hg19:g.41571555G>A	ENSP00000335632:p.Glu186Lys	101.0	0.0		125.0	54.0	NM_007236	B2R6H9|Q6FHZ9	Missense_Mutation	SNP	ENST00000334660.5	hg19	CCDS10073.1	.	.	.	.	.	.	.	.	.	.	G	36	5.720743	0.96839	.	.	ENSG00000187446	ENST00000334660	T	0.67171	-0.25	5.51	5.51	0.81932	EF-hand-like domain (1);	0.110399	0.64402	D	0.000003	T	0.77968	0.4210	L	0.50333	1.59	0.80722	D	1	D	0.69078	0.997	D	0.68039	0.955	T	0.79361	-0.1835	10	0.72032	D	0.01	-16.4974	18.1792	0.89772	0.0:0.0:1.0:0.0	.	186	Q99653	CHP1_HUMAN	K	186	ENSP00000335632:E186K	ENSP00000335632:E186K	E	+	1	0	AC012652.1	39358847	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.488000	0.97947	2.583000	0.87209	0.591000	0.81541	GAA	.	.		0.403	CHP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252554.2	NM_007236	
RAB11FIP3	9727	hgsc.bcm.edu	37	16	532669	532669	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr16:532669G>A	ENST00000262305.4	+	4	1436	c.1048G>A	c.(1048-1050)Gtg>Atg	p.V350M	RAB11FIP3_ENST00000457159.1_Missense_Mutation_p.V350M|RAB11FIP3_ENST00000450428.1_Missense_Mutation_p.V54M	NM_014700.3	NP_055515.1	O75154	RFIP3_HUMAN	RAB11 family interacting protein 3 (class II)	350					cytokinesis (GO:0000910)|endocytic recycling (GO:0032456)|vesicle-mediated transport (GO:0016192)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|endosome (GO:0005768)|intercellular bridge (GO:0045171)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ADP-ribosylation factor binding (GO:0030306)|calcium ion binding (GO:0005509)|protein homodimerization activity (GO:0042803)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|kidney(3)|lung(5)|upper_aerodigestive_tract(1)	12		Hepatocellular(16;0.0218)				CGGCTCGGCCGTGCCCTCTGA	0.677																																					p.V350M	Melanoma(160;2366 2595 4474 8099)	Atlas-SNP	.											.	RAB11FIP3	31	.	0			c.G1048A						.						43.0	36.0	39.0					16																	532669		2200	4300	6500	SO:0001583	missense	9727	exon4			TCGGCCGTGCCCT	AB014565	CCDS32351.1, CCDS45364.1	16p13.3	2013-01-10			ENSG00000090565	ENSG00000090565		"""EF-hand domain containing"""	17224	protein-coding gene	gene with protein product		608738				9734811, 11481332	Standard	NM_014700		Approved	KIAA0665, Rab11-FIP3, eferin	uc002chf.3	O75154	OTTHUMG00000047843	ENST00000262305.4:c.1048G>A	chr16.hg19:g.532669G>A	ENSP00000262305:p.Val350Met	87.0	0.0		86.0	4.0	NM_014700	B0QYI8|B0QYT8|B1AHQ0|B4DEI7|B4DZR6|Q4VXV7|Q7Z5E9|Q9H155|Q9H1G0|Q9NUI0	Missense_Mutation	SNP	ENST00000262305.4	hg19	CCDS32351.1	.	.	.	.	.	.	.	.	.	.	G	5.053	0.195423	0.09599	.	.	ENSG00000090565	ENST00000262305;ENST00000457159;ENST00000434585;ENST00000450428;ENST00000452814;ENST00000449879;ENST00000448401;ENST00000412256	.	.	.	5.12	2.02	0.26589	.	.	.	.	.	T	0.22975	0.0555	L	0.36672	1.1	0.09310	N	1	P;B;B	0.36048	0.534;0.087;0.342	B;B;B	0.28305	0.088;0.01;0.029	T	0.09465	-1.0673	8	0.41790	T	0.15	-27.6558	6.4594	0.21948	0.1631:0.148:0.6889:0.0	.	350;54;350	O75154-3;O75154-2;O75154	.;.;RFIP3_HUMAN	M	350;350;226;54;40;54;54;5	.	ENSP00000262305:V350M	V	+	1	0	RAB11FIP3	472670	0.995000	0.38212	0.186000	0.23195	0.042000	0.13812	2.535000	0.45685	0.171000	0.19730	-0.126000	0.14955	GTG	.	.		0.677	RAB11FIP3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109066.4	NM_014700	
GLYR1	84656	hgsc.bcm.edu	37	16	4861735	4861735	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr16:4861735T>C	ENST00000321919.9	-	14	1427	c.1351A>G	c.(1351-1353)Att>Gtt	p.I451V	GLYR1_ENST00000591451.1_Missense_Mutation_p.I445V|GLYR1_ENST00000436648.5_Missense_Mutation_p.I370V|GLYR1_ENST00000381983.3_Missense_Mutation_p.I434V	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	451					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						CCCTCGGCAATAGTGGCCATG	0.582																																					p.I451V		Atlas-SNP	.											.	GLYR1	49	.	0			c.A1351G						.						80.0	72.0	75.0					16																	4861735		2197	4300	6497	SO:0001583	missense	84656	exon14			CGGCAATAGTGGC	AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.1351A>G	chr16.hg19:g.4861735T>C	ENSP00000322716:p.Ile451Val	59.0	0.0		69.0	28.0	NM_032569	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	ENST00000321919.9	hg19	CCDS10524.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.885947	0.33348	.	.	ENSG00000140632	ENST00000321919;ENST00000381983;ENST00000436648	T;T;T	0.27104	1.69;1.69;1.69	5.85	5.85	0.93711	Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.045987	0.85682	D	0.000000	T	0.16041	0.0386	N	0.12182	0.205	0.54753	D	0.999982	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.002;0.004;0.002;0.001	T	0.09487	-1.0672	10	0.23302	T	0.38	-12.9502	15.2169	0.73274	0.0:0.0:0.0:1.0	.	370;445;434;451	Q49A26-5;Q49A26-3;Q49A26-2;Q49A26	.;.;.;GLYR1_HUMAN	V	451;434;370	ENSP00000322716:I451V;ENSP00000371413:I434V;ENSP00000390276:I370V	ENSP00000322716:I451V	I	-	1	0	GLYR1	4801736	1.000000	0.71417	0.923000	0.36655	0.886000	0.51366	5.881000	0.69706	2.234000	0.73211	0.533000	0.62120	ATT	.	.		0.582	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251717.2	NM_032569	
CDH11	1009	hgsc.bcm.edu	37	16	65025837	65025837	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr16:65025837A>T	ENST00000268603.4	-	6	1260	c.645T>A	c.(643-645)ggT>ggA	p.G215G	CDH11_ENST00000566827.1_Splice_Site_p.G89G|CDH11_ENST00000394156.3_Splice_Site_p.G215G	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	215	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TTCTGATGATACCTGGACAGG	0.478			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.G215G		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	260	.	0			c.T645A						.						181.0	123.0	143.0					16																	65025837		2203	4300	6503	SO:0001630	splice_region_variant	1009	exon6			GATGATACCTGGA	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.644-1T>A	chr16.hg19:g.65025837A>T		98.0	0.0		129.0	51.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Silent	SNP	ENST00000268603.4	hg19	CCDS10803.1																																																																																			.	.		0.478	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	Silent
EIF1	10209	hgsc.bcm.edu	37	17	39847045	39847045	+	Silent	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr17:39847045T>C	ENST00000469257.1	+	4	455	c.309T>C	c.(307-309)gcT>gcC	p.A103A	EIF1_ENST00000310837.4_3'UTR|JUP_ENST00000540235.1_Intron|EIF1_ENST00000591776.1_Silent_p.A103A			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1	103					dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TTGGACTGGCTAAGGACGATC	0.448																																					p.A103A	Pancreas(176;1692 2837 16734 17588)	Atlas-SNP	.											.	EIF1	10	.	0			c.T309C						.						158.0	142.0	147.0					17																	39847045		2203	4300	6503	SO:0001819	synonymous_variant	10209	exon4			ACTGGCTAAGGAC	AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.309T>C	chr17.hg19:g.39847045T>C		88.0	0.0		89.0	28.0	NM_005801	Q9UNQ9	Silent	SNP	ENST00000469257.1	hg19	CCDS11403.1																																																																																			.	.		0.448	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257390.1	NM_005801	
G6PC	2538	hgsc.bcm.edu	37	17	41056040	41056040	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr17:41056040C>T	ENST00000253801.2	+	2	402	c.323C>T	c.(322-324)aCc>aTc	p.T108I	G6PC_ENST00000585489.1_Missense_Mutation_p.T108I|G6PC_ENST00000592383.1_Missense_Mutation_p.T108I	NM_000151.3	NP_000142.2	P35575	G6PC_HUMAN	glucose-6-phosphatase, catalytic subunit	108			T -> I (in GSD1A). {ECO:0000269|PubMed:10447271, ECO:0000269|PubMed:11058903}.		carbohydrate metabolic process (GO:0005975)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|gluconeogenesis (GO:0006094)|glucose 6-phosphate metabolic process (GO:0051156)|glucose homeostasis (GO:0042593)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|hexose transport (GO:0008645)|multicellular organism growth (GO:0035264)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)|urate metabolic process (GO:0046415)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	glucose-6-phosphatase activity (GO:0004346)|phosphate ion binding (GO:0042301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.113)		TTCCCTGTAACCTGTGAGACT	0.507																																					p.T108I		Atlas-SNP	.											.	G6PC	48	.	0			c.C323T	GRCh37	CM990607	G6PC	M		.						128.0	110.0	116.0					17																	41056040		2203	4300	6503	SO:0001583	missense	2538	exon2			CTGTAACCTGTGA	U01120	CCDS11446.1, CCDS59291.1	17q21	2014-09-17	2006-06-28			ENSG00000131482	3.1.3.9		4056	protein-coding gene	gene with protein product	"""glycogen storage disease type I, von Gierke disease"""	613742	"""glucose-6-phosphatase, catalytic (glycogen storage disease type I, von Gierke disease)"""	G6PT		7774924	Standard	NM_000151		Approved	GSD1a	uc002icb.2	P35575		ENST00000253801.2:c.323C>T	chr17.hg19:g.41056040C>T	ENSP00000253801:p.Thr108Ile	100.0	0.0		89.0	40.0	NM_001270397	A1L4C0|B4E1C3|K7EL82	Missense_Mutation	SNP	ENST00000253801.2	hg19	CCDS11446.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.390114	0.82902	.	.	ENSG00000131482	ENST00000253801	D	0.83837	-1.77	4.74	4.74	0.60224	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89646	0.6775	L	0.59967	1.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.90777	0.4676	10	0.87932	D	0	.	17.9027	0.88909	0.0:1.0:0.0:0.0	.	110;108	E7ENG5;P35575	.;G6PC_HUMAN	I	108	ENSP00000253801:T108I	ENSP00000253801:T108I	T	+	2	0	G6PC	38309566	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	7.604000	0.82830	2.455000	0.83008	0.491000	0.48974	ACC	.	.		0.507	G6PC-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452451.1	NM_000151	
ITGB4	3691	hgsc.bcm.edu	37	17	73738423	73738423	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr17:73738423C>A	ENST00000200181.3	+	24	2822	c.2635C>A	c.(2635-2637)Caa>Aaa	p.Q879K	ITGB4_ENST00000339591.3_Splice_Site_p.Q879K|ITGB4_ENST00000579662.1_Splice_Site_p.Q879K|ITGB4_ENST00000449880.2_Splice_Site_p.Q879K|ITGB4_ENST00000584558.1_3'UTR|ITGB4_ENST00000450894.3_Splice_Site_p.Q879K	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	879					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCGACCCAGGCAAGACCACAC	0.642																																					p.Q879K		Atlas-SNP	.											.	ITGB4	165	.	0			c.C2635A						.						33.0	30.0	31.0					17																	73738423		2203	4300	6503	SO:0001630	splice_region_variant	3691	exon24			CCCAGGCAAGACC		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.2634-1C>A	chr17.hg19:g.73738423C>A		95.0	0.0		140.0	75.0	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879802	0.51801	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.75821	-0.97;-0.91;-0.91	5.64	5.64	0.86602	.	0.065848	0.64402	D	0.000006	T	0.81763	0.4891	L	0.34521	1.04	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.83275	0.996;0.991;0.991	T	0.83289	-0.0034	10	0.87932	D	0	.	19.7154	0.96115	0.0:1.0:0.0:0.0	.	879;879;879	P16144-3;A0AVL6;P16144	.;.;ITB4_HUMAN	K	879	ENSP00000200181:Q879K;ENSP00000344079:Q879K;ENSP00000400217:Q879K	ENSP00000200181:Q879K	Q	+	1	0	ITGB4	71250018	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.890000	0.63178	2.664000	0.90586	0.655000	0.94253	CAA	.	.		0.642	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		Missense_Mutation
FASN	2194	hgsc.bcm.edu	37	17	80038617	80038617	+	Silent	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr17:80038617G>A	ENST00000306749.2	-	39	6995	c.6777C>T	c.(6775-6777)agC>agT	p.S2259S	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2259	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGGAGGCCAGGCTGTGGAACA	0.687																																					p.S2259S	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.C6777T						.						44.0	45.0	45.0					17																	80038617		2191	4290	6481	SO:0001819	synonymous_variant	2194	exon39			GGCCAGGCTGTGG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6777C>T	chr17.hg19:g.80038617G>A		121.0	0.0		187.0	47.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	hg19	CCDS11801.1																																																																																			.	.		0.687	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
EPB41L3	23136	hgsc.bcm.edu	37	18	5410602	5410602	+	Missense_Mutation	SNP	G	G	T	rs373780287		TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr18:5410602G>T	ENST00000341928.2	-	14	2424	c.2084C>A	c.(2083-2085)aCg>aAg	p.T695K	EPB41L3_ENST00000427684.2_5'UTR|EPB41L3_ENST00000544123.1_Missense_Mutation_p.T526K|EPB41L3_ENST00000542146.1_5'UTR|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000540638.2_Missense_Mutation_p.T526K|EPB41L3_ENST00000342933.3_Missense_Mutation_p.T695K|EPB41L3_ENST00000400111.3_Missense_Mutation_p.T526K	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	695	Spectrin--actin-binding. {ECO:0000255}.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)	p.T695M(1)		breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						TGCGGTGTCCGTGCGCTCACT	0.557																																					p.T695K		Atlas-SNP	.											EPB41L3,NS,carcinoma,0,1	EPB41L3	222	.	1	Substitution - Missense(1)	kidney(1)	c.C2084A						.						103.0	67.0	79.0					18																	5410602		2203	4300	6503	SO:0001583	missense	23136	exon14			GTGTCCGTGCGCT	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2084C>A	chr18.hg19:g.5410602G>T	ENSP00000343158:p.Thr695Lys	93.0	0.0		75.0	47.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	19.72	3.879968	0.72294	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	D;D;D;D	0.83992	-1.66;-1.79;-1.66;-1.78	5.24	5.24	0.73138	.	0.058714	0.64402	D	0.000002	D	0.84388	0.5461	N	0.19112	0.55	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.994;0.995;0.995;0.998;0.999	T	0.80821	-0.1211	10	0.15952	T	0.53	.	18.8177	0.92084	0.0:0.0:1.0:0.0	.	526;87;417;526;695	F5GX05;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;.;E41L3_HUMAN	K	695;417;526;417;695;526	ENSP00000343158:T695K;ENSP00000441174:T526K;ENSP00000341138:T695K;ENSP00000382981:T526K	ENSP00000343158:T695K	T	-	2	0	EPB41L3	5400602	1.000000	0.71417	0.939000	0.37840	0.949000	0.60115	9.138000	0.94501	2.453000	0.82957	0.591000	0.81541	ACG	.	.		0.557	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
SLC35E1	79939	hgsc.bcm.edu	37	19	16664490	16664490	+	Nonstop_Mutation	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:16664490C>A	ENST00000595753.1	-	6	1250	c.1233G>T	c.(1231-1233)taG>taT	p.*411Y	CTD-3222D19.2_ENST00000409035.1_Intron|CTD-3222D19.11_ENST00000597357.1_RNA|SLC35E1_ENST00000593812.1_5'Flank	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	0					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						CCTTTGGACTCTACACATCAT	0.517																																					p.X411Y		Atlas-SNP	.											.	SLC35E1	48	.	0			c.G1233T						.						176.0	156.0	163.0					19																	16664490		2203	4300	6503	SO:0001578	stop_lost	79939	exon6			TGGACTCTACACA	AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.1233G>T	chr19.hg19:g.16664490C>A		110.0	0.0		122.0	10.0	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	hg19	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744666	0.30865	.	.	ENSG00000127526	ENST00000409648	.	.	.	4.96	3.93	0.45458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.3586	0.32346	0.0:0.8273:0.0:0.1727	.	.	.	.	Y	411	.	.	X	-	3	2	SLC35E1	16525490	0.996000	0.38824	0.990000	0.47175	0.571000	0.35966	2.463000	0.45058	2.307000	0.77673	0.561000	0.74099	TAG	.	.		0.517	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
ZNF536	9745	hgsc.bcm.edu	37	19	30935445	30935445	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:30935445G>T	ENST00000355537.3	+	2	1123	c.976G>T	c.(976-978)Gcc>Tcc	p.A326S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	326					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ACACATCACGGCCGAGTCGGC	0.652																																					p.A326S		Atlas-SNP	.											.	ZNF536	424	.	0			c.G976T						.						88.0	100.0	96.0					19																	30935445		2203	4300	6503	SO:0001583	missense	9745	exon2			ATCACGGCCGAGT		CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.976G>T	chr19.hg19:g.30935445G>T	ENSP00000347730:p.Ala326Ser	51.0	0.0		56.0	4.0	NM_014717	A2RU18	Missense_Mutation	SNP	ENST00000355537.3	hg19	CCDS32984.1	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813411	0.32053	.	.	ENSG00000198597	ENST00000355537	T	0.09350	2.99	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.19167	0.0460	N	0.16098	0.37	0.50813	D	0.999892	D;D	0.89917	0.999;1.0	D;D	0.83275	0.957;0.996	T	0.22034	-1.0228	10	0.23302	T	0.38	-27.943	19.5661	0.95393	0.0:0.0:1.0:0.0	.	326;326	A7E228;O15090	.;ZN536_HUMAN	S	326	ENSP00000347730:A326S	ENSP00000347730:A326S	A	+	1	0	ZNF536	35627285	1.000000	0.71417	0.985000	0.45067	0.909000	0.53808	8.024000	0.88770	2.631000	0.89168	0.491000	0.48974	GCC	.	.		0.652	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459667.2	NM_014717	
ANKRD27	84079	hgsc.bcm.edu	37	19	33108518	33108518	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:33108518C>A	ENST00000306065.4	-	21	2187	c.2029G>T	c.(2029-2031)Gtt>Ttt	p.V677F		NM_032139.2	NP_115515.2	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	677					early endosome to late endosome transport (GO:0045022)|positive regulation of GTPase activity (GO:0043547)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|lysosome (GO:0005764)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			breast(3)|endometrium(7)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	42	Esophageal squamous(110;0.137)					CCATCAGCAACTGCTCTCAAA	0.289																																					p.V677F		Atlas-SNP	.											.	ANKRD27	86	.	0			c.G2029T						.						28.0	32.0	30.0					19																	33108518		2200	4299	6499	SO:0001583	missense	84079	exon21			CAGCAACTGCTCT	AK054561	CCDS32986.1	19q13.12	2013-01-10				ENSG00000105186		"""Ankyrin repeat domain containing"""	25310	protein-coding gene	gene with protein product	"""Vps9 domain and ankyrin-repeat-containing protein"""					11230166, 16525121	Standard	NM_032139		Approved	FLJ00040, DKFZp434L0718, VARP	uc002ntn.1	Q96NW4		ENST00000306065.4:c.2029G>T	chr19.hg19:g.33108518C>A	ENSP00000304292:p.Val677Phe	507.0	0.0		560.0	189.0	NM_032139	Q71MF5|Q86UC3|Q8ND80|Q9H0I4	Missense_Mutation	SNP	ENST00000306065.4	hg19	CCDS32986.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065904	0.76187	.	.	ENSG00000105186	ENST00000306065	T	0.72615	-0.67	5.71	3.58	0.41010	Ankyrin repeat-containing domain (3);	0.128573	0.34750	N	0.003701	T	0.80065	0.4555	M	0.63208	1.945	0.80722	D	1	D	0.65815	0.995	D	0.71656	0.974	T	0.81665	-0.0830	10	0.66056	D	0.02	-19.7631	12.1502	0.54046	0.0:0.8605:0.0:0.1395	.	677	Q96NW4	ANR27_HUMAN	F	677	ENSP00000304292:V677F	ENSP00000304292:V677F	V	-	1	0	ANKRD27	37800358	0.994000	0.37717	0.961000	0.40146	0.979000	0.70002	2.940000	0.49003	1.414000	0.47017	0.655000	0.94253	GTT	.	.		0.289	ANKRD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450329.1	NM_032139	
MAMSTR	284358	hgsc.bcm.edu	37	19	49217263	49217263	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:49217263G>A	ENST00000318083.6	-	8	826	c.763C>T	c.(763-765)Cgt>Tgt	p.R255C	MAMSTR_ENST00000419611.1_Missense_Mutation_p.R152C|MAMSTR_ENST00000377367.3_Missense_Mutation_p.R87C|MAMSTR_ENST00000594582.1_Missense_Mutation_p.R87C|MAMSTR_ENST00000356751.4_Missense_Mutation_p.R152C			Q6ZN01	MASTR_HUMAN	MEF2 activating motif and SAP domain containing transcriptional regulator	255	Pro-rich.|Transcription activation. {ECO:0000250}.				positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)			endometrium(1)|ovary(1)	2						TCCGCGGCACGTGGAAGAGGT	0.697																																					p.R255C		Atlas-SNP	.											.	MAMSTR	36	.	0			c.C763T						.						21.0	21.0	21.0					19																	49217263		2203	4298	6501	SO:0001583	missense	284358	exon8			CGGCACGTGGAAG	AK093389	CCDS12730.1, CCDS46137.1, CCDS74415.1	19q13.33	2009-07-09			ENSG00000176909	ENSG00000176909			26689	protein-coding gene	gene with protein product	"""MEF2-activating SAP transcriptional regulator"""	610349				16818234	Standard	NM_182574		Approved	MASTR, FLJ36070	uc002pkg.2	Q6ZN01		ENST00000318083.6:c.763C>T	chr19.hg19:g.49217263G>A	ENSP00000324175:p.Arg255Cys	71.0	0.0		99.0	15.0	NM_001130915	B7ZKX4|Q3KQU9|Q8N9Y3	Missense_Mutation	SNP	ENST00000318083.6	hg19	CCDS46137.1	.	.	.	.	.	.	.	.	.	.	G	14.08	2.427550	0.43122	.	.	ENSG00000176909	ENST00000318083;ENST00000419611;ENST00000377367;ENST00000356751	.	.	.	4.2	-2.46	0.06461	.	1.173220	0.06373	N	0.713813	T	0.29028	0.0721	L	0.47716	1.5	0.09310	N	1	D	0.63880	0.993	B	0.44315	0.446	T	0.30238	-0.9985	9	0.36615	T	0.2	3.8991	3.9466	0.09350	0.0952:0.4417:0.3008:0.1622	.	255	Q6ZN01	MASTR_HUMAN	C	255;152;87;152	.	ENSP00000324175:R255C	R	-	1	0	MAMSTR	53909075	0.001000	0.12720	0.000000	0.03702	0.025000	0.11179	0.287000	0.18920	-0.255000	0.09486	-0.425000	0.05940	CGT	.	.		0.697	MAMSTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466179.1	NM_182574	
NUCB1	4924	hgsc.bcm.edu	37	19	49407702	49407702	+	Silent	SNP	G	G	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:49407702G>A	ENST00000405315.4	+	3	568	c.234G>A	c.(232-234)gaG>gaA	p.E78E	NUCB1_ENST00000407032.1_Silent_p.E78E|NUCB1_ENST00000485798.1_Intron|NUCB1_ENST00000263273.5_Silent_p.E78E	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1	78						endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		CCAATGCGGAGGACATCAAGG	0.572																																					p.E78E		Atlas-SNP	.											.	NUCB1	44	.	0			c.G234A						.						53.0	43.0	46.0					19																	49407702		2203	4300	6503	SO:0001819	synonymous_variant	4924	exon3			TGCGGAGGACATC	BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514	ENST00000405315.4:c.234G>A	chr19.hg19:g.49407702G>A		68.0	0.0		61.0	24.0	NM_006184	B2RD64|Q15838|Q7Z4J7|Q9BUR1	Silent	SNP	ENST00000405315.4	hg19	CCDS12740.1	.	.	.	.	.	.	.	.	.	.	g	0.336	-0.953283	0.02285	.	.	ENSG00000104805	ENST00000424608	.	.	.	4.23	3.19	0.36642	.	.	.	.	.	T	0.54062	0.1835	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48581	-0.9023	4	.	.	.	.	5.4936	0.16789	0.1059:0.0:0.6976:0.1965	.	.	.	.	K	78	.	.	R	+	2	0	NUCB1	54099514	1.000000	0.71417	0.998000	0.56505	0.013000	0.08279	0.890000	0.28295	0.936000	0.37367	0.283000	0.19423	AGG	.	.		0.572	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326545.2	NM_006184	
SIGLEC6	946	hgsc.bcm.edu	37	19	52033118	52033118	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:52033118G>T	ENST00000425629.3	-	5	1026	c.872C>A	c.(871-873)cCc>cAc	p.P291H	SIGLEC6_ENST00000346477.3_Missense_Mutation_p.P275H|SIGLEC6_ENST00000391797.3_Missense_Mutation_p.P280H|SIGLEC6_ENST00000343300.4_Missense_Mutation_p.P291H|SIGLEC6_ENST00000474054.1_5'Flank|SIGLEC6_ENST00000359982.4_Missense_Mutation_p.P302H|SIGLEC6_ENST00000436458.1_Missense_Mutation_p.P239H	NM_001245.5	NP_001236.4	O43699	SIGL6_HUMAN	sialic acid binding Ig-like lectin 6	291	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(15)|ovary(1)|stomach(1)	28		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.00115)|OV - Ovarian serous cystadenocarcinoma(262;0.0165)		GTTCAGGGCGGGGAAGCCCTG	0.632																																					p.P302H		Atlas-SNP	.											.	SIGLEC6	142	.	0			c.C905A						.						65.0	74.0	71.0					19																	52033118		2198	4296	6494	SO:0001583	missense	946	exon5			AGGGCGGGGAAGC	D86358	CCDS12834.3, CCDS12835.3, CCDS12836.3, CCDS54307.1, CCDS54308.1, CCDS59417.1	19q13.3	2013-01-29			ENSG00000105492	ENSG00000105492		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10875	protein-coding gene	gene with protein product		604405		CD33L, CD33L1		9465907	Standard	NM_001245		Approved	OB-BP1, SIGLEC-6, CD327	uc002pwy.3	O43699	OTTHUMG00000133571	ENST00000425629.3:c.872C>A	chr19.hg19:g.52033118G>T	ENSP00000401502:p.Pro291His	130.0	0.0		123.0	42.0	NM_001177548	A8MV71|B2RTS8|C9JBE5|F8WA78|O15388|O43700	Missense_Mutation	SNP	ENST00000425629.3	hg19	CCDS12834.3	.	.	.	.	.	.	.	.	.	.	G	8.581	0.882386	0.17467	.	.	ENSG00000105492	ENST00000346477;ENST00000391797;ENST00000425629;ENST00000359982;ENST00000436458;ENST00000343300	T;T;T;T;T	0.66460	1.56;-0.21;-0.21;-0.21;-0.21	3.71	-2.77	0.05877	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.525480	0.04431	N	0.369326	T	0.71962	0.3402	L	0.53249	1.67	0.09310	N	1	P;D;P;B;B;B	0.65815	0.531;0.995;0.659;0.019;0.014;0.069	P;D;P;B;B;B	0.66602	0.482;0.945;0.669;0.049;0.039;0.063	T	0.60826	-0.7186	10	0.45353	T	0.12	.	3.3912	0.07290	0.534:0.0:0.2709:0.1951	.	302;239;280;291;275;291	F8WA78;C9JBE5;O43699-4;O43699-2;O43699-3;O43699	.;.;.;.;.;SIGL6_HUMAN	H	264;275;291;302;239;291	ENSP00000344064:P264H;ENSP00000401502:P291H;ENSP00000353071:P302H;ENSP00000410679:P239H;ENSP00000345907:P291H	ENSP00000345907:P291H	P	-	2	0	SIGLEC6	56724930	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.133000	0.10451	-0.179000	0.10654	-0.351000	0.07748	CCC	.	.		0.632	SIGLEC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257670.3	NM_001245	
TSEN34	79042	hgsc.bcm.edu	37	19	54695356	54695356	+	Silent	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:54695356C>T	ENST00000396383.1	+	2	452	c.141C>T	c.(139-141)ggC>ggT	p.G47G	MBOAT7_ENST00000338624.6_5'Flank|MBOAT7_ENST00000431666.2_5'Flank|TSEN34_ENST00000396388.2_Silent_p.G47G|MBOAT7_ENST00000391754.1_5'Flank|CTD-3093M3.1_ENST00000594382.1_lincRNA|TSEN34_ENST00000302937.4_Silent_p.G47G|TSEN34_ENST00000429671.2_Silent_p.G47G|MBOAT7_ENST00000474910.1_5'Flank|MBOAT7_ENST00000245615.1_5'Flank			Q9BSV6	SEN34_HUMAN	TSEN34 tRNA splicing endonuclease subunit	47					mRNA processing (GO:0006397)|tRNA-type intron splice site recognition and cleavage (GO:0000379)	tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	10	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CGCGCCTGGGCCTCCCGCTGC	0.766																																					p.G47G	Esophageal Squamous(37;841 964 4869 42824)	Atlas-SNP	.											.	TSEN34	17	.	0			c.C141T						.						5.0	6.0	6.0					19																	54695356		1597	3632	5229	SO:0001819	synonymous_variant	79042	exon2			CCTGGGCCTCCCG	AF211970	CCDS42609.1, CCDS74446.1	19q13.4	2013-08-06	2013-08-06	2005-03-12	ENSG00000170892	ENSG00000170892		"""tRNA splicing endonuclease subunits"""	15506	protein-coding gene	gene with protein product		608754	"""leukocyte receptor cluster (LRC) member 5"", ""tRNA splicing endonuclease 34 homolog (SEN34, S. cerevisiae)"", ""tRNA splicing endonuclease 34 homolog (S. cerevisiae)"""	LENG5		10941842, 15109492	Standard	NM_024075		Approved	SEN34, SEN34L	uc002qdw.3	Q9BSV6	OTTHUMG00000066515	ENST00000396383.1:c.141C>T	chr19.hg19:g.54695356C>T		45.0	0.0		44.0	18.0	NM_024075	A6NNB1|B0V3J1|Q9BVT1|Q9H6H5	Silent	SNP	ENST00000396383.1	hg19	CCDS42609.1																																																																																			.	.		0.766	TSEN34-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142200.1	NM_024075	
LILRA1	11024	hgsc.bcm.edu	37	19	55106839	55106839	+	Silent	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:55106839C>A	ENST00000251372.3	+	5	815	c.633C>A	c.(631-633)ccC>ccA	p.P211P	LILRB1_ENST00000396321.2_Intron|LILRA1_ENST00000453777.1_Silent_p.P211P|LILRB1_ENST00000418536.2_Intron|LILRA1_ENST00000473156.1_3'UTR|LILRB1_ENST00000448689.1_Intron	NM_006863.2	NP_006854.1	O75019	LIRA1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1	211	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	47				GBM - Glioblastoma multiforme(193;0.0348)		GGTCTCTACCCAGTGATCTCC	0.597																																					p.P211P		Atlas-SNP	.											.	LILRA1	105	.	0			c.C633A						.						138.0	147.0	144.0					19																	55106839		2203	4300	6503	SO:0001819	synonymous_variant	11024	exon5			TCTACCCAGTGAT	AF025530	CCDS12901.1, CCDS62802.1	19q13.4	2013-01-11			ENSG00000104974	ENSG00000104974		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6602	protein-coding gene	gene with protein product		604810				9548455	Standard	NM_006863		Approved	LIR-6, CD85i, LIR6	uc002qgh.2	O75019	OTTHUMG00000065701	ENST00000251372.3:c.633C>A	chr19.hg19:g.55106839C>A		108.0	0.0		104.0	41.0	NM_006863	O75018|Q3MJA6	Silent	SNP	ENST00000251372.3	hg19	CCDS12901.1																																																																																			.	.		0.597	LILRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140807.2	NM_006863	
TTPAL	79183	hgsc.bcm.edu	37	20	43108747	43108747	+	Silent	SNP	A	A	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr20:43108747A>T	ENST00000372904.3	+	3	251	c.108A>T	c.(106-108)acA>acT	p.T36T	TTPAL_ENST00000262605.4_Silent_p.T36T|TTPAL_ENST00000372906.2_Silent_p.T36T	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	36						intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						GCTCACTGACAGAAGACCTGG	0.562																																					p.T36T		Atlas-SNP	.											.	TTPAL	31	.	0			c.A108T						.						78.0	68.0	72.0					20																	43108747		2203	4300	6503	SO:0001819	synonymous_variant	79183	exon2			ACTGACAGAAGAC	BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.108A>T	chr20.hg19:g.43108747A>T		179.0	0.0		155.0	58.0	NM_001039199	E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Silent	SNP	ENST00000372904.3	hg19	CCDS13332.2																																																																																			.	.		0.562	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106886.2	NM_024331	
KRTAP13-2	337959	hgsc.bcm.edu	37	21	31744028	31744028	+	Silent	SNP	T	T	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr21:31744028T>A	ENST00000399889.2	-	1	529	c.504A>T	c.(502-504)tcA>tcT	p.S168S		NM_181621.3	NP_853652.1	Q52LG2	KR132_HUMAN	keratin associated protein 13-2	168						intermediate filament (GO:0005882)				endometrium(1)|kidney(1)|lung(14)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	21						TGCAGAAGGTTGATCCATAGG	0.493																																					p.S168S		Atlas-SNP	.											.	KRTAP13-2	29	.	0			c.A504T						.						77.0	73.0	74.0					21																	31744028		2203	4300	6503	SO:0001819	synonymous_variant	337959	exon1			GAAGGTTGATCCA	AP001708	CCDS13589.1	21q22.1	2011-02-10			ENSG00000182816	ENSG00000182816		"""Keratin associated proteins"""	18923	protein-coding gene	gene with protein product						12359730	Standard	NM_181621		Approved	KAP13-2	uc002ynz.4	Q52LG2	OTTHUMG00000057793	ENST00000399889.2:c.504A>T	chr21.hg19:g.31744028T>A		157.0	0.0		145.0	55.0	NM_181621		Silent	SNP	ENST00000399889.2	hg19	CCDS13589.1																																																																																			.	.		0.493	KRTAP13-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128245.1		
LDOC1L	84247	hgsc.bcm.edu	37	22	44892922	44892922	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr22:44892922T>C	ENST00000341255.3	-	2	1024	c.515A>G	c.(514-516)gAg>gGg	p.E172G		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	172										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		TCTCCGCAACTCTGCCAGGAA	0.592																																					p.E172G		Atlas-SNP	.											.	LDOC1L	24	.	0			c.A515G						.						41.0	43.0	42.0					22																	44892922		2203	4300	6503	SO:0001583	missense	84247	exon2			CGCAACTCTGCCA	CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.515A>G	chr22.hg19:g.44892922T>C	ENSP00000340434:p.Glu172Gly	57.0	0.0		69.0	33.0	NM_032287	Q6ZTR1	Missense_Mutation	SNP	ENST00000341255.3	hg19	CCDS33662.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.962990	0.74016	.	.	ENSG00000188636	ENST00000341255	T	0.22336	1.96	3.2	3.2	0.36748	.	0.387478	0.19383	N	0.115602	T	0.32346	0.0826	L	0.41492	1.28	0.31740	N	0.635906	D	0.76494	0.999	D	0.75484	0.986	T	0.21008	-1.0258	10	0.54805	T	0.06	-16.6304	8.1706	0.31252	0.0:0.0:0.0:1.0	.	172	Q6ICC9	LDOCL_HUMAN	G	172	ENSP00000340434:E172G	ENSP00000340434:E172G	E	-	2	0	LDOC1L	43271586	0.597000	0.26874	0.988000	0.46212	0.997000	0.91878	1.811000	0.38942	1.717000	0.51406	0.482000	0.46254	GAG	.	.		0.592	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318222.1	NM_032287	
ADM2	79924	hgsc.bcm.edu	37	22	50921204	50921204	+	Silent	SNP	C	C	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr22:50921204C>A	ENST00000395738.2	+	2	611	c.319C>A	c.(319-321)Cga>Aga	p.R107R	ADM2_ENST00000362068.2_Nonsense_Mutation_p.C23*|ADM2_ENST00000395737.1_Silent_p.R107R	NM_001253845.1|NM_024866.5	NP_001240774.1|NP_079142.2	Q7Z4H4	ADM2_HUMAN	adrenomedullin 2	107					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|angiogenesis (GO:0001525)|digestion (GO:0007586)|feeding behavior (GO:0007631)|negative regulation of blood pressure (GO:0045776)|positive regulation of angiogenesis (GO:0045766)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)	extracellular region (GO:0005576)	protein complex binding (GO:0032403)			breast(1)|kidney(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCAGCTCCTGCGAGTGGGCTG	0.692																																					p.R107R		Atlas-SNP	.											.	ADM2	15	.	0			c.C319A						.						8.0	10.0	10.0					22																	50921204		2061	4090	6151	SO:0001819	synonymous_variant	79924	exon2			CTCCTGCGAGTGG	AF529213	CCDS33682.1	22q13.33	2013-02-25			ENSG00000128165	ENSG00000128165		"""Endogenous ligands"""	28898	protein-coding gene	gene with protein product		608682				14706825	Standard	NM_024866		Approved	AM2, FLJ21135	uc003blj.3	Q7Z4H4	OTTHUMG00000150202	ENST00000395738.2:c.319C>A	chr22.hg19:g.50921204C>A		108.0	0.0		125.0	50.0	NM_024866	Q3LFQ0	Silent	SNP	ENST00000395738.2	hg19	CCDS33682.1	.	.	.	.	.	.	.	.	.	.	C	39	7.415909	0.98269	.	.	ENSG00000128165	ENST00000362068	.	.	.	4.62	0.634	0.17718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.5448	0.56193	0.4295:0.5705:0.0:0.0	.	.	.	.	X	23	.	ENSP00000354955:C23X	C	+	3	2	ADM2	49268070	1.000000	0.71417	0.996000	0.52242	0.769000	0.43574	1.046000	0.30354	0.340000	0.23745	0.448000	0.29417	TGC	.	.		0.692	ADM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316816.1	NM_024866	
MAGEB2	4113	hgsc.bcm.edu	37	X	30237136	30237136	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chrX:30237136G>C	ENST00000378988.4	+	2	540	c.439G>C	c.(439-441)Gag>Cag	p.E147Q		NM_002364.4	NP_002355.2	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	147	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|large_intestine(3)|lung(17)|ovary(1)|skin(1)	23						AAGGTTCAGGGAGCACTTCCC	0.458																																					p.E147Q		Atlas-SNP	.											.	MAGEB2	133	.	0			c.G439C						.						62.0	58.0	59.0					X																	30237136		2202	4300	6502	SO:0001583	missense	4113	exon2			TTCAGGGAGCACT	AF015766	CCDS14219.1	Xp21.3	2009-03-17			ENSG00000099399	ENSG00000099399			6809	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 6"", ""melanoma-associated antigen B2"", ""cancer/testis antigen family 3, member 2"""	300098				9441743	Standard	NM_002364		Approved	DAM6, MAGE-XP-2, MGC26438, CT3.2	uc004dbz.3	O15479	OTTHUMG00000021319	ENST00000378988.4:c.439G>C	chrX.hg19:g.30237136G>C	ENSP00000368273:p.Glu147Gln	105.0	0.0		91.0	76.0	NM_002364	O75860	Missense_Mutation	SNP	ENST00000378988.4	hg19	CCDS14219.1	.	.	.	.	.	.	.	.	.	.	G	9.964	1.223686	0.22457	.	.	ENSG00000099399	ENST00000378988	T	0.04917	3.53	3.27	-0.661	0.11417	.	0.531761	0.19970	N	0.102007	T	0.05593	0.0147	M	0.66560	2.04	0.09310	N	1	B	0.33637	0.42	B	0.29077	0.098	T	0.33445	-0.9868	10	0.25106	T	0.35	.	3.506	0.07691	0.3619:0.1972:0.441:0.0	.	147	O15479	MAGB2_HUMAN	Q	147	ENSP00000368273:E147Q	ENSP00000368273:E147Q	E	+	1	0	MAGEB2	30147057	0.000000	0.05858	0.000000	0.03702	0.527000	0.34593	-0.087000	0.11215	-0.284000	0.09102	0.436000	0.28706	GAG	.	.		0.458	MAGEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056157.1	NM_002364	
HUWE1	10075	hgsc.bcm.edu	37	X	53672263	53672263	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chrX:53672263C>T	ENST00000342160.3	-	6	961	c.504G>A	c.(502-504)gaG>gaA	p.E168E	HUWE1_ENST00000262854.6_Splice_Site_p.E168E|HUWE1_ENST00000218328.8_Splice_Site_p.E168E			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	168					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAAGACTCACCTCTGCCAAAT	0.423																																					p.E168E		Atlas-SNP	.											.	HUWE1	724	.	0			c.G504A						.						65.0	59.0	61.0					X																	53672263		2203	4300	6503	SO:0001630	splice_region_variant	10075	exon7			ACTCACCTCTGCC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.504+1G>A	chrX.hg19:g.53672263C>T		47.0	0.0		37.0	29.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	hg19	CCDS35301.1																																																																																			.	.		0.423	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	Silent
TMEM206	55248	hgsc.bcm.edu	37	1	212548579	212548580	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr1:212548579_212548580insA	ENST00000261455.4	-	7	983_984	c.846_847insT	c.(844-849)tttgtgfs	p.V283fs	TMEM206_ENST00000535273.1_Frame_Shift_Ins_p.V344fs	NM_018252.2	NP_060722.2	Q9H813	TM206_HUMAN	transmembrane protein 206	283						cell surface (GO:0009986)|integral component of membrane (GO:0016021)				breast(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|skin(2)	17				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TCAAAGACCACAAAAAACAATT	0.356																																					p.V344fs		Atlas-INDEL	.											.	TMEM206	41	.	0			c.1030_1031insT						.																																			SO:0001589	frameshift_variant	55248	exon8			.	AK024066	CCDS1504.1, CCDS55687.1	1q32.3	2008-02-05	2008-01-17	2008-01-17	ENSG00000065600	ENSG00000065600			25593	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 75"""	C1orf75		12477932	Standard	NM_018252		Approved	FLJ10874	uc010pte.2	Q9H813	OTTHUMG00000036751	ENST00000261455.4:c.847dupT	chr1.hg19:g.212548585_212548585dupA	ENSP00000261455:p.Val283fs	173.0	0.0		223.0	74.0	NM_001198862	B7Z4D6|Q6IA87|Q9NV85	Frame_Shift_Ins	INS	ENST00000261455.4	hg19	CCDS1504.1																																																																																			.	.		0.356	TMEM206-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089306.1	NM_018252	
AKR1C2	1646	hgsc.bcm.edu	37	10	5032215	5032216	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr10:5032215_5032216insG	ENST00000380753.4	-	9	1131_1132	c.944_945insC	c.(943-945)cctfs	p.P315fs	AKR1C2_ENST00000407674.1_Frame_Shift_Ins_p.P315fs|AKR1C2_ENST00000421196.3_Frame_Shift_Ins_p.P289fs	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2	315					cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	ATGGATAATTAGGGGGGCCAGC	0.485																																					p.P315fs		Atlas-INDEL	.											.	AKR1C2	68	.	0			c.945_946insC						.																																			SO:0001589	frameshift_variant	1646	exon11			.	L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.945dupC	chr10.hg19:g.5032221_5032221dupG	ENSP00000370129:p.Pro315fs	546.0	0.0		532.0	132.0	NM_001354	A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	Frame_Shift_Ins	INS	ENST00000380753.4	hg19	CCDS7062.1																																																																																			.	.		0.485	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046531.1	NM_001354	
CDH13	1012	hgsc.bcm.edu	37	16	83704424	83704424	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr16:83704424delG	ENST00000566620.1	+	9	1421	c.1131delG	c.(1129-1131)gtgfs	p.V377fs	CDH13_ENST00000428848.3_Frame_Shift_Del_p.V338fs|CDH13_ENST00000268613.10_Frame_Shift_Del_p.V424fs	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13	377	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AAGGAGCTGTGGGAGTTATTG	0.463																																					p.V424fs		Atlas-INDEL	.											.	CDH13	97	.	0			c.1271delT						.						76.0	75.0	76.0					16																	83704424		1948	4136	6084	SO:0001589	frameshift_variant	1012	exon10			.	U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.1131delG	chr16.hg19:g.83704424delG	ENSP00000454435:p.Val377fs	136.0	0.0		153.0	62.0	NM_001220488	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	Frame_Shift_Del	DEL	ENST00000566620.1	hg19	CCDS58486.1																																																																																			.	.		0.463	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432917.1	NM_001257	
PISD	23761	hgsc.bcm.edu	37	22	32019822	32019822	+	Intron	DEL	G	G	-			TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr22:32019822delG	ENST00000439502.2	-	4	545				PISD_ENST00000397500.1_Frame_Shift_Del_p.Q23fs|PISD_ENST00000382151.2_Frame_Shift_Del_p.Q23fs|PISD_ENST00000478893.1_5'UTR|PISD_ENST00000336566.4_Intron|PISD_ENST00000266095.5_Frame_Shift_Del_p.Q23fs			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)			central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	AGGGCCAGCTGGGGGAAGTGC	0.672																																					p.Q23fs		Atlas-INDEL	.											.	PISD	53	.	0			c.68delA						.						52.0	42.0	46.0					22																	32019822		2203	4300	6503	SO:0001627	intron_variant	23761	exon4			.		CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.322-1951C>-	chr22.hg19:g.32019822delG		145.0	0.0		128.0	49.0	NM_014338	B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	Frame_Shift_Del	DEL	ENST00000439502.2	hg19																																																																																				.	.		0.672	PISD-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000075106.4		
PTEN	5728	hgsc.bcm.edu	37	10	89717669	89717674	+	In_Frame_Del	DEL	ACACGA	ACACGA	-	rs121909219		TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	ACACGA	ACACGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr10:89717669_89717674delACACGA	ENST00000371953.3	+	7	2051_2056	c.694_699delACACGA	c.(694-699)acacgadel	p.TR232del	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	232	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R233*(77)|p.0?(37)|p.R55fs*1(5)|p.R233fs*10(4)|p.R234fs*11(3)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.R233fs*12(1)|p.R233fs*20(1)|p.R233fs*25(1)|p.R233fs*23(1)|p.R233R(1)|p.R234fs*26(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCAGGACCCACACGACGGGAAGACA	0.413	R233*(HEC59_ENDOMETRIUM)|R233*(JHUEM1_ENDOMETRIUM)|R233*(NCIH1155_LUNG)|R233*(SF295_CENTRAL_NERVOUS_SYSTEM)|R233*(SW1783_CENTRAL_NERVOUS_SYSTEM)	31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.231_233del		Atlas-INDEL	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	.	PTEN	3652	.	138	Substitution - Nonsense(77)|Whole gene deletion(37)|Deletion - Frameshift(11)|Complex - frameshift(7)|Insertion - Frameshift(3)|Deletion - In frame(1)|Unknown(1)|Substitution - coding silent(1)	endometrium(48)|central_nervous_system(21)|prostate(17)|haematopoietic_and_lymphoid_tissue(15)|lung(9)|large_intestine(6)|skin(6)|ovary(5)|cervix(3)|soft_tissue(3)|breast(3)|urinary_tract(2)	c.693_698del	GRCh37	CD982916|CM971277	PTEN	D|M	rs121909219	.																																			SO:0001651	inframe_deletion	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.694_699delACACGA	chr10.hg19:g.89717669_89717674delACACGA	ENSP00000361021:p.Thr232_Arg233del	161.0	0.0		63.0	27.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	In_Frame_Del	DEL	ENST00000371953.3	hg19	CCDS31238.1																																																																																			.	.		0.413	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
THOP1	7064	hgsc.bcm.edu	37	19	2810300	2810337	+	Splice_Site	DEL	CCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG	CCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG	-	rs113316866|rs113612949|rs151055831	byFrequency	TCGA-DD-AAE2-01A-11D-A40R-10	TCGA-DD-AAE2-10A-01D-A40U-10	CCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG	CCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	66c712a0-e797-4c8f-9f9b-ff7706b87d78	318f2f81-2c67-4132-aeb5-4179b9cc568a	g.chr19:2810300_2810337delCCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG	ENST00000307741.6	+	10	1658_1694	c.1455_1491delCCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG	c.(1453-1491)cacctgggcactctgaggctctgccccatccctgcaggc>ca	p.HLGTLRLCPIPAG485fs	THOP1_ENST00000586677.1_Splice_Site_p.HLGTLRLCPIPAG364fs|THOP1_ENST00000591149.1_3'UTR|THOP1_ENST00000395212.4_Start_Codon_Del	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	485					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCATCCCTGCAGGCGGAGTTCGCCATGTTCAGCGGGACCCACGTGGAGCGGGACTTTG	0.685																																					p.486_486del		Atlas-INDEL	.											.	THOP1	49	.	0			c.1456_1457del						.																																			SO:0001630	splice_region_variant	7064	exon10			.		CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.1456-1CCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG>-	chr19.hg19:g.2810300_2810337delCCTGGGCACTCTGAGGCTCTGCCCCATCCCTGCAGGCG		69.0	0.0		67.0	19.0	NM_003249	B3KSE2|Q9UCB3	Frame_Shift_Del	DEL	ENST00000307741.6	hg19	CCDS12095.1																																																																																			.	.		0.685	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451587.2		Frame_Shift_Del
