#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM132A	388581	hgsc.bcm.edu	37	1	1179473	1179473	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:1179473C>T	ENST00000330388.2	-	4	423	c.392G>A	c.(391-393)cGc>cAc	p.R131H		NM_001014980.2	NP_001014980.1	Q5T7M4	ADIPL_HUMAN	family with sequence similarity 132, member A	131					negative regulation of gluconeogenesis (GO:0045721)|negative regulation of inflammatory response (GO:0050728)|positive regulation of glucose import (GO:0046326)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of glucose import (GO:0046324)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)			haematopoietic_and_lymphoid_tissue(1)|lung(1)	2	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TGAGAACCGGCGCTCCGTGGC	0.736																																					p.R131H		Atlas-SNP	.											.	FAM132A	12	.	0			c.G392A						.						12.0	15.0	14.0					1																	1179473		2158	4267	6425	SO:0001583	missense	388581	exon4			AACCGGCGCTCCG	BC089443	CCDS30554.1	1p36.33	2012-03-26	2007-03-27	2007-03-27	ENSG00000184163	ENSG00000184163			32308	protein-coding gene	gene with protein product	"""adipolin"", ""adipose-derived insulin-sensitizing factor"""		"""C1q domain containing 2"""	C1QDC2		21849507	Standard	NM_001014980		Approved	MGC105127, C1QTNF12, CTRP12	uc001adl.2	Q5T7M4	OTTHUMG00000001412	ENST00000330388.2:c.392G>A	chr1.hg19:g.1179473C>T	ENSP00000329137:p.Arg131His	92.0	0.0		90.0	27.0	NM_001014980	Q5EBL5	Missense_Mutation	SNP	ENST00000330388.2	hg19	CCDS30554.1	.	.	.	.	.	.	.	.	.	.	c	11.83	1.756571	0.31137	.	.	ENSG00000184163	ENST00000330388	T	0.47177	0.85	3.94	-4.3	0.03710	.	0.218660	0.34676	N	0.003769	T	0.24624	0.0597	L	0.28115	0.83	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.04723	-1.0931	10	0.33141	T	0.24	.	5.2556	0.15546	0.1388:0.4392:0.0:0.422	.	131	Q5T7M4	F132A_HUMAN	H	131	ENSP00000329137:R131H	ENSP00000329137:R131H	R	-	2	0	FAM132A	1169336	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.553000	0.06012	-1.066000	0.03164	-0.635000	0.03985	CGC	.	.		0.736	FAM132A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004080.4	XM_371208	
SPSB1	80176	hgsc.bcm.edu	37	1	9416228	9416228	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:9416228A>G	ENST00000328089.6	+	2	619	c.278A>G	c.(277-279)tAt>tGt	p.Y93C	SPSB1_ENST00000357898.3_Missense_Mutation_p.Y93C|SPSB1_ENST00000377399.2_Missense_Mutation_p.Y93C	NM_025106.3	NP_079382.2	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box containing 1	93	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|kidney(2)|lung(5)|prostate(2)	13	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)		AAAGTCGGGTATACCCGTGGG	0.637																																					p.Y93C		Atlas-SNP	.											.	SPSB1	22	.	0			c.A278G						.						118.0	122.0	121.0					1																	9416228		2203	4300	6503	SO:0001583	missense	80176	exon2			TCGGGTATACCCG		CCDS102.1	1p36.22	2008-02-05			ENSG00000171621	ENSG00000171621			30628	protein-coding gene	gene with protein product		611657				15713673, 12076535	Standard	NM_025106		Approved	SSB-1	uc010oae.2	Q96BD6	OTTHUMG00000001279	ENST00000328089.6:c.278A>G	chr1.hg19:g.9416228A>G	ENSP00000330221:p.Tyr93Cys	94.0	0.0		81.0	24.0	NM_025106	A2A275|Q59FA1|Q5TIH9|Q9BRY9|Q9H6C5	Missense_Mutation	SNP	ENST00000328089.6	hg19	CCDS102.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.911203	0.72983	.	.	ENSG00000171621	ENST00000328089;ENST00000450402;ENST00000357898;ENST00000377399	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	5.22	5.22	0.72569	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);	0.000000	0.85682	D	0.000000	T	0.69333	0.3099	M	0.90145	3.09	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	T	0.76926	-0.2778	10	0.72032	D	0.01	-6.0998	14.2914	0.66281	1.0:0.0:0.0:0.0	.	93	Q96BD6	SPSB1_HUMAN	C	93	ENSP00000330221:Y93C;ENSP00000409235:Y93C;ENSP00000350573:Y93C;ENSP00000366616:Y93C	ENSP00000330221:Y93C	Y	+	2	0	SPSB1	9338815	1.000000	0.71417	0.998000	0.56505	0.865000	0.49528	7.263000	0.78421	1.966000	0.57179	0.533000	0.62120	TAT	.	.		0.637	SPSB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003727.2	NM_025106	
UBE4B	10277	hgsc.bcm.edu	37	1	10190648	10190648	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:10190648A>T	ENST00000253251.8	+	12	2238	c.1399A>T	c.(1399-1401)Agc>Tgc	p.S467C	UBE4B_ENST00000343090.6_Missense_Mutation_p.S596C|UBE4B_ENST00000475795.1_3'UTR|UBE4B_ENST00000377157.3_Missense_Mutation_p.S351C					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GGCTTTCTTTAGCTTCTCAGT	0.448																																					p.S596C		Atlas-SNP	.											.	UBE4B	233	.	0			c.A1786T						.						163.0	161.0	162.0					1																	10190648		2203	4300	6503	SO:0001583	missense	10277	exon13			TTCTTTAGCTTCT	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.1399A>T	chr1.hg19:g.10190648A>T	ENSP00000253251:p.Ser467Cys	102.0	0.0		74.0	20.0	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	hg19	CCDS110.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.810377	0.90707	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.52526	0.66;0.66;0.66	5.93	5.93	0.95920	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.69205	0.3085	M	0.79258	2.445	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.68943	0.961;0.935	T	0.71593	-0.4546	10	0.52906	T	0.07	-22.247	16.3943	0.83563	1.0:0.0:0.0:0.0	.	596;467	O95155;O95155-2	UBE4B_HUMAN;.	C	467;351;596	ENSP00000253251:S467C;ENSP00000366362:S351C;ENSP00000343001:S596C	ENSP00000253251:S467C	S	+	1	0	UBE4B	10113235	1.000000	0.71417	0.946000	0.38457	0.960000	0.62799	6.108000	0.71522	2.281000	0.76405	0.533000	0.62120	AGC	.	.		0.448	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
ERMAP	114625	hgsc.bcm.edu	37	1	43300793	43300793	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:43300793T>G	ENST00000372517.2	+	5	762	c.518T>G	c.(517-519)cTt>cGt	p.L173R	ERMAP_ENST00000487556.1_3'UTR|RP11-342M1.3_ENST00000414798.1_RNA|ERMAP_ENST00000328249.3_Missense_Mutation_p.L83R|RP11-342M1.3_ENST00000416809.2_RNA|ERMAP_ENST00000372514.3_Missense_Mutation_p.L173R	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	173			Missing (in Sc-3 allele).			cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATGGTGTGCCTTTGCCTTATC	0.532																																					p.L173R		Atlas-SNP	.											.	ERMAP	30	.	0			c.T518G						.						157.0	122.0	134.0					1																	43300793		2203	4300	6503	SO:0001583	missense	114625	exon5			TGTGCCTTTGCCT	AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.518T>G	chr1.hg19:g.43300793T>G	ENSP00000361595:p.Leu173Arg	125.0	0.0		79.0	23.0	NM_001017922	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Missense_Mutation	SNP	ENST00000372517.2	hg19	CCDS475.1	.	.	.	.	.	.	.	.	.	.	T	8.470	0.857328	0.17106	.	.	ENSG00000164010	ENST00000372517;ENST00000372514;ENST00000328249	T;T;T	0.57107	0.66;0.66;0.42	5.47	3.03	0.35002	.	0.753572	0.11833	N	0.525035	T	0.51890	0.1701	L	0.45352	1.415	0.09310	N	1	D;P	0.61697	0.99;0.761	P;B	0.53649	0.731;0.276	T	0.37103	-0.9720	10	0.49607	T	0.09	.	4.938	0.13950	0.0:0.0947:0.1875:0.7178	.	234;173	B7Z3C6;Q96PL5	.;ERMAP_HUMAN	R	173;173;83	ENSP00000361595:L173R;ENSP00000361592:L173R;ENSP00000332439:L83R	ENSP00000332439:L83R	L	+	2	0	ERMAP	43073380	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.749000	0.26320	0.914000	0.36822	0.482000	0.46254	CTT	.	.		0.532	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020180.1	NM_018538	
SLC1A7	6512	hgsc.bcm.edu	37	1	53580429	53580429	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:53580429C>A	ENST00000371494.4	-	3	559		c.e3+1		SLC1A7_ENST00000371491.4_Splice_Site|RP11-334A14.8_ENST00000439621.1_RNA	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7						dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		GCAATAGTTACCGGATGAGGT	0.652																																					.	NSCLC(128;80 1811 21245 38490 51715)	Atlas-SNP	.											.	SLC1A7	65	.	0			c.431+1G>T						.						124.0	105.0	111.0					1																	53580429		2203	4300	6503	SO:0001630	splice_region_variant	6512	exon4			TAGTTACCGGATG	U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.431+1G>T	chr1.hg19:g.53580429C>A		79.0	0.0		61.0	38.0	NM_006671	Q5VVZ0|Q969Z8|Q9BW45	Splice_Site	SNP	ENST00000371494.4	hg19	CCDS574.1	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475421	0.63737	.	.	ENSG00000162383	ENST00000371494;ENST00000371491	.	.	.	5.42	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2111	0.65764	0.0:0.9282:0.0:0.0718	.	.	.	.	.	-1	.	.	.	-	.	.	SLC1A7	53353017	1.000000	0.71417	0.999000	0.59377	0.776000	0.43924	5.782000	0.68973	1.303000	0.44873	0.655000	0.94253	.	.	.		0.652	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024746.1	NM_006671	Intron
PALMD	54873	hgsc.bcm.edu	37	1	100155039	100155039	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:100155039A>G	ENST00000263174.4	+	7	1598	c.1223A>G	c.(1222-1224)aAt>aGt	p.N408S	PALMD_ENST00000605497.1_Missense_Mutation_p.N408S	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	408					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		CCAGACATAAATGATACAGAA	0.418																																					p.N408S		Atlas-SNP	.											.	PALMD	64	.	0			c.A1223G						.						65.0	58.0	60.0					1																	100155039		2203	4299	6502	SO:0001583	missense	54873	exon7			ACATAAATGATAC	AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.1223A>G	chr1.hg19:g.100155039A>G	ENSP00000263174:p.Asn408Ser	128.0	0.0		75.0	15.0	NM_017734	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	ENST00000263174.4	hg19	CCDS758.1	.	.	.	.	.	.	.	.	.	.	A	9.477	1.097101	0.20552	.	.	ENSG00000099260	ENST00000263174	T	0.15372	2.43	5.66	0.352	0.16051	.	0.896444	0.09773	N	0.757662	T	0.01489	0.0048	N	0.02916	-0.46	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.49062	-0.8978	10	0.12103	T	0.63	-0.0299	6.4985	0.22155	0.6094:0.2575:0.133:0.0	.	408;328	Q9NP74;Q9NP74-2	PALMD_HUMAN;.	S	408	ENSP00000263174:N408S	ENSP00000263174:N408S	N	+	2	0	PALMD	99927627	0.934000	0.31675	0.002000	0.10522	0.684000	0.39900	1.986000	0.40677	0.086000	0.17137	0.460000	0.39030	AAT	.	.		0.418	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029672.1	NM_017734	
COL11A1	1301	hgsc.bcm.edu	37	1	103385871	103385871	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:103385871T>A	ENST00000370096.3	-	49	4070	c.3758A>T	c.(3757-3759)gAa>gTa	p.E1253V	COL11A1_ENST00000512756.1_Missense_Mutation_p.E1137V|COL11A1_ENST00000353414.4_Missense_Mutation_p.E1214V|COL11A1_ENST00000358392.2_Missense_Mutation_p.E1265V	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1253	Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		ATTTACCTTTTCTCCAACACC	0.363																																					p.E1265V		Atlas-SNP	.											.	COL11A1	972	.	0			c.A3794T						.						176.0	183.0	181.0					1																	103385871		2203	4300	6503	SO:0001583	missense	1301	exon49			ACCTTTTCTCCAA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3758A>T	chr1.hg19:g.103385871T>A	ENSP00000359114:p.Glu1253Val	71.0	0.0		56.0	13.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.964729	0.74131	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.94232	-3.38;-3.38;-3.38;-3.38	6.06	6.06	0.98353	.	0.106801	0.64402	D	0.000006	D	0.87888	0.6291	N	0.21373	0.66	0.58432	D	0.999999	B;P;B;B;B	0.41131	0.18;0.739;0.441;0.314;0.275	B;P;B;B;B	0.45232	0.147;0.474;0.326;0.206;0.194	D	0.90128	0.4204	10	0.56958	D	0.05	.	15.8056	0.78506	0.0:0.0:0.0:1.0	.	1137;1214;1265;1253;473	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	V	1253;1265;1214;473;1137	ENSP00000359114:E1253V;ENSP00000351163:E1265V;ENSP00000302551:E1214V;ENSP00000426533:E1137V	ENSP00000302551:E1214V	E	-	2	0	COL11A1	103158459	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.293000	0.78740	2.323000	0.78572	0.528000	0.53228	GAA	.	.		0.363	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
GSTM5	2949	hgsc.bcm.edu	37	1	110256136	110256136	+	Missense_Mutation	SNP	A	A	C	rs146232109	byFrequency	TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:110256136A>C	ENST00000256593.3	+	4	266	c.208A>C	c.(208-210)Atc>Ctc	p.I70L	GSTM5_ENST00000369812.5_Missense_Mutation_p.I89L|GSTM5_ENST00000369813.1_Missense_Mutation_p.I29L	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	70	GST N-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	GGCTCACAAGATCACCCAGAG	0.587																																					p.I70L		Atlas-SNP	.											.	GSTM5	89	.	0			c.A208C						.						336.0	256.0	283.0					1																	110256136		2203	4300	6503	SO:0001583	missense	2949	exon4			CACAAGATCACCC	L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.208A>C	chr1.hg19:g.110256136A>C	ENSP00000256593:p.Ile70Leu	177.0	0.0		175.0	7.0	NM_000851	A8K0V8|Q6PD78	Missense_Mutation	SNP	ENST00000256593.3	hg19	CCDS811.1	.	.	.	.	.	.	.	.	.	.	A	2.484	-0.318884	0.05386	.	.	ENSG00000134201	ENST00000256593;ENST00000369813;ENST00000369812	T;T;T	0.31247	1.5;3.57;1.5	4.33	-5.35	0.02697	Glutathione S-transferase, N-terminal (2);Thioredoxin-like fold (2);	0.231648	0.31922	N	0.006858	T	0.03348	0.0097	N	0.03253	-0.375	0.31558	N	0.657878	B;B	0.09022	0.002;0.0	B;B	0.33196	0.159;0.038	T	0.32134	-0.9918	10	0.05620	T	0.96	.	11.6882	0.51499	0.2101:0.7058:0.0842:0.0	.	29;70	Q5T8Q9;P46439	.;GSTM5_HUMAN	L	70;29;89	ENSP00000256593:I70L;ENSP00000358828:I29L;ENSP00000358827:I89L	ENSP00000256593:I70L	I	+	1	0	GSTM5	110057659	0.648000	0.27313	0.577000	0.28562	0.531000	0.34715	-0.185000	0.09684	-0.664000	0.05324	0.413000	0.27773	ATC	.	A|1.000;G|0.000		0.587	GSTM5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000032200.1	NM_000851	
NBPF10	100132406	hgsc.bcm.edu	37	1	145367777	145367777	+	Missense_Mutation	SNP	G	G	T	rs200743139		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:145367777G>T	ENST00000342960.5	+	83	10408	c.10373G>T	c.(10372-10374)aGg>aTg	p.R3458M	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	755						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		gaaagaagaaggggaagaaaa	0.428																																					p.R3458M		Atlas-SNP	.											NBPF10,NS,carcinoma,0,1	NBPF10	221	.	0			c.G10373T						.																																			SO:0001583	missense	100132406	exon83			GAAGAAGGGGAAG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10373G>T	chr1.hg19:g.145367777G>T	ENSP00000345684:p.Arg3458Met	3.0	0.0		4.0	3.0	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	hg19	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	10.39	1.335798	0.24253	.	.	ENSG00000163386	ENST00000369339;ENST00000342960	T	0.05258	3.47	.	.	.	.	.	.	.	.	T	0.03651	0.0104	L	0.51422	1.61	0.09310	N	1	.	.	.	.	.	.	T	0.38351	-0.9665	4	0.87932	D	0	.	.	.	.	.	.	.	.	M	578;3458	ENSP00000345684:R3458M	ENSP00000345684:R3458M	R	+	2	0	NBPF10	144079134	.	.	.	.	.	.	.	.	.	.	.	.	AGG	.	.		0.428	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
TXNIP	10628	hgsc.bcm.edu	37	1	145439791	145439791	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:145439791T>A	ENST00000369317.4	+	3	671	c.337T>A	c.(337-339)Tcc>Acc	p.S113T	TXNIP_ENST00000475171.1_Intron	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	113					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TCTGGGAACATCCTTCAAAGG	0.413																																					p.S113T		Atlas-SNP	.											.	TXNIP	51	.	0			c.T337A						.						90.0	93.0	92.0					1																	145439791		2203	4300	6503	SO:0001583	missense	10628	exon3			GGAACATCCTTCA	S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.337T>A	chr1.hg19:g.145439791T>A	ENSP00000358323:p.Ser113Thr	128.0	0.0		130.0	30.0	NM_006472	B4E3D3|Q16226|Q6PML0|Q9BXG9	Missense_Mutation	SNP	ENST00000369317.4	hg19	CCDS913.1	.	.	.	.	.	.	.	.	.	.	T	14.30	2.494485	0.44352	.	.	ENSG00000117289	ENST00000369317;ENST00000425134	T;T	0.42513	0.97;0.97	4.84	4.84	0.62591	Immunoglobulin E-set (1);Arrestin-like, N-terminal (1);	0.118609	0.64402	D	0.000016	T	0.36166	0.0957	M	0.77712	2.385	0.52099	D	0.999947	P;B	0.34826	0.471;0.181	B;B	0.39465	0.3;0.047	T	0.37033	-0.9723	10	0.44086	T	0.13	1.8577	12.6817	0.56926	0.0:0.0:0.0:1.0	.	58;113	B4E3D3;Q9H3M7	.;TXNIP_HUMAN	T	113;58	ENSP00000358323:S113T;ENSP00000396322:S58T	ENSP00000358323:S113T	S	+	1	0	TXNIP	144151148	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	2.923000	0.48868	2.168000	0.68352	0.456000	0.33151	TCC	.	.		0.413	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038547.1	NM_006472	
SDE2	163859	hgsc.bcm.edu	37	1	226180658	226180658	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:226180658G>A	ENST00000272091.7	-	3	302	c.284C>T	c.(283-285)aCa>aTa	p.T95I		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	95																	TCGATTGGTTGTCTTCTCAAT	0.428																																					p.T95I		Atlas-SNP	.											.	.	.	.	0			c.C284T						.						90.0	80.0	83.0					1																	226180658		1867	4108	5975	SO:0001583	missense	163859	exon3			TTGGTTGTCTTCT	BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.284C>T	chr1.hg19:g.226180658G>A	ENSP00000272091:p.Thr95Ile	126.0	0.0		102.0	17.0	NM_152608	A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	ENST00000272091.7	hg19	CCDS41473.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	38|38	7.111089|7.111089	0.98070|0.98070	.|.	.|.	ENSG00000143751|ENSG00000143751	ENST00000366817|ENST00000272091;ENST00000366818	.|T	.|0.56776	.|0.44	5.86|5.86	5.86|5.86	0.93980|0.93980	.|.	.|0.044133	.|0.85682	.|D	.|0.000000	.|T	.|0.80778	.|0.4688	M|M	0.92268|0.92268	3.29|3.29	0.80722|0.80722	A|A	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.97110	.|1.0;0.991	.|D	.|0.84210	.|0.0455	.|9	0.08837|0.72032	T|D	0.75|0.01	-17.1607|-17.1607	20.242|20.242	0.98377|0.98377	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|83;95	.|Q6IQ49-2;Q6IQ49	.|.;CA055_HUMAN	X|I	44|95;83	.|ENSP00000272091:T95I	ENSP00000355782:Q44X|ENSP00000272091:T95I	Q|T	-|-	1|2	0|0	C1orf55|C1orf55	224247281|224247281	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.750000|9.750000	0.98875|0.98875	2.788000|2.788000	0.95919|0.95919	0.650000|0.650000	0.86243|0.86243	CAA|ACA	.	.		0.428	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091310.1	NM_152608	
CDC42BPA	8476	hgsc.bcm.edu	37	1	227222414	227222414	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:227222414T>C	ENST00000366769.3	-	25	4604	c.3313A>G	c.(3313-3315)Att>Gtt	p.I1105V	CDC42BPA_ENST00000366767.3_Missense_Mutation_p.I1024V|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.I1085V|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.I1077V|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.I1105V|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.I1140V|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.I1118V	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CCTTCAGCAATATCGTACAGA	0.393																																					p.I1105V		Atlas-SNP	.											.	CDC42BPA	528	.	0			c.A3313G						.						146.0	135.0	139.0					1																	227222414		2203	4300	6503	SO:0001583	missense	8476	exon25			CAGCAATATCGTA	U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.3313A>G	chr1.hg19:g.227222414T>C	ENSP00000355731:p.Ile1105Val	73.0	0.0		76.0	6.0	NM_003607		Missense_Mutation	SNP	ENST00000366769.3	hg19	CCDS1558.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.397|9.397	1.077082|1.077082	0.20227|0.20227	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765|ENST00000448940;ENST00000442054;ENST00000429440;ENST00000441725	T;T;T;T;T;T;T|.	0.41400|.	1.0;1.0;1.0;1.0;1.0;1.0;1.0|.	5.72|5.72	3.31|3.31	0.37934|0.37934	.|.	0.151874|.	0.64402|.	N|.	0.000018|.	T|T	0.33673|0.33673	0.0871|0.0871	N|N	0.10809|0.10809	0.05|0.05	0.36560|0.36560	D|D	0.872345|0.872345	B;B;B;B;B;B;B|.	0.13145|.	0.0;0.007;0.0;0.001;0.002;0.0;0.0|.	B;B;B;B;B;B;B|.	0.13407|.	0.001;0.007;0.001;0.003;0.009;0.007;0.001|.	T|T	0.22591|0.22591	-1.0212|-1.0212	10|5	0.07482|.	T|.	0.82|.	.|.	9.6681|9.6681	0.39996|0.39996	0.0:0.1938:0.0:0.8061|0.0:0.1938:0.0:0.8061	.|.	1085;1077;420;1024;1105;1140;307|.	F5H5N0;Q5VT25-4;E9PEF7;Q5VT25-3;Q5VT25-5;Q5VT25-2;Q5T799|.	.;.;.;.;.;.;.|.	V|C	1105;1024;1105;1140;1077;420;1085;1118|307;433;2;329	ENSP00000355731:I1105V;ENSP00000355729:I1024V;ENSP00000335341:I1105V;ENSP00000355728:I1140V;ENSP00000355726:I1077V;ENSP00000443275:I1085V;ENSP00000355727:I1118V|.	ENSP00000335341:I1105V|.	I|Y	-|-	1|2	0|0	CDC42BPA|CDC42BPA	225289037|225289037	0.931000|0.931000	0.31567|0.31567	0.734000|0.734000	0.30879|0.30879	0.839000|0.839000	0.47603|0.47603	1.441000|1.441000	0.35035|0.35035	0.403000|0.403000	0.25479|0.25479	0.528000|0.528000	0.53228|0.53228	ATT|TAT	.	.		0.393	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091696.1	NM_014826	
LYST	1130	hgsc.bcm.edu	37	1	235922871	235922871	+	Silent	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:235922871T>C	ENST00000389794.3	-	23	6456	c.6282A>G	c.(6280-6282)caA>caG	p.Q2094Q	LYST_ENST00000536965.1_3'UTR|LYST_ENST00000389793.2_Silent_p.Q2094Q			Q99698	LYST_HUMAN	lysosomal trafficking regulator	2094					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			CGGCCATCTGTTGTGGAATAA	0.383																																					p.Q2094Q		Atlas-SNP	.											.	LYST	370	.	0			c.A6282G						.						46.0	47.0	47.0					1																	235922871		2203	4300	6503	SO:0001819	synonymous_variant	1130	exon23			CATCTGTTGTGGA	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.6282A>G	chr1.hg19:g.235922871T>C		70.0	0.0		39.0	6.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	hg19	CCDS31062.1																																																																																			.	.		0.383	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
ERO1LB	56605	hgsc.bcm.edu	37	1	236415384	236415384	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:236415384A>C	ENST00000354619.5	-	4	515	c.314T>G	c.(313-315)aTt>aGt	p.I105S	ERO1LB_ENST00000327333.8_Missense_Mutation_p.I105S	NM_019891.3	NP_063944.3	Q86YB8	ERO1B_HUMAN	ERO1-like beta (S. cerevisiae)	105					4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|glucose homeostasis (GO:0042593)|insulin processing (GO:0030070)|protein folding (GO:0006457)|protein maturation by protein folding (GO:0022417)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor (GO:0016671)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(3)|large_intestine(8)|lung(8)|skin(2)|urinary_tract(1)	23	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Flavin adenine dinucleotide(DB03147)	TCCAACCGGAATTTTACTCTT	0.318																																					p.I105S		Atlas-SNP	.											.	ERO1LB	48	.	0			c.T314G						.						80.0	83.0	82.0					1																	236415384		2203	4300	6503	SO:0001583	missense	56605	exon4			ACCGGAATTTTAC	AF252538	CCDS31064.1	1q42.2-q43	2008-02-05			ENSG00000086619	ENSG00000086619			14355	protein-coding gene	gene with protein product		615437				10818100	Standard	NM_019891		Approved	ERO1-L(beta)	uc001hxt.3	Q86YB8	OTTHUMG00000039955	ENST00000354619.5:c.314T>G	chr1.hg19:g.236415384A>C	ENSP00000346635:p.Ile105Ser	442.0	0.0		284.0	49.0	NM_019891	B4DF57|Q5T1H4|Q8IZ11|Q9NR62	Missense_Mutation	SNP	ENST00000354619.5	hg19	CCDS31064.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.490759	0.84962	.	.	ENSG00000086619	ENST00000354619;ENST00000327333	D;T	0.82893	-1.66;0.62	5.77	5.77	0.91146	.	0.224693	0.46145	D	0.000319	D	0.88786	0.6531	M	0.78456	2.415	0.58432	D	0.999998	D;P	0.58970	0.984;0.872	P;P	0.55303	0.773;0.653	D	0.90269	0.4306	10	0.87932	D	0	-20.4477	15.0816	0.72119	1.0:0.0:0.0:0.0	.	105;105	B4DF57;Q86YB8	.;ERO1B_HUMAN	S	105	ENSP00000346635:I105S;ENSP00000377574:I105S	ENSP00000377574:I105S	I	-	2	0	ERO1LB	234482007	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.714000	0.84703	2.203000	0.70933	0.533000	0.62120	ATT	.	.		0.318	ERO1LB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096371.1	NM_019891	
OR2B11	127623	hgsc.bcm.edu	37	1	247615038	247615038	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:247615038G>C	ENST00000318749.6	-	1	270	c.247C>G	c.(247-249)Cct>Gct	p.P83A		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGCATCTGAGGGACTGTCGTG	0.567																																					p.P83A		Atlas-SNP	.											.	OR2B11	102	.	0			c.C247G						.						146.0	139.0	142.0					1																	247615038		2203	4300	6503	SO:0001583	missense	127623	exon1			TCTGAGGGACTGT		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.247C>G	chr1.hg19:g.247615038G>C	ENSP00000325682:p.Pro83Ala	64.0	0.0		52.0	7.0	NM_001004492	B2RP03	Missense_Mutation	SNP	ENST00000318749.6	hg19	CCDS31090.1	.	.	.	.	.	.	.	.	.	.	G	16.31	3.086798	0.55861	.	.	ENSG00000177535	ENST00000318749	T	0.25414	1.8	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000083	T	0.56543	0.1992	H	0.98769	4.325	0.39054	D	0.960387	P	0.48694	0.914	P	0.46452	0.517	T	0.77632	-0.2515	10	0.87932	D	0	.	16.1133	0.81278	0.0:0.0:1.0:0.0	.	83	Q5JQS5	OR2BB_HUMAN	A	83	ENSP00000325682:P83A	ENSP00000325682:P83A	P	-	1	0	OR2B11	245681661	1.000000	0.71417	0.532000	0.27989	0.639000	0.38242	6.719000	0.74718	2.749000	0.94314	0.551000	0.68910	CCT	.	.		0.567	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
TSSC1	7260	hgsc.bcm.edu	37	2	3193108	3193108	+	Silent	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:3193108T>G	ENST00000382125.4	-	9	1353	c.1161A>C	c.(1159-1161)ctA>ctC	p.L387L	TSSC1_ENST00000478754.1_5'UTR|TSSC1_ENST00000398659.4_Silent_p.L414L	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	387										breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		CCGGGAGTCATAGCAGGATGT	0.577																																					p.L387L	Colon(140;1261 1762 4183 34270 49743)	Atlas-SNP	.											.	TSSC1	39	.	0			c.A1161C						.						38.0	36.0	36.0					2																	3193108		2192	4292	6484	SO:0001819	synonymous_variant	7260	exon9			GAGTCATAGCAGG	AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.1161A>C	chr2.hg19:g.3193108T>G		131.0	0.0		155.0	37.0	NM_003310	D6W4Y1|O43179|Q53S19|Q53SG2	Silent	SNP	ENST00000382125.4	hg19	CCDS1651.1																																																																																			.	.		0.577	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206694.2	NM_003310	
SOX11	6664	hgsc.bcm.edu	37	2	5832874	5832874	+	Silent	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:5832874C>T	ENST00000322002.3	+	1	76	c.21C>T	c.(19-21)agC>agT	p.S7S	AC108025.2_ENST00000420221.1_RNA|AC107057.2_ENST00000458264.1_RNA|AC108025.2_ENST00000453678.1_RNA	NM_003108.3	NP_003099.1	P35716	SOX11_HUMAN	SRY (sex determining region Y)-box 11	7					cardiac ventricle formation (GO:0003211)|closure of optic fissure (GO:0061386)|cornea development in camera-type eye (GO:0061303)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|glial cell development (GO:0021782)|glial cell proliferation (GO:0014009)|hard palate development (GO:0060022)|kidney development (GO:0001822)|lens morphogenesis in camera-type eye (GO:0002089)|limb bud formation (GO:0060174)|lung morphogenesis (GO:0060425)|negative regulation of cell death (GO:0060548)|negative regulation of gene expression (GO:0010629)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of lymphocyte proliferation (GO:0050672)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|neural crest cell development (GO:0014032)|neural tube formation (GO:0001841)|neuroepithelial cell differentiation (GO:0060563)|neuron differentiation (GO:0030182)|noradrenergic neuron differentiation (GO:0003357)|oligodendrocyte development (GO:0014003)|outflow tract morphogenesis (GO:0003151)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of hippo signaling (GO:0035332)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lens epithelial cell proliferation (GO:2001111)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of ossification (GO:0045778)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|signal transduction involved in cell cycle checkpoint (GO:0072395)|skeletal muscle cell differentiation (GO:0035914)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)|somite development (GO:0061053)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|translation (GO:0006412)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|translation factor activity, nucleic acid binding (GO:0008135)			central_nervous_system(5)|cervix(1)|endometrium(1)|liver(1)|lung(4)|stomach(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		AGGCGGAGAGCTTGGAAGCGG	0.701																																					p.S7S		Atlas-SNP	.											.	SOX11	69	.	0			c.C21T						.						20.0	22.0	21.0					2																	5832874		2202	4298	6500	SO:0001819	synonymous_variant	6664	exon1			GGAGAGCTTGGAA		CCDS1654.1	2p25	2008-05-21			ENSG00000176887	ENSG00000176887		"""SRY (sex determining region Y)-boxes"""	11191	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 11"""	600898				8666406, 12637543	Standard	NM_003108		Approved		uc002qyj.3	P35716	OTTHUMG00000090333	ENST00000322002.3:c.21C>T	chr2.hg19:g.5832874C>T		166.0	0.0		155.0	27.0	NM_003108	Q4ZFV8	Silent	SNP	ENST00000322002.3	hg19	CCDS1654.1																																																																																			.	.		0.701	SOX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206698.1	NM_003108	
CEP68	23177	hgsc.bcm.edu	37	2	65305030	65305030	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:65305030A>C	ENST00000377990.2	+	5	2239	c.2036A>C	c.(2035-2037)cAg>cCg	p.Q679P	CEP68_ENST00000546106.1_Intron|RAB1A_ENST00000494188.1_Intron|CEP68_ENST00000260569.4_Missense_Mutation_p.Q542P	NM_015147.2	NP_055962.2	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	679					centriole-centriole cohesion (GO:0010457)|centrosome organization (GO:0051297)|protein localization to organelle (GO:0033365)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(8)|large_intestine(5)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	32						GATGAACATCAGTCTCTGACG	0.398																																					p.Q679P		Atlas-SNP	.											.	CEP68	69	.	0			c.A2036C						.						87.0	88.0	88.0					2																	65305030		2203	4300	6503	SO:0001583	missense	23177	exon5			AACATCAGTCTCT	BC004873	CCDS1880.2	2p14	2014-02-20	2005-12-01	2005-12-01	ENSG00000011523	ENSG00000011523			29076	protein-coding gene	gene with protein product			"""KIAA0582"""	KIAA0582		9628581, 9847074, 14654843	Standard	NM_015147		Approved		uc002sdl.4	Q76N32	OTTHUMG00000129538	ENST00000377990.2:c.2036A>C	chr2.hg19:g.65305030A>C	ENSP00000367229:p.Gln679Pro	76.0	0.0		59.0	11.0	NM_015147	B4DRQ1|D6W5F1|D6W5F2|O60326|Q9BQ18|Q9UDM9	Missense_Mutation	SNP	ENST00000377990.2	hg19	CCDS1880.2	.	.	.	.	.	.	.	.	.	.	A	14.82	2.648389	0.47258	.	.	ENSG00000011523	ENST00000377990;ENST00000260569	T;T	0.80123	-1.34;-1.34	5.86	5.86	0.93980	.	0.075145	0.53938	D	0.000046	D	0.86138	0.5861	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.989	D	0.83863	0.0269	10	0.25106	T	0.35	-16.7968	10.7736	0.46338	0.9268:0.0:0.0732:0.0	.	679;542	Q76N32;Q76N32-2	CEP68_HUMAN;.	P	679;542	ENSP00000367229:Q679P;ENSP00000260569:Q542P	ENSP00000260569:Q542P	Q	+	2	0	CEP68	65158534	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	3.696000	0.54757	2.237000	0.73441	0.460000	0.39030	CAG	.	.		0.398	CEP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251727.2	NM_015147	
ASTL	431705	hgsc.bcm.edu	37	2	96789942	96789942	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:96789942C>A	ENST00000342380.2	-	9	942	c.943G>T	c.(943-945)Gca>Tca	p.A315S		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GCCGACAGTGCCTCCAAAAGC	0.657																																					p.A315S		Atlas-SNP	.											.	ASTL	59	.	0			c.G943T						.						15.0	18.0	17.0					2																	96789942		2193	4274	6467	SO:0001583	missense	431705	exon9			ACAGTGCCTCCAA	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.943G>T	chr2.hg19:g.96789942C>A	ENSP00000343674:p.Ala315Ser	179.0	0.0		203.0	9.0	NM_001002036		Missense_Mutation	SNP	ENST00000342380.2	hg19	CCDS33249.1	.	.	.	.	.	.	.	.	.	.	C	19.86	3.906036	0.72868	.	.	ENSG00000188886	ENST00000342380	T	0.66280	-0.2	4.74	4.74	0.60224	.	0.388428	0.19528	N	0.112113	T	0.60958	0.2309	L	0.34521	1.04	0.20638	N	0.999876	D	0.56968	0.978	P	0.53224	0.721	T	0.53041	-0.8494	10	0.27785	T	0.31	-6.4598	13.6286	0.62181	0.0:1.0:0.0:0.0	.	315	Q6HA08	ASTL_HUMAN	S	315	ENSP00000343674:A315S	ENSP00000343674:A315S	A	-	1	0	ASTL	96153669	0.012000	0.17670	0.236000	0.24074	0.054000	0.15201	2.408000	0.44574	2.357000	0.79964	0.456000	0.33151	GCA	.	.		0.657	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1		
C1QL2	165257	hgsc.bcm.edu	37	2	119915526	119915526	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:119915526T>G	ENST00000272520.3	-	1	939	c.320A>C	c.(319-321)gAg>gCg	p.E107A		NM_182528.3	NP_872334.2	Q7Z5L3	C1QL2_HUMAN	complement component 1, q subcomponent-like 2	107	Collagen-like.				protein oligomerization (GO:0051259)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)				NS(1)|endometrium(1)|large_intestine(3)|pancreas(1)|prostate(1)	7						GTCGCCCTTCTCTCCCGGAGG	0.806										HNSCC(49;0.14)																											p.E107A		Atlas-SNP	.											.	C1QL2	25	.	0			c.A320C						.						2.0	2.0	2.0					2																	119915526		1041	2564	3605	SO:0001583	missense	165257	exon1			CCCTTCTCTCCCG	AF525315	CCDS42737.1	2q14.2	2009-05-20			ENSG00000144119	ENSG00000144119			24181	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 10"""	614330				18783346	Standard	NM_182528		Approved	CTRP10, C1QTNF10	uc002tlo.2	Q7Z5L3	OTTHUMG00000153271	ENST00000272520.3:c.320A>C	chr2.hg19:g.119915526T>G	ENSP00000272520:p.Glu107Ala	108.0	0.0		149.0	29.0	NM_182528		Missense_Mutation	SNP	ENST00000272520.3	hg19	CCDS42737.1	.	.	.	.	.	.	.	.	.	.	T	11.51	1.659756	0.29515	.	.	ENSG00000144119	ENST00000272520	D	0.93547	-3.24	4.29	4.29	0.51040	.	0.442010	0.20859	N	0.084395	D	0.90604	0.7054	L	0.52905	1.665	0.35683	D	0.814263	B	0.24186	0.099	B	0.28916	0.096	D	0.89724	0.3921	9	.	.	.	.	11.4065	0.49900	0.0:0.0:0.0:1.0	.	107	Q7Z5L3	C1QL2_HUMAN	A	107	ENSP00000272520:E107A	.	E	-	2	0	C1QL2	119631996	0.440000	0.25618	0.992000	0.48379	0.470000	0.32858	1.682000	0.37628	1.801000	0.52704	0.459000	0.35465	GAG	.	.		0.806	C1QL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330527.2	NM_182528	
SF3B1	23451	hgsc.bcm.edu	37	2	198273248	198273248	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:198273248T>A	ENST00000335508.6	-	8	1053	c.962A>T	c.(961-963)gAt>gTt	p.D321V		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	321	Interaction with PPP1R8.|U2AF homology region; mediates interaction with RMB39.				anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			ACCAATAGAATCTCCACCTCG	0.463			Mis		myelodysplastic syndrome																																p.D321V		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.A962T						.						81.0	84.0	83.0					2																	198273248		2203	4300	6503	SO:0001583	missense	23451	exon8			ATAGAATCTCCAC	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.962A>T	chr2.hg19:g.198273248T>A	ENSP00000335321:p.Asp321Val	88.0	0.0		57.0	25.0	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.	.	.	.	.	.	.	.	.	.	T	15.89	2.965255	0.53507	.	.	ENSG00000115524	ENST00000335508	.	.	.	4.67	4.67	0.58626	Splicing factor 3B subunit 1 (1);	0.112135	0.64402	D	0.000014	T	0.41766	0.1173	N	0.16790	0.44	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.25117	-1.0141	9	0.29301	T	0.29	.	14.5576	0.68113	0.0:0.0:0.0:1.0	.	321	O75533	SF3B1_HUMAN	V	321	.	ENSP00000335321:D321V	D	-	2	0	SF3B1	197981493	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.732000	0.84908	2.087000	0.62958	0.459000	0.35465	GAT	.	.		0.463	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
ABCA12	26154	hgsc.bcm.edu	37	2	215901702	215901702	+	Silent	SNP	C	C	G	rs375880439		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:215901702C>G	ENST00000272895.7	-	8	1179	c.960G>C	c.(958-960)ctG>ctC	p.L320L	AC072062.3_ENST00000437897.3_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	320					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CCAGAGTGTACAGCAGATGTT	0.418																																					p.L320L	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.G960C						.						108.0	109.0	108.0					2																	215901702		2203	4300	6503	SO:0001819	synonymous_variant	26154	exon8			AGTGTACAGCAGA	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.960G>C	chr2.hg19:g.215901702C>G		102.0	0.0		81.0	19.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	ENST00000272895.7	hg19	CCDS33372.1																																																																																			.	.		0.418	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ABCA12	26154	hgsc.bcm.edu	37	2	215901716	215901716	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:215901716C>A	ENST00000272895.7	-	8	1165	c.946G>T	c.(946-948)Gtt>Ttt	p.V316F	AC072062.3_ENST00000437897.3_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	316					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGATGTTTAACAGACTTCTGG	0.403																																					p.V316F	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											ABCA12,NS,carcinoma,0,1	ABCA12	368	.	0			c.G946T						.						108.0	109.0	109.0					2																	215901716		2203	4300	6503	SO:0001583	missense	26154	exon8			GTTTAACAGACTT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.946G>T	chr2.hg19:g.215901716C>A	ENSP00000272895:p.Val316Phe	114.0	2.0		80.0	20.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106314	0.77096	.	.	ENSG00000144452	ENST00000272895	T	0.56941	0.43	5.43	5.43	0.79202	.	0.364119	0.23142	N	0.051456	T	0.42381	0.1200	L	0.27053	0.805	0.80722	D	1	B	0.31680	0.335	B	0.30495	0.116	T	0.44757	-0.9307	10	0.87932	D	0	.	15.0898	0.72185	0.0:1.0:0.0:0.0	.	316	Q86UK0	ABCAC_HUMAN	F	316	ENSP00000272895:V316F	ENSP00000272895:V316F	V	-	1	0	ABCA12	215609961	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.273000	0.43381	2.699000	0.92147	0.655000	0.94253	GTT	.	.		0.403	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
ABCA12	26154	hgsc.bcm.edu	37	2	215901718	215901718	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:215901718G>T	ENST00000272895.7	-	8	1163	c.944C>A	c.(943-945)tCt>tAt	p.S315Y	AC072062.3_ENST00000437897.3_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	315					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ATGTTTAACAGACTTCTGGAG	0.408																																					p.S315Y	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.C944A						.						108.0	109.0	109.0					2																	215901718		2203	4300	6503	SO:0001583	missense	26154	exon8			TTAACAGACTTCT	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.944C>A	chr2.hg19:g.215901718G>T	ENSP00000272895:p.Ser315Tyr	114.0	0.0		79.0	19.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176668	0.78564	.	.	ENSG00000144452	ENST00000272895	T	0.57907	0.37	5.43	5.43	0.79202	.	0.366617	0.24022	N	0.042272	T	0.38639	0.1048	N	0.24115	0.695	0.80722	D	1	P	0.41748	0.761	B	0.35413	0.202	T	0.43458	-0.9390	10	0.66056	D	0.02	.	15.0898	0.72185	0.0:0.0:1.0:0.0	.	315	Q86UK0	ABCAC_HUMAN	Y	315	ENSP00000272895:S315Y	ENSP00000272895:S315Y	S	-	2	0	ABCA12	215609963	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.083000	0.50136	2.699000	0.92147	0.655000	0.94253	TCT	.	.		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
KLHL30	377007	hgsc.bcm.edu	37	2	239049437	239049437	+	Silent	SNP	G	G	A	rs374999323		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr2:239049437G>A	ENST00000409223.1	+	2	149	c.42G>A	c.(40-42)tcG>tcA	p.S14S	KLHL30_ENST00000305959.4_5'UTR			Q0D2K2	KLH30_HUMAN	kelch-like family member 30	14										lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		ACCTGCCCTCGCATGCCCAGG	0.662																																					p.S14S		Atlas-SNP	.											.	KLHL30	79	.	0			c.G42A						.	G		0,4296		0,0,2148	13.0	14.0	13.0		42	-9.3	0.6	2		13	1,8467		0,1,4233	no	coding-synonymous	KLHL30	NM_198582.3		0,1,6381	AA,AG,GG		0.0118,0.0,0.0078		14/579	239049437	1,12763	2148	4234	6382	SO:0001819	synonymous_variant	377007	exon2			GCCCTCGCATGCC		CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.42G>A	chr2.hg19:g.239049437G>A		100.0	0.0		104.0	21.0	NM_198582	Q6ZUS1	Silent	SNP	ENST00000409223.1	hg19	CCDS46555.2																																																																																			.	.		0.662	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328518.1	NM_198582	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	G	rs121913416|rs121913400		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr3:41266101C>G	ENST00000349496.5	+	3	378	c.98C>G	c.(97-99)tCt>tGt	p.S33C	CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26C|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33C	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33C	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,359	CTNNB1	4904	.	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98G						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>G	chr3.hg19:g.41266101C>G	ENSP00000344456:p.Ser33Cys	125.0	0.0		98.0	14.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381716	0.82792	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	C	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26C;ENSP00000385604:S33C;ENSP00000412219:S33C;ENSP00000379486:S33C;ENSP00000344456:S33C;ENSP00000411226:S26C;ENSP00000379488:S33C;ENSP00000409302:S33C;ENSP00000401599:S33C	ENSP00000344456:S33C	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
KCTD6	200845	hgsc.bcm.edu	37	3	58487086	58487086	+	Silent	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr3:58487086T>G	ENST00000355076.6	+	2	1424	c.441T>G	c.(439-441)acT>acG	p.T147T	KCTD6_ENST00000404589.3_Silent_p.T147T|KCTD6_ENST00000490264.1_Silent_p.T147T	NM_153331.3	NP_699162.3	Q8NC69	KCTD6_HUMAN	potassium channel tetramerization domain containing 6	147					protein homooligomerization (GO:0051260)		ankyrin binding (GO:0030506)			endometrium(1)|large_intestine(2)|lung(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(55;0.000177)|Kidney(10;0.00229)|KIRC - Kidney renal clear cell carcinoma(10;0.00258)|OV - Ovarian serous cystadenocarcinoma(275;0.148)		CCATCACCACTAAGGTCCATT	0.428																																					p.T147T		Atlas-SNP	.											.	KCTD6	14	.	0			c.T441G						.						130.0	116.0	120.0					3																	58487086		2203	4300	6503	SO:0001819	synonymous_variant	200845	exon3			CACCACTAAGGTC	AK074934	CCDS2891.1	3p21.2	2013-06-20	2013-06-20		ENSG00000168301	ENSG00000168301			22235	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 6"""			21472142	Standard	NM_153331		Approved	MGC27385, KCASH3	uc003dkj.4	Q8NC69	OTTHUMG00000159161	ENST00000355076.6:c.441T>G	chr3.hg19:g.58487086T>G		162.0	0.0		135.0	29.0	NM_001128214	B3KNI5|Q8NBS6|Q8TCA6	Silent	SNP	ENST00000355076.6	hg19	CCDS2891.1																																																																																			.	.		0.428	KCTD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353591.1	NM_153331	
CRYBG3	131544	hgsc.bcm.edu	37	3	97660086	97660086	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr3:97660086T>C	ENST00000182096.4	+	17	2820	c.2756T>C	c.(2755-2757)aTt>aCt	p.I919T	CRYBG3_ENST00000485253.1_3'UTR|CRYBG3_ENST00000389622.2_Missense_Mutation_p.I126T	NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2867							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TCTGTGTGCATTTCTCCCTAT	0.458																																					p.I2867T		Atlas-SNP	.											.	CRYBG3	86	.	0			c.T8600C						.						125.0	119.0	121.0					3																	97660086		1881	4103	5984	SO:0001583	missense	131544	exon20			TGTGCATTTCTCC			3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.2756T>C	chr3.hg19:g.97660086T>C	ENSP00000182096:p.Ile919Thr	121.0	0.0		80.0	15.0	NM_153605	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	ENST00000182096.4	hg19		.	.	.	.	.	.	.	.	.	.	T	7.900	0.734189	0.15574	.	.	ENSG00000080200	ENST00000182096;ENST00000495403;ENST00000389622	T;D;T	0.81659	1.67;-1.52;1.67	6.07	4.92	0.64577	Ricin B-related lectin (1);Ricin B lectin (3);	0.629153	0.15531	N	0.257492	T	0.75803	0.3899	L	0.49699	1.58	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.67476	-0.5661	10	0.72032	D	0.01	.	10.7055	0.45952	0.0:0.1313:0.0:0.8687	.	919	Q68DQ2	CRBG3_HUMAN	T	919;125;126	ENSP00000182096:I919T;ENSP00000418420:I125T;ENSP00000374273:I126T	ENSP00000182096:I919T	I	+	2	0	CRYBG3	99142776	0.081000	0.21417	0.006000	0.13384	0.307000	0.27823	2.594000	0.46189	1.121000	0.41925	0.477000	0.44152	ATT	.	.		0.458	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000353751.1	NM_153605	
OR5K1	26339	hgsc.bcm.edu	37	3	98188512	98188512	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr3:98188512T>A	ENST00000332650.5	+	1	189	c.92T>A	c.(91-93)tTc>tAc	p.F31Y		NM_001004736.2	NP_001004736.2	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K, member 1	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(4)|lung(21)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TTTGTGGTGTTCTTTGCCATC	0.433																																					p.F31Y		Atlas-SNP	.											.	OR5K1	51	.	0			c.T92A						.						126.0	125.0	126.0					3																	98188512		2203	4296	6499	SO:0001583	missense	26339	exon1			TGGTGTTCTTTGC	X64984	CCDS43115.1	3q11.2	2013-09-23			ENSG00000232382	ENSG00000232382		"""GPCR / Class A : Olfactory receptors"""	8349	protein-coding gene	gene with protein product						1370859	Standard	NM_001004736		Approved	HTPCRX10, HSHTPCRX10	uc003dsm.3	Q8NHB7	OTTHUMG00000160048	ENST00000332650.5:c.92T>A	chr3.hg19:g.98188512T>A	ENSP00000373193:p.Phe31Tyr	135.0	0.0		110.0	23.0	NM_001004736	B9EGY5|Q6IF46	Missense_Mutation	SNP	ENST00000332650.5	hg19	CCDS43115.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.590468	0.86851	.	.	ENSG00000232382	ENST00000332650	T	0.04360	3.64	5.05	5.05	0.67936	.	0.000000	0.43747	D	0.000534	T	0.23846	0.0577	M	0.89658	3.05	0.27284	N	0.95804	D	0.67145	0.996	D	0.63113	0.911	T	0.17899	-1.0354	10	0.87932	D	0	-15.8746	12.7429	0.57264	0.0:0.0:0.0:1.0	.	31	Q8NHB7	OR5K1_HUMAN	Y	31	ENSP00000373193:F31Y	ENSP00000373193:F31Y	F	+	2	0	OR5K1	99671202	0.996000	0.38824	0.472000	0.27241	0.902000	0.53008	6.293000	0.72731	1.902000	0.55061	0.383000	0.25322	TTC	.	.		0.433	OR5K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359019.1		
EPHB3	2049	hgsc.bcm.edu	37	3	184290389	184290389	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr3:184290389C>T	ENST00000330394.2	+	3	733	c.281C>T	c.(280-282)aCg>aTg	p.T94M	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	94	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)			breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TGGCTTCGCACGGGGTTCATC	0.587																																					p.T94M		Atlas-SNP	.											EPHB3,colon,carcinoma,0,1	EPHB3	114	.	0			c.C281T						.						63.0	59.0	60.0					3																	184290389		2203	4300	6503	SO:0001583	missense	2049	exon3			TTCGCACGGGGTT	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.281C>T	chr3.hg19:g.184290389C>T	ENSP00000332118:p.Thr94Met	75.0	0.0		89.0	10.0	NM_004443	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	hg19	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	C	18.67	3.672767	0.67928	.	.	ENSG00000182580	ENST00000330394	T	0.18960	2.18	5.53	5.53	0.82687	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.111469	0.64402	D	0.000014	T	0.58764	0.2145	H	0.94620	3.56	0.58432	D	0.999992	D	0.89917	1.0	D	0.65874	0.939	T	0.71494	-0.4576	10	0.87932	D	0	.	18.4651	0.90752	0.0:1.0:0.0:0.0	.	94	P54753	EPHB3_HUMAN	M	94	ENSP00000332118:T94M	ENSP00000332118:T94M	T	+	2	0	EPHB3	185773083	1.000000	0.71417	0.956000	0.39512	0.925000	0.55904	3.899000	0.56288	2.591000	0.87537	0.655000	0.94253	ACG	.	.		0.587	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
MAN2B2	23324	hgsc.bcm.edu	37	4	6598950	6598950	+	Silent	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr4:6598950C>T	ENST00000285599.3	+	8	1204	c.1168C>T	c.(1168-1170)Ctg>Ttg	p.L390L	MAN2B2_ENST00000504248.1_Silent_p.L339L	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	390					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						CACACGCTACCTGTGGCCGGC	0.672																																					p.L390L		Atlas-SNP	.											.	MAN2B2	80	.	0			c.C1168T						.						65.0	74.0	71.0					4																	6598950		2203	4300	6503	SO:0001819	synonymous_variant	23324	exon8			CGCTACCTGTGGC	BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1168C>T	chr4.hg19:g.6598950C>T		92.0	0.0		135.0	24.0	NM_015274	Q66MP2|Q86T67	Silent	SNP	ENST00000285599.3	hg19	CCDS33951.1																																																																																			.	.		0.672	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359106.2	NM_015274	
CPZ	8532	hgsc.bcm.edu	37	4	8607787	8607787	+	Silent	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr4:8607787C>T	ENST00000360986.4	+	5	955	c.781C>T	c.(781-783)Cta>Tta	p.L261L	CPZ_ENST00000429646.2_5'UTR|CPZ_ENST00000315782.6_Silent_p.L250L|CPZ_ENST00000382480.2_Silent_p.L124L	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	261					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GCTCATCTACCTAGCCCAGTA	0.602																																					p.L261L		Atlas-SNP	.											.	CPZ	95	.	0			c.C781T						.						146.0	114.0	125.0					4																	8607787		2203	4300	6503	SO:0001819	synonymous_variant	8532	exon5			ATCTACCTAGCCC	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.781C>T	chr4.hg19:g.8607787C>T		115.0	0.0		82.0	32.0	NM_001014447	O00520|Q96MX2	Silent	SNP	ENST00000360986.4	hg19	CCDS33953.1																																																																																			.	.		0.602	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
REST	5978	hgsc.bcm.edu	37	4	57797908	57797908	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr4:57797908A>G	ENST00000309042.7	+	4	3198	c.2884A>G	c.(2884-2886)Ata>Gta	p.I962V		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	962					cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					TCTCACTGGTATAAATTCAAC	0.428																																					p.I962V		Atlas-SNP	.											.	REST	104	.	0			c.A2884G						.						71.0	69.0	70.0					4																	57797908		2203	4300	6503	SO:0001583	missense	5978	exon4			ACTGGTATAAATT	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.2884A>G	chr4.hg19:g.57797908A>G	ENSP00000311816:p.Ile962Val	187.0	0.0		166.0	32.0	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	hg19	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	A	0.019	-1.450712	0.01080	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.06849	3.25	5.38	2.91	0.33838	.	0.685951	0.13240	N	0.402958	T	0.03095	0.0091	N	0.08118	0	0.09310	N	1	B;B	0.18741	0.03;0.009	B;B	0.15870	0.014;0.006	T	0.45891	-0.9230	10	0.06757	T	0.87	-5.9837	3.064	0.06209	0.5336:0.0:0.1623:0.3041	.	939;962	F8WAN5;Q13127	.;REST_HUMAN	V	962;939	ENSP00000311816:I962V	ENSP00000311816:I962V	I	+	1	0	REST	57492665	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.024000	0.13555	0.464000	0.27142	-0.250000	0.11733	ATA	.	.		0.428	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
FRAS1	80144	hgsc.bcm.edu	37	4	79204050	79204050	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr4:79204050C>T	ENST00000325942.6	+	12	1624	c.1184C>T	c.(1183-1185)tCt>tTt	p.S395F	FRAS1_ENST00000264899.6_Missense_Mutation_p.S395F|FRAS1_ENST00000264895.6_Missense_Mutation_p.S395F	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	395	VWFC 6. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TACGAGCCCTCTTGCCCACCA	0.557																																					p.S395F		Atlas-SNP	.											.	FRAS1	779	.	0			c.C1184T						.						77.0	82.0	80.0					4																	79204050		2007	4166	6173	SO:0001583	missense	80144	exon12			AGCCCTCTTGCCC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.1184C>T	chr4.hg19:g.79204050C>T	ENSP00000326330:p.Ser395Phe	84.0	0.0		82.0	37.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.85|16.85	3.237702|3.237702	0.58886|0.58886	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000502446|ENST00000325942;ENST00000264895;ENST00000264899;ENST00000534913	.|T;T;T	.|0.59364	.|0.27;0.27;0.27	5.6|5.6	5.6|5.6	0.85130|0.85130	.|von Willebrand factor, type C (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.75496|0.75496	0.3857|0.3857	M|M	0.65320|0.65320	2|2	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|0.999;1.0;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.995;0.993;0.999;0.999	T|T	0.76677|0.76677	-0.2871|-0.2871	5|10	.|0.72032	.|D	.|0.01	.|.	19.612|19.612	0.95610|0.95610	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|395;395;395;395	.|E9PHH6;Q86XX4;E7EWM9;A2RRR8	.|.;FRAS1_HUMAN;.;.	F|F	324|395;395;395;135	.|ENSP00000326330:S395F;ENSP00000264895:S395F;ENSP00000264899:S395F	.|ENSP00000264895:S395F	L|S	+|+	1|2	0|0	FRAS1|FRAS1	79423074|79423074	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.141000|0.141000	0.21300|0.21300	4.514000|4.514000	0.60482|0.60482	2.632000|2.632000	0.89209|0.89209	0.563000|0.563000	0.77884|0.77884	CTT|TCT	.	.		0.557	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
ADH4	127	hgsc.bcm.edu	37	4	100047761	100047761	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr4:100047761T>C	ENST00000265512.7	-	8	1176	c.1102A>G	c.(1102-1104)Atg>Gtg	p.M368V	ADH4_ENST00000423445.1_Missense_Mutation_p.M387V|ADH4_ENST00000505590.1_Missense_Mutation_p.M387V|ADH4_ENST00000508393.1_Missense_Mutation_p.M387V|RP11-696N14.1_ENST00000500358.2_RNA	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	368					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		CCTTGGTTCATTAGGTCAAAT	0.363																																					p.M368V		Atlas-SNP	.											.	ADH4	35	.	0			c.A1102G						.						141.0	138.0	139.0					4																	100047761		2203	4300	6503	SO:0001583	missense	127	exon8			GGTTCATTAGGTC	M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.1102A>G	chr4.hg19:g.100047761T>C	ENSP00000265512:p.Met368Val	57.0	0.0		39.0	10.0	NM_000670	A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	ENST00000265512.7	hg19	CCDS34032.1	.	.	.	.	.	.	.	.	.	.	T	11.12	1.545053	0.27652	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	4.75	-2.85	0.05734	GroES-like (1);	0.128136	0.47455	U	0.000239	T	0.10380	0.0254	M	0.77486	2.375	0.09310	N	0.999999	P;B	0.48998	0.918;0.028	B;B	0.36378	0.223;0.013	T	0.23190	-1.0195	10	0.87932	D	0	-3.668	8.954	0.35807	0.1814:0.0:0.5216:0.2969	.	387;368	P08319-2;P08319	.;ADH4_HUMAN	V	387;368;387;387	ENSP00000424630:M387V;ENSP00000265512:M368V;ENSP00000397939:M387V;ENSP00000425416:M387V	ENSP00000265512:M368V	M	-	1	0	ADH4	100266784	0.000000	0.05858	0.009000	0.14445	0.947000	0.59692	-0.937000	0.03942	-0.258000	0.09446	0.533000	0.62120	ATG	.	.		0.363	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364220.2	NM_000670	
TENM3	55714	hgsc.bcm.edu	37	4	183721241	183721241	+	Silent	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr4:183721241C>T	ENST00000511685.1	+	28	7960	c.7837C>T	c.(7837-7839)Ctg>Ttg	p.L2613L	TENM3_ENST00000406950.2_Silent_p.L2613L			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2613					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CGGCATGACCCTGGACGAGGA	0.741																																					p.L2613L		Atlas-SNP	.											.	.	.	.	0			c.C7837T						.						12.0	15.0	14.0					4																	183721241		2146	4243	6389	SO:0001819	synonymous_variant	55714	exon27			ATGACCCTGGACG	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.7837C>T	chr4.hg19:g.183721241C>T		59.0	0.0		74.0	15.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	ENST00000511685.1	hg19	CCDS47165.1																																																																																			.	.		0.741	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
CCT5	22948	hgsc.bcm.edu	37	5	10258287	10258287	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:10258287A>G	ENST00000280326.4	+	5	1015	c.595A>G	c.(595-597)Atg>Gtg	p.M199V	CCT5_ENST00000515390.1_Missense_Mutation_p.M144V|CCT5_ENST00000515676.1_Missense_Mutation_p.M161V|CCT5_ENST00000506600.1_Missense_Mutation_p.M106V|CCT5_ENST00000503026.1_Missense_Mutation_p.M178V	NM_012073.3	NP_036205.1	P48643	TCPE_HUMAN	chaperonin containing TCP1, subunit 5 (epsilon)	199					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|response to virus (GO:0009615)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleolus (GO:0005730)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|G-protein beta-subunit binding (GO:0031681)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(2)	26						TGTAGCAGATATGGAGCGGAG	0.478																																					p.M199V		Atlas-SNP	.											.	CCT5	49	.	0			c.A595G						.						109.0	92.0	97.0					5																	10258287		2203	4300	6503	SO:0001583	missense	22948	exon5			GCAGATATGGAGC	D43950	CCDS3877.1	5p15.2	2014-09-17			ENSG00000150753	ENSG00000150753		"""Heat Shock Proteins / Chaperonins"""	1618	protein-coding gene	gene with protein product		610150					Standard	NM_012073		Approved	KIAA0098	uc003jeq.3	P48643	OTTHUMG00000131042	ENST00000280326.4:c.595A>G	chr5.hg19:g.10258287A>G	ENSP00000280326:p.Met199Val	87.0	0.0		111.0	16.0	NM_012073	A8JZY8|A8K2X8|B4DYD8	Missense_Mutation	SNP	ENST00000280326.4	hg19	CCDS3877.1	.	.	.	.	.	.	.	.	.	.	A	11.28	1.592343	0.28357	.	.	ENSG00000150753	ENST00000280326;ENST00000503026;ENST00000515390;ENST00000440011;ENST00000515676;ENST00000506600	T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16	5.59	2.97	0.34412	.	0.036522	0.85682	D	0.000000	T	0.57227	0.2039	N	0.11560	0.145	0.58432	D	0.999995	B;B;B;B;B;B	0.10296	0.001;0.001;0.003;0.001;0.001;0.001	B;B;B;B;B;B	0.14578	0.001;0.006;0.011;0.006;0.006;0.006	T	0.54296	-0.8315	10	0.30854	T	0.27	-45.2411	10.4869	0.44729	0.7748:0.0:0.0:0.2252	.	106;144;48;197;199;199	B4DYD8;E7ENZ3;B4DZY9;Q9BU08;A8K2X8;P48643	.;.;.;.;.;TCPE_HUMAN	V	199;178;144;172;161;106	ENSP00000280326:M199V;ENSP00000423318:M178V;ENSP00000426923:M144V;ENSP00000427297:M161V;ENSP00000423052:M106V	ENSP00000280326:M199V	M	+	1	0	CCT5	10311287	1.000000	0.71417	0.962000	0.40283	0.401000	0.30781	4.592000	0.61027	2.141000	0.66446	0.529000	0.55759	ATG	.	.		0.478	CCT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253688.2		
RAI14	26064	hgsc.bcm.edu	37	5	34823676	34823676	+	Missense_Mutation	SNP	G	G	A	rs565597265		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:34823676G>A	ENST00000265109.3	+	15	2016	c.1729G>A	c.(1729-1731)Gag>Aag	p.E577K	RAI14_ENST00000503673.1_Missense_Mutation_p.E577K|RAI14_ENST00000428746.2_Missense_Mutation_p.E577K|RAI14_ENST00000506376.1_Missense_Mutation_p.E569K|RAI14_ENST00000515799.1_Missense_Mutation_p.E580K|RAI14_ENST00000397449.1_Missense_Mutation_p.E570K|RAI14_ENST00000512629.1_Missense_Mutation_p.E548K	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	577						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					GGAAGAGTACGAGGAAATGAA	0.358																																					p.E580K		Atlas-SNP	.											.	RAI14	100	.	0			c.G1738A						.						58.0	59.0	59.0					5																	34823676		2203	4300	6503	SO:0001583	missense	26064	exon17			GAGTACGAGGAAA	AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1729G>A	chr5.hg19:g.34823676G>A	ENSP00000265109:p.Glu577Lys	219.0	0.0		259.0	59.0	NM_001145525	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Missense_Mutation	SNP	ENST00000265109.3	hg19	CCDS34142.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979144	0.74360	.	.	ENSG00000039560	ENST00000265109;ENST00000512629;ENST00000428746;ENST00000503673;ENST00000515799;ENST00000506376;ENST00000397449	T;T;T;T;T;T;T	0.50001	0.78;0.76;0.78;0.78;0.78;0.82;0.82	5.42	5.42	0.78866	.	.	.	.	.	T	0.59742	0.2216	L	0.29908	0.895	0.48452	D	0.999658	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.80764	0.994;0.986;0.915;0.986	T	0.61992	-0.6948	9	0.59425	D	0.04	-25.9427	19.2253	0.93816	0.0:0.0:1.0:0.0	.	569;548;580;577	Q9P0K7-3;E9PED3;Q9P0K7-2;Q9P0K7	.;.;.;RAI14_HUMAN	K	577;548;577;577;580;569;570	ENSP00000265109:E577K;ENSP00000422377:E548K;ENSP00000388725:E577K;ENSP00000422942:E577K;ENSP00000427123:E580K;ENSP00000423854:E569K;ENSP00000380591:E570K	ENSP00000265109:E577K	E	+	1	0	RAI14	34859433	1.000000	0.71417	0.952000	0.39060	0.709000	0.40893	6.416000	0.73332	2.555000	0.86185	0.555000	0.69702	GAG	.	.		0.358	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366786.1	NM_015577	
NUP155	9631	hgsc.bcm.edu	37	5	37292009	37292009	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:37292009A>C	ENST00000231498.3	-	35	4372	c.4169T>G	c.(4168-4170)cTt>cGt	p.L1390R	NUP155_ENST00000502533.1_5'UTR|NUP155_ENST00000513532.1_Missense_Mutation_p.L1326R|NUP155_ENST00000381843.2_Missense_Mutation_p.L1331R	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	1390					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TAATTAATGAAGCCGTTCTAA	0.368																																					p.L1390R		Atlas-SNP	.											.	NUP155	116	.	0			c.T4169G						.						76.0	81.0	79.0					5																	37292009		2203	4300	6503	SO:0001583	missense	9631	exon35			TAATGAAGCCGTT	AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.4169T>G	chr5.hg19:g.37292009A>C	ENSP00000231498:p.Leu1390Arg	318.0	0.0		385.0	52.0	NM_153485	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	ENST00000231498.3	hg19	CCDS3921.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.392520	0.83011	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	D;D;D	0.82526	-1.62;-1.6;-1.57	5.05	5.05	0.67936	.	0.065619	0.64402	D	0.000007	D	0.88377	0.6420	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.76071	0.987;0.958	D	0.89609	0.3840	10	0.87932	D	0	.	14.9693	0.71220	1.0:0.0:0.0:0.0	.	1326;1390	E9PF10;O75694	.;NU155_HUMAN	R	1390;1331;1352;1326	ENSP00000231498:L1390R;ENSP00000371265:L1331R;ENSP00000422019:L1326R	ENSP00000231498:L1390R	L	-	2	0	NUP155	37327766	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.967000	0.87967	2.119000	0.64992	0.477000	0.44152	CTT	.	.		0.368	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207593.2	NM_153485, NM_004298	
GHR	2690	hgsc.bcm.edu	37	5	42688998	42688998	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:42688998C>T	ENST00000230882.4	+	4	333	c.143C>T	c.(142-144)tCt>tTt	p.S48F	GHR_ENST00000537449.1_Intron|GHR_ENST00000357703.3_Missense_Mutation_p.S26F	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	48					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	GCAGATTCTTCTAAGGAGCCT	0.428																																					p.S55F		Atlas-SNP	.											.	GHR	94	.	0			c.C164T						.						241.0	229.0	233.0					5																	42688998		2203	4300	6503	SO:0001583	missense	2690	exon4			ATTCTTCTAAGGA		CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.143C>T	chr5.hg19:g.42688998C>T	ENSP00000230882:p.Ser48Phe	86.0	0.0		99.0	11.0	NM_001242399	Q9HCX2	Missense_Mutation	SNP	ENST00000230882.4	hg19	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703116	0.68501	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000356276	D;D	0.83163	-1.69;-1.69	5.66	5.66	0.87406	Growth hormone/erythropoietin receptor, ligand binding (1);	0.294159	0.38164	N	0.001796	D	0.88489	0.6450	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	D	0.87832	0.2645	10	0.48119	T	0.1	-16.5512	8.9645	0.35867	0.1494:0.7746:0.0:0.0759	.	48	P10912	GHR_HUMAN	F	48;26;48	ENSP00000230882:S48F;ENSP00000350335:S26F	ENSP00000230882:S48F	S	+	2	0	GHR	42724755	0.911000	0.30947	0.998000	0.56505	0.951000	0.60555	1.420000	0.34804	2.657000	0.90304	0.655000	0.94253	TCT	.	.		0.428	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163	
HCN1	348980	hgsc.bcm.edu	37	5	45262400	45262400	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:45262400C>T	ENST00000303230.4	-	8	2353	c.2296G>A	c.(2296-2298)Gaa>Aaa	p.E766K		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	766					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TTGTGCACTTCATTTTTCGGC	0.657																																					p.E766K		Atlas-SNP	.											.	HCN1	298	.	0			c.G2296A						.						74.0	73.0	73.0					5																	45262400		2203	4300	6503	SO:0001583	missense	348980	exon8			GCACTTCATTTTT	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.2296G>A	chr5.hg19:g.45262400C>T	ENSP00000307342:p.Glu766Lys	43.0	0.0		70.0	6.0	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	hg19	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	C	10.56	1.385835	0.25031	.	.	ENSG00000164588	ENST00000303230	D	0.97352	-4.35	5.32	4.42	0.53409	.	0.266202	0.30686	N	0.009087	D	0.93674	0.7979	L	0.44542	1.39	0.40232	D	0.977864	B	0.18013	0.025	B	0.15870	0.014	D	0.90146	0.4217	10	0.06365	T	0.9	.	16.0422	0.80694	0.0:0.8662:0.1338:0.0	.	766	O60741	HCN1_HUMAN	K	766	ENSP00000307342:E766K	ENSP00000307342:E766K	E	-	1	0	HCN1	45298157	1.000000	0.71417	0.981000	0.43875	0.988000	0.76386	4.551000	0.60740	2.491000	0.84063	0.655000	0.94253	GAA	.	.		0.657	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
PJA2	9867	hgsc.bcm.edu	37	5	108714751	108714751	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:108714751T>C	ENST00000361189.2	-	4	676	c.437A>G	c.(436-438)tAt>tGt	p.Y146C	PJA2_ENST00000361557.3_Missense_Mutation_p.Y146C|PJA2_ENST00000511624.1_5'Flank	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	146					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		TCCTGGAATATACTCTCCCTC	0.423																																					p.Y146C		Atlas-SNP	.											.	PJA2	53	.	0			c.A437G						.						106.0	106.0	106.0					5																	108714751		2202	4300	6502	SO:0001583	missense	9867	exon4			GGAATATACTCTC	AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.437A>G	chr5.hg19:g.108714751T>C	ENSP00000354775:p.Tyr146Cys	79.0	0.0		120.0	9.0	NM_014819	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	hg19	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	T	7.107	0.575261	0.13623	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05447	3.44;3.44	5.65	-4.77	0.03219	.	1.001280	0.08053	N	0.996953	T	0.05090	0.0136	N	0.19112	0.55	0.09310	N	1	B	0.15473	0.013	B	0.19391	0.025	T	0.38457	-0.9660	10	0.36615	T	0.2	0.8583	14.7344	0.69406	0.0:0.534:0.0:0.466	.	146	O43164	PJA2_HUMAN	C	146	ENSP00000354775:Y146C;ENSP00000355284:Y146C	ENSP00000354775:Y146C	Y	-	2	0	PJA2	108742650	0.000000	0.05858	0.000000	0.03702	0.589000	0.36550	-0.291000	0.08343	-1.003000	0.03425	-0.408000	0.06270	TAT	.	.		0.423	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819	
APC	324	hgsc.bcm.edu	37	5	112175960	112175960	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:112175960A>G	ENST00000457016.1	+	16	5049	c.4669A>G	c.(4669-4671)Att>Gtt	p.I1557V	APC_ENST00000508376.2_Missense_Mutation_p.I1557V|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.I1557V			P25054	APC_HUMAN	adenomatous polyposis coli	1557	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.I1557fs*2(3)|p.I1557fs*1(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGAAAAAACTATTGATTCTGA	0.343		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.I1557V	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.,1	APC	4158	.	6	Insertion - Frameshift(3)|Deletion - Frameshift(2)|Unknown(1)	large_intestine(4)|soft_tissue(1)|skin(1)	c.A4669G	GRCh37	CD041153	APC	D		.						82.0	89.0	87.0					5																	112175960		2202	4300	6502	SO:0001583	missense	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	AAAACTATTGATT	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4669A>G	chr5.hg19:g.112175960A>G	ENSP00000413133:p.Ile1557Val	200.0	0.0		291.0	38.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	ENST00000457016.1	hg19	CCDS4107.1	.	.	.	.	.	.	.	.	.	.	A	0.092	-1.165756	0.01673	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.87809	-2.3;-2.3;-2.3	5.79	-3.91	0.04168	.	0.658116	0.16858	N	0.196638	T	0.58163	0.2103	N	0.02011	-0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.55872	-0.8072	9	.	.	.	0.0445	3.073	0.06237	0.4728:0.0827:0.2918:0.1526	.	1559;1557	Q4LE70;P25054	.;APC_HUMAN	V	1557	ENSP00000413133:I1557V;ENSP00000257430:I1557V;ENSP00000427089:I1557V	.	I	+	1	0	APC	112203859	0.000000	0.05858	0.059000	0.19551	0.515000	0.34225	-0.445000	0.06845	-0.944000	0.03686	-1.080000	0.02220	ATT	.	.		0.343	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
DDX46	9879	hgsc.bcm.edu	37	5	134116885	134116885	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:134116885T>G	ENST00000354283.4	+	7	963	c.828T>G	c.(826-828)gaT>gaG	p.D276E	DDX46_ENST00000452510.2_Missense_Mutation_p.D276E			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	276					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAGTTGTGGATTCTGATAAGA	0.368																																					p.D276E	Colon(13;391 453 4901 21675 24897)	Atlas-SNP	.											.	DDX46	77	.	0			c.T828G						.						95.0	101.0	99.0					5																	134116885		2203	4300	6503	SO:0001583	missense	9879	exon7			TGTGGATTCTGAT		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.828T>G	chr5.hg19:g.134116885T>G	ENSP00000346236:p.Asp276Glu	90.0	0.0		164.0	28.0	NM_014829	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	ENST00000354283.4	hg19	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	T	6.053	0.378131	0.11466	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.49720	2.99;0.77	5.05	-0.774	0.10991	.	0.381640	0.31290	N	0.007908	T	0.12050	0.0293	N	0.02011	-0.69	0.26580	N	0.973396	B	0.02656	0.0	B	0.04013	0.001	T	0.23797	-1.0178	10	0.02654	T	1	-23.8049	1.6248	0.02721	0.1164:0.1851:0.3107:0.3878	.	276	Q7L014	DDX46_HUMAN	E	276	ENSP00000416534:D276E;ENSP00000346236:D276E	ENSP00000346236:D276E	D	+	3	2	DDX46	134144784	0.168000	0.22989	0.955000	0.39395	0.905000	0.53344	-0.225000	0.09151	0.210000	0.20664	0.260000	0.18958	GAT	.	.		0.368	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
KDM3B	51780	hgsc.bcm.edu	37	5	137733999	137733999	+	Silent	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:137733999A>G	ENST00000314358.5	+	10	3164	c.2964A>G	c.(2962-2964)aaA>aaG	p.K988K	KDM3B_ENST00000394866.1_Silent_p.K644K|KDM3B_ENST00000542866.1_Silent_p.K20K	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	988					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						AGACCTCAAAATACATCCTGG	0.517																																					p.K988K		Atlas-SNP	.											.	KDM3B	177	.	0			c.A2964G						.						134.0	127.0	129.0					5																	137733999		2203	4300	6503	SO:0001819	synonymous_variant	51780	exon10			CTCAAAATACATC	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2964A>G	chr5.hg19:g.137733999A>G		132.0	0.0		164.0	21.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Silent	SNP	ENST00000314358.5	hg19	CCDS34242.1																																																																																			.	.		0.517	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
AFAP1L1	134265	hgsc.bcm.edu	37	5	148719573	148719573	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:148719573T>A	ENST00000296721.4	+	19	2385	c.2287T>A	c.(2287-2289)Tgg>Agg	p.W763R	AFAP1L1_ENST00000515000.1_Missense_Mutation_p.W720R	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	763						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTTCAGGAATGGGAAATGAA	0.413																																					p.W763R		Atlas-SNP	.											.	AFAP1L1	86	.	0			c.T2287A						.						112.0	102.0	105.0					5																	148719573		2203	4300	6503	SO:0001583	missense	134265	exon19			CAGGAATGGGAAA	AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.2287T>A	chr5.hg19:g.148719573T>A	ENSP00000296721:p.Trp763Arg	68.0	0.0		94.0	38.0	NM_152406	Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Missense_Mutation	SNP	ENST00000296721.4	hg19	CCDS34274.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.123551	0.77436	.	.	ENSG00000157510	ENST00000296721;ENST00000515000	T;T	0.61392	0.11;2.64	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.76421	0.3985	M	0.78049	2.395	0.30253	N	0.793947	D;D	0.89917	1.0;0.994	D;P	0.87578	0.998;0.807	T	0.78003	-0.2374	10	0.87932	D	0	-9.184	14.6128	0.68526	0.0:0.0:0.0:1.0	.	720;763	Q8TED9-2;Q8TED9	.;AF1L1_HUMAN	R	763;720	ENSP00000296721:W763R;ENSP00000424427:W720R	ENSP00000296721:W763R	W	+	1	0	AFAP1L1	148699766	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	4.318000	0.59190	2.271000	0.75665	0.459000	0.35465	TGG	.	.		0.413	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373443.1	NM_152406	
GEMIN5	25929	hgsc.bcm.edu	37	5	154311736	154311736	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:154311736T>C	ENST00000285873.7	-	4	659	c.584A>G	c.(583-585)gAt>gGt	p.D195G		NM_001252156.1|NM_015465.4	NP_001239085.1|NP_056280.2	Q8TEQ6	GEMI5_HUMAN	gem (nuclear organelle) associated protein 5	195					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|protein complex assembly (GO:0006461)|RNA metabolic process (GO:0016070)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)|snRNA binding (GO:0017069)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	38	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GATTTCATCATCATGGCCTCG	0.393																																					p.D195G		Atlas-SNP	.											GEMIN5,colon,carcinoma,0,1	GEMIN5	120	.	0			c.A584G						.						144.0	143.0	144.0					5																	154311736		2203	4300	6503	SO:0001583	missense	25929	exon4			TCATCATCATGGC	AK022748	CCDS4330.1	5q34	2013-01-10			ENSG00000082516	ENSG00000082516		"""WD repeat domain containing"""	20043	protein-coding gene	gene with protein product		607005				11714716	Standard	NM_015465		Approved		uc003lvx.3	Q8TEQ6	OTTHUMG00000130189	ENST00000285873.7:c.584A>G	chr5.hg19:g.154311736T>C	ENSP00000285873:p.Asp195Gly	142.0	0.0		192.0	21.0	NM_015465	Q14CV0|Q8WWV4|Q969W4|Q9H9K3|Q9UFI5	Missense_Mutation	SNP	ENST00000285873.7	hg19	CCDS4330.1	.	.	.	.	.	.	.	.	.	.	T	19.21	3.783108	0.70222	.	.	ENSG00000082516	ENST00000285873	T	0.60299	0.2	5.42	5.42	0.78866	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.152705	0.56097	D	0.000024	T	0.59252	0.2180	N	0.16098	0.37	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.65773	0.938;0.938	T	0.62483	-0.6845	10	0.39692	T	0.17	-14.2776	15.4924	0.75619	0.0:0.0:0.0:1.0	.	195;195	B7ZLC9;Q8TEQ6	.;GEMI5_HUMAN	G	195	ENSP00000285873:D195G	ENSP00000285873:D195G	D	-	2	0	GEMIN5	154291929	1.000000	0.71417	0.978000	0.43139	0.999000	0.98932	7.431000	0.80335	2.057000	0.61298	0.528000	0.53228	GAT	.	.		0.393	GEMIN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252507.1		
ITK	3702	hgsc.bcm.edu	37	5	156649918	156649918	+	Missense_Mutation	SNP	G	G	C	rs369289895		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:156649918G>C	ENST00000422843.3	+	6	693	c.541G>C	c.(541-543)Gac>Cac	p.D181H	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	181	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	TGCCTTATATGACTACCAAAC	0.483			T	SYK	peripheral T-cell lymphoma																																p.D181H	Esophageal Squamous(70;1378 1469 8785 19883)	Atlas-SNP	.		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	.	ITK	136	.	0			c.G541C						.						109.0	102.0	104.0					5																	156649918		2203	4300	6503	SO:0001583	missense	3702	exon6			TTATATGACTACC	D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.541G>C	chr5.hg19:g.156649918G>C	ENSP00000398655:p.Asp181His	125.0	0.0		138.0	15.0	NM_005546	B2R752|Q32ML7	Missense_Mutation	SNP	ENST00000422843.3	hg19	CCDS4336.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290953	0.80914	.	.	ENSG00000113263	ENST00000521769;ENST00000422843	D;T	0.93953	-3.32;-0.28	5.81	5.81	0.92471	Src homology-3 domain (4);	0.096082	0.64402	D	0.000001	D	0.97626	0.9222	H	0.94423	3.535	0.51012	D	0.9999	D	0.76494	0.999	D	0.70487	0.969	D	0.98380	1.0558	10	0.87932	D	0	.	17.008	0.86398	0.0:0.0:1.0:0.0	.	181	Q08881	ITK_HUMAN	H	56;181	ENSP00000430327:D56H;ENSP00000398655:D181H	ENSP00000398655:D181H	D	+	1	0	ITK	156582496	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	6.554000	0.73923	2.746000	0.94184	0.591000	0.81541	GAC	.	.		0.483	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252569.2		
FAM196B	100131897	hgsc.bcm.edu	37	5	169310508	169310508	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:169310508A>G	ENST00000377365.3	-	2	1776	c.395T>C	c.(394-396)aTc>aCc	p.I132T	DOCK2_ENST00000520908.1_Intron|DOCK2_ENST00000523351.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000256935.8_Intron|DOCK2_ENST00000540750.1_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	132										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						GTTGACCTGGATGGCACTTTG	0.512																																					p.I132T		Atlas-SNP	.											.	FAM196B	28	.	0			c.T395C						.						101.0	88.0	92.0					5																	169310508		692	1591	2283	SO:0001583	missense	100131897	exon2			ACCTGGATGGCAC		CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.395T>C	chr5.hg19:g.169310508A>G	ENSP00000366582:p.Ile132Thr	36.0	0.0		84.0	25.0	NM_001129891		Missense_Mutation	SNP	ENST00000377365.3	hg19	CCDS47336.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.761524	0.49468	.	.	ENSG00000204767	ENST00000377365	T	0.44482	0.92	5.25	5.25	0.73442	.	0.156175	0.44688	D	0.000422	T	0.35711	0.0941	L	0.50333	1.59	0.27704	N	0.945705	P	0.40332	0.713	B	0.39562	0.303	T	0.23476	-1.0187	10	0.16420	T	0.52	-17.0154	11.1941	0.48703	0.9259:0.0:0.0741:0.0	.	132	A6NMK8	F196B_HUMAN	T	132	ENSP00000366582:I132T	ENSP00000366582:I132T	I	-	2	0	FAM196B	169243086	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.368000	0.52357	1.980000	0.57719	0.533000	0.62120	ATC	.	.		0.512	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371629.1	NM_001129891	
ZNF346	23567	hgsc.bcm.edu	37	5	176449747	176449747	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:176449747A>G	ENST00000358149.3	+	1	51	c.8A>G	c.(7-9)tAt>tGt	p.Y3C	ZNF346_ENST00000506693.1_Missense_Mutation_p.Y3C|ZNF346_ENST00000503039.1_Missense_Mutation_p.Y3C|ZNF346_ENST00000261948.4_Missense_Mutation_p.Y3C|ZNF346_ENST00000512315.1_Missense_Mutation_p.Y3C|ZNF346_ENST00000511834.1_Missense_Mutation_p.Y3C|ZNF346_ENST00000503425.1_Missense_Mutation_p.Y3C	NM_012279.2	NP_036411.1	Q9UL40	ZN346_HUMAN	zinc finger protein 346	3					positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	14	all_cancers(89;6.3e-05)|Renal(175;0.000269)|Lung NSC(126;0.00476)|all_lung(126;0.00806)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGATGGAGTATCCCGCGCCG	0.667																																					p.Y3C		Atlas-SNP	.											.	ZNF346	24	.	0			c.A8G						.						5.0	6.0	6.0					5																	176449747		2040	4168	6208	SO:0001583	missense	23567	exon1			TGGAGTATCCCGC	AF083340	CCDS4409.1	5q35.3	2012-10-05			ENSG00000113761	ENSG00000113761			16403	protein-coding gene	gene with protein product		605308				10488071	Standard	NM_012279		Approved	JAZ, Zfp346	uc003mfi.3	Q9UL40	OTTHUMG00000130848	ENST00000358149.3:c.8A>G	chr5.hg19:g.176449747A>G	ENSP00000350869:p.Tyr3Cys	64.0	0.0		159.0	19.0	NM_012279	B7Z367|Q68CV9|Q6ZMW1	Missense_Mutation	SNP	ENST00000358149.3	hg19	CCDS4409.1	.	.	.	.	.	.	.	.	.	.	A	2.001	-0.429389	0.04701	.	.	ENSG00000113761	ENST00000358149;ENST00000506693;ENST00000512315;ENST00000503425;ENST00000261948;ENST00000511834;ENST00000503039	T;T;T;T;T;T;T	0.50813	0.83;0.73;0.79;0.79;0.78;0.82;0.78	3.27	-2.3	0.06785	.	1.280230	0.05805	N	0.612872	T	0.26448	0.0646	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.11235	0.001;0.001;0.004;0.0;0.001	B;B;B;B;B	0.09377	0.001;0.001;0.004;0.001;0.001	T	0.21552	-1.0242	10	0.39692	T	0.17	.	8.3451	0.32268	0.375:0.0:0.625:0.0	.	3;3;3;3;3	B7Z4J8;B7Z367;Q9UL40-2;B7Z4N4;Q9UL40	.;.;.;.;ZN346_HUMAN	C	3	ENSP00000350869:Y3C;ENSP00000423515:Y3C;ENSP00000421089:Y3C;ENSP00000421212:Y3C;ENSP00000261948:Y3C;ENSP00000425725:Y3C;ENSP00000424495:Y3C	ENSP00000261948:Y3C	Y	+	2	0	ZNF346	176382353	0.154000	0.22792	0.005000	0.12908	0.001000	0.01503	0.046000	0.14035	-0.500000	0.06614	-0.379000	0.06801	TAT	.	.		0.667	ZNF346-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253415.2	NM_012279	
ITPR3	3710	hgsc.bcm.edu	37	6	33651106	33651106	+	Missense_Mutation	SNP	C	C	T	rs531158838		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:33651106C>T	ENST00000374316.5	+	36	5780	c.4720C>T	c.(4720-4722)Cgg>Tgg	p.R1574W	ITPR3_ENST00000605930.1_Missense_Mutation_p.R1574W			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1574					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GGCAACCACGCGGGCCTTCCC	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16915	0.0		0.0	False		,,,				2504	0.0				p.R1574W		Atlas-SNP	.											.	ITPR3	409	.	0			c.C4720T						.						23.0	20.0	21.0					6																	33651106		2195	4297	6492	SO:0001583	missense	3710	exon35			ACCACGCGGGCCT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.4720C>T	chr6.hg19:g.33651106C>T	ENSP00000363435:p.Arg1574Trp	129.0	0.0		188.0	70.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	hg19	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760342	0.69763	.	.	ENSG00000096433	ENST00000374316	T	0.64085	-0.08	4.71	1.79	0.24919	.	0.000000	0.85682	D	0.000000	T	0.65913	0.2737	M	0.76574	2.34	0.53005	D	0.999964	D	0.89917	1.0	D	0.83275	0.996	T	0.67369	-0.5688	10	0.87932	D	0	-34.3961	7.4903	0.27458	0.4463:0.4778:0.0:0.0759	.	1574	Q14573	ITPR3_HUMAN	W	1574	ENSP00000363435:R1574W	ENSP00000363435:R1574W	R	+	1	2	ITPR3	33759084	0.952000	0.32445	0.751000	0.31187	0.822000	0.46500	2.218000	0.42889	0.042000	0.15717	-0.268000	0.10319	CGG	.	.		0.652	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
ITPR3	3710	hgsc.bcm.edu	37	6	33654876	33654876	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:33654876G>C	ENST00000374316.5	+	45	7130	c.6070G>C	c.(6070-6072)Gag>Cag	p.E2024Q	ITPR3_ENST00000605930.1_Missense_Mutation_p.E2024Q			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	2024					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	GCGGCCCCAGGAGCTGGTGAG	0.647																																					p.E2024Q		Atlas-SNP	.											.	ITPR3	409	.	0			c.G6070C						.						37.0	38.0	38.0					6																	33654876		2201	4290	6491	SO:0001583	missense	3710	exon44			CCCCAGGAGCTGG	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.6070G>C	chr6.hg19:g.33654876G>C	ENSP00000363435:p.Glu2024Gln	80.0	0.0		101.0	9.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	hg19	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469347	0.43839	.	.	ENSG00000096433	ENST00000374316	D	0.91237	-2.81	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.85470	0.5704	N	0.16130	0.375	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.91635	0.999;0.986	T	0.82792	-0.0282	10	0.02654	T	1	-39.143	18.2503	0.90000	0.0:0.0:1.0:0.0	.	2024;1694	Q14573;Q59ES2	ITPR3_HUMAN;.	Q	2024	ENSP00000363435:E2024Q	ENSP00000363435:E2024Q	E	+	1	0	ITPR3	33762854	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.701000	0.98710	2.304000	0.77564	0.561000	0.74099	GAG	.	.		0.647	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
TREML4	285852	hgsc.bcm.edu	37	6	41196730	41196730	+	Silent	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:41196730T>C	ENST00000341495.2	+	2	446	c.342T>C	c.(340-342)gcT>gcC	p.A114A	TREML4_ENST00000448827.2_Silent_p.A114A	NM_198153.2	NP_937796.1	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid cells-like 4	114	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.196)					TCTACAACGCTTCCGAAAACA	0.488																																					p.A114A		Atlas-SNP	.											.	TREML4	25	.	0			c.T342C						.						85.0	81.0	82.0					6																	41196730		2203	4300	6503	SO:0001819	synonymous_variant	285852	exon2			CAACGCTTCCGAA	AF534826	CCDS34446.1	6p21.1	2013-01-11			ENSG00000188056	ENSG00000188056		"""Immunoglobulin superfamily / V-set domain containing"""	30807	protein-coding gene	gene with protein product	"""TREM like transcript 4"""	614664				12645956	Standard	NM_198153		Approved	TLT4	uc003oqc.3	Q6UXN2	OTTHUMG00000016408	ENST00000341495.2:c.342T>C	chr6.hg19:g.41196730T>C		62.0	0.0		49.0	38.0	NM_198153	B7ZL92	Silent	SNP	ENST00000341495.2	hg19	CCDS34446.1																																																																																			.	.		0.488	TREML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043873.2		
SUPT3H	8464	hgsc.bcm.edu	37	6	45289589	45289589	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:45289589T>A	ENST00000371460.1	-	4	395	c.78A>T	c.(76-78)aaA>aaT	p.K26N	SUPT3H_ENST00000306867.5_Intron|SUPT3H_ENST00000459689.1_Intron|SUPT3H_ENST00000371459.1_Intron|SUPT3H_ENST00000371461.2_Missense_Mutation_p.K26N	NM_181356.2	NP_852001.1	O75486	SUPT3_HUMAN	suppressor of Ty 3 homolog (S. cerevisiae)	0					chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|STAGA complex (GO:0030914)|transcription factor TFTC complex (GO:0033276)	transcription coactivator activity (GO:0003713)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)	12						GAAAAACTGATTTTCCAATTA	0.313																																					p.K26N		Atlas-SNP	.											.	SUPT3H	75	.	0			c.A78T						.						41.0	41.0	41.0					6																	45289589		2201	4295	6496	SO:0001583	missense	8464	exon4			AACTGATTTTCCA	AF069734	CCDS34465.1, CCDS34466.1, CCDS75464.1	6p21.1-p12.3	2008-05-15	2001-11-28		ENSG00000196284	ENSG00000196284			11466	protein-coding gene	gene with protein product		602947	"""suppressor of Ty (S.cerevisiae) 3 homolog"""			9674425, 9726987	Standard	NM_003599		Approved	SPT3, SPT3L	uc003oxp.4	O75486	OTTHUMG00000014773	ENST00000371460.1:c.78A>T	chr6.hg19:g.45289589T>A	ENSP00000360515:p.Lys26Asn	74.0	0.0		103.0	18.0	NM_181356	A6NKG9|B2R9Q5|O76066|Q5TAV9|Q86VN7	Missense_Mutation	SNP	ENST00000371460.1	hg19	CCDS34466.1	.	.	.	.	.	.	.	.	.	.	T	11.41	1.631544	0.29068	.	.	ENSG00000196284	ENST00000371460;ENST00000371461	T;T	0.50001	0.76;0.76	4.92	-2.32	0.06745	.	0.977903	0.08360	N	0.957895	T	0.11410	0.0278	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26985	-1.0087	9	0.52906	T	0.07	.	0.6557	0.00834	0.3068:0.1292:0.1599:0.404	.	26	O75486-3	.	N	26	ENSP00000360515:K26N;ENSP00000360516:K26N	ENSP00000360515:K26N	K	-	3	2	SUPT3H	45397567	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	0.134000	0.15932	-0.451000	0.07097	-0.646000	0.03943	AAA	.	.		0.313	SUPT3H-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000106910.3	NM_181356	
GPR115	221393	hgsc.bcm.edu	37	6	47681896	47681896	+	Silent	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:47681896C>T	ENST00000283303.2	+	6	1173	c.915C>T	c.(913-915)gcC>gcT	p.A305A	GPR115_ENST00000371220.1_Silent_p.A362A|RN7SKP116_ENST00000516902.1_RNA|GPR115_ENST00000327753.3_Silent_p.A305A	NM_153838.3	NP_722580.3	Q8IZF3	GP115_HUMAN	G protein-coupled receptor 115	305					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	52						TGAGAGAAGCCCACTTGCAAA	0.473																																					p.A305A	GBM(22;431 510 9010 26644 32828)	Atlas-SNP	.											.	GPR115	140	.	0			c.C915T						.						60.0	65.0	63.0					6																	47681896		2203	4300	6503	SO:0001819	synonymous_variant	221393	exon6			AGAAGCCCACTTG	AK095395	CCDS4922.2	6p12.3	2014-08-08			ENSG00000153294	ENSG00000153294		"""-"", ""GPCR / Class B : Orphans"""	19011	protein-coding gene	gene with protein product		614268				12435584	Standard	NM_153838		Approved	FLJ38076, PGR18	uc003oza.1	Q8IZF3	OTTHUMG00000014800	ENST00000283303.2:c.915C>T	chr6.hg19:g.47681896C>T		104.0	0.0		147.0	23.0	NM_153838	B3KTD0|Q2PNZ0|Q5T5B5|Q5T5B6|Q86SN9|Q8IXE6	Silent	SNP	ENST00000283303.2	hg19	CCDS4922.2																																																																																			.	.		0.473	GPR115-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040819.2	NM_153838	
RIMS1	22999	hgsc.bcm.edu	37	6	73102484	73102484	+	Silent	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:73102484C>A	ENST00000521978.1	+	31	4590	c.4590C>A	c.(4588-4590)ggC>ggA	p.G1530G	RIMS1_ENST00000538414.1_Silent_p.G336G|RIMS1_ENST00000425662.2_Silent_p.G598G|RIMS1_ENST00000264839.7_Silent_p.G1379G|RIMS1_ENST00000491071.2_Silent_p.G1353G|RIMS1_ENST00000401910.3_Silent_p.G850G|RIMS1_ENST00000414192.2_Silent_p.G57G|RIMS1_ENST00000431478.2_3'UTR|RIMS1_ENST00000517960.1_Silent_p.G1313G|RIMS1_ENST00000520567.1_Silent_p.G1180G|RIMS1_ENST00000522291.1_Silent_p.G1129G|RIMS1_ENST00000518273.1_Silent_p.G1209G|RIMS1_ENST00000517827.1_Silent_p.G664G|RIMS1_ENST00000348717.5_Silent_p.G1313G|RIMS1_ENST00000523963.1_Silent_p.G655G	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1530					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGCTTGTTGGCCGCCAAACCC	0.388																																					p.G1530G		Atlas-SNP	.											.	RIMS1	278	.	0			c.C4590A						.						87.0	82.0	84.0					6																	73102484		1842	4103	5945	SO:0001819	synonymous_variant	22999	exon31			TGTTGGCCGCCAA	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.4590C>A	chr6.hg19:g.73102484C>A		93.0	0.0		113.0	11.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	hg19	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.293|9.293	1.051193|1.051193	0.19827|0.19827	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000517433	.|.	.|.	.|.	5.5|5.5	1.03|1.03	0.20045|0.20045	.|.	.|.	.|.	.|.	.|.	T|T	0.46619|0.46619	0.1402|0.1402	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.44236|0.44236	-0.9341|-0.9341	4|4	.|.	.|.	.|.	-16.1788|-16.1788	11.6351|11.6351	0.51198|0.51198	0.4883:0.4495:0.0:0.0622|0.4883:0.4495:0.0:0.0622	.|.	.|.	.|.	.|.	D|T	448|876	.|.	.|.	A|P	+|+	2|1	0|0	RIMS1|RIMS1	73159205|73159205	0.432000|0.432000	0.25554|0.25554	0.998000|0.998000	0.56505|0.56505	0.985000|0.985000	0.73830|0.73830	-0.232000|-0.232000	0.09055|0.09055	0.259000|0.259000	0.21709|0.21709	-0.189000|-0.189000	0.12847|0.12847	GCC|CCG	.	.		0.388	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
RWDD2A	112611	hgsc.bcm.edu	37	6	83905923	83905923	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:83905923A>T	ENST00000369724.4	+	3	1016	c.811A>T	c.(811-813)Aag>Tag	p.K271*	RWDD2A_ENST00000539997.1_Nonsense_Mutation_p.K217*|PGM3_ENST00000506587.1_5'Flank|PGM3_ENST00000513973.1_5'Flank|PGM3_ENST00000512866.1_5'Flank|PGM3_ENST00000283977.4_5'Flank	NM_033411.3	NP_219479.2	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A	271										cervix(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	5		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		AGAATTTCTCAAGAAGCACAA	0.368																																					p.K271X		Atlas-SNP	.											RWDD2A,NS,carcinoma,0,1	RWDD2A	12	.	0			c.A811T						.						72.0	74.0	73.0					6																	83905923		2203	4300	6503	SO:0001587	stop_gained	112611	exon3			TTTCTCAAGAAGC	BC010930	CCDS4998.1	6q15	2012-12-07	2007-07-17	2007-07-17	ENSG00000013392	ENSG00000013392			21385	protein-coding gene	gene with protein product			"""RWD domain containing 2"""	RWDD2			Standard	NM_033411		Approved	MGC13523, dJ747H23.2	uc003pjx.4	Q9UIY3	OTTHUMG00000015109	ENST00000369724.4:c.811A>T	chr6.hg19:g.83905923A>T	ENSP00000358739:p.Lys271*	128.0	1.0		178.0	76.0	NM_033411	B4DIQ3|E1P548|Q2M3R3|Q96FH1	Nonsense_Mutation	SNP	ENST00000369724.4	hg19	CCDS4998.1	.	.	.	.	.	.	.	.	.	.	A	45	12.058760	0.99631	.	.	ENSG00000013392	ENST00000369724;ENST00000539997	.	.	.	5.65	5.65	0.86999	.	0.214637	0.40818	N	0.001017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.6986	16.0399	0.80667	1.0:0.0:0.0:0.0	.	.	.	.	X	271;217	.	ENSP00000358739:K271X	K	+	1	0	RWDD2A	83962642	1.000000	0.71417	0.871000	0.34182	0.872000	0.50106	7.957000	0.87870	2.371000	0.80710	0.533000	0.62120	AAG	.	.		0.368	RWDD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041348.2	NM_033411	
EGFR	1956	hgsc.bcm.edu	37	7	55242460	55242460	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:55242460A>G	ENST00000275493.2	+	19	2407	c.2230A>G	c.(2230-2232)Atc>Gtc	p.I744V	EGFR_ENST00000455089.1_Missense_Mutation_p.I699V|EGFR_ENST00000454757.2_Missense_Mutation_p.I691V|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	744	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.I744_A750>VK(1)|p.I744_E749>LKR(1)|p.I744V(1)|p.E746_T751>I(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	TCCCGTCGCTATCAAGGAATT	0.473		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.I744V		Atlas-SNP	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	EGFR,NS,carcinoma,-1,1	EGFR	20426	.	4	Complex - deletion inframe(3)|Substitution - Missense(1)	lung(4)	c.A2230G						.						113.0	109.0	111.0					7																	55242460		2203	4300	6503	SO:0001583	missense	1956	exon19	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	GTCGCTATCAAGG		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2230A>G	chr7.hg19:g.55242460A>G	ENSP00000275493:p.Ile744Val	79.0	0.0		99.0	12.0	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	hg19	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	A	22.4	4.287834	0.80803	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.78481	-1.18;-1.18;-1.18	5.67	5.67	0.87782	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73063	0.3539	N	0.02960	-0.455	0.58432	D	0.99999	P;D	0.69078	0.845;0.997	B;D	0.65684	0.403;0.937	T	0.81754	-0.0788	10	0.87932	D	0	.	14.73	0.69374	1.0:0.0:0.0:0.0	.	699;744	Q504U8;P00533	.;EGFR_HUMAN	V	699;614;744;691	ENSP00000415559:I699V;ENSP00000275493:I744V;ENSP00000395243:I691V	ENSP00000275493:I744V	I	+	1	0	EGFR	55209954	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	9.236000	0.95360	2.161000	0.67846	0.459000	0.35465	ATC	.	.		0.473	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
SLC25A40	55972	hgsc.bcm.edu	37	7	87477196	87477196	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:87477196T>C	ENST00000341119.5	-	7	775	c.429A>G	c.(427-429)atA>atG	p.I143M		NM_018843.3	NP_061331.2	Q8TBP6	S2540_HUMAN	solute carrier family 25, member 40	143					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.I143I(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	17	Esophageal squamous(14;0.00202)					CAACAATTGGTATGCAGGTTT	0.348																																					p.I143M		Atlas-SNP	.											SLC25A40,NS,carcinoma,0,1	SLC25A40	32	.	1	Substitution - coding silent(1)	lung(1)	c.A429G						.						55.0	54.0	54.0					7																	87477196		2203	4300	6503	SO:0001583	missense	55972	exon7			AATTGGTATGCAG	AF125531	CCDS5610.1	7q21.12	2013-05-22			ENSG00000075303	ENSG00000075303		"""Solute carriers"""	29680	protein-coding gene	gene with protein product		610821				16949250	Standard	NM_018843		Approved	MCFP	uc003uje.3	Q8TBP6	OTTHUMG00000131033	ENST00000341119.5:c.429A>G	chr7.hg19:g.87477196T>C	ENSP00000344831:p.Ile143Met	152.0	0.0		154.0	30.0	NM_018843	A8K483|D6W5P6|Q53GB1|Q9UHR1	Missense_Mutation	SNP	ENST00000341119.5	hg19	CCDS5610.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.375060	0.42105	.	.	ENSG00000075303	ENST00000341119	T	0.78707	-1.2	5.13	3.94	0.45596	Mitochondrial carrier domain (2);	0.160905	0.64402	D	0.000020	T	0.80417	0.4619	L	0.61036	1.89	0.31432	N	0.673039	P	0.42993	0.797	P	0.55667	0.781	T	0.78043	-0.2358	10	0.33940	T	0.23	.	5.878	0.18840	0.2835:0.0:0.1248:0.5917	.	143	Q8TBP6	S2540_HUMAN	M	143	ENSP00000344831:I143M	ENSP00000344831:I143M	I	-	3	3	SLC25A40	87315132	1.000000	0.71417	0.993000	0.49108	0.598000	0.36846	1.072000	0.30678	0.875000	0.35847	0.482000	0.46254	ATA	.	.		0.348	SLC25A40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253677.5	NM_018843	
TRRAP	8295	hgsc.bcm.edu	37	7	98513492	98513492	+	Silent	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:98513492C>A	ENST00000359863.4	+	19	2555	c.2346C>A	c.(2344-2346)ctC>ctA	p.L782L	TRRAP_ENST00000355540.3_Silent_p.L782L|TRRAP_ENST00000446306.3_Silent_p.L781L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	782					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCTTGCCTCTCCTTCCAAACC	0.498																																					p.L782L		Atlas-SNP	.											.	TRRAP	863	.	0			c.C2346A						.						136.0	117.0	123.0					7																	98513492		2203	4300	6503	SO:0001819	synonymous_variant	8295	exon19			GCCTCTCCTTCCA	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.2346C>A	chr7.hg19:g.98513492C>A		103.0	0.0		75.0	11.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	ENST00000359863.4	hg19	CCDS59066.1	.	.	.	.	.	.	.	.	.	.	C	9.382	1.073344	0.20147	.	.	ENSG00000196367	ENST00000456197	.	.	.	5.7	1.66	0.24008	.	.	.	.	.	T	0.55752	0.1940	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47446	-0.9117	4	.	.	.	.	8.1337	0.31041	0.0:0.3804:0.4599:0.1597	.	.	.	.	Y	497	.	.	S	+	2	0	TRRAP	98351428	0.996000	0.38824	0.963000	0.40424	0.991000	0.79684	0.264000	0.18497	0.337000	0.23665	0.655000	0.94253	TCC	.	.		0.498	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
EXOC4	60412	hgsc.bcm.edu	37	7	132990717	132990720	+	Missense_Mutation	ONP	GAAC	GAAC	TTTT			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G|A|A|C	G|A|A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:132990717_132990720GAAC>TTTT	ENST00000253861.4	+	4	587_590	c.558_561GAAC>TTTT	c.(556-561)atGAAC>atTTTT	p.186_187MN>IF	EXOC4_ENST00000539845.1_Missense_Mutation_p.85_86MN>IF|EXOC4_ENST00000393161.2_Missense_Mutation_p.186_187MN>IF	NM_021807.3	NP_068579.3	Q96A65	EXOC4_HUMAN	exocyst complex component 4	186					cellular protein metabolic process (GO:0044267)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)	protein N-terminus binding (GO:0047485)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(16)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	50		Esophageal squamous(399;0.129)				GCAAGAAGATGAACCTTCACTTGG	0.475																																					p.M186I|p.N187Y|p.N187I|p.N187N		Atlas-SNP	.											.	EXOC4	118	.	0			c.G558T|c.A559T|c.A560T|c.C561T						.																																			SO:0001583	missense	60412	exon4			GAAGATGAACCTT|AAGATGAACCTTC|AGATGAACCTTCA|GATGAACCTTCAC	AL831989	CCDS5829.1, CCDS43648.1	7q31	2013-01-22	2005-11-01	2005-11-01	ENSG00000131558	ENSG00000131558			30389	protein-coding gene	gene with protein product		608185	"""SEC8-like 1 (S. cerevisiae)"""	SEC8L1		11214970, 12687004	Standard	XM_005250523		Approved	KIAA1699, MGC27170, SEC8, Sec8p	uc003vrk.3	Q96A65	OTTHUMG00000155259	ENST00000253861.4:c.558_561GAAC>TTTT	chr7.hg19:g.132990717GAAC>TTTT	ENSP00000253861:p.M186_N187delinsIF	93.0|93.0|93.0|94.0	0.0		90.0|89.0|89.0|88.0	15.0|14.0|14.0|14.0	NM_021807	E9PED2|Q541U8|Q9C0G4|Q9H9K0|Q9P102	Missense_Mutation|Missense_Mutation|Missense_Mutation|Silent	SNP	ENST00000253861.4	hg19	CCDS5829.1																																																																																			.	.		0.475	EXOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339182.1	NM_021807	
CNTNAP2	26047	hgsc.bcm.edu	37	7	146829531	146829531	+	Silent	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:146829531C>A	ENST00000361727.3	+	8	1794	c.1278C>A	c.(1276-1278)ctC>ctA	p.L426L		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	426	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			AGATTGACCTCACTGAAAGCA	0.443										HNSCC(39;0.1)																											p.L426L		Atlas-SNP	.											.	CNTNAP2	392	.	0			c.C1278A						.						128.0	111.0	117.0					7																	146829531		2203	4300	6503	SO:0001819	synonymous_variant	26047	exon8			TGACCTCACTGAA	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1278C>A	chr7.hg19:g.146829531C>A		120.0	0.0		102.0	25.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Silent	SNP	ENST00000361727.3	hg19	CCDS5889.1																																																																																			.	.		0.443	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
CNTNAP2	26047	hgsc.bcm.edu	37	7	147259228	147259228	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:147259228A>G	ENST00000361727.3	+	12	2293		c.e12-1			NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2						adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGTTTGTTCTAGCTATCTACG	0.453										HNSCC(39;0.1)																											.		Atlas-SNP	.											.	CNTNAP2	392	.	0			c.1778-2A>G						.						109.0	101.0	104.0					7																	147259228		2203	4300	6503	SO:0001630	splice_region_variant	26047	exon12			TGTTCTAGCTATC	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.1778-1A>G	chr7.hg19:g.147259228A>G		80.0	0.0		76.0	18.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Splice_Site	SNP	ENST00000361727.3	hg19	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.126805	0.77549	.	.	ENSG00000174469	ENST00000361727	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2071	0.73186	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CNTNAP2	146890161	1.000000	0.71417	0.989000	0.46669	0.700000	0.40528	9.145000	0.94634	2.257000	0.74773	0.533000	0.62120	.	.	.		0.453	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		Intron
KMT2C	58508	hgsc.bcm.edu	37	7	151842365	151842365	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:151842365C>G	ENST00000262189.6	-	54	14265	c.14047G>C	c.(14047-14049)Gca>Cca	p.A4683P	KMT2C_ENST00000485655.2_5'Flank|KMT2C_ENST00000355193.2_Missense_Mutation_p.A4740P	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4683	FYR C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00876}.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTTTCACATGCCTCAACCCCA	0.488																																					p.A4683P		Atlas-SNP	.											.	MLL3	1564	.	0			c.G14047C						.						73.0	64.0	67.0					7																	151842365		2203	4300	6503	SO:0001583	missense	58508	exon54			CACATGCCTCAAC	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.14047G>C	chr7.hg19:g.151842365C>G	ENSP00000262189:p.Ala4683Pro	68.0	0.0		56.0	10.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.65|16.65	3.182237|3.182237	0.57800|0.57800	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877|ENST00000360104	T;T;T|.	0.44482|.	0.92;0.92;0.92|.	5.23|5.23	5.23|5.23	0.72850|0.72850	FY-rich, C-terminal (1);FY-rich, C-terminal subgroup (1);|.	0.000000|.	0.44285|.	U|.	0.000467|.	T|T	0.72510|0.72510	0.3469|0.3469	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	0.999;1.0;1.0|.	D;D;D|.	0.81914|.	0.995;0.984;0.984|.	T|T	0.69680|0.69680	-0.5080|-0.5080	10|5	0.66056|.	D|.	0.02|.	.|.	19.161|19.161	0.93531|0.93531	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4683;3801;4740|.	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3|.	MLL3_HUMAN;.;.|.	P|A	4683;4740;1300|2243	ENSP00000262189:A4683P;ENSP00000347325:A4740P;ENSP00000410411:A1300P|.	ENSP00000262189:A4683P|.	A|G	-|-	1|2	0|0	MLL3|MLL3	151473298|151473298	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	3.929000|3.929000	0.56514|0.56514	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	GCA|GGC	.	.		0.488	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
GNRH1	2796	hgsc.bcm.edu	37	8	25276942	25276942	+	Missense_Mutation	SNP	T	T	G	rs185185508		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr8:25276942T>G	ENST00000276414.4	-	3	1595	c.272A>C	c.(271-273)aAg>aCg	p.K91T	GNRH1_ENST00000421054.2_Missense_Mutation_p.K91T	NM_000825.3	NP_000816.4	P01148	GON1_HUMAN	gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)	91					cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|ovulation cycle (GO:0042698)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|response to corticosteroid (GO:0031960)|response to ethanol (GO:0045471)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	gonadotropin hormone-releasing hormone activity (GO:0005183)|hormone activity (GO:0005179)			large_intestine(1)	1		all_cancers(63;0.0423)|Ovarian(32;0.000626)|all_epithelial(46;0.0186)|Hepatocellular(4;0.114)|Breast(100;0.14)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0201)|Epithelial(17;1.25e-12)|Colorectal(74;0.0113)|COAD - Colon adenocarcinoma(73;0.0385)		GATTTAAATCTTCTTCTGCCC	0.313																																					p.K95T		Atlas-SNP	.											.	GNRH1	8	.	0			c.A284C						.						122.0	113.0	116.0					8																	25276942		1823	4075	5898	SO:0001583	missense	2796	exon3			TAAATCTTCTTCT	X01059	CCDS43725.1	8p21-p11.2	2013-02-26	2004-10-13		ENSG00000147437	ENSG00000147437		"""Endogenous ligands"""	4419	protein-coding gene	gene with protein product		152760	"""gonadotropin-releasing hormone 1 (leutinizing-releasing hormone)"""	GRH, GNRH, LHRH		6090951	Standard	NM_000825		Approved		uc003xem.4	P01148	OTTHUMG00000163852	ENST00000276414.4:c.272A>C	chr8.hg19:g.25276942T>G	ENSP00000276414:p.Lys91Thr	79.0	0.0		86.0	12.0	NM_000825	A0AVP0	Missense_Mutation	SNP	ENST00000276414.4	hg19	CCDS43725.1	.	.	.	.	.	.	.	.	.	.	T	14.86	2.660399	0.47572	.	.	ENSG00000147437	ENST00000421054;ENST00000276414	T;T	0.53423	0.62;0.62	4.65	2.21	0.28008	.	0.187257	0.36234	N	0.002704	T	0.36771	0.0979	.	.	.	0.28712	N	0.903461	P	0.37781	0.608	B	0.37943	0.261	T	0.27536	-1.0071	9	0.56958	D	0.05	-10.301	7.1698	0.25712	0.0:0.1862:0.0:0.8138	.	91	P01148	GON1_HUMAN	T	91	ENSP00000391280:K91T;ENSP00000276414:K91T	ENSP00000276414:K91T	K	-	2	0	GNRH1	25332859	1.000000	0.71417	0.997000	0.53966	0.917000	0.54804	2.674000	0.46867	0.243000	0.21327	0.254000	0.18369	AAG	.	T|1.000;A|0.000		0.313	GNRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375982.1	NM_001083111	
GNRH1	2796	hgsc.bcm.edu	37	8	25276963	25276963	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr8:25276963T>G	ENST00000276414.4	-	3	1574	c.251A>C	c.(250-252)gAa>gCa	p.E84A	GNRH1_ENST00000421054.2_Missense_Mutation_p.E84A	NM_000825.3	NP_000816.4	P01148	GON1_HUMAN	gonadotropin-releasing hormone 1 (luteinizing-releasing hormone)	84					cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron migration (GO:2001223)|ovulation cycle (GO:0042698)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|response to corticosteroid (GO:0031960)|response to ethanol (GO:0045471)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	gonadotropin hormone-releasing hormone activity (GO:0005183)|hormone activity (GO:0005179)			large_intestine(1)	1		all_cancers(63;0.0423)|Ovarian(32;0.000626)|all_epithelial(46;0.0186)|Hepatocellular(4;0.114)|Breast(100;0.14)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0201)|Epithelial(17;1.25e-12)|Colorectal(74;0.0113)|COAD - Colon adenocarcinoma(73;0.0385)		AGTTTCCTCTTCAATCAGACT	0.294																																					p.E88A		Atlas-SNP	.											.	GNRH1	8	.	0			c.A263C						.						105.0	99.0	101.0					8																	25276963		1807	4074	5881	SO:0001583	missense	2796	exon3			TCCTCTTCAATCA	X01059	CCDS43725.1	8p21-p11.2	2013-02-26	2004-10-13		ENSG00000147437	ENSG00000147437		"""Endogenous ligands"""	4419	protein-coding gene	gene with protein product		152760	"""gonadotropin-releasing hormone 1 (leutinizing-releasing hormone)"""	GRH, GNRH, LHRH		6090951	Standard	NM_000825		Approved		uc003xem.4	P01148	OTTHUMG00000163852	ENST00000276414.4:c.251A>C	chr8.hg19:g.25276963T>G	ENSP00000276414:p.Glu84Ala	78.0	0.0		93.0	10.0	NM_000825	A0AVP0	Missense_Mutation	SNP	ENST00000276414.4	hg19	CCDS43725.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.112481	0.77210	.	.	ENSG00000147437	ENST00000421054;ENST00000276414	T;T	0.56103	0.48;0.48	5.22	5.22	0.72569	.	0.081226	0.51477	D	0.000091	T	0.70894	0.3276	.	.	.	0.42689	D	0.993571	D	0.76494	0.999	D	0.69654	0.965	T	0.75516	-0.3290	9	0.72032	D	0.01	-20.5306	12.776	0.57448	0.0:0.0:0.0:1.0	.	84	P01148	GON1_HUMAN	A	84	ENSP00000391280:E84A;ENSP00000276414:E84A	ENSP00000276414:E84A	E	-	2	0	GNRH1	25332880	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.291000	0.59025	2.109000	0.64355	0.377000	0.23210	GAA	.	.		0.294	GNRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375982.1	NM_001083111	
SLC20A2	6575	hgsc.bcm.edu	37	8	42297137	42297137	+	Silent	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr8:42297137T>C	ENST00000342228.3	-	7	1134	c.765A>G	c.(763-765)gtA>gtG	p.V255V	SLC20A2_ENST00000520262.1_Silent_p.V255V|SLC20A2_ENST00000520179.1_Silent_p.V255V	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	255					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			TTTCGTCAGATACTCGTGATA	0.408																																					p.V255V		Atlas-SNP	.											.	SLC20A2	64	.	0			c.A765G						.						139.0	129.0	132.0					8																	42297137		2203	4300	6503	SO:0001819	synonymous_variant	6575	exon7			GTCAGATACTCGT		CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.765A>G	chr8.hg19:g.42297137T>C		59.0	0.0		104.0	18.0	NM_001257181		Silent	SNP	ENST00000342228.3	hg19	CCDS6132.1																																																																																			.	.		0.408	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377578.1		
RB1CC1	9821	hgsc.bcm.edu	37	8	53540718	53540719	+	Nonsense_Mutation	DNP	CC	CC	AA			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr8:53540718_53540719CC>AA	ENST00000025008.5	-	22	5032_5033	c.4509_4510GG>TT	c.(4507-4512)gtGGga>gtTTga	p.G1504*	RB1CC1_ENST00000435644.2_Nonsense_Mutation_p.G1504*|RB1CC1_ENST00000521611.1_Intron|RB1CC1_ENST00000539297.1_Nonsense_Mutation_p.G1504*	NM_014781.4	NP_055596.3	Q8TDY2	RBCC1_HUMAN	RB1-inducible coiled-coil 1	1504					autophagic vacuole assembly (GO:0000045)|cell cycle (GO:0007049)|heart development (GO:0007507)|JNK cascade (GO:0007254)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell size (GO:0045793)|positive regulation of protein phosphorylation (GO:0001934)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)				NS(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(19)|ovary(8)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	60		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				ACCAAATCTCCCACCTGAAAAC	0.342																																					p.G1504X|p.V1503V	GBM(180;1701 2102 13475 42023 52570)	Atlas-SNP	.											.	RB1CC1	163	.	0			c.G4510T|c.G4509T						.																																			SO:0001587	stop_gained	9821	exon22			AATCTCCCACCTG|ATCTCCCACCTGA	AB059622	CCDS34892.1, CCDS47856.1	8q11	2014-06-13				ENSG00000023287			15574	protein-coding gene	gene with protein product	"""200 kDa FAK family kinase-interacting protein"", ""phosphatase 1, regulatory subunit 131"""	606837				11850849, 7724523, 18443221	Standard	NM_014781		Approved	KIAA0203, Cc1, DRAGOU14, FIP200, ATG17, PPP1R131	uc003xre.4	Q8TDY2		ENST00000025008.5:c.4509_4510delinsAA	chr8.hg19:g.53540718_53540719delinsAA	ENSP00000025008:p.Gly1504*	105.0|104.0	0.0		106.0|105.0	54.0	NM_001083617	Q86YR4|Q8WVU9|Q92601	Nonsense_Mutation|Silent	SNP	ENST00000025008.5	hg19	CCDS34892.1																																																																																			.	.		0.342	RB1CC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000378011.1	NM_014781	
SLC26A7	115111	hgsc.bcm.edu	37	8	92330492	92330492	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr8:92330492G>T	ENST00000276609.3	+	5	765	c.526G>T	c.(526-528)Gag>Tag	p.E176*	SLC26A7_ENST00000523719.1_Nonsense_Mutation_p.E176*|SLC26A7_ENST00000309536.2_Nonsense_Mutation_p.E176*	NM_001282356.1|NM_052832.2	NP_001269285.1|NP_439897.1			solute carrier family 26 (anion exchanger), member 7											breast(1)|cervix(1)|endometrium(4)|large_intestine(10)|lung(26)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	50			BRCA - Breast invasive adenocarcinoma(11;0.00802)			TGTGGTCACAGAGCCTGTGAT	0.488																																					p.E176X		Atlas-SNP	.											.	SLC26A7	207	.	0			c.G526T						.						128.0	118.0	121.0					8																	92330492		2203	4300	6503	SO:0001587	stop_gained	115111	exon5			GTCACAGAGCCTG	AF331521	CCDS6254.1, CCDS6255.1, CCDS75765.1	8q23	2013-07-18	2013-07-18		ENSG00000147606	ENSG00000147606		"""Solute carriers"""	14467	protein-coding gene	gene with protein product		608479	"""solute carrier family 26, member 7"""			11834742, 11829495, 16524946	Standard	NM_134266		Approved	SUT2	uc003yez.3	Q8TE54	OTTHUMG00000164062	ENST00000276609.3:c.526G>T	chr8.hg19:g.92330492G>T	ENSP00000276609:p.Glu176*	77.0	0.0		72.0	13.0	NM_134266		Nonsense_Mutation	SNP	ENST00000276609.3	hg19	CCDS6254.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.86|14.86	2.662572|2.662572	0.47572|0.47572	.|.	.|.	ENSG00000147606|ENSG00000147606	ENST00000522862;ENST00000523719;ENST00000276609;ENST00000309536|ENST00000520818	.|.	.|.	.|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	.|T	.|0.80341	.|0.4605	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77736	.|-0.2476	.|3	0.52906|.	T|.	0.07|.	.|.	20.3921|20.3921	0.98947|0.98947	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|H	176|43	.|.	ENSP00000276609:E176X|.	E|Q	+|+	1|3	0|2	SLC26A7|SLC26A7	92399668|92399668	1.000000|1.000000	0.71417|0.71417	0.969000|0.969000	0.41365|0.41365	0.357000|0.357000	0.29423|0.29423	6.408000|6.408000	0.73285|0.73285	2.822000|2.822000	0.97130|0.97130	0.650000|0.650000	0.86243|0.86243	GAG|CAG	.	.		0.488	SLC26A7-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377011.1		
VPS13B	157680	hgsc.bcm.edu	37	8	100115280	100115280	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr8:100115280T>A	ENST00000358544.2	+	5	623	c.512T>A	c.(511-513)gTc>gAc	p.V171D	VPS13B_ENST00000357162.2_Missense_Mutation_p.V171D|VPS13B_ENST00000395996.1_Missense_Mutation_p.V171D|VPS13B_ENST00000355155.1_Missense_Mutation_p.V171D|VPS13B_ENST00000441350.2_Missense_Mutation_p.V171D	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	171					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTCCTTTCCGTCAATATCACT	0.328																																					p.V171D	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.T512A						.						146.0	136.0	140.0					8																	100115280		2203	4300	6503	SO:0001583	missense	157680	exon5			TTTCCGTCAATAT	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.512T>A	chr8.hg19:g.100115280T>A	ENSP00000351346:p.Val171Asp	150.0	0.0		160.0	22.0	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	T	17.07	3.294697	0.60086	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350	T;T;T;T;D	0.85088	-1.37;-0.71;-0.7;-0.39;-1.94	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000002	D	0.91026	0.7177	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.998	D;D;D;D;D	0.85130	0.997;0.996;0.974;0.991;0.969	D	0.91798	0.5449	10	0.87932	D	0	.	16.3908	0.83537	0.0:0.0:0.0:1.0	.	171;171;171;171;171	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4;Q7Z7G8-5	.;VP13B_HUMAN;.;.;.	D	171	ENSP00000347281:V171D;ENSP00000349685:V171D;ENSP00000351346:V171D;ENSP00000379318:V171D;ENSP00000398472:V171D	ENSP00000347281:V171D	V	+	2	0	VPS13B	100184456	1.000000	0.71417	1.000000	0.80357	0.129000	0.20672	7.384000	0.79751	2.269000	0.75478	0.455000	0.32223	GTC	.	.		0.328	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
MRPL13	28998	hgsc.bcm.edu	37	8	121455467	121455467	+	Missense_Mutation	SNP	T	T	C	rs145547223		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr8:121455467T>C	ENST00000306185.3	-	2	400	c.109A>G	c.(109-111)Ata>Gta	p.I37V	MTBP_ENST00000305949.1_5'Flank	NM_014078.5	NP_054797.2	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13	37					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	6	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TGAAGTCTTATAGATGCCATA	0.403																																					p.I37V		Atlas-SNP	.											.	MRPL13	18	.	0			c.A109G						.	T	VAL/ILE	0,4406		0,0,2203	141.0	132.0	135.0		109	-3.3	0.0	8	dbSNP_134	135	1,8599	1.2+/-3.3	0,1,4299	no	missense	MRPL13	NM_014078.5	29	0,1,6502	CC,CT,TT		0.0116,0.0,0.0077	benign	37/179	121455467	1,13005	2203	4300	6503	SO:0001583	missense	28998	exon2			GTCTTATAGATGC	AB049640	CCDS6332.1	8q22.1-q22.3	2012-09-13			ENSG00000172172	ENSG00000172172		"""Mitochondrial ribosomal proteins / large subunits"""	14278	protein-coding gene	gene with protein product		610200				11543634	Standard	NM_014078		Approved	L13, RPL13, L13mt, RPML13, L13A	uc003ypa.3	Q9BYD1	OTTHUMG00000165039	ENST00000306185.3:c.109A>G	chr8.hg19:g.121455467T>C	ENSP00000306548:p.Ile37Val	118.0	0.0		129.0	20.0	NM_014078	B2R4R8|Q9UI04	Missense_Mutation	SNP	ENST00000306185.3	hg19	CCDS6332.1	.	.	.	.	.	.	.	.	.	.	T	5.074	0.199258	0.09652	0.0	1.16E-4	ENSG00000172172	ENST00000306185;ENST00000518918	.	.	.	5.74	-3.26	0.05064	Ribosomal protein L13 domain (2);	0.675472	0.15469	N	0.260683	T	0.15998	0.0385	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19614	-1.0300	9	0.27082	T	0.32	-1.3597	14.0231	0.64568	0.0:0.5308:0.0:0.4692	.	37	Q9BYD1	RM13_HUMAN	V	37;13	.	ENSP00000306548:I37V	I	-	1	0	MRPL13	121524648	0.000000	0.05858	0.000000	0.03702	0.324000	0.28378	-0.509000	0.06336	-0.429000	0.07329	0.443000	0.29094	ATA	.	T|1.000;C|0.000		0.403	MRPL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381523.1	NM_014078	
KIAA0020	9933	hgsc.bcm.edu	37	9	2837227	2837227	+	Missense_Mutation	SNP	T	T	C	rs552128111		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr9:2837227T>C	ENST00000397885.2	-	3	463	c.257A>G	c.(256-258)aAt>aGt	p.N86S		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	86						endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		GTTGAATTTATTTGCCGGCTG	0.418																																					p.N86S		Atlas-SNP	.											.	KIAA0020	56	.	0			c.A257G						.						246.0	239.0	241.0					9																	2837227		1864	4101	5965	SO:0001583	missense	9933	exon3			AATTTATTTGCCG	AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.257A>G	chr9.hg19:g.2837227T>C	ENSP00000380982:p.Asn86Ser	101.0	0.0		60.0	12.0	NM_014878	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	ENST00000397885.2	hg19	CCDS6448.2	.	.	.	.	.	.	.	.	.	.	T	10.45	1.353142	0.24512	.	.	ENSG00000080608	ENST00000397885	D	0.86230	-2.09	4.55	0.661	0.17874	.	0.592256	0.18106	N	0.151512	T	0.64649	0.2617	N	0.08118	0	0.23546	N	0.997444	B	0.28378	0.209	B	0.18263	0.021	T	0.52102	-0.8620	10	0.19147	T	0.46	-7.2252	1.9376	0.03340	0.1301:0.1587:0.1339:0.5772	.	86	Q15397	K0020_HUMAN	S	86	ENSP00000380982:N86S	ENSP00000380982:N86S	N	-	2	0	KIAA0020	2827227	0.188000	0.23250	0.991000	0.47740	0.981000	0.71138	0.854000	0.27791	0.360000	0.24265	0.528000	0.53228	AAT	.	.		0.418	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051529.3	NM_014878	
RUSC2	9853	hgsc.bcm.edu	37	9	35557957	35557957	+	Silent	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr9:35557957T>C	ENST00000455600.1	+	6	3599	c.3030T>C	c.(3028-3030)caT>caC	p.H1010H		NM_001135999.1	NP_001129471	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1010						cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)	Rab GTPase binding (GO:0017137)			NS(1)|breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(4)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			TTGTGGCTCATTTTGGCACAA	0.557																																					p.H1010H		Atlas-SNP	.											.	RUSC2	88	.	0			c.T3030C						.						156.0	134.0	141.0					9																	35557957		2203	4300	6503	SO:0001819	synonymous_variant	9853	exon6			GGCTCATTTTGGC	AB002373	CCDS35008.1	9p13.2	2003-12-02			ENSG00000198853	ENSG00000198853			23625	protein-coding gene	gene with protein product		611053				9205841	Standard	NM_001135999		Approved	KIAA0375	uc003zww.3	Q8N2Y8	OTTHUMG00000019861	ENST00000455600.1:c.3030T>C	chr9.hg19:g.35557957T>C		61.0	0.0		59.0	17.0	NM_014806	A2RU62|A7E2A9|O15080|Q5W134|Q641Q6|Q6P1W7	Silent	SNP	ENST00000455600.1	hg19	CCDS35008.1																																																																																			.	.		0.557	RUSC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052309.1	XM_048462	
RNF20	56254	hgsc.bcm.edu	37	9	104314807	104314807	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr9:104314807A>G	ENST00000389120.3	+	13	1763	c.1673A>G	c.(1672-1674)aAt>aGt	p.N558S	AL591377.1_ENST00000584534.1_RNA	NM_019592.5	NP_062538.5	Q5VTR2	BRE1A_HUMAN	ring finger protein 20, E3 ubiquitin protein ligase	558					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|negative regulation of cell migration (GO:0030336)|positive regulation of histone methylation (GO:0031062)|positive regulation of transcription, DNA-templated (GO:0045893)|protein polyubiquitination (GO:0000209)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|ligase activity (GO:0016874)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(6)|large_intestine(7)|lung(23)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GAGGATGCCAATGAAATCAAG	0.498																																					p.N558S		Atlas-SNP	.											.	RNF20	110	.	0			c.A1673G						.						83.0	94.0	90.0					9																	104314807		2203	4300	6503	SO:0001583	missense	56254	exon13			ATGCCAATGAAAT	AF265230	CCDS35084.1	9q22	2012-02-23	2012-02-23	2008-12-12	ENSG00000155827	ENSG00000155827		"""RING-type (C3HC4) zinc fingers"""	10062	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog (S. cerevisiae)"""	607699	"""ring finger protein 20"""			16337599, 12876294, 18832071, 19037095	Standard	NM_019592		Approved	FLJ20382, FLJ11189, KAIA2779, BRE1A, hBRE1, BRE1	uc004bbn.3	Q5VTR2	OTTHUMG00000020385	ENST00000389120.3:c.1673A>G	chr9.hg19:g.104314807A>G	ENSP00000373772:p.Asn558Ser	117.0	0.0		104.0	19.0	NM_019592	A7MCT5|Q2TB34|Q69YL5|Q6P527|Q8N3J4|Q96JD3|Q9H9Y7|Q9HA51|Q9NUR4|Q9NWQ3|Q9NX83	Missense_Mutation	SNP	ENST00000389120.3	hg19	CCDS35084.1	.	.	.	.	.	.	.	.	.	.	A	1.303	-0.604250	0.03717	.	.	ENSG00000155827	ENST00000389120	T	0.28895	1.59	5.8	-6.42	0.01932	.	0.781535	0.13039	N	0.418652	T	0.11410	0.0278	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.37056	-0.9722	10	0.12766	T	0.61	-5.2158	11.1987	0.48728	0.229:0.2066:0.5643:0.0	.	558	Q5VTR2	BRE1A_HUMAN	S	558	ENSP00000373772:N558S	ENSP00000373772:N558S	N	+	2	0	RNF20	103354628	0.000000	0.05858	0.019000	0.16419	0.415000	0.31203	-0.730000	0.04915	-1.073000	0.03137	-0.274000	0.10170	AAT	.	.		0.498	RNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356402.1	NM_019592	
FAM69B	138311	hgsc.bcm.edu	37	9	139617509	139617509	+	Silent	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr9:139617509A>G	ENST00000371692.4	+	5	675	c.579A>G	c.(577-579)gaA>gaG	p.E193E	FAM69B_ENST00000371691.1_Silent_p.E106E|SNHG7_ENST00000436596.1_RNA|SNHG7_ENST00000414282.1_RNA|SNHG7_ENST00000447221.1_RNA|SNHG7_ENST00000416970.1_RNA	NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	193						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		CCCTGGCGGAAGCCAAGTCCG	0.652																																					p.E193E		Atlas-SNP	.											.	FAM69B	22	.	0			c.A579G						.						48.0	46.0	47.0					9																	139617509		2203	4300	6503	SO:0001819	synonymous_variant	138311	exon5			GGCGGAAGCCAAG		CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.579A>G	chr9.hg19:g.139617509A>G		83.0	0.0		97.0	5.0	NM_152421	Q5VUD7|Q8N5N0|Q8WYU5	Silent	SNP	ENST00000371692.4	hg19	CCDS7004.1																																																																																			.	.		0.652	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055102.1	NM_152421	
GDI2	2665	hgsc.bcm.edu	37	10	5808025	5808025	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr10:5808025C>A	ENST00000380191.4	-	11	1572	c.1282G>T	c.(1282-1284)Gag>Tag	p.E428*	GDI2_ENST00000479928.1_5'UTR|GDI2_ENST00000380181.3_Nonsense_Mutation_p.E383*|GDI2_ENST00000380132.4_Nonsense_Mutation_p.E432*	NM_001115156.1|NM_001494.3	NP_001108628.1|NP_001485.2	P50395	GDIB_HUMAN	GDP dissociation inhibitor 2	428					protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|Rab GDP-dissociation inhibitor activity (GO:0005093)|Rab GTPase activator activity (GO:0005097)			NS(1)|breast(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10						AAGTCAAACTCTGATCCTGTC	0.358																																					p.E428X		Atlas-SNP	.											.	GDI2	26	.	0			c.G1282T						.						218.0	192.0	201.0					10																	5808025		2203	4300	6503	SO:0001587	stop_gained	2665	exon11			CAAACTCTGATCC	D13988	CCDS7071.1, CCDS44352.1	10p15	2010-03-16			ENSG00000057608	ENSG00000057608			4227	protein-coding gene	gene with protein product	"""rab GDP-dissociation"""	600767				9434952	Standard	NM_001494		Approved	RABGDIB	uc001iil.4	P50395	OTTHUMG00000017607	ENST00000380191.4:c.1282G>T	chr10.hg19:g.5808025C>A	ENSP00000369538:p.Glu428*	94.0	0.0		99.0	17.0	NM_001494	O43928|Q5SX88|Q9UQM6	Nonsense_Mutation	SNP	ENST00000380191.4	hg19	CCDS7071.1	.	.	.	.	.	.	.	.	.	.	C	35	5.448373	0.96205	.	.	ENSG00000057608	ENST00000380191;ENST00000380132;ENST00000380181	.	.	.	5.93	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-19.128	14.7569	0.69572	0.0:0.9302:0.0:0.0698	.	.	.	.	X	428;432;383	.	ENSP00000369475:E432X	E	-	1	0	GDI2	5848031	1.000000	0.71417	0.988000	0.46212	0.399000	0.30720	7.666000	0.83877	1.520000	0.48965	0.557000	0.71058	GAG	.	.		0.358	GDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046580.1	NM_001494	
SGMS1	259230	hgsc.bcm.edu	37	10	52071136	52071136	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr10:52071136T>G	ENST00000361781.2	-	9	1740	c.781A>C	c.(781-783)Aag>Cag	p.K261Q	SGMS1_ENST00000429490.1_Missense_Mutation_p.K92Q	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	267					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						GCAATGAGCTTCATTATTCTT	0.458																																					p.K261Q		Atlas-SNP	.											.	SGMS1	40	.	0			c.A781C						.						107.0	76.0	86.0					10																	52071136		2203	4300	6503	SO:0001583	missense	259230	exon9			TGAGCTTCATTAT	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.781A>C	chr10.hg19:g.52071136T>G	ENSP00000354829:p.Lys261Gln	64.0	0.0		42.0	10.0	NM_147156	Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	ENST00000361781.2	hg19	CCDS7240.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.721495	0.48728	.	.	ENSG00000198964	ENST00000412547;ENST00000361781;ENST00000429490	T	0.46063	0.88	5.87	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.22666	0.0547	N	0.11064	0.09	0.80722	D	1	B;B	0.25441	0.126;0.112	B;B	0.24006	0.021;0.05	T	0.05649	-1.0872	10	0.14252	T	0.57	-8.3248	11.6948	0.51538	0.0:0.0:0.1483:0.8517	.	92;267	B4DJU2;Q86VZ5	.;SMS1_HUMAN	Q	61;261;92	ENSP00000354829:K261Q	ENSP00000354829:K261Q	K	-	1	0	SGMS1	51741142	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.229000	0.72294	1.124000	0.41980	0.533000	0.62120	AAG	.	.		0.458	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156	
JMJD1C	221037	hgsc.bcm.edu	37	10	64936130	64936130	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr10:64936130T>C	ENST00000399262.2	-	24	7546	c.7328A>G	c.(7327-7329)tAt>tGt	p.Y2443C	JMJD1C_ENST00000399251.1_3'UTR|JMJD1C_ENST00000402544.1_Missense_Mutation_p.Y2206C|JMJD1C_ENST00000542921.1_Missense_Mutation_p.Y2261C	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	2443	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					TCTGACTCCATATTCTTCAAG	0.398																																					p.Y2443C		Atlas-SNP	.											.	JMJD1C	347	.	0			c.A7328G						.						112.0	107.0	108.0					10																	64936130		1871	4096	5967	SO:0001583	missense	221037	exon24			ACTCCATATTCTT	L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.7328A>G	chr10.hg19:g.64936130T>C	ENSP00000382204:p.Tyr2443Cys	166.0	0.0		156.0	36.0	NM_032776	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Missense_Mutation	SNP	ENST00000399262.2	hg19	CCDS41532.1	.	.	.	.	.	.	.	.	.	.	T	25.8	4.675370	0.88445	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000542921	T;T;T	0.71934	-0.61;-0.61;-0.61	5.75	5.75	0.90469	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.117745	0.64402	D	0.000016	D	0.82595	0.5071	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;0.976	D;P	0.74023	0.982;0.852	D	0.84556	0.0647	10	0.87932	D	0	-10.4747	15.7237	0.77736	0.0:0.0:0.0:1.0	.	2443;2261	Q15652;A0T124	JHD2C_HUMAN;.	C	2443;2206;2261	ENSP00000382204:Y2443C;ENSP00000384990:Y2206C;ENSP00000444682:Y2261C	ENSP00000382204:Y2443C	Y	-	2	0	JMJD1C	64606136	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.027000	0.88791	2.195000	0.70347	0.533000	0.62120	TAT	.	.		0.398	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048249.2	NM_004241	
GHITM	27069	hgsc.bcm.edu	37	10	85909910	85909910	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr10:85909910C>T	ENST00000372134.3	+	7	885	c.692C>T	c.(691-693)aCt>aTt	p.T231I		NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	231					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						GGCCTCTCCACTGTGGCCATG	0.567																																					p.T231I		Atlas-SNP	.											.	GHITM	30	.	0			c.C692T						.						115.0	123.0	120.0					10																	85909910		2068	4220	6288	SO:0001583	missense	27069	exon7			TCTCCACTGTGGC	AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.692C>T	chr10.hg19:g.85909910C>T	ENSP00000361207:p.Thr231Ile	74.0	0.0		83.0	40.0	NM_014394	A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Missense_Mutation	SNP	ENST00000372134.3	hg19	CCDS41542.1	.	.	.	.	.	.	.	.	.	.	C	18.37	3.608852	0.66558	.	.	ENSG00000165678	ENST00000372134;ENST00000538477;ENST00000436406;ENST00000339736	T	0.41400	1.0	6.03	6.03	0.97812	.	0.098369	0.64402	D	0.000001	T	0.39410	0.1077	L	0.46157	1.445	0.80722	D	1	B;B	0.26318	0.146;0.055	B;B	0.27380	0.079;0.029	T	0.10917	-1.0609	10	0.20519	T	0.43	-16.6221	17.4736	0.87653	0.0:1.0:0.0:0.0	.	162;231	B4DNL0;Q9H3K2	.;GHITM_HUMAN	I	231;218;231;211	ENSP00000361207:T231I	ENSP00000342214:T211I	T	+	2	0	GHITM	85899890	0.998000	0.40836	0.992000	0.48379	0.921000	0.55340	5.612000	0.67681	2.861000	0.98227	0.655000	0.94253	ACT	.	.		0.567	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049125.1	NM_014394	
CDHR1	92211	hgsc.bcm.edu	37	10	85958825	85958825	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr10:85958825A>G	ENST00000372117.3	+	5	489	c.386A>G	c.(385-387)aAt>aGt	p.N129S	CDHR1_ENST00000332904.3_Missense_Mutation_p.N129S|CDHR1_ENST00000440770.2_5'Flank	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	129	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						ACCGATGCCAATGATGAGGCG	0.557																																					p.N129S		Atlas-SNP	.											.	CDHR1	122	.	0			c.A386G						.						89.0	73.0	78.0					10																	85958825		2049	3918	5967	SO:0001583	missense	92211	exon5			ATGCCAATGATGA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.386A>G	chr10.hg19:g.85958825A>G	ENSP00000361189:p.Asn129Ser	94.0	0.0		66.0	13.0	NM_001171971	Q69YZ8|Q8IXY5	Missense_Mutation	SNP	ENST00000372117.3	hg19	CCDS7372.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.344928	0.82022	.	.	ENSG00000148600	ENST00000332904;ENST00000372117	T;T	0.70631	-0.5;-0.5	5.09	5.09	0.68999	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.90000	0.6878	H	0.99404	4.55	0.80722	D	1	D;D	0.55172	0.965;0.97	P;P	0.61201	0.885;0.77	D	0.93869	0.7160	10	0.87932	D	0	-20.0667	13.8713	0.63622	1.0:0.0:0.0:0.0	.	129;129	Q96JP9-2;Q96JP9	.;CDHR1_HUMAN	S	129	ENSP00000331063:N129S;ENSP00000361189:N129S	ENSP00000331063:N129S	N	+	2	0	CDHR1	85948805	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	8.418000	0.90250	1.917000	0.55516	0.459000	0.35465	AAT	.	.		0.557	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
IDE	3416	hgsc.bcm.edu	37	10	94239137	94239137	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr10:94239137T>C	ENST00000265986.6	-	15	1837	c.1781A>G	c.(1780-1782)tAt>tGt	p.Y594C	IDE_ENST00000496903.1_Intron|IDE_ENST00000371581.5_Missense_Mutation_p.Y39C	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	594					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	AAGGTACAAATAGGCCATGTT	0.423																																					p.Y594C		Atlas-SNP	.											.	IDE	77	.	0			c.A1781G						.						169.0	144.0	152.0					10																	94239137		2203	4300	6503	SO:0001583	missense	3416	exon15			TACAAATAGGCCA	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.1781A>G	chr10.hg19:g.94239137T>C	ENSP00000265986:p.Tyr594Cys	122.0	0.0		90.0	21.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	hg19	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	T	13.52	2.260477	0.39995	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.29655	1.56;1.56	5.62	5.62	0.85841	Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.31104	0.0786	L	0.54323	1.7	0.80722	D	1	B	0.28419	0.211	B	0.20767	0.031	T	0.06445	-1.0826	10	0.52906	T	0.07	-12.9568	15.4934	0.75629	0.0:0.0:0.0:1.0	.	594	P14735	IDE_HUMAN	C	594;39	ENSP00000265986:Y594C;ENSP00000360637:Y39C	ENSP00000265986:Y594C	Y	-	2	0	IDE	94229117	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.150000	0.67090	0.533000	0.62120	TAT	.	.		0.423	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
COPB1	1315	hgsc.bcm.edu	37	11	14490346	14490346	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr11:14490346G>C	ENST00000249923.3	-	16	2326	c.2026C>G	c.(2026-2028)Cta>Gta	p.L676V	COPB1_ENST00000439561.2_Missense_Mutation_p.L676V	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	676					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						TTAGCAGTTAGTTGCATGAAG	0.408																																					p.L676V		Atlas-SNP	.											.	COPB1	81	.	0			c.C2026G						.						222.0	201.0	208.0					11																	14490346		2200	4294	6494	SO:0001583	missense	1315	exon16			CAGTTAGTTGCAT	BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2026C>G	chr11.hg19:g.14490346G>C	ENSP00000249923:p.Leu676Val	81.0	0.0		36.0	12.0	NM_001144062	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	ENST00000249923.3	hg19	CCDS7815.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.115231	0.77210	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.61158	0.13;0.13	5.32	5.32	0.75619	Coatomer, beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82499	0.5050	H	0.94264	3.515	0.80722	D	1	D	0.64830	0.994	D	0.64595	0.927	D	0.87676	0.2544	10	0.87932	D	0	.	18.996	0.92813	0.0:0.0:1.0:0.0	.	676	P53618	COPB_HUMAN	V	676	ENSP00000249923:L676V;ENSP00000397873:L676V	ENSP00000249923:L676V	L	-	1	2	COPB1	14446922	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.455000	0.73497	2.494000	0.84150	0.650000	0.86243	CTA	.	.		0.408	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386410.1	NM_016451	
OR9I1	219954	hgsc.bcm.edu	37	11	57886028	57886028	+	Missense_Mutation	SNP	C	C	T	rs372541402		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr11:57886028C>T	ENST00000302610.1	-	1	888	c.889G>A	c.(889-891)Gta>Ata	p.V297I	OR9Q1_ENST00000335397.3_Intron	NM_001005211.1	NP_001005211.1	Q8NGQ6	OR9I1_HUMAN	olfactory receptor, family 9, subfamily I, member 1	297						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(2)|liver(1)|lung(15)|pancreas(1)|skin(1)|urinary_tract(1)	23		Breast(21;0.0589)				GCGTCTTTTACATCTTTGTTT	0.448																																					p.V297I		Atlas-SNP	.											.	OR9I1	53	.	0			c.G889A						.						122.0	126.0	125.0					11																	57886028		2201	4296	6497	SO:0001583	missense	219954	exon1			CTTTTACATCTTT	AB065733	CCDS31542.1	11q12.1	2012-08-09			ENSG00000172377	ENSG00000172377		"""GPCR / Class A : Olfactory receptors"""	14718	protein-coding gene	gene with protein product							Standard	NM_001005211		Approved		uc021qjl.1	Q8NGQ6	OTTHUMG00000167404	ENST00000302610.1:c.889G>A	chr11.hg19:g.57886028C>T	ENSP00000302606:p.Val297Ile	36.0	0.0		36.0	13.0	NM_001005211	Q6IFH0|Q96RA8	Missense_Mutation	SNP	ENST00000302610.1	hg19	CCDS31542.1	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057940	0.36277	.	.	ENSG00000172377	ENST00000302610	T	0.37235	1.21	4.97	4.06	0.47325	.	0.000000	0.41605	D	0.000850	T	0.38161	0.1030	N	0.17872	0.535	0.28175	N	0.928437	D	0.64830	0.994	D	0.72625	0.978	T	0.15435	-1.0437	10	0.72032	D	0.01	-23.8747	4.9574	0.14048	0.1691:0.6594:0.0:0.1715	.	297	Q8NGQ6	OR9I1_HUMAN	I	297	ENSP00000302606:V297I	ENSP00000302606:V297I	V	-	1	0	OR9I1	57642604	0.413000	0.25400	0.998000	0.56505	0.025000	0.11179	0.778000	0.26732	1.478000	0.48253	-0.363000	0.07495	GTA	.	.		0.448	OR9I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394539.1	NM_001005211	
AHNAK	79026	hgsc.bcm.edu	37	11	62291791	62291791	+	Silent	SNP	T	T	A	rs541565103		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr11:62291791T>A	ENST00000378024.4	-	5	10372	c.10098A>T	c.(10096-10098)acA>acT	p.T3366T	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3366					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CCACTTCAGGTGTCTGAACTT	0.393																																					p.T3366T		Atlas-SNP	.											.	AHNAK	532	.	0			c.A10098T						.						55.0	58.0	57.0					11																	62291791		2202	4299	6501	SO:0001819	synonymous_variant	79026	exon5			TTCAGGTGTCTGA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.10098A>T	chr11.hg19:g.62291791T>A		71.0	0.0		56.0	19.0	NM_001620	A1A586	Silent	SNP	ENST00000378024.4	hg19	CCDS31584.1																																																																																			.	.		0.393	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
C11orf80	79703	hgsc.bcm.edu	37	11	66512287	66512287	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr11:66512287A>C	ENST00000360962.4	+	1	81	c.74A>C	c.(73-75)gAg>gCg	p.E25A	C11orf80_ENST00000540737.1_5'UTR|C11orf80_ENST00000532565.2_5'Flank|C11orf80_ENST00000346672.4_5'UTR|C11orf80_ENST00000527634.1_5'UTR|C11orf80_ENST00000527368.1_3'UTR	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	25										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						CGGGCTGAGGAGGGggcggcg	0.791																																					p.E25A		Atlas-SNP	.											.	C11orf80	31	.	0			c.A74C						.						1.0	1.0	1.0					11																	66512287		258	821	1079	SO:0001583	missense	79703	exon1			CTGAGGAGGGGGC			11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.74A>C	chr11.hg19:g.66512287A>C	ENSP00000354227:p.Glu25Ala	35.0	0.0		36.0	6.0	NM_024650	Q9H677	Missense_Mutation	SNP	ENST00000360962.4	hg19	CCDS53664.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.080343	0.55753	.	.	ENSG00000173715	ENST00000360962	T	0.34275	1.37	2.37	-2.8	0.05823	.	.	.	.	.	T	0.19005	0.0456	.	.	.	0.24707	N	0.99323	.	.	.	.	.	.	T	0.28427	-1.0044	6	0.22109	T	0.4	.	3.4329	0.07434	0.328:0.4124:0.0:0.2596	.	.	.	.	A	25	ENSP00000354227:E25A	ENSP00000354227:E25A	E	+	2	0	C11orf80	66268863	0.366000	0.25014	0.017000	0.16124	0.392000	0.30506	0.135000	0.15952	-0.581000	0.05937	0.379000	0.24179	GAG	.	.		0.791	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_024650	
MED17	9440	hgsc.bcm.edu	37	11	93521276	93521276	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr11:93521276G>C	ENST00000251871.3	+	2	647	c.360G>C	c.(358-360)agG>agC	p.R120S	MED17_ENST00000530819.1_Missense_Mutation_p.R120S	NM_004268.4	NP_004259.3	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	120					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			large_intestine(2)|lung(11)|ovary(1)	14		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTATTGTTAGGGATAAAAAAT	0.363																																					p.R120S		Atlas-SNP	.											.	MED17	37	.	0			c.G360C						.						108.0	105.0	106.0					11																	93521276		2201	4298	6499	SO:0001583	missense	9440	exon2			TGTTAGGGATAAA	AF104254	CCDS8295.1	11q21	2007-07-30	2007-07-30	2007-07-30	ENSG00000042429	ENSG00000042429			2375	protein-coding gene	gene with protein product		603810	"""cofactor required for Sp1 transcriptional activation, subunit 6 (77kD)"", ""cofactor required for Sp1 transcriptional activation, subunit 6, 77kDa"""	CRSP6		9989412, 10198638	Standard	NM_004268		Approved	CRSP77, TRAP80, DRIP80	uc001pem.4	Q9NVC6	OTTHUMG00000167497	ENST00000251871.3:c.360G>C	chr11.hg19:g.93521276G>C	ENSP00000251871:p.Arg120Ser	61.0	0.0		53.0	11.0	NM_004268	B3KN07|Q9HA81|Q9UNP7|Q9Y2W0|Q9Y660	Missense_Mutation	SNP	ENST00000251871.3	hg19	CCDS8295.1	.	.	.	.	.	.	.	.	.	.	G	15.33	2.802769	0.50315	.	.	ENSG00000042429	ENST00000251871;ENST00000530819;ENST00000427225;ENST00000533359;ENST00000528786	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.44	-0.0965	0.13637	.	0.091108	0.64402	D	0.000002	T	0.20170	0.0485	N	0.08118	0	0.40009	D	0.975266	B;B	0.32467	0.003;0.372	B;B	0.24394	0.01;0.053	T	0.04017	-1.0984	10	0.62326	D	0.03	-11.0694	5.8718	0.18807	0.2683:0.2339:0.4978:0.0	.	120;120	Q9NVC6;Q9NVC6-2	MED17_HUMAN;.	S	120;120;90;120;12	ENSP00000251871:R120S;ENSP00000434459:R120S;ENSP00000431524:R120S;ENSP00000433626:R12S	ENSP00000251871:R120S	R	+	3	2	MED17	93160924	1.000000	0.71417	0.948000	0.38648	0.997000	0.91878	1.228000	0.32588	0.007000	0.14760	0.650000	0.86243	AGG	.	.		0.363	MED17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394800.2	NM_004268	
DDI1	414301	hgsc.bcm.edu	37	11	103908223	103908223	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr11:103908223G>C	ENST00000302259.3	+	1	916	c.673G>C	c.(673-675)Gaa>Caa	p.E225Q	PDGFD_ENST00000393158.2_Intron|PDGFD_ENST00000302251.5_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	225							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		AAACATTGAAGAAAACATGAA	0.473																																					p.E225Q		Atlas-SNP	.											.	DDI1	222	.	0			c.G673C						.						105.0	118.0	113.0					11																	103908223		2202	4299	6501	SO:0001583	missense	414301	exon1			ATTGAAGAAAACA		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.673G>C	chr11.hg19:g.103908223G>C	ENSP00000302805:p.Glu225Gln	96.0	0.0		92.0	18.0	NM_001001711	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	ENST00000302259.3	hg19	CCDS31660.1	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814256	0.70912	.	.	ENSG00000170967	ENST00000302259	T	0.49432	0.78	5.02	5.02	0.67125	Peptidase aspartic, eukaryotic predicted (1);	0.000000	0.85682	D	0.000000	T	0.63022	0.2476	L	0.49571	1.57	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	T	0.59941	-0.7359	10	0.42905	T	0.14	-11.0943	16.2348	0.82365	0.0:0.0:1.0:0.0	.	225	Q8WTU0	DDI1_HUMAN	Q	225	ENSP00000302805:E225Q	ENSP00000302805:E225Q	E	+	1	0	DDI1	103413433	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	9.016000	0.93645	2.781000	0.95711	0.655000	0.94253	GAA	.	.		0.473	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
OPCML	4978	hgsc.bcm.edu	37	11	132812840	132812840	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr11:132812840C>G	ENST00000331898.7	-	1	726	c.148G>C	c.(148-150)Ggg>Cgg	p.G50R	OPCML_ENST00000529038.1_Intron|OPCML_ENST00000541867.1_Missense_Mutation_p.G50R|OPCML_ENST00000374778.4_Missense_Mutation_p.G9R|OPCML_ENST00000524381.1_Missense_Mutation_p.G43R	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	50	Ig-like C2-type 1.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		GCGCTCTCCCCCTGCCGGACC	0.672																																					p.G50R		Atlas-SNP	.											.	OPCML	166	.	0			c.G148C						.						67.0	69.0	68.0					11																	132812840		2201	4297	6498	SO:0001583	missense	4978	exon1			TCTCCCCCTGCCG	BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.148G>C	chr11.hg19:g.132812840C>G	ENSP00000330862:p.Gly50Arg	68.0	0.0		55.0	25.0	NM_002545	B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	ENST00000331898.7	hg19	CCDS8492.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.936304	0.92458	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.81330	-1.48;-1.48;-1.48;-1.48	5.71	5.71	0.89125	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.387835	0.23973	N	0.042747	D	0.93054	0.7789	H	0.94886	3.595	0.80722	D	1	D;P;D;D	0.89917	1.0;0.942;1.0;1.0	D;D;D;D	0.79784	0.993;0.955;0.993;0.993	D	0.94297	0.7534	10	0.87932	D	0	-12.1022	19.8557	0.96758	0.0:1.0:0.0:0.0	.	50;43;50;50	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	R	50;43;9;43;50	ENSP00000330862:G50R;ENSP00000434750:G43R;ENSP00000363910:G9R;ENSP00000445496:G50R	ENSP00000330862:G50R	G	-	1	0	OPCML	132318050	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.398000	0.79919	2.707000	0.92482	0.655000	0.94253	GGG	.	.		0.672	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374689.3	NM_001012393	
SLCO1B3	28234	hgsc.bcm.edu	37	12	21013982	21013982	+	Missense_Mutation	SNP	C	C	A	rs374152690		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:21013982C>A	ENST00000381545.3	+	6	610	c.391C>A	c.(391-393)Cca>Aca	p.P131T	LST3_ENST00000540229.1_Missense_Mutation_p.P131T|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.P131T|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron|SLCO1B3_ENST00000261196.2_Missense_Mutation_p.P131T|SLCO1B3_ENST00000545880.1_3'UTR	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	131					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	CCATATTAATCCATCAGAAAA	0.289																																					p.P131T		Atlas-SNP	.											.	SLCO1B3	151	.	0			c.C391A						.	C	THR/PRO	1,4391	2.1+/-5.4	0,1,2195	51.0	48.0	49.0		391	0.5	0.0	12		49	0,8560		0,0,4280	no	missense	SLCO1B3	NM_019844.2	38	0,1,6475	AA,AC,CC		0.0,0.0228,0.0077	benign	131/703	21013982	1,12951	2196	4280	6476	SO:0001583	missense	28234	exon6			ATTAATCCATCAG		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.391C>A	chr12.hg19:g.21013982C>A	ENSP00000370956:p.Pro131Thr	338.0	1.0		247.0	180.0	NM_019844	E7EMT8|Q5JAR4	Missense_Mutation	SNP	ENST00000381545.3	hg19	CCDS8684.1	.	.	.	.	.	.	.	.	.	.	C	9.332	1.060884	0.19987	2.28E-4	0.0	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000540853;ENST00000261196;ENST00000381545;ENST00000553473;ENST00000540229	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	3.53	0.48	0.16804	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.713131	0.14630	N	0.307854	T	0.23766	0.0575	L	0.37897	1.145	0.09310	N	1	B;B	0.19200	0.034;0.008	B;B	0.26310	0.068;0.023	T	0.21861	-1.0233	10	0.38643	T	0.18	.	2.6183	0.04909	0.396:0.3571:0.0:0.2469	.	131;131	Q5JAR4;Q9NPD5	.;SO1B3_HUMAN	T	131	ENSP00000442000:P131T;ENSP00000261196:P131T;ENSP00000370956:P131T;ENSP00000451758:P131T;ENSP00000441269:P131T	ENSP00000441269:P131T	P	+	1	0	SLCO1B3;RP11-545J16.1	20905249	0.000000	0.05858	0.000000	0.03702	0.615000	0.37417	0.092000	0.15066	-0.105000	0.12132	-0.373000	0.07131	CCA	.	.		0.289	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
SLC38A2	54407	hgsc.bcm.edu	37	12	46754959	46754959	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:46754959T>C	ENST00000256689.5	-	16	1900	c.1456A>G	c.(1456-1458)Atg>Gtg	p.M486V	SLC38A2_ENST00000551374.1_Missense_Mutation_p.M324V	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	486					amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		CTTCCGGTCATCACCAGTACA	0.408																																					p.M486V	Ovarian(9;448 492 8335 28722 40361)	Atlas-SNP	.											.	SLC38A2	36	.	0			c.A1456G						.						98.0	84.0	88.0					12																	46754959		2203	4299	6502	SO:0001583	missense	54407	exon16			CGGTCATCACCAG	AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.1456A>G	chr12.hg19:g.46754959T>C	ENSP00000256689:p.Met486Val	101.0	0.0		46.0	10.0	NM_018976	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Missense_Mutation	SNP	ENST00000256689.5	hg19	CCDS8749.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.344864	0.61073	.	.	ENSG00000134294	ENST00000256689;ENST00000551374	T;T	0.02121	4.44;4.44	6.05	6.05	0.98169	.	0.034017	0.85682	D	0.000000	T	0.15046	0.0363	M	0.88450	2.955	0.80722	D	1	P;D;D	0.65815	0.923;0.995;0.983	P;D;P	0.66196	0.561;0.942;0.874	T	0.01484	-1.1343	10	0.35671	T	0.21	-29.8604	16.5993	0.84807	0.0:0.0:0.0:1.0	.	324;386;486	F8VQW8;Q96QD8-2;Q96QD8	.;.;S38A2_HUMAN	V	486;324	ENSP00000256689:M486V;ENSP00000450406:M324V	ENSP00000256689:M486V	M	-	1	0	SLC38A2	45041226	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.368000	0.79567	2.311000	0.77944	0.528000	0.53228	ATG	.	.		0.408	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404226.1		
DNAJC22	79962	hgsc.bcm.edu	37	12	49742904	49742904	+	Silent	SNP	C	C	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:49742904C>G	ENST00000549441.2	+	3	1453	c.249C>G	c.(247-249)gcC>gcG	p.A83A	DNAJC22_ENST00000395069.3_Silent_p.A83A			Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	83						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(1)|ovary(1)|pancreas(1)	10						GCTTTGCTGCCCAGGTGATAG	0.552																																					p.A83A		Atlas-SNP	.											.	DNAJC22	29	.	0			c.C249G						.						137.0	145.0	143.0					12																	49742904		2203	4300	6503	SO:0001819	synonymous_variant	79962	exon2			TGCTGCCCAGGTG	AK055747	CCDS8785.1	12q13.12	2011-09-02		2008-07-08	ENSG00000178401	ENSG00000178401		"""Heat shock proteins / DNAJ (HSP40)"""	25802	protein-coding gene	gene with protein product	"""wurst homolog (Drosophila)"""					17558392	Standard	NM_024902		Approved	wus, FLJ13236	uc001rua.3	Q8N4W6		ENST00000549441.2:c.249C>G	chr12.hg19:g.49742904C>G		51.0	0.0		35.0	28.0	NM_024902	B3KP54	Silent	SNP	ENST00000549441.2	hg19	CCDS8785.1																																																																																			.	.		0.552	DNAJC22-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404302.2	NM_024902	
KRT5	3852	hgsc.bcm.edu	37	12	52912936	52912936	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:52912936G>T	ENST00000252242.4	-	2	954	c.564C>A	c.(562-564)ttC>ttA	p.F188L		NM_000424.3	NP_000415.2	P13647	K2C5_HUMAN	keratin 5	188	Coil 1A.|Rod.				cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|hemidesmosome assembly (GO:0031581)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)			endometrium(5)|kidney(1)|large_intestine(8)|lung(15)|prostate(4)|skin(2)	35				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCTGCTCCAGGAACCGCACCT	0.547																																					p.F188L		Atlas-SNP	.											.	KRT5	88	.	0			c.C564A						.						54.0	49.0	50.0					12																	52912936		2203	4300	6503	SO:0001583	missense	3852	exon2			CTCCAGGAACCGC		CCDS8830.1	12q13.13	2013-01-16	2008-08-01		ENSG00000186081	ENSG00000186081		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6442	protein-coding gene	gene with protein product		148040	"""epidermolysis bullosa simplex 2 Dowling-Meara/Kobner/Weber-Cockayne types"", ""keratin 5 (epidermolysis bullosa simplex, Dowling-Meara/Kobner/Weber-Cockayne types)"""	EBS2		1713141, 16831889	Standard	NM_000424		Approved	KRT5A	uc001san.3	P13647	OTTHUMG00000169657	ENST00000252242.4:c.564C>A	chr12.hg19:g.52912936G>T	ENSP00000252242:p.Phe188Leu	112.0	0.0		90.0	63.0	NM_000424	Q6PI71|Q6UBJ0|Q8TA91	Missense_Mutation	SNP	ENST00000252242.4	hg19	CCDS8830.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.322769	0.81580	.	.	ENSG00000186081	ENST00000252242;ENST00000456000;ENST00000549420	T;T	0.75477	-0.94;-0.94	5.31	5.31	0.75309	Filament (1);	0.000000	0.64402	D	0.000016	D	0.87593	0.6216	M	0.93939	3.475	0.49915	D	0.999835	D	0.89917	1.0	D	0.85130	0.997	D	0.88733	0.3238	10	0.87932	D	0	.	7.0291	0.24956	0.1459:0.1497:0.7044:0.0	.	188	P13647	K2C5_HUMAN	L	188;153;78	ENSP00000252242:F188L;ENSP00000447209:F78L	ENSP00000252242:F188L	F	-	3	2	KRT5	51199203	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.288000	0.43514	2.764000	0.94973	0.655000	0.94253	TTC	.	.		0.547	KRT5-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405312.1		
ANKRD52	283373	hgsc.bcm.edu	37	12	56641954	56641954	+	Silent	SNP	G	G	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:56641954G>A	ENST00000267116.7	-	18	1952	c.1831C>T	c.(1831-1833)Ctg>Ttg	p.L611L		NM_173595.3	NP_775866.2	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	611										endometrium(9)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(1)	29						CTTACGTCCAGATTCACCAGC	0.632																																					p.L611L		Atlas-SNP	.											.	ANKRD52	81	.	0			c.C1831T						.						80.0	83.0	82.0					12																	56641954		2128	4227	6355	SO:0001819	synonymous_variant	283373	exon18			CGTCCAGATTCAC	AK091555	CCDS44920.1	12q13.3	2013-01-10			ENSG00000139645	ENSG00000139645		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	26614	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit C"""						Standard	NM_173595		Approved	FLJ34236, PP6-ARS-C	uc001skm.4	Q8NB46	OTTHUMG00000170329	ENST00000267116.7:c.1831C>T	chr12.hg19:g.56641954G>A		33.0	0.0		34.0	7.0	NM_173595	A6NE79|B1Q2K2	Silent	SNP	ENST00000267116.7	hg19	CCDS44920.1																																																																																			.	.		0.632	ANKRD52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408539.1	NM_173595	
LRP1	4035	hgsc.bcm.edu	37	12	57532258	57532258	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:57532258C>G	ENST00000243077.3	+	2	550	c.84C>G	c.(82-84)agC>agG	p.S28R	LRP1_ENST00000553277.1_Missense_Mutation_p.S28R|LRP1_ENST00000554174.1_Missense_Mutation_p.S28R|LRP1_ENST00000338962.4_Missense_Mutation_p.S28R	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	28	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	AGACTTGCAGCCCCAAGCAGT	0.542																																					p.S28R		Atlas-SNP	.											.	LRP1	428	.	0			c.C84G						.						148.0	149.0	149.0					12																	57532258		2203	4300	6503	SO:0001583	missense	4035	exon2			TTGCAGCCCCAAG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.84C>G	chr12.hg19:g.57532258C>G	ENSP00000243077:p.Ser28Arg	109.0	0.0		94.0	13.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690581	0.88735	.	.	ENSG00000123384	ENST00000553277;ENST00000243077;ENST00000338962;ENST00000554174	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.53384	0.1793	L	0.41824	1.3	0.51767	D	0.999935	D;D;D;D	0.76494	0.999;0.997;0.998;0.967	D;D;D;P	0.87578	0.998;0.992;0.958;0.76	T	0.32877	-0.9890	10	0.13470	T	0.59	.	16.8396	0.85965	0.0:1.0:0.0:0.0	.	28;28;28;28	Q86SW0;Q07954;Q6PJ72;Q7Z7K9	.;LRP1_HUMAN;.;.	R	28	ENSP00000451449:S28R;ENSP00000243077:S28R;ENSP00000341264:S28R;ENSP00000451737:S28R	ENSP00000243077:S28R	S	+	3	2	LRP1	55818525	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.563000	0.67352	2.768000	0.95171	0.561000	0.74099	AGC	.	.		0.542	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
GLIPR1	11010	hgsc.bcm.edu	37	12	75892688	75892688	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:75892688T>C	ENST00000266659.3	+	6	932	c.731T>C	c.(730-732)aTt>aCt	p.I244T	KRR1_ENST00000229214.4_3'UTR	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	244					cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						AATTCAGTAATTCTAATACTG	0.338																																					p.I244T		Atlas-SNP	.											.	GLIPR1	33	.	0			c.T731C						.						145.0	131.0	136.0					12																	75892688		2203	4300	6503	SO:0001583	missense	11010	exon6			CAGTAATTCTAAT	U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.731T>C	chr12.hg19:g.75892688T>C	ENSP00000266659:p.Ile244Thr	70.0	0.0		60.0	14.0	NM_006851	A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	ENST00000266659.3	hg19	CCDS9011.1	.	.	.	.	.	.	.	.	.	.	T	4.841	0.156435	0.09236	.	.	ENSG00000139278	ENST00000266659	T	0.06768	3.26	5.27	4.11	0.48088	.	0.527824	0.20411	N	0.092844	T	0.08223	0.0205	L	0.57536	1.79	0.19300	N	0.999976	B	0.30482	0.281	B	0.24848	0.056	T	0.31806	-0.9930	10	0.15499	T	0.54	.	8.3748	0.32436	0.1741:0.0:0.0:0.8259	.	244	P48060	GLIP1_HUMAN	T	244	ENSP00000266659:I244T	ENSP00000266659:I244T	I	+	2	0	GLIPR1	74178955	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	0.620000	0.24403	1.001000	0.39076	0.459000	0.35465	ATT	.	.		0.338	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405722.1	NM_006851	
ERP29	10961	hgsc.bcm.edu	37	12	112460383	112460383	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:112460383A>C	ENST00000261735.3	+	3	863	c.713A>C	c.(712-714)aAg>aCg	p.K238T	ERP29_ENST00000546477.1_Missense_Mutation_p.K137T|ERP29_ENST00000455836.1_3'UTR	NM_006817.3	NP_006808.1	P30040	ERP29_HUMAN	endoplasmic reticulum protein 29	238					intracellular protein transport (GO:0006886)|protein folding (GO:0006457)|protein secretion (GO:0009306)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein disulfide isomerase activity (GO:0003756)			cervix(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						GACGGGAAGAAGGAGGAGCTC	0.507																																					p.K238T		Atlas-SNP	.											.	ERP29	17	.	0			c.A713C						.						84.0	88.0	87.0					12																	112460383		2203	4300	6503	SO:0001583	missense	10961	exon3			GGAAGAAGGAGGA	X94910	CCDS9158.1, CCDS44977.1	12q24.13	2011-10-19	2005-10-05	2005-10-05		ENSG00000089248		"""Protein disulfide isomerases"""	13799	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 9"""	602287	"""chromosome 12 open reading frame 8"""	C12orf8		9738895, 9037184	Standard	NM_006817		Approved	ERp28, ERp31, ERp29, PDI-DB, PDIA9	uc001ttk.1	P30040	OTTHUMG00000169637	ENST00000261735.3:c.713A>C	chr12.hg19:g.112460383A>C	ENSP00000261735:p.Lys238Thr	53.0	0.0		59.0	13.0	NM_006817	C9J183|Q3MJC3|Q6FHT4	Missense_Mutation	SNP	ENST00000261735.3	hg19	CCDS9158.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.992472	0.74703	.	.	ENSG00000089248	ENST00000261735;ENST00000546477	.	.	.	5.75	4.59	0.56863	Endoplasmic reticulum, protein ERp29, C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.73682	0.3618	M	0.71581	2.175	0.53005	D	0.999964	D	0.76494	0.999	D	0.77004	0.989	T	0.70139	-0.4954	9	0.15066	T	0.55	-14.0229	12.0223	0.53350	0.9313:0.0:0.0687:0.0	.	238	P30040	ERP29_HUMAN	T	238;137	.	ENSP00000261735:K238T	K	+	2	0	ERP29	110944766	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.599000	0.61076	2.185000	0.69588	0.459000	0.35465	AAG	.	.		0.507	ERP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405200.1		
SPPL3	121665	hgsc.bcm.edu	37	12	121206182	121206182	+	Missense_Mutation	SNP	T	T	G	rs150882911	byFrequency	TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr12:121206182T>G	ENST00000353487.2	-	8	1222	c.719A>C	c.(718-720)aAt>aCt	p.N240T		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	241						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)					all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACGCCCAACATTGGGCCCCAG	0.547																																					p.N240T		Atlas-SNP	.											.	.	.	.	0			c.A719C						.						133.0	125.0	127.0					12																	121206182		2203	4300	6503	SO:0001583	missense	121665	exon8			CCAACATTGGGCC		CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.719A>C	chr12.hg19:g.121206182T>G	ENSP00000288680:p.Asn240Thr	59.0	0.0		44.0	10.0	NM_139015	Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	ENST00000353487.2	hg19	CCDS9208.1	.	.	.	.	.	.	.	.	.	.	T	15.36	2.811083	0.50421	.	.	ENSG00000157837	ENST00000353487;ENST00000405631	T	0.16743	2.32	5.34	4.2	0.49525	.	0.143208	0.64402	D	0.000007	T	0.12732	0.0309	L	0.29908	0.895	0.46131	D	0.998889	B;B	0.24675	0.109;0.011	B;B	0.27380	0.079;0.024	T	0.10291	-1.0636	10	0.19590	T	0.45	-5.7361	11.082	0.48066	0.0:0.0724:0.0:0.9276	.	241;240	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	T	240;239	ENSP00000288680:N240T	ENSP00000288680:N240T	N	-	2	0	AC069214.1	119690565	0.998000	0.40836	0.988000	0.46212	0.990000	0.78478	3.131000	0.50515	0.877000	0.35895	0.477000	0.44152	AAT	.	T|0.999;C|0.001		0.547	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402980.2	NM_139015	
SLITRK5	26050	hgsc.bcm.edu	37	13	88330117	88330117	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr13:88330117G>T	ENST00000325089.6	+	2	2693	c.2474G>T	c.(2473-2475)aGc>aTc	p.S825I	SLITRK5_ENST00000400028.3_Missense_Mutation_p.S584I	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	825					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					AGGCGGGAAAGCCACCACTTG	0.716																																					p.S825I		Atlas-SNP	.											.	SLITRK5	192	.	0			c.G2474T						.						10.0	12.0	12.0					13																	88330117		2197	4284	6481	SO:0001583	missense	26050	exon2			GGGAAAGCCACCA	AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2474G>T	chr13.hg19:g.88330117G>T	ENSP00000366283:p.Ser825Ile	121.0	0.0		163.0	23.0	NM_015567	B3KNB8|B4DSH5|Q5VT81	Missense_Mutation	SNP	ENST00000325089.6	hg19	CCDS9465.1	.	.	.	.	.	.	.	.	.	.	G	11.98	1.800282	0.31869	.	.	ENSG00000165300	ENST00000325089;ENST00000400028	T;T	0.61980	0.06;0.34	5.57	5.57	0.84162	.	0.271778	0.40222	N	0.001145	T	0.51753	0.1693	L	0.36672	1.1	0.40595	D	0.981521	B;B	0.20052	0.041;0.012	B;B	0.15484	0.013;0.006	T	0.46386	-0.9195	9	.	.	.	-6.9536	15.0578	0.71927	0.0:0.0:1.0:0.0	.	584;825	B4DSH5;O94991	.;SLIK5_HUMAN	I	825;584	ENSP00000366283:S825I;ENSP00000442244:S584I	.	S	+	2	0	SLITRK5	87128118	0.058000	0.20735	1.000000	0.80357	0.985000	0.73830	0.385000	0.20685	2.618000	0.88619	0.561000	0.74099	AGC	.	.		0.716	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045416.3		
GPR18	2841	hgsc.bcm.edu	37	13	99908040	99908040	+	Silent	SNP	A	A	G	rs371441036	byFrequency	TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr13:99908040A>G	ENST00000340807.3	-	3	643	c.87T>C	c.(85-87)taT>taC	p.Y29Y	UBAC2_ENST00000403766.3_Intron|GPR18_ENST00000397470.2_Silent_p.Y29Y|GPR18_ENST00000397473.2_Silent_p.Y29Y|UBAC2_ENST00000376440.2_Intron			Q14330	GPR18_HUMAN	G protein-coupled receptor 18	29					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)	10	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Glycine(DB00145)	AGATACAGCTATAGAAGACAA	0.378													A|||	61	0.0121805	0.0	0.0	5008	,	,		18179	0.0		0.0	False		,,,				2504	0.0624				p.Y29Y		Atlas-SNP	.											.	GPR18	23	.	0			c.T87C						.						127.0	127.0	127.0					13																	99908040		2203	4300	6503	SO:0001819	synonymous_variant	2841	exon2			ACAGCTATAGAAG	L42324	CCDS9491.1	13q32	2014-01-30			ENSG00000125245	ENSG00000125245		"""GPCR / Class A : Orphans"""	4472	protein-coding gene	gene with protein product		602042				9205118	Standard	NM_005292		Approved		uc010afv.3	Q14330	OTTHUMG00000017266	ENST00000340807.3:c.87T>C	chr13.hg19:g.99908040A>G		110.0	0.0		121.0	15.0	NM_001098200	Q6GTM3|Q96HI6|Q9H2L2	Silent	SNP	ENST00000340807.3	hg19	CCDS9491.1																																																																																			.	.		0.378	GPR18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045585.1		
ANKRD10	55608	hgsc.bcm.edu	37	13	111567223	111567223	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr13:111567223A>C	ENST00000267339.2	-	1	193	c.59T>G	c.(58-60)cTc>cGc	p.L20R	ANKRD10_ENST00000310847.4_Missense_Mutation_p.L20R|ANKRD10_ENST00000375758.5_Missense_Mutation_p.L20R	NM_017664.2	NP_060134.2	Q9NXR5	ANR10_HUMAN	ankyrin repeat domain 10	20										central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)	9	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		all cancers(43;0.0882)|BRCA - Breast invasive adenocarcinoma(86;0.188)|Lung(89;0.208)			ACGGAGCGAGAGCAGCTCCTC	0.736																																					p.L20R		Atlas-SNP	.											.	ANKRD10	24	.	0			c.T59G						.						10.0	14.0	13.0					13																	111567223		2111	4177	6288	SO:0001583	missense	55608	exon1			AGCGAGAGCAGCT	AK000100	CCDS9520.1, CCDS66580.1	13q33.3	2013-01-10			ENSG00000088448	ENSG00000088448		"""Ankyrin repeat domain containing"""	20265	protein-coding gene	gene with protein product							Standard	NM_017664		Approved	FLJ20093	uc001vrn.3	Q9NXR5	OTTHUMG00000017349	ENST00000267339.2:c.59T>G	chr13.hg19:g.111567223A>C	ENSP00000267339:p.Leu20Arg	73.0	0.0		129.0	18.0	NM_017664	Q5VW12|Q9BV12	Missense_Mutation	SNP	ENST00000267339.2	hg19	CCDS9520.1	.	.	.	.	.	.	.	.	.	.	A	17.71	3.457442	0.63401	.	.	ENSG00000088448	ENST00000267339;ENST00000375758;ENST00000310847	T;T;T	0.72615	-0.67;0.66;0.66	4.0	4.0	0.46444	Ankyrin repeat-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.79082	0.4386	L	0.58101	1.795	0.58432	D	0.999997	D;D;D	0.76494	0.999;0.996;0.998	D;P;D	0.85130	0.977;0.907;0.997	T	0.76016	-0.3113	10	0.25106	T	0.35	-0.0256	12.5463	0.56201	1.0:0.0:0.0:0.0	.	20;20;20	Q8IUW1;Q9NXR5-2;Q9NXR5	.;.;ANR10_HUMAN	R	20	ENSP00000267339:L20R;ENSP00000364911:L20R;ENSP00000312534:L20R	ENSP00000267339:L20R	L	-	2	0	ANKRD10	110365224	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.549000	0.82163	1.433000	0.47394	0.402000	0.26972	CTC	.	.		0.736	ANKRD10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045783.1		
TEP1	7011	hgsc.bcm.edu	37	14	20876563	20876563	+	Silent	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:20876563T>A	ENST00000262715.5	-	2	76	c.36A>T	c.(34-36)ccA>ccT	p.P12P	TEP1_ENST00000556935.1_Silent_p.P12P	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	12					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		AGAGGATGTCTGGATGGGCAG	0.507																																					p.P12P		Atlas-SNP	.											TEP1,right_upper_lobe,carcinoma,0,1	TEP1	224	.	0			c.A36T						.						75.0	73.0	74.0					14																	20876563		2203	4300	6503	SO:0001819	synonymous_variant	7011	exon2			GATGTCTGGATGG		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.36A>T	chr14.hg19:g.20876563T>A		38.0	0.0		61.0	7.0	NM_007110	A0AUV9	Silent	SNP	ENST00000262715.5	hg19	CCDS9548.1																																																																																			.	.		0.507	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
HNRNPC	3183	hgsc.bcm.edu	37	14	21702133	21702133	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:21702133T>C	ENST00000320084.7	-	2	459	c.220A>G	c.(220-222)Atg>Gtg	p.M74V	HNRNPC_ENST00000556628.1_Intron|HNRNPC_ENST00000553753.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000336053.6_Missense_Mutation_p.M74V|HNRNPC_ENST00000555883.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000420743.2_Missense_Mutation_p.M74V|HNRNPC_ENST00000556513.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000556142.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000554455.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000553300.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000556897.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000449098.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000557201.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000555914.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000554969.1_Missense_Mutation_p.M74V|HNRNPC_ENST00000430246.2_Missense_Mutation_p.M74V|HNRNPC_ENST00000555309.1_Missense_Mutation_p.M74V	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	74	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		CCAGCAATCATTCTGCCATCC	0.413																																					p.M74V	NSCLC(108;607 2244 12726 38757)	Atlas-SNP	.											.	HNRNPC	31	.	0			c.A220G						.						56.0	56.0	56.0					14																	21702133		2071	4235	6306	SO:0001583	missense	3183	exon2			CAATCATTCTGCC		CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.220A>G	chr14.hg19:g.21702133T>C	ENSP00000319690:p.Met74Val	204.0	0.0		227.0	27.0	NM_001077443	D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Missense_Mutation	SNP	ENST00000320084.7	hg19	CCDS41915.1	.	.	.	.	.	.	.	.	.	.	T	9.434	1.086192	0.20390	.	.	ENSG00000092199	ENST00000336053;ENST00000320084;ENST00000449098;ENST00000554969;ENST00000556142;ENST00000554455;ENST00000430246;ENST00000553753;ENST00000555914;ENST00000555309;ENST00000452166;ENST00000555883;ENST00000556513;ENST00000557201;ENST00000553300;ENST00000556897;ENST00000420743;ENST00000445284;ENST00000554383;ENST00000555215;ENST00000555137;ENST00000554891;ENST00000556226;ENST00000555176	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43;2.43	5.43	5.43	0.79202	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.062854	0.64402	U	0.000012	T	0.08758	0.0217	N	0.05078	-0.115	0.48696	D	0.999694	B;B;P;B;B	0.39831	0.027;0.029;0.69;0.073;0.022	B;B;B;B;B	0.38264	0.038;0.018;0.269;0.065;0.01	T	0.34875	-0.9811	10	0.11182	T	0.66	.	14.4601	0.67442	0.0:0.0:0.0:1.0	.	74;74;74;74;74	B4DY08;P07910-4;G3V4C1;P07910;P07910-2	.;.;.;HNRPC_HUMAN;.	V	74	ENSP00000338095:M74V;ENSP00000319690:M74V;ENSP00000404559:M74V;ENSP00000450725:M74V;ENSP00000451187:M74V;ENSP00000451291:M74V;ENSP00000442816:M74V;ENSP00000450548:M74V;ENSP00000451708:M74V;ENSP00000450790:M74V;ENSP00000450629:M74V;ENSP00000452214:M74V;ENSP00000452276:M74V;ENSP00000450544:M74V;ENSP00000451176:M74V;ENSP00000404848:M74V;ENSP00000452021:M74V;ENSP00000452213:M74V;ENSP00000452185:M74V;ENSP00000450467:M74V;ENSP00000451292:M74V;ENSP00000452573:M74V	ENSP00000319690:M74V	M	-	1	0	HNRNPC	20771973	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.228000	0.72288	2.066000	0.61787	0.533000	0.62120	ATG	.	.		0.413	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1		
NGDN	25983	hgsc.bcm.edu	37	14	23945267	23945267	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:23945267A>C	ENST00000408901.3	+	7	478	c.450A>C	c.(448-450)gaA>gaC	p.E150D	NGDN_ENST00000556580.1_5'Flank|NGDN_ENST00000397154.3_Missense_Mutation_p.E150D	NM_001042635.1|NM_015514.1	NP_001036100.1|NP_056329.1	Q8NEJ9	NGDN_HUMAN	neuroguidin, EIF4E binding protein	150	Necessary for interaction with EIF4E. {ECO:0000250}.				regulation of translation (GO:0006417)	cell projection (GO:0042995)|chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	12	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00654)		AGGAAGATGAAGCAGAAGATG	0.418																																					p.E150D		Atlas-SNP	.											.	NGDN	49	.	0			c.A450C						.						102.0	102.0	102.0					14																	23945267		2203	4300	6503	SO:0001583	missense	25983	exon7			AGATGAAGCAGAA	AK022215	CCDS32051.1, CCDS41926.1	14q11.2	2014-06-13	2006-08-02	2006-08-02	ENSG00000129460	ENSG00000129460			20271	protein-coding gene	gene with protein product		610777	"""chromosome 14 open reading frame 120"""	C14orf120		16705177	Standard	NM_001042635		Approved	DKFZP564O092, LCP5, lpd-2, NGD	uc001wjy.3	Q8NEJ9	OTTHUMG00000171501	ENST00000408901.3:c.450A>C	chr14.hg19:g.23945267A>C	ENSP00000386134:p.Glu150Asp	61.0	0.0		108.0	13.0	NM_015514	A8K760|Q9Y400	Missense_Mutation	SNP	ENST00000408901.3	hg19	CCDS41926.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	3.846|3.846	-0.032748|-0.032748	0.07543|0.07543	.|.	.|.	ENSG00000129460|ENSG00000129460	ENST00000408901;ENST00000397154;ENST00000555128|ENST00000556483	T;T|.	0.34472|.	1.36;1.36|.	5.89|5.89	5.89|5.89	0.94794|0.94794	.|.	0.246987|.	0.46758|.	D|.	0.000262|.	T|T	0.34571|0.34571	0.0902|0.0902	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.06405|.	0.002;0.001|.	T|T	0.29212|0.29212	-1.0019|-1.0019	10|5	0.15499|.	T|.	0.54|.	-8.6696|-8.6696	9.7474|9.7474	0.40455|0.40455	0.9223:0.0:0.0777:0.0|0.9223:0.0:0.0777:0.0	.|.	150;150|.	Q8NEJ9-2;Q8NEJ9|.	.;NGDN_HUMAN|.	D|R	150;150;125|98	ENSP00000386134:E150D;ENSP00000380340:E150D|.	ENSP00000380340:E150D|.	E|S	+|+	3|1	2|0	NGDN|NGDN	23015107|23015107	0.989000|0.989000	0.36119|0.36119	0.947000|0.947000	0.38551|0.38551	0.175000|0.175000	0.22909|0.22909	1.702000|1.702000	0.37836|0.37836	2.257000|2.257000	0.74773|0.74773	0.460000|0.460000	0.39030|0.39030	GAA|AGC	.	.		0.418	NGDN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000413782.3	NM_001042635	
BAZ1A	11177	hgsc.bcm.edu	37	14	35331372	35331372	+	Silent	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:35331372T>C	ENST00000382422.2	-	2	597	c.270A>G	c.(268-270)ttA>ttG	p.L90L	BAZ1A_ENST00000358716.4_Silent_p.L90L|BAZ1A_ENST00000360310.1_Silent_p.L90L|BAZ1A_ENST00000553853.1_5'UTR			Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	90	Required for association with the CHRAC1/POLE3 complex.|Required for interaction with NCOR1.|WAC. {ECO:0000255|PROSITE- ProRule:PRU00475}.				chromatin remodeling (GO:0006338)|DNA-dependent DNA replication (GO:0006261)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	ACF complex (GO:0016590)|CHRAC (GO:0008623)|nuclear chromosome (GO:0000228)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(2)|large_intestine(7)|lung(19)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TGGTCAAGTATAAAACTGGAA	0.403																																					p.L90L		Atlas-SNP	.											.	BAZ1A	128	.	0			c.A270G						.						195.0	197.0	196.0					14																	35331372		2203	4300	6503	SO:0001819	synonymous_variant	11177	exon3			CAAGTATAAAACT	AB032252	CCDS9651.1, CCDS41943.1	14q13.2	2013-01-28			ENSG00000198604	ENSG00000198604		"""Zinc fingers, PHD-type"""	960	protein-coding gene	gene with protein product		605680				10662543	Standard	NM_013448		Approved	hACF1, ACF1, WALp1, WCRF180	uc001wsk.3	Q9NRL2	OTTHUMG00000140216	ENST00000382422.2:c.270A>G	chr14.hg19:g.35331372T>C		148.0	0.0		187.0	22.0	NM_182648	Q9NZ15|Q9P065|Q9UIG1|Q9Y3V3	Silent	SNP	ENST00000382422.2	hg19	CCDS9651.1																																																																																			.	.		0.403	BAZ1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276646.1		
PLEKHG3	26030	hgsc.bcm.edu	37	14	65208353	65208353	+	Silent	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:65208353A>G	ENST00000394691.1	+	16	2265	c.2118A>G	c.(2116-2118)gaA>gaG	p.E706E	PLEKHG3_ENST00000247226.7_Silent_p.E650E|PLEKHG3_ENST00000471182.2_Silent_p.E239E|PLEKHG3_ENST00000492928.1_3'UTR|PLEKHG3_ENST00000484731.2_Silent_p.E211E			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	706							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		AGAAGAAGGAATCAGCACTCT	0.577																																					p.E650E		Atlas-SNP	.											.	PLEKHG3	89	.	0			c.A1950G						.						55.0	58.0	57.0					14																	65208353		2198	4284	6482	SO:0001819	synonymous_variant	26030	exon14			GAAGGAATCAGCA	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.2118A>G	chr14.hg19:g.65208353A>G		56.0	0.0		80.0	14.0	NM_015549	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Silent	SNP	ENST00000394691.1	hg19																																																																																				.	.		0.577	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
PCNX	22990	hgsc.bcm.edu	37	14	71413714	71413714	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:71413714A>G	ENST00000304743.2	+	2	682	c.236A>G	c.(235-237)tAt>tGt	p.Y79C	PCNX_ENST00000439984.3_Missense_Mutation_p.Y79C|PCNX_ENST00000238570.5_Missense_Mutation_p.Y79C	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	79						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		ATGGTCAACTATCGACTACAC	0.418																																					p.Y79C		Atlas-SNP	.											.	PCNX	198	.	0			c.A236G						.						125.0	107.0	113.0					14																	71413714		2203	4300	6503	SO:0001583	missense	22990	exon2			TCAACTATCGACT	AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.236A>G	chr14.hg19:g.71413714A>G	ENSP00000304192:p.Tyr79Cys	93.0	0.0		120.0	14.0	NM_014982	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	ENST00000304743.2	hg19	CCDS9806.1	.	.	.	.	.	.	.	.	.	.	A	17.19	3.326200	0.60743	.	.	ENSG00000100731	ENST00000304743;ENST00000238570;ENST00000439984	T;T;T	0.45276	0.9;0.9;0.9	6.05	6.05	0.98169	.	0.061535	0.64402	D	0.000003	T	0.64283	0.2584	M	0.68317	2.08	0.58432	D	0.999996	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.996;0.999	T	0.65623	-0.6123	10	0.59425	D	0.04	.	16.6	0.84812	1.0:0.0:0.0:0.0	.	79;79;79	B2RTR6;Q96RV3;Q96RV3-2	.;PCX1_HUMAN;.	C	79	ENSP00000304192:Y79C;ENSP00000238570:Y79C;ENSP00000396617:Y79C	ENSP00000238570:Y79C	Y	+	2	0	PCNX	70483467	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.450000	0.80656	2.323000	0.78572	0.533000	0.62120	TAT	.	.		0.418	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412479.1	NM_014982	
VRTN	55237	hgsc.bcm.edu	37	14	74824495	74824495	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:74824495C>G	ENST00000256362.4	+	2	1250	c.1009C>G	c.(1009-1011)Cag>Gag	p.Q337E		NM_018228.2	NP_060698.2	Q9H8Y1	VRTN_HUMAN	vertebrae development associated	337					transposition, DNA-mediated (GO:0006313)		sequence-specific DNA binding (GO:0043565)|transposase activity (GO:0004803)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(15)|ovary(5)|prostate(2)|skin(1)|urinary_tract(1)	41						GCAGTTCCTCCAGCGGTTCCC	0.667																																					p.Q337E		Atlas-SNP	.											.	VRTN	79	.	0			c.C1009G						.						53.0	58.0	56.0					14																	74824495		2203	4300	6503	SO:0001583	missense	55237	exon2			TTCCTCCAGCGGT	AK001673	CCDS9830.1	14q24.2	2012-12-07	2012-12-07	2010-10-20	ENSG00000133980	ENSG00000133980			20223	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 115"", ""vertebrae development homolog (pig)"""	C14orf115		21232157	Standard	NM_018228		Approved	FLJ10811, vertnin	uc001xpw.4	Q9H8Y1	OTTHUMG00000171208	ENST00000256362.4:c.1009C>G	chr14.hg19:g.74824495C>G	ENSP00000256362:p.Gln337Glu	48.0	0.0		83.0	44.0	NM_018228	Q9NVC7	Missense_Mutation	SNP	ENST00000256362.4	hg19	CCDS9830.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.061167	0.36373	.	.	ENSG00000133980	ENST00000256362	T	0.46451	0.87	5.02	5.02	0.67125	.	0.221700	0.38326	N	0.001735	T	0.25827	0.0629	N	0.17082	0.46	0.29668	N	0.842703	B	0.30236	0.274	B	0.24848	0.056	T	0.13124	-1.0521	10	0.29301	T	0.29	-9.0505	12.6328	0.56667	0.165:0.835:0.0:0.0	.	337	Q9H8Y1	VRTN_HUMAN	E	337	ENSP00000256362:Q337E	ENSP00000256362:Q337E	Q	+	1	0	VRTN	73894248	0.996000	0.38824	0.993000	0.49108	0.714000	0.41099	2.124000	0.42006	2.602000	0.87976	0.561000	0.74099	CAG	.	.		0.667	VRTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412339.1	NM_018228	
ZC2HC1C	79696	hgsc.bcm.edu	37	14	75537802	75537802	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:75537802A>G	ENST00000524913.1	+	2	1015	c.526A>G	c.(526-528)Agg>Ggg	p.R176G	ZC2HC1C_ENST00000526748.1_Intron|ACYP1_ENST00000555463.1_5'Flank|ZC2HC1C_ENST00000439583.2_Missense_Mutation_p.R176G|ZC2HC1C_ENST00000238686.8_Missense_Mutation_p.R176G	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	176							metal ion binding (GO:0046872)										GTTTTCATCTAGGAACTTTGG	0.552																																					p.R176G		Atlas-SNP	.											.	.	.	.	0			c.A526G						.						127.0	127.0	127.0					14																	75537802		1925	4126	6051	SO:0001583	missense	79696	exon2			TCATCTAGGAACT	AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.526A>G	chr14.hg19:g.75537802A>G	ENSP00000435550:p.Arg176Gly	84.0	0.0		144.0	27.0	NM_024643	E9PJQ0|Q9BTA8|Q9H5S9	Missense_Mutation	SNP	ENST00000524913.1	hg19	CCDS41972.1	.	.	.	.	.	.	.	.	.	.	A	7.327	0.618162	0.14129	.	.	ENSG00000119703	ENST00000524913;ENST00000238686;ENST00000439583	T	0.44482	0.92	4.72	4.72	0.59763	.	0.695175	0.13395	N	0.391060	T	0.31451	0.0797	N	0.22421	0.69	0.09310	N	1	B;B	0.19817	0.039;0.013	B;B	0.16289	0.015;0.007	T	0.18116	-1.0347	10	0.48119	T	0.1	-1.7992	12.9707	0.58511	1.0:0.0:0.0:0.0	.	176;176	Q53FD0;E9PJQ0	F164C_HUMAN;.	G	176	ENSP00000435550:R176G	ENSP00000238686:R176G	R	+	1	2	FAM164C	74607555	0.002000	0.14202	0.029000	0.17559	0.018000	0.09664	1.354000	0.34056	1.995000	0.58328	0.455000	0.32223	AGG	.	.		0.552	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394616.4	NM_001042430	
ATG2B	55102	hgsc.bcm.edu	37	14	96770845	96770845	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:96770845A>G	ENST00000359933.4	-	32	5722	c.4829T>C	c.(4828-4830)aTa>aCa	p.I1610T	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1610					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		GCTTAGCTGTATTTCCATTAA	0.453																																					p.I1610T		Atlas-SNP	.											.	ATG2B	169	.	0			c.T4829C						.						150.0	136.0	140.0					14																	96770845		2203	4300	6503	SO:0001583	missense	55102	exon32			AGCTGTATTTCCA	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.4829T>C	chr14.hg19:g.96770845A>G	ENSP00000353010:p.Ile1610Thr	105.0	0.0		124.0	16.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	21.9	4.211952	0.79240	.	.	ENSG00000066739	ENST00000359933	T	0.13901	2.55	5.18	5.18	0.71444	.	0.086607	0.85682	D	0.000000	T	0.39279	0.1072	M	0.77486	2.375	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.32052	-0.9921	10	0.72032	D	0.01	.	15.3344	0.74241	1.0:0.0:0.0:0.0	.	1610	Q96BY7	ATG2B_HUMAN	T	1610	ENSP00000353010:I1610T	ENSP00000261834:I254T	I	-	2	0	ATG2B	95840598	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	8.477000	0.90424	2.071000	0.62044	0.460000	0.39030	ATA	.	.		0.453	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
SNRPN	6638	hgsc.bcm.edu	37	15	25222034	25222034	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:25222034C>A	ENST00000400100.1	+	10	1168	c.278C>A	c.(277-279)gCt>gAt	p.A93D	SNRPN_ENST00000444203.2_Missense_Mutation_p.A97D|SNRPN_ENST00000390687.4_Missense_Mutation_p.A93D|SNRPN_ENST00000554227.2_Missense_Mutation_p.A97D|SNRPN_ENST00000400098.1_Missense_Mutation_p.A93D|SNHG14_ENST00000551631.2_RNA|SNRPN_ENST00000400097.1_Missense_Mutation_p.A93D|SNRPN_ENST00000346403.6_Missense_Mutation_p.A93D|SNRPN_ENST00000577565.1_Missense_Mutation_p.A93D|SNURF_ENST00000338094.6_3'UTR|SNURF_ENST00000551312.2_Intron	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	93					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		ACTGGCATTGCTCGGGTACCA	0.488									Prader-Willi syndrome																												p.A93D		Atlas-SNP	.											.	SNRPN	58	.	0			c.C278A						.						87.0	89.0	89.0					15																	25222034		1946	4149	6095	SO:0001583	missense	6638	exon10	Familial Cancer Database	Prader-Labhart-Willi syndrome	GCATTGCTCGGGT	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.278C>A	chr15.hg19:g.25222034C>A	ENSP00000382972:p.Ala93Asp	51.0	0.0		91.0	9.0	NM_022807	B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	ENST00000400100.1	hg19	CCDS10017.1	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440195	0.63067	.	.	ENSG00000128739	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203	T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87	3.79	3.79	0.43588	.	0.180238	0.48286	D	0.000194	T	0.45935	0.1367	M	0.65498	2.005	0.80722	D	1	P;P	0.49961	0.93;0.868	P;B	0.45310	0.476;0.328	T	0.52449	-0.8574	10	0.49607	T	0.09	-8.1156	13.963	0.64193	0.0:1.0:0.0:0.0	.	97;93	B3KVR1;P63162	.;RSMN_HUMAN	D	93;93;93;97;93;97	ENSP00000382972:A93D;ENSP00000382970:A93D;ENSP00000382969:A93D;ENSP00000452342:A97D;ENSP00000375105:A93D;ENSP00000408767:A97D	ENSP00000375105:A93D	A	+	2	0	SNRPN	22773127	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.437000	0.73421	2.409000	0.81822	0.561000	0.74099	GCT	.	.		0.488	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097	
FAM98B	283742	hgsc.bcm.edu	37	15	38766446	38766446	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:38766446A>G	ENST00000491535.1	+	6	684	c.676A>G	c.(676-678)Atg>Gtg	p.M226V	FAM98B_ENST00000397609.2_Missense_Mutation_p.M226V	NM_001042429.1	NP_001035894.1	Q52LJ0	FA98B_HUMAN	family with sequence similarity 98, member B	226						cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-splicing ligase complex (GO:0072669)	poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|skin(1)	8		all_cancers(109;3.11e-17)|all_epithelial(112;2.64e-15)|Lung NSC(122;2.11e-11)|all_lung(180;5.61e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;9e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0209)		ACGAATGTTAATGAAACGATT	0.378																																					p.M226V		Atlas-SNP	.											.	FAM98B	53	.	0			c.A676G						.						222.0	197.0	205.0					15																	38766446		2200	4297	6497	SO:0001583	missense	283742	exon6			ATGTTAATGAAAC		CCDS10047.2	15q14	2006-11-29		2005-11-20	ENSG00000171262	ENSG00000171262			26773	protein-coding gene	gene with protein product						12477932	Standard	NM_173611		Approved	FLJ38426	uc001zkc.3	Q52LJ0	OTTHUMG00000129831	ENST00000491535.1:c.676A>G	chr15.hg19:g.38766446A>G	ENSP00000453166:p.Met226Val	91.0	0.0		75.0	14.0	NM_001042429	A8MUW5|Q8N935	Missense_Mutation	SNP	ENST00000491535.1	hg19	CCDS42015.1	.	.	.	.	.	.	.	.	.	.	A	9.424	1.083878	0.20309	.	.	ENSG00000171262	ENST00000397609;ENST00000305752	T	0.39592	1.07	4.92	1.31	0.21738	.	0.174068	0.64402	N	0.000003	T	0.24928	0.0605	N	0.26042	0.785	0.36575	D	0.873204	B;B	0.31769	0.339;0.155	B;B	0.33254	0.16;0.05	T	0.10177	-1.0641	10	0.31617	T	0.26	-12.817	5.3283	0.15918	0.7249:0.0:0.1444:0.1307	.	226;226	A8MUW5;Q52LJ0	.;FA98B_HUMAN	V	226	ENSP00000380734:M226V	ENSP00000303412:M226V	M	+	1	0	FAM98B	36553738	0.989000	0.36119	0.998000	0.56505	0.963000	0.63663	0.375000	0.20518	0.111000	0.17947	-0.503000	0.04515	ATG	.	.		0.378	FAM98B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252071.2	NM_173611	
MGA	23269	hgsc.bcm.edu	37	15	41988901	41988901	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:41988901A>G	ENST00000570161.1	+	2	1693	c.1693A>G	c.(1693-1695)Ata>Gta	p.I565V	MGA_ENST00000389936.4_Missense_Mutation_p.I565V|MGA_ENST00000566586.1_Missense_Mutation_p.I565V|MGA_ENST00000545763.1_Missense_Mutation_p.I565V|MGA_ENST00000219905.7_Missense_Mutation_p.I565V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CACAGAAAGAATACTCGACGA	0.403																																					p.I565V		Atlas-SNP	.											.	MGA	264	.	0			c.A1693G						.						64.0	57.0	59.0					15																	41988901		1868	4114	5982	SO:0001583	missense	23269	exon3			GAAAGAATACTCG	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1693A>G	chr15.hg19:g.41988901A>G	ENSP00000457035:p.Ile565Val	147.0	0.0		144.0	17.0	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	hg19	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	A	0.692	-0.793965	0.02862	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.83163	-1.68;-1.69;-1.69	5.44	1.77	0.24775	.	2.341720	0.01261	N	0.009164	T	0.70133	0.3189	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.53563	-0.8421	10	0.29301	T	0.29	.	1.4579	0.02389	0.5204:0.1287:0.2112:0.1398	.	565;565	F5H7K2;E7ENI0	.;.	V	565	ENSP00000219905:I565V;ENSP00000374586:I565V;ENSP00000442467:I565V	ENSP00000219905:I565V	I	+	1	0	MGA	39776193	0.199000	0.23386	0.016000	0.15963	0.062000	0.15995	0.119000	0.15626	0.328000	0.23435	0.379000	0.24179	ATA	.	.		0.403	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MAPK6	5597	hgsc.bcm.edu	37	15	52356215	52356215	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:52356215A>G	ENST00000261845.5	+	6	1991	c.1184A>G	c.(1183-1185)cAa>cGa	p.Q395R	CTD-2184D3.5_ENST00000558607.1_RNA	NM_002748.3	NP_002739.1	Q16659	MK06_HUMAN	mitogen-activated protein kinase 6	395					cell cycle (GO:0007049)|MAPK cascade (GO:0000165)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(1)|kidney(3)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	20				all cancers(107;0.0028)		GAAGAAGTACAAGTTGATCCC	0.408																																					p.Q395R		Atlas-SNP	.											.	MAPK6	70	.	0			c.A1184G						.						99.0	92.0	95.0					15																	52356215		2195	4293	6488	SO:0001583	missense	5597	exon6			AAGTACAAGTTGA	L77964	CCDS10147.1	15q21	2011-06-10			ENSG00000069956	ENSG00000069956		"""Mitogen-activated protein kinase cascade / Kinases"""	6879	protein-coding gene	gene with protein product		602904		PRKM6		8875998	Standard	NM_002748		Approved	ERK3, p97MAPK, HsT17250	uc002abp.3	Q16659	OTTHUMG00000131891	ENST00000261845.5:c.1184A>G	chr15.hg19:g.52356215A>G	ENSP00000261845:p.Gln395Arg	43.0	0.0		44.0	10.0	NM_002748	B2R945|B5BU65|Q68DH4|Q8IYN8	Missense_Mutation	SNP	ENST00000261845.5	hg19	CCDS10147.1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.615171	0.87359	.	.	ENSG00000069956	ENST00000261845	T	0.45668	0.89	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.59729	0.2215	L	0.61218	1.895	0.80722	D	1	D	0.54601	0.967	P	0.62382	0.901	T	0.63857	-0.6542	10	0.87932	D	0	-15.6519	15.228	0.73364	1.0:0.0:0.0:0.0	.	395	Q16659	MK06_HUMAN	R	395	ENSP00000261845:Q395R	ENSP00000261845:Q395R	Q	+	2	0	MAPK6	50143507	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.713000	0.91408	2.023000	0.59567	0.524000	0.50904	CAA	.	.		0.408	MAPK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254841.2	NM_002748	
CGNL1	84952	hgsc.bcm.edu	37	15	57734582	57734582	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:57734582A>G	ENST00000281282.5	+	4	1787	c.1709A>G	c.(1708-1710)aAt>aGt	p.N570S		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	570						myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		AGCACTGATAATGACGATGCT	0.433																																					p.N570S		Atlas-SNP	.											.	CGNL1	125	.	0			c.A1709G						.						86.0	79.0	81.0					15																	57734582		2192	4292	6484	SO:0001583	missense	84952	exon5			CTGATAATGACGA	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.1709A>G	chr15.hg19:g.57734582A>G	ENSP00000281282:p.Asn570Ser	64.0	0.0		62.0	10.0	NM_001252335	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	hg19	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	A	9.540	1.113239	0.20795	.	.	ENSG00000128849	ENST00000281282	T	0.41065	1.01	5.46	5.46	0.80206	.	0.000000	0.64402	D	0.000017	T	0.35828	0.0945	L	0.37507	1.11	0.45607	D	0.998547	B	0.18968	0.032	B	0.19391	0.025	T	0.09422	-1.0675	10	0.31617	T	0.26	-25.6651	15.5325	0.75974	1.0:0.0:0.0:0.0	.	570	Q0VF96	CGNL1_HUMAN	S	570	ENSP00000281282:N570S	ENSP00000281282:N570S	N	+	2	0	CGNL1	55521874	1.000000	0.71417	0.994000	0.49952	0.308000	0.27856	5.599000	0.67592	2.065000	0.61736	0.455000	0.32223	AAT	.	.		0.433	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
DENND4A	10260	hgsc.bcm.edu	37	15	65995317	65995317	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:65995317T>C	ENST00000431932.2	-	16	2325	c.2117A>G	c.(2116-2118)aAt>aGt	p.N706S	DENND4A_ENST00000443035.3_Missense_Mutation_p.N706S	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	706					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TTCAAATAAATTGTTCCTAAG	0.338																																					p.N706S		Atlas-SNP	.											.	DENND4A	217	.	0			c.A2117G						.						110.0	100.0	103.0					15																	65995317		1795	4065	5860	SO:0001583	missense	10260	exon16			AATAAATTGTTCC	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.2117A>G	chr15.hg19:g.65995317T>C	ENSP00000396830:p.Asn706Ser	67.0	0.0		57.0	13.0	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	hg19	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	T	12.80	2.046012	0.36085	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.04603	3.6;3.59	5.72	4.6	0.57074	.	0.294964	0.41605	N	0.000860	T	0.02119	0.0066	N	0.01576	-0.805	0.33722	D	0.617128	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.32188	-0.9916	10	0.33940	T	0.23	.	10.6112	0.45423	0.0:0.0727:0.0:0.9273	.	706;706	E7EPL3;Q7Z401	.;MYCPP_HUMAN	S	706	ENSP00000391167:N706S;ENSP00000396830:N706S	ENSP00000396830:N706S	N	-	2	0	DENND4A	63782371	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.895000	0.56258	1.101000	0.41535	0.528000	0.53228	AAT	.	.		0.338	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
IREB2	3658	hgsc.bcm.edu	37	15	78782771	78782771	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:78782771A>G	ENST00000258886.8	+	17	2233	c.2084A>G	c.(2083-2085)aAt>aGt	p.N695S		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	695					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		CAGATGGGGAATAAACGGTGG	0.363																																					p.N695S	NSCLC(200;764 2208 35157 49871 50830)	Atlas-SNP	.											.	IREB2	106	.	0			c.A2084G						.						81.0	77.0	78.0					15																	78782771		2196	4293	6489	SO:0001583	missense	3658	exon17			TGGGGAATAAACG	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.2084A>G	chr15.hg19:g.78782771A>G	ENSP00000258886:p.Asn695Ser	193.0	0.0		183.0	30.0	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Missense_Mutation	SNP	ENST00000258886.8	hg19	CCDS10302.1	.	.	.	.	.	.	.	.	.	.	A	13.71	2.319535	0.41096	.	.	ENSG00000136381	ENST00000258886	T	0.16897	2.31	5.84	5.84	0.93424	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	0.296708	0.42821	D	0.000653	T	0.13415	0.0325	L	0.33189	0.99	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.08597	-1.0714	10	0.32370	T	0.25	.	10.2762	0.43512	0.926:0.0:0.074:0.0	.	695	P48200	IREB2_HUMAN	S	695	ENSP00000258886:N695S	ENSP00000258886:N695S	N	+	2	0	IREB2	76569826	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.478000	0.66806	2.234000	0.73211	0.459000	0.35465	AAT	.	.		0.363	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
CEMIP	57214	hgsc.bcm.edu	37	15	81199078	81199078	+	Silent	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:81199078C>A	ENST00000394685.3	+	13	1905	c.1486C>A	c.(1486-1488)Cgg>Agg	p.R496R	KIAA1199_ENST00000220244.3_Silent_p.R496R|RP11-351M8.1_ENST00000560560.1_Intron|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_Silent_p.R496R			Q8WUJ3	CEMIP_HUMAN		496	Necessary for its endoplasmic reticulum (ER) retention and interaction with HSPA5.				hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GCTTCTGAGCCGGAACATCAT	0.532																																					p.R496R		Atlas-SNP	.											.	KIAA1199	118	.	0			c.C1486A						.						166.0	145.0	152.0					15																	81199078		2203	4300	6503	SO:0001819	synonymous_variant	57214	exon12			CTGAGCCGGAACA																												ENST00000394685.3:c.1486C>A	chr15.hg19:g.81199078C>A		141.0	0.0		119.0	38.0	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Silent	SNP	ENST00000394685.3	hg19	CCDS10315.1																																																																																			.	.		0.532	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
NTRK3	4916	hgsc.bcm.edu	37	15	88690618	88690618	+	Silent	SNP	G	G	T	rs149623569		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr15:88690618G>T	ENST00000360948.2	-	5	573	c.412C>A	c.(412-414)Cgg>Agg	p.R138R	NTRK3_ENST00000558676.1_Silent_p.R138R|NTRK3_ENST00000540489.2_Silent_p.R138R|NTRK3_ENST00000542733.2_Silent_p.R40R|NTRK3_ENST00000357724.2_Silent_p.R138R|NTRK3_ENST00000557856.1_Silent_p.R138R|NTRK3_ENST00000317501.3_Silent_p.R138R|NTRK3_ENST00000355254.2_Silent_p.R138R|NTRK3_ENST00000394480.2_Silent_p.R138R	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	138					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GTGGTGAGCCGGTTACTTGAC	0.428			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.R138R		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.C412A						.						66.0	60.0	62.0					15																	88690618		2201	4299	6500	SO:0001819	synonymous_variant	4916	exon6			TGAGCCGGTTACT	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.412C>A	chr15.hg19:g.88690618G>T		122.0	0.0		110.0	35.0	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	ENST00000360948.2	hg19	CCDS32322.1																																																																																			.	G|1.000;A|0.000		0.428	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
DNASE1L2	1775	hgsc.bcm.edu	37	16	2287636	2287636	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr16:2287636A>C	ENST00000564065.1	+	4	1578	c.577A>C	c.(577-579)Aag>Cag	p.K193Q	DNASE1L2_ENST00000382437.4_Missense_Mutation_p.K172Q|DNASE1L2_ENST00000567494.1_Missense_Mutation_p.K193Q|DNASE1L2_ENST00000320700.5_Missense_Mutation_p.K193Q|RP11-304L19.11_ENST00000565709.1_RNA|RP11-304L19.12_ENST00000564055.1_lincRNA			Q92874	DNSL2_HUMAN	deoxyribonuclease I-like 2	193					corneocyte development (GO:0003335)|DNA metabolic process (GO:0006259)|hair follicle development (GO:0001942)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			endometrium(1)|prostate(1)|skin(2)	4						CGTGATCGACAAGTGGGGCAC	0.697																																					p.K193Q		Atlas-SNP	.											.	DNASE1L2	14	.	0			c.A577C						.						17.0	20.0	19.0					16																	2287636		1990	4138	6128	SO:0001583	missense	1775	exon5			ATCGACAAGTGGG	U62647	CCDS42105.1	16p13.3	2008-02-05				ENSG00000167968			2958	protein-coding gene	gene with protein product		602622				9205125, 1577479	Standard	NM_001374		Approved	DNAS1L2	uc002cpp.3	Q92874		ENST00000564065.1:c.577A>C	chr16.hg19:g.2287636A>C	ENSP00000454562:p.Lys193Gln	158.0	0.0		200.0	43.0	NM_001374	E9PBY4|Q6JVM2|Q6JVM3	Missense_Mutation	SNP	ENST00000564065.1	hg19	CCDS42105.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.335665	0.41398	.	.	ENSG00000167968	ENST00000541838;ENST00000320700;ENST00000382437	T;T	0.80480	-1.38;-1.38	4.35	4.35	0.52113	Endonuclease/exonuclease/phosphatase (2);	0.069954	0.56097	D	0.000033	T	0.79639	0.4480	L	0.58583	1.82	0.30521	N	0.768425	D;D	0.65815	0.995;0.979	P;P	0.50314	0.637;0.484	T	0.76280	-0.3017	10	0.24483	T	0.36	-10.5877	9.8706	0.41170	1.0:0.0:0.0:0.0	.	193;172	Q92874;Q6JVM2	DNSL2_HUMAN;.	Q	193;193;172	ENSP00000316938:K193Q;ENSP00000371874:K172Q	ENSP00000316938:K193Q	K	+	1	0	DNASE1L2	2227637	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	2.608000	0.46308	1.826000	0.53198	0.408000	0.27601	AAG	.	.		0.697	DNASE1L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000435236.1	NM_001374	
COG7	91949	hgsc.bcm.edu	37	16	23430073	23430073	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr16:23430073T>A	ENST00000307149.5	-	8	1270	c.1085A>T	c.(1084-1086)tAt>tTt	p.Y362F		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	362					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		CATGTCGCCATACTTCAGCTG	0.483																																					p.Y362F		Atlas-SNP	.											.	COG7	62	.	0			c.A1085T						.						144.0	105.0	118.0					16																	23430073		2197	4300	6497	SO:0001583	missense	91949	exon8			TCGCCATACTTCA	AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1085A>T	chr16.hg19:g.23430073T>A	ENSP00000305442:p.Tyr362Phe	80.0	0.0		85.0	21.0	NM_153603	Q6UWU7	Missense_Mutation	SNP	ENST00000307149.5	hg19	CCDS10610.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.710203	0.89018	.	.	ENSG00000168434	ENST00000307149	T	0.68765	-0.35	5.73	5.73	0.89815	.	0.106321	0.64402	D	0.000003	T	0.79678	0.4487	M	0.72118	2.19	0.80722	D	1	D	0.65815	0.995	D	0.70935	0.971	T	0.78003	-0.2374	10	0.31617	T	0.26	-12.577	15.1912	0.73047	0.0:0.0:0.0:1.0	.	362	P83436	COG7_HUMAN	F	362	ENSP00000305442:Y362F	ENSP00000305442:Y362F	Y	-	2	0	COG7	23337574	1.000000	0.71417	0.967000	0.41034	0.805000	0.45488	7.999000	0.88496	2.185000	0.69588	0.533000	0.62120	TAT	.	.		0.483	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211625.1		
UBFD1	56061	hgsc.bcm.edu	37	16	23578364	23578364	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr16:23578364G>T	ENST00000395878.3	+	6	1174	c.793G>T	c.(793-795)Gaa>Taa	p.E265*	UBFD1_ENST00000567212.1_Nonsense_Mutation_p.E256*|UBFD1_ENST00000219638.4_Nonsense_Mutation_p.E489*|CTD-2196E14.6_ENST00000568262.2_RNA	NM_019116.2	NP_061989.2	O14562	UBFD1_HUMAN	ubiquitin family domain containing 1	265							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7				GBM - Glioblastoma multiforme(48;0.0331)		TGAACCTATCGAAGGACATGA	0.483																																					p.E265X	Melanoma(22;290 1069 22358 48158)	Atlas-SNP	.											.	UBFD1	16	.	0			c.G793T						.						118.0	117.0	117.0					16																	23578364		1941	4143	6084	SO:0001587	stop_gained	56061	exon6			CCTATCGAAGGAC	AK124139	CCDS10613.2	16p12.1	2008-11-05			ENSG00000103353	ENSG00000103353			30565	protein-coding gene	gene with protein product	"""ubiquitin-binding protein homolog"""					10493829	Standard	XM_006721064		Approved	FLJ42145, FLJ38870, UBPH	uc002dlv.3	O14562	OTTHUMG00000128855	ENST00000395878.3:c.793G>T	chr16.hg19:g.23578364G>T	ENSP00000379217:p.Glu265*	53.0	0.0		72.0	16.0	NM_019116	A8MW58|D3DWF2	Nonsense_Mutation	SNP	ENST00000395878.3	hg19	CCDS10613.2	.	.	.	.	.	.	.	.	.	.	G	36	5.760107	0.96898	.	.	ENSG00000103353	ENST00000219638;ENST00000395878;ENST00000399462	.	.	.	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-6.6309	17.4351	0.87549	0.0:0.0:1.0:0.0	.	.	.	.	X	489;265;142	.	ENSP00000219638:E489X	E	+	1	0	UBFD1	23485865	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.393000	0.97256	2.446000	0.82766	0.561000	0.74099	GAA	.	.		0.483	UBFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250795.2	NM_019116	
CDH1	999	hgsc.bcm.edu	37	16	68856096	68856096	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr16:68856096G>T	ENST00000261769.5	+	12	2095	c.1904G>T	c.(1903-1905)aGt>aTt	p.S635I	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Missense_Mutation_p.S574I	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	635	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.			ASA -> RVP (in Ref. 3; AAA61259). {ECO:0000305}.	adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CACGGGGCGAGTGCCAACTGG	0.498			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																												p.S635I		Atlas-SNP	.	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	.	CDH1	535	.	0			c.G1904T						.						95.0	79.0	84.0					16																	68856096		2198	4300	6498	SO:0001583	missense	999	exon12	Familial Cancer Database	HDGC	GGGCGAGTGCCAA	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1904G>T	chr16.hg19:g.68856096G>T	ENSP00000261769:p.Ser635Ile	118.0	0.0		91.0	59.0	NM_004360	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	ENST00000261769.5	hg19	CCDS10869.1	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852494	0.71719	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000422392	T;T	0.53857	0.6;0.6	5.68	5.68	0.88126	Cadherin (2);Cadherin-like (1);	0.313291	0.27636	N	0.018490	T	0.69984	0.3172	M	0.80183	2.485	0.41524	D	0.988411	D;P	0.58970	0.984;0.823	P;P	0.61132	0.884;0.607	T	0.73534	-0.3952	10	0.62326	D	0.03	.	12.7648	0.57386	0.0754:0.0:0.9246:0.0	.	574;635	Q9UII8;P12830	.;CADH1_HUMAN	I	635;653;574	ENSP00000261769:S635I;ENSP00000414946:S574I	ENSP00000261769:S635I	S	+	2	0	CDH1	67413597	0.962000	0.33011	0.999000	0.59377	0.893000	0.52053	3.745000	0.55119	2.697000	0.92050	0.632000	0.83419	AGT	.	.		0.498	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268897.2	NM_004360	
MVD	4597	hgsc.bcm.edu	37	16	88721693	88721693	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr16:88721693A>C	ENST00000301012.3	-	7	840	c.811T>G	c.(811-813)Ttc>Gtc	p.F271V	MVD_ENST00000568709.1_5'Flank	NM_002461.1	NP_002452.1	P53602	MVD1_HUMAN	mevalonate (diphospho) decarboxylase	271					cellular protein metabolic process (GO:0044267)|cholesterol biosynthetic process (GO:0006695)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|positive regulation of cell proliferation (GO:0008284)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|diphosphomevalonate decarboxylase activity (GO:0004163)|Hsp70 protein binding (GO:0030544)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(1)|lung(7)|ovary(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.0478)		ATGGGCGGGAAGGTGTCGAGG	0.652																																					p.F271V		Atlas-SNP	.											.	MVD	27	.	0			c.T811G						.						263.0	197.0	219.0					16																	88721693		2188	4294	6482	SO:0001583	missense	4597	exon7			GCGGGAAGGTGTC	U49260	CCDS10968.1	16q24.3	2010-04-29			ENSG00000167508	ENSG00000167508	4.1.1.33		7529	protein-coding gene	gene with protein product	"""mevalonate pyrophosphate decarboxylase"""	603236				8626466	Standard	NM_002461		Approved	MPD	uc002flg.1	P53602	OTTHUMG00000137865	ENST00000301012.3:c.811T>G	chr16.hg19:g.88721693A>C	ENSP00000301012:p.Phe271Val	53.0	0.0		56.0	11.0	NM_002461	Q53Y65	Missense_Mutation	SNP	ENST00000301012.3	hg19	CCDS10968.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.87|13.87	2.365789|2.365789	0.41902|0.41902	.|.	.|.	ENSG00000167508|ENSG00000167508	ENST00000301012|ENST00000378400	T|.	0.29655|.	1.56|.	4.53|4.53	4.53|4.53	0.55603|0.55603	.|.	0.056069|.	0.64402|.	D|.	0.000001|.	T|T	0.65523|0.65523	0.2699|0.2699	L|L	0.54323|0.54323	1.7|1.7	0.52501|0.52501	D|D	0.999953|0.999953	B|.	0.22346|.	0.068|.	B|.	0.19391|.	0.025|.	T|T	0.69235|0.69235	-0.5198|-0.5198	10|6	0.49607|0.66056	T|D	0.09|0.02	-16.2233|-16.2233	14.1603|14.1603	0.65443|0.65443	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	271|.	P53602|.	MVD1_HUMAN|.	V|R	271|99	ENSP00000301012:F271V|.	ENSP00000301012:F271V|ENSP00000367653:L99R	F|L	-|-	1|2	0|0	MVD|MVD	87249194|87249194	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.823000|0.823000	0.46562|0.46562	6.475000|6.475000	0.73582|0.73582	1.821000|1.821000	0.53095|0.53095	0.402000|0.402000	0.26972|0.26972	TTC|CTT	.	.		0.652	MVD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269547.2	NM_002461	
CDRT1	374286	hgsc.bcm.edu	37	17	15516062	15516062	+	Missense_Mutation	SNP	C	C	A	rs151267443	byFrequency	TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr17:15516062C>A	ENST00000395906.3	-	5	1074	c.1075G>T	c.(1075-1077)Ggg>Tgg	p.G359W	RP11-385D13.1_ENST00000455584.2_Missense_Mutation_p.G669W	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	359								p.G359W(2)		endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		ATGCTCTTCCCGTCATCTACC	0.428																																					p.G359W		Atlas-SNP	.											.	CDRT1	83	.	2	Substitution - Missense(2)	lung(2)	c.G1075T						.						168.0	170.0	169.0					17																	15516062		2203	4300	6503	SO:0001583	missense	374286	exon5			TCTTCCCGTCATC	U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.1075G>T	chr17.hg19:g.15516062C>A	ENSP00000379242:p.Gly359Trp	88.0	0.0		76.0	13.0	NM_006382	O43848|O95611	Missense_Mutation	SNP	ENST00000395906.3	hg19	CCDS45619.1	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681572	0.47991	.	.	ENSG00000251537	ENST00000261644;ENST00000395906	T	0.16324	2.35	5.34	4.36	0.52297	F-box domain, Skp2-like (1);	0.396565	0.17829	U	0.160581	T	0.41119	0.1145	M	0.72894	2.215	0.37324	D	0.909667	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.956	T	0.48692	-0.9013	10	0.87932	D	0	.	13.139	0.59424	0.1613:0.8387:0.0:0.0	.	359;683	O95170;Q59EB2	CDRT1_HUMAN;.	W	389;359	ENSP00000379242:G359W	ENSP00000261644:G389W	G	-	1	0	RP11-385D13.1	15456787	0.003000	0.15002	0.034000	0.17996	0.002000	0.02628	1.214000	0.32419	1.238000	0.43771	-0.324000	0.08512	GGG	.	C|0.998;T|0.002		0.428	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448127.1	NM_006382	
TOP3A	7156	hgsc.bcm.edu	37	17	18193904	18193904	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr17:18193904C>G	ENST00000321105.5	-	13	1778	c.1564G>C	c.(1564-1566)Gac>Cac	p.D522H	TOP3A_ENST00000540524.1_Missense_Mutation_p.D52H|TOP3A_ENST00000542570.1_Missense_Mutation_p.D427H	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	522					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						GCAATGAGGTCGGCCTCGGTG	0.567																																					p.D522H		Atlas-SNP	.											.	TOP3A	85	.	0			c.G1564C						.						77.0	57.0	64.0					17																	18193904		2203	4300	6503	SO:0001583	missense	7156	exon13			TGAGGTCGGCCTC	U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.1564G>C	chr17.hg19:g.18193904C>G	ENSP00000321636:p.Asp522His	45.0	0.0		61.0	8.0	NM_004618	A8KA61|B4DK80|D3DXC7|Q13473	Missense_Mutation	SNP	ENST00000321105.5	hg19	CCDS11194.1	.	.	.	.	.	.	.	.	.	.	C	17.32	3.358811	0.61403	.	.	ENSG00000177302	ENST00000321105;ENST00000540524;ENST00000542570	T;T;T	0.23552	1.9;1.9;1.9	5.66	5.66	0.87406	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);DNA topoisomerase, type IA, central region, subdomain 1 (1);	0.000000	0.85682	D	0.000000	T	0.64605	0.2613	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.74034	-0.3794	10	0.87932	D	0	-35.4812	19.7417	0.96234	0.0:1.0:0.0:0.0	.	427;522	B4DK80;Q13472	.;TOP3A_HUMAN	H	522;52;427	ENSP00000321636:D522H;ENSP00000446425:D52H;ENSP00000442336:D427H	ENSP00000321636:D522H	D	-	1	0	TOP3A	18134629	1.000000	0.71417	0.975000	0.42487	0.992000	0.81027	7.745000	0.85046	2.667000	0.90743	0.563000	0.77884	GAC	.	.		0.567	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132052.2		
KRT26	353288	hgsc.bcm.edu	37	17	38926350	38926350	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr17:38926350C>A	ENST00000335552.4	-	4	754	c.706G>T	c.(706-708)Gct>Tct	p.A236S		NM_181539.4	NP_853517.2			keratin 26											central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(5)	16		Breast(137;0.00526)				TTCCCCCCAGCTGTATATTGC	0.478																																					p.A236S		Atlas-SNP	.											.	KRT26	49	.	0			c.G706T						.						132.0	125.0	127.0					17																	38926350		2203	4300	6503	SO:0001583	missense	353288	exon4			CCCCAGCTGTATA	AJ564205	CCDS11374.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000186393	ENSG00000186393		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30840	protein-coding gene	gene with protein product			"""keratin 25B"""	KRT25B		16831889	Standard	NM_181539		Approved		uc002hvf.3	Q7Z3Y9	OTTHUMG00000133370	ENST00000335552.4:c.706G>T	chr17.hg19:g.38926350C>A	ENSP00000334798:p.Ala236Ser	81.0	0.0		70.0	17.0	NM_181539		Missense_Mutation	SNP	ENST00000335552.4	hg19	CCDS11374.1	.	.	.	.	.	.	.	.	.	.	C	3.138	-0.176925	0.06380	.	.	ENSG00000186393	ENST00000335552	D	0.88741	-2.42	5.02	2.93	0.34026	Filament (1);	0.213952	0.32836	N	0.005596	T	0.78773	0.4336	N	0.21617	0.685	0.09310	N	1	B	0.13594	0.008	B	0.21360	0.034	T	0.61222	-0.7106	10	0.18710	T	0.47	.	8.6284	0.33904	0.3295:0.5949:0.0:0.0756	.	236	Q7Z3Y9	K1C26_HUMAN	S	236	ENSP00000334798:A236S	ENSP00000334798:A236S	A	-	1	0	KRT26	36179876	0.000000	0.05858	0.004000	0.12327	0.311000	0.27955	-1.112000	0.03299	0.506000	0.28125	0.655000	0.94253	GCT	.	.		0.478	KRT26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257215.1	NM_181539	
KPNB1	3837	hgsc.bcm.edu	37	17	45752005	45752005	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr17:45752005A>G	ENST00000290158.4	+	15	2176	c.1769A>G	c.(1768-1770)aAt>aGt	p.N590S	KPNB1_ENST00000537679.1_Splice_Site_p.N374S|KPNB1_ENST00000535458.2_Splice_Site_p.N445S|KPNB1_ENST00000540627.1_Splice_Site_p.N445S	NM_001276453.1|NM_002265.4	NP_001263382.1|NP_002256.2	Q14974	IMB1_HUMAN	karyopherin (importin) beta 1	590					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cytokine-mediated signaling pathway (GO:0019221)|intracellular transport of virus (GO:0075733)|NLS-bearing protein import into nucleus (GO:0006607)|protein import into nucleus (GO:0006606)|protein import into nucleus, translocation (GO:0000060)|ribosomal protein import into nucleus (GO:0006610)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum tubular network (GO:0071782)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|ovary(1)|pancreas(1)|skin(1)	4						ATTTCACAGAATGTTCTTCGG	0.398																																					p.D590G		Atlas-SNP	.											.	KPNB1	58	.	0			c.A1769G						.						153.0	146.0	149.0					17																	45752005		2203	4300	6503	SO:0001630	splice_region_variant	3837	exon15			CACAGAATGTTCT	L39793	CCDS11513.1, CCDS62228.1	17q21.32	2013-02-14			ENSG00000108424	ENSG00000108424		"""Importins"", ""Armadillo repeat containing"""	6400	protein-coding gene	gene with protein product	"""importin 1"""	602738				7615630, 7627554	Standard	NM_002265		Approved	NTF97, IPOB, MGC2155, MGC2156, MGC2157, IMB1, Impnb, IPO1	uc002ilt.2	Q14974	OTTHUMG00000036957	ENST00000290158.4:c.1768-1A>G	chr17.hg19:g.45752005A>G		50.0	0.0		46.0	7.0	NM_002265	B7ZAV6|D3DTT3|Q14637|Q53XN2|Q96J27	Missense_Mutation	SNP	ENST00000290158.4	hg19	CCDS11513.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.621702	0.46736	.	.	ENSG00000108424	ENST00000535458;ENST00000290158;ENST00000540627;ENST00000537679	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.13	5.13	0.70059	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.25827	0.0629	N	0.00104	-2.125	0.37095	D	0.899642	B;B	0.11235	0.004;0.0	B;B	0.04013	0.001;0.0	T	0.46247	-0.9205	9	0.06494	T	0.89	-22.0706	15.2502	0.73539	1.0:0.0:0.0:0.0	.	374;590	F5H4R7;Q14974	.;IMB1_HUMAN	S	445;590;445;374	ENSP00000438253:N445S;ENSP00000290158:N590S;ENSP00000438964:N445S;ENSP00000445006:N374S	ENSP00000290158:N590S	N	+	2	0	KPNB1	43107004	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.287000	0.95975	2.072000	0.62099	0.459000	0.35465	AAT	.	.		0.398	KPNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089755.2	NM_002265	Missense_Mutation
COX11	1353	hgsc.bcm.edu	37	17	53040188	53040188	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr17:53040188T>G	ENST00000299335.3	-	4	875	c.737A>C	c.(736-738)gAt>gCt	p.D246A	COX11_ENST00000573912.1_5'Flank	NM_004375.3	NP_004366.1	Q9Y6N1	COX11_HUMAN	cytochrome c oxidase assembly homolog 11 (yeast)	246					hydrogen ion transmembrane transport (GO:1902600)|negative regulation of glucokinase activity (GO:0033132)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)|electron carrier activity (GO:0009055)			endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|prostate(1)	9						CATTCTTGGATCTTCAGCAAA	0.363																																					p.D246A		Atlas-SNP	.											.	COX11	16	.	0			c.A737C						.						99.0	96.0	97.0					17																	53040188		2203	4300	6503	SO:0001583	missense	1353	exon4			CTTGGATCTTCAG	AF044321	CCDS11583.1, CCDS58579.1	17q22	2012-10-15	2012-10-15			ENSG00000166260		"""Mitochondrial respiratory chain complex assembly factors"""	2261	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit 11"", ""cytochrome c oxidase assembly protein COX11"""	603648	"""COX11 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX11 cytochrome c oxidase assembly homolog (yeast)"""			9878253	Standard	NM_004375		Approved	COX11P	uc010wng.1	Q9Y6N1		ENST00000299335.3:c.737A>C	chr17.hg19:g.53040188T>G	ENSP00000299335:p.Asp246Ala	197.0	0.0		187.0	29.0	NM_004375	D3DTY5|I3L220|Q6FHB7|Q9BRX0|Q9UME8	Missense_Mutation	SNP	ENST00000299335.3	hg19	CCDS11583.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.499842	0.85176	.	.	ENSG00000166260	ENST00000299335	T	0.64085	-0.08	5.33	5.33	0.75918	Cytochrome c oxidase assembly protein CtaG/Cox11, domain (2);	0.000000	0.85682	D	0.000000	T	0.79885	0.4523	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83017	-0.0169	9	0.87932	D	0	1.766	14.7737	0.69699	0.0:0.0:0.0:1.0	.	246	Q9Y6N1	COX11_HUMAN	A	246	ENSP00000299335:D246A	ENSP00000299335:D246A	D	-	2	0	COX11	50395187	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.941000	0.87700	2.134000	0.65973	0.528000	0.53228	GAT	.	.		0.363	COX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439182.1	NM_004375	
KPNA2	3838	hgsc.bcm.edu	37	17	66040111	66040111	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr17:66040111C>G	ENST00000537025.2	+	8	1708	c.1088C>G	c.(1087-1089)aCa>aGa	p.T363R	KPNA2_ENST00000330459.3_Missense_Mutation_p.T363R			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	363	NLS binding site (minor). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCAAACATCACAGCCGGCCGC	0.478																																					p.T363R		Atlas-SNP	.											.	KPNA2	55	.	0			c.C1088G						.						194.0	201.0	199.0					17																	66040111		2203	4296	6499	SO:0001583	missense	3838	exon8			ACATCACAGCCGG	U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.1088C>G	chr17.hg19:g.66040111C>G	ENSP00000438483:p.Thr363Arg	243.0	0.0		330.0	148.0	NM_002266	B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	ENST00000537025.2	hg19	CCDS32713.1	.	.	.	.	.	.	.	.	.	.	C	18.74	3.687997	0.68271	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	T;T	0.71341	-0.56;-0.56	5.51	5.51	0.81932	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	D	0.90167	0.6927	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93148	0.6547	10	0.87932	D	0	.	19.4797	0.95005	0.0:1.0:0.0:0.0	.	363	P52292	IMA2_HUMAN	R	363	ENSP00000332455:T363R;ENSP00000438483:T363R	ENSP00000332455:T363R	T	+	2	0	KPNA2	63470573	1.000000	0.71417	0.988000	0.46212	0.052000	0.14988	7.680000	0.84062	2.591000	0.87537	0.552000	0.68991	ACA	.	.		0.478	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448111.1	NM_002266	
MEX3D	399664	hgsc.bcm.edu	37	19	1555353	1555353	+	3'UTR	SNP	A	A	C	rs200558166		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:1555353A>C	ENST00000402693.4	-	0	2164				AC027307.1_ENST00000410788.1_RNA|MEX3D_ENST00000388824.6_Missense_Mutation_p.S660A|AC027307.2_ENST00000581992.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D						mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAAGGGCTGAGGCGCCGCCG	0.572																																					p.S660A		Atlas-SNP	.											.	MEX3D	11	.	0			c.T1978G						.						34.0	40.0	38.0					19																	1555353		2200	4298	6498	SO:0001624	3_prime_UTR_variant	399664	exon3			GGGCTGAGGCGCC	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.*209T>G	chr19.hg19:g.1555353A>C		194.0	0.0		214.0	12.0	NM_001174118	A0PJL8|A1L023|E9PAL6|Q71M49	Missense_Mutation	SNP	ENST00000402693.4	hg19	CCDS32865.2	.	.	.	.	.	.	.	.	.	.	A	10.78	1.446194	0.25987	.	.	ENSG00000181588	ENST00000388824	T	0.43688	0.94	4.76	-1.8	0.07907	.	.	.	.	.	T	0.28566	0.0707	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.30060	-0.9991	7	0.87932	D	0	.	5.5486	0.17078	0.2983:0.0:0.3212:0.3805	.	.	.	.	A	660	ENSP00000373476:S660A	ENSP00000373476:S660A	S	-	1	0	MEX3D	1506353	0.021000	0.18746	0.000000	0.03702	0.094000	0.18550	-0.100000	0.10990	-0.953000	0.03645	-0.421000	0.06004	TCA	.	A|0.998;C|0.002		0.572	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317870.2	NM_203304	
MEX3D	399664	hgsc.bcm.edu	37	19	1555356	1555356	+	3'UTR	SNP	C	C	G	rs201107400		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:1555356C>G	ENST00000402693.4	-	0	2161				AC027307.1_ENST00000410788.1_RNA|MEX3D_ENST00000388824.6_Missense_Mutation_p.A659P|AC027307.2_ENST00000581992.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D						mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGGCTGAGGCGCCGCCGGGC	0.572																																					p.A659P		Atlas-SNP	.											.	MEX3D	11	.	0			c.G1975C						.						34.0	40.0	38.0					19																	1555356		2201	4298	6499	SO:0001624	3_prime_UTR_variant	399664	exon3			CTGAGGCGCCGCC	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.*206G>C	chr19.hg19:g.1555356C>G		187.0	0.0		208.0	13.0	NM_001174118	A0PJL8|A1L023|E9PAL6|Q71M49	Missense_Mutation	SNP	ENST00000402693.4	hg19	CCDS32865.2	.	.	.	.	.	.	.	.	.	.	C	14.35	2.509474	0.44660	.	.	ENSG00000181588	ENST00000388824	T	0.49139	0.79	4.61	-3.83	0.04269	.	.	.	.	.	T	0.21468	0.0517	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.25398	-1.0133	7	0.87932	D	0	.	0.8792	0.01230	0.1882:0.1562:0.2369:0.4187	.	.	.	.	P	659	ENSP00000373476:A659P	ENSP00000373476:A659P	A	-	1	0	MEX3D	1506356	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-0.809000	0.04510	-0.209000	0.10156	-0.373000	0.07131	GCC	.	C|0.998;G|0.002		0.572	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317870.2	NM_203304	
MEX3D	399664	hgsc.bcm.edu	37	19	1555358	1555358	+	3'UTR	SNP	C	C	T	rs202194196		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:1555358C>T	ENST00000402693.4	-	0	2159				AC027307.1_ENST00000410788.1_RNA|MEX3D_ENST00000388824.6_Missense_Mutation_p.G658D|AC027307.2_ENST00000581992.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D						mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCTGAGGCGCCGCCGGGCTG	0.572													C|||	1	0.000199681	0.0	0.0	5008	,	,		6241	0.0		0.0	False		,,,				2504	0.001				p.G658D		Atlas-SNP	.											.	MEX3D	11	.	0			c.G1973A						.						33.0	39.0	37.0					19																	1555358		2201	4298	6499	SO:0001624	3_prime_UTR_variant	399664	exon3			GAGGCGCCGCCGG	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.*204G>A	chr19.hg19:g.1555358C>T		181.0	0.0		205.0	13.0	NM_001174118	A0PJL8|A1L023|E9PAL6|Q71M49	Missense_Mutation	SNP	ENST00000402693.4	hg19	CCDS32865.2	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339416	0.41398	.	.	ENSG00000181588	ENST00000388824	T	0.46063	0.88	4.61	-0.27	0.12926	.	.	.	.	.	T	0.29126	0.0724	N	0.22421	0.69	0.09310	N	1	.	.	.	.	.	.	T	0.30149	-0.9988	7	0.87932	D	0	.	5.1147	0.14829	0.0:0.4785:0.2795:0.242	.	.	.	.	D	658	ENSP00000373476:G658D	ENSP00000373476:G658D	G	-	2	0	MEX3D	1506358	0.000000	0.05858	0.000000	0.03702	0.164000	0.22412	0.441000	0.21611	-0.174000	0.10743	0.478000	0.44815	GGC	.	C|0.998;T|0.002		0.572	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317870.2	NM_203304	
MEX3D	399664	hgsc.bcm.edu	37	19	1555360	1555360	+	3'UTR	SNP	G	G	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:1555360G>T	ENST00000402693.4	-	0	2157				AC027307.1_ENST00000410788.1_RNA|MEX3D_ENST00000388824.6_Silent_p.G657G|AC027307.2_ENST00000581992.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D						mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGAGGCGCCGCCGGGCTGCG	0.577																																					p.G657G		Atlas-SNP	.											.	MEX3D	11	.	0			c.C1971A						.						32.0	38.0	36.0					19																	1555360		2201	4298	6499	SO:0001624	3_prime_UTR_variant	399664	exon3			GGCGCCGCCGGGC	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.*202C>A	chr19.hg19:g.1555360G>T		173.0	0.0		202.0	13.0	NM_001174118	A0PJL8|A1L023|E9PAL6|Q71M49	Silent	SNP	ENST00000402693.4	hg19	CCDS32865.2																																																																																			.	.		0.577	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317870.2	NM_203304	
MEX3D	399664	hgsc.bcm.edu	37	19	1555380	1555380	+	3'UTR	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:1555380T>G	ENST00000402693.4	-	0	2137				AC027307.1_ENST00000410788.1_RNA|MEX3D_ENST00000388824.6_Missense_Mutation_p.T651P|AC027307.2_ENST00000581992.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D						mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGGTCTCCGTCTCCACGCCT	0.637																																					p.T651P		Atlas-SNP	.											MEX3D,NS,carcinoma,0,1	MEX3D	11	.	0			c.A1951C						.						32.0	37.0	35.0					19																	1555380		2200	4299	6499	SO:0001624	3_prime_UTR_variant	399664	exon3			TCTCCGTCTCCAC	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.*182A>C	chr19.hg19:g.1555380T>G		140.0	0.0		189.0	38.0	NM_001174118	A0PJL8|A1L023|E9PAL6|Q71M49	Missense_Mutation	SNP	ENST00000402693.4	hg19	CCDS32865.2	.	.	.	.	.	.	.	.	.	.	T	15.51	2.855272	0.51376	.	.	ENSG00000181588	ENST00000388824	T	0.45668	0.89	4.61	-1.13	0.09775	.	0.296636	0.32987	U	0.005411	T	0.24084	0.0583	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.31888	-0.9927	8	0.87932	D	0	.	10.6308	0.45534	0.0:0.6741:0.0:0.3259	.	.	.	.	P	651	ENSP00000373476:T651P	ENSP00000373476:T651P	T	-	1	0	MEX3D	1506380	0.000000	0.05858	0.022000	0.16811	0.447000	0.32167	-0.028000	0.12350	-0.060000	0.13132	0.454000	0.30748	ACG	.	.		0.637	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317870.2	NM_203304	
C3	718	hgsc.bcm.edu	37	19	6713480	6713480	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:6713480T>C	ENST00000245907.6	-	8	906	c.814A>G	c.(814-816)Atc>Gtc	p.I272V		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	272					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	ATCCCGAAGATGACAAAGGCA	0.572																																					p.I272V		Atlas-SNP	.											.	C3	192	.	0			c.A814G						.						107.0	93.0	97.0					19																	6713480		2203	4300	6503	SO:0001583	missense	718	exon8			CGAAGATGACAAA	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.814A>G	chr19.hg19:g.6713480T>C	ENSP00000245907:p.Ile272Val	80.0	0.0		90.0	10.0	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	hg19	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	T	3.914	-0.019583	0.07634	.	.	ENSG00000125730	ENST00000245907	T	0.29917	1.55	4.59	2.22	0.28083	.	0.282477	0.36519	N	0.002560	T	0.18718	0.0449	L	0.36672	1.1	0.24807	N	0.992661	B	0.14805	0.011	B	0.17722	0.019	T	0.23013	-1.0200	10	0.12766	T	0.61	.	6.315	0.21186	0.0:0.0945:0.4861:0.4194	.	272	P01024	CO3_HUMAN	V	272	ENSP00000245907:I272V	ENSP00000245907:I272V	I	-	1	0	C3	6664480	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	2.066000	0.41452	0.681000	0.31386	0.397000	0.26171	ATC	.	.		0.572	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
PPAN	56342	hgsc.bcm.edu	37	19	10218695	10218695	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:10218695A>T	ENST00000253107.7	+	5	504	c.398A>T	c.(397-399)cAg>cTg	p.Q133L	PPAN-P2RY11_ENST00000428358.1_Missense_Mutation_p.Q133L|PPAN_ENST00000393793.1_Missense_Mutation_p.Q80L|PPAN-P2RY11_ENST00000393796.4_Missense_Mutation_p.Q133L|SNORD105_ENST00000386910.1_RNA|SNORD105B_ENST00000458770.1_RNA|PPAN_ENST00000556468.1_Missense_Mutation_p.Q133L	NM_020230.5	NP_064615.3	Q9NQ55	SSF1_HUMAN	peter pan homolog (Drosophila)	133	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|liver(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	15			OV - Ovarian serous cystadenocarcinoma(20;2.19e-08)|Epithelial(33;1.76e-05)|all cancers(31;3.54e-05)			ATGCACGAGCAGCAGTTTGCC	0.602																																					p.Q133L		Atlas-SNP	.											.	PPAN	43	.	0			c.A398T						.						139.0	102.0	114.0					19																	10218695		2203	4300	6503	SO:0001583	missense	56342	exon5			ACGAGCAGCAGTT	BC033202	CCDS12225.1	19p13.2	2008-02-05	2001-11-28		ENSG00000130810	ENSG00000130810			9227	protein-coding gene	gene with protein product		607793	"""peter pan (Drosophila) homolog"""			10873382	Standard	NM_020230		Approved	SSF1, SSF2, SSF, BXDC3		Q9NQ55	OTTHUMG00000156826	ENST00000253107.7:c.398A>T	chr19.hg19:g.10218695A>T	ENSP00000253107:p.Gln133Leu	80.0	0.0		103.0	22.0	NM_020230	C9J3F9|Q9BW97|Q9H170	Missense_Mutation	SNP	ENST00000253107.7	hg19	CCDS12225.1	.	.	.	.	.	.	.	.	.	.	A	29.9	5.043611	0.93685	.	.	ENSG00000243207;ENSG00000243207;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810;ENSG00000130810	ENST00000428358;ENST00000393796;ENST00000253107;ENST00000556468;ENST00000342696;ENST00000393793;ENST00000446223;ENST00000430370	T;T;T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09;1.09;1.09	5.5	5.5	0.81552	Brix domain (3);	.	.	.	.	T	0.54303	0.1850	L	0.60455	1.87	0.58432	D	0.999999	D;D;D	0.58970	0.984;0.967;0.967	P;P;P	0.57204	0.815;0.702;0.702	T	0.51988	-0.8635	9	0.35671	T	0.21	-46.803	14.5666	0.68182	1.0:0.0:0.0:0.0	.	133;133;133	C9J3F9;C9JW41;Q9NQ55	.;.;SSF1_HUMAN	L	133;133;133;133;133;80;71;71	ENSP00000411918:Q133L;ENSP00000377385:Q133L;ENSP00000253107:Q133L;ENSP00000450710:Q133L;ENSP00000377382:Q80L;ENSP00000410485:Q71L;ENSP00000415988:Q71L	ENSP00000253107:Q133L	Q	+	2	0	PPAN;PPAN-P2RY11	10079695	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.643000	0.91040	2.089000	0.63090	0.459000	0.35465	CAG	.	.		0.602	PPAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316658.1	NM_020230	
ZNF763	284390	hgsc.bcm.edu	37	19	12089392	12089392	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:12089392A>G	ENST00000358987.3	+	4	780	c.653A>G	c.(652-654)cAt>cGt	p.H218R	ZNF763_ENST00000538752.1_Missense_Mutation_p.H238R|ZNF763_ENST00000343949.5_Missense_Mutation_p.H221R|ZNF763_ENST00000590798.1_Missense_Mutation_p.H238R|ZNF763_ENST00000545530.1_Missense_Mutation_p.H96R			Q0D2J5	ZN763_HUMAN	zinc finger protein 763	218					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)	15						TATCTTATCCATGAAAGAACT	0.388																																					p.H221R		Atlas-SNP	.											.	ZNF763	31	.	0			c.A662G						.						83.0	85.0	84.0					19																	12089392		2203	4300	6503	SO:0001583	missense	284390	exon4			TTATCCATGAAAG	AK092240	CCDS45982.1	19p13.2	2014-02-12	2006-08-14		ENSG00000197054	ENSG00000197054		"""Zinc fingers, C2H2-type"", ""-"""	27614	protein-coding gene	gene with protein product							Standard	NM_001012753		Approved	ZNF440L		Q0D2J5	OTTHUMG00000156430	ENST00000358987.3:c.653A>G	chr19.hg19:g.12089392A>G	ENSP00000402017:p.His218Arg	129.0	0.0		143.0	38.0	NM_001012753	B3KRU3|B4DRE7	Missense_Mutation	SNP	ENST00000358987.3	hg19		.	.	.	.	.	.	.	.	.	.	a	11.27	1.590610	0.28357	.	.	ENSG00000197054	ENST00000538752;ENST00000343949;ENST00000545530;ENST00000358987	D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18	0.149	0.149	0.14863	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94453	0.8215	H	0.95982	3.75	0.09310	N	0.999999	D;D;D	0.89917	0.992;1.0;0.978	D;D;P	0.83275	0.954;0.996;0.731	D	0.85306	0.1076	8	0.87932	D	0	.	.	.	.	.	238;218;221	F5H0A9;Q0D2J5;Q0D2J5-2	.;ZN763_HUMAN;.	R	238;221;96;218	ENSP00000438117:H238R;ENSP00000369774:H221R;ENSP00000446166:H96R;ENSP00000402017:H218R	ENSP00000369774:H221R	H	+	2	0	ZNF763	11950392	0.952000	0.32445	0.002000	0.10522	0.276000	0.26787	4.282000	0.58971	0.166000	0.19597	0.164000	0.16699	CAT	.	.		0.388	ZNF763-002	KNOWN	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000344158.1	NM_001012753	
ZNF563	147837	hgsc.bcm.edu	37	19	12430381	12430381	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:12430381T>C	ENST00000293725.5	-	4	663	c.458A>G	c.(457-459)cAt>cGt	p.H153R	ZNF563_ENST00000595977.1_Missense_Mutation_p.H153R	NM_145276.2	NP_660319.1	Q8TA94	ZN563_HUMAN	zinc finger protein 563	153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20						AAAGGAGTGATGGTAACTGAA	0.448																																					p.H153R	GBM(39;623 795 5132 29510 31476)	Atlas-SNP	.											.	ZNF563	77	.	0			c.A458G						.						335.0	282.0	300.0					19																	12430381		2203	4300	6503	SO:0001583	missense	147837	exon4			GAGTGATGGTAAC	BC022523	CCDS12270.1	19p13.2	2013-09-20			ENSG00000188868	ENSG00000188868		"""Zinc fingers, C2H2-type"", ""-"""	30498	protein-coding gene	gene with protein product							Standard	NM_145276		Approved	FLJ34797	uc002mtp.3	Q8TA94	OTTHUMG00000156413	ENST00000293725.5:c.458A>G	chr19.hg19:g.12430381T>C	ENSP00000293725:p.His153Arg	105.0	0.0		122.0	23.0	NM_145276	B2R9E7|Q8NAT7	Missense_Mutation	SNP	ENST00000293725.5	hg19	CCDS12270.1	.	.	.	.	.	.	.	.	.	.	T	0.477	-0.881713	0.02530	.	.	ENSG00000188868	ENST00000293725;ENST00000318168	T	0.14022	2.54	1.0	-2.0	0.07433	.	.	.	.	.	T	0.04407	0.0121	N	0.03948	-0.315	0.09310	N	1	B;B	0.17038	0.02;0.009	B;B	0.18561	0.009;0.022	T	0.42103	-0.9471	9	0.19590	T	0.45	.	3.1614	0.06521	0.2437:0.0:0.1951:0.5612	.	153;153	Q8TA94-2;Q8TA94	.;ZN563_HUMAN	R	153	ENSP00000293725:H153R	ENSP00000293725:H153R	H	-	2	0	ZNF563	12291381	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	-2.930000	0.00689	-0.816000	0.04340	0.260000	0.18958	CAT	.	.		0.448	ZNF563-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344114.1	NM_145276	
ATP13A1	57130	hgsc.bcm.edu	37	19	19767906	19767906	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:19767906A>C	ENST00000357324.6	-	5	829	c.803T>G	c.(802-804)tTt>tGt	p.F268C	ATP13A1_ENST00000291503.5_Missense_Mutation_p.F150C|ATP13A1_ENST00000496082.1_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	268						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGATAGCGTAAAGACGCTGTA	0.587																																					p.F268C	Esophageal Squamous(142;920 1789 9047 14684 24777)	Atlas-SNP	.											.	ATP13A1	82	.	0			c.T803G						.						47.0	43.0	45.0					19																	19767906		2203	4300	6503	SO:0001583	missense	57130	exon5			AGCGTAAAGACGC	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.803T>G	chr19.hg19:g.19767906A>C	ENSP00000349877:p.Phe268Cys	47.0	0.0		53.0	4.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	hg19	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	A	19.50	3.838616	0.71373	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	D;D	0.89123	-2.47;-2.47	4.89	4.89	0.63831	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.92401	0.7588	H	0.95539	3.685	0.80722	D	1	P;P	0.47841	0.901;0.734	P;B	0.45276	0.475;0.382	D	0.92139	0.5719	10	0.27785	T	0.31	-38.5603	12.456	0.55704	1.0:0.0:0.0:0.0	.	268;150	Q9HD20;Q9HD20-2	AT131_HUMAN;.	C	150;268	ENSP00000291503:F150C;ENSP00000349877:F268C	ENSP00000291503:F150C	F	-	2	0	ATP13A1	19628906	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	8.877000	0.92386	1.847000	0.53656	0.383000	0.25322	TTT	.	.		0.587	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
ZNF85	7639	hgsc.bcm.edu	37	19	21132307	21132307	+	Silent	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:21132307T>C	ENST00000328178.8	+	4	1100	c.987T>C	c.(985-987)ctT>ctC	p.L329L	ZNF85_ENST00000601023.1_Silent_p.L270L|ZNF85_ENST00000345030.6_Silent_p.L296L	NM_001256173.1|NM_003429.4	NP_001243102.1|NP_003420.2	Q03923	ZNF85_HUMAN	zinc finger protein 85	329					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)	20						CCTCAAACCTTACTACACATA	0.383																																					p.L359L		Atlas-SNP	.											.	ZNF85	72	.	0			c.T1077C						.						44.0	49.0	47.0					19																	21132307		2201	4297	6498	SO:0001819	synonymous_variant	7639	exon5			AAACCTTACTACA	U35376	CCDS32977.1, CCDS58657.1	19p12	2013-01-08	2006-05-12			ENSG00000105750		"""Zinc fingers, C2H2-type"", ""-"""	13160	protein-coding gene	gene with protein product		603899	"""zinc finger protein 85 (HPF4, HTF1)"""			2505992	Standard	NM_003429		Approved	HPF4, HTF1	uc031rjx.1	Q03923		ENST00000328178.8:c.987T>C	chr19.hg19:g.21132307T>C		99.0	0.0		82.0	32.0	NM_001256171	B9ZVP4|Q6NVI0	Silent	SNP	ENST00000328178.8	hg19	CCDS32977.1																																																																																			.	.		0.383	ZNF85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463430.1	NM_003429	
TGFB1	7040	hgsc.bcm.edu	37	19	41850715	41850715	+	Missense_Mutation	SNP	C	C	T	rs201383660		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:41850715C>T	ENST00000221930.5	-	3	1437	c.571G>A	c.(571-573)Gac>Aac	p.D191N		NM_000660.4	NP_000651.3	P01137	TGFB1_HUMAN	transforming growth factor, beta 1	191	Arm domain. {ECO:0000250}.				active induction of host immune response by virus (GO:0046732)|adaptive immune response based on somatic recombination of immune receptors built from immunoglobulin superfamily domains (GO:0002460)|aging (GO:0007568)|ATP biosynthetic process (GO:0006754)|blood coagulation (GO:0007596)|branch elongation involved in mammary gland duct branching (GO:0060751)|cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cell-cell junction organization (GO:0045216)|cellular calcium ion homeostasis (GO:0006874)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|chondrocyte differentiation (GO:0002062)|common-partner SMAD protein phosphorylation (GO:0007182)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|defense response to fungus, incompatible interaction (GO:0009817)|digestive tract development (GO:0048565)|embryo development (GO:0009790)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|evasion or tolerance of host defenses by virus (GO:0019049)|extracellular matrix assembly (GO:0085029)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway (GO:0097191)|face morphogenesis (GO:0060325)|female pregnancy (GO:0007565)|frontal suture morphogenesis (GO:0060364)|germ cell migration (GO:0008354)|hematopoietic progenitor cell differentiation (GO:0002244)|hyaluronan catabolic process (GO:0030214)|inflammatory response (GO:0006954)|inner ear development (GO:0048839)|lens fiber cell differentiation (GO:0070306)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lymph node development (GO:0048535)|macrophage derived foam cell differentiation (GO:0010742)|mammary gland branching involved in thelarche (GO:0060744)|MAPK cascade (GO:0000165)|mitotic cell cycle checkpoint (GO:0007093)|modulation by virus of host morphology or physiology (GO:0019048)|mononuclear cell proliferation (GO:0032943)|myelination (GO:0042552)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of DNA replication (GO:0008156)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of extracellular matrix disassembly (GO:0010716)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gene expression (GO:0010629)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of immune response (GO:0050777)|negative regulation of macrophage cytokine production (GO:0010936)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of ossification (GO:0030279)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|ossification involved in bone remodeling (GO:0043932)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|phosphate-containing compound metabolic process (GO:0006796)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of bone mineralization (GO:0030501)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of exit from mitosis (GO:0031536)|positive regulation of extracellular matrix assembly (GO:1901203)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of isotype switching to IgA isotypes (GO:0048298)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NAD+ ADP-ribosyltransferase activity (GO:1901666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of odontogenesis (GO:0042482)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein secretion (GO:0050714)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein export from nucleus (GO:0006611)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|receptor catabolic process (GO:0032801)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of binding (GO:0051098)|regulation of blood vessel remodeling (GO:0060312)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of cartilage development (GO:0061035)|regulation of cell migration (GO:0030334)|regulation of DNA binding (GO:0051101)|regulation of miRNA metabolic process (GO:2000628)|regulation of protein import into nucleus (GO:0042306)|regulation of sodium ion transport (GO:0002028)|regulation of striated muscle tissue development (GO:0016202)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulatory T cell differentiation (GO:0045066)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to laminar fluid shear stress (GO:0034616)|response to progesterone (GO:0032570)|response to radiation (GO:0009314)|response to vitamin D (GO:0033280)|response to wounding (GO:0009611)|salivary gland morphogenesis (GO:0007435)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|T cell homeostasis (GO:0043029)|tolerance induction to self antigen (GO:0002513)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|viral life cycle (GO:0019058)	axon (GO:0030424)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	antigen binding (GO:0003823)|cytokine activity (GO:0005125)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|type II transforming growth factor beta receptor binding (GO:0005114)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)	8					Hyaluronidase(DB00070)	TCTGGCGAGTCGCTGGGTGCC	0.547																																					p.D191N		Atlas-SNP	.											.	TGFB1	27	.	0			c.G571A						.						94.0	64.0	74.0					19																	41850715		2203	4300	6503	SO:0001583	missense	7040	exon3			GCGAGTCGCTGGG	X02812	CCDS33031.1	19q13.1	2014-01-30	2007-02-16			ENSG00000105329		"""Endogenous ligands"""	11766	protein-coding gene	gene with protein product	"""Camurati-Engelmann disease"", ""prepro-transforming growth factor beta-1"""	190180		TGFB, DPD1		10631145, 10843814	Standard	NM_000660		Approved	CED, TGFbeta	uc002oqh.2	P01137		ENST00000221930.5:c.571G>A	chr19.hg19:g.41850715C>T	ENSP00000221930:p.Asp191Asn	89.0	0.0		86.0	14.0	NM_000660	A8K792|Q9UCG4	Missense_Mutation	SNP	ENST00000221930.5	hg19	CCDS33031.1	.	.	.	.	.	.	.	.	.	.	C	10.20	1.283437	0.23392	.	.	ENSG00000105329	ENST00000221930	T	0.64803	-0.12	5.44	2.02	0.26589	Transforming growth factor-beta, N-terminal (1);	0.834073	0.11189	N	0.590129	T	0.45756	0.1358	L	0.38531	1.155	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.25916	-1.0118	10	0.20046	T	0.44	-18.7748	5.0438	0.14473	0.0:0.6264:0.1859:0.1877	.	191	P01137	TGFB1_HUMAN	N	191	ENSP00000221930:D191N	ENSP00000221930:D191N	D	-	1	0	TGFB1	46542555	0.020000	0.18652	0.172000	0.22920	0.901000	0.52897	1.240000	0.32731	0.870000	0.35726	0.655000	0.94253	GAC	.	.		0.547	TGFB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463500.2		
CEACAM4	1089	hgsc.bcm.edu	37	19	42128109	42128109	+	Missense_Mutation	SNP	C	C	T	rs368076616		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:42128109C>T	ENST00000221954.2	-	3	567	c.457G>A	c.(457-459)Gtc>Atc	p.V153I	CEACAM4_ENST00000600925.1_Missense_Mutation_p.V153I	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	153						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						ATGCCAGCGACGGCCCCCACA	0.587																																					p.V153I		Atlas-SNP	.											CEACAM4,NS,carcinoma,0,1	CEACAM4	42	.	0			c.G457A						.	C	ILE/VAL	0,4406		0,0,2203	62.0	56.0	58.0		457	1.0	0.0	19		58	1,8599	1.2+/-3.3	0,1,4299	no	missense	CEACAM4	NM_001817.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	153/245	42128109	1,13005	2203	4300	6503	SO:0001583	missense	1089	exon3			CAGCGACGGCCCC	D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.457G>A	chr19.hg19:g.42128109C>T	ENSP00000221954:p.Val153Ile	219.0	0.0		167.0	67.0	NM_001817	Q03715|Q7LDZ7	Missense_Mutation	SNP	ENST00000221954.2	hg19	CCDS33033.1	.	.	.	.	.	.	.	.	.	.	C	0.036	-1.304766	0.01353	0.0	1.16E-4	ENSG00000105352	ENST00000221954	T	0.00882	5.58	3.29	1.02	0.19986	.	.	.	.	.	T	0.00440	0.0014	N	0.03209	-0.39	0.09310	N	1	B;B	0.16802	0.019;0.007	B;B	0.06405	0.002;0.002	T	0.45205	-0.9277	9	0.02654	T	1	.	2.686	0.05107	0.2243:0.1383:0.0:0.6374	.	153;153	E7EMX3;O75871	.;CEAM4_HUMAN	I	153	ENSP00000221954:V153I	ENSP00000221954:V153I	V	-	1	0	CEACAM4	46819949	0.009000	0.17119	0.000000	0.03702	0.078000	0.17371	-0.163000	0.09997	-0.080000	0.12685	-0.436000	0.05848	GTC	.	.		0.587	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321148.1	NM_001817	
SYMPK	8189	hgsc.bcm.edu	37	19	46326692	46326692	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:46326692G>C	ENST00000245934.7	-	20	2882	c.2638C>G	c.(2638-2640)Ctc>Gtc	p.L880V	SYMPK_ENST00000598155.1_5'UTR	NM_004819.2	NP_004810.2	Q92797	SYMPK_HUMAN	symplekin	880					cell adhesion (GO:0007155)|mRNA polyadenylation (GO:0006378)|positive regulation of protein dephosphorylation (GO:0035307)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(25)|ovary(1)|urinary_tract(1)	45		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		TTGTGGTAGAGATCCCGGACC	0.637																																					p.L880V		Atlas-SNP	.											.	SYMPK	104	.	0			c.C2638G						.						73.0	67.0	69.0					19																	46326692		2203	4300	6503	SO:0001583	missense	8189	exon20			GGTAGAGATCCCG	U49240	CCDS12676.2	19q13.3	2008-02-05			ENSG00000125755	ENSG00000125755			22935	protein-coding gene	gene with protein product		602388				9330635	Standard	NM_004819		Approved	SYM, SPK	uc002pdn.3	Q92797	OTTHUMG00000150151	ENST00000245934.7:c.2638C>G	chr19.hg19:g.46326692G>C	ENSP00000245934:p.Leu880Val	75.0	0.0		50.0	13.0	NM_004819	O00521|O00689|O00733|Q59GT5|Q8N2U5	Missense_Mutation	SNP	ENST00000245934.7	hg19	CCDS12676.2	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789002	0.90367	.	.	ENSG00000125755	ENST00000245934	T	0.68765	-0.35	4.67	4.67	0.58626	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.81997	0.4941	M	0.84683	2.71	0.80722	D	1	D;D	0.71674	0.998;0.974	D;P	0.65010	0.931;0.829	D	0.85471	0.1173	10	0.87932	D	0	.	15.1866	0.73006	0.0:0.0:1.0:0.0	.	895;880	Q4LE61;Q92797	.;SYMPK_HUMAN	V	880	ENSP00000245934:L880V	ENSP00000245934:L880V	L	-	1	0	SYMPK	51018532	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.061000	0.76699	2.425000	0.82216	0.650000	0.86243	CTC	.	.		0.637	SYMPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316581.1	NM_004819	
ZNF837	116412	hgsc.bcm.edu	37	19	58879429	58879429	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:58879429C>A	ENST00000427624.2	-	3	1593	c.1271G>T	c.(1270-1272)tGc>tTc	p.C424F	CTD-2619J13.3_ENST00000599889.1_RNA|ZNF837_ENST00000597582.1_Missense_Mutation_p.C424F			Q96EG3	ZN837_HUMAN	zinc finger protein 837	424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|skin(1)	2						GGCCTTTTCGCACAGTGGGCA	0.687																																					p.C424F		Atlas-SNP	.											.	ZNF837	16	.	0			c.G1271T						.						17.0	18.0	18.0					19																	58879429		691	1590	2281	SO:0001583	missense	116412	exon3			TTTTCGCACAGTG	BC012365	CCDS46216.1	19q13.43	2013-01-08			ENSG00000152475	ENSG00000152475		"""Zinc fingers, C2H2-type"""	25164	protein-coding gene	gene with protein product						12477932	Standard	NM_138466		Approved		uc002qsl.4	Q96EG3		ENST00000427624.2:c.1271G>T	chr19.hg19:g.58879429C>A	ENSP00000405699:p.Cys424Phe	31.0	0.0		34.0	15.0	NM_138466		Missense_Mutation	SNP	ENST00000427624.2	hg19	CCDS46216.1	.	.	.	.	.	.	.	.	.	.	C	14.11	2.437646	0.43224	.	.	ENSG00000152475	ENST00000427624	D	0.85861	-2.04	0.97	0.97	0.19692	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93585	0.7952	H	0.96398	3.815	0.33044	D	0.531823	D	0.89917	1.0	D	0.80764	0.994	D	0.93007	0.6428	9	0.87932	D	0	.	9.4431	0.38681	0.0:1.0:0.0:0.0	.	424	Q96EG3	ZN837_HUMAN	F	424	ENSP00000405699:C424F	ENSP00000405699:C424F	C	-	2	0	ZNF837	63571241	1.000000	0.71417	0.881000	0.34555	0.260000	0.26232	5.778000	0.68940	0.819000	0.34492	0.467000	0.42956	TGC	.	.		0.687	ZNF837-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466962.1	NM_138466	
SIGLEC1	6614	hgsc.bcm.edu	37	20	3675089	3675089	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr20:3675089G>A	ENST00000344754.4	-	12	3034	c.3035C>T	c.(3034-3036)cCg>cTg	p.P1012L	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.P1012L	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1012	Ig-like C2-type 10.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CAGCTGGGCCGGAGGGTCACT	0.667																																					p.P1012L		Atlas-SNP	.											.	SIGLEC1	210	.	0			c.C3035T						.																																			SO:0001583	missense	6614	exon12			TGGGCCGGAGGGT	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3035C>T	chr20.hg19:g.3675089G>A	ENSP00000341141:p.Pro1012Leu	70.0	0.0		127.0	12.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	hg19	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427799	0.25726	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.67171	-0.25;-0.25	5.15	1.63	0.23807	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.213642	0.24559	N	0.037499	T	0.56247	0.1972	L	0.57536	1.79	0.33991	D	0.649081	B;B	0.15719	0.014;0.011	B;B	0.16289	0.015;0.012	T	0.58165	-0.7684	10	0.42905	T	0.14	.	5.7965	0.18389	0.1798:0.0:0.6326:0.1876	.	1012;1012	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	L	1012	ENSP00000341141:P1012L;ENSP00000202578:P1012L	ENSP00000202578:P1012L	P	-	2	0	SIGLEC1	3623089	0.005000	0.15991	0.846000	0.33378	0.819000	0.46315	0.135000	0.15952	0.690000	0.31570	0.561000	0.74099	CCG	.	.		0.667	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
PCK1	5105	hgsc.bcm.edu	37	20	56138214	56138214	+	Silent	SNP	T	T	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr20:56138214T>G	ENST00000319441.4	+	5	905	c.741T>G	c.(739-741)gcT>gcG	p.A247A	PCK1_ENST00000543666.1_Intron|PCK1_ENST00000535860.1_Silent_p.A115A	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	247					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			AGTGCTTTGCTCTCAGGATGG	0.632																																					p.A247A		Atlas-SNP	.											.	PCK1	95	.	0			c.T741G						.						58.0	66.0	63.0					20																	56138214		2203	4300	6503	SO:0001819	synonymous_variant	5105	exon5			CTTTGCTCTCAGG		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.741T>G	chr20.hg19:g.56138214T>G		60.0	0.0		76.0	38.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Silent	SNP	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	.		0.632	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
KRTAP24-1	643803	hgsc.bcm.edu	37	21	31654629	31654629	+	Missense_Mutation	SNP	A	A	T	rs529683700		TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr21:31654629A>T	ENST00000340345.4	-	1	647	c.622T>A	c.(622-624)Tat>Aat	p.Y208N		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	208	6 X 10 AA repeats of Y-[ILR]-[SVPC]- [NRTS]-[SNTG]-X-[QHRP]-[PSY]-[QSL]-[SRK].					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						GAATAGTGATAATTTCTCACT	0.423																																					p.Y208N		Atlas-SNP	.											.	KRTAP24-1	44	.	0			c.T622A						.						107.0	103.0	104.0					21																	31654629		1860	4097	5957	SO:0001583	missense	643803	exon1			AGTGATAATTTCT	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.622T>A	chr21.hg19:g.31654629A>T	ENSP00000339238:p.Tyr208Asn	97.0	0.0		55.0	11.0	NM_001085455	Q1XDX0	Missense_Mutation	SNP	ENST00000340345.4	hg19	CCDS42915.1	.	.	.	.	.	.	.	.	.	.	A	4.532	0.098691	0.08681	.	.	ENSG00000188694	ENST00000340345	T	0.30981	1.51	4.45	1.94	0.25998	.	0.863754	0.10047	N	0.722667	T	0.17408	0.0418	N	0.19112	0.55	0.09310	N	1	B	0.26775	0.159	B	0.19391	0.025	T	0.22661	-1.0210	10	0.45353	T	0.12	0.6461	4.6313	0.12502	0.6986:0.1954:0.1059:0.0	.	208	Q3LI83	KR241_HUMAN	N	208	ENSP00000339238:Y208N	ENSP00000339238:Y208N	Y	-	1	0	KRTAP24-1	30576500	0.000000	0.05858	0.136000	0.22124	0.005000	0.04900	0.277000	0.18734	0.267000	0.21916	0.460000	0.39030	TAT	.	.		0.423	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	NM_001085455	
URB1	9875	hgsc.bcm.edu	37	21	33705673	33705673	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr21:33705673T>C	ENST00000382751.3	-	30	5028	c.4913A>G	c.(4912-4914)tAt>tGt	p.Y1638C	URB1_ENST00000492603.1_5'Flank	NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	1638						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						GCAGGGGTCATAGAGGCCATC	0.483																																					p.Y1638C		Atlas-SNP	.											.	URB1	176	.	0			c.A4913G						.						118.0	107.0	110.0					21																	33705673		692	1591	2283	SO:0001583	missense	9875	exon30			GGGTCATAGAGGC	AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.4913A>G	chr21.hg19:g.33705673T>C	ENSP00000372199:p.Tyr1638Cys	77.0	0.0		54.0	14.0	NM_014825	D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	ENST00000382751.3	hg19	CCDS46645.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.255707	0.80135	.	.	ENSG00000142207	ENST00000382751	T	0.29917	1.55	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.60818	0.2298	M	0.87682	2.9	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68398	-0.5419	10	0.87932	D	0	-14.7225	14.1771	0.65549	0.0:0.0:0.0:1.0	.	1638	O60287	NPA1P_HUMAN	C	1638	ENSP00000372199:Y1638C	ENSP00000372199:Y1638C	Y	-	2	0	URB1	32627544	1.000000	0.71417	0.124000	0.21820	0.209000	0.24338	6.533000	0.73829	2.143000	0.66587	0.533000	0.62120	TAT	.	.		0.483	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139400.2		
SDF2L1	23753	hgsc.bcm.edu	37	22	21996797	21996797	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr22:21996797A>G	ENST00000248958.4	+	1	248	c.172A>G	c.(172-174)Atc>Gtc	p.I58V	KB-1440D3.14_ENST00000609038.1_lincRNA	NM_022044.2	NP_071327.2	Q9HCN8	SDF2L_HUMAN	stromal cell-derived factor 2-like 1	58	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.					endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				prostate(1)	1	Colorectal(54;0.105)					CTCGCACGACATCAAATACGG	0.682																																					p.I58V		Atlas-SNP	.											.	SDF2L1	5	.	0			c.A172G						.						16.0	13.0	14.0					22																	21996797		2018	3910	5928	SO:0001583	missense	23753	exon1			CACGACATCAAAT		CCDS13792.1	22q11.21	2008-07-01			ENSG00000128228	ENSG00000128228			10676	protein-coding gene	gene with protein product	"""dihydropyrimidinase-like 2"", ""PWP1-interacting protein 8"""	607551				10591208, 11162531	Standard	NM_022044		Approved	AP000553.C22.4, OTTHUMT00000075032	uc002zvf.3	Q9HCN8	OTTHUMG00000150820	ENST00000248958.4:c.172A>G	chr22.hg19:g.21996797A>G	ENSP00000248958:p.Ile58Val	100.0	0.0		71.0	15.0	NM_022044	A2RUD3|Q9BRI5	Missense_Mutation	SNP	ENST00000248958.4	hg19	CCDS13792.1	.	.	.	.	.	.	.	.	.	.	A	8.244	0.807527	0.16467	.	.	ENSG00000128228	ENST00000248958	D	0.83755	-1.76	4.86	2.75	0.32379	MIR motif (2);MIR (2);	0.112881	0.64402	N	0.000014	T	0.41003	0.1140	N	0.00175	-1.925	0.36896	D	0.890171	B	0.12013	0.005	B	0.10450	0.005	T	0.53479	-0.8433	10	0.02654	T	1	-18.3334	5.6446	0.17582	0.7134:0.0:0.2866:0.0	.	58	Q9HCN8	SDF2L_HUMAN	V	58	ENSP00000248958:I58V	ENSP00000248958:I58V	I	+	1	0	SDF2L1	20326797	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.637000	0.67854	0.989000	0.38761	0.533000	0.62120	ATC	.	.		0.682	SDF2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320197.1	NM_022044	
TFIP11	24144	hgsc.bcm.edu	37	22	26902861	26902861	+	Silent	SNP	G	G	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr22:26902861G>A	ENST00000407690.1	-	5	526	c.243C>T	c.(241-243)atC>atT	p.I81I	TFIP11_ENST00000407431.1_Silent_p.I81I|TFIP11_ENST00000496523.1_5'Flank|TFIP11_ENST00000407148.1_Silent_p.I81I|TFIP11_ENST00000405938.1_Silent_p.I81I	NM_012143.2	NP_036275.1	Q9UBB9	TFP11_HUMAN	tuftelin interacting protein 11	81					biomineral tissue development (GO:0031214)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|spliceosomal complex disassembly (GO:0000390)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|proteinaceous extracellular matrix (GO:0005578)|spliceosomal complex (GO:0005681)|U2-type post-mRNA release spliceosomal complex (GO:0071008)	DNA binding (GO:0003677)			breast(1)|endometrium(5)|kidney(2)|large_intestine(5)|liver(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25						GCCCTGCGCTGATGAAGTTGA	0.517																																					p.I81I		Atlas-SNP	.											.	TFIP11	72	.	0			c.C243T						.						66.0	62.0	63.0					22																	26902861		2203	4300	6503	SO:0001819	synonymous_variant	24144	exon6			TGCGCTGATGAAG	AL050258	CCDS13838.1	22q12.1	2013-01-28			ENSG00000100109	ENSG00000100109		"""G patch domain containing"""	17165	protein-coding gene	gene with protein product		612747				10806191, 11230166	Standard	NM_012143		Approved	TIP39, DKFZP434B194, Spp382	uc003acs.2	Q9UBB9	OTTHUMG00000150883	ENST00000407690.1:c.243C>T	chr22.hg19:g.26902861G>A		79.0	0.0		54.0	16.0	NM_001008697	O95908|Q20WL0|Q5H8V8|Q9UGV7|Q9Y2Q8	Silent	SNP	ENST00000407690.1	hg19	CCDS13838.1																																																																																			.	.		0.517	TFIP11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320750.1	NM_001008697	
DEPDC5	9681	hgsc.bcm.edu	37	22	32215183	32215183	+	Silent	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr22:32215183A>G	ENST00000382112.3	+	21	1912	c.1842A>G	c.(1840-1842)agA>agG	p.R614R	DEPDC5_ENST00000536766.1_Silent_p.R586R|DEPDC5_ENST00000400248.2_Silent_p.R614R|DEPDC5_ENST00000400246.1_Silent_p.R614R|DEPDC5_ENST00000535622.1_Silent_p.R614R|DEPDC5_ENST00000266091.3_Silent_p.R614R|DEPDC5_ENST00000382105.2_Silent_p.R614R|DEPDC5_ENST00000400249.2_Silent_p.R614R|DEPDC5_ENST00000382111.2_Silent_p.R614R	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	614					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CGTCCAACAGAAGGCGCTGGA	0.547																																					p.R614R		Atlas-SNP	.											.	DEPDC5	266	.	0			c.A1842G						.						117.0	115.0	116.0					22																	32215183		2020	4183	6203	SO:0001819	synonymous_variant	9681	exon22			CAACAGAAGGCGC	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.1842A>G	chr22.hg19:g.32215183A>G		86.0	0.0		45.0	8.0	NM_001242897	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Silent	SNP	ENST00000382112.3	hg19	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	A	11.24	1.581064	0.28180	.	.	ENSG00000100150	ENST00000433147	.	.	.	5.8	1.29	0.21616	.	.	.	.	.	T	0.53658	0.1810	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41680	-0.9495	4	.	.	.	.	6.4357	0.21821	0.3923:0.2331:0.3746:0.0	.	.	.	.	E	12	.	.	K	+	1	0	DEPDC5	30545183	0.983000	0.35010	1.000000	0.80357	0.992000	0.81027	0.274000	0.18680	0.147000	0.19030	0.533000	0.62120	AAG	.	.		0.547	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
PNPLA5	150379	hgsc.bcm.edu	37	22	44282314	44282314	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr22:44282314G>A	ENST00000597664.1	-	6	947	c.818C>T	c.(817-819)cCg>cTg	p.P273L	PNPLA5_ENST00000593866.1_Missense_Mutation_p.P159L|PNPLA5_ENST00000381198.2_Missense_Mutation_p.P159L|PNPLA5_ENST00000216177.4_Missense_Mutation_p.P273L			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	273					lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				TCCGTCAGCCGGGGCTGGGGG	0.587																																					p.P273L		Atlas-SNP	.											.	PNPLA5	46	.	0			c.C818T						.						80.0	74.0	76.0					22																	44282314		2203	4300	6503	SO:0001583	missense	150379	exon6			TCAGCCGGGGCTG	Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.818C>T	chr22.hg19:g.44282314G>A	ENSP00000471069:p.Pro273Leu	53.0	0.0		43.0	12.0	NM_138814	B1AHL8|B3KPR1|Q6ZST0	Missense_Mutation	SNP	ENST00000597664.1	hg19		.	.	.	.	.	.	.	.	.	.	G	10.92	1.487901	0.26686	.	.	ENSG00000100341	ENST00000216177;ENST00000381198;ENST00000438734	T;T;T	0.76186	-1.0;0.95;1.68	4.43	0.925	0.19424	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.554792	0.15658	N	0.251022	T	0.45617	0.1351	N	0.16743	0.435	0.09310	N	1	P;P;B	0.37141	0.499;0.584;0.066	B;B;B	0.25405	0.06;0.054;0.006	T	0.27297	-1.0078	10	0.26408	T	0.33	-10.5946	2.9635	0.05900	0.2343:0.0:0.5467:0.219	.	181;159;273	E9PGS4;Q7Z6Z6-2;Q7Z6Z6	.;.;PLPL5_HUMAN	L	273;159;181	ENSP00000216177:P273L;ENSP00000370595:P159L;ENSP00000405732:P181L	ENSP00000216177:P273L	P	-	2	0	PNPLA5	42613647	0.022000	0.18835	0.003000	0.11579	0.065000	0.16274	0.823000	0.27366	0.580000	0.29522	0.491000	0.48974	CCG	.	.		0.587	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000075667.4	NM_138814	
GLRA2	2742	hgsc.bcm.edu	37	X	14550455	14550455	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chrX:14550455A>T	ENST00000218075.4	+	2	693	c.163A>T	c.(163-165)Aca>Tca	p.T55S	GLRA2_ENST00000443437.2_5'UTR|GLRA2_ENST00000355020.4_Missense_Mutation_p.T55S	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	55					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	AATGGGAAGGACATCAGGATA	0.398																																					p.T55S		Atlas-SNP	.											.	GLRA2	140	.	0			c.A163T						.						125.0	119.0	121.0					X																	14550455		2203	4300	6503	SO:0001583	missense	2742	exon3			GGAAGGACATCAG		CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.163A>T	chrX.hg19:g.14550455A>T	ENSP00000218075:p.Thr55Ser	246.0	0.0		168.0	81.0	NM_001118885	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	ENST00000218075.4	hg19	CCDS14160.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.764386	0.49574	.	.	ENSG00000101958	ENST00000218075;ENST00000355020;ENST00000415367	T;T;T	0.80123	-1.34;-1.34;0.44	5.08	5.08	0.68730	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.76983	0.4064	N	0.03281	-0.365	0.80722	D	1	D;P;B	0.55800	0.973;0.941;0.082	P;D;B	0.71414	0.887;0.973;0.098	T	0.82760	-0.0298	10	0.62326	D	0.03	.	13.2275	0.59922	1.0:0.0:0.0:0.0	.	39;55;55	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	S	55;55;39	ENSP00000218075:T55S;ENSP00000347123:T55S;ENSP00000391606:T39S	ENSP00000218075:T55S	T	+	1	0	GLRA2	14460376	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.276000	0.65580	1.785000	0.52413	0.481000	0.45027	ACA	.	.		0.398	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055829.1		
MED12	9968	hgsc.bcm.edu	37	X	70352248	70352248	+	Silent	SNP	A	A	G			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chrX:70352248A>G	ENST00000374080.3	+	31	4307	c.4275A>G	c.(4273-4275)gtA>gtG	p.V1425V	MED12_ENST00000374102.1_Silent_p.V1425V|MED12_ENST00000333646.6_Silent_p.V1425V			Q93074	MED12_HUMAN	mediator complex subunit 12	1425					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GCTCTGGTGTATGGCTGGTGG	0.562			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																														p.V1425V		Atlas-SNP	.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	.	0			c.A4275G						.						66.0	61.0	62.0					X																	70352248		2000	4154	6154	SO:0001819	synonymous_variant	9968	exon31			TGGTGTATGGCTG	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4275A>G	chrX.hg19:g.70352248A>G		77.0	0.0		78.0	22.0	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	ENST00000374080.3	hg19	CCDS43970.1																																																																																			.	.		0.562	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
ATRX	546	hgsc.bcm.edu	37	X	76776919	76776919	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chrX:76776919C>T	ENST00000373344.5	-	33	7247	c.7033G>A	c.(7033-7035)Gtg>Atg	p.V2345M	ATRX_ENST00000395603.3_Missense_Mutation_p.V2307M|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	2345					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TGAATCCTCACTGCTGTCACA	0.398			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.V2345M		Atlas-SNP	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	0			c.G7033A						.						183.0	150.0	161.0					X																	76776919		2203	4296	6499	SO:0001583	missense	546	exon33			TCCTCACTGCTGT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.7033G>A	chrX.hg19:g.76776919C>T	ENSP00000362441:p.Val2345Met	62.0	0.0		19.0	9.0	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	hg19	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	C	9.694	1.152651	0.21371	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.92858	-3.11;-3.12	5.06	5.06	0.68205	.	0.178870	0.38548	N	0.001644	D	0.86669	0.5988	N	0.02539	-0.55	0.80722	D	1	P;P	0.47677	0.899;0.493	P;B	0.51355	0.667;0.107	D	0.89768	0.3952	10	0.44086	T	0.13	.	17.6044	0.88034	0.0:1.0:0.0:0.0	.	2307;2345	P46100-4;P46100	.;ATRX_HUMAN	M	2345;2307	ENSP00000362441:V2345M;ENSP00000378967:V2307M	ENSP00000362441:V2345M	V	-	1	0	ATRX	76663575	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.453000	0.44970	2.086000	0.62901	0.513000	0.50165	GTG	.	.		0.398	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
FMR1	2332	hgsc.bcm.edu	37	X	147011692	147011692	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chrX:147011692A>T	ENST00000370475.4	+	7	687	c.559A>T	c.(559-561)Atg>Ttg	p.M187L	FMR1_ENST00000334557.6_Missense_Mutation_p.M187L|FMR1_ENST00000218200.8_Missense_Mutation_p.M187L|FMR1_ENST00000440235.2_5'Flank|FMR1_ENST00000439526.2_Missense_Mutation_p.M187L|FMR1_ENST00000370471.3_Missense_Mutation_p.M187L|FMR1_ENST00000370470.1_Missense_Mutation_p.M187L|FMR1_ENST00000370477.1_Missense_Mutation_p.M187L	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	187					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					GCTGATTGACATGCACTTTCG	0.398									Fragile X syndrome																												p.M187L		Atlas-SNP	.											.	FMR1	93	.	0			c.A559T						.						145.0	120.0	128.0					X																	147011692		2203	4300	6503	SO:0001583	missense	2332	exon7	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	ATTGACATGCACT	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.559A>T	chrX.hg19:g.147011692A>T	ENSP00000359506:p.Met187Leu	90.0	0.0		51.0	19.0	NM_002024	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	ENST00000370475.4	hg19	CCDS14682.1	.	.	.	.	.	.	.	.	.	.	A	16.51	3.142381	0.57044	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.57752	1.12;0.38;1.16;1.13;1.46;1.16;1.18	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.69611	0.3130	M	0.80982	2.52	0.80722	D	1	B;B;B;D;P	0.58620	0.009;0.131;0.131;0.983;0.858	B;B;B;P;P	0.59357	0.026;0.106;0.121;0.841;0.856	T	0.73480	-0.3969	10	0.52906	T	0.07	-32.1723	13.4918	0.61399	1.0:0.0:0.0:0.0	.	187;187;103;187;187	Q8IXW7;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	L	187	ENSP00000218200:M187L;ENSP00000359502:M187L;ENSP00000359508:M187L;ENSP00000359506:M187L;ENSP00000355115:M187L;ENSP00000395923:M187L;ENSP00000359501:M187L	ENSP00000218200:M187L	M	+	1	0	FMR1	146819384	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.162000	0.94745	1.850000	0.53721	0.486000	0.48141	ATG	.	.		0.398	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058655.1	NM_002024	
NOVA1	4857	hgsc.bcm.edu	37	14	26917256	26917256	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:26917256delG	ENST00000539517.2	-	5	1750	c.1433delC	c.(1432-1434)ccafs	p.P478fs	NOVA1_ENST00000465357.2_Frame_Shift_Del_p.P454fs|NOVA1_ENST00000267422.7_Frame_Shift_Del_p.P356fs	NM_002515.2	NP_002506.2	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	481	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		TGTTGCAGCTGGTGTTCCAGT	0.473																																					p.P478fs		Atlas-INDEL	.											.	NOVA1	146	.	0			c.1434delA						.						153.0	130.0	138.0					14																	26917256		2203	4300	6503	SO:0001589	frameshift_variant	4857	exon5			.	U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000539517.2:c.1433delC	chr14.hg19:g.26917256delG	ENSP00000438875:p.Pro478fs	146.0	0.0		219.0	27.0	NM_002515	A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Frame_Shift_Del	DEL	ENST00000539517.2	hg19	CCDS32061.1																																																																																			.	.		0.473	NOVA1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000073261.3	NM_006491	
MICALL2	79778	hgsc.bcm.edu	37	7	1479677	1479694	+	In_Frame_Del	DEL	GCCCTCGGCTCTGCCAGG	GCCCTCGGCTCTGCCAGG	-	rs375638403|rs143197912	byFrequency	TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	GCCCTCGGCTCTGCCAGG	GCCCTCGGCTCTGCCAGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr7:1479677_1479694delGCCCTCGGCTCTGCCAGG	ENST00000297508.7	-	9	2008_2025	c.1833_1850delCCTGGCAGAGCCGAGGGC	c.(1831-1851)gccctggcagagccgagggcg>gcg	p.611_617ALAEPRA>A	MICALL2_ENST00000471899.1_5'Flank|MICALL2_ENST00000405088.4_In_Frame_Del_p.399_405ALAEPRA>A	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	611	Mediates targeting to the cell plasma membrane. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)	p.P615L(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGCCTCCCCCGCCCTCGGCTCTGCCAGGGCCCGTGGTT	0.697																																					p.612_617del		Atlas-INDEL	.											.	MICALL2	63	.	1	Substitution - Missense(1)	breast(1)	c.1834_1851del						.																																			SO:0001651	inframe_deletion	79778	exon9			.	BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1833_1850delCCTGGCAGAGCCGAGGGC	chr7.hg19:g.1479677_1479694delGCCCTCGGCTCTGCCAGG	ENSP00000297508:p.Ala611_Arg616del	133.0	0.0		130.0	29.0	NM_182924	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	In_Frame_Del	DEL	ENST00000297508.7	hg19	CCDS5324.1																																																																																			.	.		0.697	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239223.2	NM_182924	
ZBTB12	221527	hgsc.bcm.edu	37	6	31868471	31868472	+	In_Frame_Ins	INS	-	-	TCCTCA			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:31868471_31868472insTCCTCA	ENST00000375527.2	-	2	786_787	c.611_612insTGAGGA	c.(610-612)gac>gaTGAGGAc	p.204_204D>DED	C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						TGTCAGACACGTCCTCATCCTC	0.614																																					p.D204delinsDED		Atlas-INDEL	.											.	ZBTB12	25	.	0			c.612_613insTGAGGA						.																																			SO:0001652	inframe_insertion	221527	exon2			.	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.606_611dupTGAGGA	chr6.hg19:g.31868472_31868477dupTCCTCA	ENSP00000364677:p.GluAsp204dup	29.0	0.0		48.0	12.0	NM_181842	B0UY00|Q5JQ98	In_Frame_Ins	INS	ENST00000375527.2	hg19	CCDS4727.1																																																																																			.	.		0.614	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076315.2	NM_181842	
DNAH5	1767	hgsc.bcm.edu	37	5	13870897	13870898	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr5:13870897_13870898insA	ENST00000265104.4	-	24	3916_3917	c.3812_3813insT	c.(3811-3813)gacfs	p.D1271fs	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1271	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTACTTGAAAGTCAATGGAGAT	0.361									Kartagener syndrome																												p.D1271fs		Atlas-INDEL	.											.	DNAH5	868	.	0			c.3813_3814insT						.																																			SO:0001589	frameshift_variant	1767	exon24	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	.	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3812_3813insT	chr5.hg19:g.13870897_13870898insA	ENSP00000265104:p.Asp1271fs	78.0	0.0		113.0	13.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Frame_Shift_Ins	INS	ENST00000265104.4	hg19	CCDS3882.1																																																																																			.	.		0.361	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
TAF4B	6875	hgsc.bcm.edu	37	18	23872237	23872237	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr18:23872237delG	ENST00000269142.5	+	8	2616	c.1618delG	c.(1618-1620)gaafs	p.E540fs	TAF4B_ENST00000578121.1_Frame_Shift_Del_p.E545fs|TAF4B_ENST00000400466.2_Frame_Shift_Del_p.E540fs	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	540	Nuclear export signal.				gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			AGGAGGCAATGAAAAACAAGT	0.368																																					p.N539fs		Atlas-INDEL	.											.	TAF4B	71	.	0			c.1617delT						.						137.0	123.0	128.0					18																	23872237		1905	4135	6040	SO:0001589	frameshift_variant	6875	exon8			.	Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.1618delG	chr18.hg19:g.23872237delG	ENSP00000269142:p.Glu540fs	104.0	0.0		91.0	28.0	NM_005640	Q29YA4|Q29YA5	Frame_Shift_Del	DEL	ENST00000269142.5	hg19	CCDS42421.1																																																																																			.	.		0.368	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
PTPRK	5796	hgsc.bcm.edu	37	6	128540097	128540097	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr6:128540097delC	ENST00000368215.3	-	6	837	c.838delG	c.(838-840)gtgfs	p.V280fs	PTPRK_ENST00000532331.1_Frame_Shift_Del_p.V280fs|PTPRK_ENST00000368226.4_Frame_Shift_Del_p.V280fs|PTPRK_ENST00000368227.3_Frame_Shift_Del_p.V280fs|PTPRK_ENST00000368210.3_Frame_Shift_Del_p.V280fs|PTPRK_ENST00000524481.1_5'UTR|PTPRK_ENST00000368207.3_Frame_Shift_Del_p.V280fs|PTPRK_ENST00000368213.5_Frame_Shift_Del_p.V280fs			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	280	Ig-like C2-type.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		AAATTGGACACACCGGAACCT	0.398																																					p.V280fs		Atlas-INDEL	.											.	PTPRK	330	.	0			c.839delT						.						153.0	136.0	141.0					6																	128540097		2203	4300	6503	SO:0001589	frameshift_variant	5796	exon6			.	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.838delG	chr6.hg19:g.128540097delC	ENSP00000357198:p.Val280fs	125.0	0.0		64.0	22.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Frame_Shift_Del	DEL	ENST00000368215.3	hg19																																																																																				.	.		0.398	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493779	77493780	+	In_Frame_Ins	INS	-	-	TGCTGCTGT			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr14:77493779_77493780insTGCTGCTGT	ENST00000238647.3	-	1	1254_1255	c.356_357insACAGCAGCA	c.(355-357)cag>caACAGCAGCAg	p.119_119Q>QQQQ		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	119	Poly-Gln.				development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						gctgctgctgctgctgctgctg	0.693																																					p.Q119delinsQQQQ		Atlas-INDEL	.											.	IRF2BPL	40	.	0			c.357_358insACAGCAGCA						.																																			SO:0001652	inframe_insertion	64207	exon1			.	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.356_357insACAGCAGCA	chr14.hg19:g.77493779_77493780insTGCTGCTGT	ENSP00000238647:p.GlnGlnGln125dup	29.0	0.0		70.0	46.0	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	In_Frame_Ins	INS	ENST00000238647.3	hg19	CCDS9854.1																																																																																			.	CTG|1.000;|0.000		0.693	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
B3GALNT2	148789	hgsc.bcm.edu	37	1	235617616	235617628	+	Splice_Site	DEL	TTCAGTCTGAAAC	TTCAGTCTGAAAC	-			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	TTCAGTCTGAAAC	TTCAGTCTGAAAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr1:235617616_235617628delTTCAGTCTGAAAC	ENST00000366600.3	-	10	1380_1391	c.1152_1163delGTTTCAGACTGAA	c.(1150-1164)aagtttcagactgaa>aaa	p.FQTE385fs		NM_152490.2	NP_689703.1	Q8NCR0	B3GL2_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 2	385					protein glycosylation (GO:0006486)|protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|acetylglucosaminyltransferase activity (GO:0008375)|galactosyltransferase activity (GO:0008378)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	18	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.0539)|Prostate(94;0.0353)	OV - Ovarian serous cystadenocarcinoma(106;0.000117)			AACTGCCCAATTCAGTCTGAAACTGAGATGAAA	0.46																																					p.384_388del		Atlas-INDEL	.											.	B3GALNT2	36	.	0			c.1152_1164del						.																																			SO:0001630	splice_region_variant	148789	exon10			.	BC029564	CCDS1606.1, CCDS60453.1	1q42.3	2013-02-19	2006-06-14		ENSG00000162885	ENSG00000162885		"""Beta 3-glycosyltransferases"""	28596	protein-coding gene	gene with protein product		610194	"""UDP-GalNAc:betaGlcNAc beta-1,3-galactosaminyltransferase, polypeptide 2"""			14724282	Standard	NM_001277155		Approved	MGC39558	uc001hxc.3	Q8NCR0	OTTHUMG00000040468	ENST00000366600.3:c.1152-1GTTTCAGACTGAA>-	chr1.hg19:g.235617616_235617628delTTCAGTCTGAAAC		199.0	0.0		173.0	18.0	NM_152490	Q59GR3|Q5TCI3|Q96AL7	Frame_Shift_Del	DEL	ENST00000366600.3	hg19	CCDS1606.1																																																																																			.	.		0.460	B3GALNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097376.1	NM_152490	Frame_Shift_Del
TSHZ2	128553	hgsc.bcm.edu	37	20	51871290	51871292	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	GTT	GTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr20:51871290_51871292delGTT	ENST00000371497.5	+	2	2180_2182	c.1293_1295delGTT	c.(1291-1296)tcgttg>tcg	p.L432del	TSHZ2_ENST00000603338.2_In_Frame_Del_p.L429del|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_In_Frame_Del_p.L429del	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	432					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			AAATGCAGTCGTTGTCTGAGGCC	0.478																																					p.431_432del		Atlas-INDEL	.											TSHZ2,NS,carcinoma,+1,1	TSHZ2	209	.	0			c.1292_1294del						.																																			SO:0001651	inframe_deletion	128553	exon2			.	AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1293_1295delGTT	chr20.hg19:g.51871290_51871292delGTT	ENSP00000360552:p.Leu432del	130.0	0.0		155.0	15.0	NM_173485	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	In_Frame_Del	DEL	ENST00000371497.5	hg19	CCDS33490.1																																																																																			.	.		0.478	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080398.6	NM_173485	
MEX3D	399664	hgsc.bcm.edu	37	19	1555363	1555363	+	3'UTR	DEL	G	G	-	rs538833811	byFrequency	TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr19:1555363delG	ENST00000402693.4	-	0	2154				AC027307.1_ENST00000410788.1_RNA|MEX3D_ENST00000388824.6_Frame_Shift_Del_p.P656fs|AC027307.2_ENST00000581992.1_RNA	NM_203304.3	NP_976049.3	Q86XN8	MEX3D_HUMAN	mex-3 RNA binding family member D						mRNA destabilization (GO:0061157)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|lung(3)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGCGCCGCCGGGCTGCGGGG	0.577													GGG|GGG|GG|deletion	3	0.000599042	0.0	0.0	5008	,	,		6277	0.002		0.001	False		,,,				2504	0.0				p.G657fs		Atlas-INDEL	.											.	MEX3D	11	.	0			c.1969delG						.						31.0	37.0	35.0					19																	1555363		2201	4298	6499	SO:0001624	3_prime_UTR_variant	399664	exon3			.	AB107353	CCDS32865.2	19p13.3	2013-08-21	2013-08-21	2007-07-18	ENSG00000181588	ENSG00000181588		"""RING-type (C3HC4) zinc fingers"", ""Mex-3 homologs"""	16734	protein-coding gene	gene with protein product	"""bcl-2 ARE RNA binding protein"""	611009	"""ring finger and KH domain containing 1"", ""mex-3 homolog D (C. elegans)"""	RKHD1		17267406	Standard	NM_203304		Approved	Tino, KIAA2031, OK/SW-cl.4, RNF193	uc010dsn.3	Q86XN8	OTTHUMG00000150369	ENST00000402693.4:c.*199C>-	chr19.hg19:g.1555363delG		171.0	0.0		193.0	13.0	NM_001174118	A0PJL8|A1L023|E9PAL6|Q71M49	Frame_Shift_Del	DEL	ENST00000402693.4	hg19	CCDS32865.2																																																																																			.	.		0.577	MEX3D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317870.2	NM_203304	
NELFCD	51497	hgsc.bcm.edu	37	20	57569232	57569250	+	Frame_Shift_Del	DEL	ATGACAGCATCGCAGGTAC	ATGACAGCATCGCAGGTAC	-	rs150954057|rs188308685	byFrequency	TCGA-DD-AAE3-01A-11D-A40R-10	TCGA-DD-AAE3-10A-01D-A40U-10	ATGACAGCATCGCAGGTAC	ATGACAGCATCGCAGGTAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	56734b6f-386f-4da6-b5de-8321f1231570	a236100b-e8a3-4ffa-99db-6332dada6d98	g.chr20:57569232_57569250delATGACAGCATCGCAGGTAC	ENST00000344018.3	+	14	1703_1721	c.1676_1694delATGACAGCATCGCAGGTAC	c.(1675-1695)aatgacagcatcgcaggtaccfs	p.NDSIAGT559fs	NELFCD_ENST00000479207.1_3'UTR|NELFCD_ENST00000602795.1_Frame_Shift_Del_p.NDSIAGT568fs			Q8IXH7	NELFD_HUMAN	negative elongation factor complex member C/D	559					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	membrane (GO:0016020)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)											ATCCTGGAGAATGACAGCATCGCAGGTACCATCAAAACG	0.548																																					p.568_574del		Atlas-INDEL	.											.	.	.	.	0			c.1702_1720del						.																																			SO:0001589	frameshift_variant	51497	exon14			.	AF161479	CCDS13473.1, CCDS13473.2	20q13	2013-01-31	2013-01-31	2013-01-31	ENSG00000101158	ENSG00000101158			15934	protein-coding gene	gene with protein product	"""trihydrophobin 1"""	605297	"""TH1-like (Drosophila homolog)"", ""TH1-like (Drosophila)"""	TH1L		11030415, 11042152	Standard	NM_198976		Approved	HSPC130, TH1, NELF-C, NELF-D	uc002yag.4	Q8IXH7	OTTHUMG00000032861	ENST00000344018.3:c.1676_1694delATGACAGCATCGCAGGTAC	chr20.hg19:g.57569232_57569250delATGACAGCATCGCAGGTAC	ENSP00000342300:p.Asn559fs	97.0	0.0		138.0	13.0	NM_198976	B4DE06|Q9BYL2|Q9H405|Q9H888|Q9H8T3|Q9NVX5|Q9P029|Q9UGN1|Q9UGN2|Q9UGN3	Frame_Shift_Del	DEL	ENST00000344018.3	hg19																																																																																				.	.		0.548	NELFCD-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_198976	
