#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VWA1	64856	hgsc.bcm.edu	37	1	1372593	1372593	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:1372593C>T	ENST00000476993.1	+	2	438	c.360C>T	c.(358-360)gcC>gcT	p.A120A	VWA1_ENST00000338660.5_Intron|RP4-758J18.10_ENST00000417917.1_lincRNA|VWA1_ENST00000404702.3_Intron	NM_022834.4	NP_073745.2	Q6PCB0	VWA1_HUMAN	von Willebrand factor A domain containing 1	120	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				behavioral response to pain (GO:0048266)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interstitial matrix (GO:0005614)				NS(1)|breast(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;1.79e-36)|OV - Ovarian serous cystadenocarcinoma(86;3.94e-22)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGGTCTATGCCAAGGAACAGC	0.667																																					p.A120A		Atlas-SNP	.											.	VWA1	15	.	0			c.C360T						.						34.0	32.0	33.0					1																	1372593		2193	4287	6480	SO:0001819	synonymous_variant	64856	exon2			CTATGCCAAGGAA	BC059409	CCDS27.1, CCDS28.1, CCDS28.2	1p36.33	2013-02-11			ENSG00000179403	ENSG00000179403		"""Fibronectin type III domain containing"""	30910	protein-coding gene	gene with protein product		611901				14527666, 12062410	Standard	NM_022834		Approved	FLJ22215, VWA-1, WARP	uc001afs.3	Q6PCB0	OTTHUMG00000002975	ENST00000476993.1:c.360C>T	chr1.hg19:g.1372593C>T		106.0	0.0		90.0	53.0	NM_022834	A8K692|B3KUA1|E9PB53|Q7L5D7|Q9H6J5	Silent	SNP	ENST00000476993.1	hg19	CCDS27.1																																																																																			.	.		0.667	VWA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008291.1	NM_022834	
EXOSC10	5394	hgsc.bcm.edu	37	1	11128719	11128719	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:11128719G>T	ENST00000376936.4	-	23	2582	c.2533C>A	c.(2533-2535)Cag>Aag	p.Q845K	EXOSC10_ENST00000304457.7_Missense_Mutation_p.Q820K|EXOSC10_ENST00000544779.1_3'UTR|RP4-635E18.7_ENST00000452378.1_RNA	NM_001001998.1	NP_001001998.1	Q01780	EXOSX_HUMAN	exosome component 10	845					CUT catabolic process (GO:0071034)|dosage compensation by inactivation of X chromosome (GO:0009048)|histone mRNA catabolic process (GO:0071044)|maturation of 5.8S rRNA (GO:0000460)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear retention of unspliced pre-mRNA at the site of transcription (GO:0071048)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5' exonuclease activity (GO:0008408)|exoribonuclease activity (GO:0004532)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|stomach(3)|upper_aerodigestive_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		GACGGGGTCTGTTTATTTGGA	0.498																																					p.Q845K	Colon(179;105 1987 14326 27364 29542)	Atlas-SNP	.											.	EXOSC10	59	.	0			c.C2533A						.						150.0	143.0	146.0					1																	11128719		2203	4300	6503	SO:0001583	missense	5394	exon23			GGGTCTGTTTATT	BC073788	CCDS126.1, CCDS30584.1	1p36.22	2008-02-05	2004-06-16	2004-06-18	ENSG00000171824	ENSG00000171824			9138	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 2 (100kD)"""	605960	"""polymyositis/scleroderma autoantigen 2, 100kDa"""	PMSCL2		1383382, 1644924	Standard	NM_001001998		Approved	PM-Scl, PM/Scl-100, Rrp6p, RRP6, p2, p3, p4	uc001asa.3	Q01780	OTTHUMG00000002123	ENST00000376936.4:c.2533C>A	chr1.hg19:g.11128719G>T	ENSP00000366135:p.Gln845Lys	133.0	0.0		143.0	77.0	NM_001001998	B1AKQ0|B1AKQ1|Q15158	Missense_Mutation	SNP	ENST00000376936.4	hg19	CCDS30584.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814679	0.32053	.	.	ENSG00000171824	ENST00000376936;ENST00000304457	.	.	.	4.83	3.9	0.45041	.	0.110220	0.64402	D	0.000006	T	0.46737	0.1408	L	0.34521	1.04	0.80722	D	1	P;B	0.35684	0.515;0.381	B;B	0.41440	0.357;0.195	T	0.38023	-0.9680	9	0.02654	T	1	-6.4652	14.301	0.66352	0.0:0.1494:0.8506:0.0	.	820;845	Q01780-2;Q01780	.;EXOSX_HUMAN	K	845;820	.	ENSP00000307307:Q820K	Q	-	1	0	EXOSC10	11051306	1.000000	0.71417	0.969000	0.41365	0.272000	0.26649	5.199000	0.65152	1.135000	0.42183	0.557000	0.71058	CAG	.	.		0.498	EXOSC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000006078.1	NM_001001998	
KIF17	57576	hgsc.bcm.edu	37	1	21016719	21016719	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:21016719C>T	ENST00000247986.2	-	7	1653	c.1343G>A	c.(1342-1344)aGg>aAg	p.R448K	KIF17_ENST00000400463.3_Missense_Mutation_p.R448K|KIF17_ENST00000375044.1_Missense_Mutation_p.R348K|KIF17_ENST00000490034.1_5'UTR			Q9P2E2	KIF17_HUMAN	kinesin family member 17	448					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		CGTGGACAGCCTGACGTCATA	0.642																																					p.R448K		Atlas-SNP	.											.	KIF17	130	.	0			c.G1343A						.						59.0	52.0	54.0					1																	21016719		2203	4300	6503	SO:0001583	missense	57576	exon7			GACAGCCTGACGT	AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1343G>A	chr1.hg19:g.21016719C>T	ENSP00000247986:p.Arg448Lys	89.0	0.0		134.0	76.0	NM_001122819	A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Missense_Mutation	SNP	ENST00000247986.2	hg19	CCDS213.1	.	.	.	.	.	.	.	.	.	.	C	0.869	-0.732708	0.03135	.	.	ENSG00000117245	ENST00000375044;ENST00000400463;ENST00000247986	T;T;T	0.68903	-0.36;-0.25;-0.25	4.87	3.75	0.43078	.	0.234822	0.21448	N	0.074378	T	0.22244	0.0536	N	0.00210	-1.845	0.23449	N	0.997656	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.37454	-0.9705	10	0.02654	T	1	.	7.1053	0.25360	0.0:0.1917:0.0:0.8083	.	448;448	Q9P2E2-3;Q9P2E2	.;KIF17_HUMAN	K	348;448;448	ENSP00000364184:R348K;ENSP00000383311:R448K;ENSP00000247986:R448K	ENSP00000247986:R448K	R	-	2	0	KIF17	20889306	1.000000	0.71417	0.897000	0.35233	0.423000	0.31445	1.093000	0.30939	0.726000	0.32339	-0.339000	0.08088	AGG	.	.		0.642	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276995.1	NM_020816	
HCRTR1	3061	hgsc.bcm.edu	37	1	32084909	32084909	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:32084909A>G	ENST00000373706.5	+	1	269	c.116A>G	c.(115-117)tAt>tGt	p.Y39C	HCRTR1_ENST00000403528.2_Missense_Mutation_p.Y39C|HCRTR1_ENST00000373705.1_Missense_Mutation_p.Y39C|HCRTR1_ENST00000468521.1_3'UTR			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	39					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		TGGCGCGATTATCTGTACCCA	0.607																																					p.Y39C		Atlas-SNP	.											.	HCRTR1	20	.	0			c.A116G						.						154.0	154.0	154.0					1																	32084909		2203	4300	6503	SO:0001583	missense	3061	exon3			GCGATTATCTGTA	AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.116A>G	chr1.hg19:g.32084909A>G	ENSP00000362810:p.Tyr39Cys	62.0	0.0		71.0	22.0	NM_001525	A8K3A6|Q9HBV6	Missense_Mutation	SNP	ENST00000373706.5	hg19	CCDS344.1	.	.	.	.	.	.	.	.	.	.	A	18.73	3.687146	0.68157	.	.	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.37584	1.19;1.19;1.19	3.82	3.82	0.43975	.	0.000000	0.64402	D	0.000003	T	0.49081	0.1536	L	0.47190	1.495	0.50813	D	0.999894	D;D	0.89917	0.999;1.0	D;D	0.72075	0.976;0.969	T	0.44174	-0.9345	10	0.44086	T	0.13	.	11.176	0.48598	1.0:0.0:0.0:0.0	.	39;39	A6NMV7;O43613	.;OX1R_HUMAN	C	39	ENSP00000384387:Y39C;ENSP00000362810:Y39C;ENSP00000362809:Y39C	ENSP00000362809:Y39C	Y	+	2	0	HCRTR1	31857496	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	5.648000	0.67930	1.665000	0.50811	0.482000	0.46254	TAT	.	.		0.607	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011042.1	NM_001525	
DMRTA2	63950	hgsc.bcm.edu	37	1	50886996	50886996	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:50886996C>T	ENST00000404795.3	-	2	605	c.213G>A	c.(211-213)gcG>gcA	p.A71A	DMRTA2_ENST00000418121.1_Silent_p.A71A	NM_032110.2	NP_115486.1	Q96SC8	DMTA2_HUMAN	DMRT-like family A2	71					cerebral cortex regionalization (GO:0021796)|dopaminergic neuron differentiation (GO:0071542)|neuron fate specification (GO:0048665)|positive regulation of neuroblast proliferation (GO:0002052)|skeletal muscle cell differentiation (GO:0035914)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|lung(4)|pancreas(1)	6						TGCGACAGCGCGCGCACTTGG	0.692																																					p.A71A	Colon(196;1651 2045 3292 36497 38236)|Esophageal Squamous(2;257 258 11567 27043 43804)	Atlas-SNP	.											.	DMRTA2	17	.	0			c.G213A						.						3.0	4.0	3.0					1																	50886996		1721	3418	5139	SO:0001819	synonymous_variant	63950	exon2			ACAGCGCGCGCAC	AJ301580	CCDS44141.1	1p33	2008-08-04			ENSG00000142700	ENSG00000142700			13908	protein-coding gene	gene with protein product		614804				11863363	Standard	NM_032110		Approved		uc010onb.2	Q96SC8	OTTHUMG00000007884	ENST00000404795.3:c.213G>A	chr1.hg19:g.50886996C>T		91.0	0.0		96.0	47.0	NM_032110	Q5TFQ3	Silent	SNP	ENST00000404795.3	hg19	CCDS44141.1																																																																																			.	.		0.692	DMRTA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351074.1	NM_032110	
CDCP2	200008	hgsc.bcm.edu	37	1	54618578	54618578	+	Silent	SNP	C	C	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:54618578C>G	ENST00000371330.1	-	1	865	c.18G>C	c.(16-18)ggG>ggC	p.G6G	RP11-446E24.4_ENST00000525949.1_Intron|RP11-446E24.4_ENST00000311841.7_3'UTR	NM_201546.2	NP_963840.2	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2	6						extracellular region (GO:0005576)				kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|stomach(1)	24						GCAGGCAAGCCCCCCACTCTG	0.642																																					p.G6G		Atlas-SNP	.											.	CDCP2	52	.	0			c.G18C						.						53.0	58.0	56.0					1																	54618578		2203	4300	6503	SO:0001819	synonymous_variant	200008	exon1			GCAAGCCCCCCAC		CCDS588.2	1p32.3	2011-02-10			ENSG00000157211	ENSG00000157211			27297	protein-coding gene	gene with protein product		612320				12477932	Standard	NM_201546		Approved		uc001cwv.2	Q5VXM1	OTTHUMG00000155307	ENST00000371330.1:c.18G>C	chr1.hg19:g.54618578C>G		51.0	0.0		62.0	11.0	NM_201546	Q6ZWJ3	Silent	SNP	ENST00000371330.1	hg19	CCDS588.2																																																																																			.	.		0.642	CDCP2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000022209.2	NM_201546	
CYP2J2	1573	hgsc.bcm.edu	37	1	60377391	60377391	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:60377391G>A	ENST00000371204.3	-	4	616	c.573C>T	c.(571-573)atC>atT	p.I191I	CYP2J2_ENST00000492633.1_5'UTR	NM_000775.2	NP_000766.2	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J, polypeptide 2	191					arachidonic acid metabolic process (GO:0019369)|epoxygenase P450 pathway (GO:0019373)|icosanoid metabolic process (GO:0006690)|linoleic acid metabolic process (GO:0043651)|regulation of heart contraction (GO:0008016)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	arachidonic acid 11,12-epoxygenase activity (GO:0008405)|arachidonic acid 14,15-epoxygenase activity (GO:0008404)|arachidonic acid epoxygenase activity (GO:0008392)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|linoleic acid epoxygenase activity (GO:0071614)			NS(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|skin(1)	26	all_cancers(7;0.000396)				Apixaban(DB06605)|Astemizole(DB00637)|Cholecalciferol(DB00169)|Levomilnacipran(DB08918)|Masoprocol(DB00179)|Rivaroxaban(DB06228)	TGGAGCAAATGATATTGGAAA	0.448																																					p.I191I		Atlas-SNP	.											.	CYP2J2	34	.	0			c.C573T						.						170.0	160.0	163.0					1																	60377391		2203	4300	6503	SO:0001819	synonymous_variant	1573	exon4			GCAAATGATATTG	BC032594	CCDS613.1	1p31.3-p31.2	2008-02-05	2003-01-14		ENSG00000134716	ENSG00000134716		"""Cytochrome P450s"""	2634	protein-coding gene	gene with protein product		601258	"""cytochrome P450, subfamily IIJ (arachidonic acid epoxygenase) polypeptide 2"""			9570962	Standard	NM_000775		Approved		uc001czq.3	P51589	OTTHUMG00000008991	ENST00000371204.3:c.573C>T	chr1.hg19:g.60377391G>A		122.0	0.0		107.0	17.0	NM_000775	B2RD33|Q8TF13	Silent	SNP	ENST00000371204.3	hg19	CCDS613.1																																																																																			.	.		0.448	CYP2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024940.1	NM_000775	
SSX2IP	117178	hgsc.bcm.edu	37	1	85116058	85116058	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:85116058T>A	ENST00000342203.3	-	13	1920	c.1657A>T	c.(1657-1659)Ata>Tta	p.I553L	SSX2IP_ENST00000437941.2_Missense_Mutation_p.I526L|SSX2IP_ENST00000370612.4_Missense_Mutation_p.I553L|SSX2IP_ENST00000605755.1_Missense_Mutation_p.I526L|SSX2IP_ENST00000603677.1_Missense_Mutation_p.I72L	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	553					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TGTTCAGATATGCAGGAACGT	0.403																																					p.I553L		Atlas-SNP	.											.	SSX2IP	53	.	0			c.A1657T						.						130.0	128.0	129.0					1																	85116058		2203	4300	6503	SO:0001583	missense	117178	exon14			CAGATATGCAGGA		CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.1657A>T	chr1.hg19:g.85116058T>A	ENSP00000340279:p.Ile553Leu	92.0	0.0		81.0	32.0	NM_001166417	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	ENST00000342203.3	hg19	CCDS699.1	.	.	.	.	.	.	.	.	.	.	T	8.445	0.851655	0.17034	.	.	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000370612	T;T	0.50277	0.75;0.75	5.67	1.2	0.21068	.	0.497800	0.21853	N	0.068152	T	0.13884	0.0336	L	0.39898	1.24	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.32079	-0.9920	10	0.15952	T	0.53	-0.0301	8.3313	0.32189	0.0:0.6298:0.0:0.3702	.	553;553;526	Q9Y2D8-2;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	L	553;526;553	ENSP00000340279:I553L;ENSP00000412781:I526L	ENSP00000340279:I553L	I	-	1	0	SSX2IP	84888646	0.150000	0.22732	0.282000	0.24776	0.051000	0.14879	0.254000	0.18314	0.348000	0.23949	-0.766000	0.03442	ATA	.	.		0.403	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027469.1	NM_014021	
PSMA5	5686	hgsc.bcm.edu	37	1	109957891	109957891	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:109957891A>G	ENST00000271308.4	-	3	211	c.191T>C	c.(190-192)aTt>aCt	p.I64T	PSMA5_ENST00000538610.1_Missense_Mutation_p.I6T|PSMA5_ENST00000490870.1_5'UTR	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	64					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		AATTTTCTCAATGCTGCTGGG	0.463																																					p.I64T		Atlas-SNP	.											.	PSMA5	14	.	0			c.T191C						.						168.0	136.0	146.0					1																	109957891		2203	4300	6503	SO:0001583	missense	5686	exon3			TTCTCAATGCTGC	X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.191T>C	chr1.hg19:g.109957891A>G	ENSP00000271308:p.Ile64Thr	67.0	0.0		66.0	30.0	NM_002790	B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Missense_Mutation	SNP	ENST00000271308.4	hg19	CCDS799.1	.	.	.	.	.	.	.	.	.	.	a	16.49	3.137848	0.56936	.	.	ENSG00000143106	ENST00000538610;ENST00000271308	T;T	0.24538	1.85;1.85	5.89	3.52	0.40303	.	0.044629	0.85682	D	0.000000	T	0.20495	0.0493	M	0.65975	2.015	0.53688	D	0.999973	B	0.29766	0.256	B	0.42087	0.375	T	0.02391	-1.1166	9	.	.	.	-13.6216	12.1983	0.54311	0.7298:0.2702:0.0:0.0	.	64	P28066	PSA5_HUMAN	T	6;64	ENSP00000440618:I6T;ENSP00000271308:I64T	.	I	-	2	0	PSMA5	109759414	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	7.452000	0.80683	0.456000	0.26937	-0.447000	0.05616	ATT	.	.		0.463	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033192.2	NM_002790	
RHOC	389	hgsc.bcm.edu	37	1	113245243	113245243	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:113245243T>C	ENST00000285735.2	-	5	1559	c.350A>G	c.(349-351)aAt>aGt	p.N117S	RHOC_ENST00000339083.7_Missense_Mutation_p.N117S|RP11-426L16.10_ENST00000471038.2_5'UTR|RHOC_ENST00000369638.2_Missense_Mutation_p.N117S|RHOC_ENST00000369642.3_Missense_Mutation_p.N117S|RHOC_ENST00000369632.2_Missense_Mutation_p.N117S|RHOC_ENST00000369633.2_Missense_Mutation_p.N117S|RHOC_ENST00000369637.1_Missense_Mutation_p.N117S|RHOC_ENST00000369636.2_Missense_Mutation_p.N117S			P08134	RHOC_HUMAN	ras homolog family member C	117					apical junction assembly (GO:0043297)|axon guidance (GO:0007411)|cytokinesis (GO:0000910)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTCCTTCTTATTCCCCACCAG	0.572																																					p.N117S		Atlas-SNP	.											.	RHOC	15	.	0			c.A350G						.						137.0	127.0	131.0					1																	113245243		2203	4300	6503	SO:0001583	missense	389	exon5			TTCTTATTCCCCA	BC052808	CCDS854.1	1p13.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000155366	ENSG00000155366			669	protein-coding gene	gene with protein product		165380	"""ras homolog gene family, member C"""	ARH9, ARHC		3283705	Standard	NM_001042678		Approved	RhoC	uc001ecp.1	P08134	OTTHUMG00000011905	ENST00000285735.2:c.350A>G	chr1.hg19:g.113245243T>C	ENSP00000285735:p.Asn117Ser	66.0	0.0		81.0	40.0	NM_001042679	B3KSW1|Q6ICN3	Missense_Mutation	SNP	ENST00000285735.2	hg19	CCDS854.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.056969	0.55325	.	.	ENSG00000155366	ENST00000339083;ENST00000369633;ENST00000369642;ENST00000285735;ENST00000369638;ENST00000369637;ENST00000369636;ENST00000369632;ENST00000484054;ENST00000425265;ENST00000534717;ENST00000436685	T;T;T;T;T;T;T;T;T;T;T;T	0.78126	-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15;-1.15	5.21	5.21	0.72293	Small GTP-binding protein domain (1);	7739.210000	0.00166	N	0.000010	T	0.66297	0.2775	L	0.53561	1.675	0.80722	D	1	B	0.28378	0.209	B	0.28139	0.086	T	0.36163	-0.9759	10	0.22706	T	0.39	-7.9771	14.7852	0.69796	0.0:0.0:0.0:1.0	.	117	P08134	RHOC_HUMAN	S	117;117;117;117;117;117;117;117;154;117;117;117	ENSP00000345236:N117S;ENSP00000358647:N117S;ENSP00000358656:N117S;ENSP00000285735:N117S;ENSP00000358652:N117S;ENSP00000358651:N117S;ENSP00000358650:N117S;ENSP00000358646:N117S;ENSP00000434877:N154S;ENSP00000390823:N117S;ENSP00000436240:N117S;ENSP00000399424:N117S	ENSP00000285735:N117S	N	-	2	0	RHOC	113046766	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.245000	0.72398	1.972000	0.57404	0.444000	0.29173	AAT	.	.		0.572	RHOC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032904.2	NM_175744	
LCE2B	26239	hgsc.bcm.edu	37	1	152659435	152659435	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:152659435C>T	ENST00000368780.3	+	2	170	c.116C>T	c.(115-117)cCa>cTa	p.P39L	LCE2B_ENST00000417924.2_Missense_Mutation_p.P39L	NM_014357.4	NP_055172.1	O14633	LCE2B_HUMAN	late cornified envelope 2B	39	Cys-rich.|Pro-rich.				epidermis development (GO:0008544)|keratinization (GO:0031424)					endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	11	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGCCCAGCTCCATGTTCCCCT	0.622																																					p.P39L		Atlas-SNP	.											.	LCE2B	40	.	0			c.C116T						.						146.0	151.0	149.0					1																	152659435		2203	4300	6503	SO:0001583	missense	26239	exon2			CAGCTCCATGTTC	BI670514	CCDS1020.1	1q21	2008-02-05	2004-10-11	2004-10-15	ENSG00000159455	ENSG00000159455		"""Late cornified envelopes"""	16610	protein-coding gene	gene with protein product		612610	"""small proline rich-like (epidermal differentiation complex) 1B"""	SPRL1B		11698679, 9344646	Standard	NM_014357		Approved	LEP10, XP5	uc001fai.3	O14633	OTTHUMG00000012404	ENST00000368780.3:c.116C>T	chr1.hg19:g.152659435C>T	ENSP00000357769:p.Pro39Leu	147.0	0.0		263.0	25.0	NM_014357	Q5TA80	Missense_Mutation	SNP	ENST00000368780.3	hg19	CCDS1020.1	.	.	.	.	.	.	.	.	.	.	C	0.033	-1.323675	0.01309	.	.	ENSG00000159455	ENST00000417924;ENST00000368780	T;T	0.03607	3.87;3.87	2.11	-0.333	0.12671	.	.	.	.	.	T	0.00845	0.0028	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.47586	-0.9106	9	0.87932	D	0	.	2.8171	0.05459	0.2664:0.5558:0.0:0.1779	.	39	O14633	LCE2B_HUMAN	L	39	ENSP00000414043:P39L;ENSP00000357769:P39L	ENSP00000357769:P39L	P	+	2	0	LCE2B	150926059	0.063000	0.20901	0.003000	0.11579	0.054000	0.15201	1.336000	0.33850	-0.245000	0.09625	0.313000	0.20887	CCA	.	.		0.622	LCE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034524.1	NM_014357	
SPTA1	6708	hgsc.bcm.edu	37	1	158621155	158621155	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:158621155A>T	ENST00000368147.4	-	24	3658		c.e24+1			NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AGCCTTAGTTACCTGCCGGAT	0.458																																					.		Atlas-SNP	.											.	SPTA1	720	.	0			c.3477+2T>A						.						176.0	176.0	176.0					1																	158621155		1885	4111	5996	SO:0001630	splice_region_variant	6708	exon25			TTAGTTACCTGCC	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3477+1T>A	chr1.hg19:g.158621155A>T		115.0	0.0		200.0	33.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Splice_Site	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	A	14.58	2.579287	0.46006	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3863	0.55335	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTA1	156887779	1.000000	0.71417	0.999000	0.59377	0.366000	0.29705	6.280000	0.72626	2.081000	0.62600	0.533000	0.62120	.	.	.		0.458	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	Intron
OR10J3	441911	hgsc.bcm.edu	37	1	159283710	159283710	+	Missense_Mutation	SNP	G	G	A	rs569041098		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:159283710G>A	ENST00000332217.5	-	1	739	c.740C>T	c.(739-741)aCa>aTa	p.T247I		NM_001004467.1	NP_001004467.1	Q5JRS4	O10J3_HUMAN	olfactory receptor, family 10, subfamily J, member 3	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T247R(1)		breast(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(19)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	47	all_hematologic(112;0.0429)					GATGACCACTGTGAGGTGGGA	0.517																																					p.T247I		Atlas-SNP	.											OR10J3,NS,carcinoma,0,1	OR10J3	86	.	1	Substitution - Missense(1)	kidney(1)	c.C740T						.						134.0	115.0	122.0					1																	159283710		2203	4300	6503	SO:0001583	missense	441911	exon1			ACCACTGTGAGGT		CCDS30909.1	1q23.2	2012-08-09		2004-03-10	ENSG00000196266	ENSG00000196266		"""GPCR / Class A : Olfactory receptors"""	14992	protein-coding gene	gene with protein product				OR10J3P			Standard	NM_001004467		Approved		uc010piu.2	Q5JRS4	OTTHUMG00000037233	ENST00000332217.5:c.740C>T	chr1.hg19:g.159283710G>A	ENSP00000331789:p.Thr247Ile	70.0	0.0		136.0	20.0	NM_001004467		Missense_Mutation	SNP	ENST00000332217.5	hg19	CCDS30909.1	.	.	.	.	.	.	.	.	.	.	G	6.284	0.420521	0.11928	.	.	ENSG00000196266	ENST00000332217	T	0.36157	1.27	5.34	2.48	0.30137	GPCR, rhodopsin-like superfamily (1);	0.244417	0.20970	U	0.082414	T	0.14098	0.0341	L	0.41632	1.29	0.09310	N	0.999998	B	0.27823	0.19	B	0.39840	0.311	T	0.38090	-0.9677	10	0.20046	T	0.44	.	7.236	0.26070	0.1566:0.1402:0.7032:0.0	.	247	Q5JRS4	O10J3_HUMAN	I	247	ENSP00000331789:T247I	ENSP00000331789:T247I	T	-	2	0	OR10J3	157550334	0.000000	0.05858	0.375000	0.26029	0.536000	0.34869	0.033000	0.13754	0.390000	0.25115	-0.137000	0.14449	ACA	.	.		0.517	OR10J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090629.1		
GPR161	23432	hgsc.bcm.edu	37	1	168056873	168056873	+	Missense_Mutation	SNP	G	G	T	rs371331680		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:168056873G>T	ENST00000367838.1	-	7	1587	c.1274C>A	c.(1273-1275)cCc>cAc	p.P425H	GPR161_ENST00000361697.2_Missense_Mutation_p.P425H|GPR161_ENST00000537209.1_Missense_Mutation_p.P445H|GPR161_ENST00000539777.1_Missense_Mutation_p.P347H|GPR161_ENST00000367835.1_Missense_Mutation_p.P425H|GPR161_ENST00000271357.5_Missense_Mutation_p.P425H|GPR161_ENST00000367836.1_Missense_Mutation_p.P293H|GPR161_ENST00000546300.1_Missense_Mutation_p.P311H	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	425					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					CCTTCTCTTGGGTGGGCAAGT	0.468																																					p.P445H		Atlas-SNP	.											.	GPR161	56	.	0			c.C1334A						.	G	HIS/PRO	1,4405	2.1+/-5.4	0,1,2202	182.0	173.0	176.0		1274	5.6	1.0	1		176	0,8600		0,0,4300	no	missense	GPR161	NM_153832.1	77	0,1,6502	TT,TG,GG		0.0,0.0227,0.0077	benign	425/530	168056873	1,13005	2203	4300	6503	SO:0001583	missense	23432	exon6			CTCTTGGGTGGGC	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.1274C>A	chr1.hg19:g.168056873G>T	ENSP00000356812:p.Pro425His	83.0	0.0		185.0	75.0	NM_001267609	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	hg19	CCDS1268.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.906769	0.52333	2.27E-4	0.0	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;D;T;T;T;T;T	0.81821	-0.08;-0.08;-1.54;-0.08;-1.07;-1.06;0.0;-0.08	5.61	5.61	0.85477	.	0.455799	0.24359	N	0.039209	T	0.64864	0.2637	L	0.44542	1.39	0.30087	N	0.808677	B;B;B;B;B	0.33777	0.425;0.07;0.27;0.299;0.13	B;B;B;B;B	0.28465	0.061;0.024;0.09;0.028;0.016	T	0.73043	-0.4107	9	0.72032	D	0.01	-37.6914	14.9068	0.70727	0.0:0.0:0.856:0.144	.	445;311;347;445;425	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8	.;.;.;.;GP161_HUMAN	H	425;425;293;425;311;347;445;425	ENSP00000356812:P425H;ENSP00000271357:P425H;ENSP00000356810:P293H;ENSP00000356809:P425H;ENSP00000444348:P311H;ENSP00000437576:P347H;ENSP00000441039:P445H;ENSP00000355194:P425H	ENSP00000271357:P425H	P	-	2	0	GPR161	166323497	1.000000	0.71417	0.992000	0.48379	0.968000	0.65278	3.878000	0.56130	2.628000	0.89032	0.561000	0.74099	CCC	.	.		0.468	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
KIAA0040	9674	hgsc.bcm.edu	37	1	175129958	175129958	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:175129958C>G	ENST00000423313.1	-	4	728	c.192G>C	c.(190-192)aaG>aaC	p.K64N	KIAA0040_ENST00000444639.1_Missense_Mutation_p.K64N|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000545251.2_Missense_Mutation_p.K64N	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	tcttcttgttcttctCTGGCT	0.522																																					p.K64N		Atlas-SNP	.											.	KIAA0040	2	.	0			c.G192C						.						65.0	54.0	57.0					1																	175129958		692	1591	2283	SO:0001583	missense	9674	exon3			CTTGTTCTTCTCT	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.192G>C	chr1.hg19:g.175129958C>G	ENSP00000462172:p.Lys64Asn	80.0	0.0		87.0	5.0	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	hg19																																																																																				.	.		0.522	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
TNR	7143	hgsc.bcm.edu	37	1	175348809	175348809	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:175348809C>T	ENST00000367674.2	-	9	2550	c.1842G>A	c.(1840-1842)tgG>tgA	p.W614*	TNR_ENST00000263525.2_Nonsense_Mutation_p.W614*			Q92752	TENR_HUMAN	tenascin R	614	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|negative regulation of axon extension involved in regeneration (GO:0048692)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of synaptic transmission (GO:0050805)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transmission of nerve impulse (GO:0051971)|synapse organization (GO:0050808)|telencephalon cell migration (GO:0022029)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)				NS(3)|breast(7)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|lung(98)|ovary(4)|pancreas(5)|prostate(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	177	Renal(580;0.146)					CACTGTTATCCCACTCGAGGT	0.517																																					p.W614X		Atlas-SNP	.											.	TNR	399	.	0			c.G1842A						.						115.0	87.0	97.0					1																	175348809		2203	4300	6503	SO:0001587	stop_gained	7143	exon9			GTTATCCCACTCG	X98085	CCDS1318.1	1q24	2013-02-11	2012-07-12		ENSG00000116147	ENSG00000116147		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11953	protein-coding gene	gene with protein product	"""restrictin"", ""janusin"""	601995				8626505, 8940128	Standard	NM_003285		Approved		uc009wwu.1	Q92752	OTTHUMG00000034876	ENST00000367674.2:c.1842G>A	chr1.hg19:g.175348809C>T	ENSP00000356646:p.Trp614*	75.0	0.0		141.0	21.0	NM_003285	C9J563|Q15568|Q5R3G0	Nonsense_Mutation	SNP	ENST00000367674.2	hg19	CCDS1318.1	.	.	.	.	.	.	.	.	.	.	C	46	12.439282	0.99668	.	.	ENSG00000116147	ENST00000367674;ENST00000263525;ENST00000367673	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.8373	0.92168	0.0:1.0:0.0:0.0	.	.	.	.	X	614	.	ENSP00000263525:W614X	W	-	3	0	TNR	173615432	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.797000	0.75150	2.534000	0.85438	0.650000	0.86243	TGG	.	.		0.517	TNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084414.4	NM_003285	
PTPN14	5784	hgsc.bcm.edu	37	1	214585026	214585026	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:214585026C>T	ENST00000366956.5	-	5	705		c.e5+1		PTPN14_ENST00000543945.1_Splice_Site	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14						lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		ATTACACTTACCATAGGAAAT	0.323																																					.	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.510+1G>A						.						51.0	55.0	54.0					1																	214585026		2203	4291	6494	SO:0001630	splice_region_variant	5784	exon6			CACTTACCATAGG	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.510+1G>A	chr1.hg19:g.214585026C>T		458.0	0.0		832.0	106.0	NM_005401	Q5VSI0	Splice_Site	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855832	0.71834	.	.	ENSG00000152104	ENST00000366956;ENST00000543945	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8542	0.78965	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PTPN14	212651649	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	6.716000	0.74702	2.158000	0.67659	0.557000	0.71058	.	.	.		0.323	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	Intron
OR2G3	81469	hgsc.bcm.edu	37	1	247769166	247769166	+	Silent	SNP	T	T	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:247769166T>G	ENST00000320002.2	+	1	311	c.279T>G	c.(277-279)acT>acG	p.T93T	RNU6-691P_ENST00000516585.1_RNA|RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001914.1	NP_001001914.1	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G, member 3	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(31)|skin(5)	50	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGACGATCACTTACGGTGGTT	0.468																																					p.T93T		Atlas-SNP	.											.	OR2G3	108	.	0			c.T279G						.						298.0	266.0	277.0					1																	247769166		2203	4300	6503	SO:0001819	synonymous_variant	81469	exon1			GATCACTTACGGT	BK004417	CCDS31093.1	1q44	2012-08-09			ENSG00000177476	ENSG00000177476		"""GPCR / Class A : Olfactory receptors"""	15008	protein-coding gene	gene with protein product							Standard	NM_001001914		Approved		uc010pyz.2	Q8NGZ4	OTTHUMG00000040576	ENST00000320002.2:c.279T>G	chr1.hg19:g.247769166T>G		107.0	0.0		178.0	48.0	NM_001001914	B2RN64|Q5JQT1|Q6IF45	Silent	SNP	ENST00000320002.2	hg19	CCDS31093.1																																																																																			.	.		0.468	OR2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097624.1		
OR2T10	127069	hgsc.bcm.edu	37	1	248756758	248756758	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:248756758G>A	ENST00000330500.2	-	1	342	c.312C>T	c.(310-312)taC>taT	p.Y104Y	Y_RNA_ENST00000364732.1_RNA	NM_001004693.1	NP_001004693.1	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T, member 10	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(17)|skin(3)|upper_aerodigestive_tract(1)	26	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCAACTGCAGGTAGAAGTACA	0.537																																					p.Y104Y		Atlas-SNP	.											.	OR2T10	58	.	0			c.C312T						.						68.0	76.0	74.0					1																	248756758		2046	4235	6281	SO:0001819	synonymous_variant	127069	exon1			CTGCAGGTAGAAG		CCDS31121.1	1q44	2012-08-09			ENSG00000184022	ENSG00000184022		"""GPCR / Class A : Olfactory receptors"""	19573	protein-coding gene	gene with protein product							Standard	NM_001004693		Approved		uc010pzn.2	Q8NGZ9	OTTHUMG00000040388	ENST00000330500.2:c.312C>T	chr1.hg19:g.248756758G>A		164.0	0.0		209.0	27.0	NM_001004693	B2RNK7	Silent	SNP	ENST00000330500.2	hg19	CCDS31121.1																																																																																			.	.		0.537	OR2T10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097139.1	NM_001004693	
RASGRP3	25780	hgsc.bcm.edu	37	2	33764196	33764196	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:33764196G>A	ENST00000403687.3	+	12	1937	c.1197G>A	c.(1195-1197)gtG>gtA	p.V399V	RASGRP3_ENST00000407811.1_Silent_p.V398V|RASGRP3_ENST00000402538.3_Silent_p.V399V	NM_001139488.1	NP_001132960.1	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and DAG-regulated)	399					MAPK cascade (GO:0000165)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)	guanyl-nucleotide exchange factor complex (GO:0032045)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap GTPase activator activity (GO:0046582)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|stomach(2)	11	all_hematologic(175;0.115)					ACAAGCCTGTGGTACCCCTGG	0.443																																					p.V399V		Atlas-SNP	.											.	RASGRP3	87	.	0			c.G1197A						.						44.0	41.0	42.0					2																	33764196		1857	4097	5954	SO:0001819	synonymous_variant	25780	exon13			GCCTGTGGTACCC	AB020653	CCDS46256.1, CCDS54346.1	2p25.1-p24.1	2013-01-10			ENSG00000152689	ENSG00000152689		"""EF-hand domain containing"""	14545	protein-coding gene	gene with protein product		609531				10048485, 10934204	Standard	NM_170672		Approved	KIAA0846, GRP3	uc002roy.3	Q8IV61	OTTHUMG00000152124	ENST00000403687.3:c.1197G>A	chr2.hg19:g.33764196G>A		331.0	0.0		299.0	145.0	NM_170672	D6W583|O94931|Q53SD7	Silent	SNP	ENST00000403687.3	hg19	CCDS46256.1																																																																																			.	.		0.443	RASGRP3-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325462.2	NM_015376	
LOXL3	84695	hgsc.bcm.edu	37	2	74776519	74776519	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:74776519C>T	ENST00000264094.3	-	4	740	c.669G>A	c.(667-669)aaG>aaA	p.K223K	LOXL3_ENST00000409249.1_Silent_p.K223K|LOXL3_ENST00000484369.1_5'UTR|LOXL3_ENST00000409986.1_Intron|LOXL3_ENST00000393937.2_Intron|DOK1_ENST00000409429.1_Intron|LOXL3_ENST00000409549.1_Silent_p.K223K	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	223	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						CGTTGACCCTCTTTTCGCTGG	0.647																																					p.K223K		Atlas-SNP	.											.	LOXL3	73	.	0			c.G669A						.						18.0	19.0	19.0					2																	74776519		2203	4300	6503	SO:0001819	synonymous_variant	84695	exon4			GACCCTCTTTTCG	AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.669G>A	chr2.hg19:g.74776519C>T		61.0	0.0		73.0	10.0	NM_032603	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Silent	SNP	ENST00000264094.3	hg19	CCDS1953.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.798190	0.70567	.	.	ENSG00000115318	ENST00000420535	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	T	0.71937	0.3399	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70310	-0.4907	4	.	.	.	.	16.0841	0.81025	0.0:1.0:0.0:0.0	.	.	.	.	K	23	.	.	R	-	2	0	LOXL3	74630027	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	3.852000	0.55934	2.646000	0.89796	0.563000	0.77884	AGA	.	.		0.647	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252215.1	NM_032603	
EPB41L5	57669	hgsc.bcm.edu	37	2	120834878	120834878	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:120834878A>G	ENST00000263713.5	+	9	914	c.700A>G	c.(700-702)Atg>Gtg	p.M234V	EPB41L5_ENST00000443124.1_Missense_Mutation_p.M234V|EPB41L5_ENST00000331393.4_Missense_Mutation_p.M234V|EPB41L5_ENST00000443902.2_Missense_Mutation_p.M234V|EPB41L5_ENST00000452780.1_Missense_Mutation_p.M234V	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	234	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TGGGGTTGATATGCATGTGGT	0.368																																					p.M234V		Atlas-SNP	.											.	EPB41L5	98	.	0			c.A700G						.						101.0	106.0	104.0					2																	120834878		2203	4300	6503	SO:0001583	missense	57669	exon9			GTTGATATGCATG	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.700A>G	chr2.hg19:g.120834878A>G	ENSP00000263713:p.Met234Val	489.0	1.0		411.0	265.0	NM_020909	Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	ENST00000263713.5	hg19	CCDS2130.1	.	.	.	.	.	.	.	.	.	.	A	17.57	3.423657	0.62733	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	T;T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96;-0.96	5.18	5.18	0.71444	Band 4.1 domain (1);FERM central domain (1);FERM domain (1);Pleckstrin homology-type (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.84061	0.5389	M	0.62154	1.92	0.80722	D	1	P;D;P;D	0.76494	0.725;0.999;0.729;0.999	B;D;B;D	0.83275	0.439;0.994;0.413;0.996	D	0.85825	0.1388	10	0.72032	D	0.01	.	14.6954	0.69118	1.0:0.0:0.0:0.0	.	234;234;234;234	Q9HCM4-3;Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;.;E41L5_HUMAN	V	234	ENSP00000263713:M234V;ENSP00000393856:M234V;ENSP00000329687:M234V;ENSP00000393722:M234V;ENSP00000390439:M234V	ENSP00000263713:M234V	M	+	1	0	EPB41L5	120551348	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	8.978000	0.93450	1.965000	0.57142	0.459000	0.35465	ATG	.	.		0.368	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
CCDC74B	91409	hgsc.bcm.edu	37	2	130897517	130897517	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:130897517G>A	ENST00000310463.6	-	7	1091	c.954C>T	c.(952-954)gaC>gaT	p.D318D	CCDC74B_ENST00000409943.3_Silent_p.D252D|CCDC74B_ENST00000392984.3_Silent_p.D420D|MED15P9_ENST00000427638.1_RNA	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B	318										endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					TGGCTTCTTGGTCCCTGGGTG	0.617																																					p.D318D		Atlas-SNP	.											.	CCDC74B	27	.	0			c.C954T						.						41.0	43.0	42.0					2																	130897517		2201	4296	6497	SO:0001819	synonymous_variant	91409	exon7			TTCTTGGTCCCTG		CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.954C>T	chr2.hg19:g.130897517G>A		185.0	0.0		141.0	31.0	NM_207310	Q6NW18	Silent	SNP	ENST00000310463.6	hg19	CCDS2155.1	.	.	.	.	.	.	.	.	.	.	.	14.42	2.531439	0.45073	.	.	ENSG00000152076	ENST00000409488	.	.	.	3.78	-0.487	0.12060	.	.	.	.	.	T	0.49474	0.1559	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51228	-0.8732	5	0.72032	D	0.01	.	1.5157	0.02505	0.1155:0.2071:0.3247:0.3527	.	.	.	.	I	216	.	ENSP00000386250:T216I	T	-	2	0	CCDC74B	130613987	0.998000	0.40836	0.998000	0.56505	0.719000	0.41307	0.559000	0.23485	0.011000	0.14865	0.450000	0.29827	ACC	.	.		0.617	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254522.3	NM_207310	
ZEB2	9839	hgsc.bcm.edu	37	2	145156639	145156639	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:145156639G>A	ENST00000558170.2	-	8	3299	c.2115C>T	c.(2113-2115)tcC>tcT	p.S705S	ZEB2_ENST00000303660.4_Silent_p.S705S|ZEB2_ENST00000539609.3_Silent_p.S681S|ZEB2_ENST00000409487.3_Silent_p.S705S	NM_014795.3	NP_055610.1	O60315	ZEB2_HUMAN	zinc finger E-box binding homeobox 2	705					cell proliferation in forebrain (GO:0021846)|developmental pigmentation (GO:0048066)|hippocampus development (GO:0021766)|melanocyte migration (GO:0097324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of melanin biosynthetic process (GO:0048023)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of melanosome organization (GO:1903056)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|phosphatase regulator activity (GO:0019208)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(6)|large_intestine(23)|lung(45)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	107				BRCA - Breast invasive adenocarcinoma(221;0.112)		CCAGGGATGGGGACCTGGAAT	0.458																																					p.S705S	Melanoma(33;1235 1264 5755 16332)	Atlas-SNP	.											.	ZEB2	218	.	0			c.C2115T						.						160.0	168.0	165.0					2																	145156639		2203	4300	6503	SO:0001819	synonymous_variant	9839	exon8			GGATGGGGACCTG	AB011141	CCDS2186.1, CCDS54403.1	2q22.3	2013-01-08	2007-02-15	2007-02-15	ENSG00000169554	ENSG00000169554		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	14881	protein-coding gene	gene with protein product	"""SMAD interacting protein 1"""	605802	"""zinc finger homeobox 1b"""	ZFHX1B			Standard	NM_014795		Approved	KIAA0569, SIP-1, SIP1	uc002tvu.3	O60315	OTTHUMG00000131834	ENST00000558170.2:c.2115C>T	chr2.hg19:g.145156639G>A		143.0	0.0		125.0	41.0	NM_014795	A0JP09|B7Z2P2|F5H814|Q9UED1	Silent	SNP	ENST00000558170.2	hg19	CCDS2186.1																																																																																			.	.		0.458	ZEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254778.5	NM_014795	
SLC11A1	6556	hgsc.bcm.edu	37	2	219249062	219249062	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:219249062C>T	ENST00000233202.6	+	3	587	c.247C>T	c.(247-249)Cag>Tag	p.Q83*	SLC11A1_ENST00000539932.1_5'UTR|SLC11A1_ENST00000473367.1_3'UTR	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	83					activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTCAGATCTTCAGGCTGGCGC	0.582																																					p.Q83X		Atlas-SNP	.											.	SLC11A1	41	.	0			c.C247T						.						111.0	110.0	110.0					2																	219249062		2203	4300	6503	SO:0001587	stop_gained	6556	exon3			GATCTTCAGGCTG	D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.247C>T	chr2.hg19:g.219249062C>T	ENSP00000233202:p.Gln83*	86.0	0.0		100.0	11.0	NM_000578	C0H5Y3	Nonsense_Mutation	SNP	ENST00000233202.6	hg19	CCDS2415.1	.	.	.	.	.	.	.	.	.	.	C	36	5.975222	0.97162	.	.	ENSG00000018280	ENST00000233202	.	.	.	5.06	5.06	0.68205	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.476	18.6237	0.91330	0.0:1.0:0.0:0.0	.	.	.	.	X	83	.	ENSP00000233202:Q83X	Q	+	1	0	SLC11A1	218957306	1.000000	0.71417	0.964000	0.40570	0.806000	0.45545	7.404000	0.79996	2.620000	0.88729	0.561000	0.74099	CAG	.	.		0.582	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195076.2	NM_000578	
EPHA4	2043	hgsc.bcm.edu	37	2	222347320	222347320	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:222347320C>T	ENST00000281821.2	-	5	1111	c.1070G>A	c.(1069-1071)cGc>cAc	p.R357H	EPHA4_ENST00000392071.4_Missense_Mutation_p.R306H|EPHA4_ENST00000409854.1_Missense_Mutation_p.R357H|EPHA4_ENST00000409938.1_Missense_Mutation_p.R357H	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	357	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)	p.R357H(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		AATGTCCTGGCGGCCACCTGT	0.522																																					p.R357H		Atlas-SNP	.											EPHA4_ENST00000281821,colon,carcinoma,0,2	EPHA4	263	.	2	Substitution - Missense(2)	large_intestine(2)	c.G1070A						.						142.0	155.0	151.0					2																	222347320		2203	4300	6503	SO:0001583	missense	2043	exon5			TCCTGGCGGCCAC	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.1070G>A	chr2.hg19:g.222347320C>T	ENSP00000281821:p.Arg357His	88.0	1.0		111.0	28.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.610380|5.610380	0.96637|0.96637	.|.	.|.	ENSG00000116106|ENSG00000116106	ENST00000441679|ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071;ENST00000443796	.|T;T;T;T;T	.|0.58506	.|0.33;0.33;0.33;0.33;0.33	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.82226|0.82226	0.4991|0.4991	M|M	0.90650|0.90650	3.135|3.135	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.84334|0.84334	0.0523|0.0523	5|10	.|0.87932	.|D	.|0	.|.	20.6208|20.6208	0.99490|0.99490	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|357	.|P54764	.|EPHA4_HUMAN	T|H	94|357;357;357;306;61	.|ENSP00000281821:R357H;ENSP00000386276:R357H;ENSP00000386829:R357H;ENSP00000375923:R306H;ENSP00000395917:R61H	.|ENSP00000281821:R357H	A|R	-|-	1|2	0|0	EPHA4|EPHA4	222055564|222055564	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.818000|7.818000	0.86416|0.86416	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GCC|CGC	.	.		0.522	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
EPHA4	2043	hgsc.bcm.edu	37	2	222436897	222436897	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:222436897C>T	ENST00000281821.2	-	1	113	c.72G>A	c.(70-72)agG>agA	p.R24R	EPHA4_ENST00000392071.4_5'UTR|EPHA4_ENST00000409854.1_Silent_p.R24R|EPHA4_ENST00000409938.1_Silent_p.R24R|CTD-2308L22.1_ENST00000609776.1_RNA	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	24					adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CGGGGTATACCCTGGAACCTG	0.617																																					p.R24R		Atlas-SNP	.											.	EPHA4	263	.	0			c.G72A						.						95.0	91.0	92.0					2																	222436897		2203	4300	6503	SO:0001819	synonymous_variant	2043	exon1			GTATACCCTGGAA	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.72G>A	chr2.hg19:g.222436897C>T		75.0	0.0		118.0	47.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Silent	SNP	ENST00000281821.2	hg19	CCDS2447.1																																																																																			.	.		0.617	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
PPP1R7	5510	hgsc.bcm.edu	37	2	242092994	242092994	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr2:242092994G>C	ENST00000234038.6	+	2	630	c.156G>C	c.(154-156)gaG>gaC	p.E52D	PPP1R7_ENST00000401987.1_Intron|PPP1R7_ENST00000407025.1_Missense_Mutation_p.E52D|PPP1R7_ENST00000402734.1_Intron|PPP1R7_ENST00000404405.3_Missense_Mutation_p.E52D|PPP1R7_ENST00000272983.8_Intron|PPP1R7_ENST00000406106.3_Missense_Mutation_p.E52D	NM_001282412.1|NM_001282413.1|NM_002712.1	NP_001269341.1|NP_001269342.1|NP_002703.1	Q15435	PP1R7_HUMAN	protein phosphatase 1, regulatory subunit 7	52					positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	enzyme regulator activity (GO:0030234)|protein phosphatase type 1 regulator activity (GO:0008599)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)	23		all_cancers(19;6.1e-33)|all_epithelial(40;1.07e-13)|Breast(86;0.000141)|Renal(207;0.00528)|all_lung(227;0.0446)|Ovarian(221;0.104)|Lung NSC(271;0.115)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.92e-32)|all cancers(36;5.35e-29)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-14)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.24e-08)|BRCA - Breast invasive adenocarcinoma(100;3.56e-06)|Lung(119;0.000588)|LUSC - Lung squamous cell carcinoma(224;0.0048)|Colorectal(34;0.0137)|COAD - Colon adenocarcinoma(134;0.096)		AGGATGGGGAGGAGCGGGGGG	0.627																																					p.E52D	NSCLC(62;446 1299 5417 11238 27640)	Atlas-SNP	.											.	PPP1R7	35	.	0			c.G156C						.						80.0	77.0	78.0					2																	242092994		2203	4300	6503	SO:0001583	missense	5510	exon2			TGGGGAGGAGCGG	AF067136	CCDS2546.1, CCDS63190.1, CCDS63192.1, CCDS63193.1, CCDS63194.1	2q37.3	2012-04-17	2011-10-04		ENSG00000115685	ENSG00000115685		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9295	protein-coding gene	gene with protein product		602877	"""protein phosphatase 1, regulatory (inhibitor) subunit 7"""			7498485, 7670491, 10231361	Standard	NM_001282413		Approved	sds22	uc002wat.1	Q15435	OTTHUMG00000133390	ENST00000234038.6:c.156G>C	chr2.hg19:g.242092994G>C	ENSP00000234038:p.Glu52Asp	49.0	0.0		79.0	33.0	NM_002712	B4DFD4|B5MCY6|Q9UQE5|Q9UQE6|Q9Y6K4	Missense_Mutation	SNP	ENST00000234038.6	hg19	CCDS2546.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.17|10.17	1.275838|1.275838	0.23307|0.23307	.|.	.|.	ENSG00000115685|ENSG00000115685	ENST00000438799;ENST00000407025;ENST00000234038;ENST00000404405;ENST00000439916;ENST00000406106;ENST00000427172|ENST00000450367	T;T;T;T;T;T;T|.	0.49432|.	0.88;0.78;0.78;0.93;1.24;1.07;1.42|.	4.61|4.61	1.71|1.71	0.24356|0.24356	.|.	0.931323|.	0.08998|.	N|.	0.863444|.	T|T	0.30759|0.30759	0.0775|0.0775	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	B;B;B;B|.	0.23316|.	0.01;0.083;0.017;0.01|.	B;B;B;B|.	0.18561|.	0.007;0.011;0.022;0.01|.	T|T	0.03374|0.03374	-1.1043|-1.1043	10|5	0.33940|.	T|.	0.23|.	-12.5099|-12.5099	8.0951|8.0951	0.30824|0.30824	0.2533:0.0:0.7467:0.0|0.2533:0.0:0.7467:0.0	.|.	36;52;52;52|.	C9JD73;Q15435;Q15435-3;B5MBZ8|.	.;PP1R7_HUMAN;.;.|.	D|T	36;52;52;52;52;52;61|33	ENSP00000396376:E36D;ENSP00000385657:E52D;ENSP00000234038:E52D;ENSP00000385498:E52D;ENSP00000409719:E52D;ENSP00000385022:E52D;ENSP00000397985:E61D|.	ENSP00000234038:E52D|.	E|R	+|+	3|2	2|0	PPP1R7|PPP1R7	241741667|241741667	1.000000|1.000000	0.71417|0.71417	0.931000|0.931000	0.37212|0.37212	0.943000|0.943000	0.58893|0.58893	1.295000|1.295000	0.33377|0.33377	0.368000|0.368000	0.24481|0.24481	0.561000|0.561000	0.74099|0.74099	GAG|AGG	.	.		0.627	PPP1R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257244.4	NM_002712	
SETMAR	6419	hgsc.bcm.edu	37	3	4354904	4354904	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr3:4354904C>T	ENST00000358065.4	+	2	546	c.479C>T	c.(478-480)cCg>cTg	p.P160L	SETMAR_ENST00000425863.1_Missense_Mutation_p.P160L|SETMAR_ENST00000430981.1_Missense_Mutation_p.P160L|SUMF1_ENST00000534863.1_Intron	NM_006515.3	NP_006506.3	Q53H47	SETMR_HUMAN	SET domain and mariner transposase fusion gene	160	Histone-lysine N-methyltransferase.|SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA integration (GO:0015074)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of chromosome organization (GO:2001251)|positive regulation of double-strand break repair via nonhomologous end joining (GO:2001034)|transposition, DNA-mediated (GO:0006313)	chromosome (GO:0005694)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|histone-lysine N-methyltransferase activity (GO:0018024)|protein homodimerization activity (GO:0042803)|structure-specific DNA binding (GO:0043566)|transposase activity (GO:0004803)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(1)	9		Melanoma(143;0.0657)		Epithelial(13;0.0025)|OV - Ovarian serous cystadenocarcinoma(96;0.011)|all cancers(10;0.0114)		GAATTTATACCGAAAGGAAGG	0.413								Chromatin Structure																													p.P160L		Atlas-SNP	.											.	SETMAR	30	.	0			c.C479T						.						49.0	52.0	51.0					3																	4354904		2203	4299	6502	SO:0001583	missense	6419	exon2			TTATACCGAAAGG	U80776	CCDS2563.2, CCDS58814.1, CCDS63528.1	3p26.2	2013-01-31			ENSG00000170364	ENSG00000170364			10762	protein-coding gene	gene with protein product		609834				9461395	Standard	NM_006515		Approved	metnase	uc011asp.2	Q53H47	OTTHUMG00000090265	ENST00000358065.4:c.479C>T	chr3.hg19:g.4354904C>T	ENSP00000373354:p.Pro160Leu	72.0	0.0		79.0	28.0	NM_001243723	B4DY74|E7EN68|Q13579|Q1G668|Q96F41	Missense_Mutation	SNP	ENST00000358065.4	hg19	CCDS2563.2	.	.	.	.	.	.	.	.	.	.	C	16.98	3.271328	0.59649	.	.	ENSG00000170364	ENST00000358065;ENST00000430981;ENST00000425863	D;D;D	0.83673	-1.75;-1.75;-1.56	5.18	5.18	0.71444	SET domain (3);	.	.	.	.	D	0.90232	0.6946	M	0.61703	1.905	0.58432	D	0.999992	D;D;D	0.89917	1.0;0.992;0.964	D;P;B	0.91635	0.999;0.756;0.402	D	0.91177	0.4973	9	0.87932	D	0	.	18.7279	0.91722	0.0:1.0:0.0:0.0	.	160;147;160	E7EN68;Q53H47;C9JHK2	.;SETMR_HUMAN;.	L	160	ENSP00000373354:P160L;ENSP00000403000:P160L;ENSP00000403145:P160L	ENSP00000373354:P160L	P	+	2	0	SETMAR	4329904	0.997000	0.39634	0.405000	0.26409	0.133000	0.20885	4.199000	0.58426	2.412000	0.81896	0.557000	0.71058	CCG	.	.		0.413	SETMAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206587.4	NM_006515	
CCDC80	151887	hgsc.bcm.edu	37	3	112324389	112324389	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr3:112324389C>G	ENST00000206423.3	-	8	3681	c.2728G>C	c.(2728-2730)Ggg>Cgg	p.G910R	CCDC80_ENST00000439685.2_Missense_Mutation_p.G910R	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	910					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						CAGCGCATCCCCAGTGACTGC	0.483																																					p.G910R		Atlas-SNP	.											.	CCDC80	100	.	0			c.G2728C						.						122.0	101.0	108.0					3																	112324389		2203	4300	6503	SO:0001583	missense	151887	exon8			GCATCCCCAGTGA	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.2728G>C	chr3.hg19:g.112324389C>G	ENSP00000206423:p.Gly910Arg	111.0	0.0		132.0	28.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	hg19	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.852356	0.91355	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594;ENST00000479368	T;T;T	0.70869	-0.52;-0.52;0.62	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.78861	0.4350	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.80139	-0.1507	10	0.72032	D	0.01	-31.8097	20.1099	0.97909	0.0:1.0:0.0:0.0	.	921;910	Q76M96-2;Q76M96	.;CCD80_HUMAN	R	910;910;511;188	ENSP00000206423:G910R;ENSP00000411814:G910R;ENSP00000418188:G188R	ENSP00000206423:G910R	G	-	1	0	CCDC80	113807079	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.753000	0.94483	0.585000	0.79938	GGG	.	.		0.483	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
C3orf30	152405	hgsc.bcm.edu	37	3	118867141	118867141	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr3:118867141G>A	ENST00000295622.1	+	2	1553	c.1513G>A	c.(1513-1515)Gaa>Aaa	p.E505K	IGSF11_ENST00000354673.2_5'Flank|IGSF11_ENST00000425327.2_5'Flank|RP11-484M3.5_ENST00000490594.1_Intron|IGSF11_ENST00000441144.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	505										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		CCAATACATGGAAAAACACCA	0.333																																					p.E505K		Atlas-SNP	.											.	C3orf30	64	.	0			c.G1513A						.						66.0	70.0	69.0					3																	118867141		2203	4300	6503	SO:0001583	missense	152405	exon2			TACATGGAAAAAC	AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.1513G>A	chr3.hg19:g.118867141G>A	ENSP00000295622:p.Glu505Lys	393.0	1.0		477.0	171.0	NM_152539	A1L4B7	Missense_Mutation	SNP	ENST00000295622.1	hg19	CCDS2984.1	.	.	.	.	.	.	.	.	.	.	G	33	5.205185	0.95033	.	.	ENSG00000163424	ENST00000295622;ENST00000470341;ENST00000473121	T	0.76316	-1.01	4.74	4.74	0.60224	.	0.000000	0.49305	D	0.000147	D	0.85066	0.5612	L	0.59436	1.845	0.39884	D	0.973677	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.86781	0.1979	10	0.87932	D	0	-29.9735	13.4162	0.60970	0.0:0.0:1.0:0.0	.	505;505	E9PFE5;Q96M34	.;CC030_HUMAN	K	505;505;272	ENSP00000295622:E505K	ENSP00000295622:E505K	E	+	1	0	C3orf30	120349831	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.670000	0.61583	2.609000	0.88269	0.655000	0.94253	GAA	.	.		0.333	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354838.1	NM_152539	
CD80	941	hgsc.bcm.edu	37	3	119263423	119263423	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr3:119263423A>G	ENST00000264246.3	-	3	754	c.392T>C	c.(391-393)cTg>cCg	p.L131P	CD80_ENST00000383668.3_Missense_Mutation_p.L131P|CD80_ENST00000478182.1_Missense_Mutation_p.L131P|CD80_ENST00000383669.3_Missense_Mutation_p.L131P	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	131	Ig-like V-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	CACTTCAGCCAGGTGTTCCCG	0.463																																					p.L131P	Melanoma(132;135 1764 1806 5833 14593)	Atlas-SNP	.											.	CD80	35	.	0			c.T392C						.						91.0	93.0	93.0					3																	119263423		2203	4300	6503	SO:0001583	missense	941	exon3			TCAGCCAGGTGTT		CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.392T>C	chr3.hg19:g.119263423A>G	ENSP00000264246:p.Leu131Pro	106.0	0.0		102.0	37.0	NM_005191	Q5DTA9|Q5DTB0	Missense_Mutation	SNP	ENST00000264246.3	hg19	CCDS2989.1	.	.	.	.	.	.	.	.	.	.	A	14.97	2.694635	0.48202	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669;ENST00000383668	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.13	-2.1	0.07210	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.077590	0.07311	N	0.875910	T	0.58032	0.2094	M	0.76002	2.32	0.21290	N	0.99973	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.76575	0.988;0.941;0.982;0.982	T	0.50792	-0.8786	10	0.66056	D	0.02	-0.2705	4.9992	0.14255	0.3372:0.2687:0.0:0.3941	.	131;131;131;131	Q5DTA9;Q5DTB0;A0N0P2;P33681	.;.;.;CD80_HUMAN	P	131	ENSP00000264246:L131P;ENSP00000418364:L131P;ENSP00000373165:L131P;ENSP00000373164:L131P	ENSP00000264246:L131P	L	-	2	0	CD80	120746113	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	0.456000	0.21859	-0.208000	0.10171	0.528000	0.53228	CTG	.	.		0.463	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355196.1	NM_005191	
TBC1D19	55296	hgsc.bcm.edu	37	4	26719629	26719629	+	Silent	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr4:26719629A>G	ENST00000264866.4	+	14	1307	c.1029A>G	c.(1027-1029)tcA>tcG	p.S343S	TBC1D19_ENST00000511789.1_Silent_p.S278S	NM_018317.2	NP_060787.2	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	343	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			breast(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	17		Breast(46;0.0503)				CACCAAAATCATACATAAGAG	0.313																																					p.S343S		Atlas-SNP	.											.	TBC1D19	53	.	0			c.A1029G						.						94.0	90.0	92.0					4																	26719629		2202	4299	6501	SO:0001819	synonymous_variant	55296	exon14			AAAATCATACATA	AK001944	CCDS3439.1, CCDS75115.1	4p15.2	2008-02-05			ENSG00000109680	ENSG00000109680			25624	protein-coding gene	gene with protein product							Standard	XM_006713967		Approved	FLJ11082	uc003gsf.4	Q8N5T2	OTTHUMG00000097797	ENST00000264866.4:c.1029A>G	chr4.hg19:g.26719629A>G		64.0	0.0		42.0	17.0	NM_018317	B9A6M0|Q9NUX1	Silent	SNP	ENST00000264866.4	hg19	CCDS3439.1																																																																																			.	.		0.313	TBC1D19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215052.2	NM_018317	
MMRN1	22915	hgsc.bcm.edu	37	4	90856478	90856478	+	Silent	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr4:90856478A>G	ENST00000394980.1	+	7	1966	c.1647A>G	c.(1645-1647)ttA>ttG	p.L549L	MMRN1_ENST00000264790.2_Silent_p.L549L|MMRN1_ENST00000508372.1_Silent_p.L291L|MMRN1_ENST00000394981.1_Intron			Q13201	MMRN1_HUMAN	multimerin 1	549					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TGTCTACTTTACATGAAAATA	0.378																																					p.L549L		Atlas-SNP	.											.	MMRN1	174	.	0			c.A1647G						.						77.0	78.0	78.0					4																	90856478		2203	4300	6503	SO:0001819	synonymous_variant	22915	exon6			TACTTTACATGAA	U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.1647A>G	chr4.hg19:g.90856478A>G		163.0	0.0		74.0	72.0	NM_007351	Q4W5L1|Q6P3T8|Q6ZUL9	Silent	SNP	ENST00000394980.1	hg19	CCDS3635.1																																																																																			.	.		0.378	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253546.2	NM_007351	
SLC6A19	340024	hgsc.bcm.edu	37	5	1219041	1219041	+	Silent	SNP	C	C	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr5:1219041C>G	ENST00000304460.10	+	9	1253	c.1197C>G	c.(1195-1197)gcC>gcG	p.A399A		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	399					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CAGGCCTGGCCTTCATCGTCT	0.622																																					p.A399A		Atlas-SNP	.											.	SLC6A19	99	.	0			c.C1197G						.						301.0	228.0	253.0					5																	1219041		2203	4300	6503	SO:0001819	synonymous_variant	340024	exon9			CCTGGCCTTCATC	AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1197C>G	chr5.hg19:g.1219041C>G		37.0	0.0		98.0	10.0	NM_001003841	A8K446	Silent	SNP	ENST00000304460.10	hg19	CCDS34130.1																																																																																			.	.		0.622	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365557.1	XM_291120	
HMGCR	3156	hgsc.bcm.edu	37	5	74646733	74646733	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr5:74646733A>T	ENST00000287936.4	+	9	1056	c.900A>T	c.(898-900)agA>agT	p.R300S	HMGCR_ENST00000343975.5_Missense_Mutation_p.R300S|HMGCR_ENST00000511206.1_Missense_Mutation_p.R300S	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	300					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	TGTCCAAGAGAATTGAACCAA	0.363																																					p.R300S		Atlas-SNP	.											.	HMGCR	53	.	0			c.A900T						.						107.0	106.0	106.0					5																	74646733		2203	4300	6503	SO:0001583	missense	3156	exon9			CAAGAGAATTGAA		CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	ENST00000287936.4:c.900A>T	chr5.hg19:g.74646733A>T	ENSP00000287936:p.Arg300Ser	119.0	0.0		95.0	17.0	NM_001130996	B7Z3Y9|Q8N190	Missense_Mutation	SNP	ENST00000287936.4	hg19	CCDS4027.1	.	.	.	.	.	.	.	.	.	.	A	14.71	2.615796	0.46631	.	.	ENSG00000113161	ENST00000511206;ENST00000544469;ENST00000287936;ENST00000343975	T;T;T	0.43688	0.96;0.96;0.94	5.92	3.53	0.40419	.	0.040191	0.85682	D	0.000000	T	0.34250	0.0891	M	0.72118	2.19	0.58432	D	0.999999	P;P;P;P	0.49253	0.698;0.835;0.921;0.514	B;B;B;B	0.38500	0.155;0.275;0.213;0.115	T	0.37641	-0.9697	10	0.06891	T	0.86	-23.9061	10.1126	0.42572	0.8647:0.0:0.1353:0.0	.	300;300;300;300	B2R649;A8KA27;P04035-2;P04035	.;.;.;HMDH_HUMAN	S	300;231;300;300	ENSP00000426745:R300S;ENSP00000287936:R300S;ENSP00000340816:R300S	ENSP00000287936:R300S	R	+	3	2	HMGCR	74682489	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.350000	0.44063	0.497000	0.27926	0.533000	0.62120	AGA	.	.		0.363	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219877.2		
DDX46	9879	hgsc.bcm.edu	37	5	134121267	134121267	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr5:134121267C>T	ENST00000354283.4	+	11	1590	c.1455C>T	c.(1453-1455)atC>atT	p.I485I	DDX46_ENST00000452510.2_Silent_p.I485I|DDX46_ENST00000509178.1_3'UTR			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	485	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAACAGGAATCAGTGAGCAGG	0.353																																					p.I485I	Colon(13;391 453 4901 21675 24897)	Atlas-SNP	.											.	DDX46	77	.	0			c.C1455T						.						148.0	153.0	151.0					5																	134121267		2203	4300	6503	SO:0001819	synonymous_variant	9879	exon11			AGGAATCAGTGAG		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.1455C>T	chr5.hg19:g.134121267C>T		89.0	0.0		93.0	18.0	NM_014829	O94894|Q96EI0|Q9Y658	Silent	SNP	ENST00000354283.4	hg19	CCDS34240.1																																																																																			.	.		0.353	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
PCDHGA11	56105	hgsc.bcm.edu	37	5	140802419	140802419	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr5:140802419C>T	ENST00000398587.2	+	1	1658	c.1625C>T	c.(1624-1626)cCc>cTc	p.P542L	PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.P542L|PCDHGB7_ENST00000398594.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	542	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGACCCGCCCCTCAGCAGC	0.577																																					p.P542L		Atlas-SNP	.											.	PCDHGA11	128	.	0			c.C1625T						.						142.0	164.0	157.0					5																	140802419		2203	4300	6503	SO:0001583	missense	56105	exon1			ACCCGCCCCTCAG	AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.1625C>T	chr5.hg19:g.140802419C>T	ENSP00000381589:p.Pro542Leu	114.0	0.0		115.0	25.0	NM_032091	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	ENST00000398587.2	hg19	CCDS47294.1	.	.	.	.	.	.	.	.	.	.	c	13.53	2.264175	0.39995	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.56941	0.43;0.43	5.72	4.84	0.62591	Cadherin (4);Cadherin-like (1);	0.354182	0.15011	U	0.285535	T	0.76758	0.4032	M	0.92219	3.285	0.37025	D	0.896408	D;P;D	0.55385	0.959;0.861;0.971	P;P;P	0.58721	0.809;0.492;0.844	D	0.84864	0.0821	10	0.87932	D	0	.	15.8788	0.79185	0.1366:0.8634:0.0:0.0	.	542;542;542	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	L	542	ENSP00000381589:P542L;ENSP00000428333:P542L	ENSP00000381589:P542L	P	+	2	0	PCDHGA11	140782603	0.601000	0.26907	0.664000	0.29753	0.027000	0.11550	5.683000	0.68189	1.385000	0.46445	0.655000	0.94253	CCC	.	.		0.577	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376974.1	NM_018914	
SH3TC2	79628	hgsc.bcm.edu	37	5	148408005	148408005	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr5:148408005C>A	ENST00000515425.1	-	11	1391	c.1290G>T	c.(1288-1290)gaG>gaT	p.E430D	SH3TC2_ENST00000513340.1_5'UTR|SH3TC2_ENST00000538184.1_5'UTR|SH3TC2_ENST00000394358.2_Missense_Mutation_p.E315D|SH3TC2_ENST00000512049.1_Missense_Mutation_p.E423D	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	430					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGAGAGGAGCTCCTCCTCCA	0.622																																					p.E430D		Atlas-SNP	.											.	SH3TC2	178	.	0			c.G1290T						.						38.0	42.0	40.0					5																	148408005		2203	4299	6502	SO:0001583	missense	79628	exon11			GAGGAGCTCCTCC	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.1290G>T	chr5.hg19:g.148408005C>A	ENSP00000423660:p.Glu430Asp	60.0	0.0		45.0	21.0	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	hg19	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.304268	0.40795	.	.	ENSG00000169247	ENST00000515425;ENST00000512049;ENST00000394358	T;T;T	0.77229	-1.08;-1.08;-0.71	5.73	2.76	0.32466	.	0.139235	0.45867	N	0.000329	T	0.75796	0.3898	N	0.22421	0.69	0.33744	D	0.619768	D;D;D;D	0.76494	0.999;0.997;0.997;0.999	D;D;D;D	0.78314	0.991;0.978;0.978;0.991	T	0.77305	-0.2637	10	0.38643	T	0.18	.	6.6655	0.23039	0.2331:0.5901:0.0:0.1769	.	315;423;430;430	C9JLC3;Q14CC0;E9PDF1;Q8TF17	.;.;.;S3TC2_HUMAN	D	430;423;315	ENSP00000423660:E430D;ENSP00000421860:E423D;ENSP00000377886:E315D	ENSP00000377886:E315D	E	-	3	2	SH3TC2	148388198	0.941000	0.31946	1.000000	0.80357	0.599000	0.36880	0.184000	0.16939	0.832000	0.34804	0.655000	0.94253	GAG	.	.		0.622	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
ARID1B	57492	hgsc.bcm.edu	37	6	157222615	157222615	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr6:157222615C>T	ENST00000350026.5	+	3	1844	c.1843C>T	c.(1843-1845)Cag>Tag	p.Q615*	ARID1B_ENST00000275248.4_Nonsense_Mutation_p.Q557*|ARID1B_ENST00000346085.5_Nonsense_Mutation_p.Q628*|ARID1B_ENST00000367148.1_Nonsense_Mutation_p.Q615*	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	615	Gln-rich.				chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ACCCCAGGCGCAGTATCTGCC	0.642																																					p.Q628X		Atlas-SNP	.											.	ARID1B	320	.	0			c.C1882T						.						34.0	34.0	34.0					6																	157222615		2203	4300	6503	SO:0001587	stop_gained	57492	exon4			CAGGCGCAGTATC	AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.1843C>T	chr6.hg19:g.157222615C>T	ENSP00000055163:p.Gln615*	35.0	0.0		33.0	10.0	NM_020732	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Nonsense_Mutation	SNP	ENST00000350026.5	hg19	CCDS5251.2	.	.	.	.	.	.	.	.	.	.	C	39	7.675290	0.98425	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000354354;ENST00000414678;ENST00000319584	.	.	.	5.95	5.95	0.96441	.	0.449637	0.20067	N	0.099945	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	20.3697	0.98890	0.0:1.0:0.0:0.0	.	.	.	.	X	628;615;615;557;36;114;37	.	ENSP00000275248:Q557X	Q	+	1	0	ARID1B	157264307	0.998000	0.40836	0.997000	0.53966	0.951000	0.60555	4.410000	0.59774	2.811000	0.96726	0.655000	0.94253	CAG	.	.		0.642	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000372723.1	NM_020732	
SYNJ2	8871	hgsc.bcm.edu	37	6	158490577	158490577	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr6:158490577G>T	ENST00000355585.4	+	14	1887	c.1812G>T	c.(1810-1812)aaG>aaT	p.K604N	SYNJ2_ENST00000367122.2_Missense_Mutation_p.K604N|SYNJ2_ENST00000367121.3_Missense_Mutation_p.K604N	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	604					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		CTACCAACAAGAAGATGTGGG	0.463																																					p.K604N		Atlas-SNP	.											.	SYNJ2	111	.	0			c.G1812T						.						143.0	123.0	130.0					6																	158490577		2203	4300	6503	SO:0001583	missense	8871	exon14			CAACAAGAAGATG	AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.1812G>T	chr6.hg19:g.158490577G>T	ENSP00000347792:p.Lys604Asn	53.0	0.0		53.0	30.0	NM_003898	Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Missense_Mutation	SNP	ENST00000355585.4	hg19	CCDS5254.1	.	.	.	.	.	.	.	.	.	.	G	14.58	2.577748	0.45902	.	.	ENSG00000078269	ENST00000367122;ENST00000367121;ENST00000355585	T;T;T	0.39056	1.1;1.1;1.1	5.15	1.88	0.25563	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.085060	0.51477	D	0.000096	T	0.17066	0.0410	L	0.33339	1.005	0.80722	D	1	P;B	0.39044	0.656;0.012	B;B	0.36608	0.229;0.028	T	0.11179	-1.0598	10	0.66056	D	0.02	.	9.0331	0.36271	0.3524:0.0:0.6476:0.0	.	604;604	O15056;O15056-3	SYNJ2_HUMAN;.	N	604	ENSP00000356089:K604N;ENSP00000356088:K604N;ENSP00000347792:K604N	ENSP00000347792:K604N	K	+	3	2	SYNJ2	158410565	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.636000	0.46545	2.078000	0.62432	0.529000	0.55759	AAG	.	.		0.463	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042858.2		
VWDE	221806	hgsc.bcm.edu	37	7	12383827	12383827	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr7:12383827C>T	ENST00000275358.3	-	21	4260	c.4072G>A	c.(4072-4074)Gat>Aat	p.D1358N		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1358	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TCACCTTCATCACAGGTTGCT	0.318																																					p.D1358N		Atlas-SNP	.											.	VWDE	123	.	0			c.G4072A						.						96.0	75.0	82.0					7																	12383827		692	1591	2283	SO:0001583	missense	221806	exon21			CTTCATCACAGGT		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.4072G>A	chr7.hg19:g.12383827C>T	ENSP00000275358:p.Asp1358Asn	289.0	0.0		326.0	60.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.364454	0.24684	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	T	0.23950	1.88	3.52	0.71	0.18157	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.902878	0.09418	N	0.804783	T	0.11836	0.0288	N	0.11560	0.145	0.22435	N	0.999104	P	0.39250	0.665	B	0.33042	0.157	T	0.20207	-1.0282	10	0.33141	T	0.24	.	8.7396	0.34550	0.0:0.747:0.0:0.253	.	1358	Q8N2E2	VWDE_HUMAN	N	1358;812	ENSP00000275358:D1358N	ENSP00000275358:D1358N	D	-	1	0	VWDE	12350352	1.000000	0.71417	0.600000	0.28864	0.754000	0.42855	1.478000	0.35442	0.141000	0.18875	0.585000	0.79938	GAT	.	.		0.318	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
ANKMY2	57037	hgsc.bcm.edu	37	7	16644410	16644410	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr7:16644410T>A	ENST00000306999.2	-	8	1190	c.947A>T	c.(946-948)gAt>gTt	p.D316V		NM_020319.2	NP_064715.1	Q8IV38	ANKY2_HUMAN	ankyrin repeat and MYND domain containing 2	316						cilium (GO:0005929)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	23	Lung NSC(10;0.103)|all_lung(11;0.204)			UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		AAATTCCACATCCACAAAACC	0.433																																					p.D316V		Atlas-SNP	.											.	ANKMY2	46	.	0			c.A947T						.						108.0	102.0	104.0					7																	16644410		2203	4300	6503	SO:0001583	missense	57037	exon8			TCCACATCCACAA	AK001740	CCDS5361.1	7p21	2013-01-10			ENSG00000106524	ENSG00000106524		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	25370	protein-coding gene	gene with protein product						12477932	Standard	NM_020319		Approved	DKFZP564O043, ZMYND20	uc003sti.3	Q8IV38	OTTHUMG00000090806	ENST00000306999.2:c.947A>T	chr7.hg19:g.16644410T>A	ENSP00000303570:p.Asp316Val	154.0	0.0		189.0	75.0	NM_020319	A4D124|Q659G1|Q96BL3	Missense_Mutation	SNP	ENST00000306999.2	hg19	CCDS5361.1	.	.	.	.	.	.	.	.	.	.	T	19.33	3.806125	0.70682	.	.	ENSG00000106524	ENST00000306999	D	0.85484	-1.99	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.82751	0.5105	M	0.64676	1.99	0.80722	D	1	B	0.31581	0.329	B	0.24155	0.051	T	0.80516	-0.1348	10	0.35671	T	0.21	-15.2592	16.6093	0.84858	0.0:0.0:0.0:1.0	.	316	Q8IV38	ANKY2_HUMAN	V	316	ENSP00000303570:D316V	ENSP00000303570:D316V	D	-	2	0	ANKMY2	16610935	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.698000	0.84413	2.324000	0.78689	0.533000	0.62120	GAT	.	.		0.433	ANKMY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207600.2	NM_020319	
MPP6	51678	hgsc.bcm.edu	37	7	24718945	24718945	+	Missense_Mutation	SNP	A	A	G	rs74407305		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr7:24718945A>G	ENST00000222644.5	+	10	1560	c.1310A>G	c.(1309-1311)aAc>aGc	p.N437S	MPP6_ENST00000409761.1_Missense_Mutation_p.N325S|MPP6_ENST00000396475.2_Missense_Mutation_p.N437S			Q99547	MPH6_HUMAN	membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6)	0					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|skin(2)	20						CTGGATGTCAACCCACAAGTA	0.393																																					p.N437S		Atlas-SNP	.											.	MPP6	62	.	0			c.A1310G						.						100.0	92.0	95.0					7																	24718945		2203	4300	6503	SO:0001583	missense	51678	exon11			ATGTCAACCCACA	AF162130	CCDS5388.1	7p15	2007-08-01			ENSG00000105926	ENSG00000105926			18167	protein-coding gene	gene with protein product		606959				10753959, 11311936	Standard	NM_016447		Approved	PALS2, VAM-1, p55T	uc003swx.3	Q9NZW5	OTTHUMG00000023507	ENST00000222644.5:c.1310A>G	chr7.hg19:g.24718945A>G	ENSP00000222644:p.Asn437Ser	102.0	0.0		124.0	60.0	NM_016447	B2RAF0	Missense_Mutation	SNP	ENST00000222644.5	hg19	CCDS5388.1	.	.	.	.	.	.	.	.	.	.	A	18.10	3.547417	0.65311	.	.	ENSG00000105926	ENST00000222644;ENST00000409761;ENST00000396475	T;T;T	0.39406	1.08;1.08;1.08	5.97	4.8	0.61643	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.099771	0.42964	D	0.000634	T	0.37348	0.1000	L	0.31752	0.955	0.80722	D	1	P	0.36683	0.565	B	0.42882	0.401	T	0.09143	-1.0688	10	0.30078	T	0.28	.	13.2867	0.60247	0.8676:0.1324:0.0:0.0	.	437	Q9NZW5	MPP6_HUMAN	S	437;325;437	ENSP00000222644:N437S;ENSP00000386262:N325S;ENSP00000379737:N437S	ENSP00000222644:N437S	N	+	2	0	MPP6	24685470	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.339000	0.96797	1.055000	0.40461	0.533000	0.62120	AAC	.	.		0.393	MPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250272.4		
SEMA3E	9723	hgsc.bcm.edu	37	7	83095918	83095918	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr7:83095918C>A	ENST00000307792.3	-	4	804		c.e4-1		SEMA3E_ENST00000427262.1_Splice_Site	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E						axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				CACATTCACCCTAAAGCAGGA	0.388																																					.		Atlas-SNP	.											.	SEMA3E	125	.	0			c.337-1G>T						.						109.0	95.0	100.0					7																	83095918		2203	4300	6503	SO:0001630	splice_region_variant	9723	exon5			TTCACCCTAAAGC	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.337-1G>T	chr7.hg19:g.83095918C>A		78.0	0.0		83.0	34.0	NM_012431	B4E1P1|Q75M94|Q75M97	Splice_Site	SNP	ENST00000307792.3	hg19	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.722140	0.48728	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514;ENST00000442159	.	.	.	5.48	4.6	0.57074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4471	0.61146	0.0:0.9231:0.0:0.0769	.	.	.	.	.	-1	.	.	.	-	.	.	SEMA3E	82933854	1.000000	0.71417	0.986000	0.45419	0.491000	0.33493	4.761000	0.62243	1.332000	0.45431	0.650000	0.86243	.	.	.		0.388	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	Intron
SLC12A9	56996	hgsc.bcm.edu	37	7	100454563	100454563	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr7:100454563G>A	ENST00000354161.3	+	5	647	c.522G>A	c.(520-522)ctG>ctA	p.L174L	SLC12A9_ENST00000415287.1_Silent_p.L85L|SLC12A9_ENST00000275729.3_Silent_p.L85L|SLC12A9_ENST00000540482.1_Silent_p.L174L|SLC12A9_ENST00000428758.1_Silent_p.L174L	NM_020246.3	NP_064631.2	Q9BXP2	S12A9_HUMAN	solute carrier family 12, member 9	174					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation:chloride symporter activity (GO:0015377)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(20)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	41	Lung NSC(181;0.041)|all_lung(186;0.0581)					GCTCCCTGCTGCTGGGCCTTG	0.657																																					p.L174L		Atlas-SNP	.											.	SLC12A9	81	.	0			c.G522A						.						62.0	58.0	59.0					7																	100454563		2203	4300	6503	SO:0001819	synonymous_variant	56996	exon5			CCTGCTGCTGGGC	AF284422	CCDS5707.1, CCDS59068.1, CCDS59069.1	7q22	2013-07-18	2013-07-18		ENSG00000146828	ENSG00000146828		"""Solute carriers"""	17435	protein-coding gene	gene with protein product	"""cation-chloride cotransporter-interacting protein"""					10871601, 11239002	Standard	NM_020246		Approved	CIP1	uc003uwp.4	Q9BXP2	OTTHUMG00000156045	ENST00000354161.3:c.522G>A	chr7.hg19:g.100454563G>A		29.0	0.0		64.0	12.0	NM_001267812	B7Z740|D6W5X0|D6W5X2|F5H8C2|Q9BWL2|Q9BXP1|Q9BYI0|Q9NQR5	Silent	SNP	ENST00000354161.3	hg19	CCDS5707.1																																																																																			.	.		0.657	SLC12A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342837.1	NM_020246	
ZDHHC2	51201	hgsc.bcm.edu	37	8	17043874	17043874	+	Silent	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr8:17043874A>G	ENST00000262096.8	+	3	887	c.192A>G	c.(190-192)gcA>gcG	p.A64A		NM_016353.4	NP_057437.1	Q9UIJ5	ZDHC2_HUMAN	zinc finger, DHHC-type containing 2	64					protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|recycling endosome membrane (GO:0055038)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|pancreas(1)|stomach(1)	8				Colorectal(111;0.0697)|COAD - Colon adenocarcinoma(73;0.244)		TACTTTTTGCAATGTTTGTCT	0.269																																					p.A64A		Atlas-SNP	.											.	ZDHHC2	25	.	0			c.A192G						.						125.0	110.0	115.0					8																	17043874		1828	4077	5905	SO:0001819	synonymous_variant	51201	exon3			TTTTGCAATGTTT	AB023584	CCDS47810.1	8p22	2008-05-15			ENSG00000104219	ENSG00000104219		"""Zinc fingers, DHHC-type"""	18469	protein-coding gene	gene with protein product						10918388	Standard	NM_016353		Approved	ZNF372	uc003wxe.3	Q9UIJ5	OTTHUMG00000163860	ENST00000262096.8:c.192A>G	chr8.hg19:g.17043874A>G		194.0	0.0		102.0	95.0	NM_016353	D3DSP5	Silent	SNP	ENST00000262096.8	hg19	CCDS47810.1																																																																																			.	.		0.269	ZDHHC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376014.2	NM_016353	
KAT6A	7994	hgsc.bcm.edu	37	8	41798614	41798614	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr8:41798614G>A	ENST00000396930.3	-	16	3328	c.2785C>T	c.(2785-2787)Cag>Tag	p.Q929*	KAT6A_ENST00000265713.2_Nonsense_Mutation_p.Q929*|KAT6A_ENST00000406337.1_Nonsense_Mutation_p.Q929*	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	929					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TTCCCGTCCTGGCTTGGCTGC	0.527																																					p.Q929X		Atlas-SNP	.											.	.	.	.	0			c.C2785T						.						86.0	83.0	84.0					8																	41798614		2203	4300	6503	SO:0001587	stop_gained	7994	exon16			CGTCCTGGCTTGG	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2785C>T	chr8.hg19:g.41798614G>A	ENSP00000380136:p.Gln929*	63.0	0.0		83.0	34.0	NM_001099412	Q76L81	Nonsense_Mutation	SNP	ENST00000396930.3	hg19	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	G	40	8.083108	0.98646	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	.	.	.	5.19	4.23	0.50019	.	0.394126	0.21108	N	0.080036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-4.6247	5.9275	0.19120	0.1016:0.0:0.577:0.3214	.	.	.	.	X	929;929;929;509	.	ENSP00000265713:Q929X	Q	-	1	0	KAT6A	41917771	1.000000	0.71417	0.964000	0.40570	0.004000	0.04260	2.217000	0.42880	2.411000	0.81874	0.655000	0.94253	CAG	.	.		0.527	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
PPP1R16A	84988	hgsc.bcm.edu	37	8	145724197	145724197	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr8:145724197G>A	ENST00000292539.4	+	3	1221	c.304G>A	c.(304-306)Gag>Aag	p.E102K	PPP1R16A_ENST00000435887.1_Missense_Mutation_p.E102K|CTD-2517M22.14_ENST00000532766.1_RNA|CTD-2517M14.5_ENST00000569326.1_RNA			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	102						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTTGGCCAACGAGGACGGCCT	0.667																																					p.E102K		Atlas-SNP	.											.	PPP1R16A	25	.	0			c.G304A						.						55.0	50.0	52.0					8																	145724197		2201	4300	6501	SO:0001583	missense	84988	exon2			GCCAACGAGGACG		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.304G>A	chr8.hg19:g.145724197G>A	ENSP00000292539:p.Glu102Lys	48.0	0.0		65.0	10.0	NM_032902	D3DWM5	Missense_Mutation	SNP	ENST00000292539.4	hg19	CCDS6429.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337522	0.81911	.	.	ENSG00000160972	ENST00000292539;ENST00000435887	T;T	0.52295	0.67;0.67	4.65	4.65	0.58169	Ankyrin repeat-containing domain (4);	0.062472	0.64402	D	0.000006	T	0.43433	0.1247	N	0.04636	-0.2	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.37798	-0.9690	10	0.12103	T	0.63	.	15.3956	0.74790	0.0:0.0:1.0:0.0	.	102	Q96I34	PP16A_HUMAN	K	102	ENSP00000292539:E102K;ENSP00000391126:E102K	ENSP00000292539:E102K	E	+	1	0	PPP1R16A	145695005	1.000000	0.71417	0.999000	0.59377	0.086000	0.17979	5.150000	0.64869	2.306000	0.77630	0.462000	0.41574	GAG	.	.		0.667	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382459.1	NM_032902	
ZBTB5	9925	hgsc.bcm.edu	37	9	37441538	37441538	+	Silent	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr9:37441538A>G	ENST00000307750.4	-	2	1199	c.1011T>C	c.(1009-1011)ccT>ccC	p.P337P		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		CCTGAGGCTCAGGTGAGCTCA	0.517																																					p.P337P		Atlas-SNP	.											.	ZBTB5	43	.	0			c.T1011C						.						101.0	91.0	94.0					9																	37441538		2203	4300	6503	SO:0001819	synonymous_variant	9925	exon2			AGGCTCAGGTGAG	AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.1011T>C	chr9.hg19:g.37441538A>G		41.0	0.0		28.0	18.0	NM_014872		Silent	SNP	ENST00000307750.4	hg19	CCDS6610.1																																																																																			.	.		0.517	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052462.1	NM_014872	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90536200	90536200	+	RNA	SNP	G	G	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr9:90536200G>T	ENST00000602681.1	+	0	1927							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAGACAACTGGAGCAATACAT	0.517																																					p.E460X		Atlas-SNP	.											.	.	.	.	0			c.G1378T						.						55.0	51.0	52.0					9																	90536200		692	1591	2283			441452	exon4			CAACTGGAGCAAT	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		chr9.hg19:g.90536200G>T		222.0	0.0		239.0	112.0	NM_001145124		Nonsense_Mutation	SNP	ENST00000602681.1	hg19																																																																																				.	.		0.517	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
PAPPA	5069	hgsc.bcm.edu	37	9	119115123	119115123	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr9:119115123A>G	ENST00000328252.3	+	16	4472	c.4103A>G	c.(4102-4104)aAg>aGg	p.K1368R	PAPPA_ENST00000534838.1_Missense_Mutation_p.K406R	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1368	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						AATAAGCACAAGGTGGGCTCC	0.547																																					p.K1368R		Atlas-SNP	.											.	PAPPA	243	.	0			c.A4103G						.						75.0	67.0	69.0					9																	119115123		2203	4300	6503	SO:0001583	missense	5069	exon16			AGCACAAGGTGGG		CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.4103A>G	chr9.hg19:g.119115123A>G	ENSP00000330658:p.Lys1368Arg	79.0	0.0		97.0	23.0	NM_002581	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	ENST00000328252.3	hg19	CCDS6813.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.983862	0.93044	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.63913	-0.07;-0.07	5.85	5.85	0.93711	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.78000	0.4215	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.87578	0.994;0.998	T	0.79443	-0.1801	10	0.59425	D	0.04	-24.2944	16.2343	0.82363	1.0:0.0:0.0:0.0	.	406;1368	F5GZ19;Q13219	.;PAPP1_HUMAN	R	1368;406	ENSP00000330658:K1368R;ENSP00000441461:K406R	ENSP00000330658:K1368R	K	+	2	0	PAPPA	118154944	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.300000	0.96151	2.234000	0.73211	0.533000	0.62120	AAG	.	.		0.547	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055546.1	NM_002581	
KCNT1	57582	hgsc.bcm.edu	37	9	138660719	138660719	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr9:138660719C>T	ENST00000263604.3	+	15	1389	c.1389C>T	c.(1387-1389)gcC>gcT	p.A463A	KCNT1_ENST00000486577.2_Silent_p.A443A|KCNT1_ENST00000490355.2_Silent_p.A463A|KCNT1_ENST00000371757.2_Silent_p.A482A|KCNT1_ENST00000298480.5_Silent_p.A482A|KCNT1_ENST00000491806.2_Silent_p.A449A|KCNT1_ENST00000487664.1_Silent_p.A437A|KCNT1_ENST00000488444.2_Silent_p.A463A			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	463					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		AGGACTTCGCCCCCAACTGCC	0.622																																					p.A482A		Atlas-SNP	.											KCNT1,NS,neuroblastoma,0,1	KCNT1	139	.	0			c.C1446T						.						115.0	98.0	104.0					9																	138660719		2202	4300	6502	SO:0001819	synonymous_variant	57582	exon15			CTTCGCCCCCAAC	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1389C>T	chr9.hg19:g.138660719C>T		38.0	0.0		53.0	17.0	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Silent	SNP	ENST00000263604.3	hg19																																																																																				.	.		0.622	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
ABCA2	20	hgsc.bcm.edu	37	9	139907958	139907958	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr9:139907958C>T	ENST00000371605.3	-	28	4649	c.4502G>A	c.(4501-4503)cGt>cAt	p.R1501H	ABCA2_ENST00000265662.5_Missense_Mutation_p.R1502H|ABCA2_ENST00000341511.6_Missense_Mutation_p.R1502H			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1501					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GAAATTGCCACGGGGCTGGGT	0.677																																					p.R1532H		Atlas-SNP	.											.	ABCA2	113	.	0			c.G4595A						.						52.0	60.0	57.0					9																	139907958		1999	4140	6139	SO:0001583	missense	20	exon29			TTGCCACGGGGCT	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.4502G>A	chr9.hg19:g.139907958C>T	ENSP00000360666:p.Arg1501His	42.0	0.0		50.0	28.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	ENST00000371605.3	hg19		.	.	.	.	.	.	.	.	.	.	C	20.7	4.036739	0.75617	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.87256	-2.23;-2.23;-2.23	4.86	4.86	0.63082	.	0.840660	0.10192	U	0.704486	D	0.84629	0.5514	L	0.44542	1.39	0.37658	D	0.922673	D;D	0.60160	0.976;0.987	B;P	0.47744	0.379;0.556	D	0.83777	0.0223	10	0.66056	D	0.02	.	6.3671	0.21461	0.0:0.7615:0.0:0.2385	.	1501;1532	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	H	1502;1501;1532;1502	ENSP00000265662:R1502H;ENSP00000360666:R1501H;ENSP00000344155:R1502H	ENSP00000265662:R1502H	R	-	2	0	ABCA2	139027779	0.996000	0.38824	0.987000	0.45799	0.980000	0.70556	3.199000	0.51043	2.235000	0.73313	0.484000	0.47621	CGT	.	.		0.677	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
BTRC	8945	hgsc.bcm.edu	37	10	103239157	103239157	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr10:103239157C>G	ENST00000370187.3	+	4	385	c.267C>G	c.(265-267)aaC>aaG	p.N89K	BTRC_ENST00000408038.2_Missense_Mutation_p.N53K|BTRC_ENST00000393441.4_Missense_Mutation_p.N48K	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	89					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		TCTGCTTAAACCAAGAAACAG	0.348																																					p.N89K		Atlas-SNP	.											.	BTRC	64	.	0			c.C267G						.						111.0	102.0	105.0					10																	103239157		2203	4300	6503	SO:0001583	missense	8945	exon4			CTTAAACCAAGAA	Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.267C>G	chr10.hg19:g.103239157C>G	ENSP00000359206:p.Asn89Lys	95.0	0.0		93.0	20.0	NM_033637	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	ENST00000370187.3	hg19	CCDS7512.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872075	0.51695	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038;ENST00000539411;ENST00000370183	T;T;T	0.60424	0.33;0.37;0.19	5.35	4.43	0.53597	.	0.000000	0.64402	D	0.000002	T	0.34513	0.0900	N	0.14661	0.345	0.34495	D	0.705432	B;B;B	0.27732	0.0;0.187;0.002	B;B;B	0.22386	0.0;0.039;0.002	T	0.39143	-0.9628	10	0.05833	T	0.94	-16.8582	13.0951	0.59187	0.0:0.9204:0.0:0.0796	.	63;53;89	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	K	89;48;53;27;71	ENSP00000359206:N89K;ENSP00000377088:N48K;ENSP00000385339:N53K	ENSP00000359202:N71K	N	+	3	2	BTRC	103229147	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.850000	0.39328	1.330000	0.45394	0.655000	0.94253	AAC	.	.		0.348	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049936.1	NM_033637	
ATRNL1	26033	hgsc.bcm.edu	37	10	117075138	117075138	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr10:117075138T>A	ENST00000355044.3	+	18	3055	c.2929T>A	c.(2929-2931)Tca>Aca	p.S977T	ATRNL1_ENST00000303745.7_5'UTR|ATRNL1_ENST00000423111.2_Missense_Mutation_p.S74T	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	977	PSI 5.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGAAGGTTCTTCACGGGGACC	0.453																																					p.S977T		Atlas-SNP	.											.	ATRNL1	219	.	0			c.T2929A						.						153.0	136.0	142.0					10																	117075138		2203	4300	6503	SO:0001583	missense	26033	exon18			GGTTCTTCACGGG	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2929T>A	chr10.hg19:g.117075138T>A	ENSP00000347152:p.Ser977Thr	75.0	0.0		75.0	37.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	ENST00000355044.3	hg19	CCDS7592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.39|13.39	2.221977|2.221977	0.39300|0.39300	.|.	.|.	ENSG00000107518|ENSG00000107518	ENST00000526373|ENST00000355044;ENST00000423111	.|T;T	.|0.21932	.|2.56;1.98	5.34|5.34	5.34|5.34	0.76211|0.76211	.|.	.|0.059923	.|0.64402	.|D	.|0.000002	T|T	0.21267|0.21267	0.0512|0.0512	L|L	0.39898|0.39898	1.24|1.24	0.80722|0.80722	D|D	1|1	.|B;P	.|0.37573	.|0.447;0.6	.|B;B	.|0.39299	.|0.171;0.296	T|T	0.02417|0.02417	-1.1162|-1.1162	5|10	.|0.29301	.|T	.|0.29	-11.3344|-11.3344	15.3184|15.3184	0.74102|0.74102	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|74;977	.|B4DH41;Q5VV63	.|.;ATRN1_HUMAN	Y|T	106|977;74	.|ENSP00000347152:S977T;ENSP00000409624:S74T	.|ENSP00000347152:S977T	F|S	+|+	2|1	0|0	ATRNL1|ATRNL1	117065128|117065128	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.969000|0.969000	0.65631|0.65631	6.081000|6.081000	0.71309|0.71309	2.031000|2.031000	0.59945|0.59945	0.374000|0.374000	0.22700|0.22700	TTC|TCA	.	.		0.453	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	
OR52A5	390054	hgsc.bcm.edu	37	11	5153870	5153870	+	Start_Codon_SNP	SNP	C	C	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:5153870C>A	ENST00000307388.1	-	1	2	c.3G>T	c.(1-3)atG>atT	p.M1I		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	1					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		TGAATGTCGGCATGATTTGTT	0.373																																					p.M1I		Atlas-SNP	.											.	OR52A5	80	.	0			c.G3T						.						46.0	45.0	45.0					11																	5153870		2200	4293	6493	SO:0001582	initiator_codon_variant	390054	exon1			TGTCGGCATGATT	BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.3G>T	chr11.hg19:g.5153870C>A	ENSP00000303469:p.Met1Ile	89.0	0.0		85.0	21.0	NM_001005160		Missense_Mutation	SNP	ENST00000307388.1	hg19	CCDS31373.1	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467908	0.63625	.	.	ENSG00000171944	ENST00000307388	T	0.39229	1.09	5.12	5.12	0.69794	.	0.236800	0.30151	N	0.010293	T	0.41903	0.1179	.	.	.	0.80722	D	1	P	0.38420	0.63	B	0.38106	0.265	T	0.45891	-0.9230	9	0.87932	D	0	.	16.095	0.81114	0.0:1.0:0.0:0.0	.	1	Q9H2C5	O52A5_HUMAN	I	1	ENSP00000303469:M1I	ENSP00000303469:M1I	M	-	3	0	OR52A5	5110446	0.744000	0.28250	0.945000	0.38365	0.157000	0.22087	1.230000	0.32612	2.655000	0.90218	0.585000	0.79938	ATG	.	.		0.373	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142823.1	NM_001005160	Missense_Mutation
SPTY2D1	144108	hgsc.bcm.edu	37	11	18636133	18636133	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:18636133A>T	ENST00000336349.5	-	3	1923	c.1688T>A	c.(1687-1689)cTa>cAa	p.L563Q	SPTY2D1_ENST00000543776.1_5'Flank	NM_194285.2	NP_919261.2	Q68D10	SPT2_HUMAN	SPT2, Suppressor of Ty, domain containing 1 (S. cerevisiae)	563										breast(4)|cervix(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|skin(1)|stomach(1)	30						GTAGCCAGATAGGGGAGGCTT	0.413																																					p.L563Q		Atlas-SNP	.											.	SPTY2D1	72	.	0			c.T1688A						.						96.0	102.0	100.0					11																	18636133		2199	4293	6492	SO:0001583	missense	144108	exon3			CCAGATAGGGGAG	BX647798	CCDS31441.1	11p15.1	2005-10-28			ENSG00000179119	ENSG00000179119			26818	protein-coding gene	gene with protein product							Standard	NM_194285		Approved	FLJ39441, DKFZp686I068	uc001moy.3	Q68D10	OTTHUMG00000167733	ENST00000336349.5:c.1688T>A	chr11.hg19:g.18636133A>T	ENSP00000337991:p.Leu563Gln	84.0	0.0		73.0	27.0	NM_194285	Q6AWA5|Q6MZI5|Q7Z390|Q7Z470|Q86VG8|Q8N3E7|Q8N417|Q8N8I3	Missense_Mutation	SNP	ENST00000336349.5	hg19	CCDS31441.1	.	.	.	.	.	.	.	.	.	.	A	13.83	2.354252	0.41700	.	.	ENSG00000179119	ENST00000336349	T	0.23754	1.89	6.08	3.78	0.43462	.	0.859036	0.09529	N	0.789839	T	0.32496	0.0831	L	0.57536	1.79	0.09310	N	1	D	0.60575	0.988	P	0.52514	0.701	T	0.13202	-1.0518	10	0.23891	T	0.37	-0.826	5.0287	0.14398	0.6708:0.0:0.3292:0.0	.	563	Q68D10	SPT2_HUMAN	Q	563	ENSP00000337991:L563Q	ENSP00000337991:L563Q	L	-	2	0	SPTY2D1	18592709	0.019000	0.18553	0.001000	0.08648	0.935000	0.57460	2.588000	0.46137	1.131000	0.42111	0.533000	0.62120	CTA	.	.		0.413	SPTY2D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395941.1	NM_194285	
OR4C12	283093	hgsc.bcm.edu	37	11	50003316	50003316	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:50003316T>C	ENST00000335238.4	-	1	755	c.722A>G	c.(721-723)cAc>cGc	p.H241R		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	241						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						TACTATGATGTGAGAAATACA	0.403																																					p.H241R		Atlas-SNP	.											.	OR4C12	82	.	0			c.A722G						.						78.0	71.0	74.0					11																	50003316		2201	4296	6497	SO:0001583	missense	283093	exon1			ATGATGTGAGAAA	BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.722A>G	chr11.hg19:g.50003316T>C	ENSP00000334418:p.His241Arg	88.0	0.0		60.0	29.0	NM_001005270	B2RNF0|Q6IF49	Missense_Mutation	SNP	ENST00000335238.4	hg19	CCDS31496.1	.	.	.	.	.	.	.	.	.	.	.	12.80	2.045079	0.36085	.	.	ENSG00000221954	ENST00000335238	T	0.00311	8.15	2.98	1.8	0.24995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44097	U	0.000484	T	0.00936	0.0031	H	0.97564	4.03	0.32749	N	0.506648	D	0.89917	1.0	D	0.97110	1.0	T	0.13737	-1.0498	10	0.87932	D	0	.	6.7627	0.23550	0.2098:0.0:0.0:0.7902	.	241	Q96R67	OR4CC_HUMAN	R	241	ENSP00000334418:H241R	ENSP00000334418:H241R	H	-	2	0	OR4C12	49959892	1.000000	0.71417	0.996000	0.52242	0.367000	0.29736	4.180000	0.58296	0.356000	0.24157	0.325000	0.21440	CAC	.	.		0.403	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391104.1	NM_001005270	
OR8K3	219473	hgsc.bcm.edu	37	11	56086555	56086555	+	Missense_Mutation	SNP	A	A	T	rs139467696	byFrequency	TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:56086555A>T	ENST00000312711.1	+	1	773	c.773A>T	c.(772-774)tAc>tTc	p.Y258F		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	258						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					CTTTTCATGTACGTGCAGCCC	0.438																																					p.Y258F		Atlas-SNP	.											.	OR8K3	92	.	0			c.A773T						.						115.0	102.0	107.0					11																	56086555		2201	4296	6497	SO:0001583	missense	219473	exon1			TCATGTACGTGCA	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.773A>T	chr11.hg19:g.56086555A>T	ENSP00000323555:p.Tyr258Phe	95.0	0.0		102.0	27.0	NM_001005202	Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	hg19	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	A	16.29	3.080550	0.55753	.	.	ENSG00000181689	ENST00000312711	T	0.00291	8.27	4.28	4.28	0.50868	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000091	T	0.00754	0.0025	H	0.96861	3.895	0.25816	N	0.98435	P	0.49961	0.93	P	0.51079	0.658	T	0.07712	-1.0758	10	0.87932	D	0	.	13.0251	0.58810	1.0:0.0:0.0:0.0	.	258	Q8NH51	OR8K3_HUMAN	F	258	ENSP00000323555:Y258F	ENSP00000323555:Y258F	Y	+	2	0	OR8K3	55843131	0.991000	0.36638	1.000000	0.80357	0.719000	0.41307	3.829000	0.55760	1.917000	0.55516	0.386000	0.25728	TAC	.	A|0.999;G|0.001		0.438	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
CLP1	10978	hgsc.bcm.edu	37	11	57427365	57427365	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:57427365G>A	ENST00000533682.1	+	2	1142	c.417G>A	c.(415-417)gtG>gtA	p.V139V	CLP1_ENST00000525602.1_Silent_p.V139V|CLP1_ENST00000302731.4_Intron|CLP1_ENST00000529430.1_Silent_p.V150V			Q5KU26	COL12_HUMAN	cleavage and polyadenylation factor I subunit 1	0					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|stomach(1)	15						ACTACGCAGTGCGTTTGGGCC	0.602																																					p.V139V		Atlas-SNP	.											.	CLP1	40	.	0			c.G417A						.						100.0	81.0	87.0					11																	57427365		2201	4296	6497	SO:0001819	synonymous_variant	10978	exon2			CGCAGTGCGTTTG	BC000446	CCDS7964.1, CCDS44600.1	11q12.1	2012-10-02	2012-10-02		ENSG00000172409	ENSG00000172409	2.7.1.78		16999	protein-coding gene	gene with protein product	"""ATP/GTPbinding protein"", ""polyribonucleotide 5'-hydroxyl-kinase"""	608757	"""CLP1, cleavage and polyadenylation factor I subunit, homolog (S. cerevisiae)"""			8896421, 11060040	Standard	NM_006831		Approved	HEAB, hClp1	uc001nkw.3	Q92989	OTTHUMG00000167146	ENST00000533682.1:c.417G>A	chr11.hg19:g.57427365G>A		94.0	0.0		100.0	42.0	NM_006831	Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Silent	SNP	ENST00000533682.1	hg19	CCDS7964.1																																																																																			.	.		0.602	CLP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393462.3	NM_006831	
SCGB1D2	10647	hgsc.bcm.edu	37	11	62012145	62012145	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:62012145A>C	ENST00000244926.3	+	3	345	c.247A>C	c.(247-249)Aaa>Caa	p.K83Q	RP11-703H8.9_ENST00000529875.1_RNA	NM_006551.3	NP_006542.1	O95969	SG1D2_HUMAN	secretoglobin, family 1D, member 2	83						extracellular space (GO:0005615)				breast(1)|endometrium(1)|lung(1)	3						ATTTTAGGTGAAAATATTGAA	0.433																																					p.K83Q		Atlas-SNP	.											.	SCGB1D2	11	.	0			c.A247C						.						123.0	116.0	118.0					11																	62012145		2201	4299	6500	SO:0001583	missense	10647	exon3			TAGGTGAAAATAT	AJ224172	CCDS8017.1	11q13	2011-12-14			ENSG00000124935	ENSG00000124935		"""Secretoglobins"""	18396	protein-coding gene	gene with protein product	"""prostatein-like lipophilin B"", ""lipophilin B (uteroglobin family member), prostatein-like"""	615061				10066439, 9720917, 22155607	Standard	XM_006718422		Approved	LPHB, LIPB	uc001ntb.3	O95969	OTTHUMG00000167508	ENST00000244926.3:c.247A>C	chr11.hg19:g.62012145A>C	ENSP00000244926:p.Lys83Gln	34.0	0.0		43.0	16.0	NM_006551	Q2M3N9	Missense_Mutation	SNP	ENST00000244926.3	hg19	CCDS8017.1	.	.	.	.	.	.	.	.	.	.	A	10.59	1.393634	0.25205	.	.	ENSG00000124935	ENST00000244926	T	0.16743	2.32	2.87	-2.8	0.05823	.	3.378730	0.01520	U	0.018313	T	0.14356	0.0347	.	.	.	0.09310	N	1	P	0.47841	0.901	P	0.48770	0.589	T	0.10683	-1.0619	9	0.23891	T	0.37	.	0.3499	0.00347	0.3683:0.1936:0.2492:0.1889	.	83	O95969	SG1D2_HUMAN	Q	83	ENSP00000244926:K83Q	ENSP00000244926:K83Q	K	+	1	0	SCGB1D2	61768721	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.191000	0.09601	-0.606000	0.05746	-0.815000	0.03128	AAA	.	.		0.433	SCGB1D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394859.1	NM_006551	
NXF1	10482	hgsc.bcm.edu	37	11	62563804	62563804	+	Nonsense_Mutation	SNP	C	C	A	rs367975743		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:62563804C>A	ENST00000532297.1	-	16	1929	c.1300G>T	c.(1300-1302)Gag>Tag	p.E434*	NXF1_ENST00000294172.2_Nonsense_Mutation_p.E434*|NXF1_ENST00000531709.2_3'UTR|NXF1_ENST00000533048.1_5'UTR			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	434	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTGAAATACTCGGCTAAGCTG	0.483																																					p.E434X		Atlas-SNP	.											.	NXF1	67	.	0			c.G1300T						.						183.0	183.0	183.0					11																	62563804		2201	4299	6500	SO:0001587	stop_gained	10482	exon15			AATACTCGGCTAA	AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.1300G>T	chr11.hg19:g.62563804C>A	ENSP00000436679:p.Glu434*	144.0	0.0		129.0	63.0	NM_006362	B4E269|Q99799|Q9UQL2	Nonsense_Mutation	SNP	ENST00000532297.1	hg19	CCDS8037.1	.	.	.	.	.	.	.	.	.	.	C	39	7.782608	0.98486	.	.	ENSG00000162231	ENST00000294172;ENST00000532297;ENST00000530875	.	.	.	5.28	3.4	0.38934	.	0.147941	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08599	T	0.76	-23.3521	10.1072	0.42541	0.0:0.8351:0.0:0.1649	.	.	.	.	X	434;434;477	.	ENSP00000294172:E434X	E	-	1	0	NXF1	62320380	0.999000	0.42202	0.672000	0.29872	0.235000	0.25334	4.332000	0.59279	0.789000	0.33779	-0.266000	0.10368	GAG	.	.		0.483	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395365.2	NM_006362	
SHANK2	22941	hgsc.bcm.edu	37	11	70333713	70333713	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:70333713G>A	ENST00000423696.2	-	15	1584	c.1548C>T	c.(1546-1548)ccC>ccT	p.P516P	SHANK2_ENST00000409161.1_Silent_p.P299P|SHANK2_ENST00000449833.2_Silent_p.P300P|SHANK2_ENST00000338508.4_Silent_p.P896P			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	516	Pro-rich.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			GTGGGGACGGGGGCACAGACT	0.577																																					p.P307P		Atlas-SNP	.											.	SHANK2	340	.	0			c.C921T						.						41.0	39.0	40.0					11																	70333713		2200	4294	6494	SO:0001819	synonymous_variant	22941	exon10			GGACGGGGGCACA	AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.1548C>T	chr11.hg19:g.70333713G>A		114.0	0.0		63.0	27.0	NM_133266	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Silent	SNP	ENST00000423696.2	hg19																																																																																				.	.		0.577	SHANK2-203	KNOWN	basic	protein_coding	protein_coding		NM_012309	
C2CD3	26005	hgsc.bcm.edu	37	11	73768566	73768566	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr11:73768566C>T	ENST00000334126.7	-	25	5201	c.4975G>A	c.(4975-4977)Gta>Ata	p.V1659I	C2CD3_ENST00000313663.7_Missense_Mutation_p.V1659I			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	1659	C2 2.				brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GGTATCGATACTTTCCGCTCT	0.453																																					p.V1659I		Atlas-SNP	.											C2CD3_ENST00000334126,colon,carcinoma,0,2	C2CD3	288	.	0			c.G4975A						.						109.0	109.0	109.0					11																	73768566		2200	4293	6493	SO:0001583	missense	26005	exon25			TCGATACTTTCCG	BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.4975G>A	chr11.hg19:g.73768566C>T	ENSP00000334379:p.Val1659Ile	96.0	0.0		54.0	50.0	NM_015531	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Missense_Mutation	SNP	ENST00000334126.7	hg19		.	.	.	.	.	.	.	.	.	.	C	16.16	3.045277	0.55110	.	.	ENSG00000168014	ENST00000334126;ENST00000313663;ENST00000313681;ENST00000414160	T;T;T	0.68765	-0.35;-0.35;-0.35	5.03	5.03	0.67393	.	0.118234	0.56097	D	0.000022	T	0.64305	0.2586	L	0.51422	1.61	0.39036	D	0.96004	B	0.06786	0.001	B	0.11329	0.006	T	0.64236	-0.6455	10	0.59425	D	0.04	-7.4087	18.3221	0.90242	0.0:1.0:0.0:0.0	.	1659	Q4AC94-1	.	I	1659;1659;1640;467	ENSP00000334379:V1659I;ENSP00000323339:V1659I;ENSP00000388750:V467I	ENSP00000323339:V1659I	V	-	1	0	C2CD3	73446214	1.000000	0.71417	0.994000	0.49952	0.773000	0.43773	6.389000	0.73199	2.505000	0.84491	0.650000	0.86243	GTA	.	.		0.453	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015531	
MRPS35	60488	hgsc.bcm.edu	37	12	27872748	27872748	+	Missense_Mutation	SNP	A	A	G	rs370001683		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr12:27872748A>G	ENST00000081029.3	+	4	400	c.329A>G	c.(328-330)aAt>aGt	p.N110S	MRPS35_ENST00000538315.1_Missense_Mutation_p.N110S	NM_021821.3	NP_068593.2	Q9Y2Q9	RT28_HUMAN	mitochondrial ribosomal protein S35	0						mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	6	Lung SC(9;0.0873)					AAGATTCCCAATTTTCTGCAT	0.274																																					p.N110S		Atlas-SNP	.											.	MRPS35	26	.	0			c.A329G						.						44.0	50.0	48.0					12																	27872748		2193	4286	6479	SO:0001583	missense	60488	exon4			TTCCCAATTTTCT	AF182422	CCDS8714.1, CCDS53769.1	12p11	2012-09-13			ENSG00000061794	ENSG00000061794		"""Mitochondrial ribosomal proteins / small subunits"""	16635	protein-coding gene	gene with protein product		611995				11279123	Standard	NM_021821		Approved	MRPS28, MDS023	uc001rih.3	P82673	OTTHUMG00000169215	ENST00000081029.3:c.329A>G	chr12.hg19:g.27872748A>G	ENSP00000081029:p.Asn110Ser	36.0	0.0		29.0	11.0	NM_001190864	B2RDZ7|Q96Q21	Missense_Mutation	SNP	ENST00000081029.3	hg19	CCDS8714.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.507660	0.85282	.	.	ENSG00000061794	ENST00000081029;ENST00000321446;ENST00000538315	T;T	0.59502	0.3;0.26	6.08	6.08	0.98989	.	0.042765	0.85682	D	0.000000	T	0.75532	0.3862	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.977	T	0.77381	-0.2609	10	0.52906	T	0.07	-2.3497	14.0274	0.64594	1.0:0.0:0.0:0.0	.	110;110	P82673-2;P82673	.;RT35_HUMAN	S	110	ENSP00000081029:N110S;ENSP00000445390:N110S	ENSP00000081029:N110S	N	+	2	0	MRPS35	27764015	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	8.037000	0.88933	2.333000	0.79357	0.533000	0.62120	AAT	.	.		0.274	MRPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402897.1	NM_021821	
KRT84	3890	hgsc.bcm.edu	37	12	52779057	52779057	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr12:52779057G>C	ENST00000257951.3	-	1	379	c.313C>G	c.(313-315)Ctg>Gtg	p.L105V	RP3-416H24.4_ENST00000547174.1_RNA	NM_033045.3	NP_149034.2	Q9NSB2	KRT84_HUMAN	keratin 84	105	Head.				hair follicle development (GO:0001942)|nail development (GO:0035878)|regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of epidermis (GO:0030280)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|liver(1)|lung(10)|skin(3)	27	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CCAAAGCCCAGACCAACACAG	0.592																																					p.L105V		Atlas-SNP	.											.	KRT84	61	.	0			c.C313G						.						182.0	170.0	174.0					12																	52779057		2203	4300	6503	SO:0001583	missense	3890	exon1			AGCCCAGACCAAC	Y19209	CCDS8825.1	12q13	2013-06-25	2006-07-17	2006-07-17	ENSG00000161849	ENSG00000161849		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6461	protein-coding gene	gene with protein product	"""hard keratin type II 4"""	602766	"""keratin, hair, basic, 4"""	KRTHB4		2431943, 16831889	Standard	NM_033045		Approved	Hb-4	uc001sah.1	Q9NSB2	OTTHUMG00000169634	ENST00000257951.3:c.313C>G	chr12.hg19:g.52779057G>C	ENSP00000257951:p.Leu105Val	102.0	0.0		91.0	42.0	NM_033045	B2RA43|Q6ISB0|Q701L6	Missense_Mutation	SNP	ENST00000257951.3	hg19	CCDS8825.1	.	.	.	.	.	.	.	.	.	.	G	0.055	-1.237816	0.01493	.	.	ENSG00000161849	ENST00000257951	D	0.85556	-2.0	5.01	1.13	0.20643	.	0.000000	0.38778	N	0.001577	T	0.76673	0.4020	L	0.45581	1.43	0.09310	N	1	B	0.26195	0.144	B	0.21708	0.036	T	0.60321	-0.7286	10	0.20519	T	0.43	.	10.4716	0.44640	0.3887:0.0:0.6113:0.0	.	105	Q9NSB2	KRT84_HUMAN	V	105	ENSP00000257951:L105V	ENSP00000257951:L105V	L	-	1	2	KRT84	51065324	0.000000	0.05858	0.923000	0.36655	0.022000	0.10575	-0.089000	0.11180	0.377000	0.24735	-0.192000	0.12808	CTG	.	.		0.592	KRT84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405187.1	NM_033045	
TMPO	7112	hgsc.bcm.edu	37	12	98921777	98921777	+	Silent	SNP	T	T	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr12:98921777T>G	ENST00000556029.1	+	2	749	c.393T>G	c.(391-393)ccT>ccG	p.P131P	TMPO_ENST00000393053.2_Silent_p.P131P|TMPO_ENST00000261210.5_Silent_p.P131P|TMPO_ENST00000266732.4_Silent_p.P131P|TMPO_ENST00000343315.5_Silent_p.P131P	NM_001032283.2	NP_001027454.1	P42167	LAP2B_HUMAN	thymopoietin	131	LEM. {ECO:0000255|PROSITE- ProRule:PRU00313}.|Nucleoplasmic. {ECO:0000255}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)|lamin binding (GO:0005521)			breast(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						GAGTGAATCCTGGTCCTATTG	0.353																																					p.P131P		Atlas-SNP	.											.	TMPO	111	.	0			c.T393G						.						145.0	151.0	149.0					12																	98921777		2203	4300	6503	SO:0001819	synonymous_variant	7112	exon2			GAATCCTGGTCCT		CCDS9064.1, CCDS31879.1, CCDS31880.1	12q22	2014-09-17			ENSG00000120802	ENSG00000120802			11875	protein-coding gene	gene with protein product	"""LEM domain containing 4"""	188380				7517549	Standard	NM_003276		Approved	TP, LAP2, LEMD4	uc001tfh.2	P42166	OTTHUMG00000170210	ENST00000556029.1:c.393T>G	chr12.hg19:g.98921777T>G		113.0	0.0		103.0	41.0	NM_003276	A2T926|Q14861	Silent	SNP	ENST00000556029.1	hg19	CCDS31879.1																																																																																			.	.		0.353	TMPO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407973.2	NM_003276	
VSIG10	54621	hgsc.bcm.edu	37	12	118506351	118506351	+	Silent	SNP	C	C	T	rs373328738		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr12:118506351C>T	ENST00000359236.5	-	8	1674	c.1398G>A	c.(1396-1398)gaG>gaA	p.E466E		NM_019086.5	NP_061959.2	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10	466	Glu-rich.					integral component of membrane (GO:0016021)				endometrium(5)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|urinary_tract(1)	17						cctcctcctcctcttcctctt	0.458																																					p.E466E		Atlas-SNP	.											.	VSIG10	41	.	0			c.G1398A						.						96.0	91.0	92.0					12																	118506351		2045	4191	6236	SO:0001819	synonymous_variant	54621	exon8			CTCCTCCTCTTCC		CCDS44992.1	12q24.23	2013-01-29			ENSG00000176834	ENSG00000176834		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26078	protein-coding gene	gene with protein product						12477932	Standard	NM_019086		Approved		uc001tws.3	Q8N0Z9		ENST00000359236.5:c.1398G>A	chr12.hg19:g.118506351C>T		78.0	0.0		117.0	6.0	NM_019086	Q9NWQ7	Silent	SNP	ENST00000359236.5	hg19	CCDS44992.1																																																																																			.	.		0.458	VSIG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401273.2	NM_019086	
CCDC60	160777	hgsc.bcm.edu	37	12	119909909	119909909	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr12:119909909G>A	ENST00000327554.2	+	3	746	c.281G>A	c.(280-282)aGa>aAa	p.R94K	RP11-768F21.1_ENST00000509470.2_lincRNA|CCDC60_ENST00000546345.1_3'UTR	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	94										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		GAGGAGGAAAGAAATAAATTC	0.433																																					p.R94K		Atlas-SNP	.											.	CCDC60	84	.	0			c.G281A						.						135.0	141.0	139.0					12																	119909909		2203	4300	6503	SO:0001583	missense	160777	exon3			AGGAAAGAAATAA	BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.281G>A	chr12.hg19:g.119909909G>A	ENSP00000333374:p.Arg94Lys	134.0	0.0		82.0	32.0	NM_178499		Missense_Mutation	SNP	ENST00000327554.2	hg19	CCDS9190.1	.	.	.	.	.	.	.	.	.	.	G	5.558	0.287872	0.10513	.	.	ENSG00000183273	ENST00000327554	T	0.28069	1.63	5.22	-0.0987	0.13627	.	0.491502	0.19327	N	0.116982	T	0.17365	0.0417	L	0.35723	1.085	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.17684	-1.0361	9	.	.	.	-2.5914	3.4579	0.07522	0.2602:0.0:0.4283:0.3116	.	94	Q8IWA6	CCD60_HUMAN	K	94	ENSP00000333374:R94K	.	R	+	2	0	CCDC60	118394292	0.003000	0.15002	0.002000	0.10522	0.295000	0.27426	-0.126000	0.10563	-0.334000	0.08463	0.407000	0.27541	AGA	.	.		0.433	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401680.1	NM_178499	
TMEM132B	114795	hgsc.bcm.edu	37	12	125900204	125900204	+	Missense_Mutation	SNP	C	C	T	rs372738030		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr12:125900204C>T	ENST00000299308.3	+	3	1080	c.1072C>T	c.(1072-1074)Cgc>Tgc	p.R358C		NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	358						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CATGGGCCATCGCCCGGACAC	0.592																																					p.R358C		Atlas-SNP	.											.	TMEM132B	207	.	0			c.C1072T						.						48.0	56.0	53.0					12																	125900204		2176	4265	6441	SO:0001583	missense	114795	exon3			GGCCATCGCCCGG	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1072C>T	chr12.hg19:g.125900204C>T	ENSP00000299308:p.Arg358Cys	205.0	0.0		262.0	90.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	hg19	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	13.37	2.218412	0.39201	.	.	ENSG00000139364	ENST00000299308	T	0.14640	2.49	5.63	4.66	0.58398	.	.	.	.	.	T	0.06781	0.0173	N	0.08118	0	0.19575	N	0.999966	P	0.42078	0.77	B	0.36885	0.235	T	0.13202	-1.0518	9	0.56958	D	0.05	.	7.5367	0.27714	0.2032:0.5927:0.2041:0.0	.	358	Q14DG7	T132B_HUMAN	C	358	ENSP00000299308:R358C	ENSP00000299308:R358C	R	+	1	0	TMEM132B	124466157	0.011000	0.17503	0.036000	0.18154	0.968000	0.65278	2.133000	0.42093	2.670000	0.90874	0.655000	0.94253	CGC	.	.		0.592	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
RAB2B	84932	hgsc.bcm.edu	37	14	21943061	21943061	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr14:21943061C>T	ENST00000397762.1	-	3	251	c.151G>A	c.(151-153)Gat>Aat	p.D51N	TOX4_ENST00000405508.1_5'Flank|TOX4_ENST00000262709.3_5'Flank|RAB2B_ENST00000461909.1_5'UTR|TOX4_ENST00000448790.2_5'Flank	NM_001163380.1|NM_032846.3	NP_001156852.1|NP_116235.2	Q8WUD1	RAB2B_HUMAN	RAB2B, member RAS oncogene family	51					positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			NS(1)|central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)	6	all_cancers(95;0.000858)		Epithelial(56;1.53e-06)|all cancers(55;1.44e-05)	GBM - Glioblastoma multiforme(265;0.00391)		TGTTTTCCATCAATGTTGACC	0.428																																					p.D51N	Melanoma(131;1007 1750 28652 34486 42672)	Atlas-SNP	.											.	RAB2B	19	.	0			c.G151A						.						175.0	157.0	163.0					14																	21943061		2203	4300	6503	SO:0001583	missense	84932	exon3			TTCCATCAATGTT	AK027730	CCDS9570.1	14q11.1	2006-12-18			ENSG00000129472	ENSG00000129472		"""RAB, member RAS oncogene"""	20246	protein-coding gene	gene with protein product		607466				12376746	Standard	NM_032846		Approved	FLJ14824	uc010tlt.2	Q8WUD1	OTTHUMG00000029693	ENST00000397762.1:c.151G>A	chr14.hg19:g.21943061C>T	ENSP00000380869:p.Asp51Asn	42.0	0.0		121.0	9.0	NM_032846	B2RD03|D3DS24|Q6NZ33	Missense_Mutation	SNP	ENST00000397762.1	hg19	CCDS9570.1	.	.	.	.	.	.	.	.	.	.	C	17.24	3.338225	0.60963	.	.	ENSG00000129472	ENST00000397762;ENST00000304034	T	0.80909	-1.43	5.81	5.81	0.92471	Small GTP-binding protein domain (1);	0.000000	0.64402	D	0.000001	T	0.73418	0.3584	L	0.37800	1.135	0.80722	D	1	B	0.09022	0.002	B	0.17433	0.018	T	0.68804	-0.5312	10	0.54805	T	0.06	.	12.8928	0.58082	0.0:0.9222:0.0:0.0778	.	51	Q8WUD1	RAB2B_HUMAN	N	51	ENSP00000380869:D51N	ENSP00000302005:D51N	D	-	1	0	RAB2B	21012901	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.580000	0.67464	2.756000	0.94617	0.655000	0.94253	GAT	.	.		0.428	RAB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074053.4		
RPS6KA5	9252	hgsc.bcm.edu	37	14	91338567	91338567	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr14:91338567C>A	ENST00000261991.3	-	17	2433	c.2260G>T	c.(2260-2262)Gag>Tag	p.E754*	RPS6KA5_ENST00000536315.2_Nonsense_Mutation_p.E675*	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	754					axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CTGCGCGTCTCGGTACTGGTG	0.478																																					p.E754X		Atlas-SNP	.											RPS6KA5_ENST00000261991,colon,carcinoma,0,2	RPS6KA5	135	.	0			c.G2260T						.						138.0	120.0	126.0					14																	91338567		2203	4300	6503	SO:0001587	stop_gained	9252	exon17			GCGTCTCGGTACT	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.2260G>T	chr14.hg19:g.91338567C>A	ENSP00000261991:p.Glu754*	143.0	0.0		63.0	57.0	NM_004755	O95316|Q96AF7	Nonsense_Mutation	SNP	ENST00000261991.3	hg19	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	C	39	7.699005	0.98441	.	.	ENSG00000100784	ENST00000261991;ENST00000536315	.	.	.	5.25	5.25	0.73442	.	0.050091	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	19.2225	0.93803	0.0:1.0:0.0:0.0	.	.	.	.	X	754;675	.	ENSP00000261991:E754X	E	-	1	0	RPS6KA5	90408320	1.000000	0.71417	0.959000	0.39883	0.945000	0.59286	7.776000	0.85560	2.611000	0.88343	0.655000	0.94253	GAG	.	.		0.478	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	NM_004755	
IREB2	3658	hgsc.bcm.edu	37	15	78778141	78778141	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr15:78778141C>T	ENST00000258886.8	+	13	1817	c.1668C>T	c.(1666-1668)taC>taT	p.Y556Y		NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	556					aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TTACACATTACCTCAGTTCAA	0.413																																					p.Y556Y	NSCLC(200;764 2208 35157 49871 50830)	Atlas-SNP	.											.	IREB2	106	.	0			c.C1668T						.						172.0	159.0	164.0					15																	78778141		2196	4293	6489	SO:0001819	synonymous_variant	3658	exon13			ACATTACCTCAGT	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.1668C>T	chr15.hg19:g.78778141C>T		76.0	0.0		128.0	22.0	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Silent	SNP	ENST00000258886.8	hg19	CCDS10302.1																																																																																			.	.		0.413	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	
PLIN1	5346	hgsc.bcm.edu	37	15	90210270	90210270	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr15:90210270G>A	ENST00000300055.5	-	8	1271	c.1106C>T	c.(1105-1107)cCa>cTa	p.P369L	PLIN1_ENST00000430628.2_Missense_Mutation_p.P369L	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	369					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						AGCAGGGGCTGGTGTGAGGTG	0.607																																					p.P369L		Atlas-SNP	.											.	PLIN1	36	.	0			c.C1106T						.						75.0	62.0	66.0					15																	90210270		2200	4299	6499	SO:0001583	missense	5346	exon8			GGGGCTGGTGTGA	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.1106C>T	chr15.hg19:g.90210270G>A	ENSP00000300055:p.Pro369Leu	110.0	0.0		155.0	59.0	NM_001145311	Q8N5Y6	Missense_Mutation	SNP	ENST00000300055.5	hg19	CCDS10353.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078987	0.36662	.	.	ENSG00000166819	ENST00000300055;ENST00000430628	T;T	0.07567	3.18;3.18	5.13	4.19	0.49359	.	2.061150	0.02074	N	0.051778	T	0.20292	0.0488	M	0.71581	2.175	0.09310	N	0.999999	P	0.40000	0.698	B	0.43413	0.419	T	0.37502	-0.9703	10	0.49607	T	0.09	-3.9652	12.2025	0.54335	0.0:0.0:0.8291:0.1709	.	369	O60240	PLIN1_HUMAN	L	369	ENSP00000300055:P369L;ENSP00000402167:P369L	ENSP00000300055:P369L	P	-	2	0	PLIN1	88011274	0.098000	0.21812	0.010000	0.14722	0.220000	0.24768	2.995000	0.49441	1.113000	0.41760	0.561000	0.74099	CCA	.	.		0.607	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313424.2	NM_002666	
AXIN1	8312	hgsc.bcm.edu	37	16	396164	396164	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr16:396164C>A	ENST00000262320.3	-	2	1233	c.862G>T	c.(862-864)Gaa>Taa	p.E288*	AXIN1_ENST00000481769.1_Intron|AXIN1_ENST00000354866.3_Nonsense_Mutation_p.E288*	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	288	Interaction with TP53. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TCTCTGCCTTCGCTGTACCGT	0.617																																					p.E288X		Atlas-SNP	.											.	AXIN1	290	.	0			c.G862T						.						35.0	37.0	37.0					16																	396164		2203	4300	6503	SO:0001587	stop_gained	8312	exon2			TGCCTTCGCTGTA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.862G>T	chr16.hg19:g.396164C>A	ENSP00000262320:p.Glu288*	28.0	0.0		36.0	35.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Nonsense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	42	9.582994	0.99211	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	5.4	5.4	0.78164	.	0.104367	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.173	0.93588	0.0:1.0:0.0:0.0	.	.	.	.	X	288	.	ENSP00000262320:E288X	E	-	1	0	AXIN1	336165	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.679000	0.84048	2.516000	0.84829	0.655000	0.94253	GAA	.	.		0.617	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
KIF22	3835	hgsc.bcm.edu	37	16	29816289	29816289	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr16:29816289G>T	ENST00000160827.4	+	12	1872	c.1832G>T	c.(1831-1833)gGc>gTc	p.G611V	KIF22_ENST00000400751.5_Missense_Mutation_p.G543V|MAZ_ENST00000545521.1_5'Flank|KIF22_ENST00000561482.1_Missense_Mutation_p.G543V|KIF22_ENST00000569382.2_Missense_Mutation_p.G557V|MAZ_ENST00000563402.1_5'Flank|MAZ_ENST00000219782.6_5'Flank|MAZ_ENST00000322945.6_5'Flank|MAZ_ENST00000566906.2_5'Flank|MAZ_ENST00000562337.1_5'Flank|AC009133.15_ENST00000566537.1_RNA	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	611					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						CAGCGCATTGGCCCGAAGAAG	0.642																																					p.G611V		Atlas-SNP	.											.	KIF22	29	.	0			c.G1832T						.						41.0	43.0	42.0					16																	29816289		2197	4295	6492	SO:0001583	missense	3835	exon12			GCATTGGCCCGAA	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1832G>T	chr16.hg19:g.29816289G>T	ENSP00000160827:p.Gly611Val	42.0	0.0		51.0	26.0	NM_007317	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	ENST00000160827.4	hg19	CCDS10653.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.562918	0.65538	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	D;D	0.84442	-1.8;-1.85	5.64	5.64	0.86602	Helix-hairpin-helix DNA-binding motif, class 1 (1);	.	.	.	.	D	0.95726	0.8610	H	0.98407	4.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97274	0.9913	9	0.87932	D	0	.	17.189	0.86874	0.0:0.0:1.0:0.0	.	543;611	B7Z265;Q14807	.;KIF22_HUMAN	V	611;543	ENSP00000160827:G611V;ENSP00000383562:G543V	ENSP00000160827:G611V	G	+	2	0	KIF22	29723790	1.000000	0.71417	1.000000	0.80357	0.088000	0.18126	5.726000	0.68515	2.659000	0.90383	0.561000	0.74099	GGC	.	.		0.642	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2		
BRD7	29117	hgsc.bcm.edu	37	16	50354273	50354273	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr16:50354273C>A	ENST00000394688.3	-	15	1801	c.1642G>T	c.(1642-1644)Gag>Tag	p.E548*	BRD7_ENST00000394689.2_Nonsense_Mutation_p.E549*			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	548					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CTGGTGGTCTCATCAAGTTTC	0.478																																					p.E549X		Atlas-SNP	.											.	BRD7	61	.	0			c.G1645T						.						107.0	102.0	104.0					16																	50354273		2198	4300	6498	SO:0001587	stop_gained	29117	exon15			TGGTCTCATCAAG	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1642G>T	chr16.hg19:g.50354273C>A	ENSP00000378180:p.Glu548*	44.0	0.0		27.0	27.0	NM_001173984	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Nonsense_Mutation	SNP	ENST00000394688.3	hg19	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	C	42	9.334786	0.99140	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	.	.	.	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-18.4799	19.7507	0.96267	0.0:1.0:0.0:0.0	.	.	.	.	X	548;549	.	ENSP00000378180:E548X	E	-	1	0	BRD7	48911774	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.442000	0.80503	2.722000	0.93159	0.655000	0.94253	GAG	.	.		0.478	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
ANKFN1	162282	hgsc.bcm.edu	37	17	54543824	54543824	+	Silent	SNP	A	A	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr17:54543824A>T	ENST00000318698.2	+	14	1709	c.1674A>T	c.(1672-1674)tcA>tcT	p.S558S	ANKFN1_ENST00000566473.2_Silent_p.S558S	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	558										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TGCTTTATTCATTTTTTAATG	0.413																																					p.S558S		Atlas-SNP	.											.	ANKFN1	115	.	0			c.A1674T						.						105.0	94.0	98.0					17																	54543824		2203	4300	6503	SO:0001819	synonymous_variant	162282	exon14			TTATTCATTTTTT	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1674A>T	chr17.hg19:g.54543824A>T		133.0	0.0		161.0	78.0	NM_153228		Silent	SNP	ENST00000318698.2	hg19	CCDS32686.1																																																																																			.	.		0.413	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
FBF1	85302	hgsc.bcm.edu	37	17	73910864	73910864	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr17:73910864G>A	ENST00000586717.1	-	24	3009	c.2736C>T	c.(2734-2736)gaC>gaT	p.D912D	FBF1_ENST00000319129.5_Silent_p.D911D|RP11-552F3.12_ENST00000587556.1_5'Flank|FBF1_ENST00000389570.4_Silent_p.D912D			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	912					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						CCCGCTGGGTGTCCACCTGCA	0.706																																					p.D911D		Atlas-SNP	.											.	FBF1	48	.	0			c.C2733T						.						15.0	20.0	18.0					17																	73910864		2107	4203	6310	SO:0001819	synonymous_variant	85302	exon24			CTGGGTGTCCACC	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.2736C>T	chr17.hg19:g.73910864G>A		62.0	0.0		54.0	23.0	NM_001080542	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Silent	SNP	ENST00000586717.1	hg19																																																																																				.	.		0.706	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	
ANKLE1	126549	hgsc.bcm.edu	37	19	17393777	17393777	+	Silent	SNP	G	G	A	rs368355885		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr19:17393777G>A	ENST00000394458.3	+	4	702	c.426G>A	c.(424-426)ggG>ggA	p.G142G	ANKLE1_ENST00000404085.1_Silent_p.G164G|ANKLE1_ENST00000594072.1_Silent_p.G131G|ANKLE1_ENST00000433424.2_Silent_p.G196G|ANKLE1_ENST00000598347.1_Silent_p.G142G	NM_152363.4	NP_689576	Q8NAG6	ANKL1_HUMAN	ankyrin repeat and LEM domain containing 1	142										large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	7						CCCGGATCGGGGCAGAGACTC	0.682											OREG0025341	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G142G		Atlas-SNP	.											.	ANKLE1	27	.	0			c.G426A						.	G		0,4360		0,0,2180	10.0	14.0	13.0		426	0.8	0.0	19		13	2,8514		0,2,4256	no	coding-synonymous	ANKLE1	NM_152363.4		0,2,6436	AA,AG,GG		0.0235,0.0,0.0155		142/616	17393777	2,12874	2180	4258	6438	SO:0001819	synonymous_variant	126549	exon4			GATCGGGGCAGAG	AK096688	CCDS12354.2, CCDS12354.3	19p13.11	2013-01-10	2008-03-25	2008-03-25	ENSG00000160117	ENSG00000160117		"""Ankyrin repeat domain containing"""	26812	protein-coding gene	gene with protein product	"""LEM domain containing 6"""		"""ankyrin repeat domain 41"""	ANKRD41			Standard	NM_152363		Approved	FLJ39369, LEMD6	uc002nga.2	Q8NAG6	OTTHUMG00000150839	ENST00000394458.3:c.426G>A	chr19.hg19:g.17393777G>A		55.0	0.0	717	91.0	12.0	NM_152363	A8VU82|Q8N8J8	Silent	SNP	ENST00000394458.3	hg19	CCDS12354.2																																																																																			.	.		0.682	ANKLE1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325392.2	NM_152363	
ARHGAP35	2909	hgsc.bcm.edu	37	19	47425012	47425012	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr19:47425012G>A	ENST00000404338.3	+	1	3080	c.3080G>A	c.(3079-3081)aGc>aAc	p.S1027N		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1027					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										TTCATTATGAGCAATTTTGAG	0.423																																					p.S1027N		Atlas-SNP	.											.	.	.	.	0			c.G3080A						.						60.0	57.0	58.0					19																	47425012		1866	4105	5971	SO:0001583	missense	2909	exon1			TTATGAGCAATTT	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3080G>A	chr19.hg19:g.47425012G>A	ENSP00000385720:p.Ser1027Asn	67.0	0.0		58.0	26.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	hg19	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.584263	0.28268	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.07216	3.21	5.76	5.76	0.90799	.	0.270973	0.47455	D	0.000240	T	0.05044	0.0135	N	0.08118	0	0.41890	D	0.990361	B	0.06786	0.001	B	0.11329	0.006	T	0.47086	-0.9144	10	0.30854	T	0.27	-30.9876	12.1257	0.53915	0.0796:0.0:0.9204:0.0	.	1027	Q9NRY4-2	.	N	1027	ENSP00000385720:S1027N	ENSP00000324820:S1027N	S	+	2	0	ARHGAP35	52116852	0.992000	0.36948	1.000000	0.80357	0.984000	0.73092	1.557000	0.36299	2.726000	0.93360	0.655000	0.94253	AGC	.	.		0.423	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
ZNF17	7565	hgsc.bcm.edu	37	19	57931108	57931108	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr19:57931108C>T	ENST00000601808.1	+	3	461	c.248C>T	c.(247-249)gCc>gTc	p.A83V	AC003002.6_ENST00000596400.1_Missense_Mutation_p.A95V|AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000595206.1_3'UTR|ZNF17_ENST00000307658.7_Missense_Mutation_p.A85V	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	83	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		ACCCAGAAGGCCCAGCCCTGT	0.527																																					p.A83V	Melanoma(149;1637 1853 29914 42869 44988)	Atlas-SNP	.											.	ZNF17	49	.	0			c.C248T						.						107.0	105.0	106.0					19																	57931108		2203	4300	6503	SO:0001583	missense	7565	exon3			AGAAGGCCCAGCC	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.248C>T	chr19.hg19:g.57931108C>T	ENSP00000471905:p.Ala83Val	125.0	0.0		136.0	24.0	NM_006959	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	ENST00000601808.1	hg19	CCDS42636.1	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728487	0.30593	.	.	ENSG00000186272	ENST00000307658	.	.	.	1.85	0.78	0.18556	Krueppel-associated box (1);	.	.	.	.	T	0.26159	0.0638	L	0.28400	0.85	0.09310	N	1	B;B	0.25441	0.126;0.004	B;B	0.26416	0.069;0.0	T	0.21655	-1.0239	8	0.27082	T	0.32	.	4.3715	0.11249	0.0:0.7924:0.0:0.2076	.	85;83	P17021-2;P17021	.;ZNF17_HUMAN	V	83	.	ENSP00000302455:A83V	A	+	2	0	ZNF17	62622920	0.000000	0.05858	0.004000	0.12327	0.034000	0.12701	0.142000	0.16096	0.331000	0.23511	0.650000	0.86243	GCC	.	.		0.527	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959	
ZSCAN22	342945	hgsc.bcm.edu	37	19	58846306	58846306	+	Silent	SNP	G	G	A	rs138271492		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr19:58846306G>A	ENST00000329665.4	+	2	285	c.138G>A	c.(136-138)gaG>gaA	p.E46E		NM_181846.2	NP_862829.1	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	46					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|pancreas(1)|prostate(2)	16		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		CTCACTCTGAGGCTGCACGCC	0.627																																					p.E46E		Atlas-SNP	.											.	ZSCAN22	47	.	0			c.G138A						.						86.0	76.0	79.0					19																	58846306		2203	4300	6503	SO:0001819	synonymous_variant	342945	exon2			CTCTGAGGCTGCA	M20675	CCDS12975.1	19q13.43	2013-01-08	2006-09-20	2006-09-20				"""-"", ""Zinc fingers, C2H2-type"""	4929	protein-coding gene	gene with protein product	"""oncogene HKR2"""	165260	"""zinc finger protein 50"", ""GLI-Kruppel family member HKR2"""	ZNF50, HKR2		2850480, 1505991	Standard	NM_181846		Approved		uc002qsc.2	P10073		ENST00000329665.4:c.138G>A	chr19.hg19:g.58846306G>A		64.0	0.0		54.0	23.0	NM_181846	Q15922|Q7Z3L8	Silent	SNP	ENST00000329665.4	hg19	CCDS12975.1																																																																																			.	G|1.000;C|0.000		0.627	ZSCAN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466765.1	NM_181846	
DLGAP4	22839	hgsc.bcm.edu	37	20	35068157	35068157	+	Splice_Site	SNP	G	G	A	rs575582414		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr20:35068157G>A	ENST00000373907.2	+	4	1441	c.1242G>A	c.(1240-1242)agG>agA	p.R414R	DLGAP4_ENST00000339266.5_Splice_Site_p.R414R|DLGAP4_ENST00000401952.2_Splice_Site_p.R414R|DLGAP4_ENST00000373913.3_Splice_Site_p.R414R			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	414					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				TCCCCACCAGGAGTCTGGACC	0.607											OREG0025903	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	G|||	1	0.000199681	0.0	0.0014	5008	,	,		18941	0.0		0.0	False		,,,				2504	0.0				p.R414R		Atlas-SNP	.											.	DLGAP4	111	.	0			c.G1242A						.						67.0	54.0	59.0					20																	35068157		2203	4300	6503	SO:0001630	splice_region_variant	22839	exon4			CACCAGGAGTCTG	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.1242-1G>A	chr20.hg19:g.35068157G>A		42.0	0.0	852	63.0	11.0	NM_014902	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Silent	SNP	ENST00000373907.2	hg19																																																																																				.	.		0.607	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902	Silent
GNAS	2778	hgsc.bcm.edu	37	20	57429421	57429421	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr20:57429421C>T	ENST00000306120.3	+	1	911	c.911C>T	c.(910-912)cCg>cTg	p.P304L	GNAS_ENST00000371102.4_Silent_p.A367A|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371100.4_Silent_p.A367A|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000371099.2_Silent_p.A367A|GNAS_ENST00000464624.2_3'UTR			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CCGCTGATGCCGCGGAGGGAG	0.677			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.P305L	Colon(117;935 1597 6045 8307 46442)	Atlas-SNP	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	.	GNAS	867	.	0			c.C914T						.						14.0	24.0	20.0					20																	57429421		1960	4133	6093	SO:0001583	missense	2778	exon1			TGATGCCGCGGAG	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000306120.3:c.911C>T	chr20.hg19:g.57429421C>T	ENSP00000302237:p.Pro304Leu	80.0	0.0		156.0	50.0	NM_001077490	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000306120.3	hg19		.	.	.	.	.	.	.	.	.	.	C	3.923	-0.017659	0.07681	.	.	ENSG00000087460	ENST00000306120	.	.	.	4.52	-1.14	0.09741	.	.	.	.	.	T	0.37758	0.1015	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40720	-0.9548	5	0.87932	D	0	.	5.6089	0.17394	0.0:0.5427:0.1537:0.3036	.	.	.	.	L	304	.	ENSP00000302237:P304L	P	+	2	0	GNAS	56862816	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.522000	0.06237	-0.298000	0.08921	0.462000	0.41574	CCG	.	.		0.677	GNAS-050	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000267987.1	NM_000516	
TPTE	7179	hgsc.bcm.edu	37	21	10933874	10933874	+	Silent	SNP	C	C	T			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr21:10933874C>T	ENST00000361285.4	-	17	1334	c.1005G>A	c.(1003-1005)gcG>gcA	p.A335A	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000342420.5_Silent_p.A297A|TPTE_ENST00000298232.7_Silent_p.A317A	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	335	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TACAGTGAATCGCTACGATGT	0.318																																					p.A335A		Atlas-SNP	.											TPTE_ENST00000361285,NS,carcinoma,-1,4	TPTE	513	.	0			c.G1005A						.						239.0	236.0	237.0					21																	10933874		2203	4300	6503	SO:0001819	synonymous_variant	7179	exon17			GTGAATCGCTACG	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1005G>A	chr21.hg19:g.10933874C>T		887.0	0.0		792.0	120.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	ENST00000361285.4	hg19	CCDS13560.2																																																																																			.	.		0.318	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
TMPRSS3	64699	hgsc.bcm.edu	37	21	43802304	43802304	+	Silent	SNP	T	T	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr21:43802304T>G	ENST00000291532.3	-	9	1777	c.822A>C	c.(820-822)ctA>ctC	p.L274L	TMPRSS3_ENST00000398405.1_Silent_p.L272L|TMPRSS3_ENST00000398397.3_Silent_p.L274L|TMPRSS3_ENST00000474596.1_5'UTR|TMPRSS3_ENST00000433957.2_Silent_p.L274L|TMPRSS3_ENST00000380399.1_Silent_p.L358L	NM_032404.2	NP_115780.1	P57727	TMPS3_HUMAN	transmembrane protease, serine 3	274	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular sodium ion homeostasis (GO:0006883)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(4)|skin(1)	13						ACAGGGAAACTAGACCCACCT	0.507																																					p.L274L		Atlas-SNP	.											.	TMPRSS3	40	.	0			c.A822C						.						102.0	76.0	85.0					21																	43802304		2203	4300	6503	SO:0001819	synonymous_variant	64699	exon9			GGAAACTAGACCC	AF201380	CCDS13686.1, CCDS42939.1, CCDS58790.1	21q22.3	2010-04-13			ENSG00000160183	ENSG00000160183		"""Serine peptidases / Transmembrane"""	11877	protein-coding gene	gene with protein product		605511		DFNB10, DFNB8		11462234, 11907649	Standard	NM_032405		Approved		uc002zbc.3	P57727	OTTHUMG00000086796	ENST00000291532.3:c.822A>C	chr21.hg19:g.43802304T>G		67.0	0.0		91.0	39.0	NM_001256317	D3DSJ6|Q5USC7|Q6ZMC3	Silent	SNP	ENST00000291532.3	hg19	CCDS13686.1																																																																																			.	.		0.507	TMPRSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000195347.1		
TSPEAR	54084	hgsc.bcm.edu	37	21	45949775	45949775	+	Silent	SNP	G	G	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr21:45949775G>A	ENST00000323084.4	-	5	761	c.696C>T	c.(694-696)agC>agT	p.S232S	TSPEAR_ENST00000397916.1_Silent_p.S164S	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	232	Laminin G-like.				sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GGGCGTTCCTGCTGGGACACA	0.632																																					p.S232S		Atlas-SNP	.											.	TSPEAR	110	.	0			c.C696T						.						38.0	43.0	41.0					21																	45949775		2203	4300	6503	SO:0001819	synonymous_variant	54084	exon5			GTTCCTGCTGGGA	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.696C>T	chr21.hg19:g.45949775G>A		48.0	0.0		45.0	14.0	NM_144991		Silent	SNP	ENST00000323084.4	hg19	CCDS13712.1																																																																																			.	.		0.632	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991	
CACNA1I	8911	hgsc.bcm.edu	37	22	39994193	39994193	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr22:39994193A>G	ENST00000402142.3	+	2	274	c.274A>G	c.(274-276)Aac>Gac	p.N92D	CACNA1I_ENST00000400164.3_Missense_Mutation_p.N92D|CACNA1I_ENST00000407673.1_Missense_Mutation_p.N92D|CACNA1I_ENST00000401624.1_Missense_Mutation_p.N92D|CACNA1I_ENST00000404898.1_Missense_Mutation_p.N92D|CACNA1I_ENST00000336649.4_Missense_Mutation_p.N92D	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	92					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	GATCCTGCTGAACTGCGTGAC	0.642																																					p.N92D		Atlas-SNP	.											.	CACNA1I	264	.	0			c.A274G						.						81.0	88.0	85.0					22																	39994193		2172	4261	6433	SO:0001583	missense	8911	exon2			CTGCTGAACTGCG	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.274A>G	chr22.hg19:g.39994193A>G	ENSP00000385019:p.Asn92Asp	38.0	0.0		25.0	17.0	NM_001003406	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Missense_Mutation	SNP	ENST00000402142.3	hg19	CCDS46710.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.823344	0.90873	.	.	ENSG00000100346	ENST00000402142;ENST00000404898;ENST00000401624;ENST00000407673;ENST00000336649;ENST00000400164	D;D;D;D;D;D	0.97976	-4.64;-4.64;-4.64;-4.64;-4.64;-4.64	4.03	4.03	0.46877	.	0.178102	0.47093	N	0.000256	D	0.98375	0.9460	M	0.78637	2.42	0.54753	D	0.999989	P;B;P;D	0.69078	0.694;0.265;0.911;0.997	B;B;P;D	0.75020	0.332;0.354;0.45;0.985	D	0.99218	1.0878	10	0.87932	D	0	.	13.1974	0.59746	1.0:0.0:0.0:0.0	.	92;92;92;92	Q9P0X4-3;Q9P0X4-2;Q9P0X4-4;Q9P0X4	.;.;.;CAC1I_HUMAN	D	92	ENSP00000385019:N92D;ENSP00000384093:N92D;ENSP00000383887:N92D;ENSP00000385680:N92D;ENSP00000337829:N92D;ENSP00000383028:N92D	ENSP00000337829:N92D	N	+	1	0	CACNA1I	38324139	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.020000	0.93667	1.703000	0.51240	0.449000	0.29647	AAC	.	.		0.642	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382495	24382495	+	IGR	SNP	G	G	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chrX:24382495G>C								AC004552.1 (15472 upstream) : PDK3 (100842 downstream)																							tgctctagctgctgctgctgc	0.632																																					p.A540P		Atlas-SNP	.											.	.	.	.	0			c.G1618C						.						3.0	3.0	3.0					X																	24382495		1246	2954	4200	SO:0001628	intergenic_variant	100130302	exon1			CTAGCTGCTGCTG																													chrX.hg19:g.24382495G>C		106.0	0.0		108.0	8.0	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.632								
TRPC5	7224	hgsc.bcm.edu	37	X	111195372	111195372	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chrX:111195372T>A	ENST00000262839.2	-	2	1195	c.277A>T	c.(277-279)Agc>Tgc	p.S93C		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	93					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						ACATACACGCTGTGGTTCAGC	0.552																																					p.S93C		Atlas-SNP	.											.	TRPC5	142	.	0			c.A277T						.						164.0	138.0	147.0					X																	111195372		2203	4300	6503	SO:0001583	missense	7224	exon2			ACACGCTGTGGTT	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.277A>T	chrX.hg19:g.111195372T>A	ENSP00000262839:p.Ser93Cys	213.0	0.0		191.0	87.0	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	hg19	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	T	13.87	2.365450	0.41902	.	.	ENSG00000072315	ENST00000262839	T	0.54071	0.59	5.51	5.51	0.81932	Ankyrin repeat-containing domain (3);	0.134289	0.64402	D	0.000002	T	0.42268	0.1195	L	0.45137	1.4	0.27262	N	0.958594	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.39057	-0.9632	10	0.54805	T	0.06	-13.9013	6.4141	0.21708	0.143:0.0785:0.0:0.7785	.	94;93	Q59G51;Q9UL62	.;TRPC5_HUMAN	C	93	ENSP00000262839:S93C	ENSP00000262839:S93C	S	-	1	0	TRPC5	111082028	1.000000	0.71417	0.995000	0.50966	0.927000	0.56198	2.831000	0.48144	1.840000	0.53500	0.417000	0.27973	AGC	.	.		0.552	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
MT-CYB	4519	hgsc.bcm.edu	37	M	15339	15339	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chrM:15339T>C	ENST00000361789.2	+	1	593	c.593T>C	c.(592-594)cTa>cCa	p.L198P	MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	198					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						ACTCCACCTCCTATTCTTGCA	0.493											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L198P		Atlas-SNP	.											.	.	.	.	0			c.T593C						.																																			SO:0001583	missense	0	exon1			ACCTCCTATTCTT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.593T>C	chrM.hg19:g.15339T>C	ENSP00000354554:p.Leu198Pro	17.0	0.0	585	24.0	15.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.493	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
TP53	7157	hgsc.bcm.edu	37	17	7578502	7578503	+	Frame_Shift_Ins	INS	-	-	CAGGG	rs587782620		TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr17:7578502_7578503insCAGGG	ENST00000269305.4	-	5	616_617	c.427_428insCCCTG	c.(427-429)gtgfs	p.V143fs	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Frame_Shift_Ins_p.V143fs|TP53_ENST00000359597.4_Frame_Shift_Ins_p.V143fs|TP53_ENST00000420246.2_Frame_Shift_Ins_p.V143fs|TP53_ENST00000455263.2_Frame_Shift_Ins_p.V143fs|TP53_ENST00000445888.2_Frame_Shift_Ins_p.V143fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	143	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation; strong DNA binding ability at 32.5 degrees Celsius; strong reduction of transcriptional activity at 37.5 degrees Celsius; severely represses interaction with ZNF385A).|V -> E (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V143M(19)|p.V143A(18)|p.0?(8)|p.V143E(5)|p.V143L(4)|p.V11A(2)|p.V50A(2)|p.V143fs*27(2)|p.V11M(1)|p.L137_W146del10(1)|p.V143fs*29(1)|p.P142_Q144delPVQ(1)|p.V50M(1)|p.K139fs*4(1)|p.A138_V143delAKTCPV(1)|p.V143G(1)|p.V143_S149del(1)|p.C141fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCACAGCTGCACAGGGCAGGTC	0.589		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V143fs	Pancreas(47;798 1329 9957 10801)	Atlas-INDEL	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,-1,1	TP53	33396	.	70	Substitution - Missense(53)|Whole gene deletion(8)|Deletion - In frame(4)|Deletion - Frameshift(4)|Insertion - Frameshift(1)	large_intestine(12)|haematopoietic_and_lymphoid_tissue(8)|breast(8)|stomach(7)|lung(6)|upper_aerodigestive_tract(5)|urinary_tract(4)|oesophagus(4)|ovary(4)|bone(4)|central_nervous_system(3)|salivary_gland(2)|cervix(1)|vulva(1)|prostate(1)	c.428_429insCCCTG						.																																			SO:0001589	frameshift_variant	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.423_427dupCCCTG	chr17.hg19:g.7578503_7578507dupCAGGG	ENSP00000269305:p.Val143fs	82.0	0.0		51.0	34.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Ins	INS	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.589	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PSEN2	5664	hgsc.bcm.edu	37	1	227076565	227076566	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:227076565_227076566insC	ENST00000366783.3	+	8	1038_1039	c.602_603insC	c.(601-606)taccccfs	p.YP201fs	PSEN2_ENST00000340188.4_Frame_Shift_Ins_p.YP201fs|PSEN2_ENST00000366782.1_Frame_Shift_Ins_p.YP234fs|PSEN2_ENST00000422240.2_Frame_Shift_Ins_p.YP201fs|PSEN2_ENST00000391872.2_Frame_Shift_Ins_p.YP234fs|PSEN2_ENST00000472139.2_Frame_Shift_Ins_p.YP57fs	NM_000447.2|NM_012486.2	NP_000438.2|NP_036618.2	P49810	PSN2_HUMAN	presenilin 2	201					amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|brain morphogenesis (GO:0048854)|calcium ion transport (GO:0006816)|cardiac muscle contraction (GO:0060048)|cell fate specification (GO:0001708)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|forebrain development (GO:0030900)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|locomotion (GO:0040011)|lung alveolus development (GO:0048286)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|memory (GO:0007613)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of protein phosphorylation (GO:0001933)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of synaptic plasticity (GO:0048167)|response to hypoxia (GO:0001666)|somitogenesis (GO:0001756)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary rootlet (GO:0035253)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear inner membrane (GO:0005637)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|endopeptidase activity (GO:0004175)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|urinary_tract(1)	20		Prostate(94;0.0771)				GCCATGGACTACCCCACCCTCT	0.579																																					p.Y201fs		Atlas-INDEL	.											.	PSEN2	55	.	0			c.602_603insC						.																																			SO:0001589	frameshift_variant	5664	exon8			.	BC006365	CCDS1556.1, CCDS44324.1	1q42.13	2014-09-17	2014-02-24		ENSG00000143801	ENSG00000143801			9509	protein-coding gene	gene with protein product		600759	"""Alzheimer disease 4"""	AD4		7638621	Standard	NM_000447		Approved	AD3L, STM2, PS2	uc009xeo.1	P49810	OTTHUMG00000037563	ENST00000366783.3:c.606dupC	chr1.hg19:g.227076569_227076569dupC	ENSP00000355747:p.Tyr201fs	83.0	0.0		122.0	26.0	NM_012486	A8K8D4|B1AP21|Q96P32	Frame_Shift_Ins	INS	ENST00000366783.3	hg19	CCDS1556.1																																																																																			.	.		0.579	PSEN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000091539.1	NM_000447	
HMCN1	83872	hgsc.bcm.edu	37	1	186024781	186024781	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAE6-01A-11D-A40R-10	TCGA-DD-AAE6-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	95b28a9a-7a85-4018-8418-c4381b9fc1a5	971f1297-9d76-49e3-9651-20e92dd3b3bc	g.chr1:186024781delC	ENST00000271588.4	+	45	7348	c.7119delC	c.(7117-7119)gacfs	p.D2373fs	HMCN1_ENST00000367492.2_Frame_Shift_Del_p.D2373fs	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2373	Ig-like C2-type 21.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GAATGACTGACAAAAAATATG	0.418																																					p.D2373fs		Atlas-INDEL	.											.	HMCN1	797	.	0			c.7118delA						.						140.0	129.0	133.0					1																	186024781		2203	4300	6503	SO:0001589	frameshift_variant	83872	exon45			.	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7119delC	chr1.hg19:g.186024781delC	ENSP00000271588:p.Asp2373fs	149.0	0.0		221.0	89.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Frame_Shift_Del	DEL	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
