#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RHCE	6006	hgsc.bcm.edu	37	1	25735269	25735269	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:25735269G>T	ENST00000294413.7	-	2	298	c.240C>A	c.(238-240)aaC>aaA	p.N80K	RHCE_ENST00000349320.3_Missense_Mutation_p.N64K|RHCE_ENST00000425135.1_Missense_Mutation_p.N80K|RHCE_ENST00000340849.4_Missense_Mutation_p.N80K|RHCE_ENST00000346452.4_Missense_Mutation_p.N80K|AL031284.1_ENST00000577655.1_RNA|RHCE_ENST00000243186.6_Missense_Mutation_p.N80K|RHCE_ENST00000455194.1_Missense_Mutation_p.N80K|RHCE_ENST00000374352.2_Missense_Mutation_p.N64K|RHCE_ENST00000413854.1_Missense_Mutation_p.N80K|RHCE_ENST00000349438.4_Missense_Mutation_p.N80K|RHCE_ENST00000495048.1_5'UTR	NM_020485.4	NP_065231	P18577	RHCE_HUMAN	Rh blood group, CcEe antigens	80						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			endometrium(8)|large_intestine(6)|lung(3)	17		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0426)|OV - Ovarian serous cystadenocarcinoma(117;2.12e-27)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|STAD - Stomach adenocarcinoma(196;0.00035)|KIRC - Kidney renal clear cell carcinoma(1967;0.000769)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|GBM - Glioblastoma multiforme(114;0.00458)|READ - Rectum adenocarcinoma(331;0.0649)		GCATGAAGAGGTTGAAGGCCA	0.582																																					p.N80K		Atlas-SNP	.											.	RHCE	36	.	0			c.C240A						.						82.0	50.0	62.0					1																	25735269		2169	3642	5811	SO:0001583	missense	6006	exon2			GAAGAGGTTGAAG	BC075081	CCDS30634.1, CCDS30635.1, CCDS30636.1, CCDS30637.1	1p36.11	2014-09-17	2006-02-23		ENSG00000188672	ENSG00000188672		"""CD molecules"", ""Blood group antigens"""	10008	protein-coding gene	gene with protein product		111700	"""Rhesus blood group, CcEe antigens"""	RH		8220426	Standard	NM_138618		Approved	CD240CE	uc001bkf.3	P18577	OTTHUMG00000007650	ENST00000294413.7:c.240C>A	chr1.hg19:g.25735269G>T	ENSP00000294413:p.Asn80Lys	232.0	1.0		217.0	157.0	NM_138617	A7DW68|B7UDF3|B7UDF4|B7UDF5|B7UDF6|B7UDF7|B7UDF8|B7UDF9|B7UDG0|B7UDG1|B7UDG2|B7UDG3|Q02163|Q02164|Q02165|Q16160|Q2MJW0|Q2VC86|Q3LTM6|Q6AZX5|Q6J2U3|Q7RU06|Q8IZT2|Q8IZT3|Q8IZT4|Q8IZT5|Q9UD13|Q9UD14|Q9UD15|Q9UD16|Q9UD73|Q9UD74|Q9UEC2|Q9UEC3|Q9UPN0	Missense_Mutation	SNP	ENST00000294413.7	hg19	CCDS30635.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.212941	0.39102	.	.	ENSG00000188672	ENST00000413854;ENST00000539650;ENST00000455194;ENST00000374352;ENST00000243186;ENST00000425135;ENST00000340849;ENST00000349320;ENST00000346452;ENST00000294413;ENST00000447203;ENST00000349438	T;T;T;T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83;1.83	4.34	2.43	0.29744	Ammonium transporter AmtB-like (3);	0.266849	0.40818	N	0.001016	T	0.54806	0.1881	M	0.93462	3.42	0.50039	D	0.999846	D;D;D;D;D	0.67145	0.984;0.986;0.996;0.992;0.996	D;D;D;D;D	0.85130	0.939;0.934;0.969;0.911;0.997	T	0.55528	-0.8127	10	0.87932	D	0	-7.6805	6.2622	0.20907	0.2275:0.0:0.7725:0.0	.	64;80;80;80;80	Q5VSJ9;E7EQ47;Q5VSJ7;Q5VSJ8;P18577	.;.;.;.;RHCE_HUMAN	K	80;80;80;64;80;80;80;64;80;80;80;80	ENSP00000415417:N80K;ENSP00000416275:N80K;ENSP00000363472:N64K;ENSP00000243186:N80K;ENSP00000392809:N80K;ENSP00000345084:N80K;ENSP00000311185:N64K;ENSP00000344485:N80K;ENSP00000294413:N80K;ENSP00000334570:N80K	ENSP00000243186:N80K	N	-	3	2	RHCE	25607856	1.000000	0.71417	0.995000	0.50966	0.145000	0.21501	0.921000	0.28718	0.449000	0.26747	0.561000	0.74099	AAC	.	.		0.582	RHCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020312.2	NM_020485	
ARID1A	8289	hgsc.bcm.edu	37	1	27023300	27023300	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:27023300C>A	ENST00000324856.7	+	1	777	c.406C>A	c.(406-408)Cct>Act	p.P136T	ARID1A_ENST00000457599.2_Missense_Mutation_p.P136T|RP5-968P14.2_ENST00000569378.1_RNA	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	136					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		gggggcgCCTCCTCACTCAGC	0.766			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.P136T		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.C406A						.						1.0	1.0	1.0					1																	27023300		633	1495	2128	SO:0001583	missense	8289	exon1			GCGCCTCCTCACT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.406C>A	chr1.hg19:g.27023300C>A	ENSP00000320485:p.Pro136Thr	22.0	0.0		20.0	5.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.	.	.	.	.	.	.	.	.	.	C	12.70	2.015745	0.35606	.	.	ENSG00000117713	ENST00000324856;ENST00000457599	T;T	0.02301	4.56;4.35	3.07	3.07	0.35406	.	0.342163	0.22384	U	0.060780	T	0.01353	0.0044	N	0.08118	0	0.80722	D	1	P;P	0.40302	0.588;0.712	B;B	0.39660	0.161;0.306	T	0.66767	-0.5840	10	0.10377	T	0.69	-2.9899	9.7357	0.40386	0.0:1.0:0.0:0.0	.	136;136	O14497;O14497-2	ARI1A_HUMAN;.	T	136	ENSP00000320485:P136T;ENSP00000387636:P136T	ENSP00000320485:P136T	P	+	1	0	ARID1A	26895887	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	0.551000	0.23361	1.715000	0.51383	0.385000	0.25706	CCT	.	.		0.766	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
MROH7	374977	hgsc.bcm.edu	37	1	55118887	55118887	+	Silent	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:55118887C>A	ENST00000421030.2	+	3	573	c.288C>A	c.(286-288)atC>atA	p.I96I	MROH7-TTC4_ENST00000414150.2_Silent_p.I96I|MROH7_ENST00000454855.2_Intron|MROH7_ENST00000339553.5_Silent_p.I96I|MROH7_ENST00000409996.1_Intron|MROH7_ENST00000545244.1_Intron|MROH7_ENST00000395690.2_Silent_p.I96I|MROH7_ENST00000472987.1_3'UTR	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7	96						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CCCTCCAGATCACCAGTTCTT	0.567																																					p.I96I		Atlas-SNP	.											.	.	.	.	0			c.C288A						.						84.0	83.0	83.0					1																	55118887		1965	4144	6109	SO:0001819	synonymous_variant	374977	exon3			CCAGATCACCAGT	AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.288C>A	chr1.hg19:g.55118887C>A		70.0	0.0		66.0	9.0	NM_001039464	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	Silent	SNP	ENST00000421030.2	hg19	CCDS41342.2																																																																																			.	.		0.567	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346978.1	NM_198547	
HRNR	388697	hgsc.bcm.edu	37	1	152193174	152193174	+	Nonsense_Mutation	SNP	G	G	A	rs139907915	byFrequency	TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:152193174G>A	ENST00000368801.2	-	3	1006	c.931C>T	c.(931-933)Cga>Tga	p.R311*	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	311					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GACCCATGTCGGACGTGGCTA	0.607																																					p.R311X		Atlas-SNP	.											.	HRNR	403	.	0			c.C931T						.						97.0	105.0	102.0					1																	152193174		2203	4300	6503	SO:0001587	stop_gained	388697	exon3			CATGTCGGACGTG	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.931C>T	chr1.hg19:g.152193174G>A	ENSP00000357791:p.Arg311*	97.0	0.0		189.0	8.0	NM_001009931	Q5DT20|Q5U1F4	Nonsense_Mutation	SNP	ENST00000368801.2	hg19	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	G	17.55	3.417316	0.62622	.	.	ENSG00000197915	ENST00000368801	.	.	.	3.6	-7.2	0.01495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	3.1173	0.06379	0.0847:0.1998:0.2514:0.4641	.	.	.	.	X	311	.	ENSP00000357791:R311X	R	-	1	2	HRNR	150459798	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.145000	0.10265	-1.739000	0.01347	-0.282000	0.10007	CGA	.	G|0.999;T|0.001		0.607	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
FLG2	388698	hgsc.bcm.edu	37	1	152325270	152325270	+	Silent	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:152325270C>A	ENST00000388718.5	-	3	5064	c.4992G>T	c.(4990-4992)ggG>ggT	p.G1664G	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1664					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGTGAGACCCCTGAGTGCA	0.512																																					p.G1664G		Atlas-SNP	.											.	FLG2	431	.	0			c.G4992T						.						462.0	406.0	425.0					1																	152325270		2203	4300	6503	SO:0001819	synonymous_variant	388698	exon3			TGAGACCCCTGAG	AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4992G>T	chr1.hg19:g.152325270C>A		64.0	0.0		138.0	9.0	NM_001014342	Q9H4U1	Silent	SNP	ENST00000388718.5	hg19	CCDS30861.1																																																																																			.	.		0.512	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034018.5	NM_001014342	
KCNN3	3782	hgsc.bcm.edu	37	1	154842253	154842253	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:154842253G>T	ENST00000271915.4	-	1	503	c.188C>A	c.(187-189)cCt>cAt	p.P63H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	63	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	aagctgcggaggctgaggctg	0.697																																					p.P63H		Atlas-SNP	.											.	KCNN3	141	.	0			c.C188A						.						6.0	4.0	5.0					1																	154842253		1984	3925	5909	SO:0001583	missense	3782	exon1			TGCGGAGGCTGAG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.188C>A	chr1.hg19:g.154842253G>T	ENSP00000271915:p.Pro63His	64.0	0.0		176.0	19.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	g	11.14	1.552427	0.27739	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.56275	0.47	5.07	3.18	0.36537	.	1.727610	0.03258	N	0.182822	T	0.18551	0.0445	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.11372	-1.0590	8	0.33141	T	0.24	-4.1487	6.4327	0.21807	0.0918:0.0:0.7284:0.1798	.	.	.	.	H	63;158	ENSP00000271915:P63H	ENSP00000271915:P63H	P	-	2	0	KCNN3	153108877	0.863000	0.29885	1.000000	0.80357	0.998000	0.95712	1.873000	0.39558	0.823000	0.34589	0.563000	0.77884	CCT	.	.		0.697	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
PEAR1	375033	hgsc.bcm.edu	37	1	156878621	156878621	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:156878621G>A	ENST00000338302.3	+	11	1515	c.1290G>A	c.(1288-1290)acG>acA	p.T430T	PEAR1_ENST00000292357.7_Splice_Site_p.T430T			Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	430	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				recognition of apoptotic cell (GO:0043654)	integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(6)|lung(22)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)	43	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CGGGTTACACGGTGAGGCGCG	0.687																																					p.T430T		Atlas-SNP	.											.	PEAR1	118	.	0			c.G1290A						.						37.0	31.0	33.0					1																	156878621		2202	4300	6502	SO:0001630	splice_region_variant	375033	exon10			TTACACGGTGAGG	AK098809	CCDS30892.1	1q23.1	2008-02-05	2007-10-25	2007-10-25	ENSG00000187800	ENSG00000187800			33631	protein-coding gene	gene with protein product		610278	"""multiple EGF-like-domains 12"""	MEGF12		15851471	Standard	NM_001080471		Approved	JEDI, FLJ00193	uc001fqj.1	Q5VY43	OTTHUMG00000041293	ENST00000338302.3:c.1290+1G>A	chr1.hg19:g.156878621G>A		39.0	0.0		79.0	12.0	NM_001080471	Q8TEK2	Silent	SNP	ENST00000338302.3	hg19	CCDS30892.1																																																																																			.	.		0.687	PEAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098937.2	NM_001080471	Silent
QSOX1	5768	hgsc.bcm.edu	37	1	180144477	180144477	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:180144477A>G	ENST00000367602.3	+	3	462	c.388A>G	c.(388-390)Aac>Gac	p.N130D	QSOX1_ENST00000367600.5_Missense_Mutation_p.N130D			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	130	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CTTTACCAAGAACGGCTCGGG	0.537																																					p.N130D		Atlas-SNP	.											.	QSOX1	79	.	0			c.A388G						.						146.0	128.0	134.0					1																	180144477		2203	4300	6503	SO:0001583	missense	5768	exon3			ACCAAGAACGGCT	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.388A>G	chr1.hg19:g.180144477A>G	ENSP00000356574:p.Asn130Asp	123.0	0.0		345.0	18.0	NM_002826	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	hg19	CCDS1337.1	.	.	.	.	.	.	.	.	.	.	A	0.119	-1.127801	0.01770	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.16597	2.33;2.33	3.87	0.263	0.15602	Thioredoxin-like fold (3);	0.938103	0.09142	N	0.842812	T	0.08891	0.0220	N	0.16478	0.41	0.24208	N	0.995481	B;B;B	0.13145	0.007;0.004;0.005	B;B;B	0.15052	0.009;0.012;0.005	T	0.43491	-0.9388	10	0.12766	T	0.61	-0.2332	6.6242	0.22820	0.6589:0.0:0.3411:0.0	.	130;130;130	A8K477;O00391;O00391-2	.;QSOX1_HUMAN;.	D	130	ENSP00000356574:N130D;ENSP00000356572:N130D	ENSP00000356572:N130D	N	+	1	0	QSOX1	178411100	0.048000	0.20356	0.160000	0.22671	0.040000	0.13550	0.171000	0.16685	0.030000	0.15379	-0.899000	0.02877	AAC	.	.		0.537	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826	
RGSL1	353299	hgsc.bcm.edu	37	1	182441581	182441581	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:182441581G>A	ENST00000294854.8	+	5	372	c.352G>A	c.(352-354)Gat>Aat	p.D118N	RGSL1_ENST00000542961.1_Missense_Mutation_p.D153N	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	118					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						CCTGAGCATAGATGAGATGGA	0.522																																					p.D118N	Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	Atlas-SNP	.											.	RGSL1	111	.	0			c.G352A						.						136.0	124.0	128.0					1																	182441581		692	1591	2283	SO:0001583	missense	353299	exon5			AGCATAGATGAGA	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.352G>A	chr1.hg19:g.182441581G>A	ENSP00000457748:p.Asp118Asn	44.0	0.0		112.0	7.0	NM_001137669	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	ENST00000294854.8	hg19	CCDS58049.1																																																																																			.	.		0.522	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320710.3	NM_181572	
DHX9	1660	hgsc.bcm.edu	37	1	182828232	182828232	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:182828232C>T	ENST00000367549.3	+	11	1230	c.1120C>T	c.(1120-1122)Cag>Tag	p.Q374*		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	374	MTAD.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						CCAGTTGGAACAGGATCATGA	0.378																																					p.Q374X	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.C1120T						.						117.0	105.0	108.0					1																	182828232		1868	4116	5984	SO:0001587	stop_gained	1660	exon11			TTGGAACAGGATC	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1120C>T	chr1.hg19:g.182828232C>T	ENSP00000356520:p.Gln374*	80.0	0.0		194.0	18.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Nonsense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	C	38	7.269519	0.98175	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	.	.	.	5.9	5.9	0.94986	.	0.120124	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	15.5092	0.75766	0.139:0.861:0.0:0.0	.	.	.	.	X	374	.	ENSP00000356520:Q374X	Q	+	1	0	DHX9	181094855	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.123000	0.64703	2.786000	0.95864	0.563000	0.77884	CAG	.	.		0.378	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
PLA2G4A	5321	hgsc.bcm.edu	37	1	186908281	186908281	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:186908281A>T	ENST00000367466.3	+	9	989	c.837A>T	c.(835-837)ttA>ttT	p.L279F	PLA2G4A_ENST00000442353.2_Missense_Mutation_p.L219F|PLA2G4A_ENST00000466600.1_3'UTR	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	279	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TTGAGTCTTTATGGAAGAAGA	0.353																																					p.L279F		Atlas-SNP	.											.	PLA2G4A	125	.	0			c.A837T						.						80.0	81.0	81.0					1																	186908281		2203	4300	6503	SO:0001583	missense	5321	exon9			GTCTTTATGGAAG	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	ENST00000367466.3:c.837A>T	chr1.hg19:g.186908281A>T	ENSP00000356436:p.Leu279Phe	155.0	0.0		331.0	21.0	NM_024420	B1AKG4|Q29R80	Missense_Mutation	SNP	ENST00000367466.3	hg19	CCDS1372.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.949421	0.73787	.	.	ENSG00000116711	ENST00000367466;ENST00000442353	T;T	0.14144	2.53;2.53	5.93	-3.22	0.05125	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.000000	0.85682	D	0.000000	T	0.39733	0.1089	M	0.89353	3.025	0.47341	D	0.99939	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.48269	-0.9050	10	0.87932	D	0	-16.2632	16.02	0.80473	0.3428:0.0:0.6572:0.0	.	219;279	E7EU42;P47712	.;PA24A_HUMAN	F	279;219	ENSP00000356436:L279F;ENSP00000406892:L219F	ENSP00000356436:L279F	L	+	3	2	PLA2G4A	185174904	0.778000	0.28640	0.927000	0.36925	0.996000	0.88848	-0.050000	0.11904	-0.917000	0.03813	0.533000	0.62120	TTA	.	.		0.353	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	
CD46	4179	hgsc.bcm.edu	37	1	207934753	207934753	+	Missense_Mutation	SNP	A	A	G	rs147837939		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:207934753A>G	ENST00000358170.2	+	5	791	c.635A>G	c.(634-636)gAc>gGc	p.D212G	CD46_ENST00000361067.1_Missense_Mutation_p.D212G|CD46_ENST00000322875.4_Missense_Mutation_p.D212G|CD46_ENST00000322918.5_Missense_Mutation_p.D212G|CD46_ENST00000367042.1_Missense_Mutation_p.D212G|CD46_ENST00000367047.1_Missense_Mutation_p.D149G|CD46_ENST00000354848.1_Missense_Mutation_p.D212G|CD46_ENST00000360212.2_Missense_Mutation_p.D212G|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000441839.2_Missense_Mutation_p.D212G|CD46_ENST00000367041.1_Missense_Mutation_p.D212G|CD46_ENST00000357714.1_Missense_Mutation_p.D212G|CD46_ENST00000480003.1_Missense_Mutation_p.D212G	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	212	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						TATTGTGGTGACAATTCAGTG	0.368																																					p.D212G		Atlas-SNP	.											.	CD46	34	.	0			c.A635G						.						177.0	149.0	158.0					1																	207934753		2203	4300	6503	SO:0001583	missense	4179	exon5			GTGGTGACAATTC	BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.635A>G	chr1.hg19:g.207934753A>G	ENSP00000350893:p.Asp212Gly	79.0	0.0		165.0	19.0	NM_172352	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Missense_Mutation	SNP	ENST00000358170.2	hg19	CCDS1485.1	.	.	.	.	.	.	.	.	.	.	A	0.501	-0.870770	0.02570	.	.	ENSG00000117335	ENST00000358170;ENST00000354848;ENST00000322918;ENST00000367042;ENST00000367041;ENST00000357714;ENST00000322875;ENST00000367047;ENST00000441839;ENST00000361067;ENST00000360212;ENST00000480003	T;T;T;T;T;T;T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	4.85	-5.27	0.02763	Complement control module (2);Sushi/SCR/CCP (3);	2.089050	0.02063	N	0.050905	T	0.34658	0.0905	N	0.02202	-0.64	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B;B;B	0.33448	0.0;0.0;0.0;0.0;0.076;0.213;0.0;0.0;0.0;0.001;0.0;0.175;0.412;0.252	B;B;B;B;B;B;B;B;B;B;B;B;B;P	0.44422	0.001;0.0;0.002;0.001;0.173;0.321;0.001;0.002;0.001;0.003;0.001;0.237;0.314;0.449	T	0.38156	-0.9674	10	0.02654	T	1	.	2.4359	0.04483	0.31:0.3888:0.191:0.1102	.	212;212;212;212;212;212;212;212;212;212;212;212;212;212	P15529-4;P15529-5;P15529-14;P15529-3;P15529-12;P15529-13;P15529-2;P15529-11;P15529-7;P15529-9;P15529-15;P15529-6;P15529-8;P15529	.;.;.;.;.;.;.;.;.;.;.;.;.;MCP_HUMAN	G	212;212;212;212;212;212;212;149;212;212;212;212	ENSP00000350893:D212G;ENSP00000346912:D212G;ENSP00000314664:D212G;ENSP00000356009:D212G;ENSP00000356008:D212G;ENSP00000350346:D212G;ENSP00000313875:D212G;ENSP00000356014:D149G;ENSP00000413543:D212G;ENSP00000354358:D212G;ENSP00000353342:D212G;ENSP00000418471:D212G	ENSP00000313875:D212G	D	+	2	0	CD46	206001376	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.024000	0.03603	-0.936000	0.03723	0.477000	0.44152	GAC	.	A|1.000;T|0.000		0.368	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000088588.3	NM_172361	
PTPN14	5784	hgsc.bcm.edu	37	1	214542922	214542922	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:214542922C>A	ENST00000366956.5	-	17	3343	c.3149G>T	c.(3148-3150)tGc>tTc	p.C1050F	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	1050	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		GGTTGCATAGCAAACAGAATC	0.502																																					p.C1050F	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.G3149T						.						255.0	232.0	240.0					1																	214542922		2203	4300	6503	SO:0001583	missense	5784	exon17			GCATAGCAAACAG	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.3149G>T	chr1.hg19:g.214542922C>A	ENSP00000355923:p.Cys1050Phe	159.0	0.0		308.0	13.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	C	18.01	3.526823	0.64860	.	.	ENSG00000152104	ENST00000366956	T	0.13420	2.59	5.51	5.51	0.81932	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.096235	0.64402	D	0.000001	T	0.12220	0.0297	L	0.48218	1.51	0.80722	D	1	P	0.41848	0.763	B	0.32342	0.144	T	0.15521	-1.0434	10	0.10902	T	0.67	.	19.4235	0.94732	0.0:1.0:0.0:0.0	.	1050	Q15678	PTN14_HUMAN	F	1050	ENSP00000355923:C1050F	ENSP00000355923:C1050F	C	-	2	0	PTPN14	212609545	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.840000	0.62817	2.564000	0.86499	0.650000	0.86243	TGC	.	.		0.502	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
USH2A	7399	hgsc.bcm.edu	37	1	216405413	216405413	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:216405413C>T	ENST00000307340.3	-	14	3261	c.2875G>A	c.(2875-2877)Gtt>Att	p.V959I	USH2A_ENST00000366942.3_Missense_Mutation_p.V959I|USH2A_ENST00000366943.2_Missense_Mutation_p.V959I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	959	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ATGTGATTAACTGCACCAGTT	0.403										HNSCC(13;0.011)																											p.V959I		Atlas-SNP	.											.	USH2A	1168	.	0			c.G2875A						.						126.0	113.0	117.0					1																	216405413		2203	4300	6503	SO:0001583	missense	7399	exon14			GATTAACTGCACC	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.2875G>A	chr1.hg19:g.216405413C>T	ENSP00000305941:p.Val959Ile	290.0	0.0		618.0	27.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	5.481	0.273755	0.10403	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.54866	0.55;0.55;0.55	5.93	4.01	0.46588	EGF-like, laminin (3);	0.000000	0.40554	N	0.001066	T	0.42810	0.1219	L	0.46885	1.475	0.09310	N	1	B;P	0.39352	0.036;0.669	B;B	0.38156	0.059;0.266	T	0.22661	-1.0210	10	0.30078	T	0.28	.	8.7254	0.34467	0.2696:0.662:0.0:0.0684	.	959;959	O75445-2;O75445	.;USH2A_HUMAN	I	959	ENSP00000305941:V959I;ENSP00000355910:V959I;ENSP00000355909:V959I	ENSP00000305941:V959I	V	-	1	0	USH2A	214472036	0.697000	0.27767	0.002000	0.10522	0.003000	0.03518	1.409000	0.34680	0.786000	0.33708	0.650000	0.86243	GTT	.	.		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
OR2B11	127623	hgsc.bcm.edu	37	1	247614647	247614647	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:247614647A>T	ENST00000318749.6	-	1	661	c.638T>A	c.(637-639)gTg>gAg	p.V213E		NM_001004492.1	NP_001004492.1	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B, member 11	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(13)|large_intestine(7)|lung(31)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	60	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			AGCCAGGGGCACCAACACGAA	0.567																																					p.V213E		Atlas-SNP	.											.	OR2B11	102	.	0			c.T638A						.						72.0	73.0	73.0					1																	247614647		2203	4300	6503	SO:0001583	missense	127623	exon1			AGGGGCACCAACA		CCDS31090.1	1q44	2012-08-09			ENSG00000177535	ENSG00000177535		"""GPCR / Class A : Olfactory receptors"""	31249	protein-coding gene	gene with protein product							Standard	NM_001004492		Approved		uc010pyx.2	Q5JQS5	OTTHUMG00000040572	ENST00000318749.6:c.638T>A	chr1.hg19:g.247614647A>T	ENSP00000325682:p.Val213Glu	131.0	0.0		221.0	156.0	NM_001004492	B2RP03	Missense_Mutation	SNP	ENST00000318749.6	hg19	CCDS31090.1	.	.	.	.	.	.	.	.	.	.	A	14.89	2.669343	0.47677	.	.	ENSG00000177535	ENST00000318749	T	0.40756	1.02	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.312268	0.23201	N	0.050793	T	0.59088	0.2168	M	0.81942	2.565	0.31642	N	0.647853	P	0.51933	0.949	P	0.57846	0.828	T	0.69383	-0.5160	10	0.87932	D	0	.	9.2717	0.37675	0.8184:0.1816:0.0:0.0	.	213	Q5JQS5	OR2BB_HUMAN	E	213	ENSP00000325682:V213E	ENSP00000325682:V213E	V	-	2	0	OR2B11	245681270	0.000000	0.05858	0.706000	0.30403	0.250000	0.25880	0.034000	0.13776	2.273000	0.75805	0.523000	0.50628	GTG	.	.		0.567	OR2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097620.1	NM_001004492	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613036	+	Missense_Mutation	SNP	G	G	C	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr2:73613036G>C	ENST00000264448.6	+	1	151	c.40G>C	c.(40-42)Gag>Cag	p.E14Q	ALMS1_ENST00000409009.1_Missense_Mutation_p.E14Q|ALMS1_ENST00000377715.1_Missense_Mutation_p.E14Q	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggagga	0.692																																					p.E14Q		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C						.						3.0	4.0	4.0					2																	73613036		1509	3234	4743	SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.40G>C	chr2.hg19:g.73613036G>C	ENSP00000264448:p.Glu14Gln	184.0	0.0		227.0	10.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	15.09	2.731519	0.48939	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.26373	2.4;2.61;1.74	3.19	3.19	0.36642	.	0.259523	0.20097	U	0.099311	T	0.32436	0.0829	N	0.19112	0.55	0.22317	N	0.999202	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.03493	-1.1031	10	0.87932	D	0	.	10.1262	0.42652	0.0:0.0:1.0:0.0	.	14;14	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	Q	14	ENSP00000386627:E14Q;ENSP00000264448:E14Q;ENSP00000366944:E14Q	ENSP00000264448:E14Q	E	+	1	0	ALMS1	73466544	1.000000	0.71417	1.000000	0.80357	0.826000	0.46750	2.034000	0.41145	2.070000	0.61991	0.484000	0.47621	GAG	.	.		0.692	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
IL1R1	3554	hgsc.bcm.edu	37	2	102791045	102791045	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr2:102791045A>G	ENST00000410023.1	+	10	1309		c.e10-1		AC007271.3_ENST00000428188.1_RNA|IL1R1_ENST00000409329.1_Splice_Site|IL1R1_ENST00000424272.1_Splice_Site|IL1R1_ENST00000409929.1_Splice_Site|IL1R1_ENST00000233946.3_Splice_Site|IL1R1_ENST00000409288.1_Splice_Site|IL1R1_ENST00000409589.1_Intron			P14778	IL1R1_HUMAN	interleukin 1 receptor, type I						cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|interleukin-1-mediated signaling pathway (GO:0070498)|regulation of inflammatory response (GO:0050727)|response to interleukin-1 (GO:0070555)	cell surface (GO:0009986)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)|platelet-derived growth factor receptor binding (GO:0005161)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|prostate(2)|skin(3)	19					Anakinra(DB00026)	TTTTTGCTATAGTCACTAATT	0.308																																					.		Atlas-SNP	.											.	IL1R1	52	.	0			c.992-2A>G						.						104.0	94.0	97.0					2																	102791045		2203	4299	6502	SO:0001630	splice_region_variant	3554	exon9			TGCTATAGTCACT	M27492	CCDS2055.1, CCDS74547.1	2q12	2013-01-29			ENSG00000115594	ENSG00000115594		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5993	protein-coding gene	gene with protein product		147810		IL1R, IL1RA		1833184, 10191101	Standard	XM_005263929		Approved	D2S1473, CD121A	uc002tbr.3	P14778	OTTHUMG00000130783	ENST00000410023.1:c.992-1A>G	chr2.hg19:g.102791045A>G		30.0	0.0		33.0	8.0	NM_000877	Q587I7	Splice_Site	SNP	ENST00000410023.1	hg19	CCDS2055.1	.	.	.	.	.	.	.	.	.	.	A	5.793	0.330726	0.10956	.	.	ENSG00000115594	ENST00000409929;ENST00000424272;ENST00000409329;ENST00000428279;ENST00000409288;ENST00000410023;ENST00000233946	.	.	.	5.38	4.2	0.49525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8295	0.52285	0.8685:0.0:0.0:0.1315	.	.	.	.	.	-1	.	.	.	+	.	.	IL1R1	102157477	1.000000	0.71417	0.059000	0.19551	0.005000	0.04900	6.693000	0.74582	0.954000	0.37851	0.533000	0.62120	.	.	.		0.308	IL1R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253299.1		Intron
EPB41L5	57669	hgsc.bcm.edu	37	2	120848050	120848050	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr2:120848050A>G	ENST00000263713.5	+	12	1215	c.1001A>G	c.(1000-1002)cAt>cGt	p.H334R	EPB41L5_ENST00000452780.1_Missense_Mutation_p.H334R|EPB41L5_ENST00000443124.1_Missense_Mutation_p.H334R|EPB41L5_ENST00000331393.4_Missense_Mutation_p.H334R|EPB41L5_ENST00000443902.2_Missense_Mutation_p.H334R	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	334			H -> Y (in dbSNP:rs28930677).		actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						AAGAGTTCTCATCGATCAGGA	0.388																																					p.H334R		Atlas-SNP	.											.	EPB41L5	98	.	0			c.A1001G						.						148.0	139.0	142.0					2																	120848050		2203	4300	6503	SO:0001583	missense	57669	exon12			GTTCTCATCGATC	AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1001A>G	chr2.hg19:g.120848050A>G	ENSP00000263713:p.His334Arg	129.0	0.0		109.0	19.0	NM_020909	Q7Z5S1|Q8IZ12|Q9H975	Missense_Mutation	SNP	ENST00000263713.5	hg19	CCDS2130.1	.	.	.	.	.	.	.	.	.	.	A	8.423	0.846841	0.17034	.	.	ENSG00000115109	ENST00000263713;ENST00000443902;ENST00000331393;ENST00000443124;ENST00000452780	T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49	5.41	4.25	0.50352	.	0.529047	0.19160	N	0.121216	T	0.53786	0.1818	N	0.02391	-0.57	0.33400	D	0.577252	B;B;B;B	0.12630	0.001;0.006;0.0;0.004	B;B;B;B	0.10450	0.001;0.005;0.0;0.002	T	0.57051	-0.7877	10	0.38643	T	0.18	.	4.6039	0.12366	0.7257:0.0:0.2743:0.0	.	334;334;334;334	Q9HCM4-3;Q9HCM4-4;Q9HCM4-2;Q9HCM4	.;.;.;E41L5_HUMAN	R	334	ENSP00000263713:H334R;ENSP00000393856:H334R;ENSP00000329687:H334R;ENSP00000393722:H334R;ENSP00000390439:H334R	ENSP00000263713:H334R	H	+	2	0	EPB41L5	120564520	0.844000	0.29557	0.944000	0.38274	0.954000	0.61252	2.641000	0.46587	2.184000	0.69523	0.477000	0.44152	CAT	.	.		0.388	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254230.2	NM_020909	
NBEAL1	65065	hgsc.bcm.edu	37	2	203987055	203987055	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr2:203987055T>A	ENST00000449802.1	+	18	2917	c.2584T>A	c.(2584-2586)Tgg>Agg	p.W862R		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	862										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						AGTAGTGAACTGGGACATTAA	0.299																																					p.W862R		Atlas-SNP	.											.	NBEAL1	266	.	0			c.T2584A						.						141.0	115.0	123.0					2																	203987055		692	1587	2279	SO:0001583	missense	65065	exon18			GTGAACTGGGACA	AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.2584T>A	chr2.hg19:g.203987055T>A	ENSP00000399903:p.Trp862Arg	80.0	0.0		78.0	20.0	NM_001114132	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	ENST00000449802.1	hg19	CCDS46495.1	.	.	.	.	.	.	.	.	.	.	T	19.44	3.828514	0.71258	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.30448	1.53	5.0	5.0	0.66597	.	.	.	.	.	T	0.51466	0.1676	M	0.68317	2.08	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.45760	-0.9239	9	0.22109	T	0.4	.	14.6419	0.68732	0.0:0.0:0.0:1.0	.	862	Q6ZS30	NBEL1_HUMAN	R	862	ENSP00000399903:W862R	ENSP00000344985:W862R	W	+	1	0	NBEAL1	203695300	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.538000	0.82048	1.998000	0.58463	0.383000	0.25322	TGG	.	.		0.299	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333982.4		
ABCA12	26154	hgsc.bcm.edu	37	2	215813385	215813385	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr2:215813385T>C	ENST00000272895.7	-	47	7258	c.7039A>G	c.(7039-7041)Act>Gct	p.T2347A	ABCA12_ENST00000389661.4_Missense_Mutation_p.T2029A|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2347	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCTTCCACAGTTACCAGGTCA	0.378																																					p.T2347A	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.A7039G						.						105.0	97.0	100.0					2																	215813385		2203	4300	6503	SO:0001583	missense	26154	exon47			CCACAGTTACCAG	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7039A>G	chr2.hg19:g.215813385T>C	ENSP00000272895:p.Thr2347Ala	183.0	0.0		167.0	16.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033652	0.75504	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.83419	-1.72;-1.72	5.48	-4.44	0.03557	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.400939	0.23746	N	0.044969	D	0.88800	0.6535	H	0.94808	3.585	0.80722	D	1	P;P	0.39696	0.683;0.471	P;B	0.48089	0.566;0.355	D	0.87897	0.2688	10	0.87932	D	0	.	13.6615	0.62370	0.659:0.0:0.0:0.341	.	2347;2029	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	A	2347;2029	ENSP00000272895:T2347A;ENSP00000374312:T2029A	ENSP00000272895:T2347A	T	-	1	0	ABCA12	215521630	0.992000	0.36948	0.045000	0.18777	0.997000	0.91878	2.200000	0.42724	-1.130000	0.02914	0.533000	0.62120	ACT	.	.		0.378	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
FYCO1	79443	hgsc.bcm.edu	37	3	46010096	46010096	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:46010096C>T	ENST00000296137.2	-	8	935	c.730G>A	c.(730-732)Gtg>Atg	p.V244M	FYCO1_ENST00000535325.1_Missense_Mutation_p.V244M	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	244					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TTCTCCCGCACCTCCAACTGG	0.572																																					p.V244M		Atlas-SNP	.											.	FYCO1	115	.	0			c.G730A						.						73.0	69.0	70.0					3																	46010096		2203	4300	6503	SO:0001583	missense	79443	exon8			CCCGCACCTCCAA	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.730G>A	chr3.hg19:g.46010096C>T	ENSP00000296137:p.Val244Met	24.0	0.0		23.0	10.0	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	ENST00000296137.2	hg19	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.469752	0.43839	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.22539	1.95;1.98	5.45	-0.532	0.11890	.	0.528594	0.19544	N	0.111724	T	0.12475	0.0303	L	0.50919	1.6	0.29384	N	0.863079	B;B	0.33883	0.38;0.43	B;B	0.27608	0.081;0.045	T	0.12192	-1.0557	10	0.46703	T	0.11	-11.6461	0.8898	0.01252	0.251:0.1957:0.3493:0.2041	.	244;244	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	M	244	ENSP00000296137:V244M;ENSP00000441178:V244M	ENSP00000296137:V244M	V	-	1	0	FYCO1	45985100	0.526000	0.26298	0.997000	0.53966	0.983000	0.72400	0.248000	0.18198	-0.016000	0.14127	0.563000	0.77884	GTG	.	.		0.572	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
DNAH1	25981	hgsc.bcm.edu	37	3	52387648	52387648	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:52387648A>T	ENST00000420323.2	+	20	3740	c.3479A>T	c.(3478-3480)cAg>cTg	p.Q1160L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1160	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GCCATCGAGCAGGTGGGTAGC	0.622																																					p.Q1160L		Atlas-SNP	.											.	DNAH1	534	.	0			c.A3479T						.						12.0	14.0	14.0					3																	52387648		2059	4192	6251	SO:0001630	splice_region_variant	25981	exon20			TCGAGCAGGTGGG	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.3480+1A>T	chr3.hg19:g.52387648A>T		46.0	0.0		46.0	21.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.694377	0.88830	.	.	ENSG00000114841	ENST00000420323	T	0.61742	0.08	5.74	5.74	0.90152	.	0.264926	0.27076	N	0.021054	T	0.68174	0.2972	M	0.62088	1.915	0.80722	D	1	B;P	0.49961	0.372;0.93	B;P	0.53954	0.216;0.738	T	0.69617	-0.5097	10	0.51188	T	0.08	.	16.0214	0.80499	1.0:0.0:0.0:0.0	.	1160;1160	C9JXH6;Q9P2D7-3	.;.	L	1160	ENSP00000401514:Q1160L	ENSP00000401514:Q1160L	Q	+	2	0	DNAH1	52362688	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.617000	0.74210	2.198000	0.70561	0.496000	0.49642	CAG	.	.		0.622	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	Missense_Mutation
SPATA12	353324	hgsc.bcm.edu	37	3	57107930	57107930	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:57107930C>G	ENST00000334325.1	+	2	883	c.208C>G	c.(208-210)Ctg>Gtg	p.L70V	ARHGEF3_ENST00000338458.4_Intron	NM_181727.1	NP_859078.1	Q7Z6I5	SPT12_HUMAN	spermatogenesis associated 12	70										large_intestine(2)|lung(1)	3				KIRC - Kidney renal clear cell carcinoma(284;0.0111)|Kidney(284;0.0129)		CCTCCCAGAGCTGACATTTCA	0.537																																					p.L70V		Atlas-SNP	.											.	SPATA12	9	.	0			c.C208G						.						71.0	72.0	71.0					3																	57107930		2203	4300	6503	SO:0001583	missense	353324	exon2			CCAGAGCTGACAT	AY221117	CCDS2879.1	3p21.2	2012-09-19			ENSG00000186451	ENSG00000186451			23221	protein-coding gene	gene with protein product		609869				22981541, 17251597	Standard	NM_181727		Approved		uc003dij.1	Q7Z6I5	OTTHUMG00000158862	ENST00000334325.1:c.208C>G	chr3.hg19:g.57107930C>G	ENSP00000335392:p.Leu70Val	116.0	0.0		105.0	40.0	NM_181727	A0AVA8|B2RMW1	Missense_Mutation	SNP	ENST00000334325.1	hg19	CCDS2879.1	.	.	.	.	.	.	.	.	.	.	C	8.975	0.973899	0.18736	.	.	ENSG00000186451	ENST00000334325	.	.	.	2.33	-0.97	0.10306	.	.	.	.	.	T	0.16599	0.0399	N	0.08118	0	0.09310	N	1	P	0.50156	0.932	P	0.47470	0.548	T	0.10706	-1.0618	8	0.87932	D	0	.	2.3512	0.04284	0.2354:0.4505:0.0:0.3141	.	70	Q7Z6I5	SPT12_HUMAN	V	70	.	ENSP00000335392:L70V	L	+	1	2	SPATA12	57082970	0.000000	0.05858	0.001000	0.08648	0.235000	0.25334	-1.260000	0.02858	-0.271000	0.09272	0.563000	0.77884	CTG	.	.		0.537	SPATA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352457.2	NM_181727	
DZIP3	9666	hgsc.bcm.edu	37	3	108366815	108366815	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:108366815T>A	ENST00000361582.3	+	16	2048	c.1818T>A	c.(1816-1818)aaT>aaA	p.N606K	DZIP3_ENST00000463306.1_Missense_Mutation_p.N606K	NM_014648.3	NP_055463.1	Q86Y13	DZIP3_HUMAN	DAZ interacting zinc finger protein 3	606					protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|phosphatase binding (GO:0019902)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(21)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	45						AGTTACAGAATGAGGAAGAAG	0.323																																					p.N606K		Atlas-SNP	.											.	DZIP3	111	.	0			c.T1818A						.						93.0	98.0	96.0					3																	108366815		2203	4299	6502	SO:0001583	missense	9666	exon16			ACAGAATGAGGAA	AF279370	CCDS2952.1	3q13.13	2013-05-22	2013-05-22		ENSG00000198919	ENSG00000198919		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30938	protein-coding gene	gene with protein product	"""human RNA-binding ubiquitin ligase of 138 kDa"", ""protein phosphatase 1, regulatory subunit 66"""	608672	"""DAZ interacting protein 3, zinc finger"""			9734811, 12538761	Standard	NM_014648		Approved	hRUL138, PPP1R66	uc003dxd.3	Q86Y13	OTTHUMG00000159232	ENST00000361582.3:c.1818T>A	chr3.hg19:g.108366815T>A	ENSP00000355028:p.Asn606Lys	238.0	0.0		280.0	23.0	NM_014648	B3KN01|O75162|Q6P3R9|Q6PH82|Q86Y14|Q86Y15|Q86Y16|Q8IWI0|Q96RS9	Missense_Mutation	SNP	ENST00000361582.3	hg19	CCDS2952.1	.	.	.	.	.	.	.	.	.	.	T	12.95	2.091301	0.36855	.	.	ENSG00000198919	ENST00000361582;ENST00000479138;ENST00000463306	T;T	0.22743	1.94;1.94	5.25	2.87	0.33458	.	0.200590	0.35708	N	0.003039	T	0.23014	0.0556	N	0.16478	0.41	0.27343	N	0.956466	D;D;B	0.64830	0.97;0.994;0.043	P;D;B	0.63488	0.681;0.915;0.016	T	0.03587	-1.1022	10	0.56958	D	0.05	-15.2579	6.8142	0.23820	0.0:0.1828:0.0:0.8172	.	224;606;606	D3DN61;C9J9M8;Q86Y13	.;.;DZIP3_HUMAN	K	606	ENSP00000355028:N606K;ENSP00000419981:N606K	ENSP00000355028:N606K	N	+	3	2	DZIP3	109849505	0.997000	0.39634	1.000000	0.80357	0.995000	0.86356	-0.003000	0.12901	0.452000	0.26830	-0.287000	0.09952	AAT	.	.		0.323	DZIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353968.1	NM_014648	
SPICE1	152185	hgsc.bcm.edu	37	3	113176014	113176014	+	Silent	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:113176014C>T	ENST00000295872.4	-	13	1885	c.1626G>A	c.(1624-1626)aaG>aaA	p.K542K		NM_144718.3	NP_653319.1	Q8N0Z3	SPICE_HUMAN	spindle and centriole associated protein 1	542					metaphase plate congression (GO:0051310)|regulation of centriole replication (GO:0046599)|spindle assembly involved in mitosis (GO:0090307)	centriole (GO:0005814)|centrosome (GO:0005813)|spindle (GO:0005819)				NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(3)|large_intestine(9)|lung(10)|ovary(2)|skin(2)|urinary_tract(1)	33						TTAAGTTGCTCTTCTGCCTGG	0.393																																					p.K542K		Atlas-SNP	.											.	SPICE1	130	.	0			c.G1626A						.						74.0	73.0	73.0					3																	113176014		2203	4300	6503	SO:0001819	synonymous_variant	152185	exon13			GTTGCTCTTCTGC	AY099107	CCDS2973.1	3q13.2	2010-09-01	2010-09-01	2010-09-01	ENSG00000163611	ENSG00000163611			25083	protein-coding gene	gene with protein product	"""spindle and centriole protein"""	613447	"""coiled-coil domain containing 52"""	CCDC52		20736305	Standard	NM_144718		Approved	SPICE	uc003eag.4	Q8N0Z3	OTTHUMG00000159261	ENST00000295872.4:c.1626G>A	chr3.hg19:g.113176014C>T		69.0	0.0		55.0	12.0	NM_144718	D3DN72|Q8WUX6	Silent	SNP	ENST00000295872.4	hg19	CCDS2973.1																																																																																			.	.		0.393	SPICE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354177.2	NM_144718	
COPB2	9276	hgsc.bcm.edu	37	3	139077908	139077908	+	Missense_Mutation	SNP	C	C	T	rs201811724		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:139077908C>T	ENST00000333188.5	-	19	2597	c.2416G>A	c.(2416-2418)Gtt>Att	p.V806I	COPB2_ENST00000507777.1_Missense_Mutation_p.V777I	NM_004766.2	NP_004757.1	P35606	COPB2_HUMAN	coatomer protein complex, subunit beta 2 (beta prime)	806					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)	structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	24						TCTTCAACAACAAAGGCTTCT	0.448																																					p.V806I		Atlas-SNP	.											.	COPB2	80	.	0			c.G2416A						.						157.0	160.0	159.0					3																	139077908		2203	4300	6503	SO:0001583	missense	9276	exon19			CAACAACAAAGGC	BC000326	CCDS3108.1	3q23	2013-01-10			ENSG00000184432	ENSG00000184432		"""WD repeat domain containing"""	2232	protein-coding gene	gene with protein product		606990				9858824	Standard	NM_004766		Approved	beta'-COP, betaprime-COP	uc003etf.4	P35606	OTTHUMG00000159959	ENST00000333188.5:c.2416G>A	chr3.hg19:g.139077908C>T	ENSP00000329419:p.Val806Ile	101.0	0.0		86.0	25.0	NM_004766	B4DZI8	Missense_Mutation	SNP	ENST00000333188.5	hg19	CCDS3108.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.96|13.96	2.393085|2.393085	0.42410|0.42410	.|.	.|.	ENSG00000184432|ENSG00000184432	ENST00000503326|ENST00000333188;ENST00000507777	.|T;T	.|0.62232	.|0.04;0.14	5.04|5.04	2.88|2.88	0.33553|0.33553	.|.	.|0.372503	.|0.29522	.|N	.|0.011920	T|T	0.52645|0.52645	0.1747|0.1747	L|L	0.43152|0.43152	1.355|1.355	0.35461|0.35461	D|D	0.796494|0.796494	.|B	.|0.14012	.|0.009	.|B	.|0.10450	.|0.005	T|T	0.59936|0.59936	-0.7360|-0.7360	5|10	.|0.45353	.|T	.|0.12	-11.1033|-11.1033	12.3636|12.3636	0.55217|0.55217	0.0:0.836:0.0:0.164|0.0:0.836:0.0:0.164	.|.	.|806	.|P35606	.|COPB2_HUMAN	Y|I	19|806;777	.|ENSP00000329419:V806I;ENSP00000422295:V777I	.|ENSP00000329419:V806I	C|V	-|-	2|1	0|0	COPB2|COPB2	140560598|140560598	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	1.241000|1.241000	0.32743|0.32743	1.123000|1.123000	0.41961|0.41961	0.655000|0.655000	0.94253|0.94253	TGT|GTT	.	.		0.448	COPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358495.2	NM_004766	
PLOD2	5352	hgsc.bcm.edu	37	3	145878772	145878772	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:145878772C>T	ENST00000360060.3	-	1	182	c.5G>A	c.(4-6)gGg>gAg	p.G2E	PLOD2_ENST00000282903.5_Missense_Mutation_p.G2E|PLOD2_ENST00000494950.1_5'UTR	NM_000935.2	NP_000926.2	O00469	PLOD2_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2	2					cellular protein modification process (GO:0006464)|extracellular matrix organization (GO:0030198)|response to hypoxia (GO:0001666)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29					Vitamin C(DB00126)	CGTGCATCCCCCCATATTCGG	0.721																																					p.G2E		Atlas-SNP	.											.	PLOD2	81	.	0			c.G5A						.						28.0	29.0	28.0					3																	145878772		2181	4271	6452	SO:0001583	missense	5352	exon1			CATCCCCCCATAT	U84573	CCDS3131.1, CCDS3132.1	3q24	2011-08-24	2005-01-04		ENSG00000152952	ENSG00000152952			9082	protein-coding gene	gene with protein product	"""lysyl hydroxlase 2"""	601865	"""procollagen-lysine, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase) 2"""			9054364	Standard	XM_005247535		Approved	LH2	uc003evr.1	O00469	OTTHUMG00000159417	ENST00000360060.3:c.5G>A	chr3.hg19:g.145878772C>T	ENSP00000353170:p.Gly2Glu	153.0	0.0		160.0	55.0	NM_182943	B3KWS3|Q59ED2|Q8N170	Missense_Mutation	SNP	ENST00000360060.3	hg19	CCDS3131.1	.	.	.	.	.	.	.	.	.	.	C	10.98	1.504891	0.26949	.	.	ENSG00000152952	ENST00000282903;ENST00000360060	T;T	0.65732	-0.16;-0.17	4.52	1.4	0.22301	.	1.527540	0.04108	N	0.314073	T	0.40932	0.1137	N	0.08118	0	0.22435	N	0.999107	B;B	0.22414	0.041;0.069	B;B	0.18871	0.01;0.023	T	0.33137	-0.9880	10	0.52906	T	0.07	-5.9246	3.839	0.08906	0.1545:0.5696:0.1727:0.1032	.	2;2	O00469;O00469-2	PLOD2_HUMAN;.	E	2	ENSP00000282903:G2E;ENSP00000353170:G2E	ENSP00000282903:G2E	G	-	2	0	PLOD2	147361462	0.026000	0.19158	0.094000	0.20943	0.002000	0.02628	0.246000	0.18160	0.350000	0.24002	-0.268000	0.10319	GGG	.	.		0.721	PLOD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355185.1	NM_000935	
MBNL1	4154	hgsc.bcm.edu	37	3	152132752	152132752	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:152132752G>A	ENST00000463374.1	+	2	708	c.197G>A	c.(196-198)tGc>tAc	p.C66Y	MBNL1_ENST00000485910.1_Missense_Mutation_p.C66Y|MBNL1_ENST00000545754.1_Missense_Mutation_p.C66Y|MBNL1_ENST00000324196.5_Missense_Mutation_p.C66Y|MBNL1_ENST00000282488.7_Missense_Mutation_p.C66Y|MBNL1_ENST00000493459.1_Missense_Mutation_p.C9Y|MBNL1_ENST00000324210.5_Missense_Mutation_p.C66Y|MBNL1_ENST00000282486.6_Missense_Mutation_p.C66Y|MBNL1_ENST00000485509.1_Missense_Mutation_p.C66Y|MBNL1_ENST00000355460.2_Missense_Mutation_p.C66Y|MBNL1_ENST00000357472.3_Missense_Mutation_p.C66Y|MBNL1_ENST00000492948.1_Missense_Mutation_p.C66Y|MBNL1_ENST00000498502.1_Missense_Mutation_p.C66Y	NM_207293.1	NP_997176.1	Q9NR56	MBNL1_HUMAN	muscleblind-like splicing regulator 1	66					alternative mRNA splicing, via spliceosome (GO:0000380)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|mRNA splice site selection (GO:0006376)|myoblast differentiation (GO:0045445)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|skeletal muscle tissue development (GO:0007519)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			AGGGAGAACTGCAAATATCTT	0.393																																					p.C66Y		Atlas-SNP	.											.	MBNL1	100	.	0			c.G197A						.						111.0	106.0	108.0					3																	152132752		2203	4300	6503	SO:0001583	missense	4154	exon3			AGAACTGCAAATA	Y13829	CCDS3163.1, CCDS3164.1, CCDS3165.1, CCDS3166.1, CCDS3167.1, CCDS3168.1, CCDS54656.1	3q25	2013-01-18	2012-02-23	2003-03-14	ENSG00000152601	ENSG00000152601		"""Zinc fingers, CCCH-type domain containing"""	6923	protein-coding gene	gene with protein product		606516	"""muscleblind (Drosophila)-like"", ""muscleblind-like (Drosophila)"""	MBNL			Standard	NM_021038		Approved	KIAA0428, EXP42, EXP40, EXP35, EXP	uc003ezm.3	Q9NR56	OTTHUMG00000159163	ENST00000463374.1:c.197G>A	chr3.hg19:g.152132752G>A	ENSP00000418108:p.Cys66Tyr	118.0	0.0		125.0	5.0	NM_207292	E9PBW7|O43311|O43797|Q86UV8|Q86UV9|Q96P92|Q96RE3	Missense_Mutation	SNP	ENST00000463374.1	hg19	CCDS3165.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.3|20.3	3.972532|3.972532	0.74246|0.74246	.|.	.|.	ENSG00000152601|ENSG00000152601	ENST00000464596|ENST00000282486;ENST00000282488;ENST00000355460;ENST00000493459;ENST00000324210;ENST00000459747;ENST00000498502;ENST00000324196;ENST00000545754;ENST00000357472;ENST00000485910;ENST00000463374;ENST00000465907;ENST00000492948;ENST00000485509	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.52754	.|0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65;0.65	5.8|5.8	5.8|5.8	0.92144|0.92144	.|Zinc finger, CCCH-type (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.79299|0.79299	0.4422|0.4422	H|H	0.94264|0.94264	3.515|3.515	0.80722|0.80722	D|D	1|1	.|D;B;B;B;D;B;D;D	.|0.89917	.|1.0;0.001;0.001;0.095;1.0;0.057;1.0;1.0	.|D;B;B;B;D;B;D;D	.|0.97110	.|0.99;0.005;0.005;0.159;0.999;0.102;1.0;1.0	D|D	0.84359|0.84359	0.0537|0.0537	5|10	.|0.87932	.|D	.|0	.|.	20.0693|20.0693	0.97712|0.97712	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|66;66;66;66;66;9;66;66	.|E9PBW7;Q9NR56-3;Q96RE3;Q9NR56;Q86UV8;Q86VM6;Q9NR56-2;Q96P92	.|.;.;.;MBNL1_HUMAN;.;.;.;.	T|Y	65|66;66;66;9;66;10;66;66;66;66;66;66;66;66;66	.|ENSP00000282486:C66Y;ENSP00000282488:C66Y;ENSP00000347637:C66Y;ENSP00000419347:C9Y;ENSP00000319429:C66Y;ENSP00000417169:C10Y;ENSP00000420327:C66Y;ENSP00000319374:C66Y;ENSP00000437491:C66Y;ENSP00000350064:C66Y;ENSP00000418427:C66Y;ENSP00000418108:C66Y;ENSP00000417630:C66Y;ENSP00000420103:C66Y;ENSP00000418876:C66Y	.|ENSP00000282486:C66Y	A|C	+|+	1|2	0|0	MBNL1|MBNL1	153615442|153615442	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.731000|9.731000	0.98807|0.98807	2.758000|2.758000	0.94735|0.94735	0.563000|0.563000	0.77884|0.77884	GCA|TGC	.	.		0.393	MBNL1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353604.1	NM_021038	
PLCH1	23007	hgsc.bcm.edu	37	3	155199724	155199724	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:155199724G>T	ENST00000340059.7	-	23	4114	c.4115C>A	c.(4114-4116)aCa>aAa	p.T1372K	PLCH1_ENST00000494598.1_Intron|PLCH1_ENST00000447496.2_3'UTR|PLCH1_ENST00000334686.6_Missense_Mutation_p.T1334K|PLCH1_ENST00000460012.1_Missense_Mutation_p.T1334K|PLCH1_ENST00000414191.1_Missense_Mutation_p.T1334K	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	1372					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTCACAGGTTGTTAGAGAAAG	0.423																																					p.T1372K		Atlas-SNP	.											.	PLCH1	406	.	0			c.C4115A						.						46.0	50.0	49.0					3																	155199724		2203	4300	6503	SO:0001583	missense	23007	exon23			CAGGTTGTTAGAG	AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.4115C>A	chr3.hg19:g.155199724G>T	ENSP00000345988:p.Thr1372Lys	91.0	0.0		78.0	14.0	NM_001130960	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	ENST00000340059.7	hg19	CCDS46939.1	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674648	0.47781	.	.	ENSG00000114805	ENST00000460012;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1	5.47	4.5	0.54988	.	1.432160	0.04132	N	0.318083	T	0.72748	0.3499	L	0.34521	1.04	0.18873	N	0.999987	P;P	0.39480	0.675;0.546	B;B	0.35413	0.202;0.1	T	0.64141	-0.6477	10	0.87932	D	0	.	13.8156	0.63290	0.0791:0.0:0.9209:0.0	.	1334;1372	Q4KWH8-2;Q4KWH8	.;PLCH1_HUMAN	K	1334;1372;1334;1334	ENSP00000417502:T1334K;ENSP00000345988:T1372K;ENSP00000335469:T1334K;ENSP00000412977:T1334K	ENSP00000335469:T1334K	T	-	2	0	PLCH1	156682418	0.753000	0.28349	0.001000	0.08648	0.141000	0.21300	2.995000	0.49441	1.141000	0.42275	0.585000	0.79938	ACA	.	.		0.423	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000351125.1	NM_014996	
MASP1	5648	hgsc.bcm.edu	37	3	186980347	186980347	+	Silent	SNP	G	G	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:186980347G>C	ENST00000337774.5	-	3	788	c.399C>G	c.(397-399)gcC>gcG	p.A133A	MASP1_ENST00000495249.1_Intron|MASP1_ENST00000296280.6_Silent_p.A133A|MASP1_ENST00000392470.2_Silent_p.A107A|MASP1_ENST00000392472.2_Silent_p.A20A|MASP1_ENST00000169293.6_Silent_p.A133A	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	133	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.|Homodimerization. {ECO:0000250}.|Interaction with FCN2.|Interaction with MBL2.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		CCATGTAGTGGGCATCAAAGC	0.527																																					p.A133A		Atlas-SNP	.											.	MASP1	240	.	0			c.C399G						.						72.0	75.0	74.0					3																	186980347		2203	4300	6503	SO:0001819	synonymous_variant	5648	exon3			GTAGTGGGCATCA	D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.399C>G	chr3.hg19:g.186980347G>C		272.0	1.0		304.0	130.0	NM_139125	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	ENST00000337774.5	hg19	CCDS33907.1																																																																																			.	.		0.527	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344262.1	NM_001879	
ZNF721	170960	hgsc.bcm.edu	37	4	435883	435883	+	Silent	SNP	C	C	T	rs371250652		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:435883C>T	ENST00000338977.5	-	2	2385	c.2337G>A	c.(2335-2337)acG>acA	p.T779T	ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000506646.1_Intron|ZNF721_ENST00000511833.2_Silent_p.T791T			Q8TF20	ZN721_HUMAN	zinc finger protein 721	779					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TTGAGGATGACGTAATGACTT	0.378																																					p.N791K		Atlas-SNP	.											ZNF721_ENST00000511833,NS,carcinoma,0,2	ZNF721	205	.	0			c.C2373A						.	G		0,4214		0,0,2107	67.0	71.0	70.0		2373	0.1	0.0	4		70	1,8475		0,1,4237	no	coding-synonymous	ZNF721	NM_133474.2		0,1,6344	TT,TC,CC		0.0118,0.0,0.0079		791/924	435883	1,12689	2107	4238	6345	SO:0001819	synonymous_variant	170960	exon3			GGATGACGTAATG	AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.2337G>A	chr4.hg19:g.435883C>T		95.0	0.0		96.0	12.0	NM_133474	Q69YG7	Missense_Mutation	SNP	ENST00000338977.5	hg19																																																																																				.	.		0.378	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000357939.1	NM_133474	
WHSC1	7468	hgsc.bcm.edu	37	4	1920344	1920344	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:1920344G>T	ENST00000382895.3	+	7	1835	c.1404G>T	c.(1402-1404)agG>agT	p.R468S	WHSC1_ENST00000503128.1_Missense_Mutation_p.R468S|WHSC1_ENST00000514045.1_Missense_Mutation_p.R468S|WHSC1_ENST00000382892.2_Missense_Mutation_p.R468S|WHSC1_ENST00000398261.1_Missense_Mutation_p.R468S|WHSC1_ENST00000508803.1_Missense_Mutation_p.R468S|WHSC1_ENST00000420906.2_Missense_Mutation_p.R468S|WHSC1_ENST00000382891.5_Missense_Mutation_p.R468S	NM_133330.2	NP_579877.1	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1	468					anatomical structure morphogenesis (GO:0009653)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|bone development (GO:0060348)|membranous septum morphogenesis (GO:0003149)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(14)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	48		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		AAAAACACAGGGATGAGGTCA	0.468			T	IGH@	MM																																p.R468S		Atlas-SNP	.		Dom	yes		4	4p16.3	7468	Wolf-Hirschhorn syndrome candidate 1(MMSET)		L	.	WHSC1	180	.	0			c.G1404T						.						31.0	35.0	33.0					4																	1920344		2199	4299	6498	SO:0001583	missense	7468	exon5			ACACAGGGATGAG	AF083386	CCDS3356.1, CCDS33940.1, CCDS46999.1	4p16.3	2013-05-20			ENSG00000109685	ENSG00000109685		"""Zinc fingers, PHD-type"""	12766	protein-coding gene	gene with protein product		602952				9618163, 9787135	Standard	NM_133334		Approved	MMSET, NSD2	uc003gdz.4	O96028	OTTHUMG00000121147	ENST00000382895.3:c.1404G>T	chr4.hg19:g.1920344G>T	ENSP00000372351:p.Arg468Ser	126.0	0.0		136.0	45.0	NM_133335	A2A2T2|A2A2T3|A2A2T4|A7MCZ1|D3DVQ2|O96031|Q4VBY8|Q672J1|Q6IS00|Q86V01|Q9BZB4|Q9UI92|Q9UPR2	Missense_Mutation	SNP	ENST00000382895.3	hg19	CCDS33940.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530446	0.45073	.	.	ENSG00000109685	ENST00000508803;ENST00000514045;ENST00000382891;ENST00000382892;ENST00000420906;ENST00000382895;ENST00000503128;ENST00000398261	D;D;D;D;D;D;D;D	0.98617	-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03;-5.03	5.23	1.99	0.26369	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.000000	0.56097	D	0.000037	D	0.98526	0.9508	M	0.89968	3.075	0.80722	D	1	D;B;D;D	0.57899	0.96;0.167;0.981;0.981	P;B;P;P	0.56278	0.737;0.049;0.795;0.795	D	0.96998	0.9727	10	0.32370	T	0.25	.	5.6673	0.17702	0.5355:0.0:0.4645:0.0	.	468;468;468;468	O96028-3;O96028;O96028-5;O96028-6	.;NSD2_HUMAN;.;.	S	468	ENSP00000423972:R468S;ENSP00000421681:R468S;ENSP00000372347:R468S;ENSP00000372348:R468S;ENSP00000399251:R468S;ENSP00000372351:R468S;ENSP00000425761:R468S;ENSP00000381311:R468S	ENSP00000308780:R468S	R	+	3	2	WHSC1	1890142	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.955000	0.49121	0.677000	0.31305	-0.291000	0.09656	AGG	.	.		0.468	WHSC1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366269.2	NM_133330	
PCDH7	5099	hgsc.bcm.edu	37	4	30724132	30724132	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:30724132C>T	ENST00000361762.2	+	1	2096	c.1088C>T	c.(1087-1089)aCg>aTg	p.T363M	PCDH7_ENST00000543491.1_Missense_Mutation_p.T363M	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	363	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CTTGACGAGACGTCCGGCTGG	0.701																																					p.T363M		Atlas-SNP	.											.	PCDH7	215	.	0			c.C1088T						.						28.0	31.0	30.0					4																	30724132		2190	4267	6457	SO:0001583	missense	5099	exon1			ACGAGACGTCCGG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1088C>T	chr4.hg19:g.30724132C>T	ENSP00000355243:p.Thr363Met	135.0	0.0		122.0	20.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.476533	0.26511	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.52983	0.64;0.64	5.69	3.96	0.45880	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.42539	0.1207	L	0.28054	0.825	0.35362	D	0.788299	P;P;P	0.51791	0.948;0.948;0.928	P;P;P	0.52189	0.565;0.565;0.692	T	0.54139	-0.8338	9	0.87932	D	0	.	6.4268	0.21773	0.1368:0.662:0.1318:0.0694	.	363;316;363	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	M	363;363;316	ENSP00000355243:T363M;ENSP00000441802:T363M	ENSP00000330302:T316M	T	+	2	0	PCDH7	30333230	1.000000	0.71417	0.761000	0.31378	0.002000	0.02628	3.272000	0.51616	0.749000	0.32854	-0.175000	0.13238	ACG	.	.		0.701	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
ANKRD17	26057	hgsc.bcm.edu	37	4	73943153	73943153	+	Silent	SNP	T	T	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:73943153T>A	ENST00000358602.4	-	32	7622	c.7506A>T	c.(7504-7506)cgA>cgT	p.R2502R	ANKRD17_ENST00000509867.2_Silent_p.R2389R|ANKRD17_ENST00000330838.6_Silent_p.R2251R	NM_032217.3	NP_115593.3	O75179	ANR17_HUMAN	ankyrin repeat domain 17	2502					blood vessel maturation (GO:0001955)|negative regulation of smooth muscle cell differentiation (GO:0051151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(39)|ovary(6)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)	96	Breast(15;0.000295)		Epithelial(6;8.86e-07)|OV - Ovarian serous cystadenocarcinoma(6;6.22e-06)|all cancers(17;1.51e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGTACTATCTCGCTCCATTG	0.448																																					p.R2502R		Atlas-SNP	.											.	ANKRD17	214	.	0			c.A7506T						.						194.0	175.0	181.0					4																	73943153		2203	4300	6503	SO:0001819	synonymous_variant	26057	exon32			ACTATCTCGCTCC	AB014597	CCDS34003.1, CCDS34004.1, CCDS68721.1	4q21.1-q21.21	2013-01-10			ENSG00000132466	ENSG00000132466		"""Ankyrin repeat domain containing"""	23575	protein-coding gene	gene with protein product		615929				11165478	Standard	NM_032217		Approved	GTAR, KIAA0697, FLJ22206, NY-BR-16	uc003hgp.3	O75179	OTTHUMG00000160826	ENST00000358602.4:c.7506A>T	chr4.hg19:g.73943153T>A		68.0	0.0		97.0	11.0	NM_032217	E7EUV3|G5E964|Q6PJ85|Q6PK85|Q6PKA2|Q86XI3|Q8NDR5|Q96I86|Q9H288|Q9H6J9	Silent	SNP	ENST00000358602.4	hg19	CCDS34004.1																																																																																			.	.		0.448	ANKRD17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000362475.1	NM_032217	
ALPK1	80216	hgsc.bcm.edu	37	4	113352274	113352274	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:113352274G>C	ENST00000458497.1	+	11	1850	c.1571G>C	c.(1570-1572)gGt>gCt	p.G524A	ALPK1_ENST00000504176.2_Missense_Mutation_p.G446A|ALPK1_ENST00000177648.9_Missense_Mutation_p.G524A	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	524							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		TCCCTAATGGGTAAGAATGTT	0.418																																					p.G524A		Atlas-SNP	.											.	ALPK1	125	.	0			c.G1571C						.						54.0	54.0	54.0					4																	113352274		2203	4300	6503	SO:0001583	missense	80216	exon11			TAATGGGTAAGAA	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.1571G>C	chr4.hg19:g.113352274G>C	ENSP00000398048:p.Gly524Ala	95.0	0.0		119.0	27.0	NM_001102406	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	hg19	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.649556	0.00785	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.02301	4.42;4.42;4.35	4.29	1.63	0.23807	.	0.724858	0.12495	N	0.463889	T	0.00608	0.0020	N	0.00289	-1.7	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.45731	-0.9241	10	0.02654	T	1	-0.0733	7.0544	0.25091	0.0:0.6546:0.1256:0.2198	.	446;446;524	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	A	524;524;446	ENSP00000398048:G524A;ENSP00000177648:G524A;ENSP00000426044:G446A	ENSP00000177648:G524A	G	+	2	0	ALPK1	113571723	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.656000	0.05342	0.201000	0.20466	-0.769000	0.03391	GGT	.	.		0.418	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
ANK2	287	hgsc.bcm.edu	37	4	114153356	114153356	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:114153356C>T	ENST00000357077.4	+	5	477	c.424C>T	c.(424-426)Cac>Tac	p.H142Y	ANK2_ENST00000264366.6_Missense_Mutation_p.H142Y|ANK2_ENST00000506722.1_Missense_Mutation_p.H121Y|ANK2_ENST00000394537.3_Missense_Mutation_p.H142Y	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	142					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCAAGAGAATCACATTGATGT	0.378																																					p.H142Y		Atlas-SNP	.											.	ANK2	576	.	0			c.C424T						.						145.0	137.0	139.0					4																	114153356		2203	4300	6503	SO:0001583	missense	287	exon5			GAGAATCACATTG	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.424C>T	chr4.hg19:g.114153356C>T	ENSP00000349588:p.His142Tyr	85.0	0.0		76.0	16.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016884	0.93404	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000508613;ENST00000343056;ENST00000515034	T;T;T;T;T;T;T;T;T	0.68025	-0.28;-0.3;-0.28;-0.28;-0.28;-0.28;-0.28;-0.24;-0.28	5.35	5.35	0.76521	Ankyrin repeat-containing domain (4);	0.000000	0.46758	D	0.000278	T	0.76716	0.4026	L	0.38649	1.16	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;0.997;0.975	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.995;0.974	T	0.78656	-0.2119	10	0.87932	D	0	.	19.4355	0.94792	0.0:1.0:0.0:0.0	.	142;142;142;121;121	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	Y	121;121;121;157;142;142;142;157;121;7	ENSP00000423799:H121Y;ENSP00000421011:H121Y;ENSP00000421067:H121Y;ENSP00000424722:H157Y;ENSP00000378044:H142Y;ENSP00000349588:H142Y;ENSP00000264366:H142Y;ENSP00000422900:H157Y;ENSP00000421059:H7Y	ENSP00000264366:H142Y	H	+	1	0	ANK2	114372805	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.776000	0.85560	2.668000	0.90789	0.655000	0.94253	CAC	.	.		0.378	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
ANKRD50	57182	hgsc.bcm.edu	37	4	125593424	125593424	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:125593424C>G	ENST00000504087.1	-	4	2045	c.1008G>C	c.(1006-1008)tgG>tgC	p.W336C	ANKRD50_ENST00000515641.1_Missense_Mutation_p.W157C	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	336										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						TTTGGCACAGCCAGAGATATA	0.358																																					p.W336C		Atlas-SNP	.											.	ANKRD50	136	.	0			c.G1008C						.						64.0	67.0	66.0					4																	125593424		2203	4299	6502	SO:0001583	missense	57182	exon4			GCACAGCCAGAGA	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1008G>C	chr4.hg19:g.125593424C>G	ENSP00000425658:p.Trp336Cys	152.0	0.0		177.0	72.0	NM_020337	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	hg19	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.234146	0.58886	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.69040	-0.37;-0.35	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	L	0.56769	1.78	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.80879	-0.1185	10	0.72032	D	0.01	.	19.4269	0.94746	0.0:1.0:0.0:0.0	.	336	Q9ULJ7	ANR50_HUMAN	C	336;157	ENSP00000425658:W336C;ENSP00000425355:W157C	ENSP00000425658:W336C	W	-	3	0	ANKRD50	125812874	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.164000	0.77533	2.822000	0.97130	0.650000	0.86243	TGG	.	.		0.358	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
PDGFC	56034	hgsc.bcm.edu	37	4	157732066	157732066	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr4:157732066T>C	ENST00000502773.1	-	3	908	c.418A>G	c.(418-420)Att>Gtt	p.I140V	PDGFC_ENST00000541126.1_5'UTR|PDGFC_ENST00000542208.1_Intron|PDGFC_ENST00000422544.2_Missense_Mutation_p.I140V	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	140	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		CTTATCCTAATTTGATTTCCT	0.403																																					p.I140V		Atlas-SNP	.											.	PDGFC	46	.	0			c.A418G						.						88.0	89.0	89.0					4																	157732066		2203	4300	6503	SO:0001583	missense	56034	exon3			TCCTAATTTGATT	AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.418A>G	chr4.hg19:g.157732066T>C	ENSP00000422464:p.Ile140Val	332.0	0.0		313.0	22.0	NM_016205	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Missense_Mutation	SNP	ENST00000502773.1	hg19	CCDS3795.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263165	0.80358	.	.	ENSG00000145431	ENST00000502773;ENST00000422544;ENST00000543489	T;T	0.16196	2.36;2.36	5.08	5.08	0.68730	CUB (5);	0.000000	0.85682	D	0.000000	T	0.26011	0.0634	N	0.17872	0.535	0.80722	D	1	D	0.61697	0.99	D	0.65573	0.936	T	0.04522	-1.0945	10	0.49607	T	0.09	-25.5924	15.1364	0.72569	0.0:0.0:0.0:1.0	.	140	Q9NRA1	PDGFC_HUMAN	V	140	ENSP00000422464:I140V;ENSP00000410048:I140V	ENSP00000410048:I140V	I	-	1	0	PDGFC	157951516	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	4.797000	0.62503	2.041000	0.60428	0.460000	0.39030	ATT	.	.		0.403	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366123.1		
WDR36	134430	hgsc.bcm.edu	37	5	110432780	110432780	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr5:110432780A>G	ENST00000513710.2	+	3	366	c.362A>G	c.(361-363)aAt>aGt	p.N121S	WDR36_ENST00000506538.2_Missense_Mutation_p.N121S|WDR36_ENST00000505303.1_Missense_Mutation_p.N65S			Q8NI36	WDR36_HUMAN	WD repeat domain 36	121					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		CTGCTAGGTAATTCTGTTCCA	0.338																																					p.N121S		Atlas-SNP	.											.	WDR36	111	.	0			c.A362G						.						125.0	122.0	123.0					5																	110432780		2202	4300	6502	SO:0001583	missense	134430	exon3			TAGGTAATTCTGT	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.362A>G	chr5.hg19:g.110432780A>G	ENSP00000424628:p.Asn121Ser	46.0	0.0		75.0	7.0	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	hg19	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	A	19.31	3.803060	0.70682	.	.	ENSG00000134987	ENST00000506538;ENST00000513710;ENST00000505303	T;T;T	0.27720	1.65;1.65;3.35	5.56	5.56	0.83823	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.44685	0.1305	L	0.43152	1.355	0.80722	D	1	D	0.63880	0.993	P	0.58970	0.849	T	0.40869	-0.9540	10	0.87932	D	0	-18.3439	15.6895	0.77439	1.0:0.0:0.0:0.0	.	121	Q8NI36	WDR36_HUMAN	S	121;121;65	ENSP00000423067:N121S;ENSP00000424628:N121S;ENSP00000422158:N65S	ENSP00000422158:N65S	N	+	2	0	WDR36	110460679	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.120000	0.94369	2.099000	0.63709	0.533000	0.62120	AAT	.	.		0.338	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
HMGXB3	22993	hgsc.bcm.edu	37	5	149427232	149427232	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr5:149427232A>G	ENST00000502717.1	+	17	3460	c.2996A>G	c.(2995-2997)aAg>aGg	p.K999R	HMGXB3_ENST00000503427.1_Missense_Mutation_p.K967R	NM_014983.2	NP_055798	Q12766	HMGX3_HUMAN	HMG box domain containing 3	1245					phosphorylation (GO:0016310)	nucleus (GO:0005634)	DNA binding (GO:0003677)|kinase activity (GO:0016301)			central_nervous_system(1)|endometrium(3)|kidney(3)|skin(2)	9						GGCACCTGCAAGCTTGATGAG	0.587																																					p.K999R		Atlas-SNP	.											.	HMGXB3	31	.	0			c.A2996G						.						62.0	65.0	64.0					5																	149427232		692	1591	2283	SO:0001583	missense	22993	exon17			CCTGCAAGCTTGA	D83778	CCDS54935.1	5q33.1	2011-07-01		2009-01-05	ENSG00000113716	ENSG00000113716		"""High mobility group / Non-canonical"""	28982	protein-coding gene	gene with protein product				HMGX3		8724849	Standard	NM_014983		Approved	SMF, KIAA0194	uc003lrk.4	Q12766	OTTHUMG00000163493	ENST00000502717.1:c.2996A>G	chr5.hg19:g.149427232A>G	ENSP00000421917:p.Lys999Arg	112.0	0.0		188.0	18.0	NM_014983	G5E9Y4|Q86UG3|Q9UMF4	Missense_Mutation	SNP	ENST00000502717.1	hg19	CCDS54935.1	.	.	.	.	.	.	.	.	.	.	A	10.09	1.253747	0.22965	.	.	ENSG00000113716	ENST00000503427;ENST00000502717	.	.	.	5.8	-4.33	0.03677	.	0.538041	0.22139	N	0.064077	T	0.22044	0.0531	N	0.17474	0.49	0.26217	N	0.979212	B	0.06786	0.001	B	0.04013	0.001	T	0.11372	-1.0590	9	0.87932	D	0	-6.5839	10.0906	0.42445	0.3513:0.0:0.5414:0.1073	.	1245	Q12766	HMGX3_HUMAN	R	967;999	.	ENSP00000421917:K999R	K	+	2	0	HMGXB3	149407425	0.996000	0.38824	0.210000	0.23637	0.892000	0.51952	0.734000	0.26101	-0.794000	0.04468	-0.333000	0.08304	AAG	.	.		0.587	HMGXB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373771.1	XM_001717202	
FAM193B	54540	hgsc.bcm.edu	37	5	176952090	176952090	+	Silent	SNP	C	C	T	rs371452748		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr5:176952090C>T	ENST00000514747.1	-	6	1440	c.1392G>A	c.(1390-1392)ctG>ctA	p.L464L	FAM193B_ENST00000443375.2_Silent_p.L431L|FAM193B_ENST00000329540.5_Silent_p.L90L|FAM193B_ENST00000508298.1_5'Flank	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	544						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						TGACCCGATCCAGTTCCCGGT	0.572																																					p.L464L		Atlas-SNP	.											.	FAM193B	28	.	0			c.G1392A						.	C		1,3907		0,1,1953	62.0	64.0	63.0		1392	5.0	1.0	5		63	0,8280		0,0,4140	no	coding-synonymous	FAM193B	NM_001190946.1		0,1,6093	TT,TC,CC		0.0,0.0256,0.0082		464/823	176952090	1,12187	1954	4140	6094	SO:0001819	synonymous_variant	54540	exon6			CCGATCCAGTTCC		CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.1392G>A	chr5.hg19:g.176952090C>T		145.0	0.0		147.0	25.0	NM_001190946	E9PET5|Q9NW00	Silent	SNP	ENST00000514747.1	hg19	CCDS54954.1	.	.	.	.	.	.	.	.	.	.	C	9.087	1.000865	0.19121	2.56E-4	0.0	ENSG00000146067	ENST00000524677	.	.	.	5.86	4.96	0.65561	.	.	.	.	.	T	0.71871	0.3391	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69953	-0.5005	4	.	.	.	-10.1237	16.3864	0.83505	0.1323:0.8677:0.0:0.0	.	.	.	.	R	150	.	.	G	-	1	0	FAM193B	176884696	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	2.377000	0.44300	2.771000	0.95319	0.563000	0.77884	GGA	.	.		0.572	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373121.1	NM_019057	
LATS1	9113	hgsc.bcm.edu	37	6	149997738	149997738	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr6:149997738A>G	ENST00000543571.1	-	6	3276	c.2729T>C	c.(2728-2730)tTg>tCg	p.L910S	LATS1_ENST00000253339.5_Missense_Mutation_p.L910S|LATS1_ENST00000542747.1_5'UTR	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AGTCCCAACCAAAGAATGTGC	0.473																																					p.L910S		Atlas-SNP	.											.	LATS1	241	.	0			c.T2729C						.						74.0	73.0	73.0					6																	149997738		2203	4300	6503	SO:0001583	missense	9113	exon6			CCAACCAAAGAAT	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2729T>C	chr6.hg19:g.149997738A>G	ENSP00000437550:p.Leu910Ser	61.0	0.0		51.0	28.0	NM_004690		Missense_Mutation	SNP	ENST00000543571.1	hg19	CCDS34551.1	.	.	.	.	.	.	.	.	.	.	A	26.0	4.695017	0.88830	.	.	ENSG00000131023	ENST00000543571;ENST00000253339	T;T	0.08720	3.06;3.06	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.44285	D	0.000462	T	0.10551	0.0258	L	0.27944	0.81	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.32666	-0.9898	9	.	.	.	.	16.1708	0.81812	1.0:0.0:0.0:0.0	.	910	O95835	LATS1_HUMAN	S	910	ENSP00000437550:L910S;ENSP00000253339:L910S	.	L	-	2	0	LATS1	150039431	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.225000	0.72522	0.533000	0.62120	TTG	.	.		0.473	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
LANCL2	55915	hgsc.bcm.edu	37	7	55466207	55466207	+	Silent	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr7:55466207G>T	ENST00000254770.2	+	3	992	c.414G>T	c.(412-414)cgG>cgT	p.R138R	LANCL2_ENST00000486376.1_3'UTR	NM_018697.3	NP_061167.1	Q9NS86	LANC2_HUMAN	LanC lantibiotic synthetase component C-like 2 (bacterial)	138					negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of abscisic acid-activated signaling pathway (GO:0009789)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|GTP binding (GO:0005525)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	25	Breast(14;0.0379)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00128)|Epithelial(13;0.0706)			GAACACTTCGGAATCTGAATG	0.517																																					p.R138R		Atlas-SNP	.											LANCL2,NS,carcinoma,0,1	LANCL2	54	.	0			c.G414T						.						87.0	85.0	85.0					7																	55466207		2203	4300	6503	SO:0001819	synonymous_variant	55915	exon3			ACTTCGGAATCTG	AJ278245	CCDS5517.1	7q31.1-q31.33	2008-07-18	2001-12-04		ENSG00000132434	ENSG00000132434			6509	protein-coding gene	gene with protein product	"""testis-specific adriamycin sensitivity protein"", ""G protein-coupled receptor 69B"""	612919	"""LanC (bacterial lantibiotic synthetase component C)-like 2"""	GPR69B		11762191	Standard	NM_018697		Approved	TASP	uc003tqp.3	Q9NS86	OTTHUMG00000023779	ENST00000254770.2:c.414G>T	chr7.hg19:g.55466207G>T		109.0	0.0		98.0	43.0	NM_018697	B2R8D4|Q6NSL4|Q8TCQ3|Q9BSR1	Silent	SNP	ENST00000254770.2	hg19	CCDS5517.1																																																																																			.	.		0.517	LANCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251459.1	NM_018697	
SEMA3A	10371	hgsc.bcm.edu	37	7	83643585	83643585	+	Silent	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr7:83643585A>G	ENST00000265362.4	-	7	1064	c.750T>C	c.(748-750)aaT>aaC	p.N250N	SEMA3A_ENST00000436949.1_Silent_p.N250N	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	250	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CATCTATTGCATTTTCACGGA	0.383																																					p.N250N		Atlas-SNP	.											.	SEMA3A	121	.	0			c.T750C						.						112.0	108.0	109.0					7																	83643585		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon7			TATTGCATTTTCA	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.750T>C	chr7.hg19:g.83643585A>G		69.0	0.0		55.0	6.0	NM_006080		Silent	SNP	ENST00000265362.4	hg19	CCDS5599.1																																																																																			.	.		0.383	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
PIK3CG	5294	hgsc.bcm.edu	37	7	106508205	106508205	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr7:106508205G>A	ENST00000359195.3	+	2	509	c.199G>A	c.(199-201)Gtg>Atg	p.V67M	PIK3CG_ENST00000440650.2_Missense_Mutation_p.V67M|PIK3CG_ENST00000496166.1_Missense_Mutation_p.V67M	NM_001282427.1|NM_002649.2	NP_001269356.1|NP_002640.2	P48736	PK3CG_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit gamma	67	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cytokine production (GO:0001816)|dendritic cell chemotaxis (GO:0002407)|endocytosis (GO:0006897)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte apoptotic process (GO:0097284)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|natural killer cell chemotaxis (GO:0035747)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of triglyceride catabolic process (GO:0010897)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion mediated by integrin (GO:0033628)|respiratory burst involved in defense response (GO:0002679)|secretory granule localization (GO:0032252)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell proliferation (GO:0042098)	1-phosphatidylinositol-4-phosphate 3-kinase, class IB complex (GO:0005944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|ephrin receptor binding (GO:0046875)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(9)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(16)|liver(4)|lung(59)|ovary(4)|pancreas(4)|prostate(3)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	132						CCACGGCAACGTGGAGCAGAT	0.657																																					p.V67M		Atlas-SNP	.											PIK3CG,NS,carcinoma,0,1	PIK3CG	279	.	0			c.G199A						.						26.0	31.0	29.0					7																	106508205		2200	4295	6495	SO:0001583	missense	5294	exon2			GGCAACGTGGAGC		CCDS5739.1	7q22	2012-07-13	2012-07-13		ENSG00000105851	ENSG00000105851	2.7.1.153		8978	protein-coding gene	gene with protein product		601232	"""phosphoinositide-3-kinase, catalytic, gamma polypeptide"""				Standard	XM_005250443		Approved		uc003vdw.3	P48736	OTTHUMG00000157641	ENST00000359195.3:c.199G>A	chr7.hg19:g.106508205G>A	ENSP00000352121:p.Val67Met	81.0	0.0		67.0	4.0	NM_002649	A4D0Q6|Q8IV23|Q9BZC8	Missense_Mutation	SNP	ENST00000359195.3	hg19	CCDS5739.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082979	0.76642	.	.	ENSG00000105851	ENST00000440650;ENST00000496166;ENST00000359195	T;T;T	0.74315	-0.83;-0.83;-0.83	5.64	5.64	0.86602	.	0.107094	0.64402	D	0.000006	D	0.85212	0.5645	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.85484	0.1181	10	0.72032	D	0.01	-23.9341	20.0585	0.97663	0.0:0.0:1.0:0.0	.	67	P48736	PK3CG_HUMAN	M	67	ENSP00000392258:V67M;ENSP00000419260:V67M;ENSP00000352121:V67M	ENSP00000352121:V67M	V	+	1	0	PIK3CG	106295441	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.464000	0.97655	2.812000	0.96745	0.557000	0.71058	GTG	.	.		0.657	PIK3CG-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349294.1		
GCC1	79571	hgsc.bcm.edu	37	7	127222196	127222196	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr7:127222196G>A	ENST00000321407.2	-	2	2624	c.2200C>T	c.(2200-2202)Cct>Tct	p.P734S	GCC1_ENST00000497650.1_5'Flank	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	734	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						AGGGAGTCAGGTAAGGTCAGG	0.532																																					p.P734S		Atlas-SNP	.											.	GCC1	83	.	0			c.C2200T						.						257.0	248.0	251.0					7																	127222196		2203	4300	6503	SO:0001583	missense	79571	exon2			AGTCAGGTAAGGT	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.2200C>T	chr7.hg19:g.127222196G>A	ENSP00000318821:p.Pro734Ser	221.0	0.0		245.0	26.0	NM_024523	Q9H6N7	Missense_Mutation	SNP	ENST00000321407.2	hg19	CCDS5796.1	.	.	.	.	.	.	.	.	.	.	G	9.137	1.012937	0.19277	.	.	ENSG00000179562	ENST00000321407	T	0.10573	2.86	5.87	4.05	0.47172	GRIP (4);	0.207402	0.51477	N	0.000091	T	0.05731	0.0150	N	0.12182	0.205	0.58432	D	0.99999	B	0.22800	0.075	B	0.23018	0.043	T	0.28138	-1.0053	10	0.09338	T	0.73	-9.6801	11.4873	0.50361	0.1551:0.0:0.8449:0.0	.	734	Q96CN9	GCC1_HUMAN	S	734	ENSP00000318821:P734S	ENSP00000318821:P734S	P	-	1	0	GCC1	127009432	1.000000	0.71417	0.952000	0.39060	0.954000	0.61252	6.024000	0.70857	1.632000	0.50472	-0.140000	0.14226	CCT	.	.		0.532	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523	
ASH2L	9070	hgsc.bcm.edu	37	8	37986410	37986410	+	Missense_Mutation	SNP	A	A	G	rs539322046		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr8:37986410A>G	ENST00000343823.6	+	12	1777	c.1468A>G	c.(1468-1470)Att>Gtt	p.I490V	ASH2L_ENST00000545394.1_Missense_Mutation_p.I351V|ASH2L_ENST00000521652.1_Missense_Mutation_p.I396V|ASH2L_ENST00000250635.7_Missense_Mutation_p.I396V|ASH2L_ENST00000428278.2_Missense_Mutation_p.I396V	NM_004674.4	NP_004665.2	Q9UBL3	ASH2L_HUMAN	ash2 (absent, small, or homeotic)-like (Drosophila)	490	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				cellular response to DNA damage stimulus (GO:0006974)|hemopoiesis (GO:0030097)|histone H3-K4 methylation (GO:0051568)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|stomach(1)	19	Colorectal(12;0.000501)	Lung NSC(58;0.0295)|all_lung(54;0.0413)				GGGATTTTATATTAATCTTCC	0.473																																					p.I490V		Atlas-SNP	.											.	ASH2L	62	.	0			c.A1468G						.						214.0	222.0	219.0					8																	37986410		2203	4300	6503	SO:0001583	missense	9070	exon12			TTTTATATTAATC	AF056717	CCDS6101.1, CCDS47840.1, CCDS59100.1, CCDS64872.1	8p11.2	2013-01-28	2001-11-28		ENSG00000129691	ENSG00000129691		"""Zinc fingers, PHD-type"""	744	protein-coding gene	gene with protein product		604782	"""ash2 (absent, small, or homeotic, Drosophila, homolog)-like"""	ASH2L1		10393421	Standard	NM_004674		Approved	ASH2L2, ASH2, Bre2	uc003xkt.5	Q9UBL3	OTTHUMG00000164016	ENST00000343823.6:c.1468A>G	chr8.hg19:g.37986410A>G	ENSP00000340896:p.Ile490Val	75.0	0.0		75.0	27.0	NM_004674	A8K7C3|D3DSW9|O60659|O60660|Q96B62	Missense_Mutation	SNP	ENST00000343823.6	hg19	CCDS6101.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.90|16.90	3.249822|3.249822	0.59212|0.59212	.|.	.|.	ENSG00000129691|ENSG00000129691	ENST00000343823;ENST00000250635;ENST00000545394;ENST00000428278;ENST00000521652|ENST00000524247	T;T;T;T;T|T	0.73363|0.69175	-0.74;-0.74;-0.74;-0.74;-0.74|-0.38	5.42|5.42	5.42|5.42	0.78866|0.78866	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);|.	0.042432|.	0.85682|.	N|.	0.000000|.	T|T	0.80989|0.80989	0.4730|0.4730	M|M	0.83483|0.83483	2.645|2.645	0.80722|0.80722	D|D	1|1	B;B|.	0.24721|.	0.11;0.002|.	B;B|.	0.35931|.	0.214;0.012|.	D|D	0.83452|0.83452	0.0049|0.0049	10|7	0.87932|0.56958	D|D	0|0.05	0.2925|0.2925	15.5087|15.5087	0.75764|0.75764	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	396;490|.	Q9UBL3-2;Q9UBL3|.	.;ASH2L_HUMAN|.	V|C	490;396;351;396;396|85	ENSP00000340896:I490V;ENSP00000250635:I396V;ENSP00000443606:I351V;ENSP00000395310:I396V;ENSP00000430259:I396V|ENSP00000429387:Y85C	ENSP00000250635:I396V|ENSP00000429387:Y85C	I|Y	+|+	1|2	0|0	ASH2L|ASH2L	38105567|38105567	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.921000|0.921000	0.55340|0.55340	7.488000|7.488000	0.81441|0.81441	2.072000|2.072000	0.62099|0.62099	0.397000|0.397000	0.26171|0.26171	ATT|TAT	.	.		0.473	ASH2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376749.4	NM_004674	
NOV	4856	hgsc.bcm.edu	37	8	120430340	120430340	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr8:120430340G>A	ENST00000259526.3	+	3	580	c.353G>A	c.(352-354)cGc>cAc	p.R118H	RP11-775B15.2_ENST00000519786.1_RNA	NM_002514.3	NP_002505.1	Q9UIW2	PLXA1_HUMAN	nephroblastoma overexpressed	0	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(3)	21	all_cancers(13;3.84e-26)|Lung NSC(37;1.19e-08)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.000507)			GTCATCTACCGCAGTGGAGAG	0.498																																					p.R118H		Atlas-SNP	.											NOV,NS,carcinoma,0,2	NOV	51	.	0			c.G353A						.						101.0	105.0	104.0					8																	120430340		2203	4300	6503	SO:0001583	missense	4856	exon3			TCTACCGCAGTGG	X96584	CCDS6328.1	8q24.12	2012-02-27	2012-02-27		ENSG00000136999	ENSG00000136999			7885	protein-coding gene	gene with protein product		164958	"""nephroblastoma overexpressed gene"""			1334251	Standard	NM_002514		Approved	IGFBP9, CCN3	uc003yoq.2	P48745	OTTHUMG00000164984	ENST00000259526.3:c.353G>A	chr8.hg19:g.120430340G>A	ENSP00000259526:p.Arg118His	119.0	0.0		282.0	27.0	NM_002514		Missense_Mutation	SNP	ENST00000259526.3	hg19	CCDS6328.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260726	0.80246	.	.	ENSG00000136999	ENST00000259526	T	0.72505	-0.66	5.51	2.63	0.31362	von Willebrand factor, type C (3);	0.251742	0.42821	N	0.000660	T	0.61776	0.2374	L	0.50333	1.59	0.40710	D	0.982568	B	0.24368	0.102	B	0.23419	0.046	T	0.56498	-0.7969	10	0.44086	T	0.13	-19.3073	9.239	0.37484	0.219:0.0:0.781:0.0	.	118	P48745	NOV_HUMAN	H	118	ENSP00000259526:R118H	ENSP00000259526:R118H	R	+	2	0	NOV	120499521	0.974000	0.33945	0.988000	0.46212	0.993000	0.82548	0.960000	0.29253	0.373000	0.24621	0.561000	0.74099	CGC	.	.		0.498	NOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381301.1	NM_002514	
FBXO10	26267	hgsc.bcm.edu	37	9	37541364	37541364	+	Silent	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr9:37541364A>G	ENST00000432825.2	-	2	450	c.402T>C	c.(400-402)atT>atC	p.I134I	FBXO10_ENST00000541829.1_Intron|RP11-613M10.8_ENST00000544475.1_5'UTR|RP11-613M10.8_ENST00000537239.2_3'UTR	NM_012166.2	NP_036298.2	Q9UK96	FBX10_HUMAN	F-box protein 10	134					apoptotic process (GO:0006915)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(5)|large_intestine(11)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	34				GBM - Glioblastoma multiforme(29;0.0107)		GGAAGAGCACAATTCGGTCAT	0.587																																					p.I134I		Atlas-SNP	.											.	FBXO10	75	.	0			c.T402C						.						151.0	152.0	151.0					9																	37541364		2060	4200	6260	SO:0001819	synonymous_variant	26267	exon2			GAGCACAATTCGG	AF174598	CCDS47966.1	9p13.1	2014-01-29	2004-06-15		ENSG00000147912	ENSG00000147912		"""F-boxes /  ""other"""""	13589	protein-coding gene	gene with protein product		609092	"""F-box only protein 10"""			10531035, 10531037, 19300908	Standard	NM_012166		Approved	FBX10	uc004aab.3	Q9UK96	OTTHUMG00000019926	ENST00000432825.2:c.402T>C	chr9.hg19:g.37541364A>G		91.0	0.0		81.0	34.0	NM_012166	Q08AL3|Q08AL4|Q5JRT8|Q9UKC3	Silent	SNP	ENST00000432825.2	hg19	CCDS47966.1																																																																																			.	.		0.587	FBXO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052472.3		
FGD3	89846	hgsc.bcm.edu	37	9	95780470	95780470	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr9:95780470G>T	ENST00000375482.3	+	11	1824	c.1328G>T	c.(1327-1329)aGa>aTa	p.R443I	FGD3_ENST00000416701.2_Missense_Mutation_p.R443I|FGD3_ENST00000538555.1_Missense_Mutation_p.R46I|FGD3_ENST00000337352.6_Missense_Mutation_p.R443I	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	443	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						ATAACAGGAAGAAAAAGGTCC	0.438																																					p.R443I		Atlas-SNP	.											.	FGD3	116	.	0			c.G1328T						.						119.0	122.0	121.0					9																	95780470		1959	4149	6108	SO:0001583	missense	89846	exon11			CAGGAAGAAAAAG	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.1328G>T	chr9.hg19:g.95780470G>T	ENSP00000364631:p.Arg443Ile	65.0	0.0		76.0	24.0	NM_001083536	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	ENST00000375482.3	hg19	CCDS43849.1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184723	0.38609	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352;ENST00000538555	T;T;T;T	0.76186	-1.0;-1.0;-1.0;-1.0	4.7	-7.27	0.01461	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.596324	0.13937	N	0.352500	T	0.76884	0.4050	L	0.55481	1.735	0.32090	N	0.591956	P;P;P	0.43542	0.702;0.81;0.703	B;P;P	0.53988	0.419;0.452;0.739	T	0.80113	-0.1518	10	0.87932	D	0	-20.2911	17.5283	0.87807	0.8647:0.0:0.1353:0.0	.	443;443;443	Q5JSP0-2;F8W7P2;Q5JSP0	.;.;FGD3_HUMAN	I	443;443;443;46	ENSP00000364631:R443I;ENSP00000413833:R443I;ENSP00000336914:R443I;ENSP00000442560:R46I	ENSP00000336914:R443I	R	+	2	0	FGD3	94820291	0.992000	0.36948	0.000000	0.03702	0.094000	0.18550	1.266000	0.33039	-1.551000	0.01706	-1.073000	0.02249	AGA	.	.		0.438	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086	
NINJ1	4814	hgsc.bcm.edu	37	9	95888799	95888799	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr9:95888799G>A	ENST00000375446.4	-	2	267	c.197C>T	c.(196-198)gCc>gTc	p.A66V	NINJ1_ENST00000489274.1_5'Flank	NM_004148.3	NP_004139.2	Q92982	NINJ1_HUMAN	ninjurin 1	66					cell adhesion (GO:0007155)|hyaloid vascular plexus regression (GO:1990384)|nervous system development (GO:0007399)|positive regulation of cell-matrix adhesion (GO:0001954)|tissue regeneration (GO:0042246)	integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|upper_aerodigestive_tract(1)	4						TTCCACGACGGCCTTCAGCTG	0.627																																					p.A66V		Atlas-SNP	.											.	NINJ1	7	.	0			c.C197T						.						115.0	93.0	101.0					9																	95888799		2203	4300	6503	SO:0001583	missense	4814	exon2			ACGACGGCCTTCA	U91512	CCDS6703.1	9q22	2008-07-21			ENSG00000131669	ENSG00000131669			7824	protein-coding gene	gene with protein product	"""nerve injury-induced protein-1"""	602062				8780658	Standard	NM_004148		Approved	NIN1	uc004atg.4	Q92982	OTTHUMG00000020242	ENST00000375446.4:c.197C>T	chr9.hg19:g.95888799G>A	ENSP00000364595:p.Ala66Val	116.0	0.0		112.0	10.0	NM_004148	Q6GU89|Q8WUV5|Q9BT07	Missense_Mutation	SNP	ENST00000375446.4	hg19	CCDS6703.1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700247	0.88924	.	.	ENSG00000131669	ENST00000375446	T	0.41758	0.99	4.49	4.49	0.54785	.	0.049158	0.85682	D	0.000000	T	0.58935	0.2157	M	0.71581	2.175	0.58432	D	0.999996	D	0.69078	0.997	D	0.64321	0.924	T	0.54569	-0.8274	10	0.17832	T	0.49	-18.758	16.2853	0.82717	0.0:0.0:1.0:0.0	.	66	Q92982	NINJ1_HUMAN	V	66	ENSP00000364595:A66V	ENSP00000364595:A66V	A	-	2	0	NINJ1	94928620	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.320000	0.96346	2.502000	0.84385	0.462000	0.41574	GCC	.	.		0.627	NINJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053123.2	NM_004148	
DDX50	79009	hgsc.bcm.edu	37	10	70673836	70673836	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr10:70673836C>T	ENST00000373585.3	+	7	1072	c.965C>T	c.(964-966)aCt>aTt	p.T322I	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	322	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						AATCCTCAGACTTTACTTTTT	0.353																																					p.T322I		Atlas-SNP	.											.	DDX50	65	.	0			c.C965T						.						45.0	45.0	45.0					10																	70673836		2203	4300	6503	SO:0001583	missense	79009	exon7			CTCAGACTTTACT	AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.965C>T	chr10.hg19:g.70673836C>T	ENSP00000362687:p.Thr322Ile	157.0	0.0		142.0	57.0	NM_024045	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	ENST00000373585.3	hg19	CCDS7283.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280225	0.80692	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.14022	2.54	5.49	5.49	0.81192	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.31638	0.0803	L	0.55481	1.735	0.80722	D	1	P;P	0.51240	0.943;0.94	P;P	0.58391	0.775;0.838	T	0.00242	-1.1885	10	0.51188	T	0.08	-12.286	19.7394	0.96219	0.0:1.0:0.0:0.0	.	322;322	Q9BQ39;B4DED6	DDX50_HUMAN;.	I	322	ENSP00000362687:T322I	ENSP00000362687:T322I	T	+	2	0	DDX50	70343842	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.745000	0.94114	0.462000	0.41574	ACT	.	.		0.353	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048363.1	NM_024045	
CARS	833	hgsc.bcm.edu	37	11	3039725	3039725	+	Silent	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr11:3039725C>A	ENST00000397111.5	-	13	1538	c.1293G>T	c.(1291-1293)ctG>ctT	p.L431L	CARS_ENST00000278224.9_Silent_p.L431L|CARS_ENST00000380525.4_Silent_p.L514L|CARS_ENST00000401769.3_Silent_p.L444L|CARS_ENST00000397114.3_Silent_p.L421L			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	431					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	TGAGGAAGGCCAGCCGCAACT	0.557			T	ALK	ALCL																																p.L514L	Ovarian(61;932 1157 5961 20446 52152)	Atlas-SNP	.		Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	.	CARS	114	.	0			c.G1542T						.						64.0	61.0	62.0					11																	3039725		2202	4298	6500	SO:0001819	synonymous_variant	833	exon14			GAAGGCCAGCCGC	AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1293G>T	chr11.hg19:g.3039725C>A		65.0	0.0		75.0	22.0	NM_001014437	Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Silent	SNP	ENST00000397111.5	hg19	CCDS7742.1																																																																																			.	.		0.557	CARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000030117.4	NM_001751	
CTNND1	1500	hgsc.bcm.edu	37	11	57559030	57559030	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr11:57559030C>T	ENST00000399050.4	+	3	616	c.80C>T	c.(79-81)aCc>aTc	p.T27I	CTNND1_ENST00000361796.4_Missense_Mutation_p.T27I|CTNND1_ENST00000428599.2_Missense_Mutation_p.T27I|CTNND1_ENST00000533667.1_Intron|CTNND1_ENST00000528621.1_5'UTR|CTNND1_ENST00000361391.6_Missense_Mutation_p.T27I|CTNND1_ENST00000529919.1_Missense_Mutation_p.T27I|CTNND1_ENST00000531014.1_Intron|CTNND1_ENST00000426142.2_Intron|CTNND1_ENST00000532463.1_Intron|CTNND1_ENST00000530094.1_Intron|RP11-691N7.6_ENST00000531074.1_3'UTR|CTNND1_ENST00000527467.1_Intron|CTNND1_ENST00000415361.2_Intron|CTNND1_ENST00000360682.6_Missense_Mutation_p.T27I|CTNND1_ENST00000526772.1_Intron|CTNND1_ENST00000526357.1_5'UTR|CTNND1_ENST00000532649.1_5'UTR|CTNND1_ENST00000526938.1_Missense_Mutation_p.T27I|CTNND1_ENST00000528232.1_Intron|CTNND1_ENST00000532787.1_Intron|CTNND1_ENST00000530748.1_5'UTR|CTNND1_ENST00000529873.1_5'UTR|CTNND1_ENST00000529986.1_Intron|CTNND1_ENST00000524630.1_Missense_Mutation_p.T27I|CTNND1_ENST00000534579.1_5'UTR|CTNND1_ENST00000532245.1_Intron|CTNND1_ENST00000399039.4_Missense_Mutation_p.T27I|CTNND1_ENST00000358694.6_Missense_Mutation_p.T27I|CTNND1_ENST00000361332.4_Missense_Mutation_p.T27I|CTNND1_ENST00000529526.1_5'UTR|TMX2-CTNND1_ENST00000528395.1_3'UTR|CTNND1_ENST00000525902.1_Intron|CTNND1_ENST00000532844.1_5'UTR	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	27					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				GAGAAGCTGACCCGGGCGCTG	0.637																																					p.T27I		Atlas-SNP	.											.	CTNND1	203	.	0			c.C80T						.						20.0	23.0	22.0					11																	57559030		1998	4152	6150	SO:0001583	missense	1500	exon3			AGCTGACCCGGGC	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.80C>T	chr11.hg19:g.57559030C>T	ENSP00000382004:p.Thr27Ile	133.0	0.0		139.0	17.0	NM_001085461	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	ENST00000399050.4	hg19	CCDS44604.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.949231	0.92660	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000358694;ENST00000428599;ENST00000526938	T;T;T;T;T;T;T;T;T;T;T	0.30981	1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51;1.51	5.62	5.62	0.85841	.	0.110655	0.64402	D	0.000010	T	0.55033	0.1895	M	0.62723	1.935	0.49798	D	0.999823	D;D;D;D;D;D	0.76494	0.993;0.993;0.988;0.999;0.993;0.988	P;P;P;D;P;P	0.72982	0.857;0.857;0.723;0.979;0.857;0.723	T	0.54556	-0.8276	10	0.87932	D	0	-21.8398	18.7943	0.91988	0.0:1.0:0.0:0.0	.	27;27;27;27;27;27	O60716-3;O60716-2;O60716;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.	I	27	ENSP00000436543:T27I;ENSP00000434808:T27I;ENSP00000381996:T27I;ENSP00000353902:T27I;ENSP00000354907:T27I;ENSP00000382004:T27I;ENSP00000354785:T27I;ENSP00000354823:T27I;ENSP00000351527:T27I;ENSP00000413586:T27I;ENSP00000432041:T27I	ENSP00000351527:T27I	T	+	2	0	CTNND1	57315606	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.568000	0.60857	2.809000	0.96659	0.655000	0.94253	ACC	.	.		0.637	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331	
MS4A2	2206	hgsc.bcm.edu	37	11	59857213	59857213	+	Silent	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr11:59857213A>G	ENST00000278888.3	+	2	207	c.105A>G	c.(103-105)tcA>tcG	p.S35S		NM_000139.4	NP_000130.1	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member 2	35					activation of phospholipase C activity (GO:0007202)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of mast cell degranulation (GO:0043306)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(4)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)	17		all_epithelial(135;0.245)			Omalizumab(DB00043)	AAGTATCTTCAGGCAGACTAT	0.463																																					p.S35S		Atlas-SNP	.											.	MS4A2	41	.	0			c.A105G						.						130.0	125.0	127.0					11																	59857213		2201	4295	6496	SO:0001819	synonymous_variant	2206	exon2			ATCTTCAGGCAGA	M89796	CCDS7980.1, CCDS73292.1	11q12-q13	2012-02-28	2012-02-28		ENSG00000149534	ENSG00000149534			7316	protein-coding gene	gene with protein product	"""Fc fragment of IgE, high affinity I, receptor for; beta polypeptide"""	147138	"""IgE responsiveness (atopic)"", ""membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)"""	FCER1B, IGER, APY		1386024	Standard	NM_000139		Approved	MS4A1	uc001nop.3	Q01362	OTTHUMG00000167239	ENST00000278888.3:c.105A>G	chr11.hg19:g.59857213A>G		63.0	0.0		43.0	8.0	NM_000139	Q54A81	Silent	SNP	ENST00000278888.3	hg19	CCDS7980.1																																																																																			.	.		0.463	MS4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393844.1		
SIK2	23235	hgsc.bcm.edu	37	11	111574147	111574147	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr11:111574147G>A	ENST00000304987.3	+	7	1121	c.948G>A	c.(946-948)gaG>gaA	p.E316E		NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2	316	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						AAACCATTGAGGTAAAGTGAT	0.453																																					p.E316E		Atlas-SNP	.											.	SIK2	89	.	0			c.G948A						.						62.0	59.0	60.0					11																	111574147		2201	4297	6498	SO:0001630	splice_region_variant	23235	exon7			CATTGAGGTAAAG	AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.948+1G>A	chr11.hg19:g.111574147G>A		56.0	0.0		44.0	13.0	NM_015191	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Silent	SNP	ENST00000304987.3	hg19	CCDS8347.1																																																																																			.	.		0.453	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319352.3	NM_015191	Silent
PLET1	349633	hgsc.bcm.edu	37	11	112126290	112126290	+	Silent	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr11:112126290G>A	ENST00000338832.2	-	2	477	c.207C>T	c.(205-207)agC>agT	p.S69S		NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN		69					cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						CAGCATAGACGCTGTCATTCA	0.493																																					p.S69S		Atlas-SNP	.											.	C11orf34	6	.	0			c.C207T						.						65.0	50.0	54.0					11																	112126290		692	1591	2283	SO:0001819	synonymous_variant	349633	exon2			ATAGACGCTGTCA																												ENST00000338832.2:c.207C>T	chr11.hg19:g.112126290G>A		73.0	0.0		68.0	7.0	NM_001145024	Q6UQ24|Q6UQ25|Q6UQ27	Silent	SNP	ENST00000338832.2	hg19																																																																																				.	.		0.493	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
FLI1	2313	hgsc.bcm.edu	37	11	128628065	128628065	+	Missense_Mutation	SNP	C	C	G	rs200865469	byFrequency	TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr11:128628065C>G	ENST00000527786.2	+	2	563	c.74C>G	c.(73-75)gCg>gGg	p.A25G	FLI1_ENST00000525560.1_5'UTR|FLI1_ENST00000344954.6_5'UTR|FLI1_ENST00000534087.2_5'UTR	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	25					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GCGTACGGAGCGGCAGCCCAT	0.622			T	EWSR1	Ewing sarcoma																																p.A25G		Atlas-SNP	.		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	.	FLI1	72	.	0			c.C74G						.						32.0	39.0	37.0					11																	128628065		2158	4256	6414	SO:0001583	missense	2313	exon2			ACGGAGCGGCAGC	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.74C>G	chr11.hg19:g.128628065C>G	ENSP00000433488:p.Ala25Gly	70.0	0.0		68.0	17.0	NM_002017	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	hg19	CCDS44768.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072160	0.76415	.	.	ENSG00000151702	ENST00000429175	T	0.15256	2.44	4.54	4.54	0.55810	.	0.155915	0.56097	N	0.000025	T	0.25419	0.0618	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	P	0.57244	0.816	T	0.01786	-1.1274	10	0.29301	T	0.29	.	18.1645	0.89721	0.0:1.0:0.0:0.0	.	25	Q01543	FLI1_HUMAN	G	25	ENSP00000399985:A25G	ENSP00000399985:A25G	A	+	2	0	FLI1	128133275	1.000000	0.71417	0.820000	0.32676	0.504000	0.33889	7.100000	0.76989	2.428000	0.82296	0.561000	0.74099	GCG	.	C|1.000;T|0.000		0.622	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017	
DDX11	1663	hgsc.bcm.edu	37	12	31238054	31238054	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr12:31238054C>T	ENST00000407793.2	+	5	883	c.632C>T	c.(631-633)gCg>gTg	p.A211V	DDX11_ENST00000228264.6_Missense_Mutation_p.A185V|DDX11_ENST00000545668.1_Missense_Mutation_p.A211V|DDX11_ENST00000251758.5_Missense_Mutation_p.A211V|DDX11_ENST00000350437.4_Missense_Mutation_p.A211V|DDX11_ENST00000542838.1_Missense_Mutation_p.A211V	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	211	Glu-rich.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					AAAAAGGTGGCGAGCAGGTGA	0.612										Multiple Myeloma(12;0.14)																											p.A211V		Atlas-SNP	.											.	DDX11	188	.	0			c.C632T						.						32.0	32.0	32.0					12																	31238054		2190	4278	6468	SO:0001583	missense	1663	exon5			AGGTGGCGAGCAG	U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.632C>T	chr12.hg19:g.31238054C>T	ENSP00000384703:p.Ala211Val	206.0	0.0		194.0	57.0	NM_030653	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000407793.2	hg19	CCDS44856.1	.	.	.	.	.	.	.	.	.	.	C	8.208	0.799606	0.16397	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000251758;ENST00000228264;ENST00000438391;ENST00000415475;ENST00000545668;ENST00000350437	D;T;T;T;T;T;T;T	0.81499	-1.5;-0.65;3.98;-1.41;0.31;4.05;-0.65;-1.2	3.7	1.78	0.24846	Helicase-like, DEXD box c2 type (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	2.500470	0.01725	N	0.028554	T	0.72220	0.3433	L	0.36672	1.1	0.09310	N	1	B;B;B;B	0.11235	0.001;0.002;0.004;0.002	B;B;B;B	0.08055	0.001;0.001;0.003;0.003	T	0.52064	-0.8625	10	0.23302	T	0.38	.	6.0476	0.19768	0.0:0.7467:0.0:0.2533	.	211;211;211;211	B4DZY1;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	V	211;211;211;185;182;185;211;211	ENSP00000443426:A211V;ENSP00000384703:A211V;ENSP00000251758:A211V;ENSP00000228264:A185V;ENSP00000407646:A182V;ENSP00000406457:A185V;ENSP00000440402:A211V;ENSP00000309965:A211V	ENSP00000228264:A185V	A	+	2	0	DDX11	31129321	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.009000	0.13219	0.762000	0.33152	0.505000	0.49811	GCG	.	.		0.612	DDX11-202	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000399728.1	NM_030653	
NELL2	4753	hgsc.bcm.edu	37	12	45001007	45001007	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr12:45001007A>C	ENST00000429094.2	-	15	2112	c.1608T>G	c.(1606-1608)atT>atG	p.I536M	NELL2_ENST00000333837.4_Missense_Mutation_p.I559M|NELL2_ENST00000551601.1_Missense_Mutation_p.I535M|NELL2_ENST00000452445.2_Missense_Mutation_p.I536M|NELL2_ENST00000549027.1_Missense_Mutation_p.I535M|NELL2_ENST00000395487.2_Missense_Mutation_p.I535M|NELL2_ENST00000437801.2_Missense_Mutation_p.I586M	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	536	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		CATTAGCGGCAATACAGGCTC	0.383																																					p.I586M		Atlas-SNP	.											.	NELL2	286	.	0			c.T1758G						.						86.0	82.0	83.0					12																	45001007		2203	4299	6502	SO:0001583	missense	4753	exon16			AGCGGCAATACAG	D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.1608T>G	chr12.hg19:g.45001007A>C	ENSP00000390680:p.Ile536Met	248.0	0.0		235.0	23.0	NM_001145107	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000429094.2	hg19	CCDS8746.1	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196812	0.58126	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801;ENST00000543684	D;D;D;D;D;D;D	0.92099	-2.31;-2.31;-2.97;-2.31;-2.31;-2.49;-2.31	5.68	2.03	0.26663	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.050997	0.85682	D	0.000000	D	0.90631	0.7062	L	0.58969	1.84	0.43287	D	0.995269	D;P;P;P;P	0.56035	0.974;0.552;0.919;0.868;0.552	P;B;P;B;B	0.52267	0.694;0.248;0.507;0.38;0.168	D	0.87299	0.2304	10	0.56958	D	0.05	-21.2665	4.349	0.11146	0.6322:0.0:0.2324:0.1354	.	559;586;535;536;535	B7Z2U7;B7Z9U3;F8VVB6;Q99435;Q96JS2	.;.;.;NELL2_HUMAN;.	M	535;536;535;536;535;559;586;535	ENSP00000378866:I535M;ENSP00000390680:I536M;ENSP00000449332:I535M;ENSP00000394612:I536M;ENSP00000447927:I535M;ENSP00000327988:I559M;ENSP00000416341:I586M	ENSP00000327988:I559M	I	-	3	3	NELL2	43287274	0.987000	0.35691	1.000000	0.80357	0.982000	0.71751	0.375000	0.20518	0.498000	0.27948	-0.290000	0.09829	ATT	.	.		0.383	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404180.1	NM_006159	
BCDIN3D	144233	hgsc.bcm.edu	37	12	50236859	50236859	+	Silent	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr12:50236859G>A	ENST00000333924.4	-	1	53	c.12C>T	c.(10-12)ccC>ccT	p.P4P	BCDIN3D-AS1_ENST00000548872.1_RNA|BCDIN3D-AS1_ENST00000549124.1_RNA	NM_181708.2	NP_859059.1	Q7Z5W3	BN3D2_HUMAN	BCDIN3 domain containing	4					miRNA metabolic process (GO:0010586)|negative regulation of pre-miRNA processing (GO:2000632)|RNA methylation (GO:0001510)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	O-methyltransferase activity (GO:0008171)|RNA methyltransferase activity (GO:0008173)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|skin(1)|stomach(1)	9						CCAGTTCCGTGGGCACCGCCA	0.647																																					p.P4P		Atlas-SNP	.											.	BCDIN3D	20	.	0			c.C12T						.						37.0	35.0	36.0					12																	50236859		2201	4296	6497	SO:0001819	synonymous_variant	144233	exon1			TTCCGTGGGCACC		CCDS8790.1	12q13.13	2008-03-12				ENSG00000186666			27050	protein-coding gene	gene with protein product							Standard	NM_181708		Approved		uc001rvh.3	Q7Z5W3	OTTHUMG00000169807	ENST00000333924.4:c.12C>T	chr12.hg19:g.50236859G>A		87.0	0.0		101.0	10.0	NM_181708	A8K829	Silent	SNP	ENST00000333924.4	hg19	CCDS8790.1																																																																																			.	.		0.647	BCDIN3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405982.1	NM_181708	
AVPR1A	552	hgsc.bcm.edu	37	12	63544382	63544382	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr12:63544382T>C	ENST00000299178.2	-	1	340	c.235A>G	c.(235-237)Acg>Gcg	p.T79A		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	79					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	TTGCGCGGCGTCCGGTGCAGA	0.657																																					p.T79A		Atlas-SNP	.											.	AVPR1A	85	.	0			c.A235G						.						24.0	26.0	25.0					12																	63544382		2203	4299	6502	SO:0001583	missense	552	exon1			GCGGCGTCCGGTG	L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.235A>G	chr12.hg19:g.63544382T>C	ENSP00000299178:p.Thr79Ala	59.0	0.0		54.0	13.0	NM_000706		Missense_Mutation	SNP	ENST00000299178.2	hg19	CCDS8965.1	.	.	.	.	.	.	.	.	.	.	T	15.56	2.868504	0.51588	.	.	ENSG00000166148	ENST00000299178	T	0.19250	2.16	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	0.051955	0.85682	D	0.000000	T	0.24314	0.0589	L	0.56280	1.765	0.52099	D	0.999947	B	0.24576	0.106	B	0.36378	0.223	T	0.06734	-1.0810	9	.	.	.	-26.4506	9.5386	0.39237	0.1571:0.0:0.0:0.8429	.	79	P37288	V1AR_HUMAN	A	79	ENSP00000299178:T79A	.	T	-	1	0	AVPR1A	61830649	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.718000	0.38001	2.015000	0.59207	0.459000	0.35465	ACG	.	.		0.657	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406734.1		
LEMD3	23592	hgsc.bcm.edu	37	12	65564347	65564347	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr12:65564347C>T	ENST00000308330.2	+	1	997	c.971C>T	c.(970-972)gCt>gTt	p.A324V	LEMD3_ENST00000541171.1_Intron	NM_001167614.1|NM_014319.4	NP_001161086.1|NP_055134.2	Q9Y2U8	MAN1_HUMAN	LEM domain containing 3	324	Poly-Ala.				negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of cell cycle (GO:0051726)|skeletal muscle cell differentiation (GO:0035914)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(2)	36			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0104)		AGGGCGGCGGCTGCCGGGAGT	0.647																																					p.A324V		Atlas-SNP	.											.	LEMD3	68	.	0			c.C971T						.						22.0	26.0	25.0					12																	65564347		2203	4300	6503	SO:0001583	missense	23592	exon1			CGGCGGCTGCCGG	AF263918	CCDS8972.1	12q14	2008-02-05			ENSG00000174106	ENSG00000174106			28887	protein-coding gene	gene with protein product		607844				10671519, 15489854	Standard	NM_014319		Approved	MAN1	uc001ssl.2	Q9Y2U8	OTTHUMG00000168840	ENST00000308330.2:c.971C>T	chr12.hg19:g.65564347C>T	ENSP00000308369:p.Ala324Val	77.0	0.0		82.0	27.0	NM_001167614	Q9NT47|Q9NYA5	Missense_Mutation	SNP	ENST00000308330.2	hg19	CCDS8972.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701117	0.68501	.	.	ENSG00000174106	ENST00000308330	T	0.56776	0.44	3.54	0.671	0.17929	.	0.464547	0.20195	N	0.097240	T	0.29061	0.0722	N	0.19112	0.55	0.34428	D	0.698205	B	0.02656	0.0	B	0.06405	0.002	T	0.14671	-1.0464	9	.	.	.	-2.9735	4.8775	0.13664	0.0:0.6152:0.1777:0.2071	.	324	Q9Y2U8	MAN1_HUMAN	V	324	ENSP00000308369:A324V	.	A	+	2	0	LEMD3	63850614	0.001000	0.12720	0.945000	0.38365	0.993000	0.82548	1.351000	0.34022	0.134000	0.18681	0.462000	0.41574	GCT	.	.		0.647	LEMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401312.2		
PLEKHG7	440107	hgsc.bcm.edu	37	12	93139255	93139255	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr12:93139255A>G	ENST00000344636.3	+	5	387	c.203A>G	c.(202-204)tAt>tGt	p.Y68C	PLEKHG7_ENST00000549856.1_Splice_Site_p.Y68C	NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	68	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						TTCTTGCAGTATTTCCGAGGG	0.448																																					p.Y68C		Atlas-SNP	.											.	PLEKHG7	38	.	0			c.A203G						.						98.0	91.0	93.0					12																	93139255		2203	4300	6503	SO:0001630	splice_region_variant	440107	exon5			TGCAGTATTTCCG	AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.202-1A>G	chr12.hg19:g.93139255A>G		88.0	0.0		71.0	5.0	NM_001004330	B2RNR7	Missense_Mutation	SNP	ENST00000344636.3	hg19	CCDS31873.1	.	.	.	.	.	.	.	.	.	.	A	12.96	2.093496	0.36952	.	.	ENSG00000187510	ENST00000344636	T	0.69040	-0.37	4.94	-0.438	0.12268	Dbl homology (DH) domain (4);	0.637939	0.16705	N	0.202957	T	0.46288	0.1385	L	0.27053	0.805	0.24705	N	0.993236	P	0.40834	0.73	B	0.41619	0.361	T	0.35201	-0.9798	10	0.38643	T	0.18	-10.971	1.8646	0.03195	0.538:0.1248:0.2164:0.1207	.	68	Q6ZR37	PKHG7_HUMAN	C	68	ENSP00000344961:Y68C	ENSP00000344961:Y68C	Y	+	2	0	PLEKHG7	91663386	0.869000	0.29996	0.846000	0.33378	0.216000	0.24613	0.011000	0.13264	-0.248000	0.09583	-0.256000	0.11100	TAT	.	.		0.448	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407288.1	NM_001004330	Missense_Mutation
USPL1	10208	hgsc.bcm.edu	37	13	31195968	31195968	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr13:31195968A>G	ENST00000255304.4	+	3	509	c.167A>G	c.(166-168)aAa>aGa	p.K56R	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	56					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		GGAAAGTTAAAAGCCTTAAAG	0.294																																					p.K56R	Ovarian(60;318 1180 1554 28110 31601)	Atlas-SNP	.											.	USPL1	82	.	0			c.A167G						.						99.0	106.0	104.0					13																	31195968		2203	4295	6498	SO:0001583	missense	10208	exon3			AGTTAAAAGCCTT	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.167A>G	chr13.hg19:g.31195968A>G	ENSP00000255304:p.Lys56Arg	284.0	0.0		202.0	24.0	NM_005800	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	hg19	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.550772	0.45383	.	.	ENSG00000132952	ENST00000255304	T	0.07021	3.23	6.06	4.84	0.62591	.	0.481828	0.24848	N	0.035107	T	0.15176	0.0366	M	0.62723	1.935	0.09310	N	1	D	0.53462	0.96	P	0.50537	0.643	T	0.08638	-1.0712	10	0.48119	T	0.1	-10.1764	9.135	0.36868	0.8571:0.0:0.1429:0.0	.	56	Q5W0Q7	USPL1_HUMAN	R	56	ENSP00000255304:K56R	ENSP00000255304:K56R	K	+	2	0	USPL1	30093968	0.999000	0.42202	0.912000	0.35992	0.946000	0.59487	3.064000	0.49986	1.068000	0.40764	0.533000	0.62120	AAA	.	.		0.294	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
LMO7	4008	hgsc.bcm.edu	37	13	76397850	76397850	+	Missense_Mutation	SNP	T	T	A	rs374411902		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr13:76397850T>A	ENST00000321797.8	+	13	2812	c.2091T>A	c.(2089-2091)gaT>gaA	p.D697E	LMO7_ENST00000357063.3_Missense_Mutation_p.D982E|LMO7_ENST00000341547.4_Missense_Mutation_p.D648E|LMO7_ENST00000465261.2_Missense_Mutation_p.D697E|LMO7_ENST00000526202.1_Missense_Mutation_p.D547E|LMO7_ENST00000377534.3_Missense_Mutation_p.D982E			Q8WWI1	LMO7_HUMAN	LIM domain 7	982					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CAGAAGAAGATGTGACAAGGC	0.517																																					p.D697E		Atlas-SNP	.											.	LMO7	334	.	0			c.T2091A						.						134.0	111.0	119.0					13																	76397850		2203	4300	6503	SO:0001583	missense	4008	exon12			AGAAGATGTGACA	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.2091T>A	chr13.hg19:g.76397850T>A	ENSP00000317802:p.Asp697Glu	140.0	0.0		124.0	66.0	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	hg19		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	12.18|12.18|12.18	1.861813|1.861813|1.861813	0.32884|0.32884|0.32884	.|.|.	.|.|.	ENSG00000136153|ENSG00000136153|ENSG00000136153	ENST00000447038|ENST00000341547;ENST00000357063;ENST00000377534;ENST00000377499;ENST00000321797;ENST00000526202;ENST00000465261|ENST00000524651	.|T;T;T;T;T;T;T|.	.|0.42900|.	.|1.56;1.54;1.55;0.98;0.98;0.97;0.96|.	5.98|5.98|5.98	-5.86|-5.86|-5.86	0.02304|0.02304|0.02304	.|.|.	.|2.049870|.	.|0.01754|.	.|N|.	.|0.030112|.	T|T|T	0.24470|0.24470|0.24470	0.0593|0.0593|0.0593	L|L|L	0.46157|0.46157|0.46157	1.445|1.445|1.445	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|B;B;B;B;B|.	.|0.10296|.	.|0.0;0.002;0.001;0.0;0.003|.	.|B;B;B;B;B|.	.|0.11329|.	.|0.001;0.003;0.0;0.001;0.006|.	T|T|T	0.36432|0.36432|0.36432	-0.9748|-0.9748|-0.9748	5|10|5	.|0.19147|.	.|T|.	.|0.46|.	4.1222|4.1222|4.1222	0.4658|0.4658|0.4658	0.00523|0.00523|0.00523	0.204:0.2116:0.2703:0.3142|0.204:0.2116:0.2703:0.3142|0.204:0.2116:0.2703:0.3142	.|.|.	.|547;648;982;697;930|.	.|E9PMS6;Q8WWI1-3;Q8WWI1;E9PLH4;F8J2B5|.	.|.;.;LMO7_HUMAN;.;.|.	S|E|K	606|648;982;982;596;697;547;697|2	.|ENSP00000342112:D648E;ENSP00000349571:D982E;ENSP00000366757:D982E;ENSP00000366719:D596E;ENSP00000317802:D697E;ENSP00000431129:D547E;ENSP00000433352:D697E|.	.|ENSP00000317802:D697E|.	C|D|M	+|+|+	1|3|2	0|2|0	LMO7|LMO7|LMO7	75295851|75295851|75295851	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.002000|0.002000|0.002000	0.02628|0.02628|0.02628	-0.068000|-0.068000|-0.068000	0.11561|0.11561|0.11561	-0.643000|-0.643000|-0.643000	0.05473|0.05473|0.05473	-0.408000|-0.408000|-0.408000	0.06270|0.06270|0.06270	TGT|GAT|ATG	.	.		0.517	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
COL4A2	1284	hgsc.bcm.edu	37	13	111132579	111132579	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr13:111132579A>G	ENST00000360467.5	+	31	2906	c.2600A>G	c.(2599-2601)gAt>gGt	p.D867G		NM_001846.2	NP_001837.2	P08572	CO4A2_HUMAN	collagen, type IV, alpha 2	867	Triple-helical region.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of angiogenesis (GO:0016525)|transcription, DNA-templated (GO:0006351)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	extracellular matrix structural constituent (GO:0005201)			NS(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|liver(2)|lung(48)|ovary(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	80	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			CTGCCTGGTGATAGAGGGGAC	0.547																																					p.D867G		Atlas-SNP	.											.	COL4A2	178	.	0			c.A2600G						.						106.0	106.0	106.0					13																	111132579		1910	4128	6038	SO:0001583	missense	1284	exon31			CTGGTGATAGAGG	AK025912	CCDS41907.1	13q34	2013-09-05			ENSG00000134871	ENSG00000134871		"""Collagens"""	2203	protein-coding gene	gene with protein product	"""canstatin"", ""collagen type IV alpha 2"""	120090				2439508, 3025878	Standard	NM_001846		Approved	FLJ22259, DKFZp686I14213	uc001vqx.3	P08572	OTTHUMG00000017344	ENST00000360467.5:c.2600A>G	chr13.hg19:g.111132579A>G	ENSP00000353654:p.Asp867Gly	67.0	0.0		40.0	8.0	NM_001846	Q14052|Q548C3|Q5VZA9|Q66K23	Missense_Mutation	SNP	ENST00000360467.5	hg19	CCDS41907.1	.	.	.	.	.	.	.	.	.	.	A	11.71	1.719894	0.30503	.	.	ENSG00000134871	ENST00000360467;ENST00000257309	D	0.93189	-3.18	4.93	4.93	0.64822	.	0.754074	0.11828	N	0.525490	D	0.91955	0.7452	L	0.27975	0.815	0.29886	N	0.825601	P	0.46621	0.881	P	0.53988	0.739	D	0.86229	0.1636	10	0.24483	T	0.36	.	12.1281	0.53928	1.0:0.0:0.0:0.0	.	867	P08572	CO4A2_HUMAN	G	867	ENSP00000353654:D867G	ENSP00000257309:D867G	D	+	2	0	COL4A2	109930580	0.986000	0.35501	0.962000	0.40283	0.151000	0.21798	4.178000	0.58284	1.844000	0.53588	0.379000	0.24179	GAT	.	.		0.547	COL4A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045761.2	NM_001846	
HNRNPC	3183	hgsc.bcm.edu	37	14	21702344	21702344	+	Silent	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr14:21702344G>A	ENST00000320084.7	-	2	248	c.9C>T	c.(7-9)agC>agT	p.S3S	HNRNPC_ENST00000336053.6_Silent_p.S3S|HNRNPC_ENST00000555914.1_Silent_p.S3S|HNRNPC_ENST00000449098.1_Silent_p.S3S|HNRNPC_ENST00000555309.1_Silent_p.S3S|HNRNPC_ENST00000555883.1_Silent_p.S3S|HNRNPC_ENST00000430246.2_Silent_p.S3S|HNRNPC_ENST00000554455.1_Silent_p.S3S|HNRNPC_ENST00000556142.1_Silent_p.S3S|HNRNPC_ENST00000420743.2_Silent_p.S3S|HNRNPC_ENST00000556897.1_Silent_p.S3S|HNRNPC_ENST00000556513.1_Silent_p.S3S|HNRNPC_ENST00000556628.1_Silent_p.S3S|HNRNPC_ENST00000554969.1_Silent_p.S3S|HNRNPC_ENST00000553753.1_Silent_p.S3S|HNRNPC_ENST00000553300.1_Silent_p.S3S|HNRNPC_ENST00000557201.1_Silent_p.S3S	NM_001077442.1	NP_001070910.1	P07910	HNRPC_HUMAN	heterogeneous nuclear ribonucleoprotein C (C1/C2)	3					3'-UTR-mediated mRNA stabilization (GO:0070935)|ATP-dependent chromatin remodeling (GO:0043044)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|spliceosomal complex (GO:0005681)	identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleosomal DNA binding (GO:0031492)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)			breast(1)|liver(1)|lung(6)|skin(1)	9	all_cancers(95;0.00176)		Epithelial(56;1.08e-06)|all cancers(55;8.95e-06)	GBM - Glioblastoma multiforme(265;0.00783)		TGGTAACGTTGCTGGCCATCG	0.413																																					p.S3S	NSCLC(108;607 2244 12726 38757)	Atlas-SNP	.											.	HNRNPC	31	.	0			c.C9T						.						107.0	103.0	104.0					14																	21702344		2137	4267	6404	SO:0001819	synonymous_variant	3183	exon2			AACGTTGCTGGCC		CCDS41915.1, CCDS45079.1	14q11.2	2013-06-12		2007-08-16	ENSG00000092199	ENSG00000092199		"""RNA binding motif (RRM) containing"""	5035	protein-coding gene	gene with protein product		164020		HNRPC		3457372	Standard	NM_031314		Approved	hnRNPC	uc001waa.3	P07910	OTTHUMG00000170757	ENST00000320084.7:c.9C>T	chr14.hg19:g.21702344G>A		69.0	0.0		69.0	9.0	NM_001077443	D3DS19|D3DS22|P22628|Q53EX2|Q59FD3|Q5FWE8|Q86SF8|Q86U45|Q96HK7|Q96HM4|Q96IY5|Q9BTS3	Silent	SNP	ENST00000320084.7	hg19	CCDS41915.1																																																																																			.	.		0.413	HNRNPC-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410235.1		
PNN	5411	hgsc.bcm.edu	37	14	39648641	39648641	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr14:39648641A>G	ENST00000216832.4	+	8	835	c.768A>G	c.(766-768)atA>atG	p.I256M	PNN_ENST00000557680.1_3'UTR	NM_002687.3	NP_002678	Q9H307	PININ_HUMAN	pinin, desmosome associated protein	256	Glu-rich.|Necessary for interaction with RNPS1.|Sufficient for PSAP complex assembly.				cell adhesion (GO:0007155)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(2)|stomach(1)	27	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0119)		AAAAACTAATAGAAGAGTCAC	0.338																																					p.I256M		Atlas-SNP	.											.	PNN	67	.	0			c.A768G						.						60.0	63.0	62.0					14																	39648641		2203	4300	6503	SO:0001583	missense	5411	exon8			ACTAATAGAAGAG	U77718	CCDS9671.1	14q21.1	2010-07-02			ENSG00000100941	ENSG00000100941			9162	protein-coding gene	gene with protein product		603154				8922384	Standard	NM_002687		Approved	memA	uc001wuw.4	Q9H307	OTTHUMG00000028821	ENST00000216832.4:c.768A>G	chr14.hg19:g.39648641A>G	ENSP00000216832:p.Ile256Met	401.0	0.0		381.0	37.0	NM_002687	B4DZX8|O60899|Q53EM7|Q6P5X4|Q7KYL1|Q99738|Q9UHZ9|Q9UQR9	Missense_Mutation	SNP	ENST00000216832.4	hg19	CCDS9671.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.953107	0.34471	.	.	ENSG00000100941	ENST00000216832	T	0.33438	1.41	5.96	3.48	0.39840	Pinin/SDK/MemA protein (1);	0.262936	0.44483	D	0.000460	T	0.18759	0.0450	L	0.31926	0.97	0.80722	D	1	B	0.26258	0.145	B	0.30105	0.111	T	0.09400	-1.0676	10	0.24483	T	0.36	-5.0253	2.1393	0.03771	0.4276:0.1301:0.0738:0.3685	.	256	Q9H307	PININ_HUMAN	M	256	ENSP00000216832:I256M	ENSP00000216832:I256M	I	+	3	3	PNN	38718392	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.070000	0.30653	1.046000	0.40249	0.533000	0.62120	ATA	.	.		0.338	PNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276776.2	NM_002687	
SYNE2	23224	hgsc.bcm.edu	37	14	64492109	64492109	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr14:64492109G>A	ENST00000344113.4	+	41	6434	c.6222G>A	c.(6220-6222)atG>atA	p.M2074I	SYNE2_ENST00000358025.3_Missense_Mutation_p.M2074I|SYNE2_ENST00000554584.1_Missense_Mutation_p.M2074I|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2074					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AAGGCAAAATGCCACTTGAGG	0.343																																					p.M2074I		Atlas-SNP	.											.	SYNE2	577	.	0			c.G6222A						.						57.0	53.0	54.0					14																	64492109		1809	4077	5886	SO:0001583	missense	23224	exon41			CAAAATGCCACTT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6222G>A	chr14.hg19:g.64492109G>A	ENSP00000341781:p.Met2074Ile	43.0	0.0		32.0	17.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494248	0.44352	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.57107	0.77;0.77;0.42	5.9	5.9	0.94986	.	0.079494	0.56097	D	0.000035	T	0.38904	0.1058	L	0.27053	0.805	0.80722	D	1	P;P	0.47962	0.844;0.903	B;B	0.43052	0.23;0.406	T	0.12192	-1.0557	10	0.14252	T	0.57	.	11.2884	0.49234	0.1231:0.0:0.8769:0.0	.	2074;2074	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	I	2074	ENSP00000350719:M2074I;ENSP00000341781:M2074I;ENSP00000452570:M2074I	ENSP00000261678:M2074I	M	+	3	0	SYNE2	63561862	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.408000	0.52651	2.800000	0.96347	0.455000	0.32223	ATG	.	.		0.343	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
AKAP5	9495	hgsc.bcm.edu	37	14	64935781	64935781	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr14:64935781T>G	ENST00000394718.4	+	2	1047	c.669T>G	c.(667-669)atT>atG	p.I223M	ZBTB25_ENST00000555424.1_Intron|ZBTB25_ENST00000555220.1_Intron|AKAP5_ENST00000320636.5_Missense_Mutation_p.I223M	NM_004857.3	NP_004848.3	P24588	AKAP5_HUMAN	A kinase (PRKA) anchor protein 5	223					energy reserve metabolic process (GO:0006112)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|stomach(1)	13				all cancers(60;0.00749)|OV - Ovarian serous cystadenocarcinoma(108;0.0095)|BRCA - Breast invasive adenocarcinoma(234;0.0449)		ATTCTGCTATTCAAACGGGAA	0.403																																					p.I223M		Atlas-SNP	.											.	AKAP5	23	.	0			c.T669G						.						96.0	103.0	101.0					14																	64935781		2203	4300	6503	SO:0001583	missense	9495	exon2			TGCTATTCAAACG	M90359	CCDS9764.1	14q23.3	2012-05-16			ENSG00000179841	ENSG00000179841		"""A-kinase anchor proteins"""	375	protein-coding gene	gene with protein product		604688				1512224, 1618839	Standard	NM_004857		Approved	AKAP75, AKAP79	uc001xhd.4	P24588	OTTHUMG00000029634	ENST00000394718.4:c.669T>G	chr14.hg19:g.64935781T>G	ENSP00000378207:p.Ile223Met	103.0	0.0		72.0	16.0	NM_004857	A2RRB8	Missense_Mutation	SNP	ENST00000394718.4	hg19	CCDS9764.1	.	.	.	.	.	.	.	.	.	.	T	9.444	1.088938	0.20390	.	.	ENSG00000179841	ENST00000394718;ENST00000320636	T;T	0.30981	1.51;1.51	6.02	3.64	0.41730	.	0.437167	0.21244	N	0.077773	T	0.34366	0.0895	L	0.50333	1.59	0.09310	N	1	P	0.50272	0.933	P	0.51945	0.685	T	0.16571	-1.0398	10	0.52906	T	0.07	-18.6918	4.7835	0.13213	0.0:0.166:0.1613:0.6727	.	223	P24588	AKAP5_HUMAN	M	223	ENSP00000378207:I223M;ENSP00000315615:I223M	ENSP00000315615:I223M	I	+	3	3	AKAP5	64005534	0.021000	0.18746	0.105000	0.21289	0.588000	0.36517	0.595000	0.24029	0.503000	0.28060	0.528000	0.53228	ATT	.	.		0.403	AKAP5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268070.3		
SMEK1	55671	hgsc.bcm.edu	37	14	91927808	91927808	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr14:91927808C>A	ENST00000554943.1	-	14	2423	c.2308G>T	c.(2308-2310)Gga>Tga	p.G770*	SMEK1_ENST00000555462.1_Nonsense_Mutation_p.G531*|SMEK1_ENST00000337238.4_Nonsense_Mutation_p.G757*|SMEK1_ENST00000554684.1_Nonsense_Mutation_p.G757*|SMEK1_ENST00000428424.2_Nonsense_Mutation_p.G531*|SMEK1_ENST00000555718.1_5'UTR			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	770					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		CCAGGTGATCCCGGAGAACCA	0.507																																					p.G757X		Atlas-SNP	.											.	SMEK1	94	.	0			c.G2269T						.						160.0	168.0	165.0					14																	91927808		2203	4300	6503	SO:0001587	stop_gained	55671	exon15			GTGATCCCGGAGA	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.2308G>T	chr14.hg19:g.91927808C>A	ENSP00000450883:p.Gly770*	147.0	0.0		104.0	14.0	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Nonsense_Mutation	SNP	ENST00000554943.1	hg19		.	.	.	.	.	.	.	.	.	.	C	44	10.775905	0.99465	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	-11.3977	19.7503	0.96265	0.0:1.0:0.0:0.0	.	.	.	.	X	757;757;531;770;531	.	ENSP00000337125:G757X	G	-	1	0	SMEK1	90997561	1.000000	0.71417	0.983000	0.44433	0.893000	0.52053	7.380000	0.79704	2.675000	0.91044	0.557000	0.71058	GGA	.	.		0.507	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	
EIF2AK4	440275	hgsc.bcm.edu	37	15	40268649	40268649	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr15:40268649T>C	ENST00000263791.5	+	12	1896	c.1853T>C	c.(1852-1854)gTg>gCg	p.V618A	EIF2AK4_ENST00000382727.2_Missense_Mutation_p.V618A	NM_001013703.2	NP_001013725.2	Q9P2K8	E2AK4_HUMAN	eukaryotic translation initiation factor 2 alpha kinase 4	618	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to starvation (GO:0009267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of translation (GO:0017148)|protein phosphorylation (GO:0006468)|regulation of translational initiation (GO:0006446)|regulation of translational initiation in response to stress (GO:0043558)	cytosolic ribosome (GO:0022626)	ATP binding (GO:0005524)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)	40		all_cancers(109;1.05e-19)|all_epithelial(112;4.38e-17)|Lung NSC(122;1.09e-12)|all_lung(180;3.56e-11)|Melanoma(134;0.0575)|Ovarian(310;0.0826)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;5.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0616)		TGCTACGCAGTGAAGCGCATC	0.617																																					p.V618A		Atlas-SNP	.											.	EIF2AK4	107	.	0			c.T1853C						.						32.0	34.0	34.0					15																	40268649		2094	4218	6312	SO:0001583	missense	440275	exon12			ACGCAGTGAAGCG	AB037759	CCDS42016.1	15q13.3	2008-08-18				ENSG00000128829			19687	protein-coding gene	gene with protein product		609280				10504407	Standard	XM_005254392		Approved	GCN2, KIAA1338	uc001zkm.1	Q9P2K8		ENST00000263791.5:c.1853T>C	chr15.hg19:g.40268649T>C	ENSP00000263791:p.Val618Ala	136.0	0.0		143.0	13.0	NM_001013703	C9JEC4|Q69YL7|Q6DC97|Q96GN6|Q9H5K1|Q9NSQ3|Q9NSZ5|Q9UJ56	Missense_Mutation	SNP	ENST00000263791.5	hg19	CCDS42016.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.773129	0.90108	.	.	ENSG00000128829	ENST00000263791;ENST00000382727	T;T	0.29917	1.55;1.55	5.07	5.07	0.68467	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.53997	0.1831	M	0.72624	2.21	0.58432	D	0.999997	D	0.71674	0.998	D	0.69479	0.964	T	0.59263	-0.7487	10	0.87932	D	0	-17.8179	15.1173	0.72413	0.0:0.0:0.0:1.0	.	618	Q9P2K8	E2AK4_HUMAN	A	618	ENSP00000263791:V618A;ENSP00000372174:V618A	ENSP00000263791:V618A	V	+	2	0	EIF2AK4	38055941	1.000000	0.71417	0.998000	0.56505	0.682000	0.39822	8.013000	0.88655	2.025000	0.59659	0.377000	0.23210	GTG	.	.		0.617	EIF2AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418395.1		
MGA	23269	hgsc.bcm.edu	37	15	42059132	42059132	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr15:42059132C>G	ENST00000570161.1	+	23	8852	c.8852C>G	c.(8851-8853)aCt>aGt	p.T2951S	MGA_ENST00000219905.7_Missense_Mutation_p.T2951S|MGA_ENST00000566586.1_Missense_Mutation_p.T2742S|MGA_ENST00000389936.4_Missense_Mutation_p.T2912S|MGA_ENST00000545763.1_Missense_Mutation_p.T2742S			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGGAAGAATACTTCTGGCCTC	0.493																																					p.T2951S		Atlas-SNP	.											.	MGA	264	.	0			c.C8852G						.						54.0	55.0	55.0					15																	42059132		1925	4118	6043	SO:0001583	missense	23269	exon24			AGAATACTTCTGG	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.8852C>G	chr15.hg19:g.42059132C>G	ENSP00000457035:p.Thr2951Ser	93.0	0.0		94.0	40.0	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	ENST00000570161.1	hg19	CCDS55959.1	.	.	.	.	.	.	.	.	.	.	C	10.74	1.434840	0.25813	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.85556	-1.97;-1.95;-2.0	5.5	3.59	0.41128	.	0.250675	0.27478	N	0.019199	T	0.73666	0.3616	N	0.24115	0.695	0.20764	N	0.99986	B;B	0.12630	0.006;0.003	B;B	0.13407	0.009;0.004	T	0.62567	-0.6827	10	0.44086	T	0.13	.	8.4454	0.32838	0.1539:0.7656:0.0:0.0804	.	2742;2951	F5H7K2;E7ENI0	.;.	S	2951;2912;2742	ENSP00000219905:T2951S;ENSP00000374586:T2912S;ENSP00000442467:T2742S	ENSP00000219905:T2951S	T	+	2	0	MGA	39846424	0.926000	0.31397	1.000000	0.80357	0.948000	0.59901	2.132000	0.42083	0.845000	0.35118	0.655000	0.94253	ACT	.	.		0.493	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
SEMA6D	80031	hgsc.bcm.edu	37	15	48063719	48063719	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr15:48063719G>A	ENST00000316364.5	+	19	3398	c.2959G>A	c.(2959-2961)Gtt>Att	p.V987I	SEMA6D_ENST00000537942.1_Missense_Mutation_p.V925I|SEMA6D_ENST00000389432.2_Missense_Mutation_p.V944I|SEMA6D_ENST00000354744.4_Missense_Mutation_p.V931I|SEMA6D_ENST00000358066.4_Missense_Mutation_p.V925I|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000558014.1_Missense_Mutation_p.V925I|SEMA6D_ENST00000389433.2_Missense_Mutation_p.V968I|SEMA6D_ENST00000536845.2_Missense_Mutation_p.V987I|SEMA6D_ENST00000389428.3_Missense_Mutation_p.V912I	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	987					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		ACCAAATGGTGTTTTGTTATC	0.453																																					p.V987I		Atlas-SNP	.											.	SEMA6D	322	.	0			c.G2959A						.						105.0	106.0	106.0					15																	48063719		2198	4297	6495	SO:0001583	missense	80031	exon19			AATGGTGTTTTGT	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2959G>A	chr15.hg19:g.48063719G>A	ENSP00000324857:p.Val987Ile	150.0	0.0		132.0	48.0	NM_153618	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	ENST00000316364.5	hg19	CCDS32225.1	.	.	.	.	.	.	.	.	.	.	G	16.54	3.151092	0.57151	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428	T;T;T;T;T;T;T;T	0.17854	2.25;2.29;2.29;2.28;2.25;2.25;2.25;2.25	5.8	5.8	0.92144	.	0.123074	0.53938	D	0.000042	T	0.21801	0.0525	L	0.36672	1.1	0.80722	D	1	P;P;P;P	0.38195	0.622;0.481;0.552;0.622	B;B;B;B	0.41691	0.275;0.275;0.248;0.364	T	0.00706	-1.1601	10	0.56958	D	0.05	.	20.0693	0.97712	0.0:0.0:1.0:0.0	.	912;931;987;925	Q8NFY4-3;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;SEM6D_HUMAN;.	I	925;987;987;968;944;931;925;912	ENSP00000442040:V925I;ENSP00000446152:V987I;ENSP00000324857:V987I;ENSP00000374084:V968I;ENSP00000374083:V944I;ENSP00000346786:V931I;ENSP00000350770:V925I;ENSP00000374079:V912I	ENSP00000324857:V987I	V	+	1	0	SEMA6D	45851011	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	6.227000	0.72282	2.758000	0.94735	0.563000	0.77884	GTT	.	.		0.453	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
RNF111	54778	hgsc.bcm.edu	37	15	59381902	59381902	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr15:59381902A>G	ENST00000557998.1	+	11	2874	c.2587A>G	c.(2587-2589)Att>Gtt	p.I863V	RNF111_ENST00000434298.1_Missense_Mutation_p.I872V|RNF111_ENST00000559209.1_Missense_Mutation_p.I872V|RNF111_ENST00000348370.4_Missense_Mutation_p.I863V|RNF111_ENST00000561186.1_Missense_Mutation_p.I872V	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111	863					gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		CATCCGTTACATTTCATCAGG	0.343																																					p.I872V	NSCLC(72;983 1365 10746 34387 47081)	Atlas-SNP	.											.	RNF111	179	.	0			c.A2614G						.						156.0	164.0	161.0					15																	59381902		2192	4291	6483	SO:0001583	missense	54778	exon11			CGTTACATTTCAT	AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.2587A>G	chr15.hg19:g.59381902A>G	ENSP00000452732:p.Ile863Val	43.0	0.0		39.0	12.0	NM_001270528	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Missense_Mutation	SNP	ENST00000557998.1	hg19	CCDS58366.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.120754	0.77436	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	T;T	0.15017	2.48;2.46	5.44	5.44	0.79542	.	0.111510	0.64402	D	0.000014	T	0.18718	0.0449	L	0.44542	1.39	0.58432	D	0.999998	P;P;P	0.42556	0.783;0.622;0.629	B;B;B	0.42062	0.374;0.158;0.36	T	0.02075	-1.1218	10	0.28530	T	0.3	-19.1918	15.5053	0.75735	1.0:0.0:0.0:0.0	.	872;863;863	Q6ZNA4-3;Q6ZNA4;Q6ZNA4-2	.;RN111_HUMAN;.	V	863;872	ENSP00000288199:I863V;ENSP00000393641:I872V	ENSP00000288199:I863V	I	+	1	0	RNF111	57169194	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	6.936000	0.75892	2.065000	0.61736	0.460000	0.39030	ATT	.	.		0.343	RNF111-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000416012.1	NM_017610	
GLCE	26035	hgsc.bcm.edu	37	15	69561008	69561008	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr15:69561008A>C	ENST00000261858.2	+	5	1507	c.1279A>C	c.(1279-1281)Acc>Ccc	p.T427P	GLCE_ENST00000559420.2_Missense_Mutation_p.T363P|GLCE_ENST00000559500.1_3'UTR	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	427					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AATTATGGTGACCCGTAAGTT	0.488																																					p.T427P		Atlas-SNP	.											.	GLCE	48	.	0			c.A1279C						.						78.0	70.0	73.0					15																	69561008		2200	4298	6498	SO:0001583	missense	26035	exon5			ATGGTGACCCGTA	AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.1279A>C	chr15.hg19:g.69561008A>C	ENSP00000261858:p.Thr427Pro	76.0	0.0		93.0	11.0	NM_015554	Q6GUQ2	Missense_Mutation	SNP	ENST00000261858.2	hg19	CCDS32277.1	.	.	.	.	.	.	.	.	.	.	A	18.45	3.626414	0.66901	.	.	ENSG00000138604	ENST00000261858	T	0.45668	0.89	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.58235	0.2108	M	0.63428	1.95	0.80722	D	1	D	0.71674	0.998	D	0.66351	0.943	T	0.55817	-0.8081	10	0.30854	T	0.27	-11.7991	14.0134	0.64511	1.0:0.0:0.0:0.0	.	427	O94923	GLCE_HUMAN	P	427	ENSP00000261858:T427P	ENSP00000261858:T427P	T	+	1	0	GLCE	67348062	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.342000	0.79310	1.999000	0.58509	0.455000	0.32223	ACC	.	.		0.488	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015554	
ZNF774	342132	hgsc.bcm.edu	37	15	90904318	90904318	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr15:90904318A>G	ENST00000354377.3	+	4	1441	c.1255A>G	c.(1255-1257)Att>Gtt	p.I419V	ZNF774_ENST00000379090.5_Intron	NM_001004309.2	NP_001004309.2	Q6NX45	ZN774_HUMAN	zinc finger protein 774	419					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|stomach(1)	14	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CTCCCACTTTATTACCCATCA	0.512																																					p.I419V		Atlas-SNP	.											.	ZNF774	35	.	0			c.A1255G						.						75.0	70.0	71.0					15																	90904318		2199	4298	6497	SO:0001583	missense	342132	exon4			CACTTTATTACCC	BC067279	CCDS32330.1	15q26.1	2013-01-08				ENSG00000196391		"""Zinc fingers, C2H2-type"""	33108	protein-coding gene	gene with protein product							Standard	NM_001004309		Approved	MGC75360	uc002bpk.4	Q6NX45		ENST00000354377.3:c.1255A>G	chr15.hg19:g.90904318A>G	ENSP00000346348:p.Ile419Val	114.0	0.0		126.0	31.0	NM_001004309	A8K020	Missense_Mutation	SNP	ENST00000354377.3	hg19	CCDS32330.1	.	.	.	.	.	.	.	.	.	.	A	9.634	1.137221	0.21123	.	.	ENSG00000196391	ENST00000354377	T	0.21191	2.02	5.73	2.13	0.27403	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.214383	0.23102	N	0.051918	T	0.09247	0.0228	N	0.05012	-0.13	0.09310	N	1	B	0.09022	0.002	B	0.21360	0.034	T	0.25363	-1.0134	10	0.45353	T	0.12	.	5.5269	0.16962	0.6964:0.1467:0.1568:0.0	.	419	Q6NX45	ZN774_HUMAN	V	419	ENSP00000346348:I419V	ENSP00000346348:I419V	I	+	1	0	ZNF774	88705322	0.024000	0.19004	0.116000	0.21606	0.662000	0.39071	2.869000	0.48444	0.107000	0.17824	0.533000	0.62120	ATT	.	.		0.512	ZNF774-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418048.1	NM_001004309	
MAN2A2	4122	hgsc.bcm.edu	37	15	91454130	91454130	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr15:91454130A>G	ENST00000559717.1	+	12	2273	c.1814A>G	c.(1813-1815)tAt>tGt	p.Y605C	MAN2A2_ENST00000360468.3_Missense_Mutation_p.Y605C|MAN2A2_ENST00000431652.2_Missense_Mutation_p.Y113C|MAN2A2_ENST00000430376.2_5'Flank			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	605					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCAGCCCACTATCTGGTGCTG	0.592																																					p.Y605C		Atlas-SNP	.											.	MAN2A2	99	.	0			c.A1814G						.						68.0	64.0	65.0					15																	91454130		2198	4298	6496	SO:0001583	missense	4122	exon11			CCCACTATCTGGT	L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1814A>G	chr15.hg19:g.91454130A>G	ENSP00000452948:p.Tyr605Cys	53.0	0.0		47.0	12.0	NM_006122	A6NH12|A8K1E8|Q13754	Missense_Mutation	SNP	ENST00000559717.1	hg19	CCDS32332.1	.	.	.	.	.	.	.	.	.	.	A	14.01	2.409198	0.42715	.	.	ENSG00000196547	ENST00000360468;ENST00000431652	T;T	0.74947	-0.89;-0.89	5.08	3.91	0.45181	.	0.103647	0.64402	D	0.000002	T	0.80768	0.4686	M	0.63428	1.95	0.80722	D	1	B;D;D;P	0.61080	0.07;0.989;0.988;0.89	B;P;P;P	0.61328	0.067;0.775;0.887;0.662	T	0.79181	-0.1909	10	0.42905	T	0.14	-16.9224	11.2727	0.49148	0.863:0.0:0.0:0.137	.	113;233;605;605	B4DEU9;B4DIK4;P49641-1;P49641	.;.;.;MA2A2_HUMAN	C	605;113	ENSP00000353655:Y605C;ENSP00000388221:Y113C	ENSP00000353655:Y605C	Y	+	2	0	MAN2A2	89255134	1.000000	0.71417	0.979000	0.43373	0.949000	0.60115	3.898000	0.56281	0.843000	0.35070	0.254000	0.18369	TAT	.	.		0.592	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418246.5	NM_006122	
KIF22	3835	hgsc.bcm.edu	37	16	29816222	29816222	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr16:29816222C>A	ENST00000160827.4	+	12	1805	c.1765C>A	c.(1765-1767)Cgc>Agc	p.R589S	KIF22_ENST00000561482.1_Missense_Mutation_p.R521S|KIF22_ENST00000569382.2_Missense_Mutation_p.R535S|MAZ_ENST00000322945.6_5'Flank|MAZ_ENST00000563402.1_5'Flank|AC009133.15_ENST00000566537.1_RNA|MAZ_ENST00000219782.6_5'Flank|MAZ_ENST00000545521.1_5'Flank|KIF22_ENST00000400751.5_Missense_Mutation_p.R521S|MAZ_ENST00000562337.1_5'Flank|MAZ_ENST00000566906.2_5'Flank	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	589					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						GGCTCATGGGCGCCAAAAAAT	0.602																																					p.R589S		Atlas-SNP	.											.	KIF22	29	.	0			c.C1765A						.						40.0	39.0	39.0					16																	29816222		2197	4296	6493	SO:0001583	missense	3835	exon12			CATGGGCGCCAAA	D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.1765C>A	chr16.hg19:g.29816222C>A	ENSP00000160827:p.Arg589Ser	51.0	0.0		73.0	21.0	NM_007317	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	ENST00000160827.4	hg19	CCDS10653.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.154945	0.78114	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.74421	-0.74;-0.84	5.64	2.65	0.31530	.	.	.	.	.	T	0.60051	0.2239	L	0.27053	0.805	0.80722	D	1	P;P	0.51449	0.838;0.945	B;B	0.44278	0.182;0.445	T	0.57585	-0.7786	9	0.72032	D	0.01	.	4.5168	0.11939	0.1545:0.5983:0.0:0.2472	.	521;589	B7Z265;Q14807	.;KIF22_HUMAN	S	589;521	ENSP00000160827:R589S;ENSP00000383562:R521S	ENSP00000160827:R589S	R	+	1	0	KIF22	29723723	1.000000	0.71417	0.756000	0.31282	0.844000	0.47949	4.135000	0.57997	0.331000	0.23511	0.561000	0.74099	CGC	.	.		0.602	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215012.2		
CETP	1071	hgsc.bcm.edu	37	16	56996939	56996939	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr16:56996939A>G	ENST00000200676.3	+	2	266	c.136A>G	c.(136-138)Aag>Gag	p.K46E	CETP_ENST00000379780.2_Missense_Mutation_p.K46E|CETP_ENST00000566128.1_5'UTR|CETP_ENST00000569082.1_3'UTR	NM_000078.2	NP_000069.2			cholesteryl ester transfer protein, plasma											NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						CGAGACTGCCAAGGTGATCCA	0.612																																					p.K46E		Atlas-SNP	.											.	CETP	50	.	0			c.A136G						.						86.0	64.0	72.0					16																	56996939		2198	4300	6498	SO:0001583	missense	1071	exon2			ACTGCCAAGGTGA	M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000200676.3:c.136A>G	chr16.hg19:g.56996939A>G	ENSP00000200676:p.Lys46Glu	58.0	0.0		45.0	17.0	NM_000078		Missense_Mutation	SNP	ENST00000200676.3	hg19	CCDS10772.1	.	.	.	.	.	.	.	.	.	.	A	9.237	1.037372	0.19669	.	.	ENSG00000087237	ENST00000200676;ENST00000379780	T;T	0.06768	3.26;3.26	4.77	3.66	0.41972	Lipid-binding serum glycoprotein, conserved site (1);Lipid-binding serum glycoprotein, N-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	0.224693	0.36893	U	0.002354	T	0.07052	0.0179	N	0.19112	0.55	0.80722	D	1	D;B	0.60160	0.987;0.107	P;B	0.50136	0.632;0.16	T	0.39563	-0.9608	10	0.08599	T	0.76	-2.8921	9.0636	0.36449	0.6385:0.3615:0.0:0.0	.	46;46	P11597-2;P11597	.;CETP_HUMAN	E	46	ENSP00000200676:K46E;ENSP00000369106:K46E	ENSP00000200676:K46E	K	+	1	0	CETP	55554440	0.476000	0.25901	0.987000	0.45799	0.159000	0.22180	0.777000	0.26718	0.646000	0.30693	0.482000	0.46254	AAG	.	.		0.612	CETP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257059.1	NM_000078	
RPA1	6117	hgsc.bcm.edu	37	17	1780506	1780506	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:1780506G>A	ENST00000254719.5	+	8	698	c.588G>A	c.(586-588)aaG>aaA	p.K196K	RPA1_ENST00000573924.1_3'UTR	NM_002945.3	NP_002936.1	P27694	RFA1_HUMAN	replication protein A1, 70kDa	196					base-excision repair (GO:0006284)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of cell proliferation (GO:0008284)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|DNA replication factor A complex (GO:0005662)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|single-stranded DNA binding (GO:0003697)			breast(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(2)	10						TGGTTTGTAGGTGGACCATTT	0.448								Nucleotide excision repair (NER)																													p.K196K		Atlas-SNP	.											.	RPA1	48	.	0			c.G588A						.						122.0	96.0	105.0					17																	1780506		2203	4300	6503	SO:0001630	splice_region_variant	6117	exon8			TTGTAGGTGGACC	M63488	CCDS11014.1	17p13.3	2008-02-05	2002-08-29		ENSG00000132383	ENSG00000132383			10289	protein-coding gene	gene with protein product		179835	"""replication protein A1 (70kD)"""			8454588	Standard	NM_002945		Approved	REPA1, RPA70, HSSB, RF-A, RP-A	uc002fto.2	P27694	OTTHUMG00000090579	ENST00000254719.5:c.588-1G>A	chr17.hg19:g.1780506G>A		170.0	0.0		180.0	46.0	NM_002945	A8K0Y9|Q59ES9	Silent	SNP	ENST00000254719.5	hg19	CCDS11014.1																																																																																			.	.		0.448	RPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207118.2	NM_002945	Silent
ALOX12B	242	hgsc.bcm.edu	37	17	7980038	7980038	+	Silent	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:7980038G>A	ENST00000319144.4	-	10	1559	c.1299C>T	c.(1297-1299)taC>taT	p.Y433Y	ALOX12B_ENST00000577351.1_5'UTR|AC129492.6_ENST00000399413.3_5'Flank	NM_001139.2	NP_001130.1	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	433	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|oxidation-reduction process (GO:0055114)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mucus secretion (GO:0070257)|protein lipidation (GO:0006497)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytosol (GO:0005829)	arachidonate 12-lipoxygenase activity (GO:0004052)|iron ion binding (GO:0005506)|linoleate 9S-lipoxygenase activity (GO:1990136)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)|stomach(1)	16						TCTGGACGGTGTATCGGGTAT	0.577										Multiple Myeloma(8;0.094)																											p.Y433Y		Atlas-SNP	.											.	ALOX12B	61	.	0			c.C1299T						.						43.0	37.0	39.0					17																	7980038		2117	4124	6241	SO:0001819	synonymous_variant	242	exon10			GACGGTGTATCGG	AF038461	CCDS11129.1	17p13.1	2008-03-18			ENSG00000179477	ENSG00000179477	1.13.11.-	"""Arachidonate lipoxygenases"""	430	protein-coding gene	gene with protein product		603741				9618483	Standard	NM_001139		Approved	12R-LOX	uc002gjy.1	O75342	OTTHUMG00000108180	ENST00000319144.4:c.1299C>T	chr17.hg19:g.7980038G>A		82.0	0.0		93.0	14.0	NM_001139		Silent	SNP	ENST00000319144.4	hg19	CCDS11129.1																																																																																			.	.		0.577	ALOX12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226984.3		
ARHGAP44	9912	hgsc.bcm.edu	37	17	12877579	12877579	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:12877579C>T	ENST00000379672.5	+	18	2015	c.1715C>T	c.(1714-1716)gCg>gTg	p.A572V	ARHGAP44_ENST00000578087.1_3'UTR|ARHGAP44_ENST00000340825.3_Missense_Mutation_p.A566V|ARHGAP44_ENST00000262444.9_Missense_Mutation_p.A572V|RN7SL550P_ENST00000583299.1_RNA	NM_014859.4	NP_055674.4	Q17R89	RHG44_HUMAN	Rho GTPase activating protein 44	572					exocytosis (GO:0006887)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endosome (GO:0005768)|leading edge membrane (GO:0031256)|synapse (GO:0045202)	GTPase activator activity (GO:0005096)|phospholipid binding (GO:0005543)			NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|urinary_tract(1)	31						GCGGCCCCCGCGCTCTCTCCA	0.796																																					p.A572V		Atlas-SNP	.											.	ARHGAP44	55	.	0			c.C1715T						.						2.0	2.0	2.0					17																	12877579		1100	2362	3462	SO:0001583	missense	9912	exon18			CCCCCGCGCTCTC		CCDS45616.1	17p12	2011-06-29			ENSG00000006740	ENSG00000006740		"""Rho GTPase activating proteins"""	29096	protein-coding gene	gene with protein product						19273615	Standard	NM_014859		Approved	KIAA0672, RICH-2, RICH2	uc002gnr.4	Q17R89	OTTHUMG00000058765	ENST00000379672.5:c.1715C>T	chr17.hg19:g.12877579C>T	ENSP00000368994:p.Ala572Val	65.0	0.0		37.0	9.0	NM_014859	A6NCP5|A8MQB2|O75160|Q7Z5Z7|Q9Y4Q4	Missense_Mutation	SNP	ENST00000379672.5	hg19	CCDS45616.1	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131126	0.56828	.	.	ENSG00000006740	ENST00000379672;ENST00000544416;ENST00000340825;ENST00000262444	T;T	0.16897	2.32;2.31	5.42	2.35	0.29111	.	0.934688	0.09044	N	0.856895	T	0.09468	0.0233	N	0.08118	0	0.28948	N	0.890573	B;B;B;B	0.13145	0.0;0.003;0.007;0.002	B;B;B;B	0.08055	0.0;0.003;0.002;0.001	T	0.31586	-0.9938	10	0.40728	T	0.16	.	8.9446	0.35751	0.0:0.7534:0.0:0.2466	.	566;30;228;572	A6NCP5;E7ERK8;F5H6L3;Q17R89	.;.;.;RHG44_HUMAN	V	572;228;566;30	ENSP00000368994:A572V;ENSP00000342566:A566V	ENSP00000262444:A30V	A	+	2	0	ARHGAP44	12818304	0.884000	0.30299	0.302000	0.25058	0.114000	0.19823	1.883000	0.39658	0.266000	0.21894	0.557000	0.71058	GCG	.	.		0.796	ARHGAP44-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441566.1	NM_014859	
BLMH	642	hgsc.bcm.edu	37	17	28599605	28599605	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:28599605G>C	ENST00000261714.6	-	9	1176	c.1002C>G	c.(1000-1002)agC>agG	p.S334R	BLMH_ENST00000394819.3_Missense_Mutation_p.S247R|BLMH_ENST00000582669.1_5'Flank	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	334					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	GGCCCAGCTTGCTATTGAAGT	0.413																																					p.S334R	Pancreas(127;628 1772 12912 33293 36203)	Atlas-SNP	.											.	BLMH	42	.	0			c.C1002G						.						218.0	217.0	217.0					17																	28599605		2203	4300	6503	SO:0001583	missense	642	exon9			CAGCTTGCTATTG	X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.1002C>G	chr17.hg19:g.28599605G>C	ENSP00000261714:p.Ser334Arg	68.0	0.0		89.0	6.0	NM_000386	B2R796|Q53F86|Q9UER9	Missense_Mutation	SNP	ENST00000261714.6	hg19	CCDS32604.1	.	.	.	.	.	.	.	.	.	.	G	5.430	0.264433	0.10294	.	.	ENSG00000108578	ENST00000261714;ENST00000394819	T;T	0.40225	1.04;1.04	5.91	4.91	0.64330	.	0.136793	0.64402	D	0.000002	T	0.14141	0.0342	N	0.00869	-1.13	0.46564	D	0.999104	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.26780	-1.0093	10	0.02654	T	1	-7.0305	15.6277	0.76874	0.0:0.0:0.8625:0.1375	.	247;334	E7EMN3;Q13867	.;BLMH_HUMAN	R	334;247	ENSP00000261714:S334R;ENSP00000378296:S247R	ENSP00000261714:S334R	S	-	3	2	BLMH	25623731	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.451000	0.60047	2.793000	0.96121	0.655000	0.94253	AGC	.	.		0.413	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447940.1	NM_000386	
NGFR	4804	hgsc.bcm.edu	37	17	47590068	47590068	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:47590068A>T	ENST00000172229.3	+	6	1107		c.e6-1		NGFR_ENST00000504201.1_Splice_Site|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor						apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GTTTCTCTGCAGCCCTCAAGG	0.647																																					.		Atlas-SNP	.											.	NGFR	46	.	0			c.983-2A>T						.						50.0	54.0	53.0					17																	47590068		2185	4272	6457	SO:0001630	splice_region_variant	4804	exon6			CTCTGCAGCCCTC	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.983-1A>T	chr17.hg19:g.47590068A>T		133.0	0.0		140.0	21.0	NM_002507	B2R961|B4E096	Splice_Site	SNP	ENST00000172229.3	hg19	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.623689	0.66901	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0256	0.53368	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NGFR	44945067	1.000000	0.71417	0.998000	0.56505	0.761000	0.43186	5.812000	0.69194	1.819000	0.53055	0.459000	0.35465	.	.	.		0.647	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		Intron
UNC13D	201294	hgsc.bcm.edu	37	17	73831746	73831746	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:73831746C>T	ENST00000207549.4	-	19	2088	c.1709G>A	c.(1708-1710)cGc>cAc	p.R570H	UNC13D_ENST00000412096.2_Missense_Mutation_p.R570H	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	570	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGAGCTCATGCGCAGCTGGCA	0.647									Familial Hemophagocytic Lymphohistiocytosis																												p.R570H		Atlas-SNP	.											.	UNC13D	68	.	0			c.G1709A						.						34.0	33.0	33.0					17																	73831746		2203	4300	6503	SO:0001583	missense	201294	exon19	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	CTCATGCGCAGCT	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.1709G>A	chr17.hg19:g.73831746C>T	ENSP00000207549:p.Arg570His	53.0	0.0		62.0	6.0	NM_199242	B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	hg19	CCDS11730.1	.	.	.	.	.	.	.	.	.	.	C	0.583	-0.836338	0.02692	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.70869	-0.51;-0.52	4.88	2.64	0.31445	Munc13 homology 1 (1);	0.768652	0.12175	N	0.492658	T	0.50120	0.1597	N	0.15975	0.35	0.27558	N	0.950271	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.001	T	0.31833	-0.9929	10	0.15499	T	0.54	-6.1973	10.095	0.42469	0.1458:0.7719:0.0:0.0823	.	570;570	Q70J99-3;Q70J99	.;UN13D_HUMAN	H	570	ENSP00000207549:R570H;ENSP00000388093:R570H	ENSP00000207549:R570H	R	-	2	0	UNC13D	71343341	0.998000	0.40836	0.926000	0.36857	0.056000	0.15407	1.006000	0.29847	1.039000	0.40074	-0.339000	0.08088	CGC	.	.		0.647	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
RPTOR	57521	hgsc.bcm.edu	37	17	78919549	78919549	+	Silent	SNP	G	G	C	rs149016810	byFrequency	TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:78919549G>C	ENST00000306801.3	+	26	3470	c.3108G>C	c.(3106-3108)ccG>ccC	p.P1036P	RPTOR_ENST00000544334.2_Silent_p.P878P|RPTOR_ENST00000575542.1_3'UTR	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	1036					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CCTTCACGCCGTGCATCGCCG	0.587																																					p.P1036P		Atlas-SNP	.											.	RPTOR	122	.	0			c.G3108C						.						83.0	73.0	77.0					17																	78919549		2203	4300	6503	SO:0001819	synonymous_variant	57521	exon26			CACGCCGTGCATC		CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.3108G>C	chr17.hg19:g.78919549G>C		64.0	0.0		82.0	29.0	NM_020761	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	ENST00000306801.3	hg19	CCDS11773.1																																																																																			.	G|0.999;A|0.001		0.587	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438125.1	NM_020761	
RTTN	25914	hgsc.bcm.edu	37	18	67715231	67715231	+	Silent	SNP	T	T	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr18:67715231T>C	ENST00000255674.6	-	40	5803	c.5517A>G	c.(5515-5517)gaA>gaG	p.E1839E	RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1839					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CACTAAGTTGTTCTAGAGATT	0.358																																					p.E1839E		Atlas-SNP	.											.	RTTN	184	.	0			c.A5517G						.						106.0	102.0	103.0					18																	67715231		1868	4105	5973	SO:0001819	synonymous_variant	25914	exon40			AAGTTGTTCTAGA	AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.5517A>G	chr18.hg19:g.67715231T>C		37.0	0.0		45.0	9.0	NM_173630	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Silent	SNP	ENST00000255674.6	hg19	CCDS42443.1																																																																																			.	.		0.358	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442988.1	NM_173630	
SBNO2	22904	hgsc.bcm.edu	37	19	1108560	1108560	+	Missense_Mutation	SNP	C	C	T	rs576784181		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr19:1108560C>T	ENST00000361757.3	-	32	3997	c.3760G>A	c.(3760-3762)Gga>Aga	p.G1254R	SBNO2_ENST00000438103.2_Missense_Mutation_p.G1197R|SBNO2_ENST00000587024.1_Missense_Mutation_p.G1244R	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	1254	Pro-rich.				bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGCACCTCTCCGGGGCCGCAA	0.791													c|||	1	0.000199681	0.0	0.0	5008	,	,		3823	0.001		0.0	False		,,,				2504	0.0				p.G1254R		Atlas-SNP	.											.	SBNO2	112	.	0			c.G3760A						.						1.0	1.0	1.0					19																	1108560		328	656	984	SO:0001583	missense	22904	exon32			CCTCTCCGGGGCC	AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.3760G>A	chr19.hg19:g.1108560C>T	ENSP00000354733:p.Gly1254Arg	3.0	0.0		8.0	7.0	NM_014963	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	ENST00000361757.3	hg19	CCDS45894.1	.	.	.	.	.	.	.	.	.	.	c	19.89	3.910643	0.72983	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	.	.	.	3.74	2.7	0.31948	.	1.585890	0.04110	U	0.314449	T	0.33644	0.0870	N	0.19112	0.55	0.09310	N	0.999999	D;D	0.57899	0.968;0.981	B;P	0.50405	0.436;0.64	T	0.33007	-0.9885	9	0.54805	T	0.06	-29.2617	6.379	0.21523	0.1986:0.6951:0.0:0.1063	.	1254;1197	Q9Y2G9;Q9Y2G9-3	SBNO2_HUMAN;.	R	1254;1197;1272	.	ENSP00000250872:G1272R	G	-	1	0	SBNO2	1059560	0.000000	0.05858	0.646000	0.29493	0.304000	0.27724	0.137000	0.15995	2.101000	0.63845	0.394000	0.25966	GGA	.	.		0.791	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458065.2	NM_014963	
COL5A3	50509	hgsc.bcm.edu	37	19	10084600	10084600	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr19:10084600A>G	ENST00000264828.3	-	48	3638	c.3553T>C	c.(3553-3555)Tca>Cca	p.S1185P		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1185	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTCACCTCTGATCCAGTGGGG	0.582																																					p.S1185P		Atlas-SNP	.											.	COL5A3	243	.	0			c.T3553C						.						54.0	65.0	61.0					19																	10084600		2203	4300	6503	SO:0001583	missense	50509	exon48			CCTCTGATCCAGT	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3553T>C	chr19.hg19:g.10084600A>G	ENSP00000264828:p.Ser1185Pro	61.0	0.0		41.0	22.0	NM_015719	Q9NZQ6	Missense_Mutation	SNP	ENST00000264828.3	hg19	CCDS12222.1	.	.	.	.	.	.	.	.	.	.	A	9.965	1.223864	0.22457	.	.	ENSG00000080573	ENST00000264828	D	0.90069	-2.61	4.84	-6.17	0.02091	.	1.014930	0.07900	N	0.972546	T	0.68604	0.3019	N	0.03948	-0.315	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56980	-0.7889	10	0.24483	T	0.36	.	5.3394	0.15974	0.1779:0.5554:0.1562:0.1105	.	1185	P25940	CO5A3_HUMAN	P	1185	ENSP00000264828:S1185P	ENSP00000264828:S1185P	S	-	1	0	COL5A3	9945600	0.001000	0.12720	0.513000	0.27749	0.136000	0.21042	0.580000	0.23803	-1.397000	0.02068	0.397000	0.26171	TCA	.	.		0.582	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	
ZNF44	51710	hgsc.bcm.edu	37	19	12386801	12386801	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr19:12386801G>C	ENST00000356109.5	-	3	362	c.244C>G	c.(244-246)Cga>Gga	p.R82G	ZNF44_ENST00000355684.5_Missense_Mutation_p.R34G	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	82	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		ATGGTTTCTCGCATCACATCT	0.448																																					p.R82G		Atlas-SNP	.											.	ZNF44	55	.	0			c.C244G						.						189.0	200.0	196.0					19																	12386801		2203	4300	6503	SO:0001583	missense	51710	exon3			TTTCTCGCATCAC	X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.244C>G	chr19.hg19:g.12386801G>C	ENSP00000348419:p.Arg82Gly	67.0	0.0		89.0	5.0	NM_001164276	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Missense_Mutation	SNP	ENST00000356109.5	hg19	CCDS54223.1	.	.	.	.	.	.	.	.	.	.	G	11.29	1.595890	0.28445	.	.	ENSG00000197857	ENST00000393337;ENST00000356109;ENST00000457673;ENST00000355684	T;T;T	0.01871	4.59;4.59;4.59	1.33	-1.35	0.09114	Krueppel-associated box (4);	.	.	.	.	T	0.02688	0.0081	L	0.60067	1.865	.	.	.	B;B	0.32753	0.383;0.0	B;B	0.34301	0.179;0.001	T	0.38824	-0.9643	8	0.72032	D	0.01	.	2.0677	0.03606	0.3627:0.0:0.3864:0.2509	.	82;34	P15621;F8W7T7	ZNF44_HUMAN;.	G	82;82;34;34	ENSP00000377008:R82G;ENSP00000348419:R82G;ENSP00000347910:R34G	ENSP00000347910:R34G	R	-	1	2	ZNF44	12247801	0.253000	0.23982	0.777000	0.31699	0.551000	0.35334	-0.227000	0.09126	-0.246000	0.09611	0.313000	0.20887	CGA	.	.		0.448	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000344132.1	NM_016264	
ZNF222	7673	hgsc.bcm.edu	37	19	44531618	44531618	+	Intron	SNP	A	A	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr19:44531618A>G	ENST00000187879.8	+	3	304				AC067968.3_ENST00000592583.1_lincRNA|ZNF222_ENST00000590160.1_3'UTR|ZNF222_ENST00000391960.3_Missense_Mutation_p.T80A|ZNF223_ENST00000591793.1_Missense_Mutation_p.T80A|ZNF222_ENST00000587846.1_Missense_Mutation_p.T80A	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				GATGGGGACAACAAGCCAAAG	0.458																																					p.T80A		Atlas-SNP	.											.	ZNF222	90	.	0			c.A238G						.						221.0	194.0	202.0					19																	44531618		692	1591	2283	SO:0001627	intron_variant	7673	exon3			GGGACAACAAGCC	AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.142+317A>G	chr19.hg19:g.44531618A>G		133.0	0.0		144.0	12.0	NM_001129996	G5E9B9|Q8N6G7|Q9P1U5	Missense_Mutation	SNP	ENST00000187879.8	hg19	CCDS33045.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.142294	0.00332	.	.	ENSG00000159885	ENST00000391960	T	0.05319	3.46	1.61	-1.08	0.09936	.	.	.	.	.	T	0.01765	0.0056	N	0.02111	-0.68	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.46978	-0.9152	9	0.08837	T	0.75	.	2.6321	0.04947	0.226:0.3129:0.4612:0.0	.	80	G5E9B9	.	A	80	ENSP00000375822:T80A	ENSP00000375822:T80A	T	+	1	0	ZNF222	49223458	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.255000	0.08769	-0.198000	0.10333	-0.483000	0.04790	ACA	.	.		0.458	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460465.2		
BCL2L12	83596	hgsc.bcm.edu	37	19	50169299	50169299	+	Silent	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr19:50169299G>A	ENST00000246785.3	+	1	477	c.219G>A	c.(217-219)agG>agA	p.R73R	IRF3_ENST00000596822.1_5'Flank|IRF3_ENST00000309877.7_5'Flank|BCL2L12_ENST00000246784.3_Silent_p.R73R|IRF3_ENST00000599144.1_5'Flank|IRF3_ENST00000600022.1_5'Flank|IRF3_ENST00000596765.1_5'Flank|IRF3_ENST00000598808.1_5'Flank|IRF3_ENST00000377135.4_5'Flank|IRF3_ENST00000593922.1_5'Flank|BCL2L12_ENST00000441864.2_Silent_p.R73R|IRF3_ENST00000377139.3_5'Flank|IRF3_ENST00000600911.1_5'Flank|IRF3_ENST00000599223.1_5'Flank|IRF3_ENST00000601291.1_5'Flank|IRF3_ENST00000442265.2_5'Flank|IRF3_ENST00000597198.1_5'Flank	NM_001040668.1|NM_138639.1	NP_001035758.1|NP_619580.1	Q9HB09	B2L12_HUMAN	BCL2-like 12 (proline rich)	73					inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	8		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)		TTGAGTGGAGGAGGCGGCGGT	0.657																																					p.R73R		Atlas-SNP	.											.	BCL2L12	22	.	0			c.G219A						.						9.0	10.0	10.0					19																	50169299		2160	4229	6389	SO:0001819	synonymous_variant	83596	exon1			GTGGAGGAGGCGG	AF289220	CCDS12776.1, CCDS46144.1, CCDS74424.1, CCDS74423.1	19q13.3	2014-03-07				ENSG00000126453			13787	protein-coding gene	gene with protein product		610837					Standard	NM_001040668		Approved		uc002ppa.3	Q9HB09		ENST00000246785.3:c.219G>A	chr19.hg19:g.50169299G>A		134.0	0.0		115.0	17.0	NM_001040668	Q3SY11|Q3SY13|Q96I96|Q9HB08	Silent	SNP	ENST00000246785.3	hg19	CCDS12776.1																																																																																			.	.		0.657	BCL2L12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465770.1	NM_052842	
NKX2-2	4821	hgsc.bcm.edu	37	20	21494192	21494192	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr20:21494192G>T	ENST00000377142.4	-	1	472	c.116C>A	c.(115-117)cCc>cAc	p.P39H	NKX2-2-AS1_ENST00000549659.1_RNA	NM_002509.3	NP_002500.1	O95096	NKX22_HUMAN	NK2 homeobox 2	39					astrocyte differentiation (GO:0048708)|brain development (GO:0007420)|digestive tract development (GO:0048565)|endocrine pancreas development (GO:0031018)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|oligodendrocyte development (GO:0014003)|optic nerve development (GO:0021554)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to glucose (GO:0009749)|response to progesterone (GO:0032570)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)|type B pancreatic cell fate commitment (GO:0003327)|ventral spinal cord interneuron fate determination (GO:0060580)	nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|core promoter proximal region DNA binding (GO:0001159)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21						GGCTGGCTCGGGCCCCTCGTT	0.657																																					p.P39H		Atlas-SNP	.											.	NKX2-2	49	.	0			c.C116A						.						28.0	28.0	28.0					20																	21494192		2203	4300	6503	SO:0001583	missense	4821	exon1			GGCTCGGGCCCCT	AF019415	CCDS13145.1	20p11.22	2012-03-09	2007-07-09	2002-10-04	ENSG00000125820	ENSG00000125820		"""Homeoboxes / ANTP class : NKL subclass"""	7835	protein-coding gene	gene with protein product		604612	"""NK-2 (Drosophila) homolog B"", ""NK2 transcription factor related, locus 2 (Drosophila)"""	NKX2B		9703340, 1346742	Standard	NM_002509		Approved	NKX2.2	uc002wsi.3	O95096	OTTHUMG00000170524	ENST00000377142.4:c.116C>A	chr20.hg19:g.21494192G>T	ENSP00000366347:p.Pro39His	65.0	0.0		84.0	9.0	NM_002509		Missense_Mutation	SNP	ENST00000377142.4	hg19	CCDS13145.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770931	0.49680	.	.	ENSG00000125820	ENST00000377142	D	0.90324	-2.65	5.02	5.02	0.67125	.	0.398025	0.22467	N	0.059676	D	0.83880	0.5350	N	0.14661	0.345	0.38250	D	0.941585	B	0.26809	0.16	B	0.25405	0.06	T	0.82404	-0.0474	10	0.42905	T	0.14	.	17.9439	0.89034	0.0:0.0:1.0:0.0	.	39	O95096	NKX22_HUMAN	H	39	ENSP00000366347:P39H	ENSP00000366347:P39H	P	-	2	0	NKX2-2	21442192	1.000000	0.71417	0.870000	0.34147	0.942000	0.58702	7.458000	0.80787	2.323000	0.78572	0.557000	0.71058	CCC	.	.		0.657	NKX2-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078278.9		
DNMT3B	1789	hgsc.bcm.edu	37	20	31375142	31375142	+	Missense_Mutation	SNP	C	C	T	rs537913125		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr20:31375142C>T	ENST00000328111.2	+	6	860	c.539C>T	c.(538-540)aCg>aTg	p.T180M	DNMT3B_ENST00000201963.3_Missense_Mutation_p.T192M|DNMT3B_ENST00000348286.2_Missense_Mutation_p.T180M|DNMT3B_ENST00000443239.3_Missense_Mutation_p.T138M|DNMT3B_ENST00000456297.2_Missense_Mutation_p.T104M|DNMT3B_ENST00000375623.4_Missense_Mutation_p.T138M|DNMT3B_ENST00000344505.4_Missense_Mutation_p.T180M|DNMT3B_ENST00000353855.2_Missense_Mutation_p.T180M	NM_006892.3	NP_008823.1	Q9UBC3	DNM3B_HUMAN	DNA (cytosine-5-)-methyltransferase 3 beta	180	Interaction with DNMT1 and DNMT3A.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation on cytosine within a CG sequence (GO:0010424)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of neuron differentiation (GO:0045666)|protein complex localization (GO:0031503)|regulation of gene expression by genetic imprinting (GO:0006349)|response to drug (GO:0042493)|response to ionizing radiation (GO:0010212)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA-methyltransferase activity (GO:0009008)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)|unmethylated CpG binding (GO:0045322)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(16)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACACATGGGACGCCCCAGAGC	0.652																																					p.T192M		Atlas-SNP	.											.	DNMT3B	196	.	0			c.C575T						.						109.0	96.0	101.0					20																	31375142		2203	4300	6503	SO:0001583	missense	1789	exon6			ATGGGACGCCCCA		CCDS13204.1, CCDS13205.1, CCDS13206.1, CCDS13207.1, CCDS56183.1, CCDS56184.1	20q11.2	2014-09-17			ENSG00000088305	ENSG00000088305			2979	protein-coding gene	gene with protein product		602900				9662389, 10433969	Standard	NM_006892		Approved		uc002wyc.3	Q9UBC3	OTTHUMG00000032226	ENST00000328111.2:c.539C>T	chr20.hg19:g.31375142C>T	ENSP00000328547:p.Thr180Met	147.0	0.0		124.0	54.0	NM_175850	A2A2E2|B4DSM8|B4DSU1|E1P5M6|E1P5M7|E7EN63|E9PBF2|Q9UBD4|Q9UJQ5|Q9UKA6|Q9UNE5|Q9Y5R9|Q9Y5S0	Missense_Mutation	SNP	ENST00000328111.2	hg19	CCDS13205.1	.	.	.	.	.	.	.	.	.	.	C	8.450	0.852967	0.17106	.	.	ENSG00000088305	ENST00000328111;ENST00000537219;ENST00000353855;ENST00000348286;ENST00000443239;ENST00000456297;ENST00000344505;ENST00000375623;ENST00000201963	D;D;D;D;D;D;T;D	0.97328	-4.31;-4.34;-4.28;-4.29;-4.32;-4.16;-0.16;-4.34	3.79	0.559	0.17272	.	1.045820	0.07448	N	0.898573	D	0.90981	0.7164	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;B	0.32031	0.352;0.057;0.172;0.104;0.054;0.009	B;B;B;B;B;B	0.18561	0.022;0.015;0.013;0.021;0.021;0.005	D	0.83917	0.0299	10	0.36615	T	0.2	3.2048	5.5643	0.17163	0.0:0.4774:0.0:0.5226	.	104;138;192;180;180;180	E9PBF2;E7EN63;Q9UBC3-6;Q9UBC3-3;Q9UBC3-2;Q9UBC3	.;.;.;.;.;DNM3B_HUMAN	M	180;266;180;180;138;104;180;138;192	ENSP00000328547:T180M;ENSP00000313397:T180M;ENSP00000337764:T180M;ENSP00000403169:T138M;ENSP00000412305:T104M;ENSP00000345105:T180M;ENSP00000364774:T138M;ENSP00000201963:T192M	ENSP00000201963:T192M	T	+	2	0	DNMT3B	30838803	0.003000	0.15002	0.011000	0.14972	0.201000	0.24016	0.264000	0.18497	0.114000	0.18032	-0.252000	0.11476	ACG	.	.		0.652	DNMT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078643.2	NM_006892	
RBM39	9584	hgsc.bcm.edu	37	20	34326925	34326925	+	Silent	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr20:34326925C>T	ENST00000253363.6	-	3	89	c.66G>A	c.(64-66)ttG>ttA	p.L22L	RBM39_ENST00000407261.4_5'UTR|RBM39_ENST00000361162.6_Silent_p.L22L|RBM39_ENST00000397370.3_Silent_p.L22L|RBM39_ENST00000463098.1_5'Flank|RBM39_ENST00000528062.3_Silent_p.L22L			Q14498	RBM39_HUMAN	RNA binding motif protein 39	22					mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TGGCACTGCTCAACTTGTTCT	0.433																																					p.L22L		Atlas-SNP	.											.	RBM39	68	.	0			c.G66A						.						132.0	110.0	117.0					20																	34326925		2203	4300	6503	SO:0001819	synonymous_variant	9584	exon3			ACTGCTCAACTTG	L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.66G>A	chr20.hg19:g.34326925C>T		132.0	0.0		112.0	7.0	NM_184234	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Silent	SNP	ENST00000253363.6	hg19	CCDS13266.1																																																																																			.	.		0.433	RBM39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000078931.2	NM_184237	
CHD6	84181	hgsc.bcm.edu	37	20	40162110	40162110	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr20:40162110C>G	ENST00000373233.3	-	3	310	c.133G>C	c.(133-135)Gaa>Caa	p.E45Q	CHD6_ENST00000309279.7_Missense_Mutation_p.E45Q|CHD6_ENST00000373222.3_Missense_Mutation_p.E80Q	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	45	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)	p.E45K(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				ATTTTCTCTTCTTGATCAGTG	0.413																																					p.E45Q		Atlas-SNP	.											CHD6,NS,carcinoma,0,1	CHD6	312	.	1	Substitution - Missense(1)	breast(1)	c.G133C						.						80.0	76.0	77.0					20																	40162110		2203	4300	6503	SO:0001583	missense	84181	exon3			TCTCTTCTTGATC	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.133G>C	chr20.hg19:g.40162110C>G	ENSP00000362330:p.Glu45Gln	69.0	0.0		106.0	7.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	hg19	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	C	12.24	1.877168	0.33162	.	.	ENSG00000124177	ENST00000373233;ENST00000309279;ENST00000373222;ENST00000440647	D;D;T	0.95069	-2.11;-3.6;-1.43	5.9	4.96	0.65561	.	0.291010	0.29760	N	0.011267	D	0.88994	0.6589	L	0.27053	0.805	0.26260	N	0.978588	B;B	0.24823	0.112;0.001	B;B	0.17722	0.019;0.002	T	0.79553	-0.1756	10	0.32370	T	0.25	-6.8857	11.7797	0.52006	0.0:0.8091:0.1237:0.0672	.	80;45	Q8TD26-2;Q8TD26	.;CHD6_HUMAN	Q	45;45;80;45	ENSP00000362330:E45Q;ENSP00000308684:E45Q;ENSP00000362319:E80Q	ENSP00000308684:E45Q	E	-	1	0	CHD6	39595524	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.368000	0.44222	1.503000	0.48686	0.655000	0.94253	GAA	.	.		0.413	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
KCNS1	3787	hgsc.bcm.edu	37	20	43726446	43726446	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr20:43726446C>T	ENST00000306117.1	-	4	1363	c.967G>A	c.(967-969)Ggt>Agt	p.G323S	KCNS1_ENST00000537075.1_Missense_Mutation_p.G323S	NM_002251.3	NP_002242.2	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 1	323					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel regulator activity (GO:0015459)			endometrium(1)|lung(3)|ovary(1)|stomach(1)	6		Myeloproliferative disorder(115;0.0122)				AGTGCCACACCAGCCAGCAGC	0.632																																					p.G323S		Atlas-SNP	.											.	KCNS1	30	.	0			c.G967A						.						67.0	52.0	57.0					20																	43726446		2203	4300	6503	SO:0001583	missense	3787	exon4			CCACACCAGCCAG	AF043473	CCDS13342.1	20q12	2011-07-05			ENSG00000124134	ENSG00000124134		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6300	protein-coding gene	gene with protein product		602905				9305895, 16382104	Standard	NM_002251		Approved	Kv9.1	uc002xnc.3	Q96KK3	OTTHUMG00000033079	ENST00000306117.1:c.967G>A	chr20.hg19:g.43726446C>T	ENSP00000307694:p.Gly323Ser	65.0	0.0		47.0	7.0	NM_002251	A2RUL9|B7ZM31|O43652|Q6DJU6	Missense_Mutation	SNP	ENST00000306117.1	hg19	CCDS13342.1	.	.	.	.	.	.	.	.	.	.	C	9.708	1.156353	0.21454	.	.	ENSG00000124134	ENST00000306117;ENST00000537075	D;D	0.98249	-4.82;-4.82	5.31	3.01	0.34805	Ion transport (1);	0.155438	0.56097	N	0.000025	D	0.93374	0.7887	N	0.12887	0.27	0.34504	D	0.706423	B	0.02656	0.0	B	0.09377	0.004	D	0.91493	0.5213	10	0.16420	T	0.52	.	12.9091	0.58171	0.0:0.844:0.0:0.156	.	323	Q96KK3	KCNS1_HUMAN	S	323	ENSP00000307694:G323S;ENSP00000445595:G323S	ENSP00000307694:G323S	G	-	1	0	KCNS1	43159860	0.796000	0.28864	0.217000	0.23759	0.442000	0.32017	1.666000	0.37460	1.245000	0.43885	-0.291000	0.09656	GGT	.	.		0.632	KCNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080507.3	NM_002251	
TFAP2C	7022	hgsc.bcm.edu	37	20	55206890	55206890	+	Silent	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr20:55206890C>T	ENST00000201031.2	+	3	807	c.564C>T	c.(562-564)caC>caT	p.H188H	TFAP2C_ENST00000544508.1_Silent_p.H19H	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	188					cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			TGTTGCTGCACGATCAGACAG	0.547																																					p.H188H		Atlas-SNP	.											.	TFAP2C	51	.	0			c.C564T						.						117.0	101.0	107.0					20																	55206890		2203	4300	6503	SO:0001819	synonymous_variant	7022	exon3			GCTGCACGATCAG		CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.564C>T	chr20.hg19:g.55206890C>T		90.0	0.0		74.0	9.0	NM_003222	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Silent	SNP	ENST00000201031.2	hg19	CCDS13454.1																																																																																			.	.		0.547	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079823.2	NM_003222	
KRTAP19-4	337971	hgsc.bcm.edu	37	21	31869331	31869331	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr21:31869331C>T	ENST00000334058.2	-	1	120	c.98G>A	c.(97-99)cGc>cAc	p.R33H		NM_181610.1	NP_853641.1	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	33						intermediate filament (GO:0005882)				central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ACCCAGTCTGCGGAAGCTGCC	0.532																																					p.R33H		Atlas-SNP	.											KRTAP19-4,NS,carcinoma,-1,1	KRTAP19-4	22	.	0			c.G98A						.						123.0	128.0	126.0					21																	31869331		2203	4300	6503	SO:0001583	missense	337971	exon1			AGTCTGCGGAAGC	AP001708	CCDS33534.1	21q22.1	2011-02-10			ENSG00000186967	ENSG00000186967		"""Keratin associated proteins"""	18939	protein-coding gene	gene with protein product						12359730	Standard	NM_181610		Approved	KAP19.4	uc011acz.2	Q3LI73	OTTHUMG00000057767	ENST00000334058.2:c.98G>A	chr21.hg19:g.31869331C>T	ENSP00000335567:p.Arg33His	100.0	0.0		99.0	31.0	NM_181610	Q17RT4|Q17RT6	Missense_Mutation	SNP	ENST00000334058.2	hg19	CCDS33534.1	.	.	.	.	.	.	.	.	.	.	C	6.844	0.524883	0.13066	.	.	ENSG00000186967	ENST00000334058	T	0.10668	2.85	4.54	-5.25	0.02781	.	.	.	.	.	T	0.07234	0.0183	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39742	-0.9599	8	0.87932	D	0	.	6.1988	0.20565	0.0:0.2126:0.2572:0.5301	.	33	Q3LI73	KR194_HUMAN	H	33	ENSP00000335567:R33H	ENSP00000335567:R33H	R	-	2	0	KRTAP19-4	30791202	0.000000	0.05858	0.000000	0.03702	0.425000	0.31504	-2.714000	0.00815	-1.056000	0.03205	-0.203000	0.12734	CGC	.	.		0.532	KRTAP19-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128219.2		
DOPEY2	9980	hgsc.bcm.edu	37	21	37581073	37581073	+	Silent	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr21:37581073C>A	ENST00000399151.3	+	5	637	c.552C>A	c.(550-552)gcC>gcA	p.A184A	DOPEY2_ENST00000492760.1_3'UTR	NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	184					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTTACACCGCCCTCTGGGGGA	0.622																																					p.A184A		Atlas-SNP	.											.	DOPEY2	184	.	0			c.C552A						.						72.0	58.0	63.0					21																	37581073		2203	4300	6503	SO:0001819	synonymous_variant	9980	exon5			CACCGCCCTCTGG	AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.552C>A	chr21.hg19:g.37581073C>A		56.0	0.0		74.0	23.0	NM_005128	D3DSG5|Q6PJQ7|Q9UEZ3	Silent	SNP	ENST00000399151.3	hg19	CCDS13643.1																																																																																			.	.		0.622	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194636.1	NM_005128	
DGCR6	8214	hgsc.bcm.edu	37	22	18900834	18900834	+	IGR	SNP	G	G	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr22:18900834G>C	ENST00000331444.6	+	0	1214				PRODH_ENST00000357068.6_Missense_Mutation_p.P553A|PRODH_ENST00000334029.2_Missense_Mutation_p.P445A|PRODH_ENST00000420436.1_Missense_Mutation_p.P445A	NM_005675.4	NP_005666.2	Q14129	DGCR6_HUMAN	DiGeorge syndrome critical region gene 6						cell adhesion (GO:0007155)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|cervix(1)|upper_aerodigestive_tract(1)	3						TCCATCACGGGGCCATAGGGC	0.662																																					p.P553A		Atlas-SNP	.											.	PRODH	42	.	0			c.C1657G						.						34.0	34.0	34.0					22																	18900834		2187	4267	6454	SO:0001628	intergenic_variant	5625	exon15			TCACGGGGCCATA	X96484	CCDS13753.1	22q11.21	2008-06-12			ENSG00000183628	ENSG00000183628			2846	protein-coding gene	gene with protein product		601279				8733130	Standard	NM_005675		Approved		uc002zoh.4	Q14129	OTTHUMG00000150162		chr22.hg19:g.18900834G>C		173.0	0.0		127.0	34.0	NM_016335	B2RCH5|D3DX15|G5E9J8|Q9BY28	Missense_Mutation	SNP	ENST00000331444.6	hg19	CCDS13753.1	.	.	.	.	.	.	.	.	.	.	N	25.0	4.588119	0.86851	.	.	ENSG00000100033	ENST00000357068;ENST00000313755	T	0.35236	1.32	4.43	4.43	0.53597	Proline dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.62841	0.2461	M	0.82433	2.59	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.69610	-0.5099	10	0.72032	D	0.01	-16.931	14.911	0.70758	0.0:0.0:1.0:0.0	.	469;553;445	O43272-1;O43272;E7EQL6	.;PROD_HUMAN;.	A	553;198	ENSP00000349577:P553A	ENSP00000318329:P198A	P	-	1	0	PRODH	17280834	1.000000	0.71417	0.999000	0.59377	0.947000	0.59692	5.262000	0.65501	2.196000	0.70406	0.505000	0.49811	CCC	.	.		0.662	DGCR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316631.2	NM_005675	
MYO18B	84700	hgsc.bcm.edu	37	22	26423225	26423225	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr22:26423225C>A	ENST00000407587.2	+	43	7457	c.7288C>A	c.(7288-7290)Cca>Aca	p.P2430T	MYO18B_ENST00000335473.7_Missense_Mutation_p.P2429T|MYO18B_ENST00000536101.1_Missense_Mutation_p.P2429T			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2429						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						CTGGAAACTCCCAAGCCTCGA	0.557																																					p.P2429T		Atlas-SNP	.											.	MYO18B	322	.	0			c.C7285A						.						106.0	109.0	108.0					22																	26423225		1998	4163	6161	SO:0001583	missense	84700	exon43			AAACTCCCAAGCC	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7288C>A	chr22.hg19:g.26423225C>A	ENSP00000386096:p.Pro2430Thr	118.0	0.0		147.0	51.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	C	14.20	2.465344	0.43839	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.89617	-2.52;-2.52;-2.54	4.79	4.79	0.61399	.	0.117222	0.34700	N	0.003754	D	0.93363	0.7884	M	0.62723	1.935	0.40212	D	0.977631	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.997;0.999;0.999	D	0.94498	0.7707	10	0.87932	D	0	.	16.398	0.83630	0.0:1.0:0.0:0.0	.	1942;2431;2429;2430;2429	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	T	2429;2429;2430	ENSP00000441229:P2429T;ENSP00000334563:P2429T;ENSP00000386096:P2430T	ENSP00000334563:P2429T	P	+	1	0	MYO18B	24753225	0.989000	0.36119	0.664000	0.29753	0.054000	0.15201	3.717000	0.54911	2.206000	0.71126	0.561000	0.74099	CCA	.	.		0.557	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
NEFH	4744	hgsc.bcm.edu	37	22	29885651	29885651	+	Silent	SNP	A	A	C	rs267607535		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr22:29885651A>C	ENST00000310624.6	+	4	2055	c.2022A>C	c.(2020-2022)gcA>gcC	p.A674A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	680	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGCAGAAGCAAAGTCCCCTG	0.567																																					p.A674A		Atlas-SNP	.											.	NEFH	178	.	0			c.A2022C						.						92.0	98.0	96.0					22																	29885651		2203	4297	6500	SO:0001819	synonymous_variant	4744	exon4			AGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2022A>C	chr22.hg19:g.29885651A>C		291.0	0.0		304.0	17.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
BMX	660	hgsc.bcm.edu	37	X	15555298	15555298	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrX:15555298G>C	ENST00000357607.2	+	14	1452	c.1264G>C	c.(1264-1266)Gag>Cag	p.E422Q	BMX_ENST00000348343.6_Missense_Mutation_p.E422Q|BMX_ENST00000342014.6_Missense_Mutation_p.E422Q			P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	422	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)|signal transduction (GO:0007165)	cytosol (GO:0005829)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|signal transducer activity (GO:0004871)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(14)|ovary(2)|urinary_tract(3)	30	Hepatocellular(33;0.183)					CTTGTTGAAGGAGCTGGGAAG	0.488																																					p.E422Q		Atlas-SNP	.											.	BMX	73	.	0			c.G1264C						.						186.0	173.0	178.0					X																	15555298		2203	4300	6503	SO:0001583	missense	660	exon14			TTGAAGGAGCTGG	AF045459	CCDS14168.1	Xp22.2	2013-05-14			ENSG00000102010	ENSG00000102010		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1079	protein-coding gene	gene with protein product	"""BTK-like on X chromosome"""	300101				7970727	Standard	NM_203281		Approved	ETK, PSCTK3	uc004cwx.4	P51813	OTTHUMG00000021180	ENST00000357607.2:c.1264G>C	chrX.hg19:g.15555298G>C	ENSP00000350224:p.Glu422Gln	207.0	0.0		214.0	25.0	NM_001721	A6NIH9|O60564|Q12871	Missense_Mutation	SNP	ENST00000357607.2	hg19	CCDS14168.1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.564856	0.86439	.	.	ENSG00000102010	ENST00000357607;ENST00000348343;ENST00000342014	T;T;T	0.26660	1.72;1.72;1.72	5.56	4.67	0.58626	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.088102	0.48767	N	0.000175	T	0.40886	0.1135	L	0.37561	1.115	0.44976	D	0.99799	D	0.76494	0.999	D	0.80764	0.994	T	0.27971	-1.0058	10	0.87932	D	0	.	13.8528	0.63508	0.0:0.1503:0.8497:0.0	.	422	P51813	BMX_HUMAN	Q	422	ENSP00000350224:E422Q;ENSP00000308774:E422Q;ENSP00000340082:E422Q	ENSP00000340082:E422Q	E	+	1	0	BMX	15465219	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.714000	0.84703	1.055000	0.40461	0.525000	0.51046	GAG	.	.		0.488	BMX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055877.1	NM_001721	
DMD	1756	hgsc.bcm.edu	37	X	32382769	32382769	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrX:32382769A>T	ENST00000357033.4	-	36	5290	c.5084T>A	c.(5083-5085)aTc>aAc	p.I1695N	DMD_ENST00000378677.2_Missense_Mutation_p.I1691N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1695	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AGCCTGAATGATCCACTTTGT	0.378																																					p.I1695N		Atlas-SNP	.											.	DMD	2127	.	0			c.T5084A						.						248.0	196.0	214.0					X																	32382769		2202	4300	6502	SO:0001583	missense	1756	exon36			TGAATGATCCACT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5084T>A	chrX.hg19:g.32382769A>T	ENSP00000354923:p.Ile1695Asn	110.0	0.0		91.0	4.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.675765	0.88445	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.43688	0.94;0.94	5.38	5.38	0.77491	.	0.000000	0.35235	U	0.003356	T	0.50514	0.1620	L	0.50333	1.59	0.80722	D	1	P;P;P;P;P	0.49696	0.899;0.927;0.918;0.918;0.918	P;P;P;P;P	0.52109	0.466;0.69;0.601;0.505;0.505	T	0.54309	-0.8313	10	0.87932	D	0	.	14.5942	0.68392	1.0:0.0:0.0:0.0	.	1687;1695;1691;354;351	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	N	1687;354;351;1691;1695;1695;1572	ENSP00000367948:I1691N;ENSP00000354923:I1695N	ENSP00000354923:I1695N	I	-	2	0	DMD	32292690	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.701000	0.84566	1.895000	0.54865	0.437000	0.28790	ATC	.	.		0.378	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
ZNF674	641339	hgsc.bcm.edu	37	X	46359734	46359734	+	Silent	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrX:46359734G>A	ENST00000523374.1	-	6	1500	c.1290C>T	c.(1288-1290)gtC>gtT	p.V430V	ZNF674_ENST00000518795.1_5'Flank|ZNF674_ENST00000414387.2_Silent_p.V424V	NM_001039891.2|NM_001146291.1|NM_001190417.1	NP_001034980.1|NP_001139763.1|NP_001177346.1	Q2M3X9	ZN674_HUMAN	zinc finger protein 674	430					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)	2						TTCTATGATGGACAGAGAGGT	0.418																																					p.V430V		Atlas-SNP	.											.	ZNF674	3	.	0			c.C1290T						.						91.0	92.0	92.0					X																	46359734		2187	4287	6474	SO:0001819	synonymous_variant	641339	exon6			ATGATGGACAGAG	AY971607	CCDS48099.1, CCDS55406.1	Xp11.3	2013-01-08	2010-09-15		ENSG00000251192	ENSG00000251192		"""Zinc fingers, C2H2-type"", ""-"""	17625	protein-coding gene	gene with protein product		300573		MRX92		16385466	Standard	NM_001039891		Approved	ZNF673B	uc004dgr.3	Q2M3X9	OTTHUMG00000021420	ENST00000523374.1:c.1290C>T	chrX.hg19:g.46359734G>A		72.0	0.0		99.0	8.0	NM_001039891	B4DHE2|E9PHQ4	Silent	SNP	ENST00000523374.1	hg19	CCDS48099.1																																																																																			.	.		0.418	ZNF674-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056357.2	NM_001039891	
SYN1	6853	hgsc.bcm.edu	37	X	47434654	47434654	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrX:47434654G>A	ENST00000295987.7	-	10	1302	c.1178C>T	c.(1177-1179)cCg>cTg	p.P393L	SYN1_ENST00000340666.4_Missense_Mutation_p.P393L	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	393	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						ACCAATGAGCGGCATGGAGGA	0.617																																					p.P393L		Atlas-SNP	.											.	SYN1	84	.	0			c.C1178T						.						53.0	34.0	41.0					X																	47434654		2199	4300	6499	SO:0001583	missense	6853	exon10			ATGAGCGGCATGG		CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.1178C>T	chrX.hg19:g.47434654G>A	ENSP00000295987:p.Pro393Leu	275.0	0.0		286.0	30.0	NM_006950	B1AJQ1|O75825|Q5H9A9	Missense_Mutation	SNP	ENST00000295987.7	hg19	CCDS14280.1	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868324	0.72065	.	.	ENSG00000008056	ENST00000295987;ENST00000340666	T;T	0.35973	1.71;1.28	5.17	5.17	0.71159	ATP-grasp fold, subdomain 2 (1);Synapsin, ATP-binding domain (1);	0.000000	0.64402	D	0.000002	T	0.67031	0.2850	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.989;0.999	T	0.75294	-0.3368	10	0.87932	D	0	-7.9147	15.0484	0.71844	0.0:0.0:1.0:0.0	.	393;393	P17600;P17600-2	SYN1_HUMAN;.	L	393	ENSP00000295987:P393L;ENSP00000343206:P393L	ENSP00000295987:P393L	P	-	2	0	SYN1	47319598	1.000000	0.71417	0.990000	0.47175	0.544000	0.35116	6.014000	0.70784	2.141000	0.66446	0.600000	0.82982	CCG	.	.		0.617	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056445.1	NM_006950	
MUM1L1	139221	hgsc.bcm.edu	37	X	105450458	105450458	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrX:105450458T>A	ENST00000357175.2	+	4	1682	c.1033T>A	c.(1033-1035)Ttt>Att	p.F345I	MUM1L1_ENST00000372552.1_Missense_Mutation_p.F345I|MUM1L1_ENST00000337685.2_Missense_Mutation_p.F345I	NM_001171020.1	NP_001164491.1	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	345						extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						GAGACTGGATTTTGAAGAACT	0.398																																					p.F345I		Atlas-SNP	.											.	MUM1L1	166	.	0			c.T1033A						.						22.0	20.0	21.0					X																	105450458		1844	4073	5917	SO:0001583	missense	139221	exon5			CTGGATTTTGAAG	AK090835	CCDS55469.1	Xq22.3	2008-02-05			ENSG00000157502	ENSG00000157502			26583	protein-coding gene	gene with protein product							Standard	NM_152423		Approved	FLJ33516	uc004emf.2	Q5H9M0	OTTHUMG00000022146	ENST00000357175.2:c.1033T>A	chrX.hg19:g.105450458T>A	ENSP00000349699:p.Phe345Ile	173.0	0.0		145.0	30.0	NM_152423	D3DUX2|Q49AS5|Q8N2C0|Q96MT6	Missense_Mutation	SNP	ENST00000357175.2	hg19	CCDS55469.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.643528	0.29246	.	.	ENSG00000157502	ENST00000357175;ENST00000337685;ENST00000372552	T;T;T	0.22134	1.97;1.97;1.97	5.1	-0.803	0.10886	.	0.521928	0.17623	N	0.167669	T	0.15089	0.0364	M	0.62723	1.935	0.21697	N	0.999584	B	0.10296	0.003	B	0.12156	0.007	T	0.27123	-1.0083	10	0.23302	T	0.38	.	1.2619	0.02003	0.3021:0.0908:0.1534:0.4537	.	345	Q5H9M0	MUML1_HUMAN	I	345	ENSP00000349699:F345I;ENSP00000338641:F345I;ENSP00000361632:F345I	ENSP00000338641:F345I	F	+	1	0	MUM1L1	105337114	0.449000	0.25689	0.174000	0.22961	0.147000	0.21601	-0.068000	0.11561	-0.332000	0.08489	0.481000	0.45027	TTT	.	.		0.398	MUM1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057795.1	NM_152423	
LUZP4	51213	hgsc.bcm.edu	37	X	114536617	114536617	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrX:114536617G>T	ENST00000371920.3	+	2	159	c.152G>T	c.(151-153)aGa>aTa	p.R51I	LUZP4_ENST00000451986.2_Missense_Mutation_p.D9Y	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	51						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						AAGAATAAAAGACAGAACCAT	0.338																																					p.R51I		Atlas-SNP	.											.	LUZP4	51	.	0			c.G152T						.						136.0	128.0	131.0					X																	114536617		2203	4300	6503	SO:0001583	missense	51213	exon2			ATAAAAGACAGAA	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.152G>T	chrX.hg19:g.114536617G>T	ENSP00000360988:p.Arg51Ile	603.0	0.0		636.0	232.0	NM_016383	B3KSD6	Missense_Mutation	SNP	ENST00000371920.3	hg19	CCDS14567.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.635|1.635	-0.518095|-0.518095	0.04171|0.04171	.|.	.|.	ENSG00000102021|ENSG00000102021	ENST00000451986|ENST00000371921;ENST00000371920	T|T;T	0.57436|0.45276	0.4|0.9;1.5	2.64|2.64	-2.2|-2.2	0.06994|0.06994	.|.	.|.	.|.	.|.	.|.	T|T	0.20455|0.20455	0.0492|0.0492	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	P|P	0.38020|0.41848	0.615|0.763	B|B	0.28232|0.35114	0.087|0.196	T|T	0.09840|0.09840	-1.0656|-1.0656	9|9	0.87932|0.45353	D|T	0|0.12	.|.	4.4287|4.4287	0.11517|0.11517	0.4713:0.2323:0.2964:0.0|0.4713:0.2323:0.2964:0.0	.|.	9|51	B3KSD6|Q9P127	.|LUZP4_HUMAN	Y|I	9|51	ENSP00000411212:D9Y|ENSP00000360989:R51I;ENSP00000360988:R51I	ENSP00000411212:D9Y|ENSP00000360988:R51I	D|R	+|+	1|2	0|0	LUZP4|LUZP4	114442873|114442873	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.005000|0.005000	0.04900|0.04900	-2.383000|-2.383000	0.01063|0.01063	-0.720000|-0.720000	0.04935|0.04935	-0.422000|-0.422000	0.05995|0.05995	GAC|AGA	.	.		0.338	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383	
ZIC3	7547	hgsc.bcm.edu	37	X	136649300	136649300	+	Silent	SNP	A	A	T			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrX:136649300A>T	ENST00000287538.5	+	1	1000	c.450A>T	c.(448-450)ccA>ccT	p.P150P	RP1-137H15.2_ENST00000442841.1_RNA|ZIC3_ENST00000370606.3_Silent_p.P150P	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	150					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					TGCATGCTCCAGCTGGCATCC	0.697																																					p.P150P		Atlas-SNP	.											.	ZIC3	93	.	0			c.A450T						.						11.0	13.0	12.0					X																	136649300		2149	4188	6337	SO:0001819	synonymous_variant	7547	exon1			TGCTCCAGCTGGC	AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.450A>T	chrX.hg19:g.136649300A>T		114.0	0.0		112.0	14.0	NM_003413	B2CNW4|Q14DE5|Q5JY75	Silent	SNP	ENST00000287538.5	hg19	CCDS14663.1																																																																																			.	.		0.697	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058526.1		
MT-CO1	4512	hgsc.bcm.edu	37	M	5907	5907	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chrM:5907T>C	ENST00000361624.2	+	1	4	c.4T>C	c.(4-6)Ttc>Ctc	p.F2L	MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TQ_ENST00000387372.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	2					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CCCCACTGATGTTCGCCGACC	0.468																																					p.F2L		Atlas-SNP	.											.	.	.	.	0			c.T4C						.																																			SO:0001583	missense	5742	exon1			CTGATGTTCGCCG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.4T>C	chrM.hg19:g.5907T>C	ENSP00000354499:p.Phe2Leu	51.0	0.0		69.0	10.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.468	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305774	39305775	+	In_Frame_Ins	INS	-	-	TGGCAGCAGCTGGGG	rs137947981|rs535144703|rs141265645|rs58117746	byFrequency	TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr17:39305774_39305775insTGGCAGCAGCTGGGG	ENST00000343246.4	-	1	279_280	c.245_246insCCCCAGCTGCTGCCA	c.(244-246)cag>caCCCCAGCTGCTGCCAg	p.81_82insHPSCC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	81	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.Q82H(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			agcaggtggtctggcagcagca	0.653																																					p.Q82delinsHPSCCQ		Atlas-INDEL	.											KRTAP4-5,NS,carcinoma,0,1	KRTAP4-5	34	.	1	Substitution - Missense(1)	lung(1)	c.246_247insCCCCAGCTGCTGCCA						.																																			SO:0001652	inframe_insertion	85289	exon1			.	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.245_246insCCCCAGCTGCTGCCA	chr17.hg19:g.39305774_39305775insTGGCAGCAGCTGGGG	ENSP00000340546:p.Cys81_Gln82insHisProSerCysCys	54.0	0.0		48.0	12.0	NM_033188		In_Frame_Ins	INS	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
SEMG2	6407	hgsc.bcm.edu	37	20	43851311	43851313	+	In_Frame_Del	DEL	ATC	ATC	-	rs191175081		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	ATC	ATC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr20:43851311_43851313delATC	ENST00000372769.3	+	2	1128_1130	c.1038_1040delATC	c.(1036-1041)atatca>ata	p.S347del		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	347	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				AAAATAAAATATCATACCAATCT	0.379																																					p.346_347del		Atlas-INDEL	.											.	SEMG2	92	.	0			c.1037_1039del						.																																			SO:0001651	inframe_deletion	6407	exon2			.		CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.1038_1040delATC	chr20.hg19:g.43851311_43851313delATC	ENSP00000361855:p.Ser347del	197.0	0.0		182.0	41.0	NM_003008	Q53ZU2|Q6X2M5|Q6X2M6	In_Frame_Del	DEL	ENST00000372769.3	hg19	CCDS13346.1																																																																																			.	.		0.379	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079417.1	NM_003008	
DST	667	hgsc.bcm.edu	37	6	56481396	56481397	+	Frame_Shift_Ins	INS	-	-	T	rs112473525	byFrequency	TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr6:56481396_56481397insT	ENST00000370765.6	-	24	6975_6976	c.6868_6869insA	c.(6868-6870)agafs	p.R2290fs	DST_ENST00000370788.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000446842.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000244364.6_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1628					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGGGAAAACTCTTGTGTTGCTG	0.421																																					p.R2290fs		Atlas-INDEL	.											.	DST	1427	.	0			c.6869_6870insA						.																																			SO:0001589	frameshift_variant	667	exon24			.	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.6869dupA	chr6.hg19:g.56481398_56481398dupT	ENSP00000359801:p.Arg2290fs	80.0	0.0		57.0	17.0	NM_001723	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Frame_Shift_Ins	INS	ENST00000370765.6	hg19	CCDS4959.1																																																																																			.	.		0.421	DST-010	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041027.2	NM_001723	
HMCN1	83872	hgsc.bcm.edu	37	1	186136049	186136049	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr1:186136049delA	ENST00000271588.4	+	100	15778	c.15549delA	c.(15547-15549)agafs	p.R5183fs	HMCN1_ENST00000367492.2_Frame_Shift_Del_p.R5183fs	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5183	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCTTTCGAAGAACCTCTGATG	0.453																																					p.R5183fs		Atlas-INDEL	.											.	HMCN1	797	.	0			c.15548delG						.						195.0	172.0	180.0					1																	186136049		2203	4300	6503	SO:0001589	frameshift_variant	83872	exon100			.	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.15549delA	chr1.hg19:g.186136049delA	ENSP00000271588:p.Arg5183fs	98.0	0.0		214.0	142.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Frame_Shift_Del	DEL	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.453	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
KDELR3	11015	hgsc.bcm.edu	37	22	38878529	38878540	+	Stop_Codon_Del	DEL	AATGCCAATCTG	AATGCCAATCTG	-	rs546524854		TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	AATGCCAATCTG	AATGCCAATCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr22:38878529_38878540delAATGCCAATCTG	ENST00000216014.4	+	0	805_816				KDELR3_ENST00000471268.1_3'UTR	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					TAAGTCTTCCAATGCCAATCTGAGGACCTTCA	0.358																																					p.211_215del	Ovarian(11;103 529 24120 28493 32980)	Atlas-INDEL	.											.	KDELR3	39	.	0			c.632_643del						.																																			SO:0001567	stop_retained_variant	11015	exon5			.	AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520	Exception_encountered	chr22.hg19:g.38878529_38878540delAATGCCAATCTG	ENSP00000216014:p.*215Trpext*9	88.0	0.0		57.0	19.0	NM_006855	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	In_Frame_Del	DEL	ENST00000216014.4	hg19	CCDS13972.1																																																																																			.	.		0.358	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331474.1		
TOP2B	7155	hgsc.bcm.edu	37	3	25670387	25670387	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAEG-01A-11D-A38X-10	TCGA-DD-AAEG-10A-01D-A38X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	60545315-ae1b-4ac7-bf17-6dff14fcc159	69827eac-d9d6-41e2-8db4-5e5482ff1418	g.chr3:25670387delC	ENST00000264331.4	-	15	1856	c.1857delG	c.(1855-1857)tggfs	p.W619fs	TOP2B_ENST00000435706.2_Frame_Shift_Del_p.W614fs	NM_001068.2	NP_001059.2	Q02880	TOP2B_HUMAN	topoisomerase (DNA) II beta 180kDa	619					ATP catabolic process (GO:0006200)|axonogenesis (GO:0007409)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|forebrain development (GO:0030900)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|neuron migration (GO:0001764)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein kinase C binding (GO:0005080)			breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|skin(2)|stomach(1)	36					Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Etoposide(DB00773)	TATGTTTTTTCCATTCGTCAA	0.259																																					p.K615fs		Atlas-INDEL	.											.	TOP2B	98	.	0			c.1843delA						.						52.0	49.0	50.0					3																	25670387		1787	4047	5834	SO:0001589	frameshift_variant	7155	exon15			.	X68060	CCDS46776.1	3p24.2	2012-08-30	2002-08-29		ENSG00000077097	ENSG00000077097	5.99.1.3		11990	protein-coding gene	gene with protein product		126431	"""topoisomerase (DNA) II beta (180kD)"""			1309226, 1333583	Standard	NM_001068		Approved		uc003cdj.3	Q02880	OTTHUMG00000155596	ENST00000264331.4:c.1857delG	chr3.hg19:g.25670387delC	ENSP00000264331:p.Trp619fs	344.0	0.0		306.0	41.0	NM_001068	Q13600|Q9UMG8|Q9UQP8	Frame_Shift_Del	DEL	ENST00000264331.4	hg19																																																																																				.	.		0.259	TOP2B-201	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding			
