#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf158	93190	hgsc.bcm.edu	37	1	12820816	12820816	+	Missense_Mutation	SNP	G	G	A	rs140110943		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:12820816G>A	ENST00000288048.5	+	4	733	c.517G>A	c.(517-519)Gct>Act	p.A173T	C1orf158_ENST00000376210.3_Missense_Mutation_p.A135T	NM_152290.2	NP_689503.2	Q8N1D5	CA158_HUMAN	chromosome 1 open reading frame 158	173										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(1)|ovary(1)|skin(2)|urinary_tract(3)	10	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00575)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		ACCGTTGTGCGCTATGTCCTG	0.577																																					p.A173T		Atlas-SNP	.											.	C1orf158	28	.	0			c.G517A						.	G	THR/ALA	2,4404		0,2,2201	142.0	118.0	126.0		517	2.8	0.0	1	dbSNP_134	126	0,8600		0,0,4300	no	missense	C1orf158	NM_152290.2	58	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	173/195	12820816	2,13004	2203	4300	6503	SO:0001583	missense	93190	exon4			TTGTGCGCTATGT	BX647383	CCDS147.1	1p36.21	2008-02-05			ENSG00000157330	ENSG00000157330			28567	protein-coding gene	gene with protein product						12477932	Standard	NM_152290		Approved	MGC35194	uc001auh.3	Q8N1D5	OTTHUMG00000001888	ENST00000288048.5:c.517G>A	chr1.hg19:g.12820816G>A	ENSP00000288048:p.Ala173Thr	57.0	0.0		74.0	8.0	NM_152290	Q5VUY4	Missense_Mutation	SNP	ENST00000288048.5	hg19	CCDS147.1	.	.	.	.	.	.	.	.	.	.	.	11.80	1.746198	0.30955	4.54E-4	0.0	ENSG00000157330	ENST00000288048;ENST00000376210	T;T	0.51071	0.76;0.72	4.75	2.78	0.32641	.	0.396303	0.24580	N	0.037313	T	0.41190	0.1148	M	0.65975	2.015	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.32666	-0.9898	10	0.41790	T	0.15	-12.3831	6.4952	0.22138	0.101:0.1843:0.7147:0.0	.	173	Q8N1D5	CA158_HUMAN	T	173;135	ENSP00000288048:A173T;ENSP00000365383:A135T	ENSP00000288048:A173T	A	+	1	0	C1orf158	12743403	0.000000	0.05858	0.024000	0.17045	0.005000	0.04900	-0.036000	0.12185	1.183000	0.42943	0.563000	0.77884	GCT	.	G|1.000;A|0.000		0.577	C1orf158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005325.1	NM_152290	
NSUN4	387338	hgsc.bcm.edu	37	1	46827352	46827352	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:46827352A>G	ENST00000474844.1	+	6	1639	c.989A>G	c.(988-990)aAt>aGt	p.N330S	NSUN4_ENST00000498008.1_3'UTR|NSUN4_ENST00000537428.1_Missense_Mutation_p.N281S|NSUN4_ENST00000536062.1_Missense_Mutation_p.N281S	NM_199044.3	NP_950245.2	Q96CB9	NSUN4_HUMAN	NOP2/Sun domain family, member 4	330					rRNA methylation (GO:0031167)	mitochondrial large ribosomal subunit (GO:0005762)	methyltransferase activity (GO:0008168)|rRNA binding (GO:0019843)			endometrium(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)	8	Acute lymphoblastic leukemia(166;0.155)					CTCCTGGCCAATCAATACAGC	0.493																																					p.N330S		Atlas-SNP	.											.	NSUN4	26	.	0			c.A989G						.						296.0	270.0	279.0					1																	46827352		2203	4300	6503	SO:0001583	missense	387338	exon6			TGGCCAATCAATA	AK021577	CCDS534.1, CCDS57996.1	1p34	2012-02-24	2009-11-23		ENSG00000117481	ENSG00000117481		"""NOP2/Sun domain containing"""	31802	protein-coding gene	gene with protein product	"""sperm head and tail associated protein"""	615394	"""NOL1/NOP2/Sun domain family 4"", ""NOL1/NOP2/Sun domain family, member 4"""				Standard	NM_199044		Approved	MGC22960, SHTAP	uc001cpr.2	Q96CB9	OTTHUMG00000007808	ENST00000474844.1:c.989A>G	chr1.hg19:g.46827352A>G	ENSP00000419740:p.Asn330Ser	121.0	0.0		103.0	28.0	NM_199044	A8K6S6|B3KQ50|B4DHA4|Q5TDF7|Q96AN8|Q9HAJ8	Missense_Mutation	SNP	ENST00000474844.1	hg19	CCDS534.1	.	.	.	.	.	.	.	.	.	.	A	8.892	0.954117	0.18431	.	.	ENSG00000117481	ENST00000474844;ENST00000536062;ENST00000537428	T;T;T	0.09445	2.98;2.98;2.98	5.43	4.3	0.51218	.	0.151534	0.64402	D	0.000012	T	0.06416	0.0165	L	0.31120	0.905	0.30225	N	0.796439	B;B	0.22683	0.021;0.073	B;B	0.25987	0.009;0.065	T	0.29150	-1.0021	10	0.11182	T	0.66	-12.1768	2.8814	0.05648	0.5529:0.2452:0.0786:0.1233	.	197;330	B3KUM0;Q96CB9	.;NSUN4_HUMAN	S	330;281;281	ENSP00000419740:N330S;ENSP00000438912:N281S;ENSP00000437758:N281S	ENSP00000419740:N330S	N	+	2	0	NSUN4	46599939	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	1.461000	0.35255	1.068000	0.40764	0.533000	0.62120	AAT	.	.		0.493	NSUN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021427.1	NM_199044	
MRPL37	51253	hgsc.bcm.edu	37	1	54666136	54666136	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:54666136A>G	ENST00000360840.5	+	1	297	c.220A>G	c.(220-222)Atc>Gtc	p.I74V	CYB5RL_ENST00000542737.1_5'Flank|RP11-446E24.4_ENST00000311841.7_5'Flank|MRPL37_ENST00000336230.6_Silent_p.R43R|MRPL37_ENST00000487096.1_Intron|CYB5RL_ENST00000537208.1_5'Flank|MRPL37_ENST00000605337.1_Missense_Mutation_p.I74V	NM_016491.3	NP_057575.2	Q9BZE1	RM37_HUMAN	mitochondrial ribosomal protein L37	74					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(4)|skin(2)	19						GGCGCGGCCGATCTTTCCGCC	0.622																																					p.I74V		Atlas-SNP	.											.	MRPL37	36	.	0			c.A220G						.						59.0	56.0	57.0					1																	54666136		2203	4300	6503	SO:0001583	missense	51253	exon1			CGGCCGATCTTTC	AB051344	CCDS589.1	1p32.1	2012-09-13			ENSG00000116221	ENSG00000116221		"""Mitochondrial ribosomal proteins / large subunits"""	14034	protein-coding gene	gene with protein product		611843				10600119	Standard	NM_016491		Approved	RPML2, MRP-L2	uc001cxa.4	Q9BZE1	OTTHUMG00000008118	ENST00000360840.5:c.220A>G	chr1.hg19:g.54666136A>G	ENSP00000354086:p.Ile74Val	124.0	0.0		164.0	51.0	NM_016491	Q96Q67|Q9BWR1|Q9P0P3	Missense_Mutation	SNP	ENST00000360840.5	hg19	CCDS589.1	.	.	.	.	.	.	.	.	.	.	A	3.218	-0.160140	0.06502	.	.	ENSG00000116221	ENST00000360840;ENST00000329505	T	0.27720	1.65	4.81	-0.913	0.10500	.	0.586833	0.17152	N	0.185013	T	0.09024	0.0223	N	0.02539	-0.55	0.09310	N	0.99999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.37150	-0.9718	10	0.07644	T	0.81	-4.0557	7.8303	0.29338	0.2013:0.119:0.6797:0.0	.	11;74	E9PB99;Q9BZE1	.;RM37_HUMAN	V	74;11	ENSP00000354086:I74V	ENSP00000328799:I11V	I	+	1	0	MRPL37	54438724	0.619000	0.27059	0.712000	0.30502	0.908000	0.53690	1.409000	0.34680	-0.243000	0.09653	-0.270000	0.10280	ATC	.	.		0.622	MRPL37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022224.1	NM_016491	
PRMT6	55170	hgsc.bcm.edu	37	1	107599340	107599340	+	Start_Codon_SNP	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:107599340G>A	ENST00000370078.1	+	1	40	c.3G>A	c.(1-3)atG>atA	p.M1I	PRMT6_ENST00000361318.5_5'UTR			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	1					base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		CGGCCAAGATGTCGCAGCCCA	0.697																																					p.M1I		Atlas-SNP	.											.	PRMT6	55	.	0			c.G3A						.						6.0	9.0	8.0					1																	107599340		669	1562	2231	SO:0001582	initiator_codon_variant	55170	exon1			CAAGATGTCGCAG	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.3G>A	chr1.hg19:g.107599340G>A	ENSP00000359095:p.Met1Ile	146.0	0.0		156.0	51.0	NM_018137	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Missense_Mutation	SNP	ENST00000370078.1	hg19	CCDS41360.2	.	.	.	.	.	.	.	.	.	.	G	15.60	2.880310	0.51801	.	.	ENSG00000198890	ENST00000370078	T	0.24538	1.85	4.85	4.85	0.62838	.	.	.	.	.	T	0.33789	0.0875	.	.	.	0.80722	D	1	P	0.45126	0.851	P	0.55391	0.775	T	0.07790	-1.0754	8	0.87932	D	0	-39.8888	13.3271	0.60465	0.0:0.0:1.0:0.0	.	1	Q96LA8	ANM6_HUMAN	I	1	ENSP00000359095:M1I	ENSP00000359095:M1I	M	+	3	0	PRMT6	107400863	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.119000	0.57891	2.494000	0.84150	0.544000	0.68410	ATG	.	.		0.697	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137	Missense_Mutation
KPRP	448834	hgsc.bcm.edu	37	1	152732150	152732150	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:152732150C>A	ENST00000606109.1	+	1	114	c.86C>A	c.(85-87)cCc>cAc	p.P29H	KPRP_ENST00000368773.1_Missense_Mutation_p.P29H			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	29	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCTCAATCCCCCTTTGCCCAG	0.582																																					p.P29H		Atlas-SNP	.											.	KPRP	152	.	0			c.C86A						.						122.0	120.0	121.0					1																	152732150		2203	4300	6503	SO:0001583	missense	448834	exon2			AATCCCCCTTTGC	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.86C>A	chr1.hg19:g.152732150C>A	ENSP00000475216:p.Pro29His	87.0	0.0		141.0	34.0	NM_001025231		Missense_Mutation	SNP	ENST00000606109.1	hg19	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	C	10.61	1.398900	0.25291	.	.	ENSG00000203786	ENST00000368773	T	0.14144	2.53	5.26	2.4	0.29515	.	0.451045	0.19115	N	0.122331	T	0.13798	0.0334	L	0.60455	1.87	0.09310	N	1	D	0.71674	0.998	P	0.62740	0.906	T	0.03193	-1.1062	10	0.87932	D	0	-2.7757	6.6995	0.23217	0.0:0.7193:0.0:0.2807	.	29	Q5T749	KPRP_HUMAN	H	29	ENSP00000357762:P29H	ENSP00000357762:P29H	P	+	2	0	KPRP	150998774	0.000000	0.05858	0.001000	0.08648	0.067000	0.16453	0.186000	0.16978	0.923000	0.37045	0.655000	0.94253	CCC	.	.		0.582	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
DENND4B	9909	hgsc.bcm.edu	37	1	153907290	153907290	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:153907290G>C	ENST00000361217.4	-	18	3137	c.2719C>G	c.(2719-2721)Cag>Gag	p.Q907E	DENND4B_ENST00000474386.1_5'Flank	NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	907	Gln-rich.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			tgctgctgctgctgctgctgc	0.637																																					p.Q907E		Atlas-SNP	.											.	DENND4B	210	.	0			c.C2719G						.						26.0	34.0	31.0					1																	153907290		2187	4278	6465	SO:0001583	missense	9909	exon18			GCTGCTGCTGCTG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.2719C>G	chr1.hg19:g.153907290G>C	ENSP00000354597:p.Gln907Glu	40.0	0.0		50.0	4.0	NM_014856	Q5T4K0	Missense_Mutation	SNP	ENST00000361217.4	hg19	CCDS44228.1	.	.	.	.	.	.	.	.	.	.	g	2.536	-0.307398	0.05458	.	.	ENSG00000198837	ENST00000361217;ENST00000368646	T;T	0.06142	3.34;3.34	2.18	2.18	0.27775	.	2.965800	0.00748	N	0.001049	T	0.00906	0.0030	N	0.08118	0	0.27538	N	0.95088	B	0.10296	0.003	B	0.06405	0.002	T	0.28427	-1.0044	10	0.02654	T	1	-2.8917	8.0948	0.30822	0.0:0.0:1.0:0.0	.	907	O75064	DEN4B_HUMAN	E	907;918	ENSP00000354597:Q907E;ENSP00000357635:Q918E	ENSP00000354597:Q907E	Q	-	1	0	DENND4B	152173914	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	1.183000	0.32041	1.576000	0.49790	0.271000	0.19318	CAG	.	.		0.637	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	
ATP8B2	57198	hgsc.bcm.edu	37	1	154321379	154321379	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:154321379G>C	ENST00000368489.3	+	28	3457	c.3457G>C	c.(3457-3459)Ggc>Cgc	p.G1153R		NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	1139					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			GCGGCGGGTTGGCCGCACTGG	0.647																																					p.G1153R		Atlas-SNP	.											.	ATP8B2	158	.	0			c.G3457C						.						22.0	26.0	25.0					1																	154321379		2203	4299	6502	SO:0001583	missense	57198	exon28			CGGGTTGGCCGCA	AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.3457G>C	chr1.hg19:g.154321379G>C	ENSP00000357475:p.Gly1153Arg	126.0	0.0		179.0	38.0	NM_020452	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	ENST00000368489.3	hg19	CCDS1066.1	.	.	.	.	.	.	.	.	.	.	G	6.586	0.476436	0.12521	.	.	ENSG00000143515	ENST00000368489	T	0.38240	1.15	4.23	4.23	0.50019	.	0.085282	0.48767	D	0.000171	T	0.02418	0.0074	N	0.00197	-1.87	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47086	-0.9144	10	0.02654	T	1	.	11.3881	0.49798	0.0:0.1838:0.8162:0.0	.	1153	P98198-3	.	R	1153	ENSP00000357475:G1153R	ENSP00000357475:G1153R	G	+	1	0	ATP8B2	152588003	0.758000	0.28405	0.917000	0.36280	0.852000	0.48524	0.924000	0.28777	2.173000	0.68751	0.561000	0.74099	GGC	.	.		0.647	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087658.2	NM_020452	
CCT3	7203	hgsc.bcm.edu	37	1	156290762	156290762	+	Silent	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:156290762A>G	ENST00000295688.3	-	7	757	c.477T>C	c.(475-477)tcT>tcC	p.S159S	CCT3_ENST00000368261.3_Silent_p.S114S|CCT3_ENST00000472765.2_Silent_p.S114S|CCT3_ENST00000368259.2_Silent_p.S121S	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	159					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					TGGTAGTAATAGAGCTGTTGA	0.438																																					p.S159S		Atlas-SNP	.											.	CCT3	61	.	0			c.T477C						.						195.0	171.0	179.0					1																	156290762		2203	4300	6503	SO:0001819	synonymous_variant	7203	exon7			AGTAATAGAGCTG	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.477T>C	chr1.hg19:g.156290762A>G		71.0	0.0		131.0	43.0	NM_005998	A6NE14|Q5SZY1|Q9BR64	Silent	SNP	ENST00000295688.3	hg19	CCDS1140.2																																																																																			.	.		0.438	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
CADM3	57863	hgsc.bcm.edu	37	1	159166162	159166162	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:159166162A>C	ENST00000368125.4	+	6	857	c.700A>C	c.(700-702)Act>Cct	p.T234P	CTA-134P22.2_ENST00000415675.2_RNA|CADM3_ENST00000368124.4_Missense_Mutation_p.T268P	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3	234	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					AGACACACCAACTGCGATGAT	0.507											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T268P		Atlas-SNP	.											.	CADM3	118	.	0			c.A802C						.						206.0	143.0	164.0					1																	159166162		2203	4300	6503	SO:0001583	missense	57863	exon7			ACACCAACTGCGA	AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.700A>C	chr1.hg19:g.159166162A>C	ENSP00000357107:p.Thr234Pro	98.0	0.0	1799	149.0	45.0	NM_021189	Q8IZQ9|Q9NVJ5|Q9UJP1	Missense_Mutation	SNP	ENST00000368125.4	hg19	CCDS44251.1	.	.	.	.	.	.	.	.	.	.	A	12.97	2.096991	0.37048	.	.	ENSG00000162706	ENST00000368124;ENST00000368125;ENST00000416746	T;T;T	0.15718	2.4;2.4;2.45	4.78	4.78	0.61160	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.328508	0.29838	N	0.011076	T	0.14787	0.0357	M	0.64997	1.995	0.21861	N	0.999501	P;P;D	0.61080	0.927;0.947;0.989	P;P;P	0.52454	0.477;0.699;0.656	T	0.05115	-1.0905	10	0.37606	T	0.19	.	10.6186	0.45465	1.0:0.0:0.0:0.0	.	188;234;268	Q8N126-3;Q8N126;Q8N126-2	.;CADM3_HUMAN;.	P	268;234;188	ENSP00000357106:T268P;ENSP00000357107:T234P;ENSP00000387802:T188P	ENSP00000357106:T268P	T	+	1	0	CADM3	157432786	0.482000	0.25948	0.070000	0.20053	0.275000	0.26752	4.681000	0.61663	1.999000	0.58509	0.533000	0.62120	ACT	.	.		0.507	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090330.1	NM_021189	
SUCO	51430	hgsc.bcm.edu	37	1	172547511	172547511	+	Silent	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:172547511C>T	ENST00000263688.3	+	14	1633	c.1414C>T	c.(1414-1416)Cta>Tta	p.L472L	SUCO_ENST00000610051.1_Silent_p.L435L|SUCO_ENST00000608151.1_Silent_p.L624L|SUCO_ENST00000367723.4_Silent_p.L623L	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	472					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											ACGCCAGGAACTATTTGATGA	0.348																																					p.L472L		Atlas-SNP	.											.	.	.	.	0			c.C1414T						.						124.0	115.0	118.0					1																	172547511		2203	4300	6503	SO:0001819	synonymous_variant	51430	exon14			CAGGAACTATTTG	AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1414C>T	chr1.hg19:g.172547511C>T		59.0	0.0		120.0	7.0	NM_014283	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Silent	SNP	ENST00000263688.3	hg19	CCDS1303.1																																																																																			.	.		0.348	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084273.1	NM_016227	
LAMC2	3918	hgsc.bcm.edu	37	1	183201974	183201974	+	Silent	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:183201974A>G	ENST00000264144.4	+	14	2267	c.2202A>G	c.(2200-2202)gaA>gaG	p.E734E	LAMC2_ENST00000493293.1_Silent_p.E734E	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	734	Domain II and I.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)			breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						CAGAAAGTGAAGCTTCCTTGG	0.488																																					p.E734E		Atlas-SNP	.											.	LAMC2	113	.	0			c.A2202G						.						68.0	69.0	69.0					1																	183201974		2203	4300	6503	SO:0001819	synonymous_variant	3918	exon14			AAGTGAAGCTTCC	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.2202A>G	chr1.hg19:g.183201974A>G		61.0	0.0		99.0	25.0	NM_005562	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Silent	SNP	ENST00000264144.4	hg19	CCDS1352.1																																																																																			.	.		0.488	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562	
HMCN1	83872	hgsc.bcm.edu	37	1	185704070	185704070	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:185704070T>A	ENST00000271588.4	+	1	388	c.159T>A	c.(157-159)taT>taA	p.Y53*	HMCN1_ENST00000367492.2_Nonsense_Mutation_p.Y53*	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	53	VWFA.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTTCTATGTATGATGATTTAG	0.463																																					p.Y53X		Atlas-SNP	.											.	HMCN1	797	.	0			c.T159A						.						138.0	145.0	143.0					1																	185704070		2203	4300	6503	SO:0001587	stop_gained	83872	exon1			TATGTATGATGAT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.159T>A	chr1.hg19:g.185704070T>A	ENSP00000271588:p.Tyr53*	130.0	0.0		240.0	63.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Nonsense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	40	8.197602	0.98701	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	.	.	.	5.7	-2.16	0.07080	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8529	0.63508	0.0:0.7676:0.0:0.2324	.	.	.	.	X	53	.	ENSP00000271588:Y53X	Y	+	3	2	HMCN1	183970693	0.896000	0.30565	0.992000	0.48379	0.997000	0.91878	0.012000	0.13287	-0.332000	0.08489	0.528000	0.53228	TAT	.	.		0.463	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMCN1	83872	hgsc.bcm.edu	37	1	186082011	186082011	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:186082011A>G	ENST00000271588.4	+	72	11286	c.11057A>G	c.(11056-11058)gAt>gGt	p.D3686G	HMCN1_ENST00000367492.2_Missense_Mutation_p.D3686G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3686	Ig-like C2-type 35.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GACCTAGGTGATACAGCCAAT	0.408																																					p.D3686G		Atlas-SNP	.											.	HMCN1	797	.	0			c.A11057G						.						125.0	119.0	121.0					1																	186082011		2203	4300	6503	SO:0001583	missense	83872	exon72			TAGGTGATACAGC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11057A>G	chr1.hg19:g.186082011A>G	ENSP00000271588:p.Asp3686Gly	95.0	0.0		127.0	40.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.620691	0.66787	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	D;D	0.81739	-1.53;-1.53	4.91	4.91	0.64330	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94321	0.8175	H	0.99415	4.555	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96719	0.9531	10	0.87932	D	0	.	14.8338	0.70166	1.0:0.0:0.0:0.0	.	3686	Q96RW7	HMCN1_HUMAN	G	3686	ENSP00000271588:D3686G;ENSP00000356462:D3686G	ENSP00000271588:D3686G	D	+	2	0	HMCN1	184348634	1.000000	0.71417	0.618000	0.29105	0.309000	0.27889	9.080000	0.94040	1.957000	0.56846	0.533000	0.62120	GAT	.	.		0.408	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
EPHX1	2052	hgsc.bcm.edu	37	1	226033008	226033008	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:226033008A>C	ENST00000366837.4	+	9	1524	c.1328A>C	c.(1327-1329)cAg>cCg	p.Q443P	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.Q443P	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	443					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					CTGCTCGCCCAGGACATCCGC	0.612																																					p.Q443P		Atlas-SNP	.											.	EPHX1	57	.	0			c.A1328C						.						40.0	41.0	41.0					1																	226033008		2203	4300	6503	SO:0001583	missense	2052	exon9			TCGCCCAGGACAT	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.1328A>C	chr1.hg19:g.226033008A>C	ENSP00000355802:p.Gln443Pro	39.0	0.0		63.0	7.0	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	hg19	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	A	9.738	1.164177	0.21538	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.37752	1.18;1.18	4.94	-7.46	0.01369	.	1.345280	0.04747	N	0.423936	T	0.47002	0.1422	M	0.81341	2.54	0.18873	N	0.999986	P	0.37663	0.604	B	0.43386	0.418	T	0.58549	-0.7617	10	0.52906	T	0.07	-16.3533	14.7709	0.69679	0.4284:0.0:0.5716:0.0	.	443	P07099	HYEP_HUMAN	P	443	ENSP00000272167:Q443P;ENSP00000355802:Q443P	ENSP00000272167:Q443P	Q	+	2	0	EPHX1	224099631	0.191000	0.23288	0.011000	0.14972	0.067000	0.16453	0.935000	0.28924	-1.800000	0.01247	-1.467000	0.01014	CAG	.	.		0.612	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
OBSCN	84033	hgsc.bcm.edu	37	1	228525730	228525730	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:228525730T>A	ENST00000422127.1	+	67	16930	c.16886T>A	c.(16885-16887)gTg>gAg	p.V5629E	OBSCN_ENST00000366709.4_Missense_Mutation_p.V2748E|OBSCN_ENST00000570156.2_Missense_Mutation_p.V6586E|OBSCN_ENST00000366707.4_Missense_Mutation_p.V3263E|OBSCN_ENST00000284548.11_Missense_Mutation_p.V5629E	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5629	SH3.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCCAGTATGTGGAGGTCCTG	0.632																																					p.V6586E		Atlas-SNP	.											.	OBSCN	2142	.	0			c.T19757A						.						39.0	40.0	39.0					1																	228525730		2188	4289	6477	SO:0001583	missense	84033	exon78			AGTATGTGGAGGT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16886T>A	chr1.hg19:g.228525730T>A	ENSP00000409493:p.Val5629Glu	64.0	0.0		88.0	43.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.7|25.7	4.663213|4.663213	0.88251|0.88251	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000441106|ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	.|T;T;T;T	.|0.32753	.|1.44;1.44;1.44;1.44	4.35|4.35	4.35|4.35	0.52113|0.52113	.|Src homology-3 domain (2);	.|0.000000	.|0.64402	.|D	.|0.000007	.|T	.|0.51787	.|0.1695	M|M	0.63843|0.63843	1.955|1.955	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.997;0.999	.|T	.|0.55121	.|-0.8190	.|10	.|0.62326	.|D	.|0.03	.|.	13.9922|13.9922	0.64374|0.64374	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|5629;5629	.|Q5VST9;Q5VST9-3	.|OBSCN_HUMAN;.	X|E	244|5629;5629;3263;2748	.|ENSP00000284548:V5629E;ENSP00000409493:V5629E;ENSP00000355668:V3263E;ENSP00000355670:V2748E	.|ENSP00000284548:V5629E	C|V	+|+	3|2	2|0	OBSCN|OBSCN	226592353|226592353	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.669000|0.669000	0.39330|0.39330	7.764000|7.764000	0.85297|0.85297	1.968000|1.968000	0.57251|0.57251	0.402000|0.402000	0.26972|0.26972	TGT|GTG	.	.		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
FMN2	56776	hgsc.bcm.edu	37	1	240601508	240601508	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr1:240601508G>T	ENST00000319653.9	+	16	5288	c.5058G>T	c.(5056-5058)gaG>gaT	p.E1686D	FMN2_ENST00000545751.1_Missense_Mutation_p.E282D	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1686	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TTCTACAAGAGAGGTAGGTAT	0.388																																					p.E1686D		Atlas-SNP	.											FMN2,right_upper_lobe,carcinoma,0,1	FMN2	451	.	0			c.G5058T						.						97.0	97.0	97.0					1																	240601508		2203	4300	6503	SO:0001583	missense	56776	exon16			ACAAGAGAGGTAG	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.5058G>T	chr1.hg19:g.240601508G>T	ENSP00000318884:p.Glu1686Asp	50.0	0.0		81.0	18.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	G	15.09	2.730557	0.48939	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993	T;T	0.53640	0.61;0.61	5.91	0.0799	0.14418	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (2);	0.000000	0.64402	D	0.000009	T	0.62183	0.2407	M	0.73598	2.24	0.80722	D	1	P;D;D	0.76494	0.7;0.999;0.964	B;D;P	0.78314	0.136;0.991;0.766	T	0.61686	-0.7012	10	0.66056	D	0.02	.	8.9729	0.35917	0.5826:0.0:0.4174:0.0	.	282;315;1686	B4DP05;B4DN09;Q9NZ56	.;.;FMN2_HUMAN	D	1686;282;313;162	ENSP00000318884:E1686D;ENSP00000437918:E282D	ENSP00000318884:E1686D	E	+	3	2	FMN2	238668131	0.998000	0.40836	0.999000	0.59377	0.989000	0.77384	0.465000	0.22004	0.103000	0.17682	0.579000	0.79373	GAG	.	.		0.388	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
STON1	11037	hgsc.bcm.edu	37	2	48822410	48822410	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:48822410C>T	ENST00000406226.1	+	5	2372	c.2177C>T	c.(2176-2178)cCa>cTa	p.P726L	STON1-GTF2A1L_ENST00000405008.1_Intron|STON1_ENST00000309835.3_Missense_Mutation_p.P726L|STON1_ENST00000404752.1_Missense_Mutation_p.P726L|STON1-GTF2A1L_ENST00000394754.1_Intron|STON1-GTF2A1L_ENST00000309827.2_Intron|STON1-GTF2A1L_ENST00000402114.2_Intron|STON1-GTF2A1L_ENST00000394751.3_Intron	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	726					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GGAGAAGACCCAGATAAAATT	0.398																																					p.P726L		Atlas-SNP	.											.	STON1	100	.	0			c.C2177T						.						125.0	113.0	117.0					2																	48822410		2203	4300	6503	SO:0001583	missense	11037	exon5			AAGACCCAGATAA	AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.2177C>T	chr2.hg19:g.48822410C>T	ENSP00000384615:p.Pro726Leu	99.0	0.0		100.0	34.0	NM_001198595	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	ENST00000406226.1	hg19	CCDS1841.1	.	.	.	.	.	.	.	.	.	.	C	17.93	3.508112	0.64410	.	.	ENSG00000243244	ENST00000404752;ENST00000406226;ENST00000309835	T;T;T	0.09255	3.0;3.0;3.0	4.9	4.9	0.64082	.	.	.	.	.	T	0.13114	0.0318	L	0.44542	1.39	0.80722	D	1	P	0.37423	0.594	B	0.38562	0.276	T	0.09952	-1.0651	9	0.25751	T	0.34	.	18.2553	0.90017	0.0:1.0:0.0:0.0	.	726	Q9Y6Q2	STON1_HUMAN	L	726	ENSP00000385273:P726L;ENSP00000384615:P726L;ENSP00000310969:P726L	ENSP00000310969:P726L	P	+	2	0	STON1	48675914	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.932000	0.70121	2.551000	0.86045	0.455000	0.32223	CCA	.	.		0.398	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323848.2	NM_006873	
AFTPH	54812	hgsc.bcm.edu	37	2	64808325	64808325	+	Splice_Site	SNP	T	T	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:64808325T>G	ENST00000422803.1	+	8	2771	c.2457T>G	c.(2455-2457)gcT>gcG	p.A819A	AFTPH_ENST00000487769.1_Intron|AFTPH_ENST00000238856.4_Intron|RNU6-100P_ENST00000516605.1_RNA|AFTPH_ENST00000238855.7_Splice_Site_p.A819A|AFTPH_ENST00000409183.1_Splice_Site_p.A450A|AFTPH_ENST00000409933.1_Splice_Site_p.A819A			Q6ULP2	AFTIN_HUMAN	aftiphilin	819					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						AATTTCAAGCTAGTGGAGGTT	0.488																																					p.A819A		Atlas-SNP	.											.	AFTPH	117	.	0			c.T2457G						.						73.0	74.0	73.0					2																	64808325		1938	4149	6087	SO:0001630	splice_region_variant	54812	exon8			TCAAGCTAGTGGA	AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.2456-1T>G	chr2.hg19:g.64808325T>G		59.0	0.0		71.0	18.0	NM_203437	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Silent	SNP	ENST00000422803.1	hg19																																																																																				.	.		0.488	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657	Silent
CTNNA2	1496	hgsc.bcm.edu	37	2	80835353	80835353	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:80835353A>T	ENST00000402739.4	+	16	2345	c.2340A>T	c.(2338-2340)caA>caT	p.Q780H	AC008067.2_ENST00000430876.1_RNA|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000361291.4_Missense_Mutation_p.Q814H|AC008067.2_ENST00000609950.1_RNA|CTNNA2_ENST00000343114.3_Missense_Mutation_p.Q459H|AC008067.2_ENST00000595478.1_RNA|CTNNA2_ENST00000466387.1_Missense_Mutation_p.Q780H|AC008067.2_ENST00000599412.2_RNA|AC008067.2_ENST00000596783.1_RNA|CTNNA2_ENST00000541047.1_Missense_Mutation_p.Q780H|AC008067.2_ENST00000596887.1_RNA|CTNNA2_ENST00000496558.1_Missense_Mutation_p.Q780H	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	780					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CCTACCTTCAACGAATTGCCT	0.408																																					p.Q780H		Atlas-SNP	.											.	CTNNA2	462	.	0			c.A2340T						.						150.0	137.0	141.0					2																	80835353		1905	4152	6057	SO:0001583	missense	1496	exon17			CCTTCAACGAATT		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2340A>T	chr2.hg19:g.80835353A>T	ENSP00000384638:p.Gln780His	52.0	0.0		65.0	32.0	NM_004389	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	hg19		.	.	.	.	.	.	.	.	.	.	A	15.75	2.927006	0.52759	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000343114	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	5.91	1.79	0.24919	.	0.000000	0.85682	D	0.000000	T	0.63153	0.2487	M	0.85630	2.765	0.80722	D	1	P;D;D	0.76494	0.941;0.999;0.991	P;D;D	0.77004	0.881;0.989;0.952	T	0.62015	-0.6943	9	.	.	.	.	9.5992	0.39593	0.4804:0.0:0.5196:0.0	.	412;780;780	F6KRI5;P26232;P26232-2	.;CTNA2_HUMAN;.	H	780;780;814;780;780;459	ENSP00000418191:Q780H;ENSP00000419295:Q780H;ENSP00000355398:Q814H;ENSP00000384638:Q780H;ENSP00000444675:Q780H;ENSP00000341500:Q459H	.	Q	+	3	2	CTNNA2	80688864	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	1.799000	0.38824	0.059000	0.16252	-0.261000	0.10672	CAA	.	.		0.408	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
DPP10	57628	hgsc.bcm.edu	37	2	116525977	116525977	+	Silent	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:116525977C>T	ENST00000410059.1	+	13	1698	c.1218C>T	c.(1216-1218)atC>atT	p.I406I	DPP10_ENST00000393147.2_Silent_p.I410I|DPP10_ENST00000310323.8_Silent_p.I399I|DPP10_ENST00000409163.1_Silent_p.I356I	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	406						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						TGTTCCTCATCCAGGTAAGTG	0.473																																					p.I410I		Atlas-SNP	.											.	DPP10	415	.	0			c.C1230T						.						128.0	123.0	125.0					2																	116525977		2203	4300	6503	SO:0001819	synonymous_variant	57628	exon13			CCTCATCCAGGTA	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1218C>T	chr2.hg19:g.116525977C>T		59.0	0.0		81.0	25.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Silent	SNP	ENST00000410059.1	hg19	CCDS46400.1																																																																																			.	.		0.473	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
MAP3K2	10746	hgsc.bcm.edu	37	2	128096589	128096589	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:128096589C>A	ENST00000409947.1	-	3	324	c.42G>T	c.(40-42)ttG>ttT	p.L14F	MAP3K2_ENST00000344908.5_Missense_Mutation_p.L14F			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	14					activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	GAAGGACAGCCAAATCTTGCA	0.338																																					p.L14F		Atlas-SNP	.											.	MAP3K2	78	.	0			c.G42T						.						104.0	97.0	99.0					2																	128096589		1854	4092	5946	SO:0001583	missense	10746	exon2			GACAGCCAAATCT	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.42G>T	chr2.hg19:g.128096589C>A	ENSP00000387246:p.Leu14Phe	239.0	0.0		296.0	91.0	NM_006609	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	hg19	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	C	34	5.343348	0.95783	.	.	ENSG00000169967	ENST00000409947;ENST00000344908;ENST00000409179	T;T	0.77229	-1.08;-1.08	6.11	6.11	0.99139	.	0.000000	0.85682	D	0.000000	D	0.88459	0.6442	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.88123	0.2833	10	0.87932	D	0	.	20.3293	0.98710	0.0:1.0:0.0:0.0	.	14	Q9Y2U5	M3K2_HUMAN	F	14	ENSP00000387246:L14F;ENSP00000343463:L14F	ENSP00000343463:L14F	L	-	3	2	MAP3K2	127813059	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.318000	0.65829	2.906000	0.99361	0.655000	0.94253	TTG	.	.		0.338	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609	
TANC1	85461	hgsc.bcm.edu	37	2	160050974	160050974	+	Silent	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:160050974G>A	ENST00000263635.6	+	17	3186	c.2949G>A	c.(2947-2949)ctG>ctA	p.L983L	TANC1_ENST00000454300.1_Silent_p.L877L	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	983					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						ACATGAAGCTGGTGTGTCTGC	0.542																																					p.L983L		Atlas-SNP	.											.	TANC1	157	.	0			c.G2949A						.						63.0	68.0	66.0					2																	160050974		2117	4230	6347	SO:0001819	synonymous_variant	85461	exon17			GAAGCTGGTGTGT	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2949G>A	chr2.hg19:g.160050974G>A		61.0	0.0		91.0	25.0	NM_033394	C9JD88|Q49AI8	Silent	SNP	ENST00000263635.6	hg19	CCDS42766.1																																																																																			.	.		0.542	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
KIAA1715	80856	hgsc.bcm.edu	37	2	176802102	176802102	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:176802102C>A	ENST00000272748.4	-	12	1271	c.1024G>T	c.(1024-1026)Gtg>Ttg	p.V342L	KIAA1715_ENST00000544803.1_Missense_Mutation_p.V373L|KIAA1715_ENST00000535310.1_Missense_Mutation_p.V267L	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	342					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			GATGAAAGCACACTTCCTGAT	0.393																																					p.V342L		Atlas-SNP	.											.	KIAA1715	61	.	0			c.G1024T						.						116.0	110.0	112.0					2																	176802102		2203	4300	6503	SO:0001583	missense	80856	exon12			AAAGCACACTTCC	AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.1024G>T	chr2.hg19:g.176802102C>A	ENSP00000272748:p.Val342Leu	116.0	0.0		137.0	55.0	NM_030650	B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	ENST00000272748.4	hg19	CCDS33332.1	.	.	.	.	.	.	.	.	.	.	C	11.02	1.514965	0.27123	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803;ENST00000535310	.	.	.	5.31	-6.55	0.01854	.	1.488990	0.03628	N	0.237413	T	0.28962	0.0719	L	0.41236	1.265	0.09310	N	1	B;B;B;B	0.28850	0.225;0.001;0.144;0.0	B;B;B;B	0.23574	0.047;0.001;0.021;0.0	T	0.39461	-0.9613	9	0.87932	D	0	1.542	5.2422	0.15477	0.2154:0.3475:0.0:0.4371	.	344;373;339;342	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	L	342;344;219;373;267	.	ENSP00000272748:V342L	V	-	1	0	KIAA1715	176510348	.	.	0.903000	0.35520	0.791000	0.44710	.	.	-0.688000	0.05155	-0.469000	0.05056	GTG	.	.		0.393	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333949.3	XM_042834	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098966	178098966	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:178098966C>A	ENST00000397062.3	-	2	633	c.79G>T	c.(79-81)Gat>Tat	p.D27Y	NFE2L2_ENST00000397063.4_Missense_Mutation_p.D11Y|NFE2L2_ENST00000423513.1_Missense_Mutation_p.D11Y|NFE2L2_ENST00000446151.2_Missense_Mutation_p.D11Y|NFE2L2_ENST00000464747.1_Missense_Mutation_p.D11Y	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	27					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D27Y(1)|p.D27H(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			AGATCTATATCTTGCCTCCAA	0.353			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.D27Y		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,0,2	NFE2L2	225	.	2	Substitution - Missense(2)	lung(1)|oesophagus(1)	c.G79T						.						62.0	55.0	57.0					2																	178098966		1843	4100	5943	SO:0001583	missense	4780	exon2			CTATATCTTGCCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.79G>T	chr2.hg19:g.178098966C>A	ENSP00000380252:p.Asp27Tyr	39.0	0.0		39.0	18.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.042196	0.75732	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.32023	1.47;1.47;1.47;1.47;1.47;1.47;1.47	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.999;0.999	T	0.69087	-0.5238	10	0.87932	D	0	.	19.9976	0.97389	0.0:1.0:0.0:0.0	.	11;11;11;27	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	Y	11;27;11;11;11;11;11	ENSP00000380253:D11Y;ENSP00000380252:D27Y;ENSP00000411575:D11Y;ENSP00000391590:D11Y;ENSP00000400073:D11Y;ENSP00000412191:D11Y;ENSP00000410015:D11Y	ENSP00000380252:D27Y	D	-	1	0	NFE2L2	177807212	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.487000	0.81328	2.737000	0.93849	0.563000	0.77884	GAT	.	.		0.353	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
SF3B1	23451	hgsc.bcm.edu	37	2	198260907	198260907	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:198260907C>G	ENST00000335508.6	-	23	3503	c.3412G>C	c.(3412-3414)Gtt>Ctt	p.V1138L		NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	1138					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)			NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			AGTTCAGGAACTCTGTATTCA	0.378			Mis		myelodysplastic syndrome																																p.V1138L		Atlas-SNP	.		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	.	SF3B1	1038	.	0			c.G3412C						.						171.0	163.0	166.0					2																	198260907		2203	4300	6503	SO:0001583	missense	23451	exon23			CAGGAACTCTGTA	AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.3412G>C	chr2.hg19:g.198260907C>G	ENSP00000335321:p.Val1138Leu	231.0	0.0		267.0	98.0	NM_012433	E9PCH3	Missense_Mutation	SNP	ENST00000335508.6	hg19	CCDS33356.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.65|19.65	3.867363|3.867363	0.72065|0.72065	.|.	.|.	ENSG00000115524|ENSG00000115524	ENST00000424674|ENST00000335508	.|.	.|.	.|.	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.71719|0.71719	0.3373|0.3373	M|M	0.70842|0.70842	2.15|2.15	0.80722|0.80722	D|D	1|1	.|B	.|0.24317	.|0.101	.|B	.|0.30646	.|0.118	T|T	0.68288|0.68288	-0.5448|-0.5448	5|9	.|0.56958	.|D	.|0.05	.|.	20.3539|20.3539	0.98825|0.98825	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1138	.|O75533	.|SF3B1_HUMAN	D|L	153|1138	.|.	.|ENSP00000335321:V1138L	E|V	-|-	3|1	2|0	SF3B1|SF3B1	197969152|197969152	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.743000|7.743000	0.85020|0.85020	2.826000|2.826000	0.97356|0.97356	0.655000|0.655000	0.94253|0.94253	GAG|GTT	.	.		0.378	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335245.2		
SP140	11262	hgsc.bcm.edu	37	2	231109774	231109774	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:231109774A>T	ENST00000392045.3	+	6	757	c.643A>T	c.(643-645)Agc>Tgc	p.S215C	SP140_ENST00000420434.3_Missense_Mutation_p.S215C|SP140_ENST00000417495.3_Missense_Mutation_p.S215C|SP140_ENST00000350136.5_Missense_Mutation_p.S195C|SP140_ENST00000343805.6_Missense_Mutation_p.S215C|SP140_ENST00000486687.2_Missense_Mutation_p.S215C	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	215					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		AGATGCACCCAGCCTACTACC	0.443																																					p.S215C		Atlas-SNP	.											.	SP140	121	.	0			c.A643T						.						116.0	108.0	111.0					2																	231109774		1933	4144	6077	SO:0001583	missense	11262	exon6			GCACCCAGCCTAC	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.643A>T	chr2.hg19:g.231109774A>T	ENSP00000375899:p.Ser215Cys	41.0	0.0		59.0	21.0	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Missense_Mutation	SNP	ENST00000392045.3	hg19	CCDS42831.1	.	.	.	.	.	.	.	.	.	.	A	12.10	1.837542	0.32513	.	.	ENSG00000079263	ENST00000486687;ENST00000392044;ENST00000350136;ENST00000392045;ENST00000417495;ENST00000343805;ENST00000420434	T;T;T;T;T	0.58797	0.55;0.75;0.61;0.31;0.54	2.59	0.15	0.14883	.	.	.	.	.	T	0.52821	0.1758	L	0.27053	0.805	0.09310	N	1	D;D;D;D;D	0.69078	0.989;0.987;0.992;0.997;0.987	P;B;P;P;P	0.61328	0.712;0.334;0.668;0.887;0.468	T	0.41088	-0.9528	9	0.30078	T	0.28	-0.4504	4.578	0.12243	0.6921:0.0:0.3079:0.0	.	215;215;215;215;215	E7EUR5;E7ESH9;E9PFJ6;Q13342;E7EX75	.;.;.;LY10_HUMAN;.	C	215;215;195;215;215;215;215	ENSP00000440107:S215C;ENSP00000345846:S195C;ENSP00000375899:S215C;ENSP00000342096:S215C;ENSP00000398210:S215C	ENSP00000342096:S215C	S	+	1	0	SP140	230818018	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.064000	0.14437	0.026000	0.15269	0.523000	0.50628	AGC	.	.		0.443	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
CHRND	1144	hgsc.bcm.edu	37	2	233393032	233393032	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr2:233393032C>G	ENST00000258385.3	+	4	336	c.304C>G	c.(304-306)Cgc>Ggc	p.R102G	CHRND_ENST00000457943.2_Missense_Mutation_p.C11W|CHRND_ENST00000543200.1_Missense_Mutation_p.R87G|CHRND_ENST00000536614.1_Missense_Mutation_p.R102G	NM_000751.2	NP_000742.1	Q07001	ACHD_HUMAN	cholinergic receptor, nicotinic, delta (muscle)	102					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|musculoskeletal movement (GO:0050881)|neuromuscular process (GO:0050905)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)	34		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)	Galantamine(DB00674)	CAGTGTCCTGCGCCTCCCCCC	0.577																																					p.R102G		Atlas-SNP	.											.	CHRND	67	.	0			c.C304G						.						118.0	115.0	116.0					2																	233393032		2203	4300	6503	SO:0001583	missense	1144	exon4			GTCCTGCGCCTCC	X55019	CCDS2494.1, CCDS58754.1	2q37.1	2012-02-11	2012-02-07		ENSG00000135902	ENSG00000135902		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1965	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, delta (muscle)"""	100720	"""cholinergic receptor, nicotinic, delta"""	ACHRD			Standard	NM_000751		Approved		uc002vsw.4	Q07001	OTTHUMG00000133261	ENST00000258385.3:c.304C>G	chr2.hg19:g.233393032C>G	ENSP00000258385:p.Arg102Gly	64.0	0.0		65.0	24.0	NM_000751	A8K661|B4DT92|Q52LH4	Missense_Mutation	SNP	ENST00000258385.3	hg19	CCDS2494.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.25|13.25	2.181467|2.181467	0.38511|0.38511	.|.	.|.	ENSG00000135902|ENSG00000135902	ENST00000457943|ENST00000449596;ENST00000543200;ENST00000258385;ENST00000536614	D|T;T;T;T	0.87809|0.80738	-2.3|-1.41;-1.41;-1.41;-1.41	4.4|4.4	3.52|3.52	0.40303|0.40303	.|Neurotransmitter-gated ion-channel ligand-binding (3);	.|0.225845	.|0.44902	.|D	.|0.000415	D|D	0.89550|0.89550	0.6747|0.6747	M|M	0.90198|0.90198	3.095|3.095	0.42608|0.42608	D|D	0.993302|0.993302	P|D;D	0.52463|0.89917	0.953|1.0;1.0	P|D;D	0.44990|0.97110	0.466|0.999;1.0	D|D	0.89562|0.89562	0.3807|0.3807	9|10	0.38643|0.87932	T|D	0.18|0	.|.	7.6629|7.6629	0.28413|0.28413	0.1622:0.7547:0.0:0.0831|0.1622:0.7547:0.0:0.0831	.|.	11|87;102	B4E3W4|B4DT92;Q07001	.|.;ACHD_HUMAN	W|G	11|87;87;102;102	ENSP00000391055:C11W|ENSP00000404950:R87G;ENSP00000438380:R87G;ENSP00000258385:R102G;ENSP00000437740:R102G	ENSP00000391055:C11W|ENSP00000258385:R102G	C|R	+|+	3|1	2|0	CHRND|CHRND	233101276|233101276	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.923000|0.923000	0.55619|0.55619	5.491000|5.491000	0.66887|0.66887	1.216000|1.216000	0.43427|0.43427	0.561000|0.561000	0.74099|0.74099	TGC|CGC	.	.		0.577	CHRND-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257038.2		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266136	41266136	+	Missense_Mutation	SNP	T	T	C	rs121913407		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr3:41266136T>C	ENST00000349496.5	+	3	413	c.133T>C	c.(133-135)Tct>Cct	p.S45P	CTNNB1_ENST00000453024.1_Missense_Mutation_p.S38P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S45P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S45P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S45P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	45			Missing (in colorectal cancer). {ECO:0000269|PubMed:9065402}.|S -> F (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> P (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S45P(168)|p.A5_A80del(53)|p.S45del(50)|p.S45A(11)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.D32_S47del(2)|p.P44_S45del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.S45_G48del(1)|p.Q28_Q61del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.S45_L46del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.P44_N51del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.T42_G48del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.T40_L46del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.S45E(1)|p.M8_A80del(1)|p.A5_E54del(1)|p.S45T(1)|p.A21_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.T42_K49>Q(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CACAGCTCCTTCTCTGAGTGG	0.502		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S45P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	355	Substitution - Missense(181)|Deletion - In frame(149)|Complex - deletion inframe(18)|Unknown(7)	liver(151)|kidney(53)|soft_tissue(47)|large_intestine(37)|adrenal_gland(28)|endometrium(9)|stomach(7)|skin(6)|pituitary(3)|prostate(3)|thyroid(2)|small_intestine(2)|bone(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)	c.T133C						.						84.0	74.0	78.0					3																	41266136		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCTCCTTCTCTGA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.133T>C	chr3.hg19:g.41266136T>C	ENSP00000344456:p.Ser45Pro	93.0	1.0		121.0	48.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.440246	0.83993	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.65903	0.2736	M	0.65677	2.01	0.80722	D	1	D	0.60575	0.988	P	0.62649	0.905	T	0.69083	-0.5239	10	0.87932	D	0	-13.6823	16.3453	0.83126	0.0:0.0:0.0:1.0	.	45	P35222	CTNB1_HUMAN	P	38;45;45;45;45;38;45;45;45	ENSP00000400508:S38P;ENSP00000385604:S45P;ENSP00000412219:S45P;ENSP00000379486:S45P;ENSP00000344456:S45P;ENSP00000411226:S38P;ENSP00000379488:S45P;ENSP00000409302:S45P;ENSP00000401599:S45P	ENSP00000344456:S45P	S	+	1	0	CTNNB1	41241140	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.261000	0.74972	0.533000	0.62120	TCT	.	.		0.502	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
ERC2	26059	hgsc.bcm.edu	37	3	55768826	55768826	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr3:55768826G>C	ENST00000288221.6	-	15	2940	c.2685C>G	c.(2683-2685)gaC>gaG	p.D895E		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	895						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		GTACTAGTCGGTCTTTTTCCC	0.483																																					p.D893E		Atlas-SNP	.											.	ERC2	221	.	0			c.C2679G						.						107.0	101.0	103.0					3																	55768826		1872	4113	5985	SO:0001583	missense	26059	exon14			TAGTCGGTCTTTT	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2685C>G	chr3.hg19:g.55768826G>C	ENSP00000288221:p.Asp895Glu	79.0	0.0		126.0	44.0	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	hg19	CCDS46851.1	.	.	.	.	.	.	.	.	.	.	G	18.36	3.607851	0.66558	.	.	ENSG00000187672	ENST00000288221	T	0.46063	0.88	5.67	1.64	0.23874	.	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	L	0.39245	1.2	0.42923	D	0.99429	D	0.63046	0.992	D	0.74348	0.983	T	0.28586	-1.0039	10	0.35671	T	0.21	-18.2625	7.9495	0.30006	0.3723:0.0:0.6277:0.0	.	895	O15083	ERC2_HUMAN	E	895	ENSP00000288221:D895E	ENSP00000288221:D895E	D	-	3	2	ERC2	55743866	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	3.536000	0.53582	-0.005000	0.14395	-0.140000	0.14226	GAC	.	.		0.483	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
TOMM70A	9868	hgsc.bcm.edu	37	3	100105787	100105787	+	Silent	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr3:100105787T>C	ENST00000284320.5	-	2	808	c.360A>G	c.(358-360)aaA>aaG	p.K120K		NM_014820.4	NP_055635.3	O94826	TOM70_HUMAN	translocase of outer mitochondrial membrane 70 homolog A (S. cerevisiae)	120					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)|protein transmembrane transport (GO:0071806)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)	protein transmembrane transporter activity (GO:0008320)			endometrium(11)|large_intestine(5)|lung(10)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	32						ATTTATTGCCTTTATTCTTGG	0.363																																					p.K120K		Atlas-SNP	.											.	TOMM70A	65	.	0			c.A360G						.						109.0	103.0	105.0					3																	100105787		2203	4300	6503	SO:0001819	synonymous_variant	9868	exon2			ATTGCCTTTATTC	AB018262	CCDS33807.1	3q12.2	2013-01-10	2006-04-04		ENSG00000154174	ENSG00000154174		"""Tetratricopeptide (TTC) repeat domain containing"""	11985	protein-coding gene	gene with protein product		606081	"""translocase of outer mitochondrial membrane 70 (yeast) homolog A"", ""translocase of outer mitochondrial membrane 70 homolog A (yeast)"""			10582581	Standard	NM_014820		Approved	KIAA0719	uc003dtw.3	O94826	OTTHUMG00000159065	ENST00000284320.5:c.360A>G	chr3.hg19:g.100105787T>C		107.0	0.0		124.0	38.0	NM_014820	D3DN48	Silent	SNP	ENST00000284320.5	hg19	CCDS33807.1																																																																																			.	.		0.363	TOMM70A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353141.2		
ARHGAP31	57514	hgsc.bcm.edu	37	3	119133155	119133155	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr3:119133155G>C	ENST00000264245.4	+	12	2911	c.2379G>C	c.(2377-2379)gaG>gaC	p.E793D		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	793					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CTCTGGAGGAGTCAACTCCAG	0.542																																					p.E793D	Pancreas(7;176 297 5394 51128 51241)	Atlas-SNP	.											.	ARHGAP31	175	.	0			c.G2379C						.						53.0	56.0	55.0					3																	119133155		1902	4115	6017	SO:0001583	missense	57514	exon12			GGAGGAGTCAACT		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2379G>C	chr3.hg19:g.119133155G>C	ENSP00000264245:p.Glu793Asp	82.0	0.0		103.0	43.0	NM_020754	Q9ULL6	Missense_Mutation	SNP	ENST00000264245.4	hg19	CCDS43135.1	.	.	.	.	.	.	.	.	.	.	G	12.98	2.101087	0.37048	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.07114	3.22	4.97	4.09	0.47781	.	0.466255	0.20808	N	0.085310	T	0.08846	0.0219	L	0.32530	0.975	0.41159	D	0.986081	D	0.56521	0.976	P	0.47206	0.541	T	0.01643	-1.1305	10	0.66056	D	0.02	.	7.9834	0.30196	0.0861:0.0:0.752:0.1619	.	793	Q2M1Z3	RHG31_HUMAN	D	793	ENSP00000264245:E793D	ENSP00000264245:E793D	E	+	3	2	ARHGAP31	120615845	0.254000	0.23992	0.971000	0.41717	0.160000	0.22226	0.435000	0.21510	2.757000	0.94681	0.655000	0.94253	GAG	.	.		0.542	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
ATR	545	hgsc.bcm.edu	37	3	142278092	142278092	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr3:142278092C>A	ENST00000350721.4	-	7	1854		c.e7+1		ATR_ENST00000383101.3_Splice_Site	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						TTTGTACTCACCTTGCATATA	0.353								Other conserved DNA damage response genes																													.		Atlas-SNP	.											.	ATR	285	.	0			c.1732+1G>T						.						79.0	79.0	79.0					3																	142278092		2203	4300	6503	SO:0001630	splice_region_variant	545	exon8			TACTCACCTTGCA	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1732+1G>T	chr3.hg19:g.142278092C>A		144.0	0.0		177.0	59.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Splice_Site	SNP	ENST00000350721.4	hg19	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860451	0.71834	.	.	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5553	0.91081	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATR	143760782	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.038000	0.64177	2.817000	0.96982	0.563000	0.77884	.	.	.		0.353	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	Intron
DHX15	1665	hgsc.bcm.edu	37	4	24531339	24531339	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr4:24531339C>T	ENST00000336812.4	-	13	2311	c.2155G>A	c.(2155-2157)Gtt>Att	p.V719I	DHX15_ENST00000508032.1_5'UTR	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	719					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				TGCAACTGAACCACCTGGTTA	0.388																																					p.V719I		Atlas-SNP	.											.	DHX15	69	.	0			c.G2155A						.						158.0	145.0	149.0					4																	24531339		2203	4300	6503	SO:0001583	missense	1665	exon13			ACTGAACCACCTG	AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.2155G>A	chr4.hg19:g.24531339C>T	ENSP00000336741:p.Val719Ile	147.0	0.0		141.0	40.0	NM_001358	Q9NQT7	Missense_Mutation	SNP	ENST00000336812.4	hg19	CCDS33966.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963405	0.92791	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	T	0.03772	3.81	5.83	4.96	0.65561	Domain of unknown function DUF1605 (1);	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	M	0.91249	3.19	0.80722	D	1	D;D;D	0.58268	0.982;0.982;0.977	D;D;D	0.91635	0.999;0.999;0.998	T	0.13845	-1.0494	10	0.87932	D	0	-19.199	17.0234	0.86440	0.0:0.8733:0.1267:0.0	.	719;708;708	O43143;B4E0S6;F5H6K0	DHX15_HUMAN;.;.	I	719;708	ENSP00000336741:V719I	ENSP00000336741:V719I	V	-	1	0	DHX15	24140437	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.426000	0.80270	2.749000	0.94314	0.650000	0.86243	GTT	.	.		0.388	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360143.1	NM_001358	
TBCK	93627	hgsc.bcm.edu	37	4	107133975	107133975	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr4:107133975A>T	ENST00000273980.5	-	21	2239	c.1792T>A	c.(1792-1794)Tct>Act	p.S598T	TBCK_ENST00000514689.1_5'UTR|TBCK_ENST00000394708.2_Missense_Mutation_p.S598T|TBCK_ENST00000394706.3_Missense_Mutation_p.S559T|TBCK_ENST00000361687.4_Missense_Mutation_p.S535T|TBCK_ENST00000432496.2_Missense_Mutation_p.S598T					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						ATCATCTGAGAGAAGACAGTC	0.323																																					p.S598T		Atlas-SNP	.											.	TBCK	89	.	0			c.T1792A						.						135.0	142.0	139.0					4																	107133975		2203	4299	6502	SO:0001583	missense	93627	exon20			TCTGAGAGAAGAC		CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.1792T>A	chr4.hg19:g.107133975A>T	ENSP00000273980:p.Ser598Thr	344.0	0.0		406.0	126.0	NM_001163436		Missense_Mutation	SNP	ENST00000273980.5	hg19	CCDS54788.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228967	0.79688	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.11385	2.78;2.78;2.78;2.78;2.78	5.25	5.25	0.73442	Rab-GAP/TBC domain (5);	0.000000	0.85682	D	0.000000	T	0.33847	0.0877	M	0.78637	2.42	0.80722	D	1	D;D;D	0.76494	0.987;0.999;0.995	D;D;D	0.85130	0.926;0.997;0.966	T	0.04811	-1.0925	10	0.35671	T	0.21	.	15.4434	0.75208	1.0:0.0:0.0:0.0	.	598;559;535	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	T	598;598;535;559;598	ENSP00000273980:S598T;ENSP00000405847:S598T;ENSP00000355338:S535T;ENSP00000378196:S559T;ENSP00000378198:S598T	ENSP00000273980:S598T	S	-	1	0	TBCK	107353424	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.798000	0.91888	2.105000	0.64084	0.402000	0.26972	TCT	.	.		0.323	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253953.4	NM_033115	
ANK2	287	hgsc.bcm.edu	37	4	114276434	114276434	+	Silent	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr4:114276434G>A	ENST00000357077.4	+	38	6713	c.6660G>A	c.(6658-6660)gaG>gaA	p.E2220E	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Silent_p.E2187E	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2220					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCCTGATGGAGGGGACCCCTC	0.507																																					p.E2220E		Atlas-SNP	.											.	ANK2	576	.	0			c.G6660A						.						63.0	67.0	66.0					4																	114276434		2203	4299	6502	SO:0001819	synonymous_variant	287	exon38			GATGGAGGGGACC	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.6660G>A	chr4.hg19:g.114276434G>A		103.0	0.0		121.0	56.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	ENST00000357077.4	hg19	CCDS3702.1																																																																																			.	.		0.507	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
MAP9	79884	hgsc.bcm.edu	37	4	156294546	156294546	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr4:156294546C>T	ENST00000311277.4	-	4	486	c.223G>A	c.(223-225)Gac>Aac	p.D75N	MAP9_ENST00000379248.2_Missense_Mutation_p.D3N|MAP9_ENST00000515654.1_Missense_Mutation_p.D75N|AC097467.2_ENST00000596165.1_RNA	NM_001039580.1	NP_001034669.1	Q49MG5	MAP9_HUMAN	microtubule-associated protein 9	75					cytokinesis (GO:0000910)|regulation of mitosis (GO:0007088)|spindle assembly involved in mitosis (GO:0090307)	astral microtubule (GO:0000235)|mitotic spindle midzone (GO:1990023)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.143)		ATATGAAAGTCATTCATTTTT	0.284																																					p.D75N		Atlas-SNP	.											.	MAP9	79	.	0			c.G223A						.						42.0	44.0	43.0					4																	156294546		2201	4299	6500	SO:0001583	missense	79884	exon4			GAAAGTCATTCAT	AK024812	CCDS35493.1	4q32.1	2008-02-05			ENSG00000164114	ENSG00000164114			26118	protein-coding gene	gene with protein product	"""aster-associated protein"""	610070				16049101	Standard	XM_006714306		Approved	ASAP, FLJ21159	uc003ios.3	Q49MG5	OTTHUMG00000133628	ENST00000311277.4:c.223G>A	chr4.hg19:g.156294546C>T	ENSP00000310593:p.Asp75Asn	69.0	0.0		67.0	29.0	NM_001039580	Q4W5I7|Q68DU1|Q9H781|Q9H7B6	Missense_Mutation	SNP	ENST00000311277.4	hg19	CCDS35493.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.908378	0.33721	.	.	ENSG00000164114	ENST00000311277;ENST00000515654;ENST00000433024;ENST00000393836;ENST00000379248	T;T;T;T	0.09163	3.01;3.01;3.01;3.01	5.96	4.24	0.50183	.	0.302802	0.29900	N	0.010904	T	0.07098	0.0180	L	0.29908	0.895	0.39412	D	0.966767	B;P;B;B	0.45474	0.36;0.859;0.197;0.197	B;B;B;B	0.38458	0.139;0.274;0.062;0.062	T	0.40496	-0.9560	10	0.25751	T	0.34	-19.153	8.2369	0.31631	0.0:0.8262:0.0:0.1738	.	75;3;75;75	B4DVG9;A8MSM7;B9EJB6;Q49MG5	.;.;.;MAP9_HUMAN	N	75;75;75;75;3	ENSP00000310593:D75N;ENSP00000427402:D75N;ENSP00000394048:D75N;ENSP00000368550:D3N	ENSP00000310593:D75N	D	-	1	0	MAP9	156513996	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	1.397000	0.34543	1.540000	0.49301	0.650000	0.86243	GAC	.	.		0.284	MAP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257771.3	NM_001039580	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33546183	33546183	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr5:33546183G>T	ENST00000504830.1	-	22	4762	c.4427C>A	c.(4426-4428)gCc>gAc	p.A1476D	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.A1391D	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1476	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GTTCCCAGTGGCCCAGTGACA	0.438										HNSCC(64;0.19)																											p.A1476D		Atlas-SNP	.											.	ADAMTS12	464	.	0			c.C4427A						.						118.0	104.0	108.0					5																	33546183		2203	4300	6503	SO:0001583	missense	81792	exon22			CCAGTGGCCCAGT	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4427C>A	chr5.hg19:g.33546183G>T	ENSP00000422554:p.Ala1476Asp	254.0	0.0		292.0	87.0	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	hg19	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	G	12.55	1.971821	0.34754	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.60797	0.16;0.16	5.36	1.05	0.20165	.	0.678921	0.15277	N	0.270899	T	0.53594	0.1806	L	0.47016	1.485	0.58432	D	0.999999	P;P	0.44429	0.835;0.78	P;P	0.49387	0.474;0.609	T	0.46693	-0.9173	10	0.38643	T	0.18	.	6.0968	0.20025	0.4981:0.0:0.5019:0.0	.	1391;1476	P58397-3;P58397	.;ATS12_HUMAN	D	1476;1391	ENSP00000422554:A1476D;ENSP00000344847:A1391D	ENSP00000344847:A1391D	A	-	2	0	ADAMTS12	33581940	0.001000	0.12720	0.995000	0.50966	0.794000	0.44872	0.333000	0.19768	0.277000	0.22141	-0.136000	0.14681	GCC	.	.		0.438	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
CATSPER3	347732	hgsc.bcm.edu	37	5	134332010	134332010	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr5:134332010G>T	ENST00000282611.6	+	3	386	c.300G>T	c.(298-300)atG>atT	p.M100I		NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	100					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGTTGTCCATGAAGGTCTATG	0.498																																					p.M100I		Atlas-SNP	.											.	CATSPER3	38	.	0			c.G300T						.						250.0	202.0	218.0					5																	134332010		2203	4300	6503	SO:0001583	missense	347732	exon3			GTCCATGAAGGTC	AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.300G>T	chr5.hg19:g.134332010G>T	ENSP00000282611:p.Met100Ile	50.0	0.0		45.0	12.0	NM_178019	Q86XS6	Missense_Mutation	SNP	ENST00000282611.6	hg19	CCDS4181.1	.	.	.	.	.	.	.	.	.	.	G	3.571	-0.087564	0.07097	.	.	ENSG00000152705	ENST00000282611	D	0.98105	-4.72	4.14	1.2	0.21068	Ion transport (1);	0.319638	0.27912	N	0.017350	D	0.92763	0.7699	N	0.22421	0.69	0.28707	N	0.903763	B	0.21520	0.057	B	0.20955	0.032	D	0.86640	0.1891	10	0.39692	T	0.17	-21.4185	7.3255	0.26553	0.0:0.356:0.4605:0.1834	.	100	Q86XQ3	CTSR3_HUMAN	I	100	ENSP00000282611:M100I	ENSP00000282611:M100I	M	+	3	0	CATSPER3	134359909	0.999000	0.42202	0.742000	0.31022	0.008000	0.06430	0.525000	0.22956	0.241000	0.21283	0.561000	0.74099	ATG	.	.		0.498	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251191.2	NM_178019	
HLA-A	3105	hgsc.bcm.edu	37	6	29911183	29911183	+	Missense_Mutation	SNP	A	A	C	rs72555400		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr6:29911183A>C	ENST00000396634.1	+	5	823	c.482A>C	c.(481-483)gAc>gCc	p.D161A	HLA-A_ENST00000376809.5_Missense_Mutation_p.D161A|HLA-A_ENST00000376802.2_Missense_Mutation_p.D161A|HLA-A_ENST00000376806.5_Missense_Mutation_p.D161A			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	161	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)	p.D161A(1)		central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						ACCGCGGCGGACATGGCGGCT	0.672									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																											p.D161A		Atlas-SNP	.											HLA-A,rectum,carcinoma,0,1	HLA-A	89	.	1	Substitution - Missense(1)	large_intestine(1)	c.A482C						.						43.0	31.0	35.0					6																	29911183		1506	2708	4214	SO:0001583	missense	3105	exon3	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	CGGCGGACATGGC	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.482A>C	chr6.hg19:g.29911183A>C	ENSP00000379873:p.Asp161Ala	120.0	2.0		235.0	12.0	NM_001242758	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Missense_Mutation	SNP	ENST00000396634.1	hg19	CCDS34373.1	.	.	.	.	.	.	.	.	.	.	.	3.022	-0.201625	0.06219	.	.	ENSG00000206503	ENST00000396634;ENST00000376806;ENST00000376809;ENST00000376802	T;T;T;T	0.00011	9.34;9.34;9.34;9.34	3.78	1.3	0.21679	MHC class I, alpha chain, alpha1/alpha2 (4);MHC classes I/II-like antigen recognition protein (4);MHC class I-like antigen recognition (4);	0.000000	0.37623	U	0.002003	T	0.00210	0.0006	H	0.97365	3.99	0.09310	N	1	B;B;D;B;B;B;B	0.71674	0.0;0.02;0.998;0.001;0.0;0.036;0.007	B;B;D;B;B;B;B	0.87578	0.001;0.025;0.998;0.008;0.004;0.041;0.025	T	0.42582	-0.9443	10	0.87932	D	0	.	3.8027	0.08764	0.6588:0.2215:0.1197:0.0	.	40;161;161;161;161;161;161	B4DVB9;P13746;Q5SRN7;P16188;Q5SRN5;P30455;P04439	.;1A11_HUMAN;.;1A30_HUMAN;.;1A36_HUMAN;1A03_HUMAN	A	161	ENSP00000379873:D161A;ENSP00000366002:D161A;ENSP00000366005:D161A;ENSP00000365998:D161A	ENSP00000365998:D161A	D	+	2	0	HLA-A	30019162	0.000000	0.05858	0.014000	0.15608	0.192000	0.23643	-0.054000	0.11826	0.164000	0.19529	0.397000	0.26171	GAC	.	.		0.672	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252909.1	NM_002116	
COL11A2	1302	hgsc.bcm.edu	37	6	33145004	33145004	+	Splice_Site	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr6:33145004T>C	ENST00000374708.4	-	22	1972		c.e22-2		COL11A2_ENST00000374713.1_Splice_Site|COL11A2_ENST00000374712.1_Splice_Site|COL11A2_ENST00000395197.1_Splice_Site|COL11A2_ENST00000357486.1_Splice_Site|COL11A2_ENST00000374714.1_Splice_Site|COL11A2_ENST00000477772.1_Splice_Site|COL11A2_ENST00000341947.2_Splice_Site|COL11A2_ENST00000361917.1_Splice_Site	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2						cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GGGAAGACCCTACATACAGGG	0.547																																					.	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											.	COL11A2	124	.	0			c.1714-2A>G						.						42.0	50.0	47.0					6																	33145004		1507	2706	4213	SO:0001630	splice_region_variant	1302	exon23			AGACCCTACATAC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1714-2A>G	chr6.hg19:g.33145004T>C		69.0	0.0		132.0	72.0	NM_080681	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Splice_Site	SNP	ENST00000374708.4	hg19	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	T	11.73	1.726066	0.30593	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917;ENST00000395196	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.5266	0.39169	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL11A2	33252982	1.000000	0.71417	0.953000	0.39169	0.287000	0.27160	6.195000	0.72088	1.755000	0.51935	0.523000	0.50628	.	.	.		0.547	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		Intron
CRIP3	401262	hgsc.bcm.edu	37	6	43274045	43274046	+	Missense_Mutation	DNP	TT	TT	AC			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr6:43274045_43274046TT>AC	ENST00000274990.4	-	6	410_411	c.406_407AA>GT	c.(406-408)AAg>GTg	p.K136V	ZNF318_ENST00000607252.1_5'Flank|CRIP3_ENST00000372569.3_Missense_Mutation_p.K136V			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	136	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			TGACATCACCTTCTCAGCTGGT	0.569																																					p.K136M|p.K136E		Atlas-SNP	.											.	CRIP3	30	.	0			c.A407T|c.A406G						.																																			SO:0001583	missense	401262	exon6			ATCACCTTCTCAG|TCACCTTCTCAGC	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.406_407delinsAC	chr6.hg19:g.43274045_43274046delinsAC	ENSP00000274990:p.Lys136Val	51.0|50.0	0.0		133.0	17.0|16.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	hg19																																																																																				.	.		0.569	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
GTPBP2	54676	hgsc.bcm.edu	37	6	43592642	43592642	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr6:43592642C>A	ENST00000307126.5	-	6	862	c.863G>T	c.(862-864)aGt>aTt	p.S288I	GTPBP2_ENST00000307114.7_Missense_Mutation_p.S200I|GTPBP2_ENST00000476510.1_5'UTR	NM_019096.3	NP_061969.3			GTP binding protein 2											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(3)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(18;9.36e-06)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000501)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			AGTGTTGGCACTGACGAGGAG	0.572																																					p.S288I	GBM(116;405 1620 28302 32150 44768)	Atlas-SNP	.											.	GTPBP2	39	.	0			c.G863T						.						160.0	129.0	140.0					6																	43592642		2203	4300	6503	SO:0001583	missense	54676	exon6			TTGGCACTGACGA	AB024574	CCDS4903.1, CCDS69124.1	6p21	2008-07-28			ENSG00000172432	ENSG00000172432			4670	protein-coding gene	gene with protein product		607434				10833435, 11054535	Standard	NM_019096		Approved		uc003ovs.3	Q9BX10	OTTHUMG00000014744	ENST00000307126.5:c.863G>T	chr6.hg19:g.43592642C>A	ENSP00000303997:p.Ser288Ile	69.0	0.0		140.0	30.0	NM_019096		Missense_Mutation	SNP	ENST00000307126.5	hg19	CCDS4903.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.514749|4.514749	0.85389|0.85389	.|.	.|.	ENSG00000172432|ENSG00000172432	ENST00000307126;ENST00000307114|ENST00000442748	T;T|.	0.48201|.	0.82;0.82|.	5.41|5.41	5.41|5.41	0.78517|0.78517	Protein synthesis factor, GTP-binding (1);|.	0.044177|.	0.85682|.	D|.	0.000000|.	D|D	0.85531|0.85531	0.5718|0.5718	M|M	0.93241|0.93241	3.395|3.395	0.80722|0.80722	D|D	1|1	D;P|.	0.63880|.	0.993;0.918|.	P;P|.	0.59889|.	0.865;0.522|.	D|D	0.89075|0.89075	0.3472|0.3472	10|5	0.87932|.	D|.	0|.	-9.4257|-9.4257	19.1891|19.1891	0.93656|0.93656	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	280;288|.	Q9BX10-4;Q9BX10|.	.;GTPB2_HUMAN|.	I|L	288;200|254	ENSP00000303997:S288I;ENSP00000304893:S200I|.	ENSP00000304893:S200I|.	S|V	-|-	2|1	0|0	GTPBP2|GTPBP2	43700620|43700620	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.042000|6.042000	0.70996|0.70996	2.521000|2.521000	0.84997|0.84997	0.555000|0.555000	0.69702|0.69702	AGT|GTG	.	.		0.572	GTPBP2-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040679.1		
CARD11	84433	hgsc.bcm.edu	37	7	2978336	2978336	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr7:2978336G>A	ENST00000396946.4	-	7	1397	c.994C>T	c.(994-996)Cag>Tag	p.Q332*		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	332					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TCCTCTGCCTGGCGGGCCTCC	0.667			Mis		DLBCL																																p.Q332X		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.C994T						.						59.0	46.0	50.0					7																	2978336		2203	4300	6503	SO:0001587	stop_gained	84433	exon7			CTGCCTGGCGGGC	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.994C>T	chr7.hg19:g.2978336G>A	ENSP00000380150:p.Gln332*	29.0	0.0		35.0	12.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Nonsense_Mutation	SNP	ENST00000396946.4	hg19	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	G	43	9.848978	0.99279	.	.	ENSG00000198286	ENST00000396946	.	.	.	5.72	5.72	0.89469	.	0.116020	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-57.327	18.8612	0.92273	0.0:0.0:1.0:0.0	.	.	.	.	X	332	.	ENSP00000380150:Q332X	Q	-	1	0	CARD11	2944862	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.644000	0.98468	2.690000	0.91761	0.591000	0.81541	CAG	.	.		0.667	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
PCLO	27445	hgsc.bcm.edu	37	7	82582023	82582023	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr7:82582023G>T	ENST00000333891.9	-	5	8583	c.8246C>A	c.(8245-8247)gCt>gAt	p.A2749D	PCLO_ENST00000437081.1_5'Flank|PCLO_ENST00000423517.2_Missense_Mutation_p.A2749D	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CATTGTAGAAGCAGAAAGATC	0.343																																					p.A2749D		Atlas-SNP	.											.	PCLO	1506	.	0			c.C8246A						.						76.0	74.0	74.0					7																	82582023		1883	4115	5998	SO:0001583	missense	27445	exon5			GTAGAAGCAGAAA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8246C>A	chr7.hg19:g.82582023G>T	ENSP00000334319:p.Ala2749Asp	87.0	0.0		132.0	49.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	G	8.910	0.958378	0.18507	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.19669	2.13;2.15	5.54	3.68	0.42216	.	.	.	.	.	T	0.21761	0.0524	L	0.54323	1.7	0.80722	D	1	B;B	0.17667	0.023;0.023	B;B	0.16722	0.016;0.016	T	0.05886	-1.0858	9	0.87932	D	0	.	10.836	0.46688	0.069:0.0:0.8019:0.1291	.	2749;2749	Q9Y6V0-5;Q9Y6V0-6	.;.	D	2680;2749;2749	ENSP00000334319:A2749D;ENSP00000388393:A2749D	ENSP00000334319:A2749D	A	-	2	0	PCLO	82419959	1.000000	0.71417	0.862000	0.33874	0.729000	0.41735	7.605000	0.82844	1.289000	0.44618	0.655000	0.94253	GCT	.	.		0.343	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
ZNF746	155061	hgsc.bcm.edu	37	7	149172236	149172236	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr7:149172236T>A	ENST00000340622.3	-	7	1454	c.1174A>T	c.(1174-1176)Aac>Tac	p.N392Y	ZNF746_ENST00000458143.2_Missense_Mutation_p.N393Y			Q6NUN9	ZN746_HUMAN	zinc finger protein 746	392					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(4)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GTCCTCGGGTTCAGGCCCACT	0.667																																					p.N393Y		Atlas-SNP	.											.	ZNF746	68	.	0			c.A1177T						.						13.0	16.0	15.0					7																	149172236		2194	4294	6488	SO:0001583	missense	155061	exon7			TCGGGTTCAGGCC	AK055975	CCDS5897.1, CCDS55180.1	7q36.1	2013-01-08			ENSG00000181220	ENSG00000181220		"""Zinc fingers, C2H2-type"", ""-"""	21948	protein-coding gene	gene with protein product		613914					Standard	NM_152557		Approved	FLJ31413	uc010lpi.2	Q6NUN9	OTTHUMG00000158972	ENST00000340622.3:c.1174A>T	chr7.hg19:g.149172236T>A	ENSP00000345140:p.Asn392Tyr	61.0	0.0		69.0	22.0	NM_001163474	A8K6Z9|Q6ZRF9	Missense_Mutation	SNP	ENST00000340622.3	hg19	CCDS5897.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.526436	0.44969	.	.	ENSG00000181220	ENST00000340622;ENST00000458143	T;T	0.08546	3.12;3.08	4.29	3.04	0.35103	.	0.505055	0.16524	N	0.210677	T	0.09158	0.0226	N	0.19112	0.55	0.24917	N	0.992001	P;P	0.49447	0.924;0.875	P;P	0.51135	0.66;0.459	T	0.12016	-1.0564	10	0.87932	D	0	-24.0345	8.3079	0.32053	0.0:0.0:0.2162:0.7838	.	393;392	Q6NUN9-2;Q6NUN9	.;ZN746_HUMAN	Y	392;393	ENSP00000345140:N392Y;ENSP00000395007:N393Y	ENSP00000345140:N392Y	N	-	1	0	ZNF746	148803169	0.045000	0.20229	1.000000	0.80357	0.707000	0.40811	0.701000	0.25616	1.561000	0.49584	0.460000	0.39030	AAC	.	.		0.667	ZNF746-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352730.1	NM_152557	
CPSF1	29894	hgsc.bcm.edu	37	8	145625402	145625402	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr8:145625402G>C	ENST00000349769.3	-	10	1105	c.1011C>G	c.(1009-1011)atC>atG	p.I337M	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	337					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CCTTGAGGGAGATGACCATCT	0.662																																					p.I337M	NSCLC(133;1088 1848 27708 34777 35269)	Atlas-SNP	.											.	CPSF1	92	.	0			c.C1011G						.						29.0	25.0	26.0					8																	145625402		2202	4299	6501	SO:0001583	missense	29894	exon10			GAGGGAGATGACC	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1011C>G	chr8.hg19:g.145625402G>C	ENSP00000339353:p.Ile337Met	100.0	0.0		147.0	26.0	NM_013291	Q96AF0	Missense_Mutation	SNP	ENST00000349769.3	hg19	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	G	19.31	3.803477	0.70682	.	.	ENSG00000071894	ENST00000349769	T	0.54479	0.57	5.67	4.79	0.61399	.	0.050507	0.85682	D	0.000000	T	0.64427	0.2597	L	0.61218	1.895	0.58432	D	0.999995	D;P	0.67145	0.996;0.933	D;P	0.66602	0.945;0.739	T	0.64972	-0.6281	10	0.49607	T	0.09	-6.1594	8.5164	0.33248	0.1743:0.0:0.8257:0.0	.	259;337	D3DWL9;Q10570	.;CPSF1_HUMAN	M	337	ENSP00000339353:I337M	ENSP00000339353:I337M	I	-	3	3	CPSF1	145596210	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	3.349000	0.52217	1.392000	0.46585	0.555000	0.69702	ATC	.	.		0.662	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	
MAPKAP1	79109	hgsc.bcm.edu	37	9	128305415	128305415	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr9:128305415A>G	ENST00000373498.1	-	6	949	c.881T>C	c.(880-882)gTg>gCg	p.V294A	MAPKAP1_ENST00000373511.2_Missense_Mutation_p.V294A|MAPKAP1_ENST00000394060.3_Missense_Mutation_p.V294A|MAPKAP1_ENST00000394063.1_Missense_Mutation_p.V102A|MAPKAP1_ENST00000265960.3_Missense_Mutation_p.V294A|MAPKAP1_ENST00000350766.3_Missense_Mutation_p.V294A|MAPKAP1_ENST00000373497.5_Missense_Mutation_p.V43A|MAPKAP1_ENST00000373503.3_Missense_Mutation_p.V102A			Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated protein 1	294					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|negative regulation of Ras protein signal transduction (GO:0046580)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein kinase binding (GO:0019901)|Ras GTPase binding (GO:0017016)			endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(3)	23						TGTGTTGTCCACCTGAATAAG	0.388																																					p.V294A		Atlas-SNP	.											.	MAPKAP1	68	.	0			c.T881C						.						164.0	155.0	158.0					9																	128305415		2203	4300	6503	SO:0001583	missense	79109	exon7			TTGTCCACCTGAA	M37191	CCDS6864.1, CCDS35139.1, CCDS35140.1, CCDS35141.1, CCDS48020.1	9q34.11	2008-02-05			ENSG00000119487	ENSG00000119487			18752	protein-coding gene	gene with protein product	"""stress-activated protein kinase-interacting 1"""	610558				15363842	Standard	NM_001006620		Approved	MGC2745, SIN1, MIP1	uc004bpv.3	Q9BPZ7	OTTHUMG00000020683	ENST00000373498.1:c.881T>C	chr9.hg19:g.128305415A>G	ENSP00000362597:p.Val294Ala	96.0	0.0		116.0	26.0	NM_001006618	A8K1Z5|B1AMA4|B7Z309|Q00426|Q5JSV5|Q5JSV6|Q5JSV9|Q658R0|Q699U1|Q699U2|Q699U3|Q699U4|Q6GVJ0|Q6GVJ1|Q6GVJ2	Missense_Mutation	SNP	ENST00000373498.1	hg19	CCDS35140.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824362	0.50739	.	.	ENSG00000119487	ENST00000373511;ENST00000350766;ENST00000373503;ENST00000373498;ENST00000265960;ENST00000394063;ENST00000373497;ENST00000420643;ENST00000394060;ENST00000427078	.	.	.	5.8	5.8	0.92144	.	0.053174	0.85682	D	0.000000	T	0.54191	0.1843	L	0.58428	1.81	0.80722	D	1	P;P;P;P;P	0.48503	0.679;0.739;0.911;0.66;0.583	B;B;B;B;B	0.42593	0.335;0.164;0.392;0.214;0.345	T	0.52888	-0.8515	9	0.16420	T	0.52	-1.7411	14.7322	0.69391	1.0:0.0:0.0:0.0	.	43;294;294;294;294	B7Z5E5;Q9BPZ7-5;Q9BPZ7-3;Q9BPZ7-2;Q9BPZ7	.;.;.;.;SIN1_HUMAN	A	294;294;102;294;294;102;43;102;294;102	.	ENSP00000265960:V294A	V	-	2	0	MAPKAP1	127345236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.406000	0.90216	2.213000	0.71641	0.477000	0.44152	GTG	.	.		0.388	MAPKAP1-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054092.1		
ADAMTS13	11093	hgsc.bcm.edu	37	9	136308565	136308565	+	Missense_Mutation	SNP	G	G	T	rs369510827		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr9:136308565G>T	ENST00000371929.3	+	19	2747	c.2303G>T	c.(2302-2304)cGc>cTc	p.R768L	ADAMTS13_ENST00000356589.2_Missense_Mutation_p.R737L|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.R768L|ADAMTS13_ENST00000536611.1_Intron|ADAMTS13_ENST00000485925.1_Intron|ADAMTS13_ENST00000371916.1_3'UTR	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	768	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CGGCCAGTGCGCTGCGTGGAG	0.716																																					p.R768L		Atlas-SNP	.											.	ADAMTS13	113	.	0			c.G2303T						.						9.0	10.0	9.0					9																	136308565		2175	4261	6436	SO:0001583	missense	11093	exon19			CAGTGCGCTGCGT	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.2303G>T	chr9.hg19:g.136308565G>T	ENSP00000360997:p.Arg768Leu	101.0	0.0		129.0	32.0	NM_139027	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	hg19	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	g	2.138	-0.397487	0.04899	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589	T;T;T	0.59772	0.66;0.24;0.24	4.74	-0.549	0.11829	.	.	.	.	.	T	0.46698	0.1406	L	0.34521	1.04	0.09310	N	0.999997	D;B;P	0.54397	0.966;0.333;0.851	P;B;P	0.56343	0.796;0.184;0.619	T	0.38757	-0.9646	9	0.06625	T	0.88	.	1.259	0.01997	0.2445:0.1155:0.4045:0.2355	.	768;737;768	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	L	768;768;737	ENSP00000360997:R768L;ENSP00000347927:R768L;ENSP00000348997:R737L	ENSP00000347927:R768L	R	+	2	0	ADAMTS13	135298386	0.000000	0.05858	0.001000	0.08648	0.501000	0.33797	-0.698000	0.05092	-0.770000	0.04614	-1.326000	0.01283	CGC	.	.		0.716	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
ABCA2	20	hgsc.bcm.edu	37	9	139906760	139906760	+	Silent	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr9:139906760C>T	ENST00000371605.3	-	32	5400	c.5253G>A	c.(5251-5253)ctG>ctA	p.L1751L	ABCA2_ENST00000341511.6_Silent_p.L1752L|ABCA2_ENST00000265662.5_Silent_p.L1752L			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1751					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGTTGGCACGCAGGATGGCGT	0.637																																					p.L1782L		Atlas-SNP	.											.	ABCA2	113	.	0			c.G5346A						.						63.0	66.0	65.0					9																	139906760		2081	4224	6305	SO:0001819	synonymous_variant	20	exon33			GGCACGCAGGATG	U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.5253G>A	chr9.hg19:g.139906760C>T		61.0	0.0		65.0	28.0	NM_212533	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Silent	SNP	ENST00000371605.3	hg19		.	.	.	.	.	.	.	.	.	.	C	4.654	0.121675	0.08931	.	.	ENSG00000107331	ENST00000477420	.	.	.	4.32	1.19	0.21007	.	.	.	.	.	T	0.58807	0.2148	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54323	-0.8311	4	.	.	.	.	10.7015	0.45931	0.0:0.5833:0.3338:0.0829	.	.	.	.	T	164	.	.	A	-	1	0	ABCA2	139026581	0.996000	0.38824	1.000000	0.80357	0.492000	0.33523	0.455000	0.21843	0.443000	0.26582	0.313000	0.20887	GCG	.	.		0.637	ABCA2-202	KNOWN	basic	protein_coding	protein_coding		NM_001606	
MYO3A	53904	hgsc.bcm.edu	37	10	26312983	26312983	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr10:26312983T>C	ENST00000265944.5	+	9	930	c.764T>C	c.(763-765)cTa>cCa	p.L255P	MYO3A_ENST00000543632.1_Missense_Mutation_p.L255P	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	255	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						CAGCCTGAGCTATGGTCAGCA	0.383																																					p.L255P		Atlas-SNP	.											.	MYO3A	371	.	0			c.T764C						.						135.0	136.0	136.0					10																	26312983		2203	4300	6503	SO:0001583	missense	53904	exon9			CTGAGCTATGGTC	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.764T>C	chr10.hg19:g.26312983T>C	ENSP00000265944:p.Leu255Pro	102.0	0.0		136.0	46.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	T	17.74	3.464776	0.63513	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	T;T	0.63913	-0.07;-0.07	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.239623	0.44097	D	0.000495	T	0.72260	0.3438	L	0.48935	1.535	0.80722	D	1	D;D;P	0.63046	0.99;0.992;0.949	D;D;P	0.67103	0.914;0.949;0.718	T	0.69105	-0.5233	10	0.30078	T	0.28	.	16.2644	0.82568	0.0:0.0:0.0:1.0	.	255;255;255	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	P	255	ENSP00000265944:L255P;ENSP00000445909:L255P	ENSP00000265944:L255P	L	+	2	0	MYO3A	26352989	1.000000	0.71417	0.897000	0.35233	0.989000	0.77384	5.425000	0.66470	2.244000	0.73946	0.528000	0.53228	CTA	.	.		0.383	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
ANKRD26	22852	hgsc.bcm.edu	37	10	27356167	27356167	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr10:27356167T>C	ENST00000376087.4	-	10	1291	c.1126A>G	c.(1126-1128)Att>Gtt	p.I376V	ANKRD26_ENST00000436985.2_Missense_Mutation_p.I425V	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	376					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CTTTCAATAATATCAATACCA	0.299																																					p.I376V		Atlas-SNP	.											.	ANKRD26	179	.	0			c.A1126G						.						176.0	155.0	162.0					10																	27356167		1828	4077	5905	SO:0001583	missense	22852	exon10			CAATAATATCAAT	AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1126A>G	chr10.hg19:g.27356167T>C	ENSP00000365255:p.Ile376Val	49.0	0.0		77.0	32.0	NM_014915	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	ENST00000376087.4	hg19	CCDS41499.1	.	.	.	.	.	.	.	.	.	.	T	0.029	-1.348904	0.01266	.	.	ENSG00000107890	ENST00000376087;ENST00000436985	T;T	0.29142	1.61;1.58	3.59	-3.95	0.04118	.	1.041750	0.07723	N	0.943979	T	0.17577	0.0422	L	0.31926	0.97	0.09310	N	1	B;B;B	0.17038	0.02;0.012;0.012	B;B;B	0.09377	0.004;0.002;0.002	T	0.28681	-1.0036	10	0.26408	T	0.33	.	4.2393	0.10640	0.1741:0.4381:0.0:0.3877	.	376;376;425	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	V	376;425	ENSP00000365255:I376V;ENSP00000405112:I425V	ENSP00000365255:I376V	I	-	1	0	ANKRD26	27396173	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.331000	0.07914	-0.497000	0.06641	-0.376000	0.06991	ATT	.	.		0.299	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047296.1		
PALD1	27143	hgsc.bcm.edu	37	10	72324178	72324178	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr10:72324178A>G	ENST00000263563.6	+	19	2589	c.2321A>G	c.(2320-2322)tAc>tGc	p.Y774C		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	774						cytosol (GO:0005829)											AGCCTGCAGTACTTGGAGCGC	0.622																																					p.Y774C		Atlas-SNP	.											.	.	.	.	0			c.A2321G						.						113.0	110.0	111.0					10																	72324178		2203	4300	6503	SO:0001583	missense	27143	exon19			TGCAGTACTTGGA	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.2321A>G	chr10.hg19:g.72324178A>G	ENSP00000263563:p.Tyr774Cys	85.0	0.0		121.0	33.0	NM_014431	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	ENST00000263563.6	hg19	CCDS31215.1	.	.	.	.	.	.	.	.	.	.	A	16.54	3.152304	0.57259	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.29655	1.56	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.58977	0.2160	M	0.84683	2.71	0.58432	D	0.999998	D	0.89917	1.0	D	0.71414	0.973	T	0.66960	-0.5791	10	0.87932	D	0	-24.844	14.4366	0.67284	1.0:0.0:0.0:0.0	.	774	Q9ULE6	PALD_HUMAN	C	774;750	ENSP00000263563:Y774C	ENSP00000263563:Y774C	Y	+	2	0	KIAA1274	71994184	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	5.120000	0.64685	1.903000	0.55091	0.454000	0.30748	TAC	.	.		0.622	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
PHRF1	57661	hgsc.bcm.edu	37	11	597422	597422	+	Missense_Mutation	SNP	T	T	G	rs377428073		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr11:597422T>G	ENST00000264555.5	+	8	874	c.746T>G	c.(745-747)gTc>gGc	p.V249G	PHRF1_ENST00000416188.2_Missense_Mutation_p.V249G|PHRF1_ENST00000413872.2_Missense_Mutation_p.V248G|PHRF1_ENST00000533464.1_Missense_Mutation_p.V245G	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	249					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GAGGAGGAGGTCTCCCTGCTC	0.657																																					p.V249G		Atlas-SNP	.											.	PHRF1	188	.	0			c.T746G						.						58.0	69.0	65.0					11																	597422		2096	4211	6307	SO:0001583	missense	57661	exon8			AGGAGGTCTCCCT	BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.746T>G	chr11.hg19:g.597422T>G	ENSP00000264555:p.Val249Gly	67.0	0.0		72.0	23.0	NM_020901	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Missense_Mutation	SNP	ENST00000264555.5	hg19		.	.	.	.	.	.	.	.	.	.	T	17.12	3.308010	0.60305	.	.	ENSG00000070047	ENST00000264555;ENST00000413872;ENST00000416188;ENST00000533464	D;D;D;D	0.81739	-1.52;-1.53;-1.52;-1.53	4.5	4.5	0.54988	.	0.249515	0.21812	N	0.068750	D	0.87172	0.6111	M	0.64997	1.995	0.58432	D	0.999997	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.69479	0.922;0.964;0.964;0.922	D	0.88412	0.3022	10	0.72032	D	0.01	-38.6757	14.0339	0.64634	0.0:0.0:0.0:1.0	.	245;248;249;249	E9PJ24;F8WEF5;Q9P1Y6-3;Q9P1Y6	.;.;.;PHRF1_HUMAN	G	249;248;249;245	ENSP00000264555:V249G;ENSP00000388589:V248G;ENSP00000410626:V249G;ENSP00000431870:V245G	ENSP00000264555:V249G	V	+	2	0	PHRF1	587422	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	4.202000	0.58446	1.912000	0.55364	0.454000	0.30748	GTC	.	.		0.657	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000382133.1	NM_020901	
OR52A5	390054	hgsc.bcm.edu	37	11	5153167	5153167	+	Missense_Mutation	SNP	C	C	T	rs376219001		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr11:5153167C>T	ENST00000307388.1	-	1	705	c.706G>A	c.(706-708)Gca>Aca	p.A236T		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	236					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		TTGAATCGTGCCTCCTTCTGG	0.413																																					p.A236T		Atlas-SNP	.											.	OR52A5	80	.	0			c.G706A						.						105.0	95.0	99.0					11																	5153167		2201	4298	6499	SO:0001583	missense	390054	exon1			ATCGTGCCTCCTT	BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.706G>A	chr11.hg19:g.5153167C>T	ENSP00000303469:p.Ala236Thr	115.0	0.0		123.0	54.0	NM_001005160		Missense_Mutation	SNP	ENST00000307388.1	hg19	CCDS31373.1	.	.	.	.	.	.	.	.	.	.	C	14.53	2.563633	0.45694	.	.	ENSG00000171944	ENST00000307388	T	0.00130	8.69	4.89	4.89	0.63831	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000204	T	0.00440	0.0014	M	0.89163	3.01	0.30966	N	0.723055	P	0.35944	0.529	P	0.48524	0.58	T	0.01930	-1.1245	10	0.72032	D	0.01	.	15.9656	0.79968	0.0:1.0:0.0:0.0	.	236	Q9H2C5	O52A5_HUMAN	T	236	ENSP00000303469:A236T	ENSP00000303469:A236T	A	-	1	0	OR52A5	5109743	0.000000	0.05858	0.995000	0.50966	0.070000	0.16714	0.197000	0.17197	2.707000	0.92482	0.655000	0.94253	GCA	.	.		0.413	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142823.1	NM_001005160	
HBG2	3048	hgsc.bcm.edu	37	11	5275588	5275588	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr11:5275588C>A	ENST00000380259.2	-	7	1489	c.249G>T	c.(247-249)aaG>aaT	p.K83N	HBG2_ENST00000336906.4_Missense_Mutation_p.K83N|HBG2_ENST00000380252.1_Missense_Mutation_p.K73N			P69892	HBG2_HUMAN	hemoglobin, gamma G	83					blood coagulation (GO:0007596)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	13		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAAAGGTGCCCTTGAGATCAT	0.527																																					p.K83N		Atlas-SNP	.											.	HBG2	20	.	0			c.G249T						.						289.0	224.0	246.0					11																	5275588		2201	4298	6499	SO:0001583	missense	3048	exon2			GGTGCCCTTGAGA	BC029387	CCDS7755.1	11p15.5	2014-05-19			ENSG00000196565	ENSG00000196565			4832	protein-coding gene	gene with protein product		142250				2649166	Standard	NM_000184		Approved	HBG-T1		P69892	OTTHUMG00000066673	ENST00000380259.2:c.249G>T	chr11.hg19:g.5275588C>A	ENSP00000369609:p.Lys83Asn	254.0	0.0		258.0	50.0	NM_000184	A8MZE0|P02096|P62027|Q14491|Q68NH9|Q96FH6|Q96FH7	Missense_Mutation	SNP	ENST00000380259.2	hg19	CCDS7755.1	.	.	.	.	.	.	.	.	.	.	C	11.17	1.560718	0.27827	.	.	ENSG00000196565	ENST00000380252;ENST00000380259;ENST00000336906;ENST00000380247	D;D;D	0.93307	-3.2;-3.2;-3.2	4.08	-0.26	0.12967	Globin-like (2);Globin, structural domain (2);	.	.	.	.	D	0.95245	0.8458	M	0.81497	2.545	0.50039	D	0.999844	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	D	0.92148	0.5726	9	0.87932	D	0	.	5.1575	0.15042	0.0:0.5668:0.1482:0.285	.	83;83	P69892;P69891	HBG2_HUMAN;HBG1_HUMAN	N	73;83;83;83	ENSP00000369602:K73N;ENSP00000369609:K83N;ENSP00000338082:K83N	ENSP00000338082:K83N	K	-	3	2	HBG2	5232164	0.140000	0.22579	0.004000	0.12327	0.029000	0.11900	1.016000	0.29976	-0.154000	0.11118	-0.142000	0.14014	AAG	.	.		0.527	HBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142967.2	NM_000184	
PSMA1	5682	hgsc.bcm.edu	37	11	14539222	14539222	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr11:14539222T>C	ENST00000396394.2	-	4	616	c.220A>G	c.(220-222)Att>Gtt	p.I74V	PSMA1_ENST00000530457.1_Missense_Mutation_p.I49V|PSMA1_ENST00000419365.2_Missense_Mutation_p.I74V|PSMA1_ENST00000418988.2_Missense_Mutation_p.I80V|PSMA1_ENST00000555531.1_Missense_Mutation_p.I74V|PSMA1_ENST00000396393.1_Missense_Mutation_p.I74V	NM_002786.3	NP_002777.1	P25786	PSA1_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 1	74					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysome (GO:0005844)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	RNA binding (GO:0003723)|threonine-type endopeptidase activity (GO:0004298)			large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	3						AGCCCCGCAATTGAGATACCA	0.328																																					p.I80V		Atlas-SNP	.											.	PSMA1	22	.	0			c.A238G						.						116.0	115.0	115.0					11																	14539222		2200	4294	6494	SO:0001583	missense	5682	exon5			CCGCAATTGAGAT	X61969	CCDS7816.1, CCDS31431.1	11p15.1	2005-10-10			ENSG00000129084	ENSG00000129084		"""Proteasome (prosome, macropain) subunits"""	9530	protein-coding gene	gene with protein product		602854				1398136, 2025653	Standard	NM_148976		Approved	HC2, NU, PROS30, MGC14542, MGC14575, MGC14751, MGC1667, MGC21459, MGC22853, MGC23915	uc001mlk.3	P25786	OTTHUMG00000165825	ENST00000396394.2:c.220A>G	chr11.hg19:g.14539222T>C	ENSP00000379676:p.Ile74Val	242.0	0.0		282.0	101.0	NM_148976	A8K400|Q53YE8|Q9BRV9	Missense_Mutation	SNP	ENST00000396394.2	hg19	CCDS7816.1	.	.	.	.	.	.	.	.	.	.	T	17.58	3.424181	0.62733	.	.	ENSG00000129084	ENST00000419365;ENST00000396394;ENST00000396393;ENST00000530457;ENST00000418988	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.64	5.64	0.86602	.	0.096845	0.64402	D	0.000001	T	0.20210	0.0486	L	0.37800	1.135	0.80722	D	1	B;B;B	0.17465	0.022;0.006;0.004	B;B;B	0.24155	0.024;0.023;0.051	T	0.02385	-1.1167	10	0.44086	T	0.13	-10.282	14.4348	0.67274	0.0:0.0:0.0:1.0	.	74;80;74	B4E0X6;P25786-2;P25786	.;.;PSA1_HUMAN	V	74;74;74;49;80	ENSP00000392242:I74V;ENSP00000379676:I74V;ENSP00000379675:I74V;ENSP00000441166:I49V;ENSP00000414359:I80V	ENSP00000379675:I74V	I	-	1	0	PSMA1	14495798	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.329000	0.79170	2.136000	0.66102	0.533000	0.62120	ATT	.	.		0.328	PSMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386421.3	NM_002786	
P2RY6	5031	hgsc.bcm.edu	37	11	73008130	73008130	+	Silent	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr11:73008130T>C	ENST00000393590.2	+	2	866	c.567T>C	c.(565-567)taT>taC	p.Y189Y	P2RY6_ENST00000540124.1_Silent_p.Y189Y|P2RY6_ENST00000542092.1_Silent_p.Y189Y|P2RY6_ENST00000538328.1_Silent_p.Y189Y|P2RY6_ENST00000349767.2_Silent_p.Y189Y|P2RY6_ENST00000393592.2_Silent_p.Y189Y|P2RY6_ENST00000540342.1_Silent_p.Y189Y|P2RY6_ENST00000393591.1_Silent_p.Y189Y	NM_001277207.1|NM_001277208.1	NP_001264136.1|NP_001264137.1	Q15077	P2RY6_HUMAN	pyrimidinergic receptor P2Y, G-protein coupled, 6	189					phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(2)	14						CCACCCACTATATGCCCTATG	0.642																																					p.Y189Y		Atlas-SNP	.											.	P2RY6	45	.	0			c.T567C						.						106.0	94.0	98.0					11																	73008130		2178	4263	6441	SO:0001819	synonymous_variant	5031	exon4			CCACTATATGCCC		CCDS8220.1	11q13.5	2012-08-08				ENSG00000171631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	8543	protein-coding gene	gene with protein product		602451				8670200	Standard	NM_176797		Approved	P2Y6	uc001otr.4	Q15077		ENST00000393590.2:c.567T>C	chr11.hg19:g.73008130T>C		20.0	0.0		17.0	9.0	NM_176796	Q15754	Silent	SNP	ENST00000393590.2	hg19	CCDS8220.1																																																																																			.	.		0.642	P2RY6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397349.1		
RPS3	6188	hgsc.bcm.edu	37	11	75115747	75115747	+	Silent	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr11:75115747G>T	ENST00000531188.1	+	6	632	c.570G>T	c.(568-570)ctG>ctT	p.L190L	RPS3_ENST00000278572.6_Silent_p.L206L|RPS3_ENST00000526608.1_Silent_p.L178L|RPS3_ENST00000529285.1_3'UTR|SNORD15B_ENST00000384714.1_RNA|RPS3_ENST00000534440.1_Silent_p.L105L|RPS3_ENST00000527446.1_Silent_p.L190L|RPS3_ENST00000524851.1_Silent_p.L190L	NM_001005.4|NM_001260506.1|NM_001260507.1	NP_000996.2|NP_001247435.1|NP_001247436.1	P23396	RS3_HUMAN	ribosomal protein S3	190					cellular protein metabolic process (GO:0044267)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic translation (GO:0002181)|DNA catabolic process, endonucleolytic (GO:0000737)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of DNA repair (GO:0045738)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of DNA N-glycosylase activity (GO:1902546)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|ruffle membrane (GO:0032587)	damaged DNA binding (GO:0003684)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|enzyme binding (GO:0019899)|iron-sulfur cluster binding (GO:0051536)|mRNA binding (GO:0003729)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6						AGATCATGCTGCCCTGGGACC	0.552																																					p.L206L		Atlas-SNP	.											.	RPS3	20	.	0			c.G618T						.						73.0	66.0	68.0					11																	75115747		2200	4293	6493	SO:0001819	synonymous_variant	6188	exon6			CATGCTGCCCTGG		CCDS8236.1, CCDS58161.1	11q13.3-q13.5	2011-04-05				ENSG00000149273		"""S ribosomal proteins"""	10420	protein-coding gene	gene with protein product	"""IMR-90 ribosomal protein S3"", ""40S ribosomal protein S3"""	600454				1712897, 7789996	Standard	NM_001005		Approved	FLJ26283, FLJ27450, MGC87870, S3	uc031qcs.1	P23396		ENST00000531188.1:c.570G>T	chr11.hg19:g.75115747G>T		144.0	0.0		138.0	38.0	NM_001260506	B2R7N5|J3KN86|Q498B5|Q8NI95	Silent	SNP	ENST00000531188.1	hg19	CCDS8236.1	.	.	.	.	.	.	.	.	.	.	g	11.05	1.524912	0.27299	.	.	ENSG00000149273	ENST00000525933	.	.	.	5.24	2.27	0.28462	.	.	.	.	.	T	0.54886	0.1886	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44605	-0.9317	4	.	.	.	-15.4598	6.9338	0.24455	0.083:0.0:0.4403:0.4768	.	.	.	.	F	118	.	.	C	+	2	0	RPS3	74793395	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.988000	0.49386	0.303000	0.22785	0.558000	0.71614	TGC	.	.		0.552	RPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384158.2	NM_001005	
WNT1	7471	hgsc.bcm.edu	37	12	49375114	49375114	+	Silent	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr12:49375114G>T	ENST00000293549.3	+	4	840	c.804G>T	c.(802-804)cgG>cgT	p.R268R		NM_005430.3	NP_005421.1	P04628	WNT1_HUMAN	wingless-type MMTV integration site family, member 1	268					bone development (GO:0060348)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to peptide hormone stimulus (GO:0071375)|central nervous system morphogenesis (GO:0021551)|cerebellum formation (GO:0021588)|diencephalon development (GO:0021536)|embryonic axis specification (GO:0000578)|forebrain anterior/posterior pattern specification (GO:0021797)|hematopoietic stem cell proliferation (GO:0071425)|hepatocyte differentiation (GO:0070365)|inner ear morphogenesis (GO:0042472)|midbrain development (GO:0030901)|midbrain-hindbrain boundary maturation during brain development (GO:0022004)|myoblast fusion (GO:0007520)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell aging (GO:0090344)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron differentiation (GO:0030182)|neuron fate determination (GO:0048664)|organ regeneration (GO:0031100)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dermatome development (GO:0061184)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to wounding (GO:0009611)|signal transduction in response to DNA damage (GO:0042770)|Spemann organizer formation (GO:0060061)|spinal cord association neuron differentiation (GO:0021527)|T cell differentiation in thymus (GO:0033077)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)	11				BRCA - Breast invasive adenocarcinoma(357;0.244)		GCGCTTCGCGGGCGGAGCTGC	0.706																																					p.R268R		Atlas-SNP	.											.	WNT1	13	.	0			c.G804T						.						8.0	10.0	9.0					12																	49375114		2129	4127	6256	SO:0001819	synonymous_variant	7471	exon4			TTCGCGGGCGGAG	X03072	CCDS8776.1	12q13	2013-02-28				ENSG00000125084		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12774	protein-coding gene	gene with protein product		164820		INT1		2998762, 3281802	Standard	NM_005430		Approved		uc001rsu.3	P04628	OTTHUMG00000170403	ENST00000293549.3:c.804G>T	chr12.hg19:g.49375114G>T		86.0	0.0		95.0	29.0	NM_005430	Q5U0N2	Silent	SNP	ENST00000293549.3	hg19	CCDS8776.1																																																																																			.	.		0.706	WNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408937.1		
PRIM1	5557	hgsc.bcm.edu	37	12	57132217	57132217	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr12:57132217C>T	ENST00000338193.6	-	11	1181		c.e11+1			NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						TATTACCTTACCTCTGGTTCT	0.363																																					.		Atlas-SNP	.											.	PRIM1	22	.	0			c.1144+1G>A						.						115.0	103.0	107.0					12																	57132217		1849	4082	5931	SO:0001630	splice_region_variant	5557	exon12			ACCTTACCTCTGG	BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.1144+1G>A	chr12.hg19:g.57132217C>T		57.0	0.0		70.0	26.0	NM_000946		Splice_Site	SNP	ENST00000338193.6	hg19	CCDS44926.1	.	.	.	.	.	.	.	.	.	.	C	12.85	2.061366	0.36373	.	.	ENSG00000198056	ENST00000537418;ENST00000338193	.	.	.	4.29	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.2042	0.43103	0.0:0.7976:0.2024:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRIM1	55418484	1.000000	0.71417	0.980000	0.43619	0.516000	0.34256	4.839000	0.62810	1.137000	0.42214	0.467000	0.42956	.	.	.		0.363	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406956.1	NM_000946	Intron
MGAT4C	25834	hgsc.bcm.edu	37	12	86373973	86373973	+	Silent	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr12:86373973C>T	ENST00000604798.1	-	8	1735	c.531G>A	c.(529-531)gaG>gaA	p.E177E	MGAT4C_ENST00000549405.2_Silent_p.E177E|MGAT4C_ENST00000552808.2_Silent_p.E177E|MGAT4C_ENST00000548651.1_Silent_p.E177E|MGAT4C_ENST00000393205.2_Silent_p.E206E|MGAT4C_ENST00000552435.2_Intron|MGAT4C_ENST00000332156.1_Silent_p.E177E			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	177					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TTGGGTAATACTCCTCTGGAG	0.373																																					p.E177E		Atlas-SNP	.											.	MGAT4C	110	.	0			c.G531A						.						111.0	111.0	111.0					12																	86373973		2203	4300	6503	SO:0001819	synonymous_variant	25834	exon7			GTAATACTCCTCT		CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.531G>A	chr12.hg19:g.86373973C>T		90.0	0.0		109.0	25.0	NM_013244	B4DRH2|Q4G199|Q9UIU5	Silent	SNP	ENST00000604798.1	hg19	CCDS9030.1																																																																																			.	.		0.373	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406212.2	NM_013244	
PDS5B	23047	hgsc.bcm.edu	37	13	33241913	33241913	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr13:33241913C>G	ENST00000315596.10	+	7	823	c.637C>G	c.(637-639)Caa>Gaa	p.Q213E		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	213					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		TTTAAACAAGCAAGCATATGA	0.303																																					p.Q213E		Atlas-SNP	.											.	PDS5B	141	.	0			c.C637G						.						53.0	49.0	50.0					13																	33241913		1808	4061	5869	SO:0001583	missense	23047	exon7			AACAAGCAAGCAT	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.637C>G	chr13.hg19:g.33241913C>G	ENSP00000313851:p.Gln213Glu	277.0	0.0		411.0	143.0	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	hg19	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201579	0.58234	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	4.67	4.67	0.58626	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.44705	0.1306	N	0.20401	0.57	0.80722	D	1	P;B	0.36768	0.569;0.028	B;B	0.38264	0.269;0.023	T	0.34030	-0.9845	9	0.15952	T	0.53	-13.6391	17.9602	0.89083	0.0:1.0:0.0:0.0	.	213;213	Q9NTI5;Q9NTI5-3	PDS5B_HUMAN;.	E	213	.	ENSP00000313851:Q213E	Q	+	1	0	PDS5B	32139913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.689000	0.84165	2.290000	0.77057	0.655000	0.94253	CAA	.	.		0.303	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
SUGT1	10910	hgsc.bcm.edu	37	13	53232539	53232539	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr13:53232539G>T	ENST00000343788.6	+	4	275	c.193G>T	c.(193-195)Gtt>Ttt	p.V65F	SUGT1_ENST00000310528.8_Missense_Mutation_p.V65F|SUGT1_ENST00000535397.1_Missense_Mutation_p.V9F|SUGT1_ENST00000483074.1_3'UTR	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)	65					innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		CACAGTTGCTGTTGCTGATGC	0.358																																					p.V65F		Atlas-SNP	.											.	SUGT1	37	.	0			c.G193T						.						116.0	114.0	115.0					13																	53232539		2203	4300	6503	SO:0001583	missense	10910	exon4			GTTGCTGTTGCTG	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.193G>T	chr13.hg19:g.53232539G>T	ENSP00000367208:p.Val65Phe	74.0	0.0		64.0	14.0	NM_001130912	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Missense_Mutation	SNP	ENST00000343788.6	hg19	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	G	9.341	1.062925	0.19987	.	.	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	T;T;T	0.74842	0.18;-0.88;0.18	4.42	1.3	0.21679	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.175795	0.50627	D	0.000115	T	0.76716	0.4026	L	0.58510	1.815	0.42241	D	0.991936	B;P;P	0.45986	0.11;0.87;0.789	B;P;B	0.56434	0.067;0.798;0.391	T	0.71666	-0.4524	10	0.42905	T	0.14	-11.0625	7.5282	0.27668	0.4504:0.0:0.5496:0.0	.	9;65;65	F5H5A9;Q9Y2Z0;Q9Y2Z0-2	.;SUGT1_HUMAN;.	F	65;9;65	ENSP00000367208:V65F;ENSP00000443521:V9F;ENSP00000308067:V65F	ENSP00000308067:V65F	V	+	1	0	SUGT1	52130540	1.000000	0.71417	0.995000	0.50966	0.127000	0.20565	0.704000	0.25661	-0.004000	0.14419	0.563000	0.77884	GTT	.	.		0.358	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		
CASC5	57082	hgsc.bcm.edu	37	15	40943693	40943693	+	Silent	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr15:40943693A>G	ENST00000346991.5	+	21	6705	c.6315A>G	c.(6313-6315)caA>caG	p.Q2105Q	CASC5_ENST00000399668.2_Silent_p.Q2079Q			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	2105	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		TGGAGGTACAAAAAGAGCAGA	0.348																																					p.Q2105Q		Atlas-SNP	.											.	CASC5	269	.	0			c.A6315G						.						76.0	68.0	71.0					15																	40943693		1810	4081	5891	SO:0001819	synonymous_variant	57082	exon21			GGTACAAAAAGAG	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.6315A>G	chr15.hg19:g.40943693A>G		117.0	0.0		196.0	100.0	NM_170589	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Silent	SNP	ENST00000346991.5	hg19	CCDS42023.1																																																																																			.	.		0.348	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
FBN1	2200	hgsc.bcm.edu	37	15	48760684	48760684	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr15:48760684C>T	ENST00000316623.5	-	37	4962	c.4507G>A	c.(4507-4509)Gtc>Atc	p.V1503I		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1503	EGF-like 26; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GGAGTGTTGACACAGTTCCCA	0.473																																					p.V1503I		Atlas-SNP	.											.	FBN1	310	.	0			c.G4507A						.						125.0	101.0	109.0					15																	48760684		2198	4296	6494	SO:0001583	missense	2200	exon37			TGTTGACACAGTT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.4507G>A	chr15.hg19:g.48760684C>T	ENSP00000325527:p.Val1503Ile	67.0	0.0		76.0	18.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472515	0.26423	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.93247	-3.19	5.64	-1.36	0.09085	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.742875	0.13432	N	0.388353	T	0.81206	0.4774	N	0.12471	0.22	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.64914	-0.6295	10	0.08837	T	0.75	.	6.6163	0.22778	0.0:0.4517:0.1931:0.3552	.	1503	P35555	FBN1_HUMAN	I	1503;71;393	ENSP00000325527:V1503I	ENSP00000325527:V1503I	V	-	1	0	FBN1	46547976	0.001000	0.12720	0.846000	0.33378	0.886000	0.51366	-1.148000	0.03185	-0.252000	0.09528	-0.300000	0.09419	GTC	.	.		0.473	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
MYO5A	4644	hgsc.bcm.edu	37	15	52611468	52611468	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr15:52611468T>A	ENST00000399231.3	-	38	5191	c.4948A>T	c.(4948-4950)Acc>Tcc	p.T1650S	MYO5A_ENST00000358212.6_Missense_Mutation_p.T1675S|MYO5A_ENST00000356338.6_Missense_Mutation_p.T1623S|MYO5A_ENST00000553916.1_Missense_Mutation_p.T1648S|MYO5A_ENST00000399233.2_Missense_Mutation_p.T1647S	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	1650	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		ATACTGGAGGTTCGCTTTCTC	0.547																																					p.T1650S		Atlas-SNP	.											.	MYO5A	145	.	0			c.A4948T						.						120.0	127.0	125.0					15																	52611468		2173	4266	6439	SO:0001583	missense	4644	exon38			TGGAGGTTCGCTT		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.4948A>T	chr15.hg19:g.52611468T>A	ENSP00000382177:p.Thr1650Ser	72.0	0.0		104.0	37.0	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	ENST00000399231.3	hg19	CCDS42037.1	.	.	.	.	.	.	.	.	.	.	T	1.696	-0.502894	0.04261	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.85171	-1.9;-1.9;-1.93;-1.95;-1.9	5.7	5.7	0.88788	Dilute (1);	0.000000	0.85682	D	0.000000	T	0.63616	0.2526	N	0.01640	-0.785	0.58432	D	0.999992	B;B;B	0.24258	0.018;0.003;0.1	B;B;B	0.24006	0.039;0.003;0.05	T	0.66364	-0.5942	10	0.02654	T	1	.	15.9672	0.79984	0.0:0.0:0.0:1.0	.	380;1650;1623	B5LY56;Q9Y4I1;Q9Y4I1-2	.;MYO5A_HUMAN;.	S	1650;1157;1647;1623;1675;1253;1648	ENSP00000382177:T1650S;ENSP00000382179:T1647S;ENSP00000348693:T1623S;ENSP00000350945:T1675S;ENSP00000451109:T1648S	ENSP00000348693:T1623S	T	-	1	0	MYO5A	50398760	1.000000	0.71417	0.969000	0.41365	0.041000	0.13682	5.006000	0.63978	2.181000	0.69327	0.460000	0.39030	ACC	.	.		0.547	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	
SH2B1	25970	hgsc.bcm.edu	37	16	28857319	28857319	+	5'Flank	SNP	T	T	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr16:28857319T>A	ENST00000322610.8	+	0	0				TUFM_ENST00000313511.3_Missense_Mutation_p.Y54F|MIR4721_ENST00000577590.1_RNA			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1						blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GTCGCGCACGTAAGTCTTCTT	0.632																																					p.Y54F		Atlas-SNP	.											.	TUFM	33	.	0			c.A161T						.						72.0	61.0	64.0					16																	28857319		2197	4300	6497	SO:0001631	upstream_gene_variant	7284	exon2			CGCACGTAAGTCT	AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2			chr16.hg19:g.28857319T>A	Exception_encountered	71.0	0.0		88.0	36.0	NM_003321	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	ENST00000322610.8	hg19	CCDS53996.1	.	.	.	.	.	.	.	.	.	.	T	10.56	1.385631	0.25031	.	.	ENSG00000178952	ENST00000313511	T	0.70516	-0.49	6.0	6.0	0.97389	.	0.129752	0.53938	D	0.000049	T	0.47116	0.1428	N	0.08118	0	0.48135	D	0.999594	B	0.21753	0.06	B	0.17433	0.018	T	0.49360	-0.8948	10	0.02654	T	1	-25.7142	14.0279	0.64597	0.0:0.0:0.0:1.0	.	51	P49411	EFTU_HUMAN	F	54	ENSP00000322439:Y54F	ENSP00000322439:Y54F	Y	-	2	0	TUFM	28764820	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	3.545000	0.53648	2.297000	0.77311	0.533000	0.62120	TAC	.	.		0.632	SH2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000432666.1	NM_015503	
PLEKHG4	25894	hgsc.bcm.edu	37	16	67316522	67316522	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr16:67316522C>A	ENST00000360461.5	+	9	3905	c.1370C>A	c.(1369-1371)gCc>gAc	p.A457D	PLEKHG4_ENST00000450733.1_Missense_Mutation_p.A376D|PLEKHG4_ENST00000379344.3_Missense_Mutation_p.A457D|PLEKHG4_ENST00000427155.2_Missense_Mutation_p.A457D	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	457							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		ACACTGGAGGCCCGGGAAAGC	0.592																																					p.A457D		Atlas-SNP	.											.	PLEKHG4	94	.	0			c.C1370A						.						72.0	67.0	69.0					16																	67316522		2198	4300	6498	SO:0001583	missense	25894	exon10			TGGAGGCCCGGGA	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.1370C>A	chr16.hg19:g.67316522C>A	ENSP00000353646:p.Ala457Asp	57.0	0.0		48.0	29.0	NM_001129728	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Missense_Mutation	SNP	ENST00000360461.5	hg19	CCDS32466.1	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490816	0.26774	.	.	ENSG00000196155	ENST00000360461;ENST00000427155;ENST00000379344;ENST00000450733	T;T;T;T	0.09911	2.93;2.93;2.93;2.96	5.93	4.93	0.64822	.	0.253279	0.20765	N	0.086094	T	0.12433	0.0302	M	0.65975	2.015	0.25683	N	0.98578	P;P	0.44478	0.836;0.747	B;B	0.40101	0.319;0.17	T	0.20538	-1.0272	10	0.13470	T	0.59	.	11.5993	0.50993	0.1773:0.8227:0.0:0.0	.	376;457	Q58EX7-2;Q58EX7	.;PKHG4_HUMAN	D	457;457;457;376	ENSP00000353646:A457D;ENSP00000401118:A457D;ENSP00000368649:A457D;ENSP00000398030:A376D	ENSP00000353646:A457D	A	+	2	0	PLEKHG4	65874023	1.000000	0.71417	1.000000	0.80357	0.014000	0.08584	1.944000	0.40263	2.826000	0.97356	0.655000	0.94253	GCC	.	.		0.592	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
ZNF469	84627	hgsc.bcm.edu	37	16	88496242	88496242	+	Silent	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr16:88496242G>A	ENST00000437464.1	+	1	2364	c.2364G>A	c.(2362-2364)gcG>gcA	p.A788A	ZNF469_ENST00000565624.1_Silent_p.A788A	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	788					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						ACGCACACGCGGGCTTGCTCA	0.721																																					p.A788A		Atlas-SNP	.											.	ZNF469	121	.	0			c.G2364A						.						8.0	11.0	10.0					16																	88496242		688	1566	2254	SO:0001819	synonymous_variant	84627	exon1			ACACGCGGGCTTG	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.2364G>A	chr16.hg19:g.88496242G>A		74.0	0.0		72.0	4.0	NM_001127464		Silent	SNP	ENST00000437464.1	hg19	CCDS45544.1																																																																																			.	.		0.721	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
WDR16	146845	hgsc.bcm.edu	37	17	9497562	9497562	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr17:9497562G>A	ENST00000352665.5	+	4	529	c.460G>A	c.(460-462)Gcc>Acc	p.A154T	WDR16_ENST00000299764.5_Missense_Mutation_p.A164T|WDR16_ENST00000396219.3_Missense_Mutation_p.A86T|WDR16_ENST00000576499.1_3'UTR	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						CAGCCCTGCAGCCGGCCTCAA	0.488																																					p.A154T		Atlas-SNP	.											.	WDR16	67	.	0			c.G460A						.						107.0	110.0	109.0					17																	9497562		2203	4300	6503	SO:0001583	missense	146845	exon4			CCTGCAGCCGGCC	AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.460G>A	chr17.hg19:g.9497562G>A	ENSP00000339449:p.Ala154Thr	51.0	0.0		75.0	22.0	NM_145054		Missense_Mutation	SNP	ENST00000352665.5	hg19	CCDS11149.2	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071241	0.55646	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;D;T	0.89939	1.5;-2.59;1.51	5.3	5.3	0.74995	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.112104	0.64402	D	0.000007	D	0.89100	0.6619	L	0.52266	1.64	0.39203	D	0.963182	P;P;P	0.51449	0.906;0.945;0.696	P;P;B	0.52909	0.713;0.713;0.338	D	0.87777	0.2609	10	0.32370	T	0.25	-23.0586	11.7588	0.51890	0.0:0.0:0.7191:0.2809	.	164;86;154	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	T	154;86;164	ENSP00000339449:A154T;ENSP00000379521:A86T;ENSP00000299764:A164T	ENSP00000299764:A164T	A	+	1	0	WDR16	9438287	1.000000	0.71417	0.126000	0.21872	0.307000	0.27823	4.753000	0.62183	2.645000	0.89757	0.591000	0.81541	GCC	.	.		0.488	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316569.2	NM_145054	
TANC2	26115	hgsc.bcm.edu	37	17	61497385	61497385	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr17:61497385C>A	ENST00000424789.2	+	25	4046	c.4042C>A	c.(4042-4044)Ctg>Atg	p.L1348M	RP11-269G24.3_ENST00000583552.1_RNA|TANC2_ENST00000389520.4_Missense_Mutation_p.L1358M	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	1348					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						CTTAGAGGACCTGAACGAGGC	0.502																																					p.L1348M		Atlas-SNP	.											.	TANC2	266	.	0			c.C4042A						.						25.0	28.0	27.0					17																	61497385		1870	3631	5501	SO:0001583	missense	26115	exon25			GAGGACCTGAACG	AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.4042C>A	chr17.hg19:g.61497385C>A	ENSP00000387593:p.Leu1348Met	50.0	0.0		81.0	47.0	NM_025185	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	ENST00000424789.2	hg19	CCDS45754.1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851912	0.91355	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.62105	0.05;0.05	5.95	5.95	0.96441	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.81273	0.4788	M	0.78223	2.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81326	-0.0983	10	0.62326	D	0.03	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	1348	Q9HCD6	TANC2_HUMAN	M	1358;1348	ENSP00000374171:L1358M;ENSP00000387593:L1348M	ENSP00000374171:L1358M	L	+	1	2	TANC2	58851117	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.824000	0.97209	0.655000	0.94253	CTG	.	.		0.502	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444765.1		
LAMA3	3909	hgsc.bcm.edu	37	18	21422363	21422363	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr18:21422363A>T	ENST00000313654.9	+	28	3582	c.3341A>T	c.(3340-3342)cAa>cTa	p.Q1114L	LAMA3_ENST00000399516.3_Missense_Mutation_p.Q1114L	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	1114	Domain IV 1 (domain IV B).				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TCTTAGAATCAAGTGACCCTG	0.443																																					p.Q1114L		Atlas-SNP	.											.	LAMA3	397	.	0			c.A3341T						.						97.0	94.0	95.0					18																	21422363		1875	4104	5979	SO:0001583	missense	3909	exon28			AGAATCAAGTGAC	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.3341A>T	chr18.hg19:g.21422363A>T	ENSP00000324532:p.Gln1114Leu	194.0	0.0		273.0	98.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	ENST00000313654.9	hg19	CCDS42419.1	.	.	.	.	.	.	.	.	.	.	A	18.99	3.740652	0.69304	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	T;T	0.18657	2.22;2.2	5.46	5.46	0.80206	.	.	.	.	.	T	0.47173	0.1431	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.78314	0.91;0.991	T	0.41106	-0.9527	9	0.32370	T	0.25	.	15.5466	0.76108	1.0:0.0:0.0:0.0	.	1114;1114	Q6VU67;Q16787	.;LAMA3_HUMAN	L	1114;1114;1112	ENSP00000324532:Q1114L;ENSP00000382432:Q1114L	ENSP00000324532:Q1114L	Q	+	2	0	LAMA3	19676361	1.000000	0.71417	0.991000	0.47740	0.542000	0.35054	4.191000	0.58372	2.088000	0.63022	0.533000	0.62120	CAA	.	.		0.443	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
HMHA1	23526	hgsc.bcm.edu	37	19	1068487	1068487	+	Silent	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr19:1068487C>T	ENST00000313093.2	+	2	396	c.165C>T	c.(163-165)ggC>ggT	p.G55G	HMHA1_ENST00000586866.1_Silent_p.G59G|HMHA1_ENST00000543365.1_5'Flank|HMHA1_ENST00000539243.2_Silent_p.G71G|HMHA1_ENST00000536472.1_Intron|HMHA1_ENST00000590214.1_Silent_p.G82G	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	55					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGTCCTCCGGCGTCAAGGCCA	0.726																																					p.G71G		Atlas-SNP	.											.	HMHA1	78	.	0			c.C213T						.						5.0	5.0	5.0					19																	1068487		1985	3953	5938	SO:0001819	synonymous_variant	23526	exon2			CTCCGGCGTCAAG	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.165C>T	chr19.hg19:g.1068487C>T		119.0	0.0		118.0	41.0	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Silent	SNP	ENST00000313093.2	hg19	CCDS32863.1																																																																																			.	.		0.726	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
RYR1	6261	hgsc.bcm.edu	37	19	38976259	38976259	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr19:38976259G>T	ENST00000359596.3	+	34	4964	c.4964G>T	c.(4963-4965)cGc>cTc	p.R1655L	RYR1_ENST00000355481.4_Missense_Mutation_p.R1655L|RYR1_ENST00000360985.3_Missense_Mutation_p.R1655L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1655	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTGTCGGAGCGCCTGGACCTG	0.622																																					p.R1655L		Atlas-SNP	.											.	RYR1	708	.	0			c.G4964T						.						42.0	41.0	41.0					19																	38976259		2201	4295	6496	SO:0001583	missense	6261	exon34			CGGAGCGCCTGGA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.4964G>T	chr19.hg19:g.38976259G>T	ENSP00000352608:p.Arg1655Leu	27.0	0.0		36.0	7.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992313	0.54041	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96651	-4.08;-4.08;-4.08	3.98	3.98	0.46160	.	0.078316	0.48767	U	0.000169	D	0.95896	0.8664	L	0.41236	1.265	0.42017	D	0.990968	D;B	0.69078	0.997;0.146	D;B	0.63877	0.919;0.199	D	0.94590	0.7787	10	0.35671	T	0.21	.	10.9611	0.47385	0.0952:0.0:0.9048:0.0	.	1655;1655	P21817-2;P21817	.;RYR1_HUMAN	L	1655	ENSP00000352608:R1655L;ENSP00000347667:R1655L;ENSP00000354254:R1655L	ENSP00000347667:R1655L	R	+	2	0	RYR1	43668099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.189000	0.50965	2.043000	0.60533	0.650000	0.86243	CGC	.	.		0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
DYRK1B	9149	hgsc.bcm.edu	37	19	40319067	40319067	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr19:40319067A>G	ENST00000593685.1	-	6	1145	c.677T>C	c.(676-678)cTc>cCc	p.L226P	DYRK1B_ENST00000323039.5_Missense_Mutation_p.L226P|DYRK1B_ENST00000430012.2_Missense_Mutation_p.L226P|DYRK1B_ENST00000348817.3_Missense_Mutation_p.L226P|DYRK1B_ENST00000597639.1_Missense_Mutation_p.L226P			Q9Y463	DYR1B_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adipose tissue development (GO:0060612)|myoblast fusion (GO:0007520)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(7)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	24	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)		Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)			GGCCAGAAAGAGCAGTGCCGT	0.602																																					p.L226P		Atlas-SNP	.											.	DYRK1B	114	.	0			c.T677C						.						73.0	65.0	68.0					19																	40319067		2203	4300	6503	SO:0001583	missense	9149	exon6			AGAAAGAGCAGTG	Y17999	CCDS12543.1, CCDS12544.1, CCDS46075.1	19q13.2	2012-10-02			ENSG00000105204	ENSG00000105204	2.7.12.1		3092	protein-coding gene	gene with protein product	"""minibrain-related kinase"""	604556				9918863	Standard	XM_005259395		Approved	MIRK	uc002omj.3	Q9Y463		ENST00000593685.1:c.677T>C	chr19.hg19:g.40319067A>G	ENSP00000469863:p.Leu226Pro	79.0	0.0		99.0	32.0	NM_006483	O75258|O75788|O75789	Missense_Mutation	SNP	ENST00000593685.1	hg19	CCDS12543.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.357820	0.61403	.	.	ENSG00000105204	ENST00000323039;ENST00000348817;ENST00000430012	T;T;T	0.65549	-0.16;-0.16;-0.16	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	T	0.76097	0.3940	M	0.71871	2.18	0.80722	D	1	D;D;D	0.76494	0.993;0.999;0.993	D;D;D	0.68765	0.921;0.96;0.921	T	0.74429	-0.3668	10	0.30854	T	0.27	.	14.3573	0.66745	1.0:0.0:0.0:0.0	.	226;226;226	Q9Y463-2;Q9Y463;Q9Y463-3	.;DYR1B_HUMAN;.	P	226	ENSP00000312789:L226P;ENSP00000221803:L226P;ENSP00000403182:L226P	ENSP00000312789:L226P	L	-	2	0	DYRK1B	45010907	1.000000	0.71417	1.000000	0.80357	0.518000	0.34316	9.313000	0.96297	2.279000	0.76181	0.402000	0.26972	CTC	.	.		0.602	DYRK1B-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462874.2	NM_004714	
FBL	2091	hgsc.bcm.edu	37	19	40331279	40331279	+	Silent	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr19:40331279G>A	ENST00000221801.3	-	2	272	c.159C>T	c.(157-159)ggC>ggT	p.G53G	FBL_ENST00000593503.1_5'Flank	NM_001436.3	NP_001427.2	P22087	FBRL_HUMAN	fibrillarin	53	DMA/Gly-rich.				histone glutamine methylation (GO:1990258)|osteoblast differentiation (GO:0001649)|rRNA processing (GO:0006364)|snoRNA metabolic process (GO:0016074)|tRNA processing (GO:0008033)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|extracellular vesicular exosome (GO:0070062)|granular component (GO:0001652)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone-glutamine methyltransferase activity (GO:1990259)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)	9	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		ctcctccaccgccgccgccgc	0.657																																					p.G53G		Atlas-SNP	.											.	FBL	37	.	0			c.C159T						.						18.0	21.0	20.0					19																	40331279		2201	4299	6500	SO:0001819	synonymous_variant	2091	exon2			TCCACCGCCGCCG	AC005393	CCDS12545.1	19q13.1	2010-02-17			ENSG00000105202	ENSG00000105202			3599	protein-coding gene	gene with protein product		134795				1846968, 2026646	Standard	NM_001436		Approved	RNU3IP1, FLRN, FIB	uc002omn.3	P22087		ENST00000221801.3:c.159C>T	chr19.hg19:g.40331279G>A		86.0	0.0		121.0	5.0	NM_001436	B5BUE8|O75259|Q6IAT5|Q9UPI6	Silent	SNP	ENST00000221801.3	hg19	CCDS12545.1																																																																																			.	.		0.657	FBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462509.4	NM_001436	
GPR4	2828	hgsc.bcm.edu	37	19	46094941	46094941	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr19:46094941C>T	ENST00000323040.4	-	2	1128	c.184G>A	c.(184-186)Gcc>Acc	p.A62T	OPA3_ENST00000544371.1_Intron|GPR4_ENST00000591614.1_5'Flank	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	62					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		AGCAGGTCGGCGATGCTGAGG	0.647																																					p.A62T	Esophageal Squamous(117;181 1612 1673 14956 42937)	Atlas-SNP	.											.	GPR4	54	.	0			c.G184A						.						110.0	91.0	97.0					19																	46094941		2203	4300	6503	SO:0001583	missense	2828	exon2			GGTCGGCGATGCT	BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.184G>A	chr19.hg19:g.46094941C>T	ENSP00000319744:p.Ala62Thr	72.0	0.0		91.0	38.0	NM_005282	A8K3T3|B0M0K1|Q6NWM4	Missense_Mutation	SNP	ENST00000323040.4	hg19	CCDS12669.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.009988	0.75046	.	.	ENSG00000177464	ENST00000323040	T	0.78003	-1.14	5.09	5.09	0.68999	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000009	D	0.85221	0.5647	M	0.66297	2.02	0.43673	D	0.996105	D	0.89917	1.0	D	0.74023	0.982	D	0.86398	0.1740	10	0.87932	D	0	.	11.133	0.48358	0.1845:0.8155:0.0:0.0	.	62	P46093	GPR4_HUMAN	T	62	ENSP00000319744:A62T	ENSP00000319744:A62T	A	-	1	0	GPR4	50786781	0.988000	0.35896	0.997000	0.53966	0.934000	0.57294	2.457000	0.45005	2.355000	0.79922	0.297000	0.19635	GCC	.	.		0.647	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459603.1	NM_005282	
SIGLEC10	89790	hgsc.bcm.edu	37	19	51920112	51920112	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr19:51920112C>T	ENST00000339313.5	-	3	630	c.514G>A	c.(514-516)Gaa>Aaa	p.E172K	SIGLEC10_ENST00000353836.5_Missense_Mutation_p.E172K|CTD-2616J11.2_ENST00000526996.1_RNA|CTD-2616J11.3_ENST00000532473.1_RNA|SIGLEC10_ENST00000525998.1_Missense_Mutation_p.E172K|SIGLEC10_ENST00000442846.3_Intron|SIGLEC10_ENST00000432469.2_Intron|CTD-2616J11.2_ENST00000532688.1_RNA|SIGLEC10_ENST00000441969.3_Intron|SIGLEC10_ENST00000436984.2_Intron|SIGLEC10_ENST00000356298.5_Missense_Mutation_p.E172K|SIGLEC10_ENST00000439889.2_Intron			Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10	172	Ig-like C2-type 1.				cell adhesion (GO:0007155)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(27)|ovary(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGTGGACATTCCTCAAAGGCC	0.602																																					p.E172K		Atlas-SNP	.											.	SIGLEC10	112	.	0			c.G514A						.						101.0	100.0	100.0					19																	51920112		2203	4300	6503	SO:0001583	missense	89790	exon3			GACATTCCTCAAA	AF310233	CCDS12832.1, CCDS54301.1, CCDS54302.1, CCDS54303.1, CCDS54304.1, CCDS54305.1	19q13.3	2013-01-29			ENSG00000142512	ENSG00000142512		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15620	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 10 Ig-like lectin 7"", ""siglec-like gene 2"""	606091				11284738	Standard	NM_033130		Approved	SIGLEC-10, SLG2, PRO940, MGC126774	uc002pwo.3	Q96LC7	OTTHUMG00000165521	ENST00000339313.5:c.514G>A	chr19.hg19:g.51920112C>T	ENSP00000345243:p.Glu172Lys	122.0	0.0		185.0	12.0	NM_001171157	A8K1I5|A8K3C7|C9JJ33|C9JM10|F8W917|Q3MIR5|Q6UXI8|Q96G54|Q96LC8	Missense_Mutation	SNP	ENST00000339313.5	hg19	CCDS12832.1	.	.	.	.	.	.	.	.	.	.	.	11.48	1.650199	0.29336	.	.	ENSG00000142512	ENST00000353836;ENST00000356298;ENST00000525998;ENST00000339313;ENST00000530476	T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;-0.94	4.69	-3.05	0.05396	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.077330	0.07177	N	0.853380	T	0.58977	0.2160	L	0.40543	1.245	0.09310	N	1	B;B;B	0.32862	0.387;0.045;0.058	B;B;B	0.35039	0.194;0.026;0.021	T	0.45659	-0.9246	10	0.10636	T	0.68	.	5.8825	0.18864	0.0:0.256:0.357:0.387	.	172;172;172	E9PL79;Q96LC7-2;Q96LC7	.;.;SIG10_HUMAN	K	172;172;172;172;139	ENSP00000342389:E172K;ENSP00000348646:E172K;ENSP00000431444:E172K;ENSP00000345243:E172K;ENSP00000433838:E139K	ENSP00000345243:E172K	E	-	1	0	SIGLEC10	56611924	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.461000	0.06712	-0.176000	0.10707	-0.657000	0.03884	GAA	.	.		0.602	SIGLEC10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384620.2	NM_033130	
FPR3	2359	hgsc.bcm.edu	37	19	52327369	52327369	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr19:52327369G>A	ENST00000339223.4	+	2	547	c.368G>A	c.(367-369)cGc>cAc	p.R123H	FPR3_ENST00000595991.1_Missense_Mutation_p.R123H	NM_002030.3	NP_002021.3	P25089	FPR3_HUMAN	formyl peptide receptor 3	123					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	N-formyl peptide receptor activity (GO:0004982)			NS(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(3)	35						GCTCTGGACCGCTGTATTTGT	0.478																																					p.R123H		Atlas-SNP	.											.	FPR3	66	.	0			c.G368A						.						92.0	77.0	82.0					19																	52327369		2203	4300	6503	SO:0001583	missense	2359	exon2			TGGACCGCTGTAT		CCDS12841.1	19q13.3-q13.4	2012-08-08	2008-04-17	2008-04-17		ENSG00000187474		"""GPCR / Class A : Formyl peptide receptors"""	3828	protein-coding gene	gene with protein product		136539	"""formyl peptide receptor-like 2"""	FPRL2		1612600, 8198572	Standard	NM_002030		Approved	FPRH1, FMLPY, RMLP-R-I	uc002pxt.1	P25089		ENST00000339223.4:c.368G>A	chr19.hg19:g.52327369G>A	ENSP00000341821:p.Arg123His	109.0	0.0		99.0	26.0	NM_002030		Missense_Mutation	SNP	ENST00000339223.4	hg19	CCDS12841.1	.	.	.	.	.	.	.	.	.	.	.	12.15	1.850699	0.32699	.	.	ENSG00000187474	ENST00000339223	D	0.97161	-4.27	2.34	2.34	0.29019	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	D	0.97297	0.9116	M	0.91406	3.205	0.32098	N	0.590994	B	0.30605	0.287	B	0.40228	0.323	D	0.99869	1.1094	10	0.56958	D	0.05	.	10.3497	0.43927	0.0:0.0:1.0:0.0	.	123	P25089	FPR3_HUMAN	H	123	ENSP00000341821:R123H	ENSP00000341821:R123H	R	+	2	0	FPR3	57019181	1.000000	0.71417	0.967000	0.41034	0.071000	0.16799	4.369000	0.59511	1.323000	0.45263	0.467000	0.42956	CGC	.	.		0.478	FPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466914.1	NM_002030	
PDYN	5173	hgsc.bcm.edu	37	20	1961381	1961381	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr20:1961381T>C	ENST00000217305.2	-	4	578	c.353A>G	c.(352-354)aAg>aGg	p.K118R	RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000539905.1_Missense_Mutation_p.K118R|PDYN_ENST00000540134.1_Missense_Mutation_p.K118R	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	118					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGTGTTCTCCTTTGTTGAGAT	0.552																																					p.K118R		Atlas-SNP	.											.	PDYN	74	.	0			c.A353G						.						109.0	106.0	107.0					20																	1961381		2203	4300	6503	SO:0001583	missense	5173	exon4			TTCTCCTTTGTTG		CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.353A>G	chr20.hg19:g.1961381T>C	ENSP00000217305:p.Lys118Arg	82.0	0.0		148.0	41.0	NM_001190898	A8K0Q3	Missense_Mutation	SNP	ENST00000217305.2	hg19	CCDS13023.1	.	.	.	.	.	.	.	.	.	.	T	2.026	-0.423654	0.04734	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	T;T;T	0.80824	-1.42;-1.42;-1.42	3.96	2.86	0.33363	.	0.811582	0.11477	N	0.560117	T	0.57446	0.2054	N	0.03608	-0.345	0.25176	N	0.990246	B	0.09022	0.002	B	0.04013	0.001	T	0.45026	-0.9289	10	0.23891	T	0.37	-8.7273	7.4029	0.26975	0.0:0.1072:0.0:0.8928	.	118	P01213	PDYN_HUMAN	R	118	ENSP00000440185:K118R;ENSP00000442259:K118R;ENSP00000217305:K118R	ENSP00000217305:K118R	K	-	2	0	PDYN	1909381	0.149000	0.22717	0.263000	0.24496	0.098000	0.18820	0.978000	0.29488	0.625000	0.30304	0.391000	0.25812	AAG	.	.		0.552	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077569.2		
SLX4IP	128710	hgsc.bcm.edu	37	20	10602024	10602024	+	Silent	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr20:10602024T>C	ENST00000334534.5	+	7	648	c.468T>C	c.(466-468)ccT>ccC	p.P156P		NM_001009608.1	NP_001009608.1	Q5VYV7	SLX4I_HUMAN	SLX4 interacting protein	156																	GTTCACTTCCTCCCAGTGCAA	0.403																																					p.P156P		Atlas-SNP	.											.	.	.	.	0			c.T468C						.						142.0	124.0	130.0					20																	10602024		2203	4300	6503	SO:0001819	synonymous_variant	128710	exon7			ACTTCCTCCCAGT	AL035456	CCDS33439.1	20p12	2012-10-30	2012-10-30	2012-10-30	ENSG00000149346	ENSG00000149346			16225	protein-coding gene	gene with protein product		615958	"""chromosome 20 open reading frame 94"""	C20orf94		19596235	Standard	XM_005260664		Approved	dJ1099D15.3	uc010zre.2	Q5VYV7	OTTHUMG00000031873	ENST00000334534.5:c.468T>C	chr20.hg19:g.10602024T>C		83.0	0.0		179.0	86.0	NM_001009608	Q05CG2|Q05CT9	Silent	SNP	ENST00000334534.5	hg19	CCDS33439.1																																																																																			.	.		0.403	SLX4IP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078000.3	NM_001009608	
NANP	140838	hgsc.bcm.edu	37	20	25596729	25596729	+	Silent	SNP	G	G	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr20:25596729G>C	ENST00000304788.3	-	2	805	c.579C>G	c.(577-579)acC>acG	p.T193T		NM_152667.2	NP_689880.1	Q8TBE9	NANP_HUMAN	N-acetylneuraminic acid phosphatase	193					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate biosynthetic process (GO:0046380)		N-acylneuraminate-9-phosphatase activity (GO:0050124)			endometrium(2)|lung(2)|prostate(1)	5						CTTGGATGTCGGTTTCTAATG	0.473																																					p.T193T		Atlas-SNP	.											.	NANP	10	.	0			c.C579G						.						120.0	109.0	112.0					20																	25596729		2203	4300	6503	SO:0001819	synonymous_variant	140838	exon2			GATGTCGGTTTCT	AL031673	CCDS13173.1	20p11.1	2006-10-24	2006-01-24	2006-01-24	ENSG00000170191	ENSG00000170191			16140	protein-coding gene	gene with protein product		610763	"""chromosome 20 open reading frame 147"", ""haloacid dehalogenase-like hydrolase domain containing 4"""	C20orf147, HDHD4		16237198	Standard	NM_152667		Approved	dJ694B14.3, MGC26833	uc002wuy.3	Q8TBE9	OTTHUMG00000032132	ENST00000304788.3:c.579C>G	chr20.hg19:g.25596729G>C		65.0	0.0		122.0	24.0	NM_152667	B3KP12|Q5JYN8|Q8TE97|Q9Y3N0	Silent	SNP	ENST00000304788.3	hg19	CCDS13173.1																																																																																			.	.		0.473	NANP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078457.2	NM_152667	
WFDC3	140686	hgsc.bcm.edu	37	20	44417610	44417610	+	Silent	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr20:44417610G>A	ENST00000243938.4	-	3	254	c.171C>T	c.(169-171)tgC>tgT	p.C57C	DNTTIP1_ENST00000372622.3_5'Flank|WFDC3_ENST00000372632.2_Silent_p.C57C|WFDC3_ENST00000372630.2_Intron|WFDC3_ENST00000481847.1_Intron	NM_080614.1	NP_542181.1	Q8IUB2	WFDC3_HUMAN	WAP four-disulfide core domain 3	57	WAP 1. {ECO:0000255|PROSITE- ProRule:PRU00722}.					extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|large_intestine(3)|prostate(1)	5		Myeloproliferative disorder(115;0.0122)				AGCCTGTGGTGCAGCACTTCT	0.512																																					p.C57C		Atlas-SNP	.											.	WFDC3	18	.	0			c.C171T						.						231.0	210.0	217.0					20																	44417610		2203	4300	6503	SO:0001819	synonymous_variant	140686	exon3			TGTGGTGCAGCAC	AL050348	CCDS33478.1	20q13.12	2013-01-21			ENSG00000124116	ENSG00000124116		"""WAP four-disulfide core domain containing"""	15957	protein-coding gene	gene with protein product						12206714, 10680116	Standard	NM_080614		Approved	dJ447F3.3, WAP14	uc002xpf.1	Q8IUB2	OTTHUMG00000032614	ENST00000243938.4:c.171C>T	chr20.hg19:g.44417610G>A		57.0	0.0		95.0	18.0	NM_080614	A6PVF2|Q0P6A5|Q3T1C5|Q8TC52|Q9BQP3|Q9BQP4	Silent	SNP	ENST00000243938.4	hg19	CCDS33478.1	.	.	.	.	.	.	.	.	.	.	G	3.992	-0.004255	0.07773	.	.	ENSG00000124116	ENST00000337205	.	.	.	3.57	0.403	0.16350	.	.	.	.	.	T	0.51975	0.1706	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38351	-0.9665	4	.	.	.	-6.9051	6.3144	0.21182	0.3578:0.0:0.6422:0.0	.	.	.	.	V	51	.	.	A	-	2	0	WFDC3	43851017	0.880000	0.30214	0.512000	0.27736	0.443000	0.32047	0.500000	0.22562	-0.003000	0.14444	0.655000	0.94253	GCA	.	.		0.512	WFDC3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316858.1		
CRYAA	1409	hgsc.bcm.edu	37	21	44589306	44589306	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr21:44589306G>A	ENST00000291554.2	+	1	189	c.97G>A	c.(97-99)Gag>Aag	p.E33K	CRYAA_ENST00000398133.1_5'Flank|CRYAA_ENST00000398132.1_5'Flank|CRYAA_ENST00000482775.1_3'UTR	NM_000394.2	NP_000385.1	P02489	CRYAA_HUMAN	crystallin, alpha A	33					negative regulation of apoptotic process (GO:0043066)|negative regulation of intracellular transport (GO:0032387)|protein homooligomerization (GO:0051260)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						GGGCCTTTTTGAGTATGACCT	0.612																																					p.E33K		Atlas-SNP	.											.	CRYAA	23	.	0			c.G97A						.						167.0	164.0	165.0					21																	44589306		2203	4300	6503	SO:0001583	missense	1409	exon1			CTTTTTGAGTATG		CCDS13695.1	21q22.3	2011-09-05			ENSG00000160202	ENSG00000160202		"""Heat shock proteins / HSPB"""	2388	protein-coding gene	gene with protein product		123580		CRYA1			Standard	XM_005261093		Approved	HSPB4	uc002zdd.1	P02489	OTTHUMG00000086842	ENST00000291554.2:c.97G>A	chr21.hg19:g.44589306G>A	ENSP00000291554:p.Glu33Lys	44.0	0.0		58.0	13.0	NM_000394	Q53X53	Missense_Mutation	SNP	ENST00000291554.2	hg19	CCDS13695.1	.	.	.	.	.	.	.	.	.	.	G	35	5.486293	0.96323	.	.	ENSG00000160202	ENST00000291554	D	0.86956	-2.19	4.88	4.88	0.63580	Alpha-crystallin, N-terminal (1);	0.051800	0.85682	D	0.000000	D	0.92407	0.7590	L	0.61036	1.89	0.80722	D	1	D	0.53745	0.962	D	0.69824	0.966	D	0.93127	0.6530	10	0.66056	D	0.02	-33.302	18.0021	0.89200	0.0:0.0:1.0:0.0	.	33	P02489	CRYAA_HUMAN	K	33	ENSP00000291554:E33K	ENSP00000291554:E33K	E	+	1	0	CRYAA	43462375	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.858000	0.92256	2.256000	0.74724	0.609000	0.83330	GAG	.	.		0.612	CRYAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195562.1		
NEFH	4744	hgsc.bcm.edu	37	22	29885648	29885648	+	Silent	SNP	A	A	G	rs267607535		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr22:29885648A>G	ENST00000310624.6	+	4	2052	c.2019A>G	c.(2017-2019)gaA>gaG	p.E673E		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	679	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAAGGCAGAAGCAAAGTCCC	0.567																																					p.E673E		Atlas-SNP	.											.	NEFH	178	.	0			c.A2019G						.						93.0	99.0	97.0					22																	29885648		2203	4299	6502	SO:0001819	synonymous_variant	4744	exon4			GGCAGAAGCAAAG		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2019A>G	chr22.hg19:g.29885648A>G		255.0	0.0		353.0	18.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
NEFH	4744	hgsc.bcm.edu	37	22	29885651	29885651	+	Silent	SNP	A	A	C	rs267607535		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr22:29885651A>C	ENST00000310624.6	+	4	2055	c.2022A>C	c.(2020-2022)gcA>gcC	p.A674A		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	680	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AGGCAGAAGCAAAGTCCCCTG	0.567																																					p.A674A		Atlas-SNP	.											.	NEFH	178	.	0			c.A2022C						.						92.0	98.0	96.0					22																	29885651		2203	4297	6500	SO:0001819	synonymous_variant	4744	exon4			AGAAGCAAAGTCC		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.2022A>C	chr22.hg19:g.29885651A>C		264.0	0.0		358.0	19.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Silent	SNP	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.567	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
TRO	7216	hgsc.bcm.edu	37	X	54957051	54957051	+	Silent	SNP	T	T	C			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chrX:54957051T>C	ENST00000173898.7	+	12	4006	c.3894T>C	c.(3892-3894)agT>agC	p.S1298S	TRO_ENST00000375022.4_Intron|TRO_ENST00000420798.2_Silent_p.S829S|TRO_ENST00000319167.8_Intron|TRO_ENST00000399736.1_Intron|TRO_ENST00000375041.2_Silent_p.S901S	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1298	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						CCAATGCTAGTTTCGGCAGCA	0.587																																					p.S1298S		Atlas-SNP	.											.	TRO	246	.	0			c.T3894C						.						81.0	76.0	77.0					X																	54957051		2133	4231	6364	SO:0001819	synonymous_variant	7216	exon12			TGCTAGTTTCGGC	U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.3894T>C	chrX.hg19:g.54957051T>C		32.0	0.0		50.0	35.0	NM_001039705	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Silent	SNP	ENST00000173898.7	hg19	CCDS43959.1																																																																																			.	.		0.587	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056837.3	NM_016157	
CXCR3	2833	hgsc.bcm.edu	37	X	70836725	70836725	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chrX:70836725G>T	ENST00000373693.3	-	2	664	c.597C>A	c.(595-597)aaC>aaA	p.N199K	CXCR3_ENST00000373691.4_Missense_Mutation_p.N246K	NM_001504.1	NP_001495.1	P49682	CXCR3_HUMAN	chemokine (C-X-C motif) receptor 3	199					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|calcium-mediated signaling (GO:0019722)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|chemokine (C-C motif) ligand 11 production (GO:0071954)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of execution phase of apoptosis (GO:1900118)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP metabolic process (GO:0030816)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of leukocyte migration (GO:0002685)|T cell chemotaxis (GO:0010818)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|chemokine binding (GO:0019956)|chemokine receptor activity (GO:0004950)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(2)|large_intestine(2)|lung(3)|ovary(2)	10	Renal(35;0.156)					AGTGGGTGGCGTTGAGGCGCT	0.662																																					p.N246K		Atlas-SNP	.											.	CXCR3	57	.	0			c.C738A						.						35.0	30.0	32.0					X																	70836725		2202	4295	6497	SO:0001583	missense	2833	exon2			GGTGGCGTTGAGG	U32674	CCDS14416.1, CCDS48135.1	Xq13	2012-08-08	2002-08-22	2002-08-23	ENSG00000186810	ENSG00000186810		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : C-X-C motif"""	4540	protein-coding gene	gene with protein product		300574	"""G protein-coupled receptor 9"""	GPR9		8666380, 9064356	Standard	NM_001142797		Approved	CKR-L2, CMKAR3, IP10-R, MigR, CD183	uc011mpx.2	P49682	OTTHUMG00000033326	ENST00000373693.3:c.597C>A	chrX.hg19:g.70836725G>T	ENSP00000362797:p.Asn199Lys	81.0	0.0		80.0	59.0	NM_001142797	B2R982|O15185|Q7Z710|Q9P2T4|Q9P2T5	Missense_Mutation	SNP	ENST00000373693.3	hg19	CCDS14416.1	.	.	.	.	.	.	.	.	.	.	G	3.738	-0.054130	0.07362	.	.	ENSG00000186810	ENST00000373691;ENST00000373693;ENST00000373687	T;T	0.40476	1.03;1.03	5.15	-10.2	0.00374	GPCR, rhodopsin-like superfamily (1);	0.669254	0.13737	N	0.366245	T	0.20292	0.0488	L	0.37750	1.13	0.09310	N	1	B;B	0.14438	0.01;0.007	B;B	0.19391	0.013;0.025	T	0.05750	-1.0866	10	0.30854	T	0.27	.	2.9748	0.05934	0.183:0.2001:0.4175:0.1993	.	246;199	P49682-2;P49682	.;CXCR3_HUMAN	K	246;199;199	ENSP00000362795:N246K;ENSP00000362797:N199K	ENSP00000362791:N199K	N	-	3	2	CXCR3	70753450	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-3.524000	0.00442	-2.177000	0.00769	-2.583000	0.00167	AAC	.	.		0.662	CXCR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000144141.1		
KIAA2022	340533	hgsc.bcm.edu	37	X	73963704	73963704	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chrX:73963704G>T	ENST00000055682.6	-	3	1299	c.688C>A	c.(688-690)Ccg>Acg	p.P230T		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	230					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TTCTGAGCCGGATCCTCCAAG	0.478																																					p.P230T		Atlas-SNP	.											.	KIAA2022	262	.	0			c.C688A						.						162.0	147.0	152.0					X																	73963704		2203	4298	6501	SO:0001583	missense	340533	exon3			GAGCCGGATCCTC		CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.688C>A	chrX.hg19:g.73963704G>T	ENSP00000055682:p.Pro230Thr	96.0	0.0		104.0	66.0	NM_001008537	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	ENST00000055682.6	hg19	CCDS35337.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863192	0.51482	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.39229	1.09;1.09	5.97	5.97	0.96955	.	0.052061	0.85682	D	0.000000	T	0.56202	0.1969	L	0.50333	1.59	0.54753	D	0.999981	D	0.56746	0.977	P	0.55923	0.787	T	0.57177	-0.7856	10	0.87932	D	0	-4.6567	19.3296	0.94280	0.0:0.0:1.0:0.0	.	230	Q5QGS0	K2022_HUMAN	T	230	ENSP00000362567:P230T;ENSP00000055682:P230T	ENSP00000055682:P230T	P	-	1	0	KIAA2022	73880429	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.145000	0.58065	2.517000	0.84864	0.600000	0.82982	CCG	.	.		0.478	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057270.2	NM_001008537	
KRTAP10-7	386675	hgsc.bcm.edu	37	21	46020873	46020874	+	Frame_Shift_Del	DEL	GT	GT	-	rs369241670		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr21:46020873_46020874delGT	ENST00000380102.2	+	1	377_378	c.352_353delGT	c.(352-354)gtcfs	p.V118fs	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	118	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						CTGCATGCCCGTCTGCTGCAAG	0.629																																					p.112_113del		Atlas-INDEL	.											.	KRTAP10-7	41	.	0			c.336_337del						.																																			SO:0001589	frameshift_variant	386675	exon2			.	AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.352_353delGT	chr21.hg19:g.46020873_46020874delGT	ENSP00000369445:p.Val118fs	42.0	0.0		52.0	11.0	NM_198689	Q0VDJ8|Q70LJ2	Frame_Shift_Del	DEL	ENST00000380102.2	hg19																																																																																				.	.		0.629	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128038.1	NM_198689	
ZCRB1	85437	hgsc.bcm.edu	37	12	42707501	42707502	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr12:42707501_42707502delTA	ENST00000266529.3	-	7	695_696	c.512_513delTA	c.(511-513)atafs	p.I171fs	ZCRB1_ENST00000552673.1_Frame_Shift_Del_p.I130fs|PPHLN1_ENST00000549190.1_Intron	NM_033114.3	NP_149105.3	Q8TBF4	ZCRB1_HUMAN	zinc finger CCHC-type and RNA binding motif 1	171					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)	8	all_cancers(12;0.000348)|Breast(8;0.221)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0689)		CCTGGAATGCTATGGCCTGACT	0.381																																					p.171_172del		Atlas-INDEL	.											.	ZCRB1	20	.	0			c.513_514del						.																																			SO:0001589	frameshift_variant	85437	exon7			.	BC022543	CCDS8740.1	12q12	2013-02-12				ENSG00000139168		"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	29620	protein-coding gene	gene with protein product	"""U11/U12 snRNP 31K"""	610750				15146077, 16959469	Standard	NM_033114		Approved	MADP-1, MADP1, RBM36, ZCCHC19, SNRNP31	uc001rmz.3	Q8TBF4	OTTHUMG00000169382	ENST00000266529.3:c.512_513delTA	chr12.hg19:g.42707501_42707502delTA	ENSP00000266529:p.Ile171fs	84.0	0.0		116.0	43.0	NM_033114	Q6PJX0|Q96TA6	Frame_Shift_Del	DEL	ENST00000266529.3	hg19	CCDS8740.1																																																																																			.	.		0.381	ZCRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403813.1	NM_033114	
DPP7	29952	hgsc.bcm.edu	37	9	140008389	140008402	+	Frame_Shift_Del	DEL	AAGTCGGCCAGGGC	AAGTCGGCCAGGGC	-	rs375634482		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	AAGTCGGCCAGGGC	AAGTCGGCCAGGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr9:140008389_140008402delAAGTCGGCCAGGGC	ENST00000371579.2	-	4	404_417	c.400_413delGCCCTGGCCGACTT	c.(400-414)gccctggccgacttcfs	p.ALADF134fs		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	134						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		CAGCTCTGCGAAGTCGGCCAGGGCCTGCTCCACC	0.724																																					p.134_138del		Atlas-INDEL	.											.	DPP7	22	.	0			c.401_414del						.																																			SO:0001589	frameshift_variant	29952	exon4			.	AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.400_413delGCCCTGGCCGACTT	chr9.hg19:g.140008389_140008402delAAGTCGGCCAGGGC	ENSP00000360635:p.Ala134fs	54.0	0.0		40.0	11.0	NM_013379	A8K7U7|Q5VSF1|Q969X4	Frame_Shift_Del	DEL	ENST00000371579.2	hg19	CCDS7030.1																																																																																			.	.		0.724	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055279.1	NM_013379	
ARID2	196528	hgsc.bcm.edu	37	12	46244346	46244347	+	Frame_Shift_Del	DEL	AC	AC	-	rs148307427		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	AC	AC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr12:46244346_46244347delAC	ENST00000334344.6	+	15	2612_2613	c.2440_2441delAC	c.(2440-2442)acafs	p.T814fs	ARID2_ENST00000422737.1_Frame_Shift_Del_p.T665fs|ARID2_ENST00000444670.1_Frame_Shift_Del_p.T424fs|ARID2_ENST00000457135.1_5'Flank|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	814	Gln-rich.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		ATGTACTTCTACAGTTTCACAG	0.45			"""N, S, F"""		hepatocellular carcinoma																																p.813_814del		Atlas-INDEL	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.2439_2440del						.																																			SO:0001589	frameshift_variant	196528	exon15			.		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.2440_2441delAC	chr12.hg19:g.46244346_46244347delAC	ENSP00000335044:p.Thr814fs	90.0	0.0		110.0	35.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Frame_Shift_Del	DEL	ENST00000334344.6	hg19	CCDS31783.1																																																																																			.	.		0.450	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
RTEL1	51750	hgsc.bcm.edu	37	20	62316913	62316928	+	Frame_Shift_Del	DEL	GTTCCCCAGCAGGGCT	GTTCCCCAGCAGGGCT	-			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	GTTCCCCAGCAGGGCT	GTTCCCCAGCAGGGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr20:62316913_62316928delGTTCCCCAGCAGGGCT	ENST00000360203.5	+	15	1554_1569	c.1229_1244delGTTCCCCAGCAGGGCT	c.(1228-1245)ggttccccagcagggctgfs	p.GSPAGL410fs	RTEL1_ENST00000318100.4_Frame_Shift_Del_p.GSPAGL410fs|RTEL1_ENST00000370018.3_Frame_Shift_Del_p.GSPAGL410fs|RTEL1_ENST00000508582.2_Frame_Shift_Del_p.GSPAGL434fs|RTEL1-TNFRSF6B_ENST00000482936.1_Frame_Shift_Del_p.GSPAGL410fs					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GGCAGCCCTGGTTCCCCAGCAGGGCTGGGGGCCTTA	0.634																																					p.434_439del		Atlas-INDEL	.											.	RTEL1	114	.	0			c.1300_1315del						.																																			SO:0001589	frameshift_variant	51750	exon15			.	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1229_1244delGTTCCCCAGCAGGGCT	chr20.hg19:g.62316913_62316928delGTTCCCCAGCAGGGCT	ENSP00000353332:p.Gly410fs	61.0	0.0		102.0	15.0	NM_032957		Frame_Shift_Del	DEL	ENST00000360203.5	hg19																																																																																				.	.		0.634	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
ITGAM	3684	hgsc.bcm.edu	37	16	31289337	31289337	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr16:31289337delG	ENST00000287497.8	+	12	1338	c.1263delG	c.(1261-1263)ctgfs	p.L421fs	ITGAM_ENST00000544665.3_Frame_Shift_Del_p.L421fs			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	421					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GCCTGGTTCTGGGGGCACCTC	0.587																																					p.L421fs		Atlas-INDEL	.											.	ITGAM	137	.	0			c.1262delT						.						46.0	47.0	47.0					16																	31289337		2047	4191	6238	SO:0001589	frameshift_variant	3684	exon12			.	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.1263delG	chr16.hg19:g.31289337delG	ENSP00000287497:p.Leu421fs	76.0	0.0		126.0	41.0	NM_000632	Q4VAK0|Q4VAK1|Q4VAK2	Frame_Shift_Del	DEL	ENST00000287497.8	hg19	CCDS45470.1																																																																																			.	.		0.587	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
BRD7	29117	hgsc.bcm.edu	37	16	50388735	50388736	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr16:50388735_50388736insT	ENST00000394688.3	-	3	515_516	c.356_357insA	c.(355-357)aagfs	p.K119fs	snoU13_ENST00000459559.1_RNA|BRD7_ENST00000401491.3_5'UTR|BRD7_ENST00000394689.2_Frame_Shift_Ins_p.K119fs			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	119					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				TTGTGAGAGGCTTCTCAGGAGG	0.45																																					p.K119fs		Atlas-INDEL	.											.	BRD7	61	.	0			c.357_358insA						.																																			SO:0001589	frameshift_variant	29117	exon3			.	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.357dupA	chr16.hg19:g.50388737_50388737dupT	ENSP00000378180:p.Lys119fs	175.0	0.0		161.0	70.0	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Frame_Shift_Ins	INS	ENST00000394688.3	hg19	CCDS10742.1																																																																																			.	.		0.450	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
HNRNPA2B1	3181	hgsc.bcm.edu	37	7	26232938	26232940	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr7:26232938_26232940delAGA	ENST00000354667.4	-	10	1099_1101	c.931_933delTCT	c.(931-933)tctdel	p.S311del	HNRNPA2B1_ENST00000356674.7_In_Frame_Del_p.S299del|HNRNPA2B1_ENST00000476233.1_5'Flank	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	311	Gly-rich.|Nuclear targeting sequence. {ECO:0000250}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						GACCGTAGTTAGAAGGTTGCTGG	0.34			T	ETV1	prostate																																p.311_312del		Atlas-INDEL	.		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	.	HNRNPA2B1	70	.	0			c.932_934del						.																																			SO:0001651	inframe_deletion	3181	exon10			.	D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.931_933delTCT	chr7.hg19:g.26232938_26232940delAGA	ENSP00000346694:p.Ser311del	89.0	0.0		93.0	33.0	NM_031243	A8K064|P22627|Q9UC98|Q9UDJ2	In_Frame_Del	DEL	ENST00000354667.4	hg19	CCDS43557.1																																																																																			.	.		0.340	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214109.1	NM_002137	
SMTNL1	219537	hgsc.bcm.edu	37	11	57310839	57310841	+	Intron	DEL	GAG	GAG	-	rs370650341		TCGA-DD-AAEH-01A-11D-A40R-10	TCGA-DD-AAEH-10A-01D-A40U-10	GAG	GAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fa21884c-96c0-4146-a5fe-65cade5f3658	3c6c79fc-5876-4247-8e0c-edba801ceb16	g.chr11:57310839_57310841delGAG	ENST00000399154.2	+	2	621				SMTNL1_ENST00000457912.1_In_Frame_Del_p.E261del|SMTNL1_ENST00000527972.1_In_Frame_Del_p.E243del			A8MU46	SMTL1_HUMAN	smoothelin-like 1						negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GGAGGATGCAGAGGAGGCAGTGA	0.562																																					p.241_242del		Atlas-INDEL	.											.	SMTNL1	68	.	0			c.723_725del						.																																			SO:0001627	intron_variant	219537	exon1			.	BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.621+25GAG>-	chr11.hg19:g.57310842_57310844delGAG		187.0	0.0		235.0	36.0	NM_001105565		In_Frame_Del	DEL	ENST00000399154.2	hg19																																																																																				.	.		0.562	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_166203	
