#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KAZN	23254	hgsc.bcm.edu	37	1	15382644	15382644	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:15382644A>T	ENST00000376030.2	+	5	1078	c.784A>T	c.(784-786)Atg>Ttg	p.M262L	KAZN_ENST00000361144.5_Missense_Mutation_p.M256L|KAZN_ENST00000400798.2_Missense_Mutation_p.M168L|KAZN_ENST00000400797.3_Missense_Mutation_p.M168L|KAZN_ENST00000503743.1_Missense_Mutation_p.M262L|KAZN_ENST00000422387.2_Missense_Mutation_p.M262L	NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	262	Interaction with PPL.				keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						TTCCCTCGCCATGCCGGGCGA	0.597																																					p.M262L		Atlas-SNP	.											.	KAZN	57	.	0			c.A784T						.						76.0	73.0	74.0					1																	15382644		2203	4300	6503	SO:0001583	missense	23254	exon5			CTCGCCATGCCGG	AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.784A>T	chr1.hg19:g.15382644A>T	ENSP00000365198:p.Met262Leu	189.0	0.0		169.0	61.0	NM_015209	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Missense_Mutation	SNP	ENST00000376030.2	hg19	CCDS152.2	.	.	.	.	.	.	.	.	.	.	A	20.2	3.946075	0.73672	.	.	ENSG00000189337	ENST00000376030;ENST00000503743;ENST00000422387;ENST00000361144;ENST00000400798;ENST00000400797	T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81	5.68	5.68	0.88126	.	0.073974	0.85682	D	0.000000	T	0.35740	0.0942	L	0.27053	0.805	0.45183	D	0.998197	B;B;B;B	0.16396	0.003;0.017;0.01;0.003	B;B;B;B	0.08055	0.003;0.003;0.003;0.001	T	0.11767	-1.0574	10	0.23891	T	0.37	-31.2401	15.1533	0.72720	1.0:0.0:0.0:0.0	.	262;168;256;262	Q674X7-2;Q674X7-4;Q674X7-3;Q674X7	.;.;.;KAZRN_HUMAN	L	262;262;262;256;168;168	ENSP00000365198:M262L;ENSP00000426015:M262L;ENSP00000391728:M262L;ENSP00000354727:M256L;ENSP00000383602:M168L;ENSP00000383601:M168L	ENSP00000354727:M256L	M	+	1	0	KAZN	15255231	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.836000	0.75349	2.176000	0.68965	0.454000	0.30748	ATG	.	.		0.597	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005690.2	NM_001017999	
AHDC1	27245	hgsc.bcm.edu	37	1	27876698	27876698	+	Silent	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:27876698C>T	ENST00000247087.5	-	5	2525	c.1929G>A	c.(1927-1929)ccG>ccA	p.P643P	AHDC1_ENST00000374011.2_Silent_p.P643P			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	643							DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCACCGACTCCGGCTCACTGG	0.677																																					p.P643P		Atlas-SNP	.											.	AHDC1	98	.	0			c.G1929A						.						54.0	57.0	56.0					1																	27876698		2203	4298	6501	SO:0001819	synonymous_variant	27245	exon6			CGACTCCGGCTCA	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.1929G>A	chr1.hg19:g.27876698C>T		70.0	0.0		77.0	30.0	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	ENST00000247087.5	hg19	CCDS30652.1																																																																																			.	.		0.677	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
PPT1	5538	hgsc.bcm.edu	37	1	40562825	40562825	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:40562825G>T	ENST00000433473.3	-	1	550	c.86C>A	c.(85-87)cCg>cAg	p.P29Q	PPT1_ENST00000449045.2_Missense_Mutation_p.P29Q	NM_000310.3	NP_000301.1	P50897	PPT1_HUMAN	palmitoyl-protein thioesterase 1	29					adult locomotory behavior (GO:0008344)|associative learning (GO:0008306)|brain development (GO:0007420)|cell death (GO:0008219)|cellular protein catabolic process (GO:0044257)|cofactor metabolic process (GO:0051186)|cofactor transport (GO:0051181)|grooming behavior (GO:0007625)|lipid catabolic process (GO:0016042)|lysosomal lumen acidification (GO:0007042)|membrane raft organization (GO:0031579)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)|neuron development (GO:0048666)|neurotransmitter secretion (GO:0007269)|pinocytosis (GO:0006907)|positive regulation of pinocytosis (GO:0048549)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein catabolic process (GO:0030163)|protein depalmitoylation (GO:0002084)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|regulation of phospholipase A2 activity (GO:0032429)|regulation of synapse structure and activity (GO:0050803)|sphingolipid catabolic process (GO:0030149)|visual perception (GO:0007601)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|synaptic vesicle (GO:0008021)	palmitoyl-(protein) hydrolase activity (GO:0008474)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(5)|large_intestine(1)|lung(3)|ovary(1)|stomach(1)	11	Lung NSC(20;3.43e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1e-18)|Epithelial(16;3.6e-17)|all cancers(16;1.1e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CGGCGCCGGCGGGTCCAGATG	0.612																																					p.P29Q		Atlas-SNP	.											.	PPT1	18	.	0			c.C86A						.						77.0	92.0	87.0					1																	40562825		2203	4300	6503	SO:0001583	missense	5538	exon1			GCCGGCGGGTCCA	U44772	CCDS447.1, CCDS44119.1	1p32	2014-09-17	2008-07-31		ENSG00000131238	ENSG00000131238	3.1.2.22		9325	protein-coding gene	gene with protein product	"""ceroid-lipofuscinosis, neuronal 1, infantile"""	600722		PPT		7637805, 8325646	Standard	NM_000310		Approved	CLN1, INCL	uc001cfb.2	P50897	OTTHUMG00000004495	ENST00000433473.3:c.86C>A	chr1.hg19:g.40562825G>T	ENSP00000394863:p.Pro29Gln	411.0	1.0		436.0	138.0	NM_000310	B4DY24|Q6FGQ4	Missense_Mutation	SNP	ENST00000433473.3	hg19	CCDS447.1	.	.	.	.	.	.	.	.	.	.	G	10.82	1.458532	0.26248	.	.	ENSG00000131238	ENST00000433473;ENST00000449045;ENST00000372779	D;D;D	0.97772	-4.53;-3.67;-3.34	4.44	1.4	0.22301	.	1.031490	0.07620	N	0.926940	D	0.95433	0.8517	N	0.12182	0.205	0.58432	D	0.999998	D;B	0.76494	0.999;0.001	D;B	0.64776	0.929;0.002	D	0.89117	0.3500	10	0.18276	T	0.48	-9.0386	3.8965	0.09141	0.0908:0.1622:0.5793:0.1677	.	29;29	P50897-2;P50897	.;PPT1_HUMAN	Q	29	ENSP00000394863:P29Q;ENSP00000392293:P29Q;ENSP00000361865:P29Q	ENSP00000361865:P29Q	P	-	2	0	PPT1	40335412	0.150000	0.22732	0.053000	0.19242	0.036000	0.12997	0.171000	0.16685	0.194000	0.20326	-0.188000	0.12872	CCG	.	.		0.612	PPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013126.2	NM_000310	
LRP8	7804	hgsc.bcm.edu	37	1	53716470	53716470	+	Silent	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:53716470G>T	ENST00000306052.6	-	17	2669	c.2568C>A	c.(2566-2568)acC>acA	p.T856T	LRP8_ENST00000347547.2_Silent_p.T686T|LRP8_ENST00000354412.3_Silent_p.T652T|LRP8_ENST00000465675.1_Silent_p.T409T|LRP8_ENST00000371454.2_Silent_p.T856T	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	856					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						TCATGCTTTTGGTGTTCTTCC	0.488																																					p.T856T		Atlas-SNP	.											.	LRP8	58	.	0			c.C2568A						.						302.0	255.0	271.0					1																	53716470		2203	4300	6503	SO:0001819	synonymous_variant	7804	exon17			GCTTTTGGTGTTC	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2568C>A	chr1.hg19:g.53716470G>T		59.0	0.0		65.0	22.0	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Silent	SNP	ENST00000306052.6	hg19	CCDS578.1																																																																																			.	.		0.488	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
ASB17	127247	hgsc.bcm.edu	37	1	76397715	76397715	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:76397715C>A	ENST00000284142.6	-	1	401	c.262G>T	c.(262-264)Gac>Tac	p.D88Y		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	88					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						TCAGTGAAGTCGAGGTTAAAA	0.378																																					p.D88Y		Atlas-SNP	.											ASB17,colon,carcinoma,0,1	ASB17	53	.	0			c.G262T						.						105.0	99.0	101.0					1																	76397715		2203	4300	6503	SO:0001583	missense	127247	exon1			TGAAGTCGAGGTT	AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.262G>T	chr1.hg19:g.76397715C>A	ENSP00000284142:p.Asp88Tyr	184.0	0.0		192.0	65.0	NM_080868	B1APB8|Q8N0X5	Missense_Mutation	SNP	ENST00000284142.6	hg19	CCDS671.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027149	0.54683	.	.	ENSG00000154007	ENST00000284142	T	0.34072	1.38	5.97	5.97	0.96955	.	0.103499	0.42172	D	0.000741	T	0.16041	0.0386	N	0.08118	0	0.32374	N	0.555447	P	0.49447	0.924	P	0.45660	0.489	T	0.07009	-1.0795	10	0.87932	D	0	.	15.9063	0.79433	0.0:1.0:0.0:0.0	.	88	Q8WXJ9	ASB17_HUMAN	Y	88	ENSP00000284142:D88Y	ENSP00000284142:D88Y	D	-	1	0	ASB17	76170303	0.999000	0.42202	1.000000	0.80357	0.458000	0.32498	4.054000	0.57434	2.831000	0.97527	0.655000	0.94253	GAC	.	.		0.378	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026982.1	NM_080868	
MCOLN2	255231	hgsc.bcm.edu	37	1	85406668	85406668	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:85406668T>A	ENST00000370608.3	-	8	921	c.854A>T	c.(853-855)aAa>aTa	p.K285I	MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Missense_Mutation_p.K257I	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	285					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		CTGAGCATTTTTCTGAGCTGA	0.353																																					p.K285I		Atlas-SNP	.											.	MCOLN2	60	.	0			c.A854T						.						111.0	95.0	101.0					1																	85406668		2203	4300	6503	SO:0001583	missense	255231	exon8			GCATTTTTCTGAG	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.854A>T	chr1.hg19:g.85406668T>A	ENSP00000359640:p.Lys285Ile	122.0	0.0		93.0	31.0	NM_153259	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	hg19	CCDS30762.1	.	.	.	.	.	.	.	.	.	.	T	12.19	1.864426	0.32977	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.80304	-1.36;-1.36	5.69	4.57	0.56435	.	0.043144	0.85682	D	0.000000	T	0.76097	0.3940	M	0.65975	2.015	0.48696	D	0.999699	P	0.50710	0.938	P	0.52267	0.694	T	0.74639	-0.3598	10	0.29301	T	0.29	-37.61	10.8523	0.46777	0.0:0.0746:0.0:0.9254	.	285	Q8IZK6	MCLN2_HUMAN	I	285;257	ENSP00000359640:K285I;ENSP00000284027:K257I	ENSP00000284027:K257I	K	-	2	0	MCOLN2	85179256	1.000000	0.71417	0.961000	0.40146	0.480000	0.33159	3.081000	0.50120	1.006000	0.39211	0.533000	0.62120	AAA	.	.		0.353	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259	
MCOLN2	255231	hgsc.bcm.edu	37	1	85422189	85422189	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:85422189A>T	ENST00000370608.3	-	4	557	c.490T>A	c.(490-492)Tgt>Agt	p.C164S	MCOLN2_ENST00000531325.1_5'UTR|MCOLN2_ENST00000284027.5_Missense_Mutation_p.C136S	NM_153259.2	NP_694991.2	Q8IZK6	MCLN2_HUMAN	mucolipin 2	164					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)	18				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		TGCTGCTTACAGACTTTTAAG	0.373																																					p.C164S		Atlas-SNP	.											.	MCOLN2	60	.	0			c.T490A						.						222.0	211.0	215.0					1																	85422189		2203	4300	6503	SO:0001583	missense	255231	exon4			GCTTACAGACTTT	AK094010	CCDS30762.1	1p22	2011-12-16			ENSG00000153898	ENSG00000153898		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13357	protein-coding gene	gene with protein product		607399				16382100	Standard	XM_005270719		Approved	TRPML2, FLJ36691, TRP-ML2	uc001dkm.3	Q8IZK6	OTTHUMG00000009954	ENST00000370608.3:c.490T>A	chr1.hg19:g.85422189A>T	ENSP00000359640:p.Cys164Ser	133.0	0.0		144.0	6.0	NM_153259	A6NI99|Q2M3I6|Q5TAG5|Q8N9R3	Missense_Mutation	SNP	ENST00000370608.3	hg19	CCDS30762.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.651683	0.88056	.	.	ENSG00000153898	ENST00000370608;ENST00000284027	T;T	0.57107	0.42;0.42	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.69904	0.3163	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.76165	-0.3059	10	0.66056	D	0.02	-43.9047	14.9755	0.71267	1.0:0.0:0.0:0.0	.	164	Q8IZK6	MCLN2_HUMAN	S	164;136	ENSP00000359640:C164S;ENSP00000284027:C136S	ENSP00000284027:C136S	C	-	1	0	MCOLN2	85194777	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.557000	0.90700	2.073000	0.62155	0.528000	0.53228	TGT	.	.		0.373	MCOLN2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027567.2	NM_153259	
PRRC2C	23215	hgsc.bcm.edu	37	1	171484941	171484941	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:171484941A>G	ENST00000338920.4	+	5	700	c.463A>G	c.(463-465)Aaa>Gaa	p.K155E	PRRC2C_ENST00000367742.3_Missense_Mutation_p.K157E|PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000426496.2_Missense_Mutation_p.K155E|PRRC2C_ENST00000392078.3_Missense_Mutation_p.K157E	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	155					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TCAGGAAAAAAAAGAAAAGGA	0.358																																					p.K155E		Atlas-SNP	.											.	.	.	.	0			c.A463G						.						73.0	73.0	73.0					1																	171484941		2203	4300	6503	SO:0001583	missense	23215	exon5			GAAAAAAAAGAAA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.463A>G	chr1.hg19:g.171484941A>G	ENSP00000343629:p.Lys155Glu	559.0	0.0		587.0	218.0	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	hg19	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	A	14.81	2.645066	0.47258	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920	T;T;T;T	0.21543	2.0;2.0;2.0;2.0	5.62	5.62	0.85841	BAT2, N-terminal (1);	0.000000	0.47852	D	0.000217	T	0.16428	0.0395	N	0.08118	0	0.37848	D	0.929294	D;D;B	0.69078	0.996;0.997;0.224	P;P;B	0.62885	0.851;0.908;0.171	T	0.28650	-1.0037	10	0.72032	D	0.01	.	16.1189	0.81329	1.0:0.0:0.0:0.0	.	155;157;155	Q9Y520-4;E7EPN9;Q9Y520	.;.;PRC2C_HUMAN	E	157;155;155;157;155	ENSP00000375928:K157E;ENSP00000410219:K155E;ENSP00000356716:K157E;ENSP00000343629:K155E	ENSP00000343629:K155E	K	+	1	0	PRRC2C	169751565	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.667000	0.91153	2.263000	0.75096	0.533000	0.62120	AAA	.	.		0.358	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
HMCN1	83872	hgsc.bcm.edu	37	1	186088326	186088326	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr1:186088326C>A	ENST00000271588.4	+	78	12081	c.11852C>A	c.(11851-11853)gCa>gAa	p.A3951E	HMCN1_ENST00000367492.2_Missense_Mutation_p.A3951E	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3951	Ig-like C2-type 38.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.A3951V(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TTTTTAGGAGCAATTGAAATA	0.363																																					p.A3951E		Atlas-SNP	.											HMCN1,NS,carcinoma,+1,1	HMCN1	797	.	1	Substitution - Missense(1)	large_intestine(1)	c.C11852A						.						76.0	75.0	76.0					1																	186088326		2203	4300	6503	SO:0001583	missense	83872	exon78			TAGGAGCAATTGA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11852C>A	chr1.hg19:g.186088326C>A	ENSP00000271588:p.Ala3951Glu	140.0	0.0		161.0	57.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	C	19.48	3.836205	0.71373	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66099	-0.19;-0.19	5.44	5.44	0.79542	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.350254	0.33496	N	0.004859	T	0.52125	0.1715	L	0.31476	0.935	0.09310	N	0.999997	P	0.48834	0.916	P	0.50405	0.64	T	0.45977	-0.9224	10	0.06757	T	0.87	.	9.2806	0.37727	0.0:0.7773:0.1464:0.0763	.	3951	Q96RW7	HMCN1_HUMAN	E	3951	ENSP00000271588:A3951E;ENSP00000356462:A3951E	ENSP00000271588:A3951E	A	+	2	0	HMCN1	184354949	0.027000	0.19231	0.982000	0.44146	0.978000	0.69477	2.525000	0.45598	2.563000	0.86464	0.585000	0.79938	GCA	.	.		0.363	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
USP34	9736	hgsc.bcm.edu	37	2	61632843	61632843	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:61632843C>T	ENST00000398571.2	-	3	628	c.552G>A	c.(550-552)gaG>gaA	p.E184E		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	184					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TTTTACATACCTCAATAGTAG	0.343																																					p.E184E		Atlas-SNP	.											.	USP34	334	.	0			c.G552A						.						53.0	50.0	51.0					2																	61632843		1821	4070	5891	SO:0001630	splice_region_variant	9736	exon3			ACATACCTCAATA	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.552+1G>A	chr2.hg19:g.61632843C>T		316.0	1.0		300.0	106.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Silent	SNP	ENST00000398571.2	hg19	CCDS42686.1																																																																																			.	.		0.343	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		Silent
ARHGAP25	9938	hgsc.bcm.edu	37	2	69014971	69014971	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:69014971G>A	ENST00000295381.3	+	4	768		c.e4-1		ARHGAP25_ENST00000467265.1_Intron|ARHGAP25_ENST00000497079.1_Splice_Site|ARHGAP25_ENST00000409202.3_Splice_Site|ARHGAP25_ENST00000409030.3_Splice_Site|ARHGAP25_ENST00000409220.1_Splice_Site|ARHGAP25_ENST00000544262.1_Splice_Site|ARHGAP25_ENST00000456116.2_Intron	NM_001007231.2	NP_001007232.2	P42331	RHG25_HUMAN	Rho GTPase activating protein 25						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(20)|ovary(3)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	52						TCTTCCTCCAGCCTCATGGGA	0.493																																					.		Atlas-SNP	.											.	ARHGAP25	175	.	0			c.350-1G>A						.						133.0	126.0	129.0					2																	69014971		2203	4300	6503	SO:0001630	splice_region_variant	9938	exon4			CCTCCAGCCTCAT	D29642	CCDS33214.1, CCDS46312.1, CCDS33214.2, CCDS54363.1, CCDS54364.1	2p13.3	2013-01-10			ENSG00000163219	ENSG00000163219		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	28951	protein-coding gene	gene with protein product		610587				7584044	Standard	NM_001007231		Approved	KIAA0053	uc010fdg.3	P42331	OTTHUMG00000152621	ENST00000295381.3:c.350-1G>A	chr2.hg19:g.69014971G>A		84.0	0.0		77.0	24.0	NM_001007231	A8K2Y1|B7Z498|E9PFQ7|G5E9G2|Q8IXQ2	Splice_Site	SNP	ENST00000295381.3	hg19		.	.	.	.	.	.	.	.	.	.	G	19.32	3.805391	0.70682	.	.	ENSG00000163219	ENST00000544262;ENST00000295381;ENST00000409202;ENST00000409030;ENST00000409220;ENST00000482106;ENST00000497079;ENST00000543533	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5025	0.75709	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP25	68868475	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	5.337000	0.65941	2.722000	0.93159	0.467000	0.42956	.	.	.		0.493	ARHGAP25-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014882	Intron
LRRTM1	347730	hgsc.bcm.edu	37	2	80529433	80529433	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:80529433G>C	ENST00000295057.3	-	2	2168	c.1512C>G	c.(1510-1512)atC>atG	p.I504M	CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000466387.1_Intron|LRRTM1_ENST00000409148.1_Missense_Mutation_p.I504M|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000361291.4_Intron|CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000540488.1_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	504					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CATACTCGTTGATGATCACCA	0.537										HNSCC(69;0.2)																											p.I504M		Atlas-SNP	.											.	LRRTM1	251	.	0			c.C1512G						.						122.0	100.0	108.0					2																	80529433		2203	4300	6503	SO:0001583	missense	347730	exon2			CTCGTTGATGATC	AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.1512C>G	chr2.hg19:g.80529433G>C	ENSP00000295057:p.Ile504Met	65.0	0.0		75.0	28.0	NM_178839	A8K397|D6W5K1|Q96DN1	Missense_Mutation	SNP	ENST00000295057.3	hg19	CCDS1966.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534723	0.64972	.	.	ENSG00000162951	ENST00000295057;ENST00000409148	T;T	0.45276	0.9;0.9	4.99	2.89	0.33648	.	0.000000	0.64402	U	0.000001	T	0.44685	0.1305	L	0.34521	1.04	0.53688	D	0.999972	D	0.76494	0.999	D	0.80764	0.994	T	0.36407	-0.9749	9	.	.	.	.	4.1559	0.10260	0.5312:0.0:0.4688:0.0	.	504	Q86UE6	LRRT1_HUMAN	M	504	ENSP00000295057:I504M;ENSP00000386646:I504M	.	I	-	3	3	LRRTM1	80382944	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.463000	0.60128	1.069000	0.40788	0.561000	0.74099	ATC	.	.		0.537	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313614.1	NM_178839	
DNAH6	1768	hgsc.bcm.edu	37	2	84838966	84838966	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:84838966G>A	ENST00000237449.6	+	21	3471	c.3463G>A	c.(3463-3465)Gct>Act	p.A1155T	DNAH6_ENST00000389394.3_Missense_Mutation_p.A1155T|DNAH6_ENST00000398278.2_Missense_Mutation_p.A1155T			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	1155	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TCTTCGAGCCGCTACTCAGCC	0.438																																					p.A1155T		Atlas-SNP	.											.	DNAH6	194	.	0			c.G3463A						.						10.0	17.0	15.0					2																	84838966		691	1590	2281	SO:0001583	missense	1768	exon22			CGAGCCGCTACTC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.3463G>A	chr2.hg19:g.84838966G>A	ENSP00000237449:p.Ala1155Thr	459.0	0.0		506.0	166.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019585	0.75275	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.60672	0.17;0.17;0.17	5.6	4.72	0.59763	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.30135	0.0755	N	0.02960	-0.455	0.37171	D	0.903055	P	0.39831	0.69	B	0.33690	0.168	T	0.32771	-0.9894	9	0.19147	T	0.46	.	14.7236	0.69326	0.0:0.0:0.8537:0.1463	.	1155	Q9C0G6	DYH6_HUMAN	T	1155	ENSP00000374045:A1155T;ENSP00000381326:A1155T;ENSP00000237449:A1155T	ENSP00000237449:A1155T	A	+	1	0	DNAH6	84692477	1.000000	0.71417	0.936000	0.37596	0.929000	0.56500	6.457000	0.73505	1.336000	0.45506	0.655000	0.94253	GCT	.	.		0.438	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
CHST10	9486	hgsc.bcm.edu	37	2	101023123	101023123	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:101023123C>A	ENST00000264249.3	-	3	400	c.15G>T	c.(13-15)tgG>tgT	p.W5C	CHST10_ENST00000485085.1_5'Flank|CHST10_ENST00000542617.1_Missense_Mutation_p.W53C|CHST10_ENST00000409701.1_Missense_Mutation_p.W5C	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	5					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						CCAGCAGAAGCCACTGGTGGT	0.478																																					p.W5C		Atlas-SNP	.											.	CHST10	42	.	0			c.G15T						.						164.0	162.0	163.0					2																	101023123		2203	4300	6503	SO:0001583	missense	9486	exon3			CAGAAGCCACTGG	BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.15G>T	chr2.hg19:g.101023123C>A	ENSP00000264249:p.Trp5Cys	112.0	0.0		119.0	30.0	NM_004854	Q53T18	Missense_Mutation	SNP	ENST00000264249.3	hg19	CCDS2047.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.445829	0.84101	.	.	ENSG00000115526	ENST00000264249;ENST00000542617;ENST00000409701;ENST00000409046;ENST00000420858;ENST00000448989;ENST00000421474;ENST00000418201;ENST00000435960	T;T;T;T;T;T;T;T;T	0.80480	-0.69;-0.83;-0.69;0.54;0.44;-0.92;-0.4;-0.78;-1.38	5.18	5.18	0.71444	.	0.126578	0.64402	D	0.000020	D	0.85669	0.5750	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.87273	0.2287	10	0.87932	D	0	-14.9306	19.0742	0.93154	0.0:1.0:0.0:0.0	.	5	O43529	CHSTA_HUMAN	C	5;53;5;5;5;53;5;5;5	ENSP00000264249:W5C;ENSP00000438869:W53C;ENSP00000387309:W5C;ENSP00000387121:W5C;ENSP00000405922:W5C;ENSP00000387977:W53C;ENSP00000407525:W5C;ENSP00000416831:W5C;ENSP00000395643:W5C	ENSP00000264249:W5C	W	-	3	0	CHST10	100389555	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.596000	0.74113	2.576000	0.86940	0.655000	0.94253	TGG	.	.		0.478	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	
GCC2	9648	hgsc.bcm.edu	37	2	109087121	109087121	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:109087121T>A	ENST00000309863.6	+	6	2050	c.1336T>A	c.(1336-1338)Tca>Aca	p.S446T		NM_181453.3	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain containing 2	446					Golgi ribbon formation (GO:0090161)|late endosome to Golgi transport (GO:0034499)|microtubule anchoring (GO:0034453)|microtubule organizing center organization (GO:0031023)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|recycling endosome to Golgi transport (GO:0071955)|regulation of protein exit from endoplasmic reticulum (GO:0070861)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	identical protein binding (GO:0042802)			breast(8)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	54						GACATTTTTGTCAGATTCAGA	0.303																																					p.S446T		Atlas-SNP	.											.	GCC2	129	.	0			c.T1336A						.						29.0	33.0	31.0					2																	109087121		2198	4280	6478	SO:0001583	missense	9648	exon6			TTTTTGTCAGATT	BC020645	CCDS33268.1	2q12.3	2008-02-05	2004-03-05		ENSG00000135968	ENSG00000135968			23218	protein-coding gene	gene with protein product		612711	"""GRIP and coiled-coil domain-containing 2"""			12446665	Standard	NM_181453		Approved	GCC185, KIAA0336	uc002tec.3	Q8IWJ2	OTTHUMG00000153214	ENST00000309863.6:c.1336T>A	chr2.hg19:g.109087121T>A	ENSP00000307939:p.Ser446Thr	472.0	1.0		446.0	158.0	NM_181453	A6H8X8|O15045|Q4ZG46|Q8TDH3|Q9H2G8	Missense_Mutation	SNP	ENST00000309863.6	hg19	CCDS33268.1	.	.	.	.	.	.	.	.	.	.	T	14.30	2.494343	0.44352	.	.	ENSG00000135968	ENST00000435553;ENST00000309863;ENST00000409896;ENST00000393318	T	0.34275	1.37	5.82	5.82	0.92795	.	0.509240	0.18819	N	0.130285	T	0.42921	0.1224	M	0.67953	2.075	0.09310	N	0.999997	D	0.53151	0.958	P	0.45276	0.475	T	0.43310	-0.9399	10	0.27082	T	0.32	.	16.1832	0.81925	0.0:0.0:0.0:1.0	.	446	Q8IWJ2	GCC2_HUMAN	T	446;446;409;191	ENSP00000307939:S446T	ENSP00000307939:S446T	S	+	1	0	GCC2	108453553	0.699000	0.27786	0.993000	0.49108	0.708000	0.40852	2.938000	0.48987	2.218000	0.71995	0.533000	0.62120	TCA	.	.		0.303	GCC2-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358516.3	NM_014635	
NEB	4703	hgsc.bcm.edu	37	2	152581406	152581406	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:152581406C>T	ENST00000172853.10	-	7	619	c.472G>A	c.(472-474)Gaa>Aaa	p.E158K	NEB_ENST00000409198.1_Missense_Mutation_p.E158K|NEB_ENST00000427231.2_Missense_Mutation_p.E158K|NEB_ENST00000604864.1_Missense_Mutation_p.E158K|NEB_ENST00000603639.1_Missense_Mutation_p.E158K|NEB_ENST00000397345.3_Missense_Mutation_p.E158K			P20929	NEBU_HUMAN	nebulin	158					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTTGCATGTTCAATATCCTTT	0.413																																					p.E158K		Atlas-SNP	.											.	NEB	1697	.	0			c.G472A						.						250.0	225.0	233.0					2																	152581406		2041	4202	6243	SO:0001583	missense	4703	exon7			CATGTTCAATATC	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.472G>A	chr2.hg19:g.152581406C>T	ENSP00000172853:p.Glu158Lys	68.0	0.0		57.0	20.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	C	18.14	3.556751	0.65425	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853;ENST00000439291	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.71	5.71	0.89125	.	0.060071	0.64402	D	0.000003	T	0.48003	0.1476	N	0.19112	0.55	0.80722	D	1	D	0.64830	0.994	D	0.67231	0.95	T	0.24728	-1.0152	10	0.10902	T	0.67	.	19.8546	0.96752	0.0:1.0:0.0:0.0	.	158	P20929	NEBU_HUMAN	K	158	ENSP00000386259:E158K;ENSP00000380505:E158K;ENSP00000416578:E158K;ENSP00000172853:E158K	ENSP00000172853:E158K	E	-	1	0	NEB	152289652	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.660000	0.74417	2.697000	0.92050	0.655000	0.94253	GAA	.	.		0.413	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
SLC4A10	57282	hgsc.bcm.edu	37	2	162738921	162738921	+	Silent	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:162738921T>A	ENST00000446997.1	+	10	1254	c.1161T>A	c.(1159-1161)atT>atA	p.I387I	SLC4A10_ENST00000272716.5_Silent_p.I357I|SLC4A10_ENST00000375514.5_Silent_p.I368I|SLC4A10_ENST00000535165.1_Intron|SLC4A10_ENST00000421911.1_Silent_p.I387I|SLC4A10_ENST00000493021.1_3'UTR|SLC4A10_ENST00000415876.2_Silent_p.I357I	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	387					bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	ACCATGAGATTGGCAGATCAA	0.358																																					p.I387I		Atlas-SNP	.											.	SLC4A10	309	.	0			c.T1161A						.						53.0	55.0	54.0					2																	162738921		1981	4222	6203	SO:0001819	synonymous_variant	57282	exon10			TGAGATTGGCAGA		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.1161T>A	chr2.hg19:g.162738921T>A		347.0	0.0		316.0	109.0	NM_001178015	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Silent	SNP	ENST00000446997.1	hg19	CCDS54411.1																																																																																			.	.		0.358	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
NEU4	129807	hgsc.bcm.edu	37	2	242758032	242758032	+	Silent	SNP	G	G	A	rs570038056	byFrequency	TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:242758032G>A	ENST00000391969.2	+	5	1824	c.1113G>A	c.(1111-1113)ccG>ccA	p.P371P	NEU4_ENST00000405370.1_Silent_p.P371P|NEU4_ENST00000404257.1_Silent_p.P383P|NEU4_ENST00000407683.1_Silent_p.P371P|NEU4_ENST00000325935.6_Silent_p.P384P	NM_001167602.1	NP_001161074.1	Q8WWR8	NEUR4_HUMAN	sialidase 4	371	Pro-rich.				ganglioside catabolic process (GO:0006689)|glycoprotein catabolic process (GO:0006516)|glycosphingolipid metabolic process (GO:0006687)|oligosaccharide catabolic process (GO:0009313)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|organelle inner membrane (GO:0019866)	exo-alpha-(2->3)-sialidase activity (GO:0052794)|exo-alpha-(2->6)-sialidase activity (GO:0052795)|exo-alpha-(2->8)-sialidase activity (GO:0052796)|exo-alpha-sialidase activity (GO:0004308)			breast(1)|lung(10)|prostate(2)|skin(2)	15		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		TTGCTGCCCCGCCCCAGAGCC	0.721													g|||	3	0.000599042	0.0	0.0	5008	,	,		13245	0.0		0.0	False		,,,				2504	0.0031				p.P384P		Atlas-SNP	.											.	NEU4	39	.	0			c.G1152A						.						7.0	9.0	8.0					2																	242758032		2139	4212	6351	SO:0001819	synonymous_variant	129807	exon4			TGCCCCGCCCCAG	BC012899	CCDS2553.1, CCDS54441.1, CCDS54442.1	2q37.3	2008-02-05			ENSG00000204099	ENSG00000204099			21328	protein-coding gene	gene with protein product		608527					Standard	NM_001167600		Approved		uc010fzr.3	Q8WWR8	OTTHUMG00000133412	ENST00000391969.2:c.1113G>A	chr2.hg19:g.242758032G>A		72.0	0.0		78.0	26.0	NM_001167599	A8K056|J3KNJ5|Q96D64	Silent	SNP	ENST00000391969.2	hg19	CCDS54442.1																																																																																			.	.		0.721	NEU4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257270.2	NM_080741	
ZNF589	51385	hgsc.bcm.edu	37	3	48310031	48310032	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr3:48310031_48310032GG>TT	ENST00000354698.3	+	4	922_923	c.850_851GG>TT	c.(850-852)GGc>TTc	p.G284F	ZNF589_ENST00000440261.2_Intron|ZNF589_ENST00000427617.2_Intron|ZNF589_ENST00000412564.1_Intron	NM_016089.2	NP_057173.2	Q86UQ0	ZN589_HUMAN	zinc finger protein 589	284					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTGTGGGCGAGGCTTTATAGTT	0.545																																					p.G284C|p.G284V	Colon(9;319 328 25374 27611 50948)	Atlas-SNP	.											.	ZNF589	20	.	0			c.G850T|c.G851T						.																																			SO:0001583	missense	51385	exon4			GGGCGAGGCTTTA|GGCGAGGCTTTAT	AF114816	CCDS43085.1	3p21	2013-01-08			ENSG00000164048	ENSG00000164048		"""Zinc fingers, C2H2-type"", ""-"""	16747	protein-coding gene	gene with protein product						10029171	Standard	NM_016089		Approved	SZF1	uc003csl.4	Q86UQ0	OTTHUMG00000156833	Exception_encountered	chr3.hg19:g.48310031_48310032delinsTT	ENSP00000346729:p.Gly284Phe	151.0|148.0	0.0		151.0	57.0|56.0	NM_016089	Q86UC9|Q9BRI6|Q9BRY3|Q9Y611|Q9Y612	Missense_Mutation	SNP	ENST00000354698.3	hg19	CCDS43085.1																																																																																			.	.		0.545	ZNF589-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346124.1	NM_016089	
DNAH12	201625	hgsc.bcm.edu	37	3	57493370	57493370	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr3:57493370C>T	ENST00000351747.2	-	8	1077	c.897G>A	c.(895-897)caG>caA	p.Q299Q	DNAH12_ENST00000311202.6_Splice_Site_p.Q299Q|DNAH12_ENST00000389536.4_Splice_Site_p.Q299Q	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	299	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GTGTATGTACCTGATTTGACA	0.269																																					p.Q299Q		Atlas-SNP	.											.	DNAH12	182	.	0			c.G897A						.						72.0	67.0	69.0					3																	57493370		2203	4300	6503	SO:0001630	splice_region_variant	201625	exon8			ATGTACCTGATTT	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.897+1G>A	chr3.hg19:g.57493370C>T		59.0	0.0		62.0	25.0	NM_198564	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	ENST00000351747.2	hg19																																																																																				.	.		0.269	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	Silent
BOC	91653	hgsc.bcm.edu	37	3	112997029	112997029	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr3:112997029A>T	ENST00000495514.1	+	10	2331	c.1627A>T	c.(1627-1629)Agc>Tgc	p.S543C	BOC_ENST00000497495.1_3'UTR|BOC_ENST00000273395.4_Missense_Mutation_p.S544C|BOC_ENST00000355385.3_Missense_Mutation_p.S543C			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	543	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			TGACCCCGGGAGCTTGTATGA	0.562																																					p.S543C		Atlas-SNP	.											.	BOC	139	.	0			c.A1627T						.						138.0	126.0	130.0					3																	112997029		2203	4300	6503	SO:0001583	missense	91653	exon10			CCCGGGAGCTTGT	AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.1627A>T	chr3.hg19:g.112997029A>T	ENSP00000418663:p.Ser543Cys	123.0	0.0		136.0	55.0	NM_033254	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	ENST00000495514.1	hg19	CCDS2971.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.919317	0.92249	.	.	ENSG00000144857	ENST00000495514;ENST00000273395;ENST00000355385	T;T;T	0.58652	0.32;0.32;0.32	5.8	5.8	0.92144	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.088381	0.85682	D	0.000000	T	0.74831	0.3768	M	0.68317	2.08	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77120	-0.2705	10	0.66056	D	0.02	.	16.1384	0.81506	1.0:0.0:0.0:0.0	.	544;543	Q9BWV1-3;Q9BWV1	.;BOC_HUMAN	C	543;544;543	ENSP00000418663:S543C;ENSP00000273395:S544C;ENSP00000347546:S543C	ENSP00000273395:S544C	S	+	1	0	BOC	114479719	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	8.954000	0.93051	2.203000	0.70933	0.460000	0.39030	AGC	.	.		0.562	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354485.3	NM_033254	
KIAA2018	205717	hgsc.bcm.edu	37	3	113380094	113380094	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr3:113380094T>A	ENST00000478658.1	-	5	452	c.435A>T	c.(433-435)aaA>aaT	p.K145N	KIAA2018_ENST00000316407.4_Missense_Mutation_p.K145N|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	145						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CAATAATTTTTTTTTGAACCT	0.368																																					p.K145N		Atlas-SNP	.											.	KIAA2018	180	.	0			c.A435T						.						89.0	85.0	86.0					3																	113380094		1810	4072	5882	SO:0001583	missense	205717	exon7			AATTTTTTTTTGA	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.435A>T	chr3.hg19:g.113380094T>A	ENSP00000420721:p.Lys145Asn	186.0	0.0		215.0	70.0	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	ENST00000478658.1	hg19	CCDS43133.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126316	0.56721	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.20738	2.05;2.05	5.95	3.57	0.40892	.	0.000000	0.85682	D	0.000000	T	0.29061	0.0722	L	0.32530	0.975	0.54753	D	0.999981	D	0.89917	1.0	D	0.85130	0.997	T	0.07770	-1.0755	10	0.87932	D	0	-17.0997	4.5277	0.11990	0.0:0.3439:0.0:0.6561	.	145	Q68DE3	K2018_HUMAN	N	145	ENSP00000320794:K145N;ENSP00000420721:K145N	ENSP00000320794:K145N	K	-	3	2	KIAA2018	114862784	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.926000	0.48892	1.054000	0.40438	0.533000	0.62120	AAA	.	.		0.368	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
CLSTN2	64084	hgsc.bcm.edu	37	3	140123468	140123468	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr3:140123468A>T	ENST00000458420.3	+	4	687	c.497A>T	c.(496-498)aAg>aTg	p.K166M	AC092988.1_ENST00000580582.1_RNA	NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	166	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						CCAGCCTACAAGGCTGTTGTG	0.537										HNSCC(16;0.037)																											p.K166M	GBM(45;858 913 3709 36904 37282)	Atlas-SNP	.											.	CLSTN2	190	.	0			c.A497T						.						129.0	104.0	112.0					3																	140123468		2203	4300	6503	SO:0001583	missense	64084	exon4			CCTACAAGGCTGT	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.497A>T	chr3.hg19:g.140123468A>T	ENSP00000402460:p.Lys166Met	199.0	0.0		181.0	72.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	hg19	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	A	17.74	3.464565	0.63513	.	.	ENSG00000158258	ENST00000458420	T	0.52754	0.65	5.66	3.31	0.37934	Cadherin (4);Cadherin-like (1);	0.268084	0.35903	N	0.002914	T	0.58949	0.2158	M	0.69248	2.105	0.37010	D	0.895677	D	0.67145	0.996	D	0.64042	0.921	T	0.61888	-0.6970	10	0.51188	T	0.08	-14.8873	6.9825	0.24711	0.7451:0.0:0.2549:0.0	.	166	Q9H4D0	CSTN2_HUMAN	M	166	ENSP00000402460:K166M	ENSP00000402460:K166M	K	+	2	0	CLSTN2	141606158	0.969000	0.33509	0.908000	0.35775	0.941000	0.58515	1.429000	0.34903	0.444000	0.26612	0.460000	0.39030	AAG	.	.		0.537	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
ATR	545	hgsc.bcm.edu	37	3	142215316	142215316	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr3:142215316T>A	ENST00000350721.4	-	34	5906	c.5785A>T	c.(5785-5787)Agg>Tgg	p.R1929W	ATR_ENST00000383101.3_Missense_Mutation_p.R1865W	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	1929	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						CTAGCTACCCTGGCACTCTGC	0.483								Other conserved DNA damage response genes																													p.R1929W		Atlas-SNP	.											.	ATR	285	.	0			c.A5785T						.						156.0	130.0	139.0					3																	142215316		2203	4300	6503	SO:0001583	missense	545	exon34			CTACCCTGGCACT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.5785A>T	chr3.hg19:g.142215316T>A	ENSP00000343741:p.Arg1929Trp	70.0	0.0		57.0	24.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	hg19	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	24.6	4.548996	0.86127	.	.	ENSG00000175054	ENST00000350721;ENST00000383101	T;T	0.70399	-0.48;-0.48	5.78	3.24	0.37175	PIK-related kinase (1);Tetratricopeptide-like helical (1);PIK-related kinase, FAT (1);	0.000000	0.85682	D	0.000000	T	0.81945	0.4930	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83907	0.0293	10	0.87932	D	0	-18.9969	13.3687	0.60701	0.0:0.0:0.474:0.526	.	1929	Q13535	ATR_HUMAN	W	1929;1865	ENSP00000343741:R1929W;ENSP00000372581:R1865W	ENSP00000343741:R1929W	R	-	1	2	ATR	143698006	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.144000	0.64832	0.997000	0.38969	-0.313000	0.08912	AGG	.	.		0.483	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
SLC2A2	6514	hgsc.bcm.edu	37	3	170732355	170732355	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr3:170732355G>C	ENST00000314251.3	-	3	353	c.274C>G	c.(274-276)Cta>Gta	p.L92V	SLC2A2_ENST00000382808.4_Intron	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	92					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	ATGGTGATTAGTTGAGCAGCT	0.488																																					p.L92V		Atlas-SNP	.											.	SLC2A2	71	.	0			c.C274G						.						218.0	200.0	206.0					3																	170732355		2203	4300	6503	SO:0001583	missense	6514	exon3			TGATTAGTTGAGC	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.274C>G	chr3.hg19:g.170732355G>C	ENSP00000323568:p.Leu92Val	145.0	0.0		144.0	49.0	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Missense_Mutation	SNP	ENST00000314251.3	hg19	CCDS3215.1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.579973	0.28180	.	.	ENSG00000163581	ENST00000314251	D	0.83506	-1.73	6.08	2.85	0.33270	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.791364	0.12021	N	0.506963	T	0.76758	0.4032	L	0.42245	1.32	0.09310	N	1	B	0.13145	0.007	B	0.16722	0.016	T	0.58572	-0.7613	10	0.15952	T	0.53	.	13.9806	0.64301	0.0:0.0:0.5885:0.4115	.	92	P11168	GTR2_HUMAN	V	92	ENSP00000323568:L92V	ENSP00000323568:L92V	L	-	1	2	SLC2A2	172215049	0.000000	0.05858	0.008000	0.14137	0.106000	0.19336	-0.161000	0.10026	0.803000	0.34113	0.655000	0.94253	CTA	.	.		0.488	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
TAPT1	202018	hgsc.bcm.edu	37	4	16168391	16168391	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr4:16168391T>A	ENST00000405303.2	-	13	1422	c.1339A>T	c.(1339-1341)Agc>Tgc	p.S447C	TAPT1_ENST00000304584.8_3'UTR|TAPT1_ENST00000399920.3_Missense_Mutation_p.S336C	NM_153365.2	NP_699196.2	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation 1	447					embryonic skeletal system development (GO:0048706)|G-protein coupled receptor signaling pathway (GO:0007186)|in utero embryonic development (GO:0001701)|post-embryonic development (GO:0009791)	integral component of membrane (GO:0016021)	growth hormone-releasing hormone receptor activity (GO:0016520)			NS(1)|breast(2)|cervix(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	10						AGCACGATGCTATTAAGTACT	0.458																																					p.S447C		Atlas-SNP	.											.	TAPT1	31	.	0			c.A1339T						.						127.0	127.0	127.0					4																	16168391		1958	4137	6095	SO:0001583	missense	202018	exon13			CGATGCTATTAAG	AK074494	CCDS47030.1	4p15.32	2014-01-28			ENSG00000169762	ENSG00000169762			26887	protein-coding gene	gene with protein product		612758				12477932	Standard	NM_153365		Approved	FLJ90013	uc010ied.1	Q6NXT6	OTTHUMG00000160177	ENST00000405303.2:c.1339A>T	chr4.hg19:g.16168391T>A	ENSP00000385347:p.Ser447Cys	99.0	0.0		95.0	53.0	NM_153365	Q8N2S3|Q9NZK9	Missense_Mutation	SNP	ENST00000405303.2	hg19	CCDS47030.1	.	.	.	.	.	.	.	.	.	.	T	26.8	4.768750	0.90020	.	.	ENSG00000169762	ENST00000405303;ENST00000542770;ENST00000399920	T;T	0.36699	1.24;1.28	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.60766	0.2294	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65602	-0.6128	10	0.72032	D	0.01	-10.5153	15.2568	0.73591	0.0:0.0:0.0:1.0	.	447	Q6NXT6	TAPT1_HUMAN	C	447;447;336	ENSP00000385347:S447C;ENSP00000382803:S336C	ENSP00000382803:S336C	S	-	1	0	TAPT1	15777489	1.000000	0.71417	0.956000	0.39512	0.927000	0.56198	7.534000	0.82004	2.074000	0.62210	0.528000	0.53228	AGC	.	.		0.458	TAPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359568.1	NM_153365	
PYURF	100996939	hgsc.bcm.edu	37	4	89444729	89444729	+	Silent	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr4:89444729C>T	ENST00000273968.4	-	1	235	c.123G>A	c.(121-123)aaG>aaA	p.K41K	HERC3_ENST00000601319.1_3'UTR|PIGY_ENST00000527353.1_5'Flank	NM_001042616.2|NM_032906.4	NP_001036081.1|NP_116295.1	Q96I23	PREY_HUMAN	PIGY upstream reading frame	41					GPI anchor biosynthetic process (GO:0006506)|positive regulation of metabolic process (GO:0009893)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|mitochondrion (GO:0005739)											CCTCAGTCTTCTTGCCCCGGT	0.726																																					p.K41K		Atlas-SNP	.											.	.	.	.	0			c.G123A						.						9.0	12.0	11.0					4																	89444729		690	1586	2276	SO:0001819	synonymous_variant	100996939	exon1			AGTCTTCTTGCCC			4q22.1	2012-08-14			ENSG00000145337	ENSG00000145337			44317	protein-coding gene	gene with protein product						16162815	Standard	NM_032906		Approved	PreY	uc003hru.2	Q96I23	OTTHUMG00000130949	ENST00000273968.4:c.123G>A	chr4.hg19:g.89444729C>T		182.0	0.0		153.0	29.0	NM_032906	B2R571	Silent	SNP	ENST00000273968.4	hg19	CCDS3631.1																																																																																			.	.		0.726	PYURF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253550.1	NM_032906.4	
INTU	27152	hgsc.bcm.edu	37	4	128564999	128564999	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr4:128564999G>A	ENST00000335251.6	+	2	573	c.470G>A	c.(469-471)cGa>cAa	p.R157Q	INTU_ENST00000296461.5_Missense_Mutation_p.R157Q	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	157					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.R157L(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						GTCCAACAGCGATACAAAGAT	0.393																																					p.R157Q		Atlas-SNP	.											INTU,NS,carcinoma,0,1	INTU	92	.	1	Substitution - Missense(1)	lung(1)	c.G470A						.						95.0	94.0	94.0					4																	128564999		2203	4300	6503	SO:0001583	missense	27152	exon2			AACAGCGATACAA	BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.470G>A	chr4.hg19:g.128564999G>A	ENSP00000334003:p.Arg157Gln	494.0	0.0		464.0	172.0	NM_015693	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	ENST00000335251.6	hg19	CCDS34061.1	.	.	.	.	.	.	.	.	.	.	G	10.70	1.423726	0.25639	.	.	ENSG00000164066	ENST00000504491;ENST00000335251;ENST00000296461	T	0.41065	1.01	5.1	1.44	0.22558	.	0.357608	0.29417	N	0.012203	T	0.22551	0.0544	L	0.27053	0.805	0.32999	D	0.525964	B	0.20780	0.048	B	0.15052	0.012	T	0.20240	-1.0281	10	0.16896	T	0.51	-1.8835	5.0901	0.14704	0.417:0.0:0.4477:0.1353	.	157	Q9ULD6	PDZD6_HUMAN	Q	138;157;157	ENSP00000296461:R157Q	ENSP00000296461:R157Q	R	+	2	0	INTU	128784449	0.486000	0.25980	0.206000	0.23566	0.445000	0.32107	0.062000	0.14389	0.053000	0.16036	-0.136000	0.14681	CGA	.	.		0.393	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364147.2	XM_371707	
HELT	391723	hgsc.bcm.edu	37	4	185940790	185940790	+	Intron	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr4:185940790G>A	ENST00000515777.1	+	3	220				HELT_ENST00000338875.4_Missense_Mutation_p.E93K|HELT_ENST00000505610.1_Intron			A6NFD8	HELT_HUMAN	helt bHLH transcription factor						central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		CGAACCTCAGGAGGCTCTGGC	0.741																																					p.E93K		Atlas-SNP	.											.	HELT	34	.	0			c.G277A						.						7.0	10.0	9.0					4																	185940790		2146	4240	6386	SO:0001627	intron_variant	391723	exon3			CCTCAGGAGGCTC	BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.133-111G>A	chr4.hg19:g.185940790G>A		149.0	0.0		158.0	51.0	NM_001029887	B2RTS5|B7ZMI7|B7ZMI8	Missense_Mutation	SNP	ENST00000515777.1	hg19		.	.	.	.	.	.	.	.	.	.	G	9.725	1.160601	0.21454	.	.	ENSG00000187821	ENST00000338875	T	0.21191	2.02	2.78	0.716	0.18191	Helix-loop-helix DNA-binding (4);	.	.	.	.	T	0.09113	0.0225	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.38802	-0.9644	9	0.21014	T	0.42	.	6.5549	0.22454	0.0:0.2792:0.5271:0.1937	.	93	A6NFD8	HELT_HUMAN	K	93	ENSP00000343464:E93K	ENSP00000343464:E93K	E	+	1	0	HELT	186177784	0.255000	0.24002	0.000000	0.03702	0.003000	0.03518	1.726000	0.38085	0.095000	0.17434	0.561000	0.74099	GAG	.	.		0.741	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000360792.1	NM_001300781	
PJA2	9867	hgsc.bcm.edu	37	5	108679977	108679977	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr5:108679977T>A	ENST00000361189.2	-	9	2154	c.1915A>T	c.(1915-1917)Agt>Tgt	p.S639C	PJA2_ENST00000361557.3_Missense_Mutation_p.S639C	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	639	Interaction with PRKAR1A, PRKAR2A and PRKAR2B.				long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		ATATACTCACTGCAACAGATT	0.368																																					p.S639C		Atlas-SNP	.											.	PJA2	53	.	0			c.A1915T						.						99.0	92.0	94.0					5																	108679977		2202	4300	6502	SO:0001583	missense	9867	exon9			ACTCACTGCAACA	AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.1915A>T	chr5.hg19:g.108679977T>A	ENSP00000354775:p.Ser639Cys	408.0	1.0		431.0	156.0	NM_014819	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	hg19	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	T	19.25	3.790668	0.70452	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.44083	0.93;0.93	6.03	4.8	0.61643	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	D	0.000000	T	0.42966	0.1226	N	0.12502	0.225	0.45662	D	0.99858	D	0.60575	0.988	D	0.64687	0.928	T	0.43081	-0.9413	10	0.45353	T	0.12	-20.5468	13.0322	0.58848	0.0:0.0:0.1341:0.8659	.	639	O43164	PJA2_HUMAN	C	639	ENSP00000354775:S639C;ENSP00000355284:S639C	ENSP00000354775:S639C	S	-	1	0	PJA2	108707876	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.995000	0.29706	2.308000	0.77769	0.533000	0.62120	AGT	.	.		0.368	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819	
PCDHB13	56123	hgsc.bcm.edu	37	5	140595753	140595753	+	Silent	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr5:140595753C>T	ENST00000341948.4	+	1	2245	c.2058C>T	c.(2056-2058)ctC>ctT	p.L686L		NM_018933.2	NP_061756.1	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13	686					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(4)|lung(24)|ovary(5)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	66			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCGACTTGCTCACCGTCTACC	0.692																																					p.L686L		Atlas-SNP	.											.	PCDHB13	142	.	0			c.C2058T						.						80.0	85.0	83.0					5																	140595753		2182	4270	6452	SO:0001819	synonymous_variant	56123	exon1			CTTGCTCACCGTC	AF152492	CCDS4255.1	5q31	2010-01-26			ENSG00000187372	ENSG00000187372		"""Cadherins / Protocadherins : Clustered"""	8684	other	protocadherin		606339				10380929	Standard	NM_018933		Approved	PCDH-BETA13	uc003lja.1	Q9Y5F0	OTTHUMG00000129615	ENST00000341948.4:c.2058C>T	chr5.hg19:g.140595753C>T		112.0	0.0		96.0	31.0	NM_018933	A8K9V6	Silent	SNP	ENST00000341948.4	hg19	CCDS4255.1																																																																																			.	.		0.692	PCDHB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251810.1	NM_018933	
GABRG2	2566	hgsc.bcm.edu	37	5	161495110	161495110	+	Silent	SNP	T	T	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr5:161495110T>C	ENST00000361925.4	+	1	325	c.105T>C	c.(103-105)ccT>ccC	p.P35P	GABRG2_ENST00000393933.4_5'UTR|GABRG2_ENST00000356592.3_Silent_p.P35P|GABRG2_ENST00000414552.2_Silent_p.P35P			P18507	GBRG2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 2	35					adult behavior (GO:0030534)|cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|post-embryonic development (GO:0009791)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|GABA-A receptor complex (GO:1902711)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(15)|lung(24)|ovary(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	62	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CGCTCTACCCTGGGTAAGATG	0.507																																					p.P35P		Atlas-SNP	.											.	GABRG2	142	.	0			c.T105C						.						80.0	71.0	74.0					5																	161495110		2203	4300	6503	SO:0001819	synonymous_variant	2566	exon1			CTACCCTGGGTAA		CCDS4358.1, CCDS4359.1, CCDS47333.1	5q34	2012-06-22			ENSG00000113327	ENSG00000113327		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4087	protein-coding gene	gene with protein product	"""GABA(A) receptor, gamma 2"""	137164					Standard	NM_198904		Approved		uc010jjc.3	P18507	OTTHUMG00000130350	ENST00000361925.4:c.105T>C	chr5.hg19:g.161495110T>C		84.0	0.0		98.0	41.0	NM_198904	F5HB82|Q6GRL6|Q6PCC3|Q9UDB3|Q9UN15	Silent	SNP	ENST00000361925.4	hg19	CCDS4358.1																																																																																			.	.		0.507	GABRG2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252706.1		
DOCK2	1794	hgsc.bcm.edu	37	5	169138990	169138990	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr5:169138990C>T	ENST00000256935.8	+	16	1614	c.1534C>T	c.(1534-1536)Cga>Tga	p.R512*	DOCK2_ENST00000520908.1_Silent_p.F38F|DOCK2_ENST00000540750.1_5'UTR	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	512	DHR-1.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATTCATGTTTCGACATCGGTC	0.502																																					p.R512X		Atlas-SNP	.											DOCK2,NS,carcinoma,0,2	DOCK2	389	.	0			c.C1534T						.						203.0	171.0	182.0					5																	169138990		2203	4300	6503	SO:0001587	stop_gained	1794	exon16			ATGTTTCGACATC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.1534C>T	chr5.hg19:g.169138990C>T	ENSP00000256935:p.Arg512*	89.0	0.0		96.0	33.0	NM_004946	Q2M3I0|Q96AK7	Nonsense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	40	8.082213	0.98646	.	.	ENSG00000134516	ENST00000256935;ENST00000343291	.	.	.	5.49	4.61	0.57282	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.7037	0.57049	0.4536:0.5464:0.0:0.0	.	.	.	.	X	512;30	.	ENSP00000256935:R512X	R	+	1	2	DOCK2	169071568	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.172000	0.50832	1.292000	0.44672	0.655000	0.94253	CGA	.	.		0.502	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
PHACTR1	221692	hgsc.bcm.edu	37	6	13286433	13286433	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr6:13286433A>T	ENST00000379335.3	+	4	503	c.398A>T	c.(397-399)gAa>gTa	p.E133V	PHACTR1_ENST00000457702.2_Missense_Mutation_p.E424V|RP1-257A7.4_ENST00000399446.2_RNA|RP1-257A7.4_ENST00000606150.1_RNA|PHACTR1_ENST00000332995.7_Missense_Mutation_p.E569V			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	569					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GAAGTTCATGAATTGAGTAGA	0.393																																					p.E569V		Atlas-SNP	.											.	PHACTR1	94	.	0			c.A1706T						.						78.0	84.0	82.0					6																	13286433		1851	4094	5945	SO:0001583	missense	221692	exon14			TTCATGAATTGAG	AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379335.3:c.398A>T	chr6.hg19:g.13286433A>T	ENSP00000368639:p.Glu133Val	114.0	0.0		143.0	32.0	NM_030948	A8K1V2|Q3MJ93|Q5JSJ2	Missense_Mutation	SNP	ENST00000379335.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	29.8|29.8	5.036595|5.036595	0.93630|0.93630	.|.	.|.	ENSG00000112137|ENSG00000112137	ENST00000332995;ENST00000457702;ENST00000379335|ENST00000415087	T;T|.	0.38887|.	1.12;1.11|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59662|0.59662	0.2210|0.2210	L|L	0.49640|0.49640	1.575|1.575	0.80722|0.80722	D|D	1|1	B|.	0.25955|.	0.138|.	B|.	0.30716|.	0.119|.	T|T	0.58719|0.58719	-0.7587|-0.7587	10|5	0.62326|.	D|.	0.03|.	-17.1197|-17.1197	16.0034|16.0034	0.80327|0.80327	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	569|.	Q9C0D0|.	PHAR1_HUMAN|.	V|Y	569;424;133|404	ENSP00000329880:E569V;ENSP00000397669:E424V|.	ENSP00000329880:E569V|.	E|N	+|+	2|1	0|0	PHACTR1|PHACTR1	13394412|13394412	1.000000|1.000000	0.71417|0.71417	0.955000|0.955000	0.39395|0.39395	0.997000|0.997000	0.91878|0.91878	7.359000|7.359000	0.79477|0.79477	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GAA|AAT	.	.		0.393	PHACTR1-003	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000039878.1	XM_166420	
SYNGAP1	8831	hgsc.bcm.edu	37	6	33410881	33410881	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr6:33410881C>T	ENST00000418600.2	+	15	2653	c.2552C>T	c.(2551-2553)cCt>cTt	p.P851L	SYNGAP1_ENST00000496374.1_3'UTR|SYNGAP1_ENST00000293748.5_Missense_Mutation_p.P851L|SYNGAP1_ENST00000428982.2_Missense_Mutation_p.P792L	NM_006772.2	NP_006763.2	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	851					dendrite development (GO:0016358)|negative regulation of axonogenesis (GO:0050771)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|pattern specification process (GO:0007389)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|receptor clustering (GO:0043113)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of MAPK cascade (GO:0043408)|regulation of synapse structure and activity (GO:0050803)|regulation of synaptic plasticity (GO:0048167)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Rab GTPase activator activity (GO:0005097)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(15)|ovary(7)|pancreas(1)|stomach(1)|urinary_tract(1)	43						GGTGATGGGCCTGGTGGCCGC	0.607																																					p.P851L		Atlas-SNP	.											.	SYNGAP1	202	.	0			c.C2552T						.						89.0	73.0	79.0					6																	33410881		2203	4300	6503	SO:0001583	missense	8831	exon15			ATGGGCCTGGTGG	AB067525	CCDS34434.2	6p21.3	2010-06-25	2010-06-25		ENSG00000197283	ENSG00000197283			11497	protein-coding gene	gene with protein product		603384	"""synaptic Ras GTPase activating protein 1 homolog (rat)"""			9581761, 18323856	Standard	NM_006772		Approved	SYNGAP, RASA5, KIAA1938	uc011dri.2	Q96PV0	OTTHUMG00000031096	ENST00000418600.2:c.2552C>T	chr6.hg19:g.33410881C>T	ENSP00000403636:p.Pro851Leu	123.0	0.0		97.0	44.0	NM_006772	A2AB17|A2BEL6|A2BEL7|A8MQC4|Q8TCS2|Q9UGE2	Missense_Mutation	SNP	ENST00000418600.2	hg19	CCDS34434.2	.	.	.	.	.	.	.	.	.	.	C	14.89	2.670994	0.47781	.	.	ENSG00000197283	ENST00000293748;ENST00000418600;ENST00000449372;ENST00000428982	T;T;T	0.15487	2.42;2.51;2.5	4.52	4.52	0.55395	.	0.653596	0.15967	N	0.235966	T	0.16257	0.0391	L	0.36672	1.1	0.43708	D	0.996175	D;D;D	0.76494	0.999;0.997;0.999	D;D;D	0.81914	0.995;0.958;0.991	T	0.04029	-1.0983	10	0.10636	T	0.68	.	12.5968	0.56474	0.0:1.0:0.0:0.0	.	851;851;851	Q96PV0;Q96PV0-2;Q96PV0-4	SYGP1_HUMAN;.;.	L	851;851;837;792	ENSP00000293748:P851L;ENSP00000403636:P851L;ENSP00000412475:P792L	ENSP00000293748:P851L	P	+	2	0	SYNGAP1	33518859	1.000000	0.71417	0.963000	0.40424	0.994000	0.84299	4.828000	0.62730	2.343000	0.79666	0.591000	0.81541	CCT	.	.		0.607	SYNGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076151.4	XM_166407	
FGD2	221472	hgsc.bcm.edu	37	6	36993582	36993582	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr6:36993582G>T	ENST00000274963.8	+	14	1644	c.1473G>T	c.(1471-1473)agG>agT	p.R491S		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	491					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						TGTGTGCCAGGTGCTCCGACT	0.627																																					p.R491S		Atlas-SNP	.											.	FGD2	65	.	0			c.G1473T						.						116.0	94.0	102.0					6																	36993582		2203	4300	6503	SO:0001583	missense	221472	exon14			TGCCAGGTGCTCC	AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1473G>T	chr6.hg19:g.36993582G>T	ENSP00000274963:p.Arg491Ser	109.0	0.0		90.0	32.0	NM_173558	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	ENST00000274963.8	hg19	CCDS4829.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756112	0.49362	.	.	ENSG00000146192	ENST00000274963;ENST00000394459	T	0.75938	-0.98	5.2	3.35	0.38373	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.473710	0.17885	N	0.158710	T	0.33990	0.0882	N	0.05199	-0.095	0.30384	N	0.781656	P;B	0.36683	0.565;0.332	B;B	0.37015	0.239;0.138	T	0.20174	-1.0283	10	0.87932	D	0	-4.2643	6.2324	0.20742	0.1585:0.3989:0.4426:0.0	.	491;68	Q7Z6J4;Q7Z6J4-2	FGD2_HUMAN;.	S	491;119	ENSP00000274963:R491S	ENSP00000274963:R491S	R	+	3	2	FGD2	37101560	0.998000	0.40836	0.999000	0.59377	0.882000	0.50991	0.615000	0.24329	1.292000	0.44672	0.563000	0.77884	AGG	.	.		0.627	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040398.2	NM_173558	
EYS	346007	hgsc.bcm.edu	37	6	66063431	66063431	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr6:66063431T>G	ENST00000370621.3	-	9	1905	c.1379A>C	c.(1378-1380)tAc>tCc	p.Y460S	EYS_ENST00000393380.2_Missense_Mutation_p.Y460S|EYS_ENST00000370618.3_Missense_Mutation_p.Y460S|EYS_ENST00000342421.5_Missense_Mutation_p.Y460S|EYS_ENST00000503581.1_Missense_Mutation_p.Y460S|EYS_ENST00000370616.2_Missense_Mutation_p.Y460S			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	460					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GACTCCACAGTAGCAGAGGTG	0.373																																					p.Y460S		Atlas-SNP	.											.	EYS	527	.	0			c.A1379C						.						119.0	108.0	112.0					6																	66063431		2203	4300	6503	SO:0001583	missense	346007	exon9			CCACAGTAGCAGA		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1379A>C	chr6.hg19:g.66063431T>G	ENSP00000359655:p.Tyr460Ser	324.0	0.0		328.0	41.0	NM_001142801	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	t	11.26	1.585927	0.28268	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	T;T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39;1.39	4.05	1.27	0.21489	.	.	.	.	.	T	0.05686	0.0149	N	0.24115	0.695	0.09310	N	1	B;B;B	0.21309	0.013;0.054;0.032	B;B;B	0.17722	0.006;0.019;0.014	T	0.41592	-0.9500	9	0.07325	T	0.83	.	4.7147	0.12889	0.1857:0.0:0.3817:0.4327	.	460;460;460	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	S	460	ENSP00000424243:Y460S;ENSP00000359655:Y460S;ENSP00000359650:Y460S;ENSP00000377042:Y460S;ENSP00000341818:Y460S;ENSP00000359652:Y460S	ENSP00000341818:Y460S	Y	-	2	0	EYS	66120152	0.000000	0.05858	0.010000	0.14722	0.004000	0.04260	-0.350000	0.07721	0.405000	0.25532	0.482000	0.46254	TAC	.	.		0.373	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
PKD1L1	168507	hgsc.bcm.edu	37	7	47976458	47976458	+	Missense_Mutation	SNP	T	T	A	rs145116707		TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr7:47976458T>A	ENST00000289672.2	-	4	433	c.383A>T	c.(382-384)gAt>gTt	p.D128V		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	128					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AGCACTGTTATCACAATCCAG	0.378																																					p.D128V		Atlas-SNP	.											.	PKD1L1	328	.	0			c.A383T						.						132.0	132.0	132.0					7																	47976458		2202	4300	6502	SO:0001583	missense	168507	exon4			CTGTTATCACAAT	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.383A>T	chr7.hg19:g.47976458T>A	ENSP00000289672:p.Asp128Val	87.0	0.0		90.0	37.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	hg19	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	T	7.765	0.706294	0.15239	.	.	ENSG00000158683	ENST00000289672	T	0.25579	1.79	3.01	-4.79	0.03200	.	.	.	.	.	T	0.08891	0.0220	N	0.08118	0	0.09310	N	1	P	0.39480	0.675	B	0.31101	0.124	T	0.20638	-1.0269	9	0.87932	D	0	-0.0969	5.3878	0.16227	0.0:0.5184:0.1634:0.3181	.	128	Q8TDX9	PK1L1_HUMAN	V	128	ENSP00000289672:D128V	ENSP00000289672:D128V	D	-	2	0	PKD1L1	47942983	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.599000	0.05700	-1.142000	0.02869	0.456000	0.33151	GAT	.	T|1.000;C|0.000		0.378	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
C7orf72	100130988	hgsc.bcm.edu	37	7	50169362	50169362	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr7:50169362A>T	ENST00000297001.6	+	3	751	c.701A>T	c.(700-702)gAc>gTc	p.D234V		NM_001161834.2	NP_001155306	A4D263	CG072_HUMAN	chromosome 7 open reading frame 72	234										NS(1)|breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|prostate(2)	9						AATGCAAAGGACTCATTTTAC	0.318																																					p.D234V		Atlas-SNP	.											.	C7orf72	26	.	0			c.A701T						.						111.0	92.0	98.0					7																	50169362		692	1588	2280	SO:0001583	missense	100130988	exon3			CAAAGGACTCATT		CCDS47585.1	7p12.2	2009-10-15			ENSG00000164500	ENSG00000164500			22564	protein-coding gene	gene with protein product							Standard	NM_001161834		Approved		uc011kcj.2	A4D263	OTTHUMG00000155883	ENST00000297001.6:c.701A>T	chr7.hg19:g.50169362A>T	ENSP00000297001:p.Asp234Val	329.0	0.0		331.0	118.0	NM_001161834	A6NDX9	Missense_Mutation	SNP	ENST00000297001.6	hg19	CCDS47585.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.765337	0.49574	.	.	ENSG00000164500	ENST00000297001	.	.	.	5.31	2.94	0.34122	.	.	.	.	.	T	0.44871	0.1314	L	0.36672	1.1	0.44149	D	0.996942	P	0.52061	0.95	P	0.48227	0.571	T	0.32798	-0.9893	8	0.46703	T	0.11	.	6.4166	0.21719	0.8098:0.0:0.1902:0.0	.	234	A4D263	CG072_HUMAN	V	234	.	ENSP00000297001:D234V	D	+	2	0	C7orf72	50139908	0.984000	0.35163	0.962000	0.40283	0.586000	0.36452	1.780000	0.38634	0.952000	0.37798	0.528000	0.53228	GAC	.	.		0.318	C7orf72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342124.1	NM_001161834	
ZNF282	8427	hgsc.bcm.edu	37	7	148895458	148895458	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr7:148895458A>C	ENST00000262085.3	+	2	304	c.199A>C	c.(199-201)Atg>Ctg	p.M67L	ZNF282_ENST00000479907.1_Missense_Mutation_p.M67L	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	67					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CCGGCGGCCAATGCCTTTTCA	0.592																																					p.M67L		Atlas-SNP	.											.	ZNF282	42	.	0			c.A199C						.						65.0	63.0	64.0					7																	148895458		2203	4300	6503	SO:0001583	missense	8427	exon2			CGGCCAATGCCTT	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.199A>C	chr7.hg19:g.148895458A>C	ENSP00000262085:p.Met67Leu	99.0	0.0		162.0	44.0	NM_003575	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	ENST00000262085.3	hg19	CCDS5895.1	.	.	.	.	.	.	.	.	.	.	A	12.33	1.905543	0.33628	.	.	ENSG00000170265	ENST00000262085;ENST00000479907	T;T	0.05447	3.44;5.18	4.56	1.99	0.26369	.	0.000000	0.51477	D	0.000085	T	0.03136	0.0092	N	0.24115	0.695	0.21105	N	0.999783	B;B;B;B	0.26081	0.012;0.141;0.141;0.141	B;B;B;B	0.20767	0.01;0.031;0.031;0.031	T	0.44982	-0.9292	10	0.06099	T	0.92	-23.6365	6.3333	0.21282	0.7796:0.0:0.2204:0.0	.	67;18;39;67	B4DRI5;Q86YG2;Q7Z2V4;Q9UDV7	.;.;.;ZN282_HUMAN	L	67	ENSP00000262085:M67L;ENSP00000418840:M67L	ENSP00000262085:M67L	M	+	1	0	ZNF282	148526391	0.000000	0.05858	0.872000	0.34217	0.958000	0.62258	-0.016000	0.12613	0.619000	0.30197	0.260000	0.18958	ATG	.	.		0.592	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352746.1	NM_003575	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70594495	70594495	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr8:70594495A>G	ENST00000260126.4	-	7	2412	c.1706T>C	c.(1705-1707)gTc>gCc	p.V569A	SLCO5A1_ENST00000524945.1_Missense_Mutation_p.V569A|SLCO5A1_ENST00000530307.1_Missense_Mutation_p.V514A	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	569	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			TGATCCACAGACTGGCTCATA	0.433																																					p.V569A		Atlas-SNP	.											.	SLCO5A1	142	.	0			c.T1706C						.						186.0	159.0	168.0					8																	70594495		2203	4300	6503	SO:0001583	missense	81796	exon7			CCACAGACTGGCT	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.1706T>C	chr8.hg19:g.70594495A>G	ENSP00000260126:p.Val569Ala	138.0	0.0		281.0	13.0	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Missense_Mutation	SNP	ENST00000260126.4	hg19	CCDS6205.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.935904	0.92458	.	.	ENSG00000137571	ENST00000260126;ENST00000524945;ENST00000530307	T;T;T	0.15952	2.38;2.38;2.38	5.77	5.77	0.91146	Proteinase inhibitor I1, Kazal (1);Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);Protease inhibitor, Kazal-type (1);	0.000000	0.85682	D	0.000000	T	0.54615	0.1869	H	0.94385	3.53	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.79108	0.992;0.978;0.982	T	0.68629	-0.5358	10	0.87932	D	0	.	16.1024	0.81184	1.0:0.0:0.0:0.0	.	514;569;569	E9PKK5;Q9H2Y9;G3V1C0	.;SO5A1_HUMAN;.	A	569;569;514	ENSP00000260126:V569A;ENSP00000434422:V569A;ENSP00000431611:V514A	ENSP00000260126:V569A	V	-	2	0	SLCO5A1	70757049	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.273000	0.95719	2.200000	0.70718	0.459000	0.35465	GTC	.	.		0.433	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
MTSS1	9788	hgsc.bcm.edu	37	8	125565918	125565918	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr8:125565918T>C	ENST00000518547.1	-	14	2056	c.1583A>G	c.(1582-1584)tAt>tGt	p.Y528C	MTSS1_ENST00000524090.1_Missense_Mutation_p.Y418C|MTSS1_ENST00000325064.5_Missense_Mutation_p.Y532C|NDUFB9_ENST00000522532.1_Intron|MTSS1_ENST00000431961.2_Missense_Mutation_p.Y246C|MTSS1_ENST00000395508.2_Missense_Mutation_p.Y302C|MTSS1_ENST00000378017.3_Missense_Mutation_p.Y503C|MTSS1_ENST00000354184.4_Missense_Mutation_p.Y246C|MTSS1_ENST00000523587.1_5'UTR	NM_001282971.1|NM_014751.4	NP_001269900.1|NP_055566.3	O43312	MTSS1_HUMAN	metastasis suppressor 1	528					actin cytoskeleton organization (GO:0030036)|actin filament polymerization (GO:0030041)|adherens junction maintenance (GO:0034334)|bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|cellular response to fluid shear stress (GO:0071498)|epithelial cell proliferation involved in renal tubule morphogenesis (GO:2001013)|filopodium assembly (GO:0046847)|glomerulus morphogenesis (GO:0072102)|in utero embryonic development (GO:0001701)|magnesium ion homeostasis (GO:0010960)|microspike assembly (GO:0030035)|negative regulation of epithelial cell proliferation (GO:0050680)|nephron tubule epithelial cell differentiation (GO:0072160)|positive regulation of actin filament bundle assembly (GO:0032233)|renal tubule morphogenesis (GO:0061333)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TACAGAGAAATAATCATAATC	0.458																																					p.Y528C	Esophageal Squamous(160;622 1893 3862 8546 12509)	Atlas-SNP	.											.	MTSS1	79	.	0			c.A1583G						.						39.0	37.0	37.0					8																	125565918		2203	4300	6503	SO:0001583	missense	9788	exon14			GAGAAATAATCAT	AF086645	CCDS6353.1, CCDS64968.1, CCDS64969.1	8p22	2008-02-05			ENSG00000170873	ENSG00000170873			20443	protein-coding gene	gene with protein product		608486				12482861, 12082544	Standard	XM_005251111		Approved	KIAA0429, MIMA, MIMB, MIM	uc003yrk.2	O43312	OTTHUMG00000048189	ENST00000518547.1:c.1583A>G	chr8.hg19:g.125565918T>C	ENSP00000429064:p.Tyr528Cys	87.0	0.0		190.0	44.0	NM_014751	J3KNK6|Q8TCA2|Q96RX2	Missense_Mutation	SNP	ENST00000518547.1	hg19	CCDS6353.1	.	.	.	.	.	.	.	.	.	.	T	8.096	0.775656	0.16051	.	.	ENSG00000170873	ENST00000378017;ENST00000518547;ENST00000354184;ENST00000395508;ENST00000325064;ENST00000431961;ENST00000524090	T;T;T;T;T;T;T	0.30714	1.52;1.59;1.57;1.56;1.59;1.57;1.56	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.41926	0.1180	N	0.24115	0.695	0.52099	D	0.999947	B;D;B;B;B;D;D	0.89917	0.114;1.0;0.016;0.013;0.013;1.0;1.0	B;D;B;B;B;D;D	0.76071	0.034;0.987;0.006;0.007;0.009;0.947;0.956	T	0.27640	-1.0068	10	0.38643	T	0.18	-9.4794	15.9478	0.79806	0.0:0.0:0.0:1.0	.	418;302;503;528;503;246;177	E7EWW5;B7Z3B6;A5YM41;O43312;O43312-4;O43312-2;Q6ZTG0	.;.;.;MTSS1_HUMAN;.;.;.	C	503;528;246;302;532;246;418	ENSP00000367256:Y503C;ENSP00000429064:Y528C;ENSP00000346119:Y246C;ENSP00000378884:Y302C;ENSP00000322804:Y532C;ENSP00000393606:Y246C;ENSP00000428319:Y418C	ENSP00000322804:Y532C	Y	-	2	0	MTSS1	125635099	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	3.470000	0.53100	2.171000	0.68590	0.402000	0.26972	TAT	.	.		0.458	MTSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109625.3	NM_014751	
PLIN2	123	hgsc.bcm.edu	37	9	19119797	19119797	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr9:19119797G>T	ENST00000276914.2	-	6	807	c.628C>A	c.(628-630)Ctg>Atg	p.L210M	PLIN2_ENST00000411567.1_Silent_p.I166I	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	210					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						TTCTGAACCAGATCAAATCCT	0.418																																					p.L210M		Atlas-SNP	.											.	PLIN2	41	.	0			c.C628A						.						151.0	157.0	155.0					9																	19119797		2203	4300	6503	SO:0001583	missense	123	exon6			GAACCAGATCAAA	X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.628C>A	chr9.hg19:g.19119797G>T	ENSP00000276914:p.Leu210Met	105.0	0.0		91.0	30.0	NM_001122	Q9BSC3	Missense_Mutation	SNP	ENST00000276914.2	hg19	CCDS6490.1	.	.	.	.	.	.	.	.	.	.	G	5.435	0.265445	0.10294	.	.	ENSG00000147872	ENST00000276914	T	0.17370	2.28	5.98	-11.7	0.00046	.	1.923010	0.02306	N	0.071673	T	0.02970	0.0088	N	0.00289	-1.7	0.09310	N	1	B	0.06786	0.001	B	0.15052	0.012	T	0.45629	-0.9248	10	0.35671	T	0.21	.	4.3327	0.11071	0.1725:0.4453:0.2662:0.1159	.	210	Q99541	PLIN2_HUMAN	M	210	ENSP00000276914:L210M	ENSP00000276914:L210M	L	-	1	2	PLIN2	19109797	0.000000	0.05858	0.000000	0.03702	0.713000	0.41058	-1.233000	0.02934	-2.131000	0.00815	-0.860000	0.03012	CTG	.	.		0.418	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051835.1	NM_001122	
IFNA16	3449	hgsc.bcm.edu	37	9	21217149	21217149	+	Silent	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr9:21217149G>A	ENST00000380216.1	-	1	161	c.156C>T	c.(154-156)tgC>tgT	p.C52C		NM_002173.2	NP_002164.1	P05015	IFN16_HUMAN	interferon, alpha 16	52					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	13				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		TGTCCTTCAGGCAGGAGAAAT	0.512																																					p.C52C		Atlas-SNP	.											.	IFNA16	27	.	0			c.C156T						.						106.0	107.0	106.0					9																	21217149		2203	4300	6503	SO:0001819	synonymous_variant	3449	exon1			CTTCAGGCAGGAG		CCDS34996.1	9p22	2010-12-10			ENSG00000147885	ENSG00000147885		"""Interferons"""	5421	protein-coding gene	gene with protein product		147580				1385305	Standard	NM_002173		Approved	IFN-alphaO	uc003zor.1	P05015	OTTHUMG00000019663	ENST00000380216.1:c.156C>T	chr9.hg19:g.21217149G>A		194.0	0.0		205.0	78.0	NM_002173	Q5VV12	Silent	SNP	ENST00000380216.1	hg19	CCDS34996.1																																																																																			.	.		0.512	IFNA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051892.1	NM_002173	
IFNA2	3440	hgsc.bcm.edu	37	9	21385205	21385205	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr9:21385205C>A	ENST00000380206.2	-	1	191	c.124G>T	c.(124-126)Gca>Tca	p.A42S		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	42					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CTCATCTGTGCCAGGAGCATC	0.542																																					p.A42S		Atlas-SNP	.											.	IFNA2	32	.	0			c.G124T						.						114.0	112.0	113.0					9																	21385205		2203	4300	6503	SO:0001583	missense	3440	exon1			TCTGTGCCAGGAG		CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.124G>T	chr9.hg19:g.21385205C>A	ENSP00000369554:p.Ala42Ser	122.0	0.0		103.0	40.0	NM_000605	H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	ENST00000380206.2	hg19	CCDS6506.1	.	.	.	.	.	.	.	.	.	.	C	8.650	0.897930	0.17686	.	.	ENSG00000188379	ENST00000380206	T	0.40225	1.04	3.24	-0.168	0.13343	.	0.761996	0.12212	N	0.489217	T	0.28499	0.0705	L	0.41124	1.26	0.09310	N	1	B	0.11235	0.004	B	0.23150	0.044	T	0.24657	-1.0154	10	0.39692	T	0.17	.	2.7784	0.05354	0.0:0.4258:0.2516:0.3226	.	42	Q6DJX8	.	S	42	ENSP00000369554:A42S	ENSP00000369554:A42S	A	-	1	0	IFNA2	21375205	0.000000	0.05858	0.066000	0.19879	0.085000	0.17905	-0.686000	0.05161	0.103000	0.17682	0.484000	0.47621	GCA	.	.		0.542	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051903.1	NM_000605	
CDC14B	8555	hgsc.bcm.edu	37	9	99296248	99296248	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr9:99296248A>G	ENST00000375241.1	-	9	1358	c.907T>C	c.(907-909)Tgt>Cgt	p.C303R	CDC14B_ENST00000463569.1_Missense_Mutation_p.C303R|CDC14B_ENST00000375242.3_Missense_Mutation_p.C266R|CDC14B_ENST00000375236.1_Missense_Mutation_p.C303R|CDC14B_ENST00000375240.3_Missense_Mutation_p.C303R|CDC14B_ENST00000265659.2_Missense_Mutation_p.C303R	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	303	B.				activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				GCATTTTCACAGATATCTAGG	0.418																																					p.C303R		Atlas-SNP	.											.	CDC14B	64	.	0			c.T907C						.						66.0	57.0	60.0					9																	99296248		2203	4300	6503	SO:0001583	missense	8555	exon9			TTTCACAGATATC	AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.907T>C	chr9.hg19:g.99296248A>G	ENSP00000364389:p.Cys303Arg	265.0	0.0		236.0	77.0	NM_033331	A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Missense_Mutation	SNP	ENST00000375241.1	hg19	CCDS6722.1	.	.	.	.	.	.	.	.	.	.	A	19.28	3.797218	0.70567	.	.	ENSG00000081377	ENST00000265659;ENST00000375241;ENST00000375240;ENST00000375242;ENST00000463569;ENST00000375236	T;T;T;T;T;T	0.22743	1.94;1.94;1.94;1.94;1.94;1.94	5.42	4.27	0.50696	Dual specificity phosphatase, catalytic domain (1);Protein-tyrosine/Dual-specificity phosphatase (1);Dual specificity phosphatase, subgroup, catalytic domain (1);	0.043904	0.85682	D	0.000000	T	0.44138	0.1279	M	0.73319	2.225	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.72075	0.959;0.976;0.976	T	0.42515	-0.9447	10	0.87932	D	0	-6.0934	12.7445	0.57273	0.8628:0.1372:0.0:0.0	.	303;303;266	O60729-2;O60729;A8MQ20	.;CC14B_HUMAN;.	R	303;303;303;266;303;303	ENSP00000265659:C303R;ENSP00000364389:C303R;ENSP00000364388:C303R;ENSP00000364390:C266R;ENSP00000420572:C303R;ENSP00000364384:C303R	ENSP00000265659:C303R	C	-	1	0	CDC14B	98336069	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.139000	0.94554	1.057000	0.40506	-0.321000	0.08615	TGT	.	.		0.418	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053278.2	NM_033331	
AKNA	80709	hgsc.bcm.edu	37	9	117120428	117120428	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr9:117120428C>G	ENST00000307564.4	-	12	2673	c.2512G>C	c.(2512-2514)Gta>Cta	p.V838L	AKNA_ENST00000374075.5_Missense_Mutation_p.V757L|AKNA_ENST00000374088.3_Missense_Mutation_p.V838L|AKNA_ENST00000223791.3_Missense_Mutation_p.V298L	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	838					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						TTCATAGATACCATCTTCTCC	0.632																																					p.V838L		Atlas-SNP	.											.	AKNA	119	.	0			c.G2512C						.						77.0	65.0	69.0					9																	117120428		2203	4300	6503	SO:0001583	missense	80709	exon12			TAGATACCATCTT	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2512G>C	chr9.hg19:g.117120428C>G	ENSP00000303769:p.Val838Leu	82.0	0.0		76.0	32.0	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Missense_Mutation	SNP	ENST00000307564.4	hg19	CCDS6805.1	.	.	.	.	.	.	.	.	.	.	C	2.519	-0.311230	0.05458	.	.	ENSG00000106948	ENST00000307564;ENST00000374088;ENST00000223791;ENST00000374075	T;T;T;T	0.15487	2.64;2.64;2.42;2.64	3.67	2.78	0.32641	.	1.536310	0.03947	N	0.287797	T	0.13072	0.0317	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.33214	-0.9877	10	0.10636	T	0.68	0.0302	11.9937	0.53189	0.0:0.8226:0.1774:0.0	.	838;757	Q7Z591;Q7Z591-2	AKNA_HUMAN;.	L	838;838;298;757	ENSP00000303769:V838L;ENSP00000363201:V838L;ENSP00000223791:V298L;ENSP00000363188:V757L	ENSP00000223791:V298L	V	-	1	0	AKNA	116160249	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	1.025000	0.30090	0.545000	0.28902	-2.315000	0.00254	GTA	.	.		0.632	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
NOTCH1	4851	hgsc.bcm.edu	37	9	139393656	139393656	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr9:139393656G>A	ENST00000277541.6	-	32	6065	c.5990C>T	c.(5989-5991)aCg>aTg	p.T1997M		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1997					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GATCAGTGGCGTCGTGCCATC	0.647			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.T1997M		Atlas-SNP	.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1	1980	.	0			c.C5990T						.						61.0	66.0	64.0					9																	139393656		2202	4300	6502	SO:0001583	missense	4851	exon32			AGTGGCGTCGTGC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5990C>T	chr9.hg19:g.139393656G>A	ENSP00000277541:p.Thr1997Met	67.0	0.0		78.0	31.0	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	hg19	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.706161	0.68615	.	.	ENSG00000148400	ENST00000277541	T	0.59906	0.23	5.07	5.07	0.68467	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.82527	0.5056	M	0.93328	3.405	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87381	0.2357	10	0.87932	D	0	.	17.7871	0.88541	0.0:0.0:1.0:0.0	.	1997	P46531	NOTC1_HUMAN	M	1997	ENSP00000277541:T1997M	ENSP00000277541:T1997M	T	-	2	0	NOTCH1	138513477	1.000000	0.71417	0.082000	0.20525	0.241000	0.25554	9.154000	0.94694	2.512000	0.84698	0.561000	0.74099	ACG	.	.		0.647	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
LARP4B	23185	hgsc.bcm.edu	37	10	875345	875345	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr10:875345T>A	ENST00000316157.3	-	10	1145	c.1105A>T	c.(1105-1107)Agc>Tgc	p.S369C		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	369					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						TCAAGATAGCTGTGCGTTGCT	0.483																																					p.S369C		Atlas-SNP	.											.	LARP4B	110	.	0			c.A1105T						.						40.0	40.0	40.0					10																	875345		2203	4300	6503	SO:0001583	missense	23185	exon11			GATAGCTGTGCGT	D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1105A>T	chr10.hg19:g.875345T>A	ENSP00000326128:p.Ser369Cys	122.0	0.0		106.0	51.0	NM_015155	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	ENST00000316157.3	hg19	CCDS31131.1	.	.	.	.	.	.	.	.	.	.	T	16.93	3.257550	0.59321	.	.	ENSG00000107929	ENST00000316157	T	0.33865	1.39	5.4	4.27	0.50696	.	0.000000	0.85682	D	0.000000	T	0.44329	0.1288	N	0.22421	0.69	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.42849	-0.9427	10	0.72032	D	0.01	-7.668	11.4767	0.50302	0.0:0.0709:0.0:0.9291	.	369	Q92615	LAR4B_HUMAN	C	369	ENSP00000326128:S369C	ENSP00000326128:S369C	S	-	1	0	LARP4B	865345	1.000000	0.71417	0.976000	0.42696	0.485000	0.33311	4.082000	0.57635	0.984000	0.38629	0.533000	0.62120	AGC	.	.		0.483	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046395.2	NM_015155	
ANK3	288	hgsc.bcm.edu	37	10	61832432	61832432	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr10:61832432T>A	ENST00000280772.2	-	37	8398	c.8207A>T	c.(8206-8208)gAa>gTa	p.E2736V	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	2736					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CTTTCTGTCTTCTTGAGACAT	0.423																																					p.E2736V		Atlas-SNP	.											.	ANK3	703	.	0			c.A8207T						.						126.0	126.0	126.0					10																	61832432		2203	4300	6503	SO:0001583	missense	288	exon37			CTGTCTTCTTGAG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.8207A>T	chr10.hg19:g.61832432T>A	ENSP00000280772:p.Glu2736Val	107.0	0.0		135.0	33.0	NM_020987	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384963	0.82792	.	.	ENSG00000151150	ENST00000280772	T	0.66280	-0.2	5.82	5.82	0.92795	.	0.161017	0.28883	N	0.013840	T	0.52041	0.1710	N	0.24115	0.695	0.80722	D	1	P	0.42123	0.771	B	0.40410	0.328	T	0.56312	-0.8000	10	0.49607	T	0.09	.	16.1852	0.81946	0.0:0.0:0.0:1.0	.	2736	Q12955	ANK3_HUMAN	V	2736	ENSP00000280772:E2736V	ENSP00000280772:E2736V	E	-	2	0	ANK3	61502438	1.000000	0.71417	0.998000	0.56505	0.890000	0.51754	5.792000	0.69052	2.223000	0.72356	0.454000	0.30748	GAA	.	.		0.423	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
TECTB	6975	hgsc.bcm.edu	37	10	114046125	114046125	+	Silent	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr10:114046125C>T	ENST00000369422.3	+	4	459	c.459C>T	c.(457-459)agC>agT	p.S153S		NM_058222.1	NP_478129.1	Q96PL2	TECTB_HUMAN	tectorin beta	153	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.					anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				kidney(2)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		CATTTGAGAGCCAACTGTCTC	0.493																																					p.S153S		Atlas-SNP	.											.	TECTB	35	.	0			c.C459T						.						143.0	113.0	123.0					10																	114046125		2203	4300	6503	SO:0001819	synonymous_variant	6975	exon4			TGAGAGCCAACTG	AF312827	CCDS7571.1	10q25-q26	2005-06-09			ENSG00000119913	ENSG00000119913			11721	protein-coding gene	gene with protein product		602653				9079715	Standard	NM_058222		Approved		uc001kzr.1	Q96PL2	OTTHUMG00000019056	ENST00000369422.3:c.459C>T	chr10.hg19:g.114046125C>T		129.0	0.0		81.0	39.0	NM_058222	Q5VW53	Silent	SNP	ENST00000369422.3	hg19	CCDS7571.1																																																																																			.	.		0.493	TECTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050381.1	NM_058222	
MKI67	4288	hgsc.bcm.edu	37	10	129905646	129905646	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr10:129905646G>C	ENST00000368654.3	-	13	4833	c.4458C>G	c.(4456-4458)caC>caG	p.H1486Q	MKI67_ENST00000368653.3_Missense_Mutation_p.H1126Q	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1486	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TAGTTTTCTCGTGAGTCGTGG	0.517																																					p.H1486Q		Atlas-SNP	.											.	MKI67	363	.	0			c.C4458G						.						295.0	276.0	283.0					10																	129905646		2203	4300	6503	SO:0001583	missense	4288	exon13			TTTCTCGTGAGTC	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.4458C>G	chr10.hg19:g.129905646G>C	ENSP00000357643:p.His1486Gln	159.0	0.0		138.0	46.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	G	1.872	-0.459998	0.04508	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01246	5.16;5.11	3.46	-0.678	0.11353	.	4.389550	0.00682	N	0.000691	T	0.01320	0.0043	L	0.29908	0.895	0.09310	N	1	B;P;B	0.36483	0.079;0.555;0.206	B;B;B	0.36567	0.043;0.228;0.056	T	0.44159	-0.9346	10	0.13853	T	0.58	.	1.8183	0.03105	0.5718:0.1694:0.0957:0.1631	.	1485;1126;1486	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	Q	1486;1126;1485	ENSP00000357643:H1486Q;ENSP00000357642:H1126Q	ENSP00000357642:H1126Q	H	-	3	2	MKI67	129795636	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.921000	0.04008	-0.233000	0.09797	-1.762000	0.00668	CAC	.	.		0.517	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
TUBGCP2	10844	hgsc.bcm.edu	37	10	135098648	135098648	+	Silent	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr10:135098648G>A	ENST00000252936.3	-	12	2004	c.1965C>T	c.(1963-1965)ctC>ctT	p.L655L	TUBGCP2_ENST00000368562.1_Silent_p.L248L|TUBGCP2_ENST00000417178.2_Silent_p.L525L|TUBGCP2_ENST00000543663.1_Silent_p.L683L|TUBGCP2_ENST00000368563.2_Silent_p.L655L			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	655					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		AGACGCTGCAGAGCTGCCGCT	0.617																																					p.L683L		Atlas-SNP	.											.	TUBGCP2	79	.	0			c.C2049T						.						92.0	70.0	77.0					10																	135098648		2203	4300	6503	SO:0001819	synonymous_variant	10844	exon14			GCTGCAGAGCTGC	AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.1965C>T	chr10.hg19:g.135098648G>A		64.0	0.0		56.0	14.0	NM_001256617	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	ENST00000252936.3	hg19	CCDS7676.1																																																																																			.	.		0.617	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051148.1		
SYT8	90019	hgsc.bcm.edu	37	11	1857147	1857147	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:1857147G>A	ENST00000381968.3	+	4	460	c.332G>A	c.(331-333)aGc>aAc	p.S111N	SYT8_ENST00000436964.2_Missense_Mutation_p.S97N|SYT8_ENST00000341958.3_Missense_Mutation_p.S97N|SYT8_ENST00000483280.1_3'UTR|SYT8_ENST00000535046.1_Missense_Mutation_p.S249N	NM_138567.3	NP_612634	Q8NBV8	SYT8_HUMAN	synaptotagmin VIII	111					acrosome reaction (GO:0007340)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	transporter activity (GO:0005215)			breast(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CTGGAGTCCAGCCCGGGGGAT	0.647																																					p.S111N		Atlas-SNP	.											.	SYT8	29	.	0			c.G332A						.						46.0	47.0	47.0					11																	1857147		2201	4299	6500	SO:0001583	missense	90019	exon4			AGTCCAGCCCGGG	AL137708	CCDS7726.2	11p15.5	2013-01-21			ENSG00000149043	ENSG00000149043		"""Synaptotagmins"""	19264	protein-coding gene	gene with protein product		607719				7791877	Standard	XM_005253216		Approved	DKFZp434K0322	uc001lue.1	Q8NBV8	OTTHUMG00000009026	ENST00000381968.3:c.332G>A	chr11.hg19:g.1857147G>A	ENSP00000371394:p.Ser111Asn	130.0	0.0		108.0	39.0	NM_138567	A6NFJ4|Q9NSV9	Missense_Mutation	SNP	ENST00000381968.3	hg19	CCDS7726.2	.	.	.	.	.	.	.	.	.	.	g	7.507	0.653884	0.14580	.	.	ENSG00000149043	ENST00000436964;ENST00000430303;ENST00000417052;ENST00000535046;ENST00000381968;ENST00000341958	T;T;T;T;T;T	0.47177	2.22;0.85;0.86;2.19;3.11;3.11	2.75	1.81	0.25067	C2 calcium/lipid-binding domain, CaLB (1);	.	.	.	.	T	0.31389	0.0795	L	0.45137	1.4	0.09310	N	1	B;B;B	0.14012	0.009;0.003;0.003	B;B;B	0.08055	0.003;0.002;0.002	T	0.32903	-0.9889	9	0.02654	T	1	.	7.0146	0.24881	0.2365:0.0:0.7635:0.0	.	97;111;97	C9JSK3;Q8NBV8;A6NCR4	.;SYT8_HUMAN;.	N	97;97;97;249;111;97	ENSP00000414626:S97N;ENSP00000392469:S97N;ENSP00000387678:S97N;ENSP00000443325:S249N;ENSP00000371394:S111N;ENSP00000343691:S97N	ENSP00000343691:S97N	S	+	2	0	SYT8	1813723	0.023000	0.18921	0.000000	0.03702	0.006000	0.05464	1.528000	0.35985	0.491000	0.27793	0.305000	0.20034	AGC	.	.		0.647	SYT8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025013.4		
RRM1	6240	hgsc.bcm.edu	37	11	4141136	4141136	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:4141136A>G	ENST00000300738.5	+	9	1058	c.854A>G	c.(853-855)tAt>tGt	p.Y285C	RRM1_ENST00000537197.1_5'UTR|RRM1_ENST00000534285.1_Missense_Mutation_p.Y63C|RRM1_ENST00000528470.1_3'UTR|RRM1_ENST00000423050.2_Missense_Mutation_p.Y188C	NM_001033.3	NP_001024.1	P23921	RIR1_HUMAN	ribonucleotide reductase M1	285	Allosteric effector binding, determines substrate specificity.				cell proliferation in forebrain (GO:0021846)|deoxyribonucleotide biosynthetic process (GO:0009263)|DNA replication (GO:0006260)|male gonad development (GO:0008584)|mitotic cell cycle (GO:0000278)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein heterotetramerization (GO:0051290)|pyrimidine nucleobase metabolic process (GO:0006206)|response to ionizing radiation (GO:0010212)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ribonucleoside-diphosphate reductase activity, thioredoxin disulfide as acceptor (GO:0004748)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)	14		Medulloblastoma(188;0.0025)|Breast(177;0.00502)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0848)|LUSC - Lung squamous cell carcinoma(625;0.205)	Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Gemcitabine(DB00441)|Hydroxyurea(DB01005)	ACAGCTCGATATGTGGATCAA	0.393																																					p.Y285C	NSCLC(45;1345 1376 6258 22925)|Ovarian(34;894 1053 6175 12768)	Atlas-SNP	.											.	RRM1	31	.	0			c.A854G						.						150.0	136.0	140.0					11																	4141136		2201	4298	6499	SO:0001583	missense	6240	exon9			CTCGATATGTGGA	X59543	CCDS7750.1	11p15.5	2009-07-10	2008-03-11		ENSG00000167325	ENSG00000167325	1.17.14.1		10451	protein-coding gene	gene with protein product		180410	"""ribonucleotide reductase M1 polypeptide"""			7557993	Standard	NM_001033		Approved		uc001lyw.4	P23921	OTTHUMG00000133361	ENST00000300738.5:c.854A>G	chr11.hg19:g.4141136A>G	ENSP00000300738:p.Tyr285Cys	121.0	0.0		95.0	22.0	NM_001033	Q9UNN2	Missense_Mutation	SNP	ENST00000300738.5	hg19	CCDS7750.1	.	.	.	.	.	.	.	.	.	.	A	27.1	4.797877	0.90538	.	.	ENSG00000167325	ENST00000300738;ENST00000423050;ENST00000536894;ENST00000534285;ENST00000543838	T;T;T	0.47869	0.83;0.83;0.83	5.65	5.65	0.86999	Ribonucleoside-diphosphate reductase, alpha subunit (1);Ribonucleotide reductase large subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72011	0.3408	M	0.89353	3.025	0.80722	D	1	D	0.76494	0.999	D	0.64595	0.927	T	0.78532	-0.2168	10	0.87932	D	0	-12.9793	15.0275	0.71680	1.0:0.0:0.0:0.0	.	285	P23921	RIR1_HUMAN	C	285;188;198;63;63	ENSP00000300738:Y285C;ENSP00000390539:Y188C;ENSP00000431464:Y63C	ENSP00000300738:Y285C	Y	+	2	0	RRM1	4097712	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.933000	0.92911	2.146000	0.66826	0.482000	0.46254	TAT	.	.		0.393	RRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257197.1	NM_001033	
OR56A3	390083	hgsc.bcm.edu	37	11	5968733	5968733	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:5968733A>G	ENST00000329564.6	+	1	164	c.157A>G	c.(157-159)Atc>Gtc	p.I53V	AC025016.1_ENST00000528915.1_lincRNA	NM_001003443.2	NP_001003443.2	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A, member 3	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(27)|stomach(1)|upper_aerodigestive_tract(1)	41		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCTGATGACCATCTGGCTGGA	0.612																																					p.I53V		Atlas-SNP	.											.	OR56A3	81	.	0			c.A157G						.						122.0	123.0	123.0					11																	5968733		2201	4296	6497	SO:0001583	missense	390083	exon1			ATGACCATCTGGC		CCDS41614.1	11p15.4	2012-08-09		2004-03-10	ENSG00000184478	ENSG00000184478		"""GPCR / Class A : Olfactory receptors"""	14786	protein-coding gene	gene with protein product				OR56A6, OR56A3P			Standard	NM_001003443		Approved		uc010qzt.2	Q8NH54	OTTHUMG00000165373	ENST00000329564.6:c.157A>G	chr11.hg19:g.5968733A>G	ENSP00000331572:p.Ile53Val	145.0	0.0		123.0	39.0	NM_001003443	A6NN77|Q6IFF7	Missense_Mutation	SNP	ENST00000329564.6	hg19	CCDS41614.1	.	.	.	.	.	.	.	.	.	.	A	7.864	0.726771	0.15439	.	.	ENSG00000184478	ENST00000329564	T	0.06687	3.27	5.12	4.0	0.46444	GPCR, rhodopsin-like superfamily (1);	0.100375	0.43919	D	0.000502	T	0.08891	0.0220	L	0.46947	1.48	0.31915	N	0.614133	B	0.30824	0.296	B	0.33454	0.164	T	0.06826	-1.0805	10	0.35671	T	0.21	-32.9041	9.0774	0.36531	0.9133:0.0:0.0867:0.0	.	53	Q8NH54	O56A3_HUMAN	V	53	ENSP00000331572:I53V	ENSP00000331572:I53V	I	+	1	0	OR56A3	5925309	0.022000	0.18835	0.985000	0.45067	0.014000	0.08584	0.800000	0.27042	0.988000	0.38734	-0.268000	0.10319	ATC	.	.		0.612	OR56A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383753.1	NM_001003443	
CTNND1	1500	hgsc.bcm.edu	37	11	57575697	57575697	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:57575697G>A	ENST00000399050.4	+	13	2560	c.2024G>A	c.(2023-2025)aGc>aAc	p.S675N	CTNND1_ENST00000361332.4_Missense_Mutation_p.S669N|CTNND1_ENST00000532649.1_Missense_Mutation_p.S615N|CTNND1_ENST00000529526.1_Missense_Mutation_p.S615N|CTNND1_ENST00000399039.4_Missense_Mutation_p.S675N|CTNND1_ENST00000524630.1_Missense_Mutation_p.S669N|CTNND1_ENST00000529986.1_Missense_Mutation_p.S568N|CTNND1_ENST00000532245.1_Missense_Mutation_p.S568N|CTNND1_ENST00000426142.2_Missense_Mutation_p.S568N|CTNND1_ENST00000529873.1_Missense_Mutation_p.S615N|CTNND1_ENST00000428599.2_Missense_Mutation_p.S669N|CTNND1_ENST00000358694.6_Missense_Mutation_p.S669N|CTNND1_ENST00000526357.1_Missense_Mutation_p.S615N|CTNND1_ENST00000532463.1_Missense_Mutation_p.S568N|CTNND1_ENST00000531014.1_Missense_Mutation_p.S346N|CTNND1_ENST00000534579.1_Missense_Mutation_p.S615N|CTNND1_ENST00000532844.1_Missense_Mutation_p.S621N|CTNND1_ENST00000415361.2_Missense_Mutation_p.S574N|CTNND1_ENST00000360682.6_Missense_Mutation_p.S675N|CTNND1_ENST00000527467.1_Missense_Mutation_p.S352N|CTNND1_ENST00000530748.1_Missense_Mutation_p.S621N|CTNND1_ENST00000361391.6_Missense_Mutation_p.S669N|CTNND1_ENST00000525902.1_Missense_Mutation_p.S352N|CTNND1_ENST00000528232.1_Missense_Mutation_p.S574N|CTNND1_ENST00000528621.1_Missense_Mutation_p.S615N|CTNND1_ENST00000533667.1_Missense_Mutation_p.S346N|CTNND1_ENST00000532787.1_Missense_Mutation_p.S568N|CTNND1_ENST00000529919.1_Missense_Mutation_p.S675N|CTNND1_ENST00000361796.4_Missense_Mutation_p.S669N|CTNND1_ENST00000526772.1_Missense_Mutation_p.S346N|CTNND1_ENST00000526938.1_Missense_Mutation_p.S675N|CTNND1_ENST00000530094.1_Missense_Mutation_p.S568N	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	675					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				CTTAAGGAGAGCAAGACTCCT	0.478																																					p.S675N		Atlas-SNP	.											CTNND1_ENST00000399050,NS,carcinoma,0,2	CTNND1	203	.	0			c.G2024A						.						83.0	74.0	76.0					11																	57575697		1894	4112	6006	SO:0001583	missense	1500	exon13			AGGAGAGCAAGAC	AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.2024G>A	chr11.hg19:g.57575697G>A	ENSP00000382004:p.Ser675Asn	89.0	0.0		92.0	40.0	NM_001085458	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	ENST00000399050.4	hg19	CCDS44604.1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.650490	0.87958	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.81739	-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53;-1.53	5.13	5.13	0.70059	Armadillo-like helical (1);Armadillo-type fold (1);	0.227898	0.44902	D	0.000401	D	0.90253	0.6952	M	0.90082	3.085	0.54753	D	0.999983	P;P;P;P;P;P;D;P;P	0.65815	0.882;0.882;0.813;0.867;0.882;0.933;0.995;0.882;0.813	P;P;B;B;P;P;D;P;B	0.63957	0.503;0.503;0.307;0.445;0.503;0.503;0.92;0.503;0.307	D	0.91570	0.5271	10	0.59425	D	0.04	-6.8317	14.2087	0.65750	0.0:0.1497:0.8503:0.0	.	675;669;675;568;615;615;669;675;675	O60716-3;O60716-2;O60716;O60716-18;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.;.;.	N	669;675;675;675;669;615;568;675;669;669;568;568;669;568;346;615;615;621;669;352;574;346;346;615;352;621;615;568;574;568;615;675	ENSP00000436543:S669N;ENSP00000434808:S675N;ENSP00000381996:S675N;ENSP00000353902:S675N;ENSP00000354907:S669N;ENSP00000436323:S615N;ENSP00000409930:S568N;ENSP00000382004:S675N;ENSP00000354785:S669N;ENSP00000354823:S669N;ENSP00000432075:S568N;ENSP00000437156:S568N;ENSP00000351527:S669N;ENSP00000434949:S568N;ENSP00000437051:S346N;ENSP00000435379:S615N;ENSP00000432243:S615N;ENSP00000436744:S621N;ENSP00000413586:S669N;ENSP00000434900:S352N;ENSP00000435266:S574N;ENSP00000432623:S346N;ENSP00000433158:S346N;ENSP00000435494:S615N;ENSP00000434672:S352N;ENSP00000433276:S621N;ENSP00000433334:S615N;ENSP00000437327:S568N;ENSP00000403518:S574N;ENSP00000434017:S568N;ENSP00000435789:S615N;ENSP00000432041:S675N	ENSP00000351527:S669N	S	+	2	0	CTNND1	57332273	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.257000	0.65473	2.566000	0.86566	0.460000	0.39030	AGC	.	.		0.478	CTNND1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000393944.1	NM_001331	
CTSW	1521	hgsc.bcm.edu	37	11	65650839	65650839	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:65650839C>T	ENST00000307886.3	+	9	1010	c.964C>T	c.(964-966)Cac>Tac	p.H322Y	FIBP_ENST00000426652.2_5'Flank|CTSW_ENST00000528419.1_Missense_Mutation_p.H322Y	NM_001335.3	NP_001326	P56202	CATW_HUMAN	cathepsin W	322					immune response (GO:0006955)	membrane (GO:0016020)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)	9				READ - Rectum adenocarcinoma(159;0.168)		TCAGCCTCCACACCCCACCCC	0.592																																					p.H322Y		Atlas-SNP	.											.	CTSW	18	.	0			c.C964T						.						91.0	90.0	90.0					11																	65650839		2201	4296	6497	SO:0001583	missense	1521	exon9			CCTCCACACCCCA	AF055903	CCDS8117.1	11q13.1	2008-02-01	2006-12-05		ENSG00000172543	ENSG00000172543		"""Cathepsins"""	2546	protein-coding gene	gene with protein product		602364	"""cathepsin W (lymphopain)"""			9108299, 9675123	Standard	NM_001335		Approved		uc001ogc.1	P56202	OTTHUMG00000166663	ENST00000307886.3:c.964C>T	chr11.hg19:g.65650839C>T	ENSP00000311300:p.His322Tyr	106.0	0.0		88.0	25.0	NM_001335	Q86VT4	Missense_Mutation	SNP	ENST00000307886.3	hg19	CCDS8117.1	.	.	.	.	.	.	.	.	.	.	C	12.18	1.862066	0.32884	.	.	ENSG00000172543	ENST00000307886;ENST00000528419	T;T	0.29142	1.58;1.58	4.99	3.96	0.45880	Peptidase C1A, papain C-terminal (2);	7.976250	0.00166	N	0.000010	T	0.30070	0.0753	L	0.43152	1.355	0.09310	N	1	P;P	0.40398	0.68;0.716	B;B	0.38880	0.273;0.284	T	0.27468	-1.0073	10	0.56958	D	0.05	.	5.486	0.16749	0.0:0.8184:0.0:0.1816	.	322;322	P56202;E9PI30	CATW_HUMAN;.	Y	322	ENSP00000311300:H322Y;ENSP00000436568:H322Y	ENSP00000311300:H322Y	H	+	1	0	CTSW	65407415	0.000000	0.05858	0.013000	0.15412	0.079000	0.17450	0.352000	0.20113	2.317000	0.78254	0.491000	0.48974	CAC	.	.		0.592	CTSW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391042.1	NM_001335	
ATM	472	hgsc.bcm.edu	37	11	108206607	108206607	+	Missense_Mutation	SNP	A	A	T	rs587781946		TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:108206607A>T	ENST00000452508.2	+	57	8376	c.8187A>T	c.(8185-8187)caA>caT	p.Q2729H	ATM_ENST00000278616.4_Missense_Mutation_p.Q2729H|C11orf65_ENST00000525729.1_Intron			Q13315	ATM_HUMAN	ATM serine/threonine kinase	2729	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	CTGTCATGCAACAGGTCTTCC	0.353			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.Q2729H		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.A8187T						.						112.0	104.0	107.0					11																	108206607		2201	4298	6499	SO:0001583	missense	472	exon56	Familial Cancer Database	AT, Louis-Bar syndrome	CATGCAACAGGTC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.8187A>T	chr11.hg19:g.108206607A>T	ENSP00000388058:p.Gln2729His	106.0	0.0		91.0	51.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.533279	0.85812	.	.	ENSG00000149311	ENST00000278616;ENST00000452508	D;D	0.88896	-2.44;-2.44	5.56	4.64	0.57946	Protein kinase-like domain (1);Armadillo-type fold (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.95095	0.8411	M	0.91406	3.205	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95458	0.8540	10	0.87932	D	0	.	11.7253	0.51706	0.1494:0.0:0.8505:0.0	.	2729	Q13315	ATM_HUMAN	H	2729	ENSP00000278616:Q2729H;ENSP00000388058:Q2729H	ENSP00000278616:Q2729H	Q	+	3	2	ATM	107711817	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.725000	0.47294	1.335000	0.45486	-0.242000	0.12053	CAA	.	.		0.353	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
USP28	57646	hgsc.bcm.edu	37	11	113683133	113683133	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:113683133A>T	ENST00000003302.4	-	16	1905	c.1837T>A	c.(1837-1839)Tgg>Agg	p.W613R	USP28_ENST00000544967.1_Missense_Mutation_p.W321R|USP28_ENST00000545540.1_Missense_Mutation_p.W488R|USP28_ENST00000260188.5_Missense_Mutation_p.W613R	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	613	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		TACTTGAGCCAGCTCTGTCGG	0.438																																					p.W613R	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	Atlas-SNP	.											.	USP28	135	.	0			c.T1837A						.						152.0	154.0	153.0					11																	113683133		2201	4296	6497	SO:0001583	missense	57646	exon16			TGAGCCAGCTCTG	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1837T>A	chr11.hg19:g.113683133A>T	ENSP00000003302:p.Trp613Arg	79.0	0.0		81.0	21.0	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	hg19	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990150	0.74589	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475	T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12	5.43	5.43	0.79202	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	D	0.83018	0.5163	H	0.95151	3.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88415	0.3024	10	0.87932	D	0	-8.4685	15.4805	0.75521	1.0:0.0:0.0:0.0	.	488;613;321	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	R	613;613;321;488;317	ENSP00000003302:W613R;ENSP00000260188:W613R;ENSP00000442431:W321R;ENSP00000444991:W488R;ENSP00000442257:W317R	ENSP00000003302:W613R	W	-	1	0	USP28	113188343	1.000000	0.71417	0.996000	0.52242	0.634000	0.38068	8.962000	0.93254	2.053000	0.61076	0.533000	0.62120	TGG	.	.		0.438	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
CDON	50937	hgsc.bcm.edu	37	11	125848206	125848206	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:125848206T>A	ENST00000392693.3	-	18	3476	c.3349A>T	c.(3349-3351)Aac>Tac	p.N1117Y	CDON_ENST00000531738.1_Missense_Mutation_p.N494Y|CDON_ENST00000263577.7_Missense_Mutation_p.N1117Y	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	1117					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TACCTATTGTTGTTTCGACAA	0.418																																					p.N1117Y		Atlas-SNP	.											.	CDON	137	.	0			c.A3349T						.						96.0	78.0	84.0					11																	125848206		2201	4299	6500	SO:0001583	missense	50937	exon18			TATTGTTGTTTCG	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.3349A>T	chr11.hg19:g.125848206T>A	ENSP00000376458:p.Asn1117Tyr	96.0	0.0		92.0	23.0	NM_016952	O14631	Missense_Mutation	SNP	ENST00000392693.3	hg19	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.365146	0.82463	.	.	ENSG00000064309	ENST00000392693;ENST00000531738;ENST00000263577	T;T;T	0.79141	-1.22;-0.63;-1.24	5.68	5.68	0.88126	.	0.000000	0.52532	D	0.000067	D	0.87406	0.6169	M	0.72894	2.215	0.53688	D	0.999978	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.88761	0.3257	10	0.87932	D	0	-30.9435	15.9253	0.79611	0.0:0.0:0.0:1.0	.	1117;1117;494	Q4KMG0;Q4KMG0-2;E9PN78	CDON_HUMAN;.;.	Y	1117;494;1117	ENSP00000376458:N1117Y;ENSP00000432901:N494Y;ENSP00000263577:N1117Y	ENSP00000263577:N1117Y	N	-	1	0	CDON	125353416	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	7.620000	0.83070	2.165000	0.68154	0.366000	0.22137	AAC	.	.		0.418	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
ARHGAP32	9743	hgsc.bcm.edu	37	11	128843038	128843038	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr11:128843038G>T	ENST00000310343.9	-	21	3320	c.3321C>A	c.(3319-3321)ttC>ttA	p.F1107L	ARHGAP32_ENST00000524655.1_3'UTR|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.F758L|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.F758L	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	1107					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						TCTGGAGGTGGAACTGCTCTG	0.488																																					p.F1107L		Atlas-SNP	.											.	ARHGAP32	307	.	0			c.C3321A						.						205.0	191.0	196.0					11																	128843038		2201	4297	6498	SO:0001583	missense	9743	exon21			GAGGTGGAACTGC	AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.3321C>A	chr11.hg19:g.128843038G>T	ENSP00000310561:p.Phe1107Leu	152.0	0.0		134.0	52.0	NM_001142685	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	ENST00000310343.9	hg19	CCDS44769.1	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.439577	0.00180	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000527272	T;T;T	0.05925	3.37;3.38;3.38	5.61	-1.75	0.08031	.	0.938757	0.09089	N	0.850175	T	0.04003	0.0112	L	0.39898	1.24	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48445	-0.9035	10	0.10377	T	0.69	.	1.4424	0.02357	0.2772:0.2783:0.304:0.1405	.	1107	A7KAX9	RHG32_HUMAN	L	1107;758;758	ENSP00000310561:F1107L;ENSP00000376425:F758L;ENSP00000432862:F758L	ENSP00000310561:F1107L	F	-	3	2	ARHGAP32	128348248	0.003000	0.15002	0.001000	0.08648	0.237000	0.25408	-0.178000	0.09782	-0.166000	0.10890	-1.845000	0.00574	TTC	.	.		0.488	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386151.3	NM_014715	
PDE3A	5139	hgsc.bcm.edu	37	12	20806880	20806880	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr12:20806880G>A	ENST00000359062.3	+	15	2965		c.e15-1		PDE3A_ENST00000544307.1_Splice_Site	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)	p.?(1)		NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TTTATTTCTAGGGTGATGAAG	0.428																																					.		Atlas-SNP	.											PDE3A,NS,carcinoma,0,1	PDE3A	184	.	1	Unknown(1)	lung(1)	c.2926-1G>A						.						57.0	58.0	58.0					12																	20806880		2203	4299	6502	SO:0001630	splice_region_variant	5139	exon15			TTTCTAGGGTGAT		CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2926-1G>A	chr12.hg19:g.20806880G>A		95.0	0.0		63.0	30.0	NM_000921	O60865|Q13348|Q17RD1	Splice_Site	SNP	ENST00000359062.3	hg19	CCDS31754.1	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092705	0.56075	.	.	ENSG00000172572	ENST00000359062	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3412	0.94342	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDE3A	20698147	1.000000	0.71417	0.997000	0.53966	0.433000	0.31745	9.358000	0.97109	2.657000	0.90304	0.655000	0.94253	.	.	.		0.428	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401756.2		Intron
FGD4	121512	hgsc.bcm.edu	37	12	32777980	32777980	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr12:32777980A>G	ENST00000427716.2	+	13	2037	c.1613A>G	c.(1612-1614)aAt>aGt	p.N538S	FGD4_ENST00000266482.3_Missense_Mutation_p.N290S|FGD4_ENST00000525053.1_Missense_Mutation_p.N650S|FGD4_ENST00000534526.2_Missense_Mutation_p.N675S|FGD4_ENST00000531134.1_Missense_Mutation_p.N623S|FGD4_ENST00000546442.1_Missense_Mutation_p.N445S	NM_139241.2	NP_640334.2	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	538					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|microspike assembly (GO:0030035)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	27	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)					GCAAAGGATAATGACATTCAC	0.348																																					p.N538S		Atlas-SNP	.											.	FGD4	86	.	0			c.A1613G						.						118.0	125.0	122.0					12																	32777980		2203	4300	6503	SO:0001583	missense	121512	exon13			AGGATAATGACAT	AK057294	CCDS8727.1	12p11.1	2014-09-17	2004-08-24		ENSG00000139132	ENSG00000139132		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19125	protein-coding gene	gene with protein product		611104	"""FGD1 family, member 4"""			11527409	Standard	NM_139241		Approved	FRABP, frabin, ZFYVE6, CMT4H	uc001rkz.3	Q96M96	OTTHUMG00000137374	ENST00000427716.2:c.1613A>G	chr12.hg19:g.32777980A>G	ENSP00000394487:p.Asn538Ser	263.0	1.0		245.0	98.0	NM_139241	Q6ULS2|Q8TCP6	Missense_Mutation	SNP	ENST00000427716.2	hg19	CCDS8727.1	.	.	.	.	.	.	.	.	.	.	A	11.70	1.717920	0.30413	.	.	ENSG00000139132	ENST00000534526;ENST00000531134;ENST00000427716;ENST00000266482;ENST00000546442;ENST00000525053	D;D;D;D;D;D	0.87571	-2.27;-2.27;-2.27;-2.27;-2.27;-2.27	5.81	4.67	0.58626	.	0.225111	0.31246	N	0.007994	T	0.75982	0.3924	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.18863	0.014;0.014;0.031;0.004	B;B;B;B	0.14023	0.01;0.01;0.006;0.003	T	0.68484	-0.5396	10	0.31617	T	0.26	-19.2165	11.4675	0.50248	0.9304:0.0:0.0696:0.0	.	650;623;538;290	E9PJX4;B7Z493;Q96M96;G3XA97	.;.;FGD4_HUMAN;.	S	675;623;538;290;445;650	ENSP00000449273:N675S;ENSP00000431323:N623S;ENSP00000394487:N538S;ENSP00000266482:N290S;ENSP00000446695:N445S;ENSP00000433666:N650S	ENSP00000266482:N290S	N	+	2	0	FGD4	32669247	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.530000	0.53539	1.037000	0.40024	0.533000	0.62120	AAT	.	.		0.348	FGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268017.1	NM_139241	
ARID2	196528	hgsc.bcm.edu	37	12	46230722	46230722	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr12:46230722T>G	ENST00000334344.6	+	8	1143	c.971T>G	c.(970-972)tTt>tGt	p.F324C	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000422737.1_Missense_Mutation_p.F175C|ARID2_ENST00000444670.1_5'Flank	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	324					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CATAGTCATTTTATTTCTTTA	0.368			"""N, S, F"""		hepatocellular carcinoma																																p.F324C		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.T971G						.						150.0	143.0	145.0					12																	46230722		2203	4300	6503	SO:0001583	missense	196528	exon8			GTCATTTTATTTC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.971T>G	chr12.hg19:g.46230722T>G	ENSP00000335044:p.Phe324Cys	121.0	0.0		117.0	8.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.193908	0.78902	.	.	ENSG00000189079	ENST00000334344;ENST00000422737	T;T	0.48522	0.81;0.81	5.87	5.87	0.94306	.	0.051051	0.85682	D	0.000000	T	0.60470	0.2271	L	0.44542	1.39	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.63189	-0.6693	10	0.87932	D	0	-12.9744	16.2628	0.82557	0.0:0.0:0.0:1.0	.	324	Q68CP9	ARID2_HUMAN	C	324;175	ENSP00000335044:F324C;ENSP00000415650:F175C	ENSP00000335044:F324C	F	+	2	0	ARID2	44516989	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.004000	0.88535	2.233000	0.73108	0.482000	0.46254	TTT	.	.		0.368	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
COL2A1	1280	hgsc.bcm.edu	37	12	48378844	48378844	+	Silent	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr12:48378844A>T	ENST00000380518.3	-	27	1931	c.1767T>A	c.(1765-1767)ccT>ccA	p.P589P	COL2A1_ENST00000337299.6_Silent_p.P520P|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	589	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GAGGACCTGGAGGTCCAGGAC	0.527																																					p.P589P		Atlas-SNP	.											.	COL2A1	368	.	0			c.T1767A						.						47.0	42.0	44.0					12																	48378844		2202	4300	6502	SO:0001819	synonymous_variant	1280	exon27			ACCTGGAGGTCCA	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.1767T>A	chr12.hg19:g.48378844A>T		174.0	0.0		182.0	44.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Silent	SNP	ENST00000380518.3	hg19	CCDS41778.1																																																																																			.	.		0.527	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
KMT2D	8085	hgsc.bcm.edu	37	12	49446022	49446022	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr12:49446022C>T	ENST00000301067.7	-	10	1443	c.1444G>A	c.(1444-1446)Gca>Aca	p.A482T		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	482	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGGTGCAATGCCTCAGGAAGT	0.622																																					p.A482T		Atlas-SNP	.											.	MLL2	1173	.	0			c.G1444A						.						89.0	100.0	96.0					12																	49446022		2119	4217	6336	SO:0001583	missense	8085	exon10			GCAATGCCTCAGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.1444G>A	chr12.hg19:g.49446022C>T	ENSP00000301067:p.Ala482Thr	139.0	0.0		154.0	51.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	5.570	0.290008	0.10567	.	.	ENSG00000167548	ENST00000301067	T	0.79940	-1.32	2.28	2.28	0.28536	.	.	.	.	.	T	0.63046	0.2478	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.06405	0.002	T	0.58194	-0.7679	9	0.87932	D	0	.	10.167	0.42886	0.0:1.0:0.0:0.0	.	482	O14686	MLL2_HUMAN	T	482	ENSP00000301067:A482T	ENSP00000301067:A482T	A	-	1	0	MLL2	47732289	0.000000	0.05858	0.099000	0.21106	0.359000	0.29487	-0.107000	0.10873	1.257000	0.44085	0.313000	0.20887	GCA	.	.		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
ZFC3H1	196441	hgsc.bcm.edu	37	12	72050734	72050734	+	Missense_Mutation	SNP	G	G	A	rs561382640		TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr12:72050734G>A	ENST00000378743.3	-	2	1304	c.946C>T	c.(946-948)Cgt>Tgt	p.R316C	ZFC3H1_ENST00000548100.1_Missense_Mutation_p.R316C|ZFC3H1_ENST00000549407.1_5'UTR|ZFC3H1_ENST00000552037.1_Missense_Mutation_p.R316C	NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	316					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						TTTTTCAAACGGTTCTTATCT	0.348																																					p.R316C		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.C946T						.						129.0	124.0	125.0					12																	72050734		1817	4071	5888	SO:0001583	missense	196441	exon2			TCAAACGGTTCTT	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.946C>T	chr12.hg19:g.72050734G>A	ENSP00000368017:p.Arg316Cys	116.0	0.0		127.0	61.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	hg19	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	G	17.80	3.477836	0.63849	.	.	ENSG00000133858	ENST00000378743;ENST00000548100;ENST00000552037	T	0.39056	1.1	5.72	3.66	0.41972	.	0.163980	0.40222	N	0.001160	T	0.48943	0.1528	N	0.24115	0.695	0.47621	D	0.999477	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.83275	0.996;0.992;0.719	T	0.53837	-0.8382	10	0.72032	D	0.01	.	12.8853	0.58040	0.0:0.0:0.6131:0.3869	.	316;316;316	G3V1X1;O60293-4;O60293	.;.;ZC3H1_HUMAN	C	316	ENSP00000368017:R316C	ENSP00000368017:R316C	R	-	1	0	ZFC3H1	70337001	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.614000	0.46359	1.380000	0.46344	0.563000	0.77884	CGT	.	.		0.348	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
SOHLH2	54937	hgsc.bcm.edu	37	13	36747903	36747903	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr13:36747903T>A	ENST00000379881.3	-	9	1014	c.926A>T	c.(925-927)cAa>cTa	p.Q309L	CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.Q386L|SOHLH2_ENST00000554962.1_Missense_Mutation_p.Q386L	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	309					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		AGTCAGGAATTGGAGCCCTCT	0.468																																					p.Q386L		Atlas-SNP	.											.	.	.	.	0			c.A1157T						.						123.0	113.0	117.0					13																	36747903		2203	4300	6503	SO:0001583	missense	100526761	exon14			AGGAATTGGAGCC	AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.926A>T	chr13.hg19:g.36747903T>A	ENSP00000369210:p.Gln309Leu	96.0	0.0		88.0	32.0	NM_001198910	B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	ENST00000379881.3	hg19	CCDS9355.1	.	.	.	.	.	.	.	.	.	.	T	8.096	0.775680	0.16051	.	.	ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000511166	T;T;T	0.34859	1.34;1.34;1.34	5.6	4.67	0.58626	.	0.480573	0.19554	N	0.111482	T	0.24044	0.0582	L	0.38175	1.15	0.09310	N	1	P;P	0.34462	0.454;0.454	B;B	0.30401	0.053;0.115	T	0.28459	-1.0043	10	0.62326	D	0.03	-0.7942	3.7495	0.08561	0.0:0.7176:0.0:0.2824	.	386;309	B4DX90;Q9NX45	.;SOLH2_HUMAN	L	309;386;386	ENSP00000369210:Q309L;ENSP00000451542:Q386L;ENSP00000421868:Q386L	ENSP00000421868:Q386L	Q	-	2	0	CCDC169-SOHLH2;SOHLH2	35645903	0.445000	0.25657	0.003000	0.11579	0.008000	0.06430	1.882000	0.39648	1.188000	0.43014	0.460000	0.39030	CAA	.	.		0.468	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044477.2	NM_017826	
AKAP11	11215	hgsc.bcm.edu	37	13	42876689	42876689	+	Silent	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr13:42876689A>T	ENST00000025301.2	+	8	3982	c.3807A>T	c.(3805-3807)acA>acT	p.T1269T		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	1269					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AAGTCATTACAGAAGCTGAGA	0.368																																					p.T1269T		Atlas-SNP	.											.	AKAP11	146	.	0			c.A3807T						.						72.0	74.0	73.0					13																	42876689		2203	4300	6503	SO:0001819	synonymous_variant	11215	exon8			CATTACAGAAGCT	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.3807A>T	chr13.hg19:g.42876689A>T		155.0	0.0		162.0	51.0	NM_016248	O75124|Q9NUK7	Silent	SNP	ENST00000025301.2	hg19	CCDS9383.1																																																																																			.	.		0.368	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
EFNB2	1948	hgsc.bcm.edu	37	13	107147231	107147231	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr13:107147231G>A	ENST00000245323.4	-	4	760	c.611C>T	c.(610-612)cCa>cTa	p.P204L		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	204					anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TGTTATACCTGGATTTGGTTT	0.418																																					p.P204L		Atlas-SNP	.											.	EFNB2	39	.	0			c.C611T						.						262.0	232.0	242.0					13																	107147231		2203	4300	6503	SO:0001583	missense	1948	exon4			ATACCTGGATTTG	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.611C>T	chr13.hg19:g.107147231G>A	ENSP00000245323:p.Pro204Leu	68.0	0.0		80.0	8.0	NM_004093	Q5JV56	Missense_Mutation	SNP	ENST00000245323.4	hg19	CCDS9507.1	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663830	0.47572	.	.	ENSG00000125266	ENST00000245323	D	0.90620	-2.7	6.07	6.07	0.98685	.	0.636389	0.17852	N	0.159813	D	0.86306	0.5901	L	0.27053	0.805	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.79127	-0.1931	10	0.38643	T	0.18	.	18.8244	0.92111	0.0:0.0:1.0:0.0	.	204	P52799	EFNB2_HUMAN	L	204	ENSP00000245323:P204L	ENSP00000245323:P204L	P	-	2	0	EFNB2	105945232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.394000	0.73223	2.890000	0.99128	0.650000	0.86243	CCA	.	.		0.418	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
MYH6	4624	hgsc.bcm.edu	37	14	23858666	23858666	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr14:23858666C>A	ENST00000356287.3	-	27	3943	c.3914G>T	c.(3913-3915)cGg>cTg	p.R1305L	MIR208A_ENST00000362287.1_RNA|MYH6_ENST00000405093.3_Missense_Mutation_p.R1305L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1305					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GAGCTTCCCCCGGGTCAGCTG	0.592																																					p.R1305L		Atlas-SNP	.											.	MYH6	274	.	0			c.G3914T						.						71.0	70.0	71.0					14																	23858666		2203	4300	6503	SO:0001583	missense	4624	exon28			TTCCCCCGGGTCA	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.3914G>T	chr14.hg19:g.23858666C>A	ENSP00000348634:p.Arg1305Leu	136.0	0.0		110.0	40.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	ENST00000356287.3	hg19	CCDS9600.1	.	.	.	.	.	.	.	.	.	.	c	31	5.088037	0.94100	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.79749	-1.3;-1.3	4.63	4.63	0.57726	Myosin tail (1);	.	.	.	.	D	0.92368	0.7578	M	0.93197	3.39	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.94450	0.7666	9	0.72032	D	0.01	.	17.8701	0.88808	0.0:1.0:0.0:0.0	.	1305	P13533	MYH6_HUMAN	L	1305	ENSP00000386041:R1305L;ENSP00000348634:R1305L	ENSP00000348634:R1305L	R	-	2	0	MYH6	22928506	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.634000	0.83273	2.280000	0.76307	0.655000	0.94253	CGG	.	.		0.592	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
SYNE2	23224	hgsc.bcm.edu	37	14	64676274	64676274	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr14:64676274A>G	ENST00000344113.4	+	102	18730	c.18518A>G	c.(18517-18519)aAa>aGa	p.K6173R	SYNE2_ENST00000554584.1_Missense_Mutation_p.K6135R|SYNE2_ENST00000555002.1_Missense_Mutation_p.K2807R|SYNE2_ENST00000554805.1_5'UTR|SYNE2_ENST00000555022.1_Missense_Mutation_p.K51R|SYNE2_ENST00000358025.3_Missense_Mutation_p.K6173R|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000357395.3_Missense_Mutation_p.K2558R|SYNE2_ENST00000394768.2_Missense_Mutation_p.K2558R	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6173					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACGAGTGCCAAAGAGGAACTG	0.517																																					p.K6173R		Atlas-SNP	.											.	SYNE2	577	.	0			c.A18518G						.						63.0	58.0	60.0					14																	64676274		2203	4300	6503	SO:0001583	missense	23224	exon102			GTGCCAAAGAGGA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.18518A>G	chr14.hg19:g.64676274A>G	ENSP00000341781:p.Lys6173Arg	75.0	0.0		76.0	28.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.840012	0.51057	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000556906;ENST00000555022	T;T;T;T;T;T;T;T	0.60299	0.67;0.67;0.67;0.2;0.67;0.67;0.71;0.67	5.54	5.54	0.83059	.	0.000000	0.52532	D	0.000072	T	0.70979	0.3286	M	0.72894	2.215	0.80722	D	1	P;D;D;P;D	0.56521	0.755;0.96;0.976;0.614;0.957	P;P;D;P;P	0.62955	0.823;0.872;0.909;0.889;0.841	T	0.67803	-0.5576	10	0.15952	T	0.53	.	15.6693	0.77262	1.0:0.0:0.0:0.0	.	2558;561;6135;6173;6173	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	R	6173;2558;6173;6135;6141;2807;2558;143;51	ENSP00000350719:K6173R;ENSP00000349969:K2558R;ENSP00000341781:K6173R;ENSP00000452570:K6135R;ENSP00000450831:K2807R;ENSP00000378249:K2558R;ENSP00000452298:K143R;ENSP00000451009:K51R	ENSP00000261678:K6141R	K	+	2	0	SYNE2	63746027	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	7.520000	0.81821	2.087000	0.62958	0.496000	0.49642	AAA	.	.		0.517	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
WDR20	91833	hgsc.bcm.edu	37	14	102605737	102605737	+	5'Flank	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr14:102605737G>A	ENST00000342702.3	+	0	0				HSP90AA1_ENST00000558600.1_5'UTR|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.P2L|WDR20_ENST00000558567.1_5'Flank|WDR20_ENST00000299135.6_5'Flank|WDR20_ENST00000556807.1_5'Flank|WDR20_ENST00000556511.2_5'Flank|WDR20_ENST00000335263.5_5'Flank|WDR20_ENST00000424963.2_5'Flank|WDR20_ENST00000499851.2_5'Flank|WDR20_ENST00000322340.5_5'Flank|WDR20_ENST00000454394.2_5'Flank	NM_001242418.1|NM_144574.3	NP_001229347.1|NP_653175.2	Q8TBZ3	WDR20_HUMAN	WD repeat domain 20											breast(1)|large_intestine(2)|lung(4)|prostate(1)	8						CGAACACGGGGGCATCCGCGC	0.726																																					p.P2L		Atlas-SNP	.											.	HSP90AA1	65	.	0			c.C5T						.						7.0	9.0	8.0					14																	102605737		2163	4242	6405	SO:0001631	upstream_gene_variant	3320	exon1			CACGGGGGCATCC	BC028387	CCDS9968.1, CCDS9969.1, CCDS9970.1, CCDS55942.1, CCDS55943.1, CCDS55944.1, CCDS55945.1	14q32.31	2013-01-09				ENSG00000140153		"""WD repeat domain containing"""	19667	protein-coding gene	gene with protein product							Standard	NM_181291		Approved	DMR, MGC33177, FLJ33659	uc010txu.2	Q8TBZ3			chr14.hg19:g.102605737G>A	Exception_encountered	156.0	0.0		142.0	50.0	NM_001017963	B4DN18|E7EUY8|F8W9S4|G3V2F8|G3V5R0|H0YJJ1|Q86TU2|Q8NCN7|Q8WXX2|Q9UF86	Missense_Mutation	SNP	ENST00000342702.3	hg19	CCDS9969.1	.	.	.	.	.	.	.	.	.	.	G	13.68	2.308775	0.40895	.	.	ENSG00000080824	ENST00000334701	T	0.10288	2.89	2.79	1.85	0.25348	.	.	.	.	.	T	0.12944	0.0314	N	0.08118	0	0.18873	N	0.999982	D	0.69078	0.997	D	0.78314	0.991	T	0.19877	-1.0292	9	0.87932	D	0	.	6.8707	0.24119	0.0:0.0:0.7253:0.2747	.	2	P07900-2	.	L	2	ENSP00000335153:P2L	ENSP00000335153:P2L	P	-	2	0	HSP90AA1	101675490	0.000000	0.05858	0.001000	0.08648	0.023000	0.10783	-0.728000	0.04925	0.702000	0.31825	0.511000	0.50034	CCC	.	.		0.726	WDR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414963.1	NM_181291	
NIPA1	123606	hgsc.bcm.edu	37	15	23086286	23086286	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr15:23086286G>T	ENST00000337435.4	-	1	150	c.126C>A	c.(124-126)aaC>aaA	p.N42K	NIPA1_ENST00000561183.1_Intron|NIPA1_ENST00000437912.2_Intron|NIPA1_ENST00000538684.1_5'UTR	NM_001142275.1|NM_144599.4	NP_001135747.1|NP_653200.2	Q7RTP0	NIPA1_HUMAN	non imprinted in Prader-Willi/Angelman syndrome 1	42					cell death (GO:0008219)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|skin(1)	15		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;4.18e-06)|Epithelial(43;3.97e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00165)		ACGTGGACCCGTTCACCAGGC	0.791																																					p.N42K		Atlas-SNP	.											.	NIPA1	26	.	0			c.C126A						.						12.0	10.0	11.0					15																	23086286		2166	4233	6399	SO:0001583	missense	123606	exon1			GGACCCGTTCACC	BK001020	CCDS73691.1, CCDS73692.1	15q11.2	2006-10-06			ENSG00000170113	ENSG00000170113			17043	protein-coding gene	gene with protein product		608145	"""spastic paraplegia 6 (autosomal dominant)"""	SPG6		14508710	Standard	NM_144599		Approved	MGC35570	uc001yvc.3	Q7RTP0	OTTHUMG00000129099	ENST00000337435.4:c.126C>A	chr15.hg19:g.23086286G>T	ENSP00000337452:p.Asn42Lys	526.0	1.0		579.0	208.0	NM_144599	B2RA76|Q5HYA9|Q7KZB0|Q86XW4	Missense_Mutation	SNP	ENST00000337435.4	hg19	CCDS10011.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.046780	0.75846	.	.	ENSG00000170113	ENST00000337435	D	0.89875	-2.58	3.81	2.89	0.33648	.	0.000000	0.85682	D	0.000000	D	0.82508	0.5052	L	0.44542	1.39	0.80722	D	1	P	0.47677	0.899	B	0.40602	0.334	T	0.79995	-0.1568	10	0.87932	D	0	-15.3246	7.2383	0.26082	0.1305:0.0:0.8695:0.0	.	42	Q7RTP0	NIPA1_HUMAN	K	42	ENSP00000337452:N42K	ENSP00000337452:N42K	N	-	3	2	NIPA1	20637727	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	0.506000	0.22658	0.588000	0.29660	0.305000	0.20034	AAC	.	.		0.791	NIPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251135.2	NM_144599	
FGF7	2252	hgsc.bcm.edu	37	15	49716642	49716642	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr15:49716642G>T	ENST00000267843.4	+	2	759	c.148G>T	c.(148-150)Gag>Tag	p.E50*	FGF7_ENST00000560270.1_Nonsense_Mutation_p.E50*|FAM227B_ENST00000561064.1_Intron|FAM227B_ENST00000299338.6_Intron	NM_002009.3	NP_002000.1	P21781	FGF7_HUMAN	fibroblast growth factor 7	50					actin cytoskeleton reorganization (GO:0031532)|branching involved in salivary gland morphogenesis (GO:0060445)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle morphogenesis (GO:0031069)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization to cell surface (GO:0034394)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|response to wounding (GO:0009611)|secretion by lung epithelial cell involved in lung growth (GO:0061033)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)		TTCCAGCCCTGAGCGACACAC	0.428																																					p.E50X		Atlas-SNP	.											.	FGF7	21	.	0			c.G148T						.						137.0	127.0	130.0					15																	49716642		2196	4295	6491	SO:0001587	stop_gained	2252	exon2			AGCCCTGAGCGAC	M60828	CCDS10131.1	15q21.2	2014-01-30	2010-08-18		ENSG00000140285	ENSG00000140285		"""Endogenous ligands"""	3685	protein-coding gene	gene with protein product	"""keratinocyte growth factor"""	148180	"""fibroblast growth factor 7 (keratinocyte growth factor)"""			7749227, 1409637	Standard	NM_002009		Approved	KGF	uc001zxn.3	P21781	OTTHUMG00000131517	ENST00000267843.4:c.148G>T	chr15.hg19:g.49716642G>T	ENSP00000267843:p.Glu50*	150.0	0.0		159.0	47.0	NM_002009	H0YNY5|Q6FGV5|Q96FG5	Nonsense_Mutation	SNP	ENST00000267843.4	hg19	CCDS10131.1	.	.	.	.	.	.	.	.	.	.	G	39	7.531707	0.98342	.	.	ENSG00000140285	ENST00000267843	.	.	.	5.7	5.7	0.88788	.	0.078136	0.49916	D	0.000127	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	19.8389	0.96675	0.0:0.0:1.0:0.0	.	.	.	.	X	50	.	ENSP00000267843:E50X	E	+	1	0	FGF7	47503934	1.000000	0.71417	0.985000	0.45067	0.999000	0.98932	9.229000	0.95273	2.703000	0.92315	0.655000	0.94253	GAG	.	.		0.428	FGF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254374.3	NM_002009	
CACNA1H	8912	hgsc.bcm.edu	37	16	1269083	1269083	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:1269083C>T	ENST00000348261.5	+	34	6249	c.6001C>T	c.(6001-6003)Cgg>Tgg	p.R2001W	CACNA1H_ENST00000358590.4_Missense_Mutation_p.R1995W|CACNA1H_ENST00000565831.1_Missense_Mutation_p.R1995W	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	2001					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CCTGTCCCCTCGGGGCACAGC	0.697																																					p.R2001W		Atlas-SNP	.											.	CACNA1H	317	.	0			c.C6001T						.						6.0	7.0	6.0					16																	1269083		1697	3633	5330	SO:0001583	missense	8912	exon34			TCCCCTCGGGGCA	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.6001C>T	chr16.hg19:g.1269083C>T	ENSP00000334198:p.Arg2001Trp	120.0	0.0		135.0	41.0	NM_021098	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	hg19	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	c	20.3	3.959798	0.74016	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97089	-4.24;-4.19	4.04	4.04	0.47022	.	2.135640	0.03389	U	0.201639	D	0.97046	0.9035	L	0.42245	1.32	0.09310	N	1	D;D;D;D;D	0.69078	0.978;0.995;0.995;0.997;0.978	B;P;P;P;B	0.52856	0.353;0.586;0.586;0.711;0.353	D	0.90652	0.4583	10	0.66056	D	0.02	.	13.4982	0.61438	0.0:1.0:0.0:0.0	.	747;725;731;1995;2001	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	W	2001;1995	ENSP00000334198:R2001W;ENSP00000351401:R1995W	ENSP00000334198:R2001W	R	+	1	2	CACNA1H	1209084	0.002000	0.14202	0.004000	0.12327	0.080000	0.17528	1.677000	0.37576	2.103000	0.63969	0.461000	0.40582	CGG	.	.		0.697	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
RNF151	146310	hgsc.bcm.edu	37	16	2018778	2018778	+	Missense_Mutation	SNP	G	G	T	rs376750121		TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:2018778G>T	ENST00000569714.1	+	4	598	c.590G>T	c.(589-591)cGt>cTt	p.R197L	RNF151_ENST00000321392.3_Missense_Mutation_p.R196L|RNF151_ENST00000569210.2_3'UTR	NM_174903.4	NP_777563.2	Q2KHN1	RN151_HUMAN	ring finger protein 151	197					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|lung(1)	2						AGTGTCGTTCGTAGAGAGCTG	0.677																																					p.R197L		Atlas-SNP	.											.	RNF151	12	.	0			c.G590T						.						8.0	10.0	10.0					16																	2018778		2096	4203	6299	SO:0001583	missense	146310	exon4			TCGTTCGTAGAGA	BC029501	CCDS58405.1	16p13.3	2013-01-09			ENSG00000179580	ENSG00000179580		"""RING-type (C3HC4) zinc fingers"""	23235	protein-coding gene	gene with protein product						12477932	Standard	NM_174903		Approved		uc002cnt.1	Q2KHN1	OTTHUMG00000176852	ENST00000569714.1:c.590G>T	chr16.hg19:g.2018778G>T	ENSP00000456566:p.Arg197Leu	131.0	0.0		155.0	59.0	NM_174903	Q8NHS5	Missense_Mutation	SNP	ENST00000569714.1	hg19	CCDS58405.1	.	.	.	.	.	.	.	.	.	.	g	8.767	0.924948	0.18056	.	.	ENSG00000179580	ENST00000321392	T	0.27720	1.65	5.25	1.03	0.20045	TRAF-like (1);	0.712898	0.12687	N	0.447488	T	0.19765	0.0475	L	0.32530	0.975	0.09310	N	0.999993	P	0.44090	0.826	B	0.37346	0.247	T	0.09574	-1.0668	10	0.59425	D	0.04	-19.2332	7.0882	0.25270	0.3697:0.0:0.6303:0.0	.	197	Q2KHN1	RN151_HUMAN	L	196	ENSP00000325794:R196L	ENSP00000325794:R196L	R	+	2	0	RNF151	1958779	0.086000	0.21541	0.003000	0.11579	0.002000	0.02628	1.203000	0.32284	0.212000	0.20703	0.655000	0.94253	CGT	.	.		0.677	RNF151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434030.1	NM_174903	
SCNN1G	6340	hgsc.bcm.edu	37	16	23203678	23203678	+	Silent	SNP	A	A	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:23203678A>C	ENST00000300061.2	+	4	767	c.624A>C	c.(622-624)tcA>tcC	p.S208S	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	208					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CACAGTGCTCAAATGACACCT	0.502																																					p.S208S		Atlas-SNP	.											.	SCNN1G	82	.	0			c.A624C						.						138.0	118.0	125.0					16																	23203678		2197	4300	6497	SO:0001819	synonymous_variant	6340	exon4			GTGCTCAAATGAC	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.624A>C	chr16.hg19:g.23203678A>C		76.0	0.0		74.0	29.0	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Silent	SNP	ENST00000300061.2	hg19	CCDS10608.1																																																																																			.	.		0.502	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
TNRC6A	27327	hgsc.bcm.edu	37	16	24834981	24834981	+	Silent	SNP	C	C	T	rs373265827	byFrequency	TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:24834981C>T	ENST00000395799.3	+	25	5871	c.5742C>T	c.(5740-5742)caC>caT	p.H1914H	TNRC6A_ENST00000432286.2_Silent_p.H392H|TNRC6A_ENST00000315183.7_Silent_p.H1865H	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1914	Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		GAGACCTTCACGGCACTTCAC	0.597													c|||	2	0.000399361	0.0	0.0	5008	,	,		15912	0.0		0.001	False		,,,				2504	0.001				p.H1914H		Atlas-SNP	.											.	TNRC6A	171	.	0			c.C5742T						.	C		1,4393	2.1+/-5.4	0,1,2196	105.0	105.0	105.0		5742	-0.4	1.0	16		105	0,8600		0,0,4300	no	coding-synonymous	TNRC6A	NM_014494.2		0,1,6496	TT,TC,CC		0.0,0.0228,0.0077		1914/1963	24834981	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	27327	exon25			CCTTCACGGCACT	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.5742C>T	chr16.hg19:g.24834981C>T		141.0	0.0		128.0	42.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	c	1.778	-0.482756	0.04383	2.28E-4	0.0	ENSG00000090905	ENST00000450465	.	.	.	5.64	-0.428	0.12306	.	.	.	.	.	T	0.51702	0.1690	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41448	-0.9508	4	.	.	.	-5.0747	6.5391	0.22370	0.0:0.2026:0.1509:0.6465	.	.	.	.	W	805	.	.	R	+	1	2	TNRC6A	24742482	0.999000	0.42202	0.998000	0.56505	0.998000	0.95712	0.579000	0.23788	0.027000	0.15297	0.651000	0.88453	CGG	.	.		0.597	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
SALL1	6299	hgsc.bcm.edu	37	16	51172810	51172810	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:51172810A>T	ENST00000251020.4	-	2	3356	c.3323T>A	c.(3322-3324)gTc>gAc	p.V1108D	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.V1011D|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1108					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CCCAGACGGGACGTGACTGGT	0.562																																					p.V1108D	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.T3323A						.						101.0	87.0	92.0					16																	51172810		2198	4300	6498	SO:0001583	missense	6299	exon2			GACGGGACGTGAC	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3323T>A	chr16.hg19:g.51172810A>T	ENSP00000251020:p.Val1108Asp	139.0	0.0		116.0	36.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	hg19	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	A	17.45	3.393479	0.62066	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.08282	3.11;3.12	5.42	4.34	0.51931	.	0.354056	0.32106	N	0.006575	T	0.07007	0.0178	L	0.39898	1.24	0.54753	D	0.999983	B	0.33448	0.412	B	0.29267	0.1	T	0.33879	-0.9851	10	0.30854	T	0.27	.	9.7213	0.40304	0.8622:0.0:0.1378:0.0	.	1108	Q9NSC2	SALL1_HUMAN	D	1108;1011;1072	ENSP00000251020:V1108D;ENSP00000407914:V1011D	ENSP00000251020:V1108D	V	-	2	0	SALL1	49730311	1.000000	0.71417	0.954000	0.39281	0.803000	0.45373	6.128000	0.71650	2.046000	0.60703	0.460000	0.39030	GTC	.	.		0.562	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
PKD1L2	114780	hgsc.bcm.edu	37	16	81208430	81208430	+	RNA	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:81208430G>A	ENST00000527937.1	-	0	554				PKD1L2_ENST00000531391.1_RNA|PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000337114.4_RNA|PKD1L2_ENST00000533478.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						GCTGCTCGGGGCCACCCTCGC	0.572																																					p.G891G		Atlas-SNP	.											.	PKD1L2	361	.	0			c.C2673T						.						57.0	57.0	57.0					16																	81208430		2064	4218	6282			114780	exon16			CTCGGGGCCACCC	AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		chr16.hg19:g.81208430G>A		67.0	0.0		57.0	19.0	NM_001076780	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Silent	SNP	ENST00000527937.1	hg19		.	.	.	.	.	.	.	.	.	.	G	6.385	0.439214	0.12104	.	.	ENSG00000166473	ENST00000526632	.	.	.	4.7	3.72	0.42706	.	.	.	.	.	T	0.46908	0.1417	.	.	.	0.29299	N	0.868815	.	.	.	.	.	.	T	0.41805	-0.9488	4	.	.	.	-12.4898	12.2557	0.54623	0.0:0.172:0.828:0.0	.	.	.	.	S	419	.	.	P	-	1	0	PKD1L2	79765931	0.370000	0.25047	0.134000	0.22075	0.134000	0.20937	2.181000	0.42547	1.067000	0.40740	0.555000	0.69702	CCC	.	.		0.572	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	polymorphic_pseudogene	OTTHUMT00000387978.1		
FOXL1	2300	hgsc.bcm.edu	37	16	86612573	86612573	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:86612573C>A	ENST00000320241.3	+	1	459	c.244C>A	c.(244-246)Cgc>Agc	p.R82S		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	82					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						CATCATGGACCGCTTCCCCTT	0.617																																					p.R82S	NSCLC(163;308 2020 10889 11476 18208)	Atlas-SNP	.											.	FOXL1	39	.	0			c.C244A						.						111.0	112.0	112.0					16																	86612573		2198	4300	6498	SO:0001583	missense	2300	exon1			ATGGACCGCTTCC	AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.244C>A	chr16.hg19:g.86612573C>A	ENSP00000326272:p.Arg82Ser	265.0	0.0		249.0	104.0	NM_005250	Q17RR1|Q9H242	Missense_Mutation	SNP	ENST00000320241.3	hg19	CCDS10959.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350185	0.82132	.	.	ENSG00000176678	ENST00000320241	D	0.95518	-3.73	3.78	3.78	0.43462	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	U	0.000000	D	0.97139	0.9065	M	0.78223	2.4	0.58432	D	0.999993	D	0.57899	0.981	D	0.66084	0.941	D	0.97355	0.9966	10	0.54805	T	0.06	.	14.7693	0.69662	0.0:1.0:0.0:0.0	.	82	Q12952	FOXL1_HUMAN	S	82	ENSP00000326272:R82S	ENSP00000326272:R82S	R	+	1	0	FOXL1	85170074	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.436000	0.59948	1.951000	0.56629	0.491000	0.48974	CGC	.	.		0.617	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269105.2	NM_005250	
ANKRD11	29123	hgsc.bcm.edu	37	16	89350828	89350828	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr16:89350828T>C	ENST00000301030.4	-	9	2582	c.2122A>G	c.(2122-2124)Aaa>Gaa	p.K708E	ANKRD11_ENST00000378330.2_Missense_Mutation_p.K708E	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	708	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		AGCCATTCTTTTTCTTCTAAT	0.348																																					p.K708E		Atlas-SNP	.											.	ANKRD11	195	.	0			c.A2122G						.						69.0	68.0	69.0					16																	89350828		2198	4300	6498	SO:0001583	missense	29123	exon9			ATTCTTTTTCTTC	AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.2122A>G	chr16.hg19:g.89350828T>C	ENSP00000301030:p.Lys708Glu	103.0	0.0		118.0	51.0	NM_001256183	Q6NTG1|Q6QMF8	Missense_Mutation	SNP	ENST00000301030.4	hg19	CCDS32513.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.640725	0.67244	.	.	ENSG00000167522	ENST00000301030;ENST00000378330;ENST00000330736	T;T	0.39787	1.06;1.06	5.82	5.82	0.92795	.	0.125578	0.52532	D	0.000077	T	0.62048	0.2396	M	0.63843	1.955	0.80722	D	1	D;D	0.69078	0.997;0.996	D;D	0.69654	0.965;0.923	T	0.65055	-0.6261	10	0.87932	D	0	.	16.1778	0.81874	0.0:0.0:0.0:1.0	.	327;708	Q7Z5E5;Q6UB99	.;ANR11_HUMAN	E	708;708;327	ENSP00000301030:K708E;ENSP00000367581:K708E	ENSP00000301030:K708E	K	-	1	0	ANKRD11	87878329	1.000000	0.71417	0.017000	0.16124	0.930000	0.56654	7.789000	0.85783	2.225000	0.72522	0.459000	0.35465	AAA	.	.		0.348	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430462.3	NM_013275	
KRT39	390792	hgsc.bcm.edu	37	17	39118496	39118496	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr17:39118496T>A	ENST00000355612.2	-	5	949	c.914A>T	c.(913-915)cAg>cTg	p.Q305L	AC004231.2_ENST00000418393.1_RNA	NM_213656.3	NP_998821.3	Q6A163	K1C39_HUMAN	keratin 39	305	Coil 2.|Rod.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	17		Breast(137;0.00043)|Ovarian(249;0.15)				GCAGCATTGCTGCTGTTGAGA	0.473																																					p.Q305L		Atlas-SNP	.											.	KRT39	53	.	0			c.A914T						.						223.0	205.0	211.0					17																	39118496		2203	4296	6499	SO:0001583	missense	390792	exon5			CATTGCTGCTGTT	AJ786657	CCDS11382.1	17q21.2	2013-01-16			ENSG00000196859	ENSG00000196859		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	32971	protein-coding gene	gene with protein product						16831889	Standard	NM_213656		Approved	KA35	uc002hvo.1	Q6A163	OTTHUMG00000133424	ENST00000355612.2:c.914A>T	chr17.hg19:g.39118496T>A	ENSP00000347823:p.Gln305Leu	73.0	0.0		38.0	19.0	NM_213656	B2RXK6|Q6IFU6	Missense_Mutation	SNP	ENST00000355612.2	hg19	CCDS11382.1	.	.	.	.	.	.	.	.	.	.	T	7.157	0.584845	0.13749	.	.	ENSG00000196859	ENST00000355612	T	0.71461	-0.57	5.7	4.56	0.56223	Filament (1);	0.000000	0.42548	D	0.000683	T	0.23649	0.0572	N	0.00068	-2.285	0.37853	D	0.929459	B	0.11235	0.004	B	0.11329	0.006	T	0.50491	-0.8822	10	0.02654	T	1	.	8.8091	0.34956	0.3221:0.0:0.0:0.6779	.	305	Q6A163	K1C39_HUMAN	L	305	ENSP00000347823:Q305L	ENSP00000347823:Q305L	Q	-	2	0	KRT39	36372022	0.698000	0.27777	1.000000	0.80357	0.982000	0.71751	5.166000	0.64965	2.173000	0.68751	0.533000	0.62120	CAG	.	.		0.473	KRT39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257287.1	NM_213656	
CRHR1	1394	hgsc.bcm.edu	37	17	43893892	43893892	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr17:43893892A>T	ENST00000398285.3	+	3	185	c.185A>T	c.(184-186)cAg>cTg	p.Q62L	CRHR1_ENST00000577353.1_Missense_Mutation_p.Q62L|CRHR1_ENST00000352855.5_Intron|CRHR1_ENST00000339069.5_5'UTR|RP11-105N13.4_ENST00000587305.1_RNA|CRHR1_ENST00000314537.5_Missense_Mutation_p.Q62L|CRHR1_ENST00000293493.7_5'UTR	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	62					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		CCTGCGGGGCAGCTAGTGGTT	0.607																																					p.Q62L	Ovarian(110;57 1568 10207 38216 49865)	Atlas-SNP	.											.	CRHR1	48	.	0			c.A185T						.						41.0	45.0	43.0					17																	43893892		1934	4113	6047	SO:0001583	missense	1394	exon3			CGGGGCAGCTAGT	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.185A>T	chr17.hg19:g.43893892A>T	ENSP00000381333:p.Gln62Leu	77.0	0.0		49.0	35.0	NM_001145148	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	hg19	CCDS45712.1	.	.	.	.	.	.	.	.	.	.	A	16.05	3.012995	0.54468	.	.	ENSG00000120088	ENST00000398285;ENST00000314537;ENST00000347197	T;T;T	0.64618	-0.11;-0.11;-0.11	5.04	5.04	0.67666	GPCR, family 2, secretin-like, conserved site (1);GPCR, family 2, extracellular hormone receptor domain (3);	0.120686	0.56097	D	0.000022	T	0.45915	0.1366	N	0.17800	0.525	0.80722	D	1	B;B;B	0.09022	0.001;0.002;0.0	B;B;B	0.19666	0.005;0.026;0.002	T	0.37220	-0.9715	10	0.28530	T	0.3	.	11.109	0.48221	1.0:0.0:0.0:0.0	.	62;62;62	P34998-4;P34998;P34998-2	.;CRFR1_HUMAN;.	L	62	ENSP00000381333:Q62L;ENSP00000326060:Q62L;ENSP00000239167:Q62L	ENSP00000326060:Q62L	Q	+	2	0	CRHR1	41249673	0.999000	0.42202	1.000000	0.80357	0.958000	0.62258	5.230000	0.65321	2.126000	0.65437	0.533000	0.62120	CAG	.	.		0.607	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		
CEP95	90799	hgsc.bcm.edu	37	17	62532722	62532722	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr17:62532722A>G	ENST00000556440.2	+	18	2583	c.2073A>G	c.(2071-2073)atA>atG	p.I691M	CEP95_ENST00000553412.1_Missense_Mutation_p.I527M	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	691						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						ACTGACAGATATTTAAGAAAC	0.318																																					p.I691M		Atlas-SNP	.											.	CEP95	103	.	0			c.A2073G						.						56.0	57.0	57.0					17																	62532722		1833	4087	5920	SO:0001583	missense	90799	exon18			ACAGATATTTAAG	AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.2073A>G	chr17.hg19:g.62532722A>G	ENSP00000450461:p.Ile691Met	452.0	0.0		458.0	165.0	NM_138363	B4DMD2|Q96M81	Missense_Mutation	SNP	ENST00000556440.2	hg19	CCDS45763.1	.	.	.	.	.	.	.	.	.	.	A	10.81	1.456659	0.26161	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.37752	1.29;1.18	5.48	1.65	0.23941	.	0.108254	0.64402	D	0.000005	T	0.31167	0.0788	L	0.46157	1.445	0.36224	D	0.852201	P	0.36199	0.543	B	0.34489	0.184	T	0.46233	-0.9206	10	0.72032	D	0.01	-9.3789	13.7593	0.62956	0.4621:0.5379:0.0:0.0	.	691	Q96GE4	CEP95_HUMAN	M	626;691;527	ENSP00000450461:I691M;ENSP00000450906:I527M	ENSP00000438458:I626M	I	+	3	3	CEP95	59963184	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.988000	0.40697	0.414000	0.25790	0.528000	0.53228	ATA	.	.		0.318	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445100.2	NM_138363	
SMCHD1	23347	hgsc.bcm.edu	37	18	2772286	2772286	+	Silent	SNP	A	A	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr18:2772286A>T	ENST00000320876.6	+	41	5429	c.5091A>T	c.(5089-5091)tcA>tcT	p.S1697S	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Silent_p.S1697S|snoU13_ENST00000459147.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1697					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						GAAAGCTATCAGAACAAGAAG	0.353																																					p.S1697S		Atlas-SNP	.											.	SMCHD1	88	.	0			c.A5091T						.						86.0	76.0	79.0					18																	2772286		1813	4076	5889	SO:0001819	synonymous_variant	23347	exon41			GCTATCAGAACAA	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.5091A>T	chr18.hg19:g.2772286A>T		109.0	0.0		97.0	35.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	ENST00000320876.6	hg19	CCDS45822.1																																																																																			.	.		0.353	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
EEF2	1938	hgsc.bcm.edu	37	19	3981359	3981359	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr19:3981359T>G	ENST00000309311.6	-	7	1077	c.989A>C	c.(988-990)aAa>aCa	p.K330T	EEF2_ENST00000600720.1_5'Flank|SNORD37_ENST00000384048.1_RNA	NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	330	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		TTTGCCTTCTTTGTCCTTGTC	0.547																																					p.K330T	Colon(165;1804 1908 4071 6587 18799)	Atlas-SNP	.											.	EEF2	57	.	0			c.A989C						.						311.0	256.0	275.0					19																	3981359		2203	4300	6503	SO:0001583	missense	1938	exon7			CCTTCTTTGTCCT	Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.989A>C	chr19.hg19:g.3981359T>G	ENSP00000307940:p.Lys330Thr	80.0	0.0		92.0	34.0	NM_001961	B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	ENST00000309311.6	hg19	CCDS12117.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.858141	0.51376	.	.	ENSG00000167658	ENST00000543343;ENST00000309311	T	0.29397	1.57	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.41743	0.1172	L	0.55213	1.73	0.80722	D	1	P	0.51537	0.946	P	0.51550	0.673	T	0.34875	-0.9811	10	0.66056	D	0.02	-32.1649	14.5906	0.68362	0.0:0.0:0.0:1.0	.	330	P13639	EF2_HUMAN	T	330	ENSP00000307940:K330T	ENSP00000307940:K330T	K	-	2	0	EEF2	3932359	1.000000	0.71417	0.907000	0.35723	0.631000	0.37964	7.985000	0.88162	2.042000	0.60477	0.459000	0.35465	AAA	.	.		0.547	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457615.2	NM_001961	
DUS3L	56931	hgsc.bcm.edu	37	19	5790068	5790068	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr19:5790068G>C	ENST00000309061.7	-	2	473	c.377C>G	c.(376-378)tCc>tGc	p.S126C	DUS3L_ENST00000590681.1_5'UTR|DUS3L_ENST00000320699.8_Intron	NM_020175.2	NP_064560.2	Q96G46	DUS3L_HUMAN	dihydrouridine synthase 3-like (S. cerevisiae)	126							flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA dihydrouridine synthase activity (GO:0017150)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(2)	14						CTGGATTAGGGAGGGACACAG	0.617																																					p.S126C		Atlas-SNP	.											.	DUS3L	42	.	0			c.C377G						.						77.0	76.0	77.0					19																	5790068		2203	4300	6503	SO:0001583	missense	56931	exon2			ATTAGGGAGGGAC		CCDS32880.1, CCDS54202.1	19p13.3	2014-02-12			ENSG00000141994	ENSG00000141994			26920	protein-coding gene	gene with protein product						12477932	Standard	NM_020175		Approved	DUS3, FLJ13896	uc002mdc.3	Q96G46	OTTHUMG00000162311	ENST00000309061.7:c.377C>G	chr19.hg19:g.5790068G>C	ENSP00000311977:p.Ser126Cys	159.0	0.0		165.0	46.0	NM_020175	Q96HM5|Q9BSU4|Q9H877|Q9NPR1	Missense_Mutation	SNP	ENST00000309061.7	hg19	CCDS32880.1	.	.	.	.	.	.	.	.	.	.	G	15.81	2.941754	0.53079	.	.	ENSG00000141994	ENST00000309061	T	0.21361	2.01	4.74	3.61	0.41365	Zinc finger, CCCH-type (1);	0.222750	0.39687	N	0.001285	T	0.28599	0.0708	M	0.79614	2.46	0.39487	D	0.967973	P	0.36125	0.538	B	0.38106	0.265	T	0.32955	-0.9887	10	0.72032	D	0.01	0.0328	12.3594	0.55194	0.0:0.1718:0.8282:0.0	.	126	Q96G46	DUS3L_HUMAN	C	126	ENSP00000311977:S126C	ENSP00000311977:S126C	S	-	2	0	DUS3L	5741068	1.000000	0.71417	0.100000	0.21137	0.876000	0.50452	7.213000	0.77950	2.332000	0.79248	0.655000	0.94253	TCC	.	.		0.617	DUS3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451870.2	NM_020175	
SH2D3A	10045	hgsc.bcm.edu	37	19	6752638	6752638	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr19:6752638C>T	ENST00000245908.6	-	10	1966	c.1697G>A	c.(1696-1698)gGc>gAc	p.G566D	SH2D3A_ENST00000437152.3_Missense_Mutation_p.G473D|CTD-3128G10.6_ENST00000594056.1_RNA|SH2D3A_ENST00000599563.1_5'Flank	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	566					JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						CGACAGGACGCCGAGGACGCG	0.672																																					p.G566D		Atlas-SNP	.											.	SH2D3A	53	.	0			c.G1697A						.						16.0	21.0	20.0					19																	6752638		2190	4286	6476	SO:0001583	missense	10045	exon10			AGGACGCCGAGGA	AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.1697G>A	chr19.hg19:g.6752638C>T	ENSP00000245908:p.Gly566Asp	87.0	0.0		87.0	9.0	NM_005490	A8K9R6|B4DRS7|Q9Y2X4	Missense_Mutation	SNP	ENST00000245908.6	hg19	CCDS12173.1	.	.	.	.	.	.	.	.	.	.	C	13.30	2.197357	0.38806	.	.	ENSG00000125731	ENST00000245908;ENST00000437152	T;T	0.28895	2.63;1.59	4.77	1.28	0.21552	.	0.376200	0.22710	N	0.056591	T	0.12220	0.0297	N	0.03608	-0.345	0.09310	N	1	B;B	0.22800	0.075;0.013	B;B	0.18871	0.023;0.01	T	0.23013	-1.0200	10	0.36615	T	0.2	-5.6676	8.6964	0.34298	0.0:0.6314:0.2847:0.084	.	473;566	B4DRS7;Q9BRG2	.;SH23A_HUMAN	D	566;473	ENSP00000245908:G566D;ENSP00000393303:G473D	ENSP00000245908:G566D	G	-	2	0	SH2D3A	6703638	0.000000	0.05858	0.192000	0.23308	0.757000	0.42996	0.162000	0.16501	0.591000	0.29711	0.563000	0.77884	GGC	.	.		0.672	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458016.1	NM_005490	
COL5A3	50509	hgsc.bcm.edu	37	19	10087234	10087234	+	Splice_Site	SNP	C	C	T	rs146470482	byFrequency	TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr19:10087234C>T	ENST00000264828.3	-	45	3427	c.3342G>A	c.(3340-3342)ccG>ccA	p.P1114P		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	1114	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			GGGCACTCACCGGGGGACCTG	0.532																																					p.P1114P		Atlas-SNP	.											COL5A3,NS,carcinoma,0,1	COL5A3	243	.	0			c.G3342A						.						22.0	25.0	24.0					19																	10087234		2202	4300	6502	SO:0001630	splice_region_variant	50509	exon45			ACTCACCGGGGGA	AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.3342+1G>A	chr19.hg19:g.10087234C>T		30.0	0.0		58.0	17.0	NM_015719	Q9NZQ6	Silent	SNP	ENST00000264828.3	hg19	CCDS12222.1																																																																																			.	C|0.999;G|0.001		0.532	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315788.1	NM_015719	Silent
ZNF285	26974	hgsc.bcm.edu	37	19	44891428	44891428	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr19:44891428G>A	ENST00000330997.4	-	4	1043	c.979C>T	c.(979-981)Cgc>Tgc	p.R327C	ZNF285_ENST00000544719.2_Missense_Mutation_p.R327C|ZNF285_ENST00000591679.1_Missense_Mutation_p.R334C|CTC-512J12.6_ENST00000588212.1_Intron	NM_152354.3	NP_689567.3	Q96NJ3	ZN285_HUMAN	zinc finger protein 285	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|prostate(5)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	44						GAAGAGCTGCGCCTGAAGCCC	0.493																																					p.R327C		Atlas-SNP	.											.	ZNF285	86	.	0			c.C979T						.						93.0	93.0	93.0					19																	44891428		2203	4300	6503	SO:0001583	missense	26974	exon4			AGCTGCGCCTGAA	AK055309	CCDS12638.1, CCDS74389.1	19q13.32	2013-01-08	2010-04-14	2010-04-14		ENSG00000267508		"""Zinc fingers, C2H2-type"", ""-"""	13079	protein-coding gene	gene with protein product			"""zinc finger protein 285A"""	ZNF285A			Standard	XM_005258734		Approved			Q96NJ3	OTTHUMG00000178848	ENST00000330997.4:c.979C>T	chr19.hg19:g.44891428G>A	ENSP00000333595:p.Arg327Cys	135.0	0.0		111.0	37.0	NM_152354	Q17RJ3|Q6B0A8|Q6ISR5	Missense_Mutation	SNP	ENST00000330997.4	hg19	CCDS12638.1	.	.	.	.	.	.	.	.	.	.	G	12.93	2.084260	0.36758	.	.	ENSG00000062370	ENST00000544719;ENST00000330997	T	0.16196	2.36	3.5	-1.58	0.08479	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10380	0.0254	L	0.35793	1.09	0.09310	N	1	B;B	0.12630	0.006;0.002	B;B	0.08055	0.001;0.003	T	0.34650	-0.9820	9	0.30078	T	0.28	.	3.018	0.06066	0.3928:0.0:0.2628:0.3444	.	351;327	B7ZLR9;Q96NJ3	.;ZN285_HUMAN	C	350;327	ENSP00000333595:R327C	ENSP00000333595:R327C	R	-	1	0	ZNF285	49583268	0.000000	0.05858	0.000000	0.03702	0.666000	0.39218	-2.537000	0.00939	-0.177000	0.10690	0.454000	0.30748	CGC	.	.		0.493	ZNF285-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443600.1	NM_152354	
MYBPC2	4606	hgsc.bcm.edu	37	19	50961957	50961957	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr19:50961957G>T	ENST00000357701.5	+	21	2503	c.2452G>T	c.(2452-2454)Ggg>Tgg	p.G818W		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	818	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CAACATCGCGGGGCGCAGCGA	0.672																																					p.G818W		Atlas-SNP	.											.	MYBPC2	103	.	0			c.G2452T						.						28.0	36.0	33.0					19																	50961957		2042	4181	6223	SO:0001583	missense	4606	exon21			ATCGCGGGGCGCA		CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.2452G>T	chr19.hg19:g.50961957G>T	ENSP00000350332:p.Gly818Trp	60.0	0.0		79.0	25.0	NM_004533	A1L4G9	Missense_Mutation	SNP	ENST00000357701.5	hg19	CCDS46152.1	.	.	.	.	.	.	.	.	.	.	g	23.6	4.435950	0.83885	.	.	ENSG00000086967	ENST00000357701	T	0.69306	-0.39	4.05	4.05	0.47172	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.35407	U	0.003229	D	0.88551	0.6467	H	0.98629	4.285	0.52099	D	0.999946	D	0.89917	1.0	D	0.97110	1.0	D	0.93192	0.6584	10	0.87932	D	0	.	15.339	0.74282	0.0:0.0:1.0:0.0	.	818	Q14324	MYPC2_HUMAN	W	818	ENSP00000350332:G818W	ENSP00000350332:G818W	G	+	1	0	MYBPC2	55653769	1.000000	0.71417	0.979000	0.43373	0.955000	0.61496	8.532000	0.90613	1.992000	0.58205	0.457000	0.33378	GGG	.	.		0.672	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464751.1	NM_004533	
PLCB4	5332	hgsc.bcm.edu	37	20	9424869	9424869	+	Silent	SNP	T	T	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr20:9424869T>A	ENST00000378493.1	+	28	2838	c.2823T>A	c.(2821-2823)tcT>tcA	p.S941S	PLCB4_ENST00000278655.4_Silent_p.S941S|PLCB4_ENST00000414679.2_Silent_p.S953S|PLCB4_ENST00000492632.1_3'UTR|PLCB4_ENST00000378473.3_Silent_p.S953S|PLCB4_ENST00000334005.3_Silent_p.S941S|PLCB4_ENST00000378501.2_Silent_p.S941S			Q15147	PLCB4_HUMAN	phospholipase C, beta 4	941					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						AGCTAAATTCTTTAAAGAAGA	0.313																																					p.S953S		Atlas-SNP	.											.	PLCB4	204	.	0			c.T2859A						.						72.0	73.0	72.0					20																	9424869		2203	4299	6502	SO:0001819	synonymous_variant	5332	exon31			AAATTCTTTAAAG		CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.2823T>A	chr20.hg19:g.9424869T>A		101.0	0.0		120.0	48.0	NM_001172646	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	Silent	SNP	ENST00000378493.1	hg19	CCDS13105.1																																																																																			.	.		0.313	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000077948.2		
MORC3	23515	hgsc.bcm.edu	37	21	37742093	37742093	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr21:37742093G>A	ENST00000400485.1	+	15	2503	c.2427G>A	c.(2425-2427)atG>atA	p.M809I	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	809					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						AAAGTGAAATGGATGAGATGG	0.398																																					p.M809I		Atlas-SNP	.											.	MORC3	78	.	0			c.G2427A						.						134.0	126.0	129.0					21																	37742093		2012	4187	6199	SO:0001583	missense	23515	exon15			TGAAATGGATGAG	AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.2427G>A	chr21.hg19:g.37742093G>A	ENSP00000383333:p.Met809Ile	103.0	0.0		115.0	40.0	NM_015358	A8KA92|Q9UEZ2	Missense_Mutation	SNP	ENST00000400485.1	hg19	CCDS42924.1	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600701	0.28534	.	.	ENSG00000159256	ENST00000400485	T	0.13089	2.62	5.56	5.56	0.83823	.	0.498441	0.23565	N	0.046805	T	0.10852	0.0265	L	0.38175	1.15	0.25884	N	0.983555	B	0.11235	0.004	B	0.13407	0.009	T	0.26430	-1.0103	10	0.13470	T	0.59	-7.7086	11.0861	0.48089	0.0716:0.1302:0.7983:0.0	.	809	Q14149	MORC3_HUMAN	I	809	ENSP00000383333:M809I	ENSP00000383333:M809I	M	+	3	0	MORC3	36663963	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	0.789000	0.26886	2.600000	0.87896	0.655000	0.94253	ATG	.	.		0.398	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000194640.1	NM_015358	
TCEANC	170082	hgsc.bcm.edu	37	X	13681525	13681525	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chrX:13681525T>C	ENST00000380600.1	+	2	985	c.898T>C	c.(898-900)Tgt>Cgt	p.C300R	TCEANC_ENST00000544987.1_Missense_Mutation_p.C300R|TCEANC_ENST00000314720.4_Missense_Mutation_p.C330R|TCEANC_ENST00000545566.1_Missense_Mutation_p.C300R|TCEANC_ENST00000490617.1_3'UTR			Q8N8B7	TEANC_HUMAN	transcription elongation factor A (SII) N-terminal and central domain containing	300					regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|large_intestine(5)|lung(2)|pancreas(1)	9						ATGCAGACGCTGTGAGAAATA	0.418																																					p.C330R		Atlas-SNP	.											.	TCEANC	29	.	0			c.T988C						.						32.0	27.0	28.0					X																	13681525		1887	4078	5965	SO:0001583	missense	170082	exon4			AGACGCTGTGAGA		CCDS48081.1, CCDS75954.1	Xp22.2	2009-01-30			ENSG00000176896	ENSG00000176896			28277	protein-coding gene	gene with protein product						12477932	Standard	XM_005274454		Approved	MGC17403	uc010neg.1	Q8N8B7	OTTHUMG00000021154	ENST00000380600.1:c.898T>C	chrX.hg19:g.13681525T>C	ENSP00000369974:p.Cys300Arg	147.0	1.0		143.0	101.0	NM_152634	A6NI06|B2RDM3	Missense_Mutation	SNP	ENST00000380600.1	hg19		.	.	.	.	.	.	.	.	.	.	T	19.41	3.822509	0.71028	.	.	ENSG00000176896	ENST00000545566;ENST00000544987;ENST00000314720;ENST00000380600	T;T;T;T	0.74526	-0.85;-0.85;-0.72;-0.85	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.88032	0.6328	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90326	0.4348	10	0.87932	D	0	.	14.5594	0.68126	0.0:0.0:0.0:1.0	.	330;300	Q8N8B7-2;Q8N8B7	.;TEANC_HUMAN	R	300;300;330;300	ENSP00000438952:C300R;ENSP00000440038:C300R;ENSP00000313886:C330R;ENSP00000369974:C300R	ENSP00000313886:C330R	C	+	1	0	TCEANC	13591446	1.000000	0.71417	0.994000	0.49952	0.940000	0.58332	7.601000	0.82783	1.819000	0.53055	0.486000	0.48141	TGT	.	.		0.418	TCEANC-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000055796.1	NM_152634	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20185787	20185787	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chrX:20185787G>C	ENST00000379565.3	-	17	1729	c.1522C>G	c.(1522-1524)Caa>Gaa	p.Q508E	RPS6KA3_ENST00000379548.4_Missense_Mutation_p.Q478E|RPS6KA3_ENST00000540702.1_Missense_Mutation_p.Q479E|RPS6KA3_ENST00000479809.1_5'UTR|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.Q480E	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	508	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.Q508K(1)		breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	AAAAATTTTTGTCTAAGAATT	0.348																																					p.Q508E		Atlas-SNP	.											.	RPS6KA3	110	.	1	Substitution - Missense(1)	kidney(1)	c.C1522G						.						164.0	172.0	169.0					X																	20185787		2203	4300	6503	SO:0001583	missense	6197	exon17			ATTTTTGTCTAAG	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1522C>G	chrX.hg19:g.20185787G>C	ENSP00000368884:p.Gln508Glu	195.0	0.0		202.0	135.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	G	15.72	2.916446	0.52546	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.8	4.94	0.65067	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43211	0.1237	N	0.05330	-0.07	0.58432	D	0.999998	B;B;B;B	0.17465	0.022;0.018;0.005;0.022	B;B;B;B	0.22152	0.026;0.015;0.011;0.038	T	0.22977	-1.0201	10	0.29301	T	0.29	.	14.1151	0.65149	0.074:0.0:0.926:0.0	.	479;478;480;508	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	E	508;480;478;479	ENSP00000368884:Q508E;ENSP00000440220:Q480E;ENSP00000368865:Q478E;ENSP00000444837:Q479E	ENSP00000368865:Q478E	Q	-	1	0	RPS6KA3	20095708	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	9.869000	0.99810	1.198000	0.43158	0.513000	0.50165	CAA	.	.		0.348	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
AR	367	hgsc.bcm.edu	37	X	66765176	66765176	+	Missense_Mutation	SNP	A	A	T	rs62636527		TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chrX:66765176A>T	ENST00000374690.3	+	1	712	c.188A>T	c.(187-189)cAg>cTg	p.Q63L	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q63L|AR_ENST00000504326.1_Missense_Mutation_p.Q63L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	63	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	cagcagcagcagcagcagcag	0.672									Androgen Insensitivity Syndrome																												p.Q63L		Atlas-SNP	.											.	AR	249	.	0			c.A188T						.						5.0	8.0	7.0					X																	66765176		1640	3236	4876	SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	AGCAGCAGCAGCA	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.188A>T	chrX.hg19:g.66765176A>T	ENSP00000363822:p.Gln63Leu	76.0	0.0		96.0	22.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	ENST00000374690.3	hg19	CCDS14387.1	.	.	.	.	.	.	.	.	.	.	a	11.08	1.532203	0.27387	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.78246	-1.16;-1.16;-1.16	.	.	.	.	0.479323	0.15343	U	0.267412	T	0.62624	0.2443	N	0.19112	0.55	0.09310	N	0.999992	P;D;.	0.58268	0.755;0.982;.	B;P;.	0.48627	0.089;0.584;.	T	0.56408	-0.7984	8	0.17832	T	0.49	.	.	.	.	rs62636527	63;63;61	E7EVX6;D3YPQ2;P10275	.;.;ANDR_HUMAN	L	63	ENSP00000363822:Q63L;ENSP00000421155:Q63L;ENSP00000379359:Q63L	ENSP00000363822:Q63L	Q	+	2	0	AR	66681901	0.810000	0.29049	0.871000	0.34182	0.555000	0.35460	1.078000	0.30754	0.000000	0.14550	0.000000	0.15137	CAG	.	A|0.982;T|0.018		0.672	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
PCDH19	57526	hgsc.bcm.edu	37	X	99596912	99596912	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chrX:99596912A>C	ENST00000373034.4	-	5	4512	c.2837T>G	c.(2836-2838)aTg>aGg	p.M946R	PCDH19_ENST00000420881.2_Missense_Mutation_p.M898R|PCDH19_ENST00000255531.7_Missense_Mutation_p.M899R	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	946					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						ATGATCAGGCATCTGAGATCC	0.463																																					p.M946R		Atlas-SNP	.											.	PCDH19	269	.	0			c.T2837G						.						137.0	121.0	126.0					X																	99596912		2084	4199	6283	SO:0001583	missense	57526	exon5			TCAGGCATCTGAG	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.2837T>G	chrX.hg19:g.99596912A>C	ENSP00000362125:p.Met946Arg	54.0	0.0		66.0	11.0	NM_001184880	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	hg19	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	A	9.856	1.195046	0.22037	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.52295	0.67;0.78;0.72	5.99	5.99	0.97316	.	0.251960	0.45606	D	0.000351	T	0.26085	0.0636	N	0.08118	0	0.35538	D	0.802837	B;B;B	0.27498	0.18;0.004;0.002	B;B;B	0.23018	0.043;0.004;0.002	T	0.36768	-0.9734	10	0.16896	T	0.51	.	12.0859	0.53698	0.8489:0.1511:0.0:0.0	.	946;899;898	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	R	898;946;899	ENSP00000400327:M898R;ENSP00000362125:M946R;ENSP00000255531:M899R	ENSP00000255531:M899R	M	-	2	0	PCDH19	99483568	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.745000	0.68672	2.025000	0.59659	0.486000	0.48141	ATG	.	.		0.463	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
ARMCX3	51566	hgsc.bcm.edu	37	X	100880947	100880947	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chrX:100880947T>G	ENST00000341189.4	+	5	1844	c.978T>G	c.(976-978)aaT>aaG	p.N326K	ARMCX3_ENST00000537169.1_Missense_Mutation_p.N326K|ARMCX3-AS1_ENST00000454228.1_RNA|ARMCX3_ENST00000471229.2_Missense_Mutation_p.N326K|RP4-545K15.5_ENST00000564612.1_RNA	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	326					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						CTACTCAGAATCAATTCGGTG	0.308																																					p.N326K		Atlas-SNP	.											.	ARMCX3	33	.	0			c.T978G						.						49.0	54.0	52.0					X																	100880947		2190	4289	6479	SO:0001583	missense	51566	exon5			TCAGAATCAATTC	AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.978T>G	chrX.hg19:g.100880947T>G	ENSP00000340672:p.Asn326Lys	186.0	0.0		195.0	138.0	NM_016607	Q53HC6|Q7LCF5|Q9NPE4	Missense_Mutation	SNP	ENST00000341189.4	hg19	CCDS14489.1	.	.	.	.	.	.	.	.	.	.	T	0.048	-1.260541	0.01445	.	.	ENSG00000102401	ENST00000341189;ENST00000537169	T;T	0.27890	1.64;1.64	4.44	0.168	0.15012	Armadillo-type fold (1);	0.477766	0.25711	N	0.028803	T	0.08935	0.0221	N	0.02011	-0.69	0.28502	N	0.913949	B	0.17852	0.024	B	0.24701	0.055	T	0.26155	-1.0111	9	.	.	.	-7.3172	3.5266	0.07761	0.0:0.2416:0.1961:0.5624	.	326	Q9UH62	ARMX3_HUMAN	K	326	ENSP00000340672:N326K;ENSP00000439032:N326K	.	N	+	3	2	ARMCX3	100767603	1.000000	0.71417	0.965000	0.40720	0.972000	0.66771	1.606000	0.36826	-0.066000	0.12998	0.486000	0.48141	AAT	.	.		0.308	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057568.2	NM_016607	
SEC23B	10483	hgsc.bcm.edu	37	20	18506573	18506573	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr20:18506573delG	ENST00000336714.3	+	7	1263	c.831delG	c.(829-831)ctgfs	p.L277fs	SEC23B_ENST00000377465.1_Frame_Shift_Del_p.L277fs|SEC23B_ENST00000262544.2_Frame_Shift_Del_p.L277fs|SEC23B_ENST00000377475.3_Frame_Shift_Del_p.L277fs	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	277					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TTGGCTTGCTGGAGGTAATTT	0.433																																					p.L277fs		Atlas-INDEL	.											.	SEC23B	70	.	0			c.830delT						.						101.0	100.0	100.0					20																	18506573		2203	4300	6503	SO:0001589	frameshift_variant	10483	exon7			.	X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.831delG	chr20.hg19:g.18506573delG	ENSP00000338844:p.Leu277fs	124.0	0.0		120.0	38.0	NM_032985	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Frame_Shift_Del	DEL	ENST00000336714.3	hg19	CCDS13137.1																																																																																			.	.		0.433	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078184.5		
CUX2	23316	hgsc.bcm.edu	37	12	111729223	111729223	+	Splice_Site	DEL	C	C	-			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr12:111729223delC	ENST00000261726.6	+	5	457	c.303delC	c.(301-303)gac>ga	p.D101fs		NM_015267.3	NP_056082.2	O14529	CUX2_HUMAN	cut-like homeobox 2	101					cellular response to organic substance (GO:0071310)|cognition (GO:0050890)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of synapse assembly (GO:0051965)|short-term memory (GO:0007614)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(24)|ovary(5)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	55						CCTGCACAGACCCCGTGCCTG	0.647																																					p.D101fs		Atlas-INDEL	.											.	CUX2	145	.	0			c.302delA						.						61.0	67.0	65.0					12																	111729223		2034	4171	6205	SO:0001630	splice_region_variant	23316	exon5			.	AB006631	CCDS41837.1	12q24.12	2011-06-20	2007-11-07	2007-11-07	ENSG00000111249	ENSG00000111249		"""Homeoboxes / CUT class"""	19347	protein-coding gene	gene with protein product		610648	"""cut-like 2 (Drosophila)"""	CUTL2			Standard	NM_015267		Approved	KIAA0293, CDP2	uc001tsa.2	O14529	OTTHUMG00000169546	ENST00000261726.6:c.302-1C>-	chr12.hg19:g.111729223delC		74.0	0.0		100.0	33.0	NM_015267	A7E2Y4	Frame_Shift_Del	DEL	ENST00000261726.6	hg19	CCDS41837.1																																																																																			.	.		0.647	CUX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404765.1	NM_015267	Frame_Shift_Del
SLC4A3	6508	hgsc.bcm.edu	37	2	220497642	220497642	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:220497642delA	ENST00000358055.3	+	9	1700	c.1188delA	c.(1186-1188)gcafs	p.A396fs	SLC4A3_ENST00000373760.2_Frame_Shift_Del_p.A396fs|SLC4A3_ENST00000373762.3_Frame_Shift_Del_p.A423fs|SLC4A3_ENST00000273063.6_Frame_Shift_Del_p.A423fs|SLC4A3_ENST00000317151.3_Frame_Shift_Del_p.A396fs			P48751	B3A3_HUMAN	solute carrier family 4 (anion exchanger), member 3	396					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|regulation of intracellular pH (GO:0051453)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	51		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CAGGCATTGCACACCTCGTGG	0.612																																					p.A423fs		Atlas-INDEL	.											.	SLC4A3	144	.	0			c.1268delC						.						85.0	70.0	75.0					2																	220497642		2203	4300	6503	SO:0001589	frameshift_variant	6508	exon9			.		CCDS2445.1, CCDS2446.1	2q35	2013-07-19	2013-07-19		ENSG00000114923	ENSG00000114923		"""Solute carriers"""	11029	protein-coding gene	gene with protein product	"""Anion exchanger 3, neuronal"""	106195	"""solute carrier family 4, anion exchanger, member 3"""			8001971	Standard	NM_005070		Approved	AE3, SLC2C	uc002vmo.4	P48751	OTTHUMG00000059238	ENST00000358055.3:c.1188delA	chr2.hg19:g.220497642delA	ENSP00000350756:p.Ala396fs	149.0	0.0		144.0	49.0	NM_201574	A6H8L2|A8K1Q9|B7ZVX6|B9EGD1|Q6YIQ9	Frame_Shift_Del	DEL	ENST00000358055.3	hg19	CCDS2445.1																																																																																			.	.		0.612	SLC4A3-009	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316472.1	NM_005070	
LRRD1	401387	hgsc.bcm.edu	37	7	91793161	91793162	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr7:91793161_91793162delTA	ENST00000458448.1	-	2	1555_1556	c.1355_1356delTA	c.(1354-1356)atafs	p.I453fs	LRRD1_ENST00000343318.5_Intron|LRRD1_ENST00000454089.2_5'UTR|LRRD1_ENST00000430130.2_Frame_Shift_Del_p.I453fs|CTB-161K23.1_ENST00000453068.1_RNA|LRRD1_ENST00000422722.1_Intron			A4D1F6	LRRD1_HUMAN	leucine-rich repeats and death domain containing 1	453					signal transduction (GO:0007165)					breast(4)|endometrium(1)	5						CATCTGTGATTATGTTTCCTGA	0.267																																					p.452_453del		Atlas-INDEL	.											.	LRRD1	35	.	0			c.1356_1357del						.																																			SO:0001589	frameshift_variant	401387	exon1			.	BC026112	CCDS55124.1	7q21.2	2011-05-23			ENSG00000240720	ENSG00000240720			34300	protein-coding gene	gene with protein product							Standard	NM_001161528		Approved	IMAGE:4798971	uc011khp.1	A4D1F6	OTTHUMG00000155861	ENST00000458448.1:c.1355_1356delTA	chr7.hg19:g.91793161_91793162delTA	ENSP00000405987:p.Ile453fs	132.0	0.0		192.0	48.0	NM_001161528	B7ZMM9|Q49AT9	Frame_Shift_Del	DEL	ENST00000458448.1	hg19	CCDS55124.1																																																																																			.	.		0.267	LRRD1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342027.2	NM_001045475	
MYH4	4622	hgsc.bcm.edu	37	17	10358067	10358067	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr17:10358067delG	ENST00000255381.2	-	22	2606	c.2496delC	c.(2494-2496)cccfs	p.P832fs	RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	832					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GCTTCATCCAGGGCCAGTGCT	0.423																																					p.W833fs		Atlas-INDEL	.											.	MYH4	349	.	0			c.2497delT						.						137.0	124.0	128.0					17																	10358067		2203	4300	6503	SO:0001589	frameshift_variant	4622	exon22			.		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2496delC	chr17.hg19:g.10358067delG	ENSP00000255381:p.Pro832fs	122.0	0.0		77.0	43.0	NM_017533		Frame_Shift_Del	DEL	ENST00000255381.2	hg19	CCDS11154.1																																																																																			.	.		0.423	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
ZNF519	162655	hgsc.bcm.edu	37	18	14105451	14105454	+	Frame_Shift_Del	DEL	AGGT	AGGT	-			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	AGGT	AGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr18:14105451_14105454delAGGT	ENST00000590202.1	-	3	1237_1240	c.1085_1088delACCT	c.(1084-1089)taccttfs	p.YL362fs	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	362					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						GTGTTGAGTAAGGTATGACCCCCT	0.422																																					p.362_363del		Atlas-INDEL	.											.	ZNF519	53	.	0			c.1086_1089del						.																																			SO:0001589	frameshift_variant	162655	exon3			.	BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.1085_1088delACCT	chr18.hg19:g.14105451_14105454delAGGT	ENSP00000464872:p.Tyr362fs	67.0	0.0		61.0	17.0	NM_145287		Frame_Shift_Del	DEL	ENST00000590202.1	hg19	CCDS32797.1																																																																																			.	.		0.422	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459037.1	NM_145287	
C6orf223	221416	hgsc.bcm.edu	37	6	43970601	43970617	+	Frame_Shift_Del	DEL	CGGGACAGGTGACTCCT	CGGGACAGGTGACTCCT	-	rs117880737	byFrequency	TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	CGGGACAGGTGACTCCT	CGGGACAGGTGACTCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr6:43970601_43970617delCGGGACAGGTGACTCCT	ENST00000336600.5	+	4	487_503	c.467_483delCGGGACAGGTGACTCCT	c.(466-483)ccgggacaggtgactcctfs	p.PGQVTP156fs	C6orf223_ENST00000448947.2_3'UTR|C6orf223_ENST00000439969.2_3'UTR|C6orf223_ENST00000442114.2_Frame_Shift_Del_p.PGQVTP136fs|RP5-1120P11.1_ENST00000422059.1_RNA|RP5-1120P11.1_ENST00000607590.1_RNA	NM_001171992.1|NM_153246.4	NP_001165463.1|NP_694978.2	Q8N319	CF223_HUMAN	chromosome 6 open reading frame 223	156										central_nervous_system(1)|lung(2)|pancreas(1)|prostate(1)|urinary_tract(1)	6	all_cancers(18;2.28e-07)|all_epithelial(2;1.62e-08)|Lung NSC(15;0.000172)|all_lung(25;0.000533)|Hepatocellular(11;0.00309)|Ovarian(13;0.0437)		all cancers(41;0.00141)|Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.217)			CCGAGGAGCCCGGGACAGGTGACTCCTAGAGGACTGC	0.774																																					p.156_161del		Atlas-INDEL	.											.	C6orf223	14	.	0			c.466_482del						.																																			SO:0001589	frameshift_variant	221416	exon4			.	BC032706	CCDS34459.1, CCDS55016.1	6p21.1	2012-09-05			ENSG00000181577	ENSG00000181577			28692	protein-coding gene	gene with protein product						12477932	Standard	NM_153246		Approved	MGC45491	uc003own.3	Q8N319	OTTHUMG00000014753	ENST00000336600.5:c.467_483delCGGGACAGGTGACTCCT	chr6.hg19:g.43970601_43970617delCGGGACAGGTGACTCCT	ENSP00000426159:p.Pro156fs	40.0	0.0		42.0	12.0	NM_153246	E9PB59|Q8N575	Frame_Shift_Del	DEL	ENST00000336600.5	hg19	CCDS34459.1																																																																																			.	.		0.774	C6orf223-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040702.3	NM_153246	
TP53	7157	hgsc.bcm.edu	37	17	7579521	7579521	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr17:7579521delC	ENST00000269305.4	-	4	355	c.166delG	c.(166-168)gaafs	p.E56fs	TP53_ENST00000413465.2_Frame_Shift_Del_p.E56fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.E56fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.E56fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.E56fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.E56fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	56	Interaction with HRMT1L2.		E -> K (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.E56*(7)|p.E56K(3)|p.E56fs*73(3)|p.E51fs*59(1)|p.Q52fs*67(1)|p.D48fs*55(1)|p.E56fs*67(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTGGGTCTTCAGTGAACCAT	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E56fs	Pancreas(47;798 1329 9957 10801)	Atlas-INDEL	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000413465,NS,carcinoma,-1,3	TP53	33396	.	27	Whole gene deletion(8)|Substitution - Nonsense(7)|Deletion - Frameshift(6)|Insertion - Frameshift(3)|Substitution - Missense(3)	upper_aerodigestive_tract(4)|bone(4)|liver(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|breast(2)|pancreas(2)|large_intestine(1)|stomach(1)|endometrium(1)|lung(1)|skin(1)|prostate(1)	c.167delA						.						158.0	159.0	159.0					17																	7579521		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon4	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.166delG	chr17.hg19:g.7579521delC	ENSP00000269305:p.Glu56fs	137.0	0.0		66.0	45.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
APOB	338	hgsc.bcm.edu	37	2	21231201	21231202	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr2:21231201_21231202insA	ENST00000233242.1	-	26	8665_8666	c.8538_8539insT	c.(8536-8541)tttggafs	p.G2847fs		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2847					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATAGCATTTCCAAAAAACAGCA	0.406																																					p.G2847fs		Atlas-INDEL	.											APOB,NS,carcinoma,0,1	APOB	761	.	0			c.8539_8540insT						.																																			SO:0001589	frameshift_variant	338	exon26			.	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8539dupT	chr2.hg19:g.21231207_21231207dupA	ENSP00000233242:p.Gly2847fs	84.0	0.0		105.0	38.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Frame_Shift_Ins	INS	ENST00000233242.1	hg19	CCDS1703.1																																																																																			.	.		0.406	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
ZNF784	147808	hgsc.bcm.edu	37	19	56133523	56133524	+	In_Frame_Ins	INS	-	-	CCG			TCGA-DD-AAEI-01A-11D-A40R-10	TCGA-DD-AAEI-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	076dd458-720e-4989-8ec2-6d49897b1479	233f19ee-f0d2-4fa9-ae52-fa3da11b3489	g.chr19:56133523_56133524insCCG	ENST00000325351.4	-	2	604_605	c.565_566insCGG	c.(565-567)ggc>gCGGgc	p.188_189insA	ZNF784_ENST00000591479.1_3'UTR	NM_203374.1	NP_976308.1	Q8NCA9	ZN784_HUMAN	zinc finger protein 784	188					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			upper_aerodigestive_tract(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		caccgctgcgcccgccgccgcc	0.728																																					p.G189delinsAG		Atlas-INDEL	.											.	ZNF784	9	.	0			c.566_567insCGG						.																																			SO:0001652	inframe_insertion	147808	exon2			.	AK074859	CCDS12930.1	19q13.42	2013-01-08			ENSG00000179922	ENSG00000179922		"""Zinc fingers, C2H2-type"""	33111	protein-coding gene	gene with protein product							Standard	NM_203374		Approved	MGC75238	uc002qll.1	Q8NCA9	OTTHUMG00000180860	ENST00000325351.4:c.563_565dupCGG	chr19.hg19:g.56133530_56133532dupCCG	ENSP00000320096:p.Ala190_Ala191dup	40.0	0.0		39.0	14.0	NM_203374		In_Frame_Ins	INS	ENST00000325351.4	hg19	CCDS12930.1																																																																																			.	.		0.728	ZNF784-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453355.2	NM_203374	
