#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCNL2	81669	hgsc.bcm.edu	37	1	1326223	1326223	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:1326223G>A	ENST00000400809.3	-	6	687	c.682C>T	c.(682-684)Cgc>Tgc	p.R228C	CCNL2_ENST00000408952.5_Missense_Mutation_p.R6C|CCNL2_ENST00000505849.1_5'UTR	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	228	Cyclin-like 2.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		ACGTCGGTGCGAAGGCTGTCG	0.547																																					p.R228C		Atlas-SNP	.											.	CCNL2	54	.	0			c.C682T						.						79.0	79.0	79.0					1																	1326223		2203	4296	6499	SO:0001583	missense	81669	exon6			CGGTGCGAAGGCT	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.682C>T	chr1.hg19:g.1326223G>A	ENSP00000383611:p.Arg228Cys	408.0	0.0		302.0	30.0	NM_030937	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	ENST00000400809.3	hg19	CCDS30557.1	.	.	.	.	.	.	.	.	.	.	G	18.08	3.542993	0.65198	.	.	ENSG00000221978	ENST00000400809;ENST00000408952	T;T	0.21734	1.99;1.99	5.84	5.84	0.93424	Cyclin, C-terminal (1);Cyclin-like (3);	0.000000	0.64402	D	0.000001	T	0.48333	0.1494	M	0.80982	2.52	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.41052	-0.9530	10	0.45353	T	0.12	.	14.5921	0.68373	0.0:0.0:0.8451:0.1549	.	228	Q96S94	CCNL2_HUMAN	C	228;6	ENSP00000383611:R228C;ENSP00000386132:R6C	ENSP00000383611:R228C	R	-	1	0	CCNL2	1316086	1.000000	0.71417	0.995000	0.50966	0.502000	0.33828	4.806000	0.62569	2.779000	0.95612	0.655000	0.94253	CGC	.	.		0.547	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
AADACL3	126767	hgsc.bcm.edu	37	1	12785194	12785194	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:12785194G>T	ENST00000359318.5	+	4	489	c.284G>T	c.(283-285)cGc>cTc	p.R95L	AADACL3_ENST00000332530.3_Missense_Mutation_p.R25L	NM_001103170.1	NP_001096640.1	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3	95							hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	15	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		TTTAGTTACCGCAAGTTACCT	0.463																																					p.R95L		Atlas-SNP	.											AADACL3_ENST00000359318,colon,carcinoma,0,2	AADACL3	84	.	0			c.G284T						.						109.0	113.0	112.0					1																	12785194		1966	4154	6120	SO:0001583	missense	126767	exon4			GTTACCGCAAGTT		CCDS41253.1	1p36.21	2014-07-17			ENSG00000188984	ENSG00000188984			32037	protein-coding gene	gene with protein product							Standard	XM_006710337		Approved	OTTHUMG00000001887	uc009vnn.1	Q5VUY0	OTTHUMG00000001887	ENST00000359318.5:c.284G>T	chr1.hg19:g.12785194G>T	ENSP00000352268:p.Arg95Leu	90.0	0.0		68.0	31.0	NM_001103170	B3KXR9|Q5VUY1	Missense_Mutation	SNP	ENST00000359318.5	hg19	CCDS41253.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.585885	0.66105	.	.	ENSG00000188984	ENST00000332530;ENST00000359318	T;T	0.21191	2.02;2.02	5.31	2.36	0.29203	Alpha/beta hydrolase fold-3 (1);	0.053408	0.64402	D	0.000001	T	0.60715	0.2290	H	0.99130	4.44	0.50467	D	0.999873	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.66019	-0.6027	10	0.87932	D	0	-15.1905	8.3834	0.32486	0.1432:0.1274:0.7294:0.0	.	95;25	Q5VUY0;Q5VUY0-2	ADCL3_HUMAN;.	L	25;95	ENSP00000333352:R25L;ENSP00000352268:R95L	ENSP00000333352:R25L	R	+	2	0	AADACL3	12707781	0.999000	0.42202	0.003000	0.11579	0.021000	0.10359	3.128000	0.50492	0.225000	0.20959	0.484000	0.47621	CGC	.	.		0.463	AADACL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005324.2	NM_001103170	
OVGP1	5016	hgsc.bcm.edu	37	1	111957295	111957295	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:111957295A>C	ENST00000369732.3	-	11	1883	c.1828T>G	c.(1828-1830)Ttg>Gtg	p.L610V		NM_002557.3	NP_002548.3	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1, 120kDa	610					binding of sperm to zona pellucida (GO:0007339)|carbohydrate metabolic process (GO:0005975)|chitin catabolic process (GO:0006032)|female pregnancy (GO:0007565)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|single fertilization (GO:0007338)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|egg coat (GO:0035805)|perivitelline space (GO:0098595)	chitinase activity (GO:0004568)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	39		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)		TGAAGACCCAAGTTACCCATC	0.522																																					p.L610V		Atlas-SNP	.											.	OVGP1	177	.	0			c.T1828G						.						84.0	82.0	83.0					1																	111957295		2203	4300	6503	SO:0001583	missense	5016	exon11			GACCCAAGTTACC	U09550	CCDS834.1	1p13.2	2008-07-31	2008-07-31		ENSG00000085465	ENSG00000085465		"""Mucins"""	8524	protein-coding gene	gene with protein product	"""oviductin"""	603578	"""mucin 9"""	MUC9		7819450, 9341614	Standard	NM_002557		Approved	CHIT5	uc001eba.3	Q12889	OTTHUMG00000011746	ENST00000369732.3:c.1828T>G	chr1.hg19:g.111957295A>C	ENSP00000358747:p.Leu610Val	139.0	0.0		105.0	21.0	NM_002557	A0AV19|B9EGE1|Q15841	Missense_Mutation	SNP	ENST00000369732.3	hg19	CCDS834.1	.	.	.	.	.	.	.	.	.	.	A	10.91	1.483418	0.26598	.	.	ENSG00000085465	ENST00000369732;ENST00000369728;ENST00000434331	T	0.05447	3.44	4.16	1.76	0.24704	.	47.035900	0.00166	N	0.000000	T	0.01489	0.0048	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.15930	0.005;0.015	B;B	0.09377	0.003;0.004	T	0.42481	-0.9449	10	0.46703	T	0.11	3.0E-4	3.4746	0.07579	0.4949:0.1683:0.0:0.3368	.	610;674	Q12889;Q59HH5	OVGP1_HUMAN;.	V	610;674;418	ENSP00000358747:L610V	ENSP00000358743:L674V	L	-	1	2	OVGP1	111758818	0.000000	0.05858	0.054000	0.19295	0.129000	0.20672	0.733000	0.26087	0.365000	0.24400	0.477000	0.44152	TTG	.	.		0.522	OVGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032461.1	NM_002557	
PLEKHO1	51177	hgsc.bcm.edu	37	1	150129195	150129195	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:150129195C>A	ENST00000369124.4	+	4	687	c.409C>A	c.(409-411)Cgt>Agt	p.R137S	PLEKHO1_ENST00000025469.6_Missense_Mutation_p.R137S|PLEKHO1_ENST00000479194.1_3'UTR|PLEKHO1_ENST00000369126.1_5'UTR	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	137	Interaction with ATM, CKIP, IFP35 and NMI.|Interaction with capping proteins (CPs).					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			AGCCAAGAACCGTATCTTGGA	0.597																																					p.R137S		Atlas-SNP	.											.	PLEKHO1	37	.	0			c.C409A						.						83.0	80.0	81.0					1																	150129195		2203	4300	6503	SO:0001583	missense	51177	exon4			AAGAACCGTATCT	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.409C>A	chr1.hg19:g.150129195C>A	ENSP00000358120:p.Arg137Ser	94.0	0.0		123.0	43.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	hg19	CCDS945.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.839396	0.91117	.	.	ENSG00000023902	ENST00000025469;ENST00000369124	T;T	0.16897	2.31;2.31	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.32645	0.0836	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.02437	-1.1159	10	0.49607	T	0.09	-15.5364	17.1577	0.86795	0.0:1.0:0.0:0.0	.	137	Q53GL0	PKHO1_HUMAN	S	137	ENSP00000025469:R137S;ENSP00000358120:R137S	ENSP00000025469:R137S	R	+	1	0	PLEKHO1	148395819	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.363000	0.52321	2.599000	0.87857	0.561000	0.74099	CGT	.	.		0.597	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
PSMD4	5710	hgsc.bcm.edu	37	1	151239737	151239737	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:151239737C>G	ENST00000368884.3	+	10	1132	c.1052C>G	c.(1051-1053)gCc>gGc	p.A351G	PSMD4_ENST00000368881.4_Missense_Mutation_p.A354G	NM_002810.2	NP_002801.1	P55036	PSMD4_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 4	351					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle, base subcomplex (GO:0008540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(7)	11	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AACAATGAAGCCATTCGAAAT	0.547																																					p.A351G		Atlas-SNP	.											.	PSMD4	27	.	0			c.C1052G						.						113.0	104.0	107.0					1																	151239737		2203	4300	6503	SO:0001583	missense	5710	exon10			ATGAAGCCATTCG	U51007	CCDS991.1	1q21.2	2008-05-22			ENSG00000159352	ENSG00000159352		"""Proteasome (prosome, macropain) subunits"""	9561	protein-coding gene	gene with protein product		601648				8641424	Standard	XM_005245354		Approved	S5A, AF-1, AF, Rpn10	uc001exl.3	P55036	OTTHUMG00000012349	ENST00000368884.3:c.1052C>G	chr1.hg19:g.151239737C>G	ENSP00000357879:p.Ala351Gly	136.0	0.0		153.0	13.0	NM_002810	D3DV16|Q5VWC5|Q9NS92	Missense_Mutation	SNP	ENST00000368884.3	hg19	CCDS991.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	30|30|30	5.054734|5.054734|5.054734	0.93793|0.93793|0.93793	.|.|.	.|.|.	ENSG00000159352|ENSG00000159352|ENSG00000159352	ENST00000368884;ENST00000368881|ENST00000453615|ENST00000445776	.|.|.	.|.|.	.|.|.	5.64|5.64|5.64	4.72|4.72|4.72	0.59763|0.59763|0.59763	.|.|.	0.059639|.|.	0.64402|.|.	D|.|.	0.000004|.|.	T|T|T	0.69851|0.69851|0.69851	0.3157|0.3157|0.3157	M|M|M	0.80616|0.80616|0.80616	2.505|2.505|2.505	0.58432|0.58432|0.58432	D|D|D	0.999998|0.999998|0.999998	D;P|.|.	0.54964|.|.	0.969;0.945|.|.	P;P|.|.	0.48425|.|.	0.577;0.577|.|.	T|T|T	0.73509|0.73509|0.73509	-0.3960|-0.3960|-0.3960	9|5|5	0.35671|.|.	T|.|.	0.21|.|.	-19.4623|-19.4623|-19.4623	15.4089|15.4089|15.4089	0.74902|0.74902|0.74902	0.0:0.8603:0.1397:0.0|0.0:0.8603:0.1397:0.0|0.0:0.8603:0.1397:0.0	.|.|.	354;351|.|.	Q5VWC4;P55036|.|.	.;PSMD4_HUMAN|.|.	G|A|R	351;354|58|166	.|.|.	ENSP00000357876:A354G|.|.	A|P|S	+|+|+	2|1|3	0|0|2	PSMD4|PSMD4|PSMD4	149506361|149506361|149506361	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.061000|7.061000|7.061000	0.76699|0.76699|0.76699	1.600000|1.600000|1.600000	0.50102|0.50102|0.50102	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GCC|CCA|AGC	.	.		0.547	PSMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034409.3	NM_002810	
THBS3	7059	hgsc.bcm.edu	37	1	155171290	155171290	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:155171290C>T	ENST00000368378.3	-	11	1267	c.1247G>A	c.(1246-1248)cGg>cAg	p.R416Q	RP11-263K19.4_ENST00000454348.1_RNA|RP11-263K19.4_ENST00000436772.1_RNA|THBS3_ENST00000541990.1_5'UTR|THBS3_ENST00000541576.1_5'UTR|RP11-263K19.4_ENST00000422665.1_RNA|RP11-263K19.4_ENST00000453136.1_RNA|RP11-263K19.4_ENST00000447623.1_RNA|THBS3_ENST00000486260.1_5'UTR|RP11-263K19.4_ENST00000430312.1_RNA|THBS3_ENST00000457183.2_Missense_Mutation_p.R296Q	NM_001252607.1|NM_007112.4	NP_001239536.1|NP_009043.1	P49746	TSP3_HUMAN	thrombospondin 3	416	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bone trabecula formation (GO:0060346)|cell-matrix adhesion (GO:0007160)|growth plate cartilage development (GO:0003417)|ossification involved in bone maturation (GO:0043931)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(6)|endometrium(4)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(3)	48	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTGGCAGGTCCGGGCTGGGAG	0.617																																					p.R416Q		Atlas-SNP	.											THBS3,NS,carcinoma,0,1	THBS3	70	.	0			c.G1247A						.						49.0	55.0	53.0					1																	155171290		2203	4300	6503	SO:0001583	missense	7059	exon11			CAGGTCCGGGCTG	L38969	CCDS1099.1, CCDS58034.1, CCDS72937.1	1q21	2008-02-05			ENSG00000169231	ENSG00000169231			11787	protein-coding gene	gene with protein product		188062				1601886	Standard	NM_007112		Approved		uc001fix.3	P49746	OTTHUMG00000035710	ENST00000368378.3:c.1247G>A	chr1.hg19:g.155171290C>T	ENSP00000357362:p.Arg416Gln	295.0	0.0		361.0	116.0	NM_007112	B1AVR8|B4DQ20|Q8WV34	Missense_Mutation	SNP	ENST00000368378.3	hg19	CCDS1099.1	.	.	.	.	.	.	.	.	.	.	C	15.96	2.987796	0.53934	.	.	ENSG00000169231	ENST00000368378;ENST00000457183;ENST00000428962	T;T;T	0.81415	-1.43;-1.49;-1.03	4.71	4.71	0.59529	Epidermal growth factor-like, type 3 (1);	0.207707	0.42294	D	0.000737	T	0.66723	0.2818	L	0.54908	1.71	0.36440	D	0.865448	B;B;B;B	0.31859	0.343;0.184;0.184;0.343	B;B;B;B	0.30943	0.122;0.026;0.043;0.043	T	0.69939	-0.5009	10	0.40728	T	0.16	-22.7002	13.3465	0.60575	0.0:1.0:0.0:0.0	.	296;416;416;416	B4DQ20;Q53FK6;Q2HIZ0;P49746	.;.;.;TSP3_HUMAN	Q	416;296;266	ENSP00000357362:R416Q;ENSP00000392207:R296Q;ENSP00000404040:R266Q	ENSP00000357362:R416Q	R	-	2	0	THBS3	153437914	0.001000	0.12720	0.968000	0.41197	0.995000	0.86356	-0.094000	0.11094	2.618000	0.88619	0.591000	0.81541	CGG	.	.		0.617	THBS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086856.1	NM_007112	
PPOX	5498	hgsc.bcm.edu	37	1	161140408	161140408	+	Splice_Site	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:161140408A>C	ENST00000367999.4	+	11	1364		c.e11-1		PPOX_ENST00000535223.1_Splice_Site|PPOX_ENST00000352210.5_Splice_Site|PPOX_ENST00000495483.1_Splice_Site|B4GALT3_ENST00000470882.1_5'Flank|PPOX_ENST00000432542.2_Splice_Site|PPOX_ENST00000544598.1_Splice_Site	NM_001122764.1	NP_001116236.1	P50336	PPOX_HUMAN	protoporphyrinogen oxidase						heme biosynthetic process (GO:0006783)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound biosynthetic process (GO:0006779)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of mitochondrial inner membrane (GO:0031304)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)	flavin adenine dinucleotide binding (GO:0050660)|oxygen-dependent protoporphyrinogen oxidase activity (GO:0004729)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(3)	15	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TTCCCTCCTTAGGTGATGCTG	0.537																																					.		Atlas-SNP	.											.	PPOX	34	.	0			c.1099-2A>C						.						118.0	121.0	120.0					1																	161140408		2203	4300	6503	SO:0001630	splice_region_variant	5498	exon11			CTCCTTAGGTGAT	BC002357	CCDS1221.1	1q22	2008-02-05			ENSG00000143224	ENSG00000143224	1.3.3.4		9280	protein-coding gene	gene with protein product		600923	"""variegate porphyria"""	VP		8575762, 10457135	Standard	NM_000309		Approved	PPO	uc001fyg.2	P50336	OTTHUMG00000034342	ENST00000367999.4:c.1099-1A>C	chr1.hg19:g.161140408A>C		69.0	0.0		110.0	13.0	NM_000309	D3DVG0|Q5VTW8	Splice_Site	SNP	ENST00000367999.4	hg19	CCDS1221.1	.	.	.	.	.	.	.	.	.	.	A	16.64	3.178404	0.57692	.	.	ENSG00000143224	ENST00000352210;ENST00000367999;ENST00000544598;ENST00000435935;ENST00000535223;ENST00000432542;ENST00000537523;ENST00000537829	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3518	0.66708	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PPOX	159407032	0.998000	0.40836	0.935000	0.37517	0.910000	0.53928	3.973000	0.56845	2.275000	0.75901	0.528000	0.53228	.	.	.		0.537	PPOX-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082993.1	NM_000309	Intron
LBR	3930	hgsc.bcm.edu	37	1	225600294	225600294	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:225600294C>A	ENST00000338179.2	-	8	1071	c.946G>T	c.(946-948)Ggc>Tgc	p.G316C	AC092811.1_ENST00000366845.2_5'Flank|LBR_ENST00000272163.4_Missense_Mutation_p.G316C	NM_194442.2	NP_919424.1	Q14739	LBR_HUMAN	lamin B receptor	316					cholesterol biosynthetic process (GO:0006695)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|integral component of nuclear inner membrane (GO:0005639)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)	chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|lamin binding (GO:0005521)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		AACTCTACGCCCTGGAAGAGA	0.378																																					p.G316C		Atlas-SNP	.											.	LBR	54	.	0			c.G946T						.						73.0	73.0	73.0					1																	225600294		2203	4300	6503	SO:0001583	missense	3930	exon8			CTACGCCCTGGAA	L25931	CCDS1545.1	1q42.1	2013-01-23			ENSG00000143815	ENSG00000143815		"""Tudor domain containing"""	6518	protein-coding gene	gene with protein product	"""tudor domain containing 18"""	600024				8157663, 9878250	Standard	NM_194442		Approved	DHCR14B, TDRD18	uc001hoy.3	Q14739	OTTHUMG00000037520	ENST00000338179.2:c.946G>T	chr1.hg19:g.225600294C>A	ENSP00000339883:p.Gly316Cys	469.0	0.0		481.0	70.0	NM_194442	B2R5P3|Q14740|Q53GU7|Q59FE6	Missense_Mutation	SNP	ENST00000338179.2	hg19	CCDS1545.1	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795265	0.50208	.	.	ENSG00000143815	ENST00000272163;ENST00000338179	D;D	0.97976	-4.64;-4.64	6.07	5.17	0.71159	.	0.435805	0.27323	N	0.019894	D	0.98566	0.9521	H	0.95574	3.69	0.38739	D	0.953832	D	0.59767	0.986	P	0.54856	0.762	D	0.99838	1.1059	10	0.45353	T	0.12	-7.9541	10.4419	0.44471	0.0:0.7844:0.1428:0.0727	.	316	Q14739	LBR_HUMAN	C	316	ENSP00000272163:G316C;ENSP00000339883:G316C	ENSP00000272163:G316C	G	-	1	0	LBR	223666917	0.995000	0.38212	0.921000	0.36526	0.021000	0.10359	2.124000	0.42006	1.586000	0.49944	0.655000	0.94253	GGC	.	.		0.378	LBR-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091398.1	NM_002296	
STRN	6801	hgsc.bcm.edu	37	2	37129895	37129895	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:37129895C>A	ENST00000263918.4	-	5	500		c.e5-1		STRN_ENST00000379213.2_Splice_Site	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein						dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CTGTAGATACCTGTGTGAAGA	0.358																																					.		Atlas-SNP	.											.	STRN	71	.	0			c.492-1G>T						.						122.0	122.0	122.0					2																	37129895		2203	4300	6503	SO:0001630	splice_region_variant	6801	exon6			AGATACCTGTGTG	AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.492-1G>T	chr2.hg19:g.37129895C>A		48.0	0.0		41.0	12.0	NM_003162	Q3KP65|Q53TQ8|Q9NP38	Splice_Site	SNP	ENST00000263918.4	hg19	CCDS1784.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.496070	0.64186	.	.	ENSG00000115808	ENST00000263918;ENST00000538092;ENST00000379213	.	.	.	4.95	4.95	0.65309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5752	0.91153	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	STRN	36983399	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	6.870000	0.75526	2.446000	0.82766	0.655000	0.94253	.	.	.		0.358	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218568.1		Intron
NRXN1	9378	hgsc.bcm.edu	37	2	51255005	51255005	+	Missense_Mutation	SNP	T	T	C	rs202118977		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:51255005T>C	ENST00000406316.2	-	2	1883	c.407A>G	c.(406-408)aAg>aGg	p.K136R	NRXN1_ENST00000401669.2_Missense_Mutation_p.K136R|NRXN1_ENST00000402717.3_Missense_Mutation_p.K136R|NRXN1_ENST00000406859.3_Missense_Mutation_p.K136R|NRXN1_ENST00000405472.3_Missense_Mutation_p.K136R|NRXN1_ENST00000405581.1_Missense_Mutation_p.K136R|NRXN1_ENST00000404971.1_Missense_Mutation_p.K136R	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	136	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTCCACCCACTTGGCCTCCAC	0.682																																					p.K136R		Atlas-SNP	.											.	NRXN1	1118	.	0			c.A407G						.						29.0	34.0	32.0					2																	51255005		2138	4244	6382	SO:0001583	missense	9378	exon2			ACCCACTTGGCCT	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.407A>G	chr2.hg19:g.51255005T>C	ENSP00000384311:p.Lys136Arg	101.0	0.0		83.0	27.0	NM_004801	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	ENST00000406316.2	hg19	CCDS54360.1	.	.	.	.	.	.	.	.	.	.	T	8.865	0.947848	0.18356	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859;ENST00000405581	T;T;T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17;-1.17;-1.17	4.97	2.59	0.31030	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.942673	0.08464	U	0.941992	T	0.69513	0.3119	L	0.46614	1.455	0.23607	N	0.997301	B;B;B	0.26195	0.0;0.007;0.144	B;B;B	0.23716	0.001;0.008;0.048	T	0.51364	-0.8715	10	0.19590	T	0.45	.	8.9498	0.35781	0.0:0.1523:0.0:0.8477	.	136;136;136	Q9ULB1-3;F8WB18;Q9ULB1	.;.;NRX1A_HUMAN	R	136	ENSP00000385142:K136R;ENSP00000384311:K136R;ENSP00000434015:K136R;ENSP00000385017:K136R;ENSP00000385434:K136R;ENSP00000385681:K136R;ENSP00000385310:K136R	ENSP00000385017:K136R	K	-	2	0	NRXN1	51108509	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.278000	0.51662	0.257000	0.21650	-0.371000	0.07208	AAG	.	.		0.682	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
MAP3K2	10746	hgsc.bcm.edu	37	2	128065249	128065249	+	Missense_Mutation	SNP	T	T	C	rs370911611		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:128065249T>C	ENST00000409947.1	-	17	2048	c.1766A>G	c.(1765-1767)tAt>tGt	p.Y589C	MAP3K2_ENST00000344908.5_Missense_Mutation_p.Y589C			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	589	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	ATCTCGAGTATAGTCTGAGAC	0.458																																					p.Y589C		Atlas-SNP	.											.	MAP3K2	78	.	0			c.A1766G						.	T	CYS/TYR	0,4140		0,0,2070	69.0	73.0	72.0		1766	5.7	1.0	2		72	1,8445		0,1,4222	no	missense	MAP3K2	NM_006609.4	194	0,1,6292	CC,CT,TT		0.0118,0.0,0.0079	benign	589/620	128065249	1,12585	2070	4223	6293	SO:0001583	missense	10746	exon16			CGAGTATAGTCTG	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1766A>G	chr2.hg19:g.128065249T>C	ENSP00000387246:p.Tyr589Cys	139.0	0.0		99.0	32.0	NM_006609	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	hg19	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709679	0.48517	0.0	1.18E-4	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.65364	-0.15;-0.15	5.7	5.7	0.88788	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.141127	0.64402	D	0.000005	T	0.55081	0.1898	L	0.38175	1.15	0.53688	D	0.99997	B	0.02656	0.0	B	0.01281	0.0	T	0.52132	-0.8616	10	0.59425	D	0.04	.	16.2585	0.82528	0.0:0.0:0.0:1.0	.	589	Q9Y2U5	M3K2_HUMAN	C	589	ENSP00000387246:Y589C;ENSP00000343463:Y589C	ENSP00000343463:Y589C	Y	-	2	0	MAP3K2	127781719	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	6.256000	0.72473	2.295000	0.77249	0.528000	0.53228	TAT	.	.		0.458	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609	
RAPGEF4	11069	hgsc.bcm.edu	37	2	173879264	173879264	+	Silent	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:173879264C>T	ENST00000397081.3	+	18	1874	c.1731C>T	c.(1729-1731)gtC>gtT	p.V577V	RAPGEF4_ENST00000397087.3_Silent_p.V433V|RAPGEF4_ENST00000540783.1_Silent_p.V424V|RAPGEF4_ENST00000264111.6_Silent_p.V576V|RAPGEF4_ENST00000409036.1_Silent_p.V577V|RAPGEF4_ENST00000535187.1_Silent_p.V357V|RAPGEF4_ENST00000539331.1_Silent_p.V424V|RAPGEF4_ENST00000538974.1_Silent_p.V406V	NM_007023.3	NP_008954.2	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	577	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				blood coagulation (GO:0007596)|calcium ion-dependent exocytosis (GO:0017156)|cAMP-mediated signaling (GO:0019933)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|insulin secretion (GO:0030073)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of exocytosis (GO:0017157)|regulation of insulin secretion (GO:0050796)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(14)|lung(13)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47			OV - Ovarian serous cystadenocarcinoma(117;0.194)			AGAGGCGAGTCATCCGCCTGG	0.527																																					p.V577V		Atlas-SNP	.											.	RAPGEF4	103	.	0			c.C1731T						.						90.0	92.0	92.0					2																	173879264		2035	4191	6226	SO:0001819	synonymous_variant	11069	exon18			GCGAGTCATCCGC	U78516	CCDS42775.1, CCDS42776.1, CCDS63060.1, CCDS63061.1, CCDS74604.1	2q31-q32	2008-02-05	2004-03-26		ENSG00000091428	ENSG00000091428			16626	protein-coding gene	gene with protein product	"""cAMP-regulated guanine nucleotide exchange factor II"", "" exchange protein directly activated by cAMP 2"""	606058	"""RAP guanine-nucleotide-exchange factor (GEF) 4"""			10777494, 9856955	Standard	NM_007023		Approved	cAMP-GEFII, CGEF2	uc002uhv.4	Q8WZA2	OTTHUMG00000133677	ENST00000397081.3:c.1731C>T	chr2.hg19:g.173879264C>T		174.0	0.0		168.0	61.0	NM_007023	B2R7R3|B7Z283|B7Z3T6|B7Z912|O95636|Q8IXK6|Q8TAA4	Silent	SNP	ENST00000397081.3	hg19	CCDS42775.1																																																																																			.	.		0.527	RAPGEF4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257864.2	NM_007023	
TRPM8	79054	hgsc.bcm.edu	37	2	234916713	234916713	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:234916713G>T	ENST00000324695.4	+	24	3270		c.e24-1		TRPM8_ENST00000433712.2_Splice_Site	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8						calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	CTTCTTTGCAGAATGAGGCAT	0.323																																					.		Atlas-SNP	.											.	TRPM8	146	.	0			c.3231-1G>T						.						224.0	216.0	219.0					2																	234916713		2203	4300	6503	SO:0001630	splice_region_variant	79054	exon24			TTTGCAGAATGAG	AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.3231-1G>T	chr2.hg19:g.234916713G>T		69.0	0.0		51.0	8.0	NM_024080	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Splice_Site	SNP	ENST00000324695.4	hg19	CCDS33407.1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553955	0.65425	.	.	ENSG00000144481	ENST00000324695;ENST00000433712;ENST00000456930	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7965	0.69881	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRPM8	234581452	1.000000	0.71417	0.990000	0.47175	0.900000	0.52787	5.546000	0.67243	2.580000	0.87095	0.655000	0.94253	.	.	.		0.323	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131005.4	NM_024080	Intron
GPR35	2859	hgsc.bcm.edu	37	2	241569491	241569491	+	Missense_Mutation	SNP	C	C	A	rs148595408		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:241569491C>A	ENST00000319838.5	+	6	1064	c.122C>A	c.(121-123)gCg>gAg	p.A41E	GPR35_ENST00000403859.1_Missense_Mutation_p.A41E|GPR35_ENST00000407714.1_Missense_Mutation_p.A41E|GPR35_ENST00000438013.2_Missense_Mutation_p.A72E|GPR35_ENST00000430267.1_Missense_Mutation_p.A41E	NM_001195381.1	NP_001182310.1	Q9HC97	GPR35_HUMAN	G protein-coupled receptor 35	41					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|cervix(1)|endometrium(1)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	17		all_epithelial(40;7.49e-12)|Breast(86;0.000148)|Renal(207;0.00571)|Ovarian(221;0.104)|all_neural(83;0.107)|all_hematologic(139;0.182)|all_lung(227;0.186)|Melanoma(123;0.238)		Epithelial(32;5.29e-32)|all cancers(36;1.38e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.13e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.02e-06)|Lung(119;0.00163)|Colorectal(34;0.00463)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.031)		AACAGCCTGGCGCTCTGGGTG	0.652																																					p.A72E		Atlas-SNP	.											.	GPR35	43	.	0			c.C215A						.						75.0	69.0	71.0					2																	241569491		2203	4300	6503	SO:0001583	missense	2859	exon6			GCCTGGCGCTCTG		CCDS2541.1, CCDS56174.1	2q37.3	2012-08-21			ENSG00000178623	ENSG00000178623		"""GPCR / Class A : Orphans"""	4492	protein-coding gene	gene with protein product		602646				9479505	Standard	NM_005301		Approved		uc021vze.1	Q9HC97	OTTHUMG00000133356	ENST00000319838.5:c.122C>A	chr2.hg19:g.241569491C>A	ENSP00000322731:p.Ala41Glu	42.0	0.0		49.0	16.0	NM_001195382	J3KR30|O43495|Q17R58|Q4VBN5|Q4ZFV2|Q6FHI8|Q86UH4	Missense_Mutation	SNP	ENST00000319838.5	hg19	CCDS2541.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.612214	0.66672	.	.	ENSG00000178623	ENST00000319838;ENST00000403859;ENST00000438013;ENST00000407714;ENST00000430267	T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.7;-0.7	3.81	2.9	0.33743	GPCR, rhodopsin-like superfamily (1);	0.063722	0.64402	U	0.000009	D	0.85474	0.5705	M	0.92026	3.265	0.37917	D	0.931563	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.997;0.997	D	0.88585	0.3139	10	0.87932	D	0	-20.192	11.1666	0.48547	0.0:0.8108:0.1892:0.0	.	126;72;41	Q6ZMP9;A8K2J1;Q9HC97	.;.;GPR35_HUMAN	E	41;41;72;41;41	ENSP00000322731:A41E;ENSP00000385140:A41E;ENSP00000415890:A72E;ENSP00000384263:A41E;ENSP00000411788:A41E	ENSP00000322731:A41E	A	+	2	0	GPR35	241218164	0.003000	0.15002	0.995000	0.50966	0.863000	0.49368	0.026000	0.13599	0.908000	0.36671	0.462000	0.41574	GCG	.	C|1.000;T|0.000		0.652	GPR35-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000325631.1	NM_001195382	
TRNT1	51095	hgsc.bcm.edu	37	3	3182289	3182289	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr3:3182289A>C	ENST00000251607.6	+	4	540	c.438A>C	c.(436-438)aaA>aaC	p.K146N	TRNT1_ENST00000280591.6_Missense_Mutation_p.K146N	NM_182916.2	NP_886552	Q96Q11	TRNT1_HUMAN	tRNA nucleotidyl transferase, CCA-adding, 1	146					protein targeting to mitochondrion (GO:0006626)|tRNA 3'-end processing (GO:0042780)|tRNA 3'-terminal CCA addition (GO:0001680)	intracellular (GO:0005622)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP:3'-cytidine-cytidine-tRNA adenylyltransferase activity (GO:0052929)|CTP:3'-cytidine-tRNA cytidylyltransferase activity (GO:0052928)|CTP:tRNA cytidylyltransferase activity (GO:0052927)|tRNA adenylyltransferase activity (GO:0004810)|tRNA binding (GO:0000049)			breast(2)|endometrium(3)|large_intestine(4)|lung(2)|urinary_tract(1)	12				Epithelial(13;0.00226)|OV - Ovarian serous cystadenocarcinoma(96;0.00592)|all cancers(10;0.011)		ACTGGCAGAAAGATGCGGAAC	0.368																																					p.K146N		Atlas-SNP	.											.	TRNT1	34	.	0			c.A438C						.						96.0	97.0	96.0					3																	3182289		2203	4300	6503	SO:0001583	missense	51095	exon4			GCAGAAAGATGCG	AF151805	CCDS2561.2	3p25.1	2002-05-30			ENSG00000072756	ENSG00000072756	2.7.7.25		17341	protein-coding gene	gene with protein product		612907				10810093, 11504732	Standard	NM_182916		Approved	MtCCA, CGI-47, CCA1	uc003bpp.4	Q96Q11	OTTHUMG00000090259	ENST00000251607.6:c.438A>C	chr3.hg19:g.3182289A>C	ENSP00000251607:p.Lys146Asn	279.0	0.0		179.0	51.0	NM_182916	A8K2Z6|B7WP13|C9JKA2|Q8ND57|Q9BS97|Q9Y362	Missense_Mutation	SNP	ENST00000251607.6	hg19	CCDS2561.2	.	.	.	.	.	.	.	.	.	.	A	19.62	3.862317	0.71949	.	.	ENSG00000072756	ENST00000251607;ENST00000280591	T;T	0.44083	0.93;0.93	5.71	-2.49	0.06403	Poly A polymerase, head domain (1);	0.084915	0.85682	D	0.000000	T	0.28134	0.0694	L	0.28694	0.88	0.80722	D	1	B;P	0.37548	0.024;0.599	B;B	0.37239	0.061;0.244	T	0.02683	-1.1124	10	0.46703	T	0.11	-18.9096	12.9605	0.58455	0.53:0.0:0.47:0.0	.	146;146	Q96Q11-2;Q96Q11	.;TRNT1_HUMAN	N	146	ENSP00000251607:K146N;ENSP00000280591:K146N	ENSP00000251607:K146N	K	+	3	2	TRNT1	3157289	0.994000	0.37717	0.976000	0.42696	0.997000	0.91878	0.591000	0.23969	-0.720000	0.04935	0.533000	0.62120	AAA	.	.		0.368	TRNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337616.1		
GRM7	2917	hgsc.bcm.edu	37	3	7620197	7620197	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr3:7620197C>A	ENST00000357716.4	+	8	1878	c.1604C>A	c.(1603-1605)aCa>aAa	p.T535K	GRM7_ENST00000403881.1_Missense_Mutation_p.T535K|GRM7_ENST00000389336.4_Missense_Mutation_p.T535K|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000486284.1_Missense_Mutation_p.T535K|GRM7_ENST00000402647.2_Missense_Mutation_p.T535K	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	535					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						AGAAAGAAGACACAGAAAGGA	0.498																																					p.T535K		Atlas-SNP	.											.	GRM7	223	.	0			c.C1604A						.						132.0	126.0	128.0					3																	7620197		2203	4300	6503	SO:0001583	missense	2917	exon8			AGAAGACACAGAA	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1604C>A	chr3.hg19:g.7620197C>A	ENSP00000350348:p.Thr535Lys	237.0	0.0		199.0	34.0	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Missense_Mutation	SNP	ENST00000357716.4	hg19	CCDS43042.1	.	.	.	.	.	.	.	.	.	.	C	10.85	1.465968	0.26335	.	.	ENSG00000196277	ENST00000357716;ENST00000486284;ENST00000389336;ENST00000403881;ENST00000525747;ENST00000402647;ENST00000413492	D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04	5.93	4.12	0.48240	GPCR, family 3, nine cysteines domain (1);	0.305792	0.36200	N	0.002739	T	0.74207	0.3686	L	0.31294	0.92	0.21325	N	0.999721	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.08055	0.002;0.0;0.001;0.001;0.003	T	0.63743	-0.6568	10	0.54805	T	0.06	.	5.4616	0.16619	0.0:0.6279:0.1505:0.2216	.	535;535;290;535;535	B7ZKK0;Q14831-5;Q59G95;Q14831;Q14831-2	.;.;.;GRM7_HUMAN;.	K	535	ENSP00000350348:T535K;ENSP00000417536:T535K;ENSP00000373987:T535K;ENSP00000385664:T535K;ENSP00000384585:T535K	ENSP00000350348:T535K	T	+	2	0	GRM7	7595197	0.417000	0.25432	0.562000	0.28370	0.884000	0.51177	0.819000	0.27308	0.820000	0.34516	0.655000	0.94253	ACA	.	.		0.498	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266112	41266112	+	Missense_Mutation	SNP	T	T	G	rs121913416|rs121913228		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr3:41266112T>G	ENST00000349496.5	+	3	389	c.109T>G	c.(109-111)Tct>Gct	p.S37A	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S37A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S37A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S37A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S30A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	37			S -> A (in MDB and hepatocellular carcinoma; enhances transactivation of target genes). {ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> C (in PTR, hepatoblastoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:9927029}.|S -> F (in PTR). {ECO:0000269|PubMed:10192393}.|S -> Y (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|SG -> W (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S37A(62)|p.A5_A80del(53)|p.S37P(21)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.S37T(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.S37_G38>W(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGAATCCATTCTGGTGCCAC	0.498	S37P(HEC108_ENDOMETRIUM)|S37P(SNGM_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S37A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1,1	CTNNB1	4904	.	214	Deletion - In frame(102)|Substitution - Missense(84)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(108)|large_intestine(33)|stomach(21)|endometrium(13)|small_intestine(10)|parathyroid(9)|central_nervous_system(8)|skin(3)|ovary(3)|pancreas(2)|adrenal_gland(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|pituitary(1)	c.T109G						.						94.0	79.0	84.0					3																	41266112		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ATCCATTCTGGTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.109T>G	chr3.hg19:g.41266112T>G	ENSP00000344456:p.Ser37Ala	143.0	0.0		118.0	14.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.591559	0.86953	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.67468	0.2896	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72357	-0.4318	10	0.87932	D	0	-15.9763	16.0677	0.80897	0.0:0.0:0.0:1.0	.	37	P35222	CTNB1_HUMAN	A	30;37;37;37;37;30;37;37;37	ENSP00000400508:S30A;ENSP00000385604:S37A;ENSP00000412219:S37A;ENSP00000379486:S37A;ENSP00000344456:S37A;ENSP00000411226:S30A;ENSP00000379488:S37A;ENSP00000409302:S37A;ENSP00000401599:S37A	ENSP00000344456:S37A	S	+	1	0	CTNNB1	41241116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
ZNF502	91392	hgsc.bcm.edu	37	3	44763338	44763338	+	Silent	SNP	A	A	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr3:44763338A>G	ENST00000296091.4	+	4	1285	c.1029A>G	c.(1027-1029)agA>agG	p.R343R	ZNF502_ENST00000436624.2_Silent_p.R343R|ZNF502_ENST00000449836.1_Silent_p.R343R	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		AGCATCAGAGAATTCATAGTG	0.403																																					p.R343R		Atlas-SNP	.											.	ZNF502	58	.	0			c.A1029G						.						50.0	54.0	53.0					3																	44763338		2203	4300	6503	SO:0001819	synonymous_variant	91392	exon4			TCAGAGAATTCAT	AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.1029A>G	chr3.hg19:g.44763338A>G		138.0	0.0		120.0	18.0	NM_001134440		Silent	SNP	ENST00000296091.4	hg19	CCDS2719.1	.	.	.	.	.	.	.	.	.	.	A	8.139	0.784706	0.16189	.	.	ENSG00000196653	ENST00000427783	.	.	.	4.27	3.1	0.35709	.	.	.	.	.	T	0.64527	0.2606	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.65154	-0.6237	5	0.72032	D	0.01	-21.4789	8.9095	0.35543	0.908:0.0:0.092:0.0	.	.	.	.	G	343	.	ENSP00000397812:E343G	E	+	2	0	ZNF502	44738342	0.000000	0.05858	1.000000	0.80357	0.998000	0.95712	-0.231000	0.09069	0.792000	0.33850	0.533000	0.62120	GAA	.	.		0.403	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256744.4	NM_033210	
KNG1	3827	hgsc.bcm.edu	37	3	186459974	186459974	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr3:186459974G>A	ENST00000265023.4	+	10	2001	c.1789G>A	c.(1789-1791)Ggc>Agc	p.G597S	KNG1_ENST00000287611.2_Intron|RP11-573D15.8_ENST00000596632.1_RNA|RP11-573D15.8_ENST00000609652.1_RNA|RP11-573D15.8_ENST00000354642.2_RNA|RP11-573D15.8_ENST00000609726.1_RNA|RP11-573D15.8_ENST00000596329.1_RNA|RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000447445.1_Intron	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	597					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)	p.G597C(1)		endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		AGACCCAAATGGCCTTTCATT	0.453																																					p.G597S		Atlas-SNP	.											KNG1_ENST00000265023,NS,carcinoma,0,1	KNG1	129	.	1	Substitution - Missense(1)	endometrium(1)	c.G1789A						.						139.0	130.0	133.0					3																	186459974		1901	4115	6016	SO:0001583	missense	3827	exon10			CCAAATGGCCTTT		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1789G>A	chr3.hg19:g.186459974G>A	ENSP00000265023:p.Gly597Ser	126.0	0.0		148.0	21.0	NM_001102416	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	hg19	CCDS43183.1	.	.	.	.	.	.	.	.	.	.	G	1.384	-0.582660	0.03827	.	.	ENSG00000113889	ENST00000265023	T	0.05580	3.42	5.18	-0.451	0.12214	.	0.381500	0.22838	N	0.055003	T	0.02455	0.0075	N	0.10874	0.06	0.09310	N	0.999997	B	0.06786	0.001	B	0.04013	0.001	T	0.43845	-0.9366	9	.	.	.	-1.7458	3.2892	0.06943	0.4402:0.0:0.3704:0.1895	.	597	P01042	KNG1_HUMAN	S	597	ENSP00000265023:G597S	.	G	+	1	0	KNG1	187942668	0.989000	0.36119	0.096000	0.21009	0.045000	0.14185	1.208000	0.32345	0.056000	0.16144	-0.471000	0.05019	GGC	.	.		0.453	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	
CTNND2	1501	hgsc.bcm.edu	37	5	11385065	11385065	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr5:11385065C>T	ENST00000304623.8	-	7	1078	c.889G>A	c.(889-891)Ggc>Agc	p.G297S	CTNND2_ENST00000495388.2_5'Flank|CTNND2_ENST00000503622.1_Intron|CTNND2_ENST00000458100.2_Intron|CTNND2_ENST00000359640.2_Missense_Mutation_p.G297S|CTNND2_ENST00000511377.1_Missense_Mutation_p.G206S	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	297					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						ggcgaggagccgcgcggcgcg	0.771																																					p.G297S		Atlas-SNP	.											.	CTNND2	289	.	0			c.G889A						.						28.0	35.0	33.0					5																	11385065		2173	4252	6425	SO:0001583	missense	1501	exon7			AGGAGCCGCGCGG	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.889G>A	chr5.hg19:g.11385065C>T	ENSP00000307134:p.Gly297Ser	45.0	0.0		35.0	8.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	hg19	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	C	10.24	1.295971	0.23650	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377	T;T;T	0.75477	-0.86;-0.94;-0.83	3.5	3.5	0.40072	.	0.748719	0.10145	U	0.710384	T	0.47801	0.1465	N	0.03608	-0.345	0.80722	D	1	B	0.31274	0.317	B	0.21151	0.033	T	0.35895	-0.9770	10	0.11794	T	0.64	-9.688	11.7937	0.52084	0.0:0.8206:0.1794:0.0	.	297	Q9UQB3	CTND2_HUMAN	S	297;297;206	ENSP00000307134:G297S;ENSP00000352661:G297S;ENSP00000426510:G206S	ENSP00000307134:G297S	G	-	1	0	CTNND2	11438065	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	1.447000	0.35101	1.466000	0.48025	0.462000	0.41574	GGC	.	.		0.771	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
VARS	7407	hgsc.bcm.edu	37	6	31750583	31750583	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr6:31750583T>C	ENST00000375663.3	-	15	2242	c.1802A>G	c.(1801-1803)tAt>tGt	p.Y601C	VARS_ENST00000482996.1_5'Flank|VARS_ENST00000444930.2_Intron	NM_006295.2	NP_006286.1	P26640	SYVC_HUMAN	valyl-tRNA synthetase	601					gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)|valyl-tRNA aminoacylation (GO:0006438)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|valine-tRNA ligase activity (GO:0004832)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	30					L-Valine(DB00161)	CCCAACTTCATAGTCATTTTG	0.592																																					p.Y601C		Atlas-SNP	.											.	VARS	76	.	0			c.A1802G						.						52.0	50.0	51.0					6																	31750583		1509	2708	4217	SO:0001583	missense	7407	exon15			ACTTCATAGTCAT	BC012808	CCDS34412.1	6p21.3	2011-07-01		2005-07-05	ENSG00000204394	ENSG00000204394	6.1.1.9	"""Aminoacyl tRNA synthetases / Class I"""	12651	protein-coding gene	gene with protein product	"""valine tRNA ligase 1, cytoplasmic"""	192150	"""valyl-tRNA synthetase 2"""	VARS2		15779907	Standard	XM_005249362		Approved		uc003nxe.3	P26640	OTTHUMG00000031286	ENST00000375663.3:c.1802A>G	chr6.hg19:g.31750583T>C	ENSP00000364815:p.Tyr601Cys	83.0	0.0		120.0	19.0	NM_006295	B0V1N1|B4DZ61|Q5JQ90|Q96E77|Q9UQM2	Missense_Mutation	SNP	ENST00000375663.3	hg19	CCDS34412.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949568	0.73787	.	.	ENSG00000204394	ENST00000375663	T	0.55413	0.52	5.09	5.09	0.68999	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.000000	0.85682	D	0.000000	T	0.76948	0.4059	H	0.97131	3.945	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.84942	0.0866	10	0.87932	D	0	-18.8418	12.8172	0.57671	0.0:0.0:0.0:1.0	.	601	P26640	SYVC_HUMAN	C	601	ENSP00000364815:Y601C	ENSP00000364815:Y601C	Y	-	2	0	VARS	31858562	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	4.284000	0.58983	1.919000	0.55581	0.460000	0.39030	TAT	.	.		0.592	VARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076619.2	NM_006295	
CD109	135228	hgsc.bcm.edu	37	6	74481156	74481156	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr6:74481156A>C	ENST00000287097.5	+	15	1791	c.1679A>C	c.(1678-1680)aAg>aCg	p.K560T	CD109_ENST00000422508.2_Missense_Mutation_p.K483T|CD109_ENST00000437994.2_Missense_Mutation_p.K560T			Q6YHK3	CD109_HUMAN	CD109 molecule	560					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TTTTAGATAAAGCTATATTGG	0.378																																					p.K560T		Atlas-SNP	.											.	CD109	170	.	0			c.A1679C						.						68.0	68.0	68.0					6																	74481156		2203	4300	6503	SO:0001583	missense	135228	exon15			AGATAAAGCTATA	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.1679A>C	chr6.hg19:g.74481156A>C	ENSP00000287097:p.Lys560Thr	42.0	0.0		37.0	12.0	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	hg19	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	A	7.146	0.582795	0.13749	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.63255	-0.03;-0.03;-0.03	5.5	3.12	0.35913	Alpha-2-macroglobulin, N-terminal 2 (1);	0.821791	0.11492	N	0.558636	T	0.34832	0.0911	L	0.42245	1.32	0.23628	N	0.997251	B;B;B;B	0.24368	0.027;0.102;0.041;0.019	B;B;B;B	0.31016	0.02;0.086;0.123;0.044	T	0.32824	-0.9892	10	0.34782	T	0.22	.	8.3501	0.32297	0.7792:0.1424:0.0784:0.0	.	483;560;560;560	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	T	560;483;560	ENSP00000388062:K560T;ENSP00000404475:K483T;ENSP00000287097:K560T	ENSP00000287097:K560T	K	+	2	0	CD109	74537877	0.311000	0.24536	0.728000	0.30774	0.637000	0.38172	1.009000	0.29886	1.113000	0.41760	0.533000	0.62120	AAG	.	.		0.378	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
C6orf118	168090	hgsc.bcm.edu	37	6	165713968	165713968	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr6:165713968T>G	ENST00000230301.8	-	3	781	c.761A>C	c.(760-762)cAg>cCg	p.Q254P	C6orf118_ENST00000543069.1_Missense_Mutation_p.Q150P	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	254										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		GCAAATTTTCTGGAGCTCCTG	0.458																																					p.Q254P		Atlas-SNP	.											.	C6orf118	116	.	0			c.A761C						.						117.0	135.0	129.0					6																	165713968		2203	4300	6503	SO:0001583	missense	168090	exon3			ATTTTCTGGAGCT		CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.761A>C	chr6.hg19:g.165713968T>G	ENSP00000230301:p.Gln254Pro	45.0	0.0		29.0	5.0	NM_144980	Q8TC11	Missense_Mutation	SNP	ENST00000230301.8	hg19	CCDS5288.1	.	.	.	.	.	.	.	.	.	.	T	13.19	2.164586	0.38217	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.17054	2.52;2.3	5.02	5.02	0.67125	.	0.106984	0.39759	N	0.001261	T	0.26882	0.0658	M	0.65975	2.015	0.38655	D	0.951949	D	0.76494	0.999	D	0.67548	0.952	T	0.03684	-1.1013	10	0.54805	T	0.06	.	12.2852	0.54788	0.0:0.0:0.0:1.0	.	254	Q5T5N4	CF118_HUMAN	P	254;150	ENSP00000230301:Q254P;ENSP00000439288:Q150P	ENSP00000230301:Q254P	Q	-	2	0	C6orf118	165633958	1.000000	0.71417	1.000000	0.80357	0.079000	0.17450	1.787000	0.38704	1.876000	0.54355	0.533000	0.62120	CAG	.	.		0.458	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043026.1	NM_144980	
TTYH3	80727	hgsc.bcm.edu	37	7	2687142	2687142	+	Silent	SNP	C	C	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr7:2687142C>A	ENST00000258796.7	+	4	701	c.496C>A	c.(496-498)Cga>Aga	p.R166R	TTYH3_ENST00000403167.1_5'Flank|TTYH3_ENST00000407643.1_Silent_p.R166R	NM_025250.2	NP_079526.1	Q9C0H2	TTYH3_HUMAN	tweety family member 3	166					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)|intracellular calcium activated chloride channel activity (GO:0005229)			kidney(1)|large_intestine(3)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	17		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.04e-14)		CGAGCCCCTGCGAGCCGTACA	0.726																																					p.R166R		Atlas-SNP	.											.	TTYH3	36	.	0			c.C496A						.						5.0	6.0	5.0					7																	2687142		1952	3869	5821	SO:0001819	synonymous_variant	80727	exon4			CCCCTGCGAGCCG		CCDS34588.1	7p22	2013-09-02	2013-09-02		ENSG00000136295	ENSG00000136295			22222	protein-coding gene	gene with protein product		608919	"""tweety homolog 3 (Drosophila)"""				Standard	NM_025250		Approved	KIAA1691	uc003smp.3	Q9C0H2	OTTHUMG00000152050	ENST00000258796.7:c.496C>A	chr7.hg19:g.2687142C>A		50.0	0.0		54.0	8.0	NM_025250	A4D201|B7WP98|Q6L749|Q6ZVG3|Q8TEG6	Silent	SNP	ENST00000258796.7	hg19	CCDS34588.1																																																																																			.	.		0.726	TTYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325082.2	XM_166523	
ZNF853	54753	hgsc.bcm.edu	37	7	6662092	6662092	+	Silent	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr7:6662092C>T	ENST00000457543.3	+	3	2028	c.1470C>T	c.(1468-1470)tgC>tgT	p.C490C		NM_017560.1	NP_060030.1	P0CG23	ZN853_HUMAN	zinc finger protein 853	490							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)	2						GCGGGGAGTGCGGCAAGGGCT	0.766																																					p.C490C		Atlas-SNP	.											.	ZNF853	32	.	0			c.C1470T						.						4.0	6.0	5.0					7																	6662092		639	1488	2127	SO:0001819	synonymous_variant	54753	exon3			GGAGTGCGGCAAG	AL133055	CCDS59048.1	7p22.1	2013-01-08				ENSG00000236609		"""Zinc fingers, C2H2-type"""	21767	protein-coding gene	gene with protein product							Standard	NM_017560		Approved	DKFZp434J1015	uc011jwz.2	P0CG23		ENST00000457543.3:c.1470C>T	chr7.hg19:g.6662092C>T		37.0	0.0		18.0	10.0	NM_017560		Silent	SNP	ENST00000457543.3	hg19	CCDS59048.1																																																																																			.	.		0.766	ZNF853-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324169.2	NM_017560	
THSD7A	221981	hgsc.bcm.edu	37	7	11514132	11514132	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr7:11514132C>A	ENST00000423059.4	-	8	2332	c.2081G>T	c.(2080-2082)tGc>tTc	p.C694F	AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	694	TSP type-1 6. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GTACACTGTGCAAGGATGCTC	0.483										HNSCC(18;0.044)																											p.C694F		Atlas-SNP	.											.	THSD7A	219	.	0			c.G2081T						.						76.0	75.0	75.0					7																	11514132		2011	4178	6189	SO:0001583	missense	221981	exon8			ACTGTGCAAGGAT		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.2081G>T	chr7.hg19:g.11514132C>A	ENSP00000406482:p.Cys694Phe	101.0	0.0		93.0	21.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	hg19	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	18.86	3.713699	0.68730	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	D	0.98762	-5.12	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.99566	0.9844	H	0.98407	4.225	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97833	1.0264	10	0.87932	D	0	.	19.8575	0.96767	0.0:1.0:0.0:0.0	.	694	Q9UPZ6	THS7A_HUMAN	F	694	ENSP00000406482:C694F	ENSP00000262042:C694F	C	-	2	0	THSD7A	11480657	1.000000	0.71417	0.997000	0.53966	0.404000	0.30871	7.776000	0.85560	2.767000	0.95098	0.563000	0.77884	TGC	.	.		0.483	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
SLC13A1	6561	hgsc.bcm.edu	37	7	122774580	122774580	+	Silent	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr7:122774580G>A	ENST00000194130.2	-	8	855	c.816C>T	c.(814-816)cgC>cgT	p.R272R	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	272					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	AGTCAGGATAGCGTCTGTGTG	0.488																																					p.R272R		Atlas-SNP	.											.	SLC13A1	110	.	0			c.C816T						.						162.0	132.0	142.0					7																	122774580		2203	4300	6503	SO:0001819	synonymous_variant	6561	exon8			AGGATAGCGTCTG		CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.816C>T	chr7.hg19:g.122774580G>A		92.0	0.0		81.0	22.0	NM_022444	Q9H5Z0	Silent	SNP	ENST00000194130.2	hg19	CCDS5786.1																																																																																			.	.		0.488	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347404.1	NM_022444	
TMUB1	83590	hgsc.bcm.edu	37	7	150779558	150779558	+	Silent	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr7:150779558C>T	ENST00000392818.3	-	2	450	c.93G>A	c.(91-93)acG>acA	p.T31T	FASTK_ENST00000482571.1_5'Flank|TMUB1_ENST00000482202.1_Silent_p.T31T|FASTK_ENST00000540185.1_5'Flank|TMUB1_ENST00000462940.1_Silent_p.T31T|FASTK_ENST00000353841.2_5'Flank|FASTK_ENST00000297532.6_5'Flank|TMUB1_ENST00000476627.1_Silent_p.T31T|TMUB1_ENST00000297533.4_Silent_p.T31T|FASTK_ENST00000489884.1_5'Flank	NM_031434.3	NP_113622.1	Q9BVT8	TMUB1_HUMAN	transmembrane and ubiquitin-like domain containing 1	31						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGCGGTGTGCGTTGAGACCC	0.662																																					p.T31T		Atlas-SNP	.											.	TMUB1	7	.	0			c.G93A						.						62.0	64.0	63.0					7																	150779558		2203	4300	6503	SO:0001819	synonymous_variant	83590	exon2			GGTGTGCGTTGAG	BC000936	CCDS5920.1	7q36.1	2006-06-27	2006-06-27	2006-06-27	ENSG00000164897	ENSG00000164897			21709	protein-coding gene	gene with protein product		614792	"""chromosome 7 open reading frame 21"""	C7orf21			Standard	NM_001136044		Approved	SB144	uc003wjd.3	Q9BVT8	OTTHUMG00000158621	ENST00000392818.3:c.93G>A	chr7.hg19:g.150779558C>T		135.0	0.0		136.0	37.0	NM_031434	D3DX06|Q53AQ2	Silent	SNP	ENST00000392818.3	hg19	CCDS5920.1																																																																																			.	.		0.662	TMUB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351485.1	NM_031434	
C8orf76	84933	hgsc.bcm.edu	37	8	124243859	124243859	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr8:124243859T>A	ENST00000276704.4	-	4	547	c.496A>T	c.(496-498)Aac>Tac	p.N166Y	ZHX1-C8ORF76_ENST00000357082.4_Missense_Mutation_p.N134Y|C8orf76_ENST00000521310.1_5'UTR	NM_032847.2	NP_116236.1	Q96K31	CH076_HUMAN	chromosome 8 open reading frame 76	166										NS(1)|lung(9)|ovary(2)|prostate(1)|urinary_tract(4)	17	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TTGCCCCAGTTCCAAGGATTA	0.448																																					p.N166Y		Atlas-SNP	.											.	C8orf76	26	.	0			c.A496T						.						112.0	120.0	117.0					8																	124243859		2203	4300	6503	SO:0001583	missense	84933	exon4			CCCAGTTCCAAGG	AK027731	CCDS6341.1	8q24.13	2012-06-27			ENSG00000189376	ENSG00000189376			25924	protein-coding gene	gene with protein product							Standard	NM_032847		Approved	FLJ14825	uc003yqc.2	Q96K31	OTTHUMG00000172562	ENST00000276704.4:c.496A>T	chr8.hg19:g.124243859T>A	ENSP00000276704:p.Asn166Tyr	79.0	0.0		98.0	47.0	NM_032847	Q53HC1	Missense_Mutation	SNP	ENST00000276704.4	hg19	CCDS6341.1	.	.	.	.	.	.	.	.	.	.	T	8.777	0.927336	0.18056	.	.	ENSG00000189376	ENST00000276704;ENST00000357082	T;T	0.75704	-0.96;-0.96	5.74	5.74	0.90152	Tetratricopeptide-like helical (1);	0.340781	0.37483	N	0.002068	T	0.62551	0.2437	L	0.41236	1.265	0.29225	N	0.873654	P;P	0.49090	0.919;0.919	B;P	0.45506	0.406;0.483	T	0.60224	-0.7305	10	0.02654	T	1	-1.2328	8.2152	0.31507	0.1305:0.0:0.1358:0.7337	.	134;166	Q96EF9;Q96K31	.;CH076_HUMAN	Y	166;134	ENSP00000276704:N166Y;ENSP00000349593:N134Y	ENSP00000276704:N166Y	N	-	1	0	C8orf76	124313040	0.672000	0.27530	1.000000	0.80357	0.946000	0.59487	0.234000	0.17930	2.193000	0.70182	0.533000	0.62120	AAC	.	.		0.448	C8orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381748.1	NM_032847	
KIFC2	90990	hgsc.bcm.edu	37	8	145693163	145693163	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr8:145693163G>A	ENST00000301332.2	+	6	1058		c.e6+1		CYHR1_ENST00000424149.2_5'Flank|CYHR1_ENST00000306145.5_5'Flank|CTD-2517M22.16_ENST00000525461.1_RNA|KIFC2_ENST00000301331.5_Splice_Site|CYHR1_ENST00000403000.2_5'Flank|CYHR1_ENST00000438911.2_5'Flank	NM_145754.2	NP_665697.1	Q96AC6	KIFC2_HUMAN	kinesin family member C2						ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(3)|prostate(3)|skin(2)|urinary_tract(1)	19	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			CCTGGGCGTGGTGAGGCTGCA	0.642											OREG0019057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									.		Atlas-SNP	.											.	KIFC2	53	.	0			c.681+1G>A						.						43.0	48.0	46.0					8																	145693163		2203	4300	6503	SO:0001630	splice_region_variant	90990	exon6			GGCGTGGTGAGGC	AY007121	CCDS6427.1	8q24.3	2007-02-13			ENSG00000167702	ENSG00000167702		"""Kinesins"""	29530	protein-coding gene	gene with protein product						9115737	Standard	NM_145754		Approved		uc003zcz.3	Q96AC6	OTTHUMG00000165133	ENST00000301332.2:c.681+1G>A	chr8.hg19:g.145693163G>A		155.0	0.0	1696	204.0	26.0	NM_145754	E9PHB2|Q96NN6	Splice_Site	SNP	ENST00000301332.2	hg19	CCDS6427.1	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233639	0.58886	.	.	ENSG00000167702	ENST00000301332;ENST00000528415	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5804	0.84713	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIFC2	145663971	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	6.996000	0.76263	2.521000	0.84997	0.655000	0.94253	.	.	.		0.642	KIFC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382052.2	NM_145754	Intron
GNAQ	2776	hgsc.bcm.edu	37	9	80537112	80537112	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr9:80537112T>A	ENST00000286548.4	-	2	508	c.286A>T	c.(286-288)Aca>Tca	p.T96S		NM_002072.3	NP_002063.2	P50148	GNAQ_HUMAN	guanine nucleotide binding protein (G protein), q polypeptide	96					action potential (GO:0001508)|activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|developmental pigmentation (GO:0048066)|embryonic digit morphogenesis (GO:0042733)|forebrain neuron development (GO:0021884)|glutamate receptor signaling pathway (GO:0007215)|heart development (GO:0007507)|maternal behavior (GO:0042711)|negative regulation of protein kinase activity (GO:0006469)|neuron remodeling (GO:0016322)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|platelet activation (GO:0030168)|positive regulation of GTPase activity (GO:0043547)|post-embryonic development (GO:0009791)|protein stabilization (GO:0050821)|regulation of catenin import into nucleus (GO:0035412)|regulation of melanocyte differentiation (GO:0045634)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 2A serotonin receptor binding (GO:0031826)	p.T96S(1)		NS(1)|endometrium(3)|eye(229)|kidney(1)|large_intestine(4)|lung(6)|meninges(11)|ovary(1)|prostate(1)|skin(44)|upper_aerodigestive_tract(1)	302						ATCTTGAGTGTGTCCATGGCT	0.473			Mis		uveal melanoma																																p.T96S		Atlas-SNP	.		Dom	yes		9	9q21	2776	"""guanine nucleotide binding protein (G protein), q polypeptide"""		E	GNAQ,NS,carcinoma,0,2	GNAQ	384	.	1	Substitution - Missense(1)	prostate(1)	c.A286T						.																																			SO:0001583	missense	2776	exon2			TGAGTGTGTCCAT		CCDS6658.1	9q21	2010-03-17			ENSG00000156052	ENSG00000156052			4390	protein-coding gene	gene with protein product		600998				8825633	Standard	NM_002072		Approved	G-ALPHA-q, GAQ	uc004akw.3	P50148	OTTHUMG00000020059	ENST00000286548.4:c.286A>T	chr9.hg19:g.80537112T>A	ENSP00000286548:p.Thr96Ser	56.0	1.0		31.0	5.0	NM_002072	O15108|Q13462|Q6NT27|Q92471|Q9BZB9	Missense_Mutation	SNP	ENST00000286548.4	hg19	CCDS6658.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.141103	0.37825	.	.	ENSG00000156052	ENST00000286548;ENST00000411677	D;D	0.87809	-2.3;-2.3	5.86	5.86	0.93980	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.84170	0.5413	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.79122	-0.1933	10	0.29301	T	0.29	.	16.2652	0.82574	0.0:0.0:0.0:1.0	.	96	P50148	GNAQ_HUMAN	S	96;67	ENSP00000286548:T96S;ENSP00000391501:T67S	ENSP00000286548:T96S	T	-	1	0	GNAQ	79726932	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.145000	0.64839	2.241000	0.73720	0.528000	0.53228	ACA	.	.		0.473	GNAQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052761.1	NM_002072	
FAM188A	80013	hgsc.bcm.edu	37	10	15875655	15875655	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:15875655T>C	ENST00000277632.3	-	8	924	c.704A>G	c.(703-705)gAt>gGt	p.D235G	FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	235					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						TCTATCACCATCCCATACATT	0.313																																					p.D235G	Pancreas(159;946 1953 2111 4475 22008)	Atlas-SNP	.											.	FAM188A	44	.	0			c.A704G						.						115.0	107.0	110.0					10																	15875655		2203	4298	6501	SO:0001583	missense	80013	exon8			TCACCATCCCATA	AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.704A>G	chr10.hg19:g.15875655T>C	ENSP00000277632:p.Asp235Gly	310.0	0.0		237.0	38.0	NM_024948	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Missense_Mutation	SNP	ENST00000277632.3	hg19	CCDS7110.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.470713	0.84533	.	.	ENSG00000148481	ENST00000277632;ENST00000418767;ENST00000436829	T;T;T	0.37235	1.21;1.21;1.21	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.66025	0.2748	M	0.87456	2.885	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72711	-0.4211	10	0.72032	D	0.01	-16.662	15.8509	0.78930	0.0:0.0:0.0:1.0	.	235	Q9H8M7	F188A_HUMAN	G	235;75;88	ENSP00000277632:D235G;ENSP00000388661:D75G;ENSP00000389883:D88G	ENSP00000277632:D235G	D	-	2	0	FAM188A	15915661	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.361000	0.79497	2.148000	0.66965	0.455000	0.32223	GAT	.	.		0.313	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046990.2	NM_024948	
PCDH15	65217	hgsc.bcm.edu	37	10	55663063	55663063	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:55663063T>G	ENST00000320301.6	-	26	3835	c.3441A>C	c.(3439-3441)aaA>aaC	p.K1147N	PCDH15_ENST00000395433.1_Missense_Mutation_p.K1125N|PCDH15_ENST00000414778.1_Missense_Mutation_p.K1152N|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395445.1_Missense_Mutation_p.K1154N|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.K1110N|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373965.2_Missense_Mutation_p.K1154N|PCDH15_ENST00000395430.1_Missense_Mutation_p.K1147N|PCDH15_ENST00000409834.1_Missense_Mutation_p.K758N|PCDH15_ENST00000395438.1_Missense_Mutation_p.K1147N|PCDH15_ENST00000437009.1_Missense_Mutation_p.K1076N|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.K1147N	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1147	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CGATGTAGAATTTTTTCTGAA	0.353										HNSCC(58;0.16)																											p.K1152N		Atlas-SNP	.											.,4	PCDH15	1715	.	0			c.A3456C						.						87.0	88.0	88.0					10																	55663063		2203	4300	6503	SO:0001583	missense	65217	exon27			GTAGAATTTTTTC	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.3441A>C	chr10.hg19:g.55663063T>G	ENSP00000322604:p.Lys1147Asn	49.0	0.0		58.0	8.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	hg19	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	t	16.76	3.213223	0.58452	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T;T;T;T;T;T	0.60920	0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15;0.15	5.01	2.47	0.30058	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.56673	0.2001	L	0.34521	1.04	0.45837	D	0.998705	D;P;P;P;P;P;D;P;P;P;P;P;P	0.76494	0.999;0.945;0.945;0.885;0.944;0.573;0.999;0.82;0.902;0.902;0.67;0.895;0.945	D;P;P;P;P;B;D;B;P;P;P;P;P	0.85130	0.997;0.696;0.621;0.521;0.696;0.244;0.997;0.392;0.621;0.621;0.468;0.468;0.621	T	0.58171	-0.7683	9	0.34782	T	0.22	.	1.7411	0.02952	0.2554:0.2451:0.0:0.4995	.	1125;1147;1147;1152;1076;1110;1147;1147;1154;1154;1147;1152;1147	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	N	1154;1152;1147;1147;758;1154;1110;1147;1125;1147;1147;1152;1076	ENSP00000363076:K1154N;ENSP00000410304:K1152N;ENSP00000378826:K1147N;ENSP00000386693:K758N;ENSP00000378832:K1154N;ENSP00000378820:K1110N;ENSP00000354950:K1147N;ENSP00000378821:K1125N;ENSP00000322604:K1147N;ENSP00000378818:K1147N;ENSP00000412628:K1076N	ENSP00000322604:K1147N	K	-	3	2	PCDH15	55333069	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.750000	0.26334	1.878000	0.54408	0.352000	0.21897	AAA	.	.		0.353	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
TET1	80312	hgsc.bcm.edu	37	10	70426952	70426952	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:70426952A>C	ENST00000373644.4	+	7	4821	c.4612A>C	c.(4612-4614)Aca>Cca	p.T1538P		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1538					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CACAGAGCTCACAGAGAATCT	0.483																																					p.T1538P		Atlas-SNP	.											.	TET1	255	.	0			c.A4612C						.						90.0	73.0	79.0					10																	70426952		2203	4300	6503	SO:0001583	missense	80312	exon7			GAGCTCACAGAGA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.4612A>C	chr10.hg19:g.70426952A>C	ENSP00000362748:p.Thr1538Pro	100.0	0.0		116.0	15.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	16.77	3.214600	0.58452	.	.	ENSG00000138336	ENST00000373644;ENST00000545846	T	0.37584	1.19	5.21	4.08	0.47627	TET cysteine-rich domain (1);	0.186444	0.46145	D	0.000320	T	0.56863	0.2014	M	0.71036	2.16	0.42146	D	0.991533	D	0.89917	1.0	D	0.85130	0.997	T	0.60063	-0.7336	10	0.87932	D	0	.	11.0615	0.47950	0.9267:0.0:0.0733:0.0	.	1538	Q8NFU7	TET1_HUMAN	P	1538;10	ENSP00000362748:T1538P	ENSP00000362748:T1538P	T	+	1	0	TET1	70096958	1.000000	0.71417	0.031000	0.17742	0.399000	0.30720	7.455000	0.80726	0.927000	0.37143	0.477000	0.44152	ACA	.	.		0.483	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
VCL	7414	hgsc.bcm.edu	37	10	75842271	75842271	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:75842271A>T	ENST00000211998.4	+	7	937	c.843A>T	c.(841-843)aaA>aaT	p.K281N	VCL_ENST00000478896.2_Intron|VCL_ENST00000417648.2_Intron|VCL_ENST00000372755.3_Missense_Mutation_p.K281N	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	281	3 X 112 AA tandem repeats.|N-terminal globular head.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					ACCAGGCCAAAGGTTGGCTCC	0.448																																					p.K281N		Atlas-SNP	.											.	VCL	77	.	0			c.A843T						.						86.0	79.0	81.0					10																	75842271		2203	4300	6503	SO:0001583	missense	7414	exon7			GGCCAAAGGTTGG	M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.843A>T	chr10.hg19:g.75842271A>T	ENSP00000211998:p.Lys281Asn	78.0	0.0		82.0	9.0	NM_003373	Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	ENST00000211998.4	hg19	CCDS7341.1	.	.	.	.	.	.	.	.	.	.	A	16.05	3.011523	0.54468	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000415462;ENST00000537043	T;T	0.38401	1.14;1.14	5.52	3.2	0.36748	Vinculin, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	L	0.42245	1.32	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.991	D;D;D	0.78314	0.974;0.974;0.991	T	0.23940	-1.0174	10	0.41790	T	0.15	.	8.2026	0.31434	0.7826:0.0:0.2174:0.0	.	208;281;281	F5H7T3;P18206-2;P18206	.;.;VINC_HUMAN	N	281;281;188;208	ENSP00000361841:K281N;ENSP00000211998:K281N	ENSP00000211998:K281N	K	+	3	2	VCL	75512277	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.218000	0.32467	0.402000	0.25451	0.524000	0.50904	AAA	.	.		0.448	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_003373, NM_014000	
FAM213A	84293	hgsc.bcm.edu	37	10	82187098	82187098	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:82187098A>G	ENST00000372181.1	+	4	892	c.422A>G	c.(421-423)tAt>tGt	p.Y141C	FAM213A_ENST00000372185.1_Missense_Mutation_p.Y130C|FAM213A_ENST00000372188.1_Missense_Mutation_p.Y141C|FAM213A_ENST00000372187.5_Missense_Mutation_p.Y141C	NM_001243778.1|NM_001243782.1	NP_001230707.1|NP_001230711.1	Q9BRX8	F213A_HUMAN	family with sequence similarity 213, member A	141					oxidation-reduction process (GO:0055114)|regulation of osteoclast differentiation (GO:0045670)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	antioxidant activity (GO:0016209)										AAAAAGTTCTATGGTCCACAA	0.493																																					p.Y141C		Atlas-SNP	.											.	.	.	.	0			c.A422G						.						115.0	111.0	112.0					10																	82187098		2203	4300	6503	SO:0001583	missense	84293	exon5			AGTTCTATGGTCC	AF086462	CCDS7368.1, CCDS58089.1	10q23.1	2011-12-08	2011-12-08	2011-12-08	ENSG00000122378	ENSG00000122378			28651	protein-coding gene	gene with protein product	"""peroxiredoxin-like 2 activated in M-CSF stimulated monocytes"""		"""chromosome 10 open reading frame 58"""	C10orf58		11483580, 19951071	Standard	NM_032333		Approved	MGC4248, PAMM	uc001kce.4	Q9BRX8	OTTHUMG00000018614	ENST00000372181.1:c.422A>G	chr10.hg19:g.82187098A>G	ENSP00000361254:p.Tyr141Cys	73.0	0.0		74.0	11.0	NM_032333	B2RD81|Q6UW08|Q8N2K3|Q8NBK9|Q96JR0	Missense_Mutation	SNP	ENST00000372181.1	hg19	CCDS7368.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.526674	0.64860	.	.	ENSG00000122378	ENST00000372188;ENST00000372187;ENST00000372185;ENST00000372181	T;T;T;T	0.59772	0.24;0.24;0.24;0.24	5.97	4.81	0.61882	.	0.053430	0.85682	D	0.000000	T	0.79257	0.4415	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82080	-0.0634	10	0.87932	D	0	-4.2926	10.5986	0.45354	0.8558:0.0:0.0:0.1442	.	141	Q9BRX8	PAMM_HUMAN	C	141;141;130;141	ENSP00000361262:Y141C;ENSP00000361261:Y141C;ENSP00000361259:Y130C;ENSP00000361254:Y141C	ENSP00000361254:Y141C	Y	+	2	0	C10orf58	82177078	1.000000	0.71417	0.841000	0.33234	0.722000	0.41435	7.084000	0.76866	1.023000	0.39654	0.533000	0.62120	TAT	.	.		0.493	FAM213A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049077.2		
R3HCC1L	27291	hgsc.bcm.edu	37	10	99991445	99991445	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:99991445G>A	ENST00000298999.3	+	6	2264		c.e6+1		R3HCC1L_ENST00000314594.5_Splice_Site|R3HCC1L_ENST00000370586.2_Splice_Site|R3HCC1L_ENST00000370584.3_Splice_Site	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like								nucleotide binding (GO:0000166)										GCAGTTATCAGTGAGTATGCA	0.358																																					.		Atlas-SNP	.											C10orf28,NS,carcinoma,0,1	R3HCC1L	3	.	0			c.2003+1G>A						.						92.0	92.0	92.0					10																	99991445		2203	4300	6503	SO:0001630	splice_region_variant	27291	exon7			TTATCAGTGAGTA	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1961+1G>A	chr10.hg19:g.99991445G>A		102.0	1.0		68.0	13.0	NM_001256619	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Splice_Site	SNP	ENST00000298999.3	hg19	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.424351	0.83667	.	.	ENSG00000166024	ENST00000370584;ENST00000298999;ENST00000370586;ENST00000314594;ENST00000544834	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6448	0.91407	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C10orf28	99981435	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.744000	0.85034	2.687000	0.91594	0.655000	0.94253	.	.	.		0.358	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472	Intron
FGF8	2253	hgsc.bcm.edu	37	10	103530257	103530257	+	Silent	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:103530257G>A	ENST00000344255.3	-	6	530	c.531C>T	c.(529-531)ccC>ccT	p.P177P	FGF8_ENST00000485728.1_5'UTR|FGF8_ENST00000320185.2_Silent_p.P188P|FGF8_ENST00000346714.3_Silent_p.P148P|FGF8_ENST00000347978.2_Silent_p.P159P			P55075	FGF8_HUMAN	fibroblast growth factor 8 (androgen-induced)	177					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|apoptotic process (GO:0006915)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in mesendoderm migration (GO:0090134)|cell proliferation in forebrain (GO:0021846)|corticotropin hormone secreting cell differentiation (GO:0060128)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral axon guidance (GO:0033563)|embryonic hindlimb morphogenesis (GO:0035116)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain morphogenesis (GO:0048853)|forebrain neuron development (GO:0021884)|gastrulation (GO:0007369)|gonad development (GO:0008406)|heart looping (GO:0001947)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lung morphogenesis (GO:0060425)|male genitalia development (GO:0030539)|MAPK cascade (GO:0000165)|mesodermal cell migration (GO:0008078)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|midbrain-hindbrain boundary development (GO:0030917)|motor neuron axon guidance (GO:0008045)|negative regulation of cardiac muscle tissue development (GO:0055026)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate morphogenesis (GO:0001839)|neuroepithelial cell differentiation (GO:0060563)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|pallium development (GO:0021543)|patterning of blood vessels (GO:0001569)|pharyngeal system development (GO:0060037)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of mitosis (GO:0045840)|positive regulation of organ growth (GO:0046622)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to oxidative stress (GO:0006979)|signal transduction involved in regulation of gene expression (GO:0023019)|subpallium development (GO:0021544)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone-secreting cell differentiation (GO:0060129)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(2)	5		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		AGCCCTTGCGGGGCCGGCCCT	0.637																																					p.P188P		Atlas-SNP	.											.	FGF8	23	.	0			c.C564T						.						50.0	46.0	47.0					10																	103530257		2203	4300	6503	SO:0001819	synonymous_variant	2253	exon6			CTTGCGGGGCCGG	D38752	CCDS7515.1, CCDS7516.1, CCDS7517.1, CCDS7518.1, CCDS73185.1	10q25-q26	2014-01-30			ENSG00000107831	ENSG00000107831		"""Endogenous ligands"""	3686	protein-coding gene	gene with protein product		600483				8595889	Standard	NM_033164		Approved	AIGF	uc001ktq.2	P55075	OTTHUMG00000018940	ENST00000344255.3:c.531C>T	chr10.hg19:g.103530257G>A		94.0	0.0		88.0	15.0	NM_033163	A1A514|Q14915|Q15766	Silent	SNP	ENST00000344255.3	hg19	CCDS7517.1																																																																																			.	.		0.637	FGF8-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049999.1	NM_006119, NM_033165	
DOCK1	1793	hgsc.bcm.edu	37	10	128860039	128860039	+	Splice_Site	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr10:128860039A>C	ENST00000280333.6	+	23	2490	c.2381A>C	c.(2380-2382)aAg>aCg	p.K794T		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	794					apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GTCCGGGTGAAGGTGAGTGCC	0.468																																					p.K794T		Atlas-SNP	.											.	DOCK1	188	.	0			c.A2381C						.						36.0	37.0	37.0					10																	128860039		1919	4127	6046	SO:0001630	splice_region_variant	1793	exon23			GGGTGAAGGTGAG	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.2382+1A>C	chr10.hg19:g.128860039A>C		56.0	0.0		58.0	5.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	hg19		.	.	.	.	.	.	.	.	.	.	A	19.49	3.837498	0.71373	.	.	ENSG00000150760	ENST00000280333	T	0.68331	-0.32	4.99	4.99	0.66335	.	0.000000	0.64402	U	0.000005	T	0.74512	0.3726	M	0.76574	2.34	0.58432	D	0.999998	P;P	0.42556	0.783;0.783	P;P	0.49226	0.603;0.603	T	0.78727	-0.2091	10	0.87932	D	0	.	13.9995	0.64424	1.0:0.0:0.0:0.0	.	794;794	B2RUU3;Q14185	.;DOCK1_HUMAN	T	794	ENSP00000280333:K794T	ENSP00000280333:K794T	K	+	2	0	DOCK1	128750029	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	8.452000	0.90346	2.003000	0.58678	0.533000	0.62120	AAG	.	.		0.468	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	Missense_Mutation
NUP98	4928	hgsc.bcm.edu	37	11	3744592	3744592	+	Silent	SNP	G	G	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr11:3744592G>T	ENST00000324932.7	-	16	2361	c.1941C>A	c.(1939-1941)gcC>gcA	p.A647A	NUP98_ENST00000397007.4_Silent_p.A664A|NUP98_ENST00000397004.4_Silent_p.A647A|NUP98_ENST00000355260.3_Silent_p.A647A|NUP98_ENST00000359171.4_Silent_p.A647A	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	664					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		GAATAGGTTTGGCAATAGGGT	0.408			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.A664A		Atlas-SNP	.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	149	.	0			c.C1992A						.						131.0	114.0	119.0					11																	3744592		2201	4298	6499	SO:0001819	synonymous_variant	4928	exon16			AGGTTTGGCAATA	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.1941C>A	chr11.hg19:g.3744592G>T		147.0	0.0		81.0	4.0	NM_005387	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Silent	SNP	ENST00000324932.7	hg19	CCDS7746.1																																																																																			.	.		0.408	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
OR52E6	390078	hgsc.bcm.edu	37	11	5862416	5862416	+	Missense_Mutation	SNP	C	C	A	rs61735020	byFrequency	TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr11:5862416C>A	ENST00000329322.5	-	1	711	c.712G>T	c.(712-714)Gct>Tct	p.A238S	OR52E6_ENST00000379946.2_Missense_Mutation_p.A242S|TRIM5_ENST00000380027.1_Intron	NM_001005167.1	NP_001005167.1	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E, member 6	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTGTTGAGAGCTTTGAGTCGA	0.443																																					p.A238S		Atlas-SNP	.											.	OR52E6	70	.	0			c.G712T						.						64.0	65.0	65.0					11																	5862416		2197	4294	6491	SO:0001583	missense	390078	exon1			TGAGAGCTTTGAG	AB065815	CCDS53597.1	11p15.4	2012-08-09				ENSG00000205409		"""GPCR / Class A : Olfactory receptors"""	15215	protein-coding gene	gene with protein product							Standard	NM_001005167		Approved		uc010qzq.2	Q96RD3		ENST00000329322.5:c.712G>T	chr11.hg19:g.5862416C>A	ENSP00000328878:p.Ala238Ser	129.0	0.0		109.0	20.0	NM_001005167	Q6IFF8	Missense_Mutation	SNP	ENST00000329322.5	hg19	CCDS53597.1	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414454	0.42817	.	.	ENSG00000205409	ENST00000329322;ENST00000379946	T;T	0.00359	7.87;7.87	3.23	3.23	0.37069	GPCR, rhodopsin-like superfamily (1);	0.110508	0.40144	N	0.001174	T	0.00724	0.0024	M	0.80028	2.48	0.38300	D	0.942944	D	0.64830	0.994	D	0.68039	0.955	T	0.74438	-0.3665	10	0.51188	T	0.08	.	13.1659	0.59571	0.0:1.0:0.0:0.0	.	238	Q96RD3	O52E6_HUMAN	S	238;242	ENSP00000328878:A238S;ENSP00000369279:A242S	ENSP00000328878:A238S	A	-	1	0	OR52E6	5818992	0.998000	0.40836	0.504000	0.27639	0.080000	0.17528	3.007000	0.49536	1.631000	0.50456	0.551000	0.68910	GCT	.	C|0.984;T|0.016		0.443	OR52E6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401144.1	NM_001005167	
MS4A4A	51338	hgsc.bcm.edu	37	11	60059725	60059725	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr11:60059725G>A	ENST00000337908.4	+	2	159	c.69G>A	c.(67-69)atG>atA	p.M23I	MS4A4A_ENST00000395016.3_Missense_Mutation_p.M4I|MS4A4A_ENST00000532114.1_Missense_Mutation_p.M23I|MS4A4A_ENST00000355131.3_Missense_Mutation_p.M4I	NM_148975.2	NP_683876.1	Q96JQ5	M4A4A_HUMAN	membrane-spanning 4-domains, subfamily A, member 4A	23						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(12)|prostate(1)|skin(4)	23						TGACAACCATGCAAGGAATGG	0.483																																					p.M23I		Atlas-SNP	.											.	MS4A4A	76	.	0			c.G69A						.						77.0	77.0	77.0					11																	60059725		2203	4300	6503	SO:0001583	missense	51338	exon2			AACCATGCAAGGA	AB013102	CCDS7982.1, CCDS58135.1	11q12	2012-02-28	2012-02-28		ENSG00000110079	ENSG00000110079			13371	protein-coding gene	gene with protein product		606547	"""membrane-spanning 4-domains, subfamily A, member 4"""	MS4A4		11245982, 11401424	Standard	NM_148975		Approved	CD20L1, MS4A7	uc001noz.3	Q96JQ5	OTTHUMG00000154949	ENST00000337908.4:c.69G>A	chr11.hg19:g.60059725G>A	ENSP00000338648:p.Met23Ile	137.0	0.0		89.0	21.0	NM_148975	Q8TEZ6|Q96PG7|Q9BY18|Q9H3V3|Q9P1S3	Missense_Mutation	SNP	ENST00000337908.4	hg19	CCDS7982.1	.	.	.	.	.	.	.	.	.	.	g	10.13	1.266577	0.23136	.	.	ENSG00000110079	ENST00000532114;ENST00000337908;ENST00000355131;ENST00000395016	T;T;T;T	0.18960	2.18;3.02;3.06;3.06	2.94	-0.975	0.10289	.	5.503770	0.01045	U	0.004372	T	0.12135	0.0295	N	0.20685	0.6	0.09310	N	1	B;B	0.13594	0.008;0.004	B;B	0.11329	0.006;0.002	T	0.18366	-1.0339	10	0.07030	T	0.85	-0.287	5.8453	0.18663	0.609:0.0:0.391:0.0	.	23;23	Q96JQ5-2;Q96JQ5	.;M4A4A_HUMAN	I	23;23;4;4	ENSP00000434506:M23I;ENSP00000338648:M23I;ENSP00000347252:M4I;ENSP00000378462:M4I	ENSP00000338648:M23I	M	+	3	0	MS4A4A	59816301	0.000000	0.05858	0.008000	0.14137	0.914000	0.54420	-1.416000	0.02467	-0.193000	0.10415	0.460000	0.39030	ATG	.	.		0.483	MS4A4A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337774.2		
KIAA1377	57562	hgsc.bcm.edu	37	11	101793445	101793445	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr11:101793445C>T	ENST00000263468.8	+	2	472	c.202C>T	c.(202-204)Cga>Tga	p.R68*		NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	68								p.R68*(1)		breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAAAATATGTCGAAATCGAGC	0.303																																					p.R68X		Atlas-SNP	.											KIAA1377,NS,carcinoma,-1,3	KIAA1377	111	.	1	Substitution - Nonsense(1)	breast(1)	c.C202T						.						65.0	68.0	67.0					11																	101793445		2203	4299	6502	SO:0001587	stop_gained	57562	exon2			ATATGTCGAAATC	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.202C>T	chr11.hg19:g.101793445C>T	ENSP00000263468:p.Arg68*	228.0	0.0		139.0	28.0	NM_020802	Q4G0U6	Nonsense_Mutation	SNP	ENST00000263468.8	hg19	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	C	39	7.577581	0.98368	.	.	ENSG00000110318	ENST00000263468	.	.	.	5.84	4.91	0.64330	.	0.000000	0.53938	D	0.000056	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1498	13.8959	0.63770	0.1536:0.8464:0.0:0.0	.	.	.	.	X	68	.	ENSP00000263468:R68X	R	+	1	2	KIAA1377	101298655	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	0.963000	0.29293	1.426000	0.47256	0.591000	0.81541	CGA	.	.		0.303	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
SORL1	6653	hgsc.bcm.edu	37	11	121360805	121360805	+	Silent	SNP	C	C	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr11:121360805C>G	ENST00000260197.7	+	5	873	c.744C>G	c.(742-744)gtC>gtG	p.V248V	SORL1_ENST00000532451.1_3'UTR	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	248					cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		AGGAACATGTCAAGTCCTTTT	0.438																																					p.V248V		Atlas-SNP	.											.	SORL1	218	.	0			c.C744G						.						220.0	182.0	195.0					11																	121360805		2203	4299	6502	SO:0001819	synonymous_variant	6653	exon5			ACATGTCAAGTCC	Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.744C>G	chr11.hg19:g.121360805C>G		88.0	0.0		82.0	19.0	NM_003105	B2RNX7|Q92856	Silent	SNP	ENST00000260197.7	hg19	CCDS8436.1																																																																																			.	.		0.438	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387626.2	NM_003105	
FOXRED1	55572	hgsc.bcm.edu	37	11	126143301	126143301	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr11:126143301C>G	ENST00000263578.5	+	4	562	c.488C>G	c.(487-489)gCt>gGt	p.A163G	FOXRED1_ENST00000442061.2_5'UTR|FOXRED1_ENST00000532125.1_Missense_Mutation_p.A149G|FOXRED1_ENST00000534011.1_3'UTR	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	163						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		CTCTTGCTGGCTTCAGAAAAG	0.577																																					p.A163G		Atlas-SNP	.											.	FOXRED1	38	.	0			c.C488G						.						74.0	79.0	77.0					11																	126143301		2201	4298	6499	SO:0001583	missense	55572	exon4			TGCTGGCTTCAGA		CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.488C>G	chr11.hg19:g.126143301C>G	ENSP00000263578:p.Ala163Gly	56.0	0.0		61.0	9.0	NM_017547	B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Missense_Mutation	SNP	ENST00000263578.5	hg19	CCDS8471.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.071451	0.76301	.	.	ENSG00000110074	ENST00000263578;ENST00000532125	D;D	0.85339	-1.97;-1.97	5.45	5.45	0.79879	FAD dependent oxidoreductase (1);	0.065505	0.64402	D	0.000011	D	0.93423	0.7902	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.995;0.999	D	0.94097	0.7358	10	0.87932	D	0	-7.9586	19.2849	0.94067	0.0:1.0:0.0:0.0	.	149;163	Q96CU9-3;Q96CU9	.;FXRD1_HUMAN	G	163;149	ENSP00000263578:A163G;ENSP00000434178:A149G	ENSP00000263578:A163G	A	+	2	0	FOXRED1	125648511	1.000000	0.71417	0.991000	0.47740	0.180000	0.23129	6.833000	0.75334	2.547000	0.85894	0.650000	0.86243	GCT	.	.		0.577	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386434.1	NM_017547	
ANO2	57101	hgsc.bcm.edu	37	12	5853336	5853336	+	Silent	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr12:5853336G>A	ENST00000356134.5	-	13	1400	c.1329C>T	c.(1327-1329)ttC>ttT	p.F443F	ANO2_ENST00000327087.8_Silent_p.F442F|ANO2_ENST00000546188.1_Silent_p.F443F	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	447					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						ACAGAGCCATGAAGATAGAGA	0.542																																					p.F442F		Atlas-SNP	.											ANO2_ENST00000327087,left_upper_lobe,carcinoma,0,2	ANO2	309	.	0			c.C1326T						.						91.0	97.0	95.0					12																	5853336		2062	4213	6275	SO:0001819	synonymous_variant	57101	exon12			AGCCATGAAGATA	AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.1329C>T	chr12.hg19:g.5853336G>A		84.0	0.0		85.0	19.0	NM_020373	C4N787|Q9H847	Silent	SNP	ENST00000356134.5	hg19																																																																																				.	.		0.542	ANO2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000399019.4	NM_020373	
ARID2	196528	hgsc.bcm.edu	37	12	46233237	46233237	+	Missense_Mutation	SNP	A	A	G	rs370535448		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr12:46233237A>G	ENST00000334344.6	+	11	1628	c.1456A>G	c.(1456-1458)Ata>Gta	p.I486V	ARID2_ENST00000422737.1_Missense_Mutation_p.I337V|ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Missense_Mutation_p.I96V	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	486					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GCCACAAGCTATAGAGCAAGT	0.418			"""N, S, F"""		hepatocellular carcinoma																																p.I486V		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.A1456G						.	A	VAL/ILE	2,4404	4.2+/-10.8	0,2,2201	200.0	181.0	187.0		1456	-3.5	0.9	12		187	0,8600		0,0,4300	no	missense	ARID2	NM_152641.2	29	0,2,6501	GG,GA,AA		0.0,0.0454,0.0154	benign	486/1836	46233237	2,13004	2203	4300	6503	SO:0001583	missense	196528	exon11			CAAGCTATAGAGC		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1456A>G	chr12.hg19:g.46233237A>G	ENSP00000335044:p.Ile486Val	127.0	0.0		93.0	15.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	A	2.500	-0.315388	0.05422	4.54E-4	0.0	ENSG00000189079	ENST00000334344;ENST00000422737;ENST00000444670	T	0.26223	1.75	5.19	-3.55	0.04639	.	0.514032	0.20612	N	0.088952	T	0.05273	0.0140	N	0.00538	-1.39	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.46816	-0.9164	10	0.02654	T	1	0.0722	13.1195	0.59318	0.5292:0.0:0.4708:0.0	.	486;337;486	Q68CP9-3;F8WCU9;Q68CP9	.;.;ARID2_HUMAN	V	486;337;96	ENSP00000335044:I486V	ENSP00000335044:I486V	I	+	1	0	ARID2	44519504	1.000000	0.71417	0.875000	0.34327	0.973000	0.67179	0.937000	0.28951	-1.016000	0.03371	-0.899000	0.02877	ATA	.	.		0.418	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
UHRF1BP1L	23074	hgsc.bcm.edu	37	12	100453094	100453094	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr12:100453094T>C	ENST00000279907.7	-	14	2173	c.1961A>G	c.(1960-1962)cAt>cGt	p.H654R	UHRF1BP1L_ENST00000545232.2_Missense_Mutation_p.H304R	NM_015054.1	NP_055869.1	A0JNW5	UH1BL_HUMAN	UHRF1 binding protein 1-like	654										breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(21)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	50						GAAAATTGGATGTAGAAGATT	0.303																																					p.H654R		Atlas-SNP	.											.	UHRF1BP1L	144	.	0			c.A1961G						.						54.0	62.0	59.0					12																	100453094		2203	4300	6503	SO:0001583	missense	23074	exon14			ATTGGATGTAGAA		CCDS31882.1, CCDS31883.1	12q23.1	2011-04-15	2008-08-15		ENSG00000111647	ENSG00000111647			29102	protein-coding gene	gene with protein product							Standard	XM_005268737		Approved	KIAA0701	uc001tgq.3	A0JNW5	OTTHUMG00000170195	ENST00000279907.7:c.1961A>G	chr12.hg19:g.100453094T>C	ENSP00000279907:p.His654Arg	97.0	0.0		74.0	25.0	NM_015054	A0PJE5|O75183|Q8NDL1|Q96C30|Q9BTS5|Q9H0F1	Missense_Mutation	SNP	ENST00000279907.7	hg19	CCDS31882.1	.	.	.	.	.	.	.	.	.	.	T	15.10	2.733725	0.48939	.	.	ENSG00000111647	ENST00000279907;ENST00000545232	T;T	0.12147	2.77;2.71	5.56	4.39	0.52855	.	0.050342	0.85682	D	0.000000	T	0.35856	0.0946	M	0.74258	2.255	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.10222	-1.0639	10	0.87932	D	0	-14.7995	11.8246	0.52259	0.1315:0.0:0.0:0.8685	.	654	A0JNW5	UH1BL_HUMAN	R	654;304	ENSP00000279907:H654R;ENSP00000444824:H304R	ENSP00000279907:H654R	H	-	2	0	UHRF1BP1L	98977225	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	6.102000	0.71486	0.914000	0.36822	0.528000	0.53228	CAT	.	.		0.303	UHRF1BP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407875.1	NM_001006947	
DCLK1	9201	hgsc.bcm.edu	37	13	36410249	36410249	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr13:36410249C>G	ENST00000360631.3	-	8	1361	c.1150G>C	c.(1150-1152)Gct>Cct	p.A384P	DCLK1_ENST00000379893.1_Missense_Mutation_p.A77P|DCLK1_ENST00000255448.4_Missense_Mutation_p.A384P			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	384					axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GTTATTGTAGCTGGAATCTGG	0.363																																					p.A384P		Atlas-SNP	.											.	DCLK1	350	.	0			c.G1150C						.						238.0	223.0	228.0					13																	36410249		2203	4300	6503	SO:0001583	missense	9201	exon8			TTGTAGCTGGAAT	AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1150G>C	chr13.hg19:g.36410249C>G	ENSP00000353846:p.Ala384Pro	113.0	0.0		65.0	15.0	NM_004734	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	ENST00000360631.3	hg19		.	.	.	.	.	.	.	.	.	.	C	15.52	2.858765	0.51376	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.39056	1.1;1.1;1.1	6.04	6.04	0.98038	.	0.166820	0.53938	D	0.000051	T	0.33933	0.0880	N	0.19112	0.55	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.15052	0.008;0.012;0.005	T	0.04752	-1.0929	10	0.33141	T	0.24	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	77;384;77	O15075-4;O15075-2;O15075-3	.;.;.	P	76;384;384;77;384	ENSP00000255448:A384P;ENSP00000353846:A384P;ENSP00000369223:A77P	ENSP00000255448:A384P	A	-	1	0	DCLK1	35308249	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.310000	0.59141	2.873000	0.98535	0.563000	0.77884	GCT	.	.		0.363	DCLK1-010	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000044487.1	NM_004734	
CYSLTR2	57105	hgsc.bcm.edu	37	13	49281602	49281602	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr13:49281602C>G	ENST00000282018.3	+	1	652	c.649C>G	c.(649-651)Ctc>Gtc	p.L217V		NM_020377.2	NP_065110.1	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	217					immune response (GO:0006955)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell death (GO:0010942)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteinyl leukotriene receptor activity (GO:0001631)|leukotriene receptor activity (GO:0004974)			endometrium(2)|large_intestine(4)|lung(12)|skin(2)	20		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	ATTTTTCACACTCAGCATCTG	0.478																																					p.L217V		Atlas-SNP	.											.	CYSLTR2	55	.	0			c.C649G						.						103.0	103.0	103.0					13																	49281602		2203	4300	6503	SO:0001583	missense	57105	exon1			TTCACACTCAGCA	AB038269	CCDS9412.1	13q14.2	2012-08-10			ENSG00000152207	ENSG00000152207		"""GPCR / Class A : Leukotriene receptors"""	18274	protein-coding gene	gene with protein product		605666				10913337, 1085123	Standard	NM_020377		Approved	CysLT(2), CYSLT2R	uc001vck.2	Q9NS75	OTTHUMG00000016906	ENST00000282018.3:c.649C>G	chr13.hg19:g.49281602C>G	ENSP00000282018:p.Leu217Val	35.0	0.0		52.0	14.0	NM_020377	Q9HCQ2	Missense_Mutation	SNP	ENST00000282018.3	hg19	CCDS9412.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.459401	0.43736	.	.	ENSG00000152207	ENST00000282018	T	0.26518	1.73	5.89	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.105827	0.36972	N	0.002310	T	0.31136	0.0787	L	0.48362	1.52	0.32195	N	0.578609	P	0.51791	0.948	P	0.54499	0.754	T	0.19943	-1.0290	10	0.26408	T	0.33	.	8.3036	0.32029	0.2335:0.6894:0.0:0.0771	.	217	Q9NS75	CLTR2_HUMAN	V	217	ENSP00000282018:L217V	ENSP00000282018:L217V	L	+	1	0	CYSLTR2	48179603	0.999000	0.42202	0.964000	0.40570	0.678000	0.39670	4.634000	0.61325	2.793000	0.96121	0.655000	0.94253	CTC	.	.		0.478	CYSLTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044894.1		
OLFM4	10562	hgsc.bcm.edu	37	13	53624695	53624695	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr13:53624695A>C	ENST00000219022.2	+	5	1400	c.1322A>C	c.(1321-1323)tAt>tCt	p.Y441S		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	441	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		GGGGTTCTGTATGCCACCCGT	0.408																																					p.Y441S		Atlas-SNP	.											.	OLFM4	94	.	0			c.A1322C						.						145.0	129.0	135.0					13																	53624695		2203	4300	6503	SO:0001583	missense	10562	exon5			TTCTGTATGCCAC	AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1322A>C	chr13.hg19:g.53624695A>C	ENSP00000219022:p.Tyr441Ser	95.0	0.0		73.0	22.0	NM_006418	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	ENST00000219022.2	hg19	CCDS9440.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.738931	0.89573	.	.	ENSG00000102837	ENST00000219022	D	0.95885	-3.84	5.92	5.92	0.95590	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.98403	0.9469	H	0.94385	3.53	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99593	1.0976	10	0.87932	D	0	.	16.3604	0.83263	1.0:0.0:0.0:0.0	.	441	Q6UX06	OLFM4_HUMAN	S	441	ENSP00000219022:Y441S	ENSP00000219022:Y441S	Y	+	2	0	OLFM4	52522696	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.339000	0.96797	2.260000	0.74910	0.528000	0.53228	TAT	.	.		0.408	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045112.2	NM_006418	
TGDS	23483	hgsc.bcm.edu	37	13	95235445	95235445	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr13:95235445T>C	ENST00000261296.5	-	5	479	c.359A>G	c.(358-360)tAt>tGt	p.Y120C	TGDS_ENST00000498294.1_5'UTR	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	120					nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					GTGAGTGCCATAAACATTAAC	0.383																																					p.Y120C		Atlas-SNP	.											.	TGDS	24	.	0			c.A359G						.						128.0	107.0	114.0					13																	95235445		2203	4300	6503	SO:0001583	missense	23483	exon5			GTGCCATAAACAT	AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.359A>G	chr13.hg19:g.95235445T>C	ENSP00000261296:p.Tyr120Cys	66.0	0.0		78.0	29.0	NM_014305	Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	Missense_Mutation	SNP	ENST00000261296.5	hg19	CCDS9471.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.040741	0.75732	.	.	ENSG00000088451	ENST00000261296	D	0.93189	-3.18	5.61	5.61	0.85477	NAD-dependent epimerase/dehydratase (1);NAD(P)-binding domain (1);	0.114581	0.64402	D	0.000014	D	0.96160	0.8748	M	0.70275	2.135	0.58432	D	0.999994	D	0.76494	0.999	D	0.70716	0.97	D	0.96623	0.9461	10	0.87932	D	0	.	16.0994	0.81158	0.0:0.0:0.0:1.0	.	120	O95455	TGDS_HUMAN	C	120	ENSP00000261296:Y120C	ENSP00000261296:Y120C	Y	-	2	0	TGDS	94033446	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	6.112000	0.71547	2.261000	0.74972	0.533000	0.62120	TAT	.	.		0.383	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106904.2	NM_014305	
TOX4	9878	hgsc.bcm.edu	37	14	21964732	21964732	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr14:21964732A>G	ENST00000405508.1	+	10	2110	c.1834A>G	c.(1834-1836)Aga>Gga	p.R612G	TOX4_ENST00000448790.2_Missense_Mutation_p.R589G|TOX4_ENST00000262709.3_Missense_Mutation_p.R612G			O94842	TOX4_HUMAN	TOX high mobility group box family member 4	612						chromatin (GO:0000785)|nucleus (GO:0005634)|PTW/PP1 phosphatase complex (GO:0072357)	DNA binding (GO:0003677)			large_intestine(8)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		GGTAGCCTCTAGAAATTCAAA	0.388																																					p.R612G		Atlas-SNP	.											.	TOX4	50	.	0			c.A1834G						.						145.0	134.0	138.0					14																	21964732		2203	4300	6503	SO:0001583	missense	9878	exon9			GCCTCTAGAAATT	AB018280	CCDS32043.1	14q11.2	2007-03-20	2007-03-20	2007-03-20	ENSG00000092203	ENSG00000092203			20161	protein-coding gene	gene with protein product		614032	"""chromosome 14 open reading frame 92"", ""KIAA0737"""	C14orf92, KIAA0737			Standard	NM_014828		Approved	LCP1	uc001waz.3	O94842	OTTHUMG00000150278	ENST00000405508.1:c.1834A>G	chr14.hg19:g.21964732A>G	ENSP00000385102:p.Arg612Gly	78.0	0.0		74.0	13.0	NM_014828	B4DPY8|B4DSM0|E7EV69	Missense_Mutation	SNP	ENST00000405508.1	hg19	CCDS32043.1	.	.	.	.	.	.	.	.	.	.	A	17.49	3.401772	0.62288	.	.	ENSG00000092203	ENST00000405508;ENST00000262709;ENST00000448790;ENST00000545559	T;T;T	0.15952	2.38;2.38;2.39	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.26702	0.0653	L	0.35854	1.095	0.46874	D	0.999239	P;P	0.48350	0.909;0.909	P;P	0.60789	0.879;0.879	T	0.01294	-1.1393	10	0.87932	D	0	.	9.1536	0.36978	0.8163:0.1836:0.0:0.0	.	589;612	B4DPY8;O94842	.;TOX4_HUMAN	G	612;612;589;540	ENSP00000385102:R612G;ENSP00000262709:R612G;ENSP00000393080:R589G	ENSP00000262709:R612G	R	+	1	2	TOX4	21034572	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.616000	0.46376	2.234000	0.73211	0.528000	0.53228	AGA	.	.		0.388	TOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317287.2	NM_014828	
HSP90AA1	3320	hgsc.bcm.edu	37	14	102552400	102552400	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr14:102552400T>A	ENST00000216281.8	-	3	429	c.224A>T	c.(223-225)gAg>gTg	p.E75V	HSP90AA1_ENST00000441629.2_Intron|HSP90AA1_ENST00000334701.7_Missense_Mutation_p.E197V	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	75					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	AATATGCAGCTCTTTCCCAGA	0.388																																					p.E197V		Atlas-SNP	.											.	HSP90AA1	65	.	0			c.A590T						.						70.0	71.0	71.0					14																	102552400		2203	4300	6503	SO:0001583	missense	3320	exon4			TGCAGCTCTTTCC	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.224A>T	chr14.hg19:g.102552400T>A	ENSP00000216281:p.Glu75Val	77.0	0.0		66.0	9.0	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	hg19	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.616046	0.66672	.	.	ENSG00000080824	ENST00000216281;ENST00000334701;ENST00000553585	T;T;T	0.56941	2.04;2.04;0.43	3.79	3.79	0.43588	ATPase-like, ATP-binding domain (4);	0.213930	0.38548	U	0.001642	T	0.65354	0.2683	H	0.94964	3.605	0.80722	D	1	P;B	0.35208	0.49;0.083	B;B	0.37144	0.242;0.182	T	0.74743	-0.3562	10	0.87932	D	0	.	12.8341	0.57763	0.0:0.0:0.0:1.0	.	197;75	P07900-2;P07900	.;HS90A_HUMAN	V	75;197;75	ENSP00000216281:E75V;ENSP00000335153:E197V;ENSP00000450712:E75V	ENSP00000216281:E75V	E	-	2	0	HSP90AA1	101622153	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	5.935000	0.70145	1.500000	0.48636	0.467000	0.42956	GAG	.	.		0.388	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
HERC1	8925	hgsc.bcm.edu	37	15	63920927	63920927	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr15:63920927G>A	ENST00000443617.2	-	70	13141	c.13054C>T	c.(13054-13056)Cgc>Tgc	p.R4352C		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	4352					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CTGTGGCAGCGGCCAGCCGAG	0.517																																					p.R4352C		Atlas-SNP	.											HERC1_ENST00000443617,colon,carcinoma,0,2	HERC1	624	.	0			c.C13054T						.						83.0	88.0	87.0					15																	63920927		1960	4170	6130	SO:0001583	missense	8925	exon70			GGCAGCGGCCAGC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.13054C>T	chr15.hg19:g.63920927G>A	ENSP00000390158:p.Arg4352Cys	66.0	0.0		71.0	3.0	NM_003922	Q8IW65	Missense_Mutation	SNP	ENST00000443617.2	hg19	CCDS45277.1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735138	0.89482	.	.	ENSG00000103657	ENST00000443617	D	0.84944	-1.92	5.89	5.89	0.94794	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.64402	D	0.000001	D	0.87281	0.6138	N	0.21282	0.65	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.88359	0.2986	10	0.72032	D	0.01	.	15.0168	0.71591	0.0:0.0:0.8577:0.1423	.	4352	Q15751	HERC1_HUMAN	C	4352	ENSP00000390158:R4352C	ENSP00000390158:R4352C	R	-	1	0	HERC1	61707980	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	7.795000	0.85887	2.781000	0.95711	0.555000	0.69702	CGC	.	.		0.517	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
MEF2A	4205	hgsc.bcm.edu	37	15	100252747	100252747	+	Missense_Mutation	SNP	C	C	A	rs369815961		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr15:100252747C>A	ENST00000557785.1	+	11	1614	c.1265C>A	c.(1264-1266)cCg>cAg	p.P422Q	MEF2A_ENST00000449277.2_Missense_Mutation_p.P354Q|MEF2A_ENST00000558812.1_Missense_Mutation_p.P362Q|MEF2A_ENST00000338042.6_Missense_Mutation_p.P431Q|MEF2A_ENST00000453228.2_Missense_Mutation_p.P422Q|MEF2A_ENST00000557942.1_Missense_Mutation_p.P430Q|MEF2A_ENST00000354410.5_Missense_Mutation_p.P424Q	NM_001171894.1	NP_001165365.1	Q02078	MEF2A_HUMAN	myocyte enhancer factor 2A	432	Gln/Pro-rich.				apoptotic process (GO:0006915)|cardiac conduction (GO:0061337)|cellular response to calcium ion (GO:0071277)|dendrite morphogenesis (GO:0048813)|ERK5 cascade (GO:0070375)|heart development (GO:0007507)|innate immune response (GO:0045087)|MAPK cascade (GO:0000165)|mitochondrial genome maintenance (GO:0000002)|mitochondrion distribution (GO:0048311)|muscle cell differentiation (GO:0042692)|muscle organ development (GO:0007517)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ventricular cardiac myofibril assembly (GO:0055005)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)	p.P432Q(1)|p.P422Q(1)|p.P424Q(1)		endometrium(2)|large_intestine(2)|lung(7)|ovary(1)	12	Lung NSC(78;0.00335)|all_lung(78;0.00659)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00085)			cagcagcCGCCGCCACCACCG	0.637																																					p.P424Q		Atlas-SNP	.											MEF2A_ENST00000453228,NS,carcinoma,-1,3	MEF2A	138	.	3	Substitution - Missense(3)	lung(3)	c.C1271A						.						5.0	8.0	7.0					15																	100252747		1639	3328	4967	SO:0001583	missense	4205	exon11			AGCCGCCGCCACC		CCDS45362.1, CCDS45363.1, CCDS53978.1, CCDS58401.1	15q26	2008-02-05	2007-04-24			ENSG00000068305		"""Myocyte enhancer factors"""	6993	protein-coding gene	gene with protein product		600660				1516833	Standard	NM_005587		Approved	RSRFC4, RSRFC9	uc002bvf.3	Q02078		ENST00000557785.1:c.1265C>A	chr15.hg19:g.100252747C>A	ENSP00000453441:p.Pro422Gln	67.0	0.0		58.0	6.0	NM_005587	B4DFQ7|F6XG23|O43814|Q14223|Q14224|Q59GX4|Q7Z6C9|Q96D14	Missense_Mutation	SNP	ENST00000557785.1	hg19	CCDS53978.1	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.687083	0.00738	.	.	ENSG00000068305	ENST00000453228;ENST00000354410;ENST00000338042;ENST00000449277	T;T;T	0.59224	0.29;0.28;0.29	5.55	-1.61	0.08399	.	0.480375	0.14766	N	0.299691	T	0.49541	0.1563	N	0.22421	0.69	0.09310	N	1	P;B;B;B;P;B	0.46512	0.808;0.001;0.001;0.003;0.879;0.003	P;B;B;B;P;B	0.50934	0.452;0.002;0.002;0.012;0.654;0.012	T	0.50709	-0.8796	10	0.15952	T	0.53	.	16.1596	0.81693	0.653:0.347:0.0:0.0	.	432;362;343;422;424;430	Q02078;B4DFQ7;Q7Z6C9;Q02078-6;Q02078-5;Q02078-2	MEF2A_HUMAN;.;.;.;.;.	Q	422;424;431;362	ENSP00000404110:P422Q;ENSP00000346389:P424Q;ENSP00000337202:P431Q	ENSP00000337202:P431Q	P	+	2	0	MEF2A	98070270	0.993000	0.37304	0.000000	0.03702	0.015000	0.08874	0.872000	0.28037	-0.125000	0.11703	-0.516000	0.04426	CCG	.	.		0.637	MEF2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415985.1		
SRRM2	23524	hgsc.bcm.edu	37	16	2814150	2814150	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr16:2814150A>C	ENST00000301740.8	+	11	4170	c.3621A>C	c.(3619-3621)agA>agC	p.R1207S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1207	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						ACACACTTAGAACCCCGCCAA	0.458																																					p.R1207S		Atlas-SNP	.											.	SRRM2	263	.	0			c.A3621C						.						104.0	108.0	107.0					16																	2814150		2198	4300	6498	SO:0001583	missense	23524	exon11			ACTTAGAACCCCG	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3621A>C	chr16.hg19:g.2814150A>C	ENSP00000301740:p.Arg1207Ser	127.0	0.0		110.0	16.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	A	0.782	-0.762063	0.02996	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	D	0.92647	-3.08	5.82	4.71	0.59529	.	0.530522	0.19876	N	0.104093	D	0.86965	0.6060	L	0.40543	1.245	0.09310	N	1	B	0.13594	0.008	B	0.16722	0.016	T	0.78130	-0.2324	10	0.62326	D	0.03	-0.28	7.3106	0.26473	0.8734:0.0:0.1266:0.0	.	1207	Q9UQ35	SRRM2_HUMAN	S	1207;1207;459	ENSP00000301740:R1207S	ENSP00000301740:R1207S	R	+	3	2	SRRM2	2754151	0.000000	0.05858	0.018000	0.16275	0.010000	0.07245	0.332000	0.19751	2.228000	0.72767	0.533000	0.62120	AGA	.	.		0.458	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
SF3B3	23450	hgsc.bcm.edu	37	16	70562901	70562901	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr16:70562901A>G	ENST00000302516.5	+	3	407	c.196A>G	c.(196-198)Atg>Gtg	p.M66V	SNORD111B_ENST00000408587.1_RNA	NM_012426.4	NP_036558.3	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3, 130kDa	66					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|protein complex assembly (GO:0006461)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleic acid binding (GO:0003676)			breast(2)|endometrium(8)|kidney(2)|large_intestine(8)|liver(3)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	53		Ovarian(137;0.0694)				CCGGTCACTCATGGCCTTTAG	0.478																																					p.M66V		Atlas-SNP	.											.	SF3B3	99	.	0			c.A196G						.						134.0	118.0	123.0					16																	70562901		2198	4300	6498	SO:0001583	missense	23450	exon3			TCACTCATGGCCT	AJ001443	CCDS10894.1	16q22	2008-08-01	2002-08-29		ENSG00000189091	ENSG00000189091			10770	protein-coding gene	gene with protein product		605592	"""splicing factor 3b, subunit 3, 130kD"""			10490618	Standard	NM_012426		Approved	SAP130, SF3b130, RSE1, KIAA0017	uc002ezf.3	Q15393	OTTHUMG00000137582	ENST00000302516.5:c.196A>G	chr16.hg19:g.70562901A>G	ENSP00000305790:p.Met66Val	191.0	0.0		137.0	25.0	NM_012426	Q6NTI8|Q96GC0|Q9BPY2|Q9UFX7|Q9UJ29	Missense_Mutation	SNP	ENST00000302516.5	hg19	CCDS10894.1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.260243	0.39995	.	.	ENSG00000189091	ENST00000302516;ENST00000310750	T	0.05081	3.5	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.10937	0.0267	M	0.68317	2.08	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.02385	-1.1167	10	0.44086	T	0.13	.	15.7649	0.78117	1.0:0.0:0.0:0.0	.	66	Q15393	SF3B3_HUMAN	V	66	ENSP00000305790:M66V	ENSP00000305790:M66V	M	+	1	0	SF3B3	69120402	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	9.339000	0.96797	2.120000	0.65058	0.459000	0.35465	ATG	.	.		0.478	SF3B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268972.1	NM_012426	
PLCG2	5336	hgsc.bcm.edu	37	16	81922861	81922861	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr16:81922861T>A	ENST00000359376.3	+	10	1064	c.850T>A	c.(850-852)Ttc>Atc	p.F284I		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	284					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						TGCTGAGCCTTTCTTGTTTGT	0.448																																					p.F284I		Atlas-SNP	.											.	PLCG2	276	.	0			c.T850A						.						180.0	174.0	176.0					16																	81922861		2037	4196	6233	SO:0001583	missense	5336	exon10			GAGCCTTTCTTGT		CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.850T>A	chr16.hg19:g.81922861T>A	ENSP00000352336:p.Phe284Ile	119.0	0.0		102.0	22.0	NM_002661	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	ENST00000359376.3	hg19	CCDS42204.1	.	.	.	.	.	.	.	.	.	.	T	17.20	3.328517	0.60743	.	.	ENSG00000197943	ENST00000359376	T	0.29142	1.58	5.09	5.09	0.68999	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);	0.173944	0.52532	D	0.000068	T	0.24160	0.0585	L	0.27053	0.805	0.46631	D	0.999131	B;P	0.35656	0.079;0.514	B;B	0.35182	0.065;0.197	T	0.05084	-1.0907	10	0.42905	T	0.14	.	14.8381	0.70201	0.0:0.0:0.0:1.0	.	151;284	B4E3H3;P16885	.;PLCG2_HUMAN	I	284	ENSP00000352336:F284I	ENSP00000352336:F284I	F	+	1	0	PLCG2	80480362	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	5.440000	0.66563	2.046000	0.60703	0.460000	0.39030	TTC	.	.		0.448	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432429.1		
NLGN2	57555	hgsc.bcm.edu	37	17	7318376	7318376	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr17:7318376G>T	ENST00000302926.2	+	5	1019	c.946G>T	c.(946-948)Ggc>Tgc	p.G316C	NLGN2_ENST00000575301.1_Missense_Mutation_p.G316C	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	316					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				AGCCAAGGTGGGCTGTGACCG	0.652																																					p.G316C		Atlas-SNP	.											.	NLGN2	61	.	0			c.G946T						.						42.0	41.0	41.0					17																	7318376		2203	4300	6503	SO:0001583	missense	57555	exon5			AAGGTGGGCTGTG	AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.946G>T	chr17.hg19:g.7318376G>T	ENSP00000305288:p.Gly316Cys	98.0	0.0		94.0	39.0	NM_020795	Q9P2I1	Missense_Mutation	SNP	ENST00000302926.2	hg19	CCDS11103.1	.	.	.	.	.	.	.	.	.	.	G	18.45	3.625597	0.66901	.	.	ENSG00000169992	ENST00000302926	T	0.69306	-0.39	5.17	5.17	0.71159	Carboxylesterase, type B (1);	0.000000	0.85682	D	0.000000	D	0.87478	0.6187	H	0.96365	3.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.91035	0.4867	10	0.87932	D	0	.	16.2209	0.82257	0.0:0.0:1.0:0.0	.	316	Q8NFZ4	NLGN2_HUMAN	C	316	ENSP00000305288:G316C	ENSP00000305288:G316C	G	+	1	0	NLGN2	7259100	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.612000	0.74187	2.711000	0.92665	0.561000	0.74099	GGC	.	.		0.652	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226941.2	NM_020795	
TRIM16	10626	hgsc.bcm.edu	37	17	15539431	15539431	+	Silent	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr17:15539431C>T	ENST00000578237.1	-	8	1623	c.768G>A	c.(766-768)gaG>gaA	p.E256E	TRIM16_ENST00000581224.1_5'Flank|RP11-385D13.1_ENST00000455584.2_Silent_p.E256E|TRIM16_ENST00000577886.1_Silent_p.E40E|TRIM16_ENST00000416464.2_Silent_p.E126E|TRIM16_ENST00000336708.7_Silent_p.E256E|TRIM16_ENST00000579219.1_Silent_p.E40E			O95361	TRI16_HUMAN	tripartite motif containing 16	256					histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription, DNA-templated (GO:0045893)|response to growth hormone (GO:0060416)|response to organophosphorus (GO:0046683)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|PML body (GO:0016605)	DNA binding (GO:0003677)|interleukin-1 binding (GO:0019966)|NACHT domain binding (GO:0032089)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	19				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		CACTCCTGTACTCCAGGTGGG	0.592																																					p.E256E		Atlas-SNP	.											.	TRIM16	45	.	0			c.G768A						.						119.0	98.0	106.0					17																	15539431		2189	4298	6487	SO:0001819	synonymous_variant	10626	exon6			CCTGTACTCCAGG	AF096870	CCDS11171.1	17p11.2	2011-04-20	2011-01-25		ENSG00000221926	ENSG00000221926		"""Tripartite motif containing / Tripartite motif containing"""	17241	protein-coding gene	gene with protein product	"""estrogen-responsive B box protein"""	609505	"""tripartite motif-containing 16"""			11331580	Standard	NM_006470		Approved	EBBP	uc002gor.1	O95361	OTTHUMG00000059067	ENST00000578237.1:c.768G>A	chr17.hg19:g.15539431C>T		112.0	0.0		115.0	32.0	NM_006470	Q6IAL8|Q7Z6I2|Q96BE8|Q96J43	Silent	SNP	ENST00000578237.1	hg19	CCDS11171.1	.	.	.	.	.	.	.	.	.	.	c	8.498	0.863660	0.17250	.	.	ENSG00000251537	ENST00000455584	.	.	.	3.97	3.0	0.34707	.	.	.	.	.	T	0.58921	0.2156	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54957	-0.8215	4	.	.	.	.	9.4618	0.38789	0.0:0.8942:0.0:0.1058	.	.	.	.	N	271	.	.	S	-	2	0	RP11-385D13.1	15480156	1.000000	0.71417	0.991000	0.47740	0.878000	0.50629	2.227000	0.42972	1.034000	0.39945	0.555000	0.69702	AGT	.	.		0.592	TRIM16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130700.2	NM_006470	
HOXB2	3212	hgsc.bcm.edu	37	17	46620510	46620510	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr17:46620510C>A	ENST00000330070.4	-	2	2158	c.991G>T	c.(991-993)Gac>Tac	p.D331Y	HOXB2_ENST00000504772.3_5'Flank|HOXB-AS1_ENST00000508688.1_RNA|HOXB-AS1_ENST00000504972.3_RNA|HOXB-AS1_ENST00000435312.1_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	331					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						ACCGGGCTGTCGAGAGAACCC	0.582																																					p.D331Y		Atlas-SNP	.											.	HOXB2	23	.	0			c.G991T						.						75.0	79.0	78.0					17																	46620510		2203	4300	6503	SO:0001583	missense	3212	exon2			GGCTGTCGAGAGA		CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.991G>T	chr17.hg19:g.46620510C>A	ENSP00000331741:p.Asp331Tyr	79.0	0.0		83.0	13.0	NM_002145	P10913|P17485	Missense_Mutation	SNP	ENST00000330070.4	hg19	CCDS11527.1	.	.	.	.	.	.	.	.	.	.	C	15.04	2.715097	0.48622	.	.	ENSG00000173917	ENST00000330070	T	0.11930	2.73	5.49	2.39	0.29439	.	0.107197	0.64402	D	0.000009	T	0.13628	0.0330	L	0.42245	1.32	0.48185	D	0.999601	P	0.44776	0.843	P	0.44673	0.457	T	0.02320	-1.1177	10	0.87932	D	0	.	7.0379	0.25002	0.0:0.5886:0.2665:0.1449	.	331	P14652	HXB2_HUMAN	Y	331	ENSP00000331741:D331Y	ENSP00000331741:D331Y	D	-	1	0	HOXB2	43975509	0.938000	0.31826	0.125000	0.21846	0.659000	0.38960	1.988000	0.40697	0.279000	0.22186	0.655000	0.94253	GAC	.	.		0.582	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358384.2		
CASKIN2	57513	hgsc.bcm.edu	37	17	73501979	73501979	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr17:73501979T>C	ENST00000321617.3	-	9	1344	c.758A>G	c.(757-759)tAt>tGt	p.Y253C	CASKIN2_ENST00000433559.2_Missense_Mutation_p.Y171C|CASKIN2_ENST00000581870.1_Missense_Mutation_p.Y253C	NM_020753.3	NP_065804.2	Q8WXE0	CSKI2_HUMAN	CASK interacting protein 2	253						cytoplasm (GO:0005737)				endometrium(1)|kidney(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CGTCTGGTTATACGTATTCCG	0.572																																					p.P253R		Atlas-SNP	.											.	CASKIN2	66	.	0			c.C758G						.						132.0	105.0	114.0					17																	73501979		2202	4299	6501	SO:0001583	missense	57513	exon9			TGGTTATACGTAT	AB032965	CCDS11723.1, CCDS45775.1	17q25.1	2014-09-04			ENSG00000177303	ENSG00000177303		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	18200	protein-coding gene	gene with protein product		612185				12040031	Standard	NM_020753		Approved	KIAA1139, FLJ21609, ANKS5B	uc002joc.4	Q8WXE0	OTTHUMG00000179683	ENST00000321617.3:c.758A>G	chr17.hg19:g.73501979T>C	ENSP00000325355:p.Tyr253Cys	39.0	0.0		59.0	16.0	NM_020753	B4DTT3|B7Z9H1|Q7LG69|Q9ULT1	Missense_Mutation	SNP	ENST00000321617.3	hg19	CCDS11723.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.449017	0.84101	.	.	ENSG00000177303	ENST00000321617;ENST00000433559	T;T	0.53857	0.6;0.6	5.53	5.53	0.82687	Ankyrin repeat-containing domain (3);	0.000000	0.42294	D	0.000730	T	0.63260	0.2496	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.995	T	0.65335	-0.6193	10	0.54805	T	0.06	.	15.6478	0.77068	0.0:0.0:0.0:1.0	.	171;253	Q8WXE0-2;Q8WXE0	.;CSKI2_HUMAN	C	253;171	ENSP00000325355:Y253C;ENSP00000406963:Y171C	ENSP00000325355:Y253C	Y	-	2	0	CASKIN2	71013574	1.000000	0.71417	0.130000	0.21974	0.592000	0.36648	7.945000	0.87732	2.100000	0.63781	0.533000	0.62120	TAT	.	.		0.572	CASKIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447609.1	NM_020753	
FBF1	85302	hgsc.bcm.edu	37	17	73922395	73922395	+	Silent	SNP	T	T	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr17:73922395T>C	ENST00000586717.1	-	10	939	c.666A>G	c.(664-666)aaA>aaG	p.K222K	FBF1_ENST00000319129.5_Silent_p.K222K|FBF1_ENST00000389570.4_Silent_p.K222K			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	222					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						TCTTCTCTGCTTTGGGGCTGT	0.532																																					p.K222K		Atlas-SNP	.											.	FBF1	48	.	0			c.A666G						.						33.0	35.0	35.0					17																	73922395		1931	4133	6064	SO:0001819	synonymous_variant	85302	exon10			CTCTGCTTTGGGG	AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.666A>G	chr17.hg19:g.73922395T>C		31.0	0.0		49.0	6.0	NM_001080542	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Silent	SNP	ENST00000586717.1	hg19																																																																																				.	.		0.532	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000448945.2	NM_001080542	
NEDD4L	23327	hgsc.bcm.edu	37	18	56001068	56001068	+	Silent	SNP	A	A	C			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr18:56001068A>C	ENST00000400345.3	+	12	1292	c.1009A>C	c.(1009-1011)Agg>Cgg	p.R337R	NEDD4L_ENST00000256832.7_Silent_p.R216R|NEDD4L_ENST00000356462.6_Silent_p.R337R|NEDD4L_ENST00000382850.4_Silent_p.R337R|NEDD4L_ENST00000456986.1_Silent_p.R216R|NEDD4L_ENST00000357895.5_Silent_p.R329R|NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000586263.1_Silent_p.R329R|NEDD4L_ENST00000435432.2_Silent_p.R216R|NEDD4L_ENST00000256830.9_Silent_p.R337R|NEDD4L_ENST00000431212.2_Silent_p.R216R|NEDD4L_ENST00000456173.2_Silent_p.R216R	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	337					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						ACCCTCCTCAAGGTTGAGGTC	0.438																																					p.R337R		Atlas-SNP	.											.	NEDD4L	126	.	0			c.A1009C						.						100.0	97.0	98.0					18																	56001068		1947	4144	6091	SO:0001819	synonymous_variant	23327	exon12			TCCTCAAGGTTGA	AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1009A>C	chr18.hg19:g.56001068A>C		97.0	0.0		91.0	15.0	NM_015277	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Silent	SNP	ENST00000400345.3	hg19	CCDS45872.1																																																																																			.	.		0.438	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000448749.1		
FBN3	84467	hgsc.bcm.edu	37	19	8196669	8196669	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr19:8196669A>G	ENST00000600128.1	-	15	2173	c.1759T>C	c.(1759-1761)Tgt>Cgt	p.C587R	FBN3_ENST00000601739.1_Missense_Mutation_p.C587R|FBN3_ENST00000270509.2_Missense_Mutation_p.C587R			Q75N90	FBN3_HUMAN	fibrillin 3	587	EGF-like 7; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						GTGTTGGTACAGTGGCCGTTC	0.677																																					p.C587R		Atlas-SNP	.											.	FBN3	300	.	0			c.T1759C						.						24.0	25.0	25.0					19																	8196669		2202	4300	6502	SO:0001583	missense	84467	exon14			TGGTACAGTGGCC		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.1759T>C	chr19.hg19:g.8196669A>G	ENSP00000470498:p.Cys587Arg	57.0	0.0		76.0	14.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	ENST00000600128.1	hg19	CCDS12196.1	.	.	.	.	.	.	.	.	.	.	a	12.93	2.085061	0.36758	.	.	ENSG00000142449	ENST00000270509	D	0.99445	-5.91	2.92	2.92	0.33932	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.99764	0.9904	H	0.99777	4.77	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.97189	0.9856	10	0.87932	D	0	.	10.9744	0.47456	1.0:0.0:0.0:0.0	.	587	Q75N90	FBN3_HUMAN	R	587	ENSP00000270509:C587R	ENSP00000270509:C587R	C	-	1	0	FBN3	8102669	1.000000	0.71417	0.306000	0.25113	0.030000	0.12068	7.956000	0.87863	0.961000	0.38030	0.155000	0.16302	TGT	.	.		0.677	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
HAPLN4	404037	hgsc.bcm.edu	37	19	19369378	19369378	+	Silent	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr19:19369378G>A	ENST00000291481.7	-	4	834	c.771C>T	c.(769-771)aaC>aaT	p.N257N	AC138430.4_ENST00000586064.2_RNA	NM_023002.2	NP_075378.1	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4	257	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323, ECO:0000305}.				cell adhesion (GO:0007155)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)	16			Epithelial(12;0.00575)		Hyaluronan(DB08818)	GTTCCTCGGCGTTATGGCGAT	0.701																																					p.N257N		Atlas-SNP	.											.	HAPLN4	44	.	0			c.C771T						.						76.0	62.0	67.0					19																	19369378		2203	4300	6503	SO:0001819	synonymous_variant	404037	exon4			CTCGGCGTTATGG	AB107883	CCDS12398.1	19p13.1	2013-01-11						"""Immunoglobulin superfamily / V-set domain containing"""	31357	protein-coding gene	gene with protein product	"""brain link protein 2"""					12663660	Standard	NM_023002		Approved	BRAL2, KIAA1926	uc002nmb.3	Q86UW8		ENST00000291481.7:c.771C>T	chr19.hg19:g.19369378G>A		89.0	0.0		85.0	33.0	NM_023002	A5PKW5|Q96PW2	Silent	SNP	ENST00000291481.7	hg19	CCDS12398.1																																																																																			.	.		0.701	HAPLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460117.2	NM_023002	
PNMAL1	55228	hgsc.bcm.edu	37	19	46974172	46974172	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr19:46974172C>T	ENST00000313683.10	-	2	426	c.121G>A	c.(121-123)Gag>Aag	p.E41K	PNMAL1_ENST00000602246.1_Missense_Mutation_p.E41K|PNMAL1_ENST00000438932.2_Missense_Mutation_p.E41K	NM_001103149.1|NM_018215.3	NP_001096619.1|NP_060685.2	Q86V59	PNML1_HUMAN	paraneoplastic Ma antigen family-like 1	41										cervix(1)|endometrium(2)|large_intestine(8)|lung(8)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000166)|all cancers(93;0.0014)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		ttcaaggtctcctcaatttct	0.542																																					p.E41K		Atlas-SNP	.											PNMAL1_ENST00000438932,caecum,carcinoma,+2,2	PNMAL1	87	.	0			c.G121A						.						81.0	68.0	72.0					19																	46974172		2203	4300	6503	SO:0001583	missense	55228	exon2			AGGTCTCCTCAAT	BC026026	CCDS33059.1, CCDS46124.1	19q13.32	2014-02-12	2012-02-09			ENSG00000182013		"""Paraneoplastic Ma antigens"""	25578	protein-coding gene	gene with protein product			"""PNMA-like 1"""			12477932	Standard	NM_018215		Approved	KIAA1183L, FLJ10781	uc002peq.4	Q86V59		ENST00000313683.10:c.121G>A	chr19.hg19:g.46974172C>T	ENSP00000318131:p.Glu41Lys	48.0	0.0		61.0	14.0	NM_018215	A8K2F3|Q5U638|Q8N3H4|Q9NVE8	Missense_Mutation	SNP	ENST00000313683.10	hg19	CCDS33059.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.611023	0.87258	.	.	ENSG00000182013	ENST00000438932;ENST00000313683;ENST00000417103	T;T	0.14516	2.5;2.5	3.94	3.94	0.45596	.	0.000000	0.41396	D	0.000895	T	0.33818	0.0876	M	0.72353	2.195	0.35297	D	0.782704	D;P	0.89917	1.0;0.746	D;B	0.83275	0.996;0.385	T	0.41752	-0.9491	10	0.56958	D	0.05	-20.0036	11.7787	0.52001	0.0:1.0:0.0:0.0	.	41;41	Q86V59-2;Q86V59	.;PNML1_HUMAN	K	41	ENSP00000410273:E41K;ENSP00000318131:E41K	ENSP00000318131:E41K	E	-	1	0	PNMAL1	51666012	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.004000	0.40854	2.491000	0.84063	0.655000	0.94253	GAG	.	.		0.542	PNMAL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000403929.1	NM_018215	
GRIK1	2897	hgsc.bcm.edu	37	21	30968882	30968882	+	Silent	SNP	G	G	T	rs374777692		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr21:30968882G>T	ENST00000399907.1	-	9	1626	c.1215C>A	c.(1213-1215)ggC>ggA	p.G405G	GRIK1_ENST00000327783.4_Silent_p.G405G|GRIK1-AS2_ENST00000333765.4_3'UTR|GRIK1_ENST00000535441.1_Silent_p.G407G|GRIK1_ENST00000472429.1_5'Flank|GRIK1_ENST00000389125.3_Intron|GRIK1_ENST00000399909.1_Intron|GRIK1_ENST00000399914.1_Intron|GRIK1_ENST00000399913.1_Silent_p.G405G|BACH1_ENST00000462262.1_3'UTR|GRIK1_ENST00000389124.2_Silent_p.G405G|GRIK1_ENST00000309434.7_Silent_p.G407G	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	405					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	TAGACACTTCGCCAGCAGCCT	0.428																																					p.G405G		Atlas-SNP	.											.	GRIK1	293	.	0			c.C1215A						.						125.0	124.0	124.0					21																	30968882		1858	4097	5955	SO:0001819	synonymous_variant	2897	exon9			CACTTCGCCAGCA		CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1215C>A	chr21.hg19:g.30968882G>T		68.0	0.0		63.0	10.0	NM_000830	Q13001|Q86SU9	Silent	SNP	ENST00000399907.1	hg19	CCDS42913.1																																																																																			.	.		0.428	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171979.1		
CSNK1E	1454	hgsc.bcm.edu	37	22	38694819	38694819	+	Missense_Mutation	SNP	T	T	C	rs11548926		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr22:38694819T>C	ENST00000396832.1	-	7	1117	c.857A>G	c.(856-858)tAc>tGc	p.Y286C	CSNK1E_ENST00000359867.3_Missense_Mutation_p.Y286C|CSNK1E_ENST00000413574.2_Missense_Mutation_p.Y286C|CSNK1E_ENST00000405675.3_Missense_Mutation_p.Y286C|CSNK1E_ENST00000403904.1_Missense_Mutation_p.Y286C|CSNK1E_ENST00000498529.1_5'UTR|CSNK1E_ENST00000400206.2_Missense_Mutation_p.Y286C	NM_152221.2	NP_689407.1	P49674	KC1E_HUMAN	casein kinase 1, epsilon	286					cellular protein localization (GO:0034613)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|signal transduction (GO:0007165)	cytosol (GO:0005829)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Melanoma(58;0.045)					GTCAAAGACGTAGTCATAGGA	0.582											OREG0026559	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y286C	Esophageal Squamous(119;108 755 9651 12170 13692 17603 24932 28315 37982 41601)	Atlas-SNP	.											.	CSNK1E	143	.	0			c.A857G						.						140.0	135.0	137.0					22																	38694819		2203	4300	6503	SO:0001583	missense	1454	exon7			AAGACGTAGTCAT		CCDS13970.1	22q13.1	2013-01-17			ENSG00000213923	ENSG00000213923			2453	protein-coding gene	gene with protein product		600863				7797465, 10535959	Standard	NM_001894		Approved	HCKIE, CKIE, CKIepsilon	uc003avk.3	P49674	OTTHUMG00000151135	ENST00000396832.1:c.857A>G	chr22.hg19:g.38694819T>C	ENSP00000380044:p.Tyr286Cys	85.0	0.0	880	105.0	14.0	NM_001894		Missense_Mutation	SNP	ENST00000396832.1	hg19	CCDS13970.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.38|16.38	3.106279|3.106279	0.56291|0.56291	.|.	.|.	ENSG00000213923|ENSG00000213923	ENST00000451964|ENST00000359867;ENST00000396832;ENST00000402865;ENST00000400206;ENST00000403904;ENST00000413574;ENST00000405675	.|T;T;T;T;T;T	.|0.10477	.|2.87;2.87;2.87;2.87;2.87;2.87	5.14|5.14	4.09|4.09	0.47781|0.47781	.|Protein kinase-like domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.25568|0.25568	0.0622|0.0622	L|L	0.57536|0.57536	1.79|1.79	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|0.997;1.0;1.0	.|P;D;D	.|0.64877	.|0.739;0.93;0.922	T|T	0.00536|0.00536	-1.1683|-1.1683	5|10	.|0.87932	.|D	.|0	.|.	11.3274|11.3274	0.49456|0.49456	0.1362:0.0:0.0:0.8638|0.1362:0.0:0.0:0.8638	rs11548926;rs11548926|rs11548926;rs11548926	.|286;286;286	.|B0QY35;B0QY34;P49674	.|.;.;KC1E_HUMAN	A|C	224|286	.|ENSP00000352929:Y286C;ENSP00000380044:Y286C;ENSP00000383067:Y286C;ENSP00000384074:Y286C;ENSP00000407235:Y286C;ENSP00000384426:Y286C	.|ENSP00000352929:Y286C	T|Y	-|-	1|2	0|0	CSNK1E|CSNK1E	37024765|37024765	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.977000|0.977000	0.68977|0.68977	8.028000|8.028000	0.88798|0.88798	0.785000|0.785000	0.33685|0.33685	0.533000|0.533000	0.62120|0.62120	ACG|TAC	.	T|1.000;|0.000		0.582	CSNK1E-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321462.1	NM_001894	
MT-ND6	4541	hgsc.bcm.edu	37	M	14607	14607	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chrM:14607G>A	ENST00000361681.2	-	1	66	c.67C>T	c.(67-69)Cct>Tct	p.P23S	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03923	NU6M_HUMAN	mitochondrially encoded NADH dehydrogenase 6	23					cellular metabolic process (GO:0044237)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain (GO:0070469)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(10)|kidney(17)|urinary_tract(1)	29						AATAGGAGAAGGCTTAGAAGA	0.408																																					p.P23S		Atlas-SNP	.											.	.	.	.	0			c.C67T						.																																			SO:0001583	missense	0	exon1			GAGAAGGCTTAGA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198695	ENSG00000198695	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7462	protein-coding gene	gene with protein product	"""complex I ND6 subunit"", ""NADH-ubiquinone oxidoreductase chain 6"""	516006	"""NADH dehydrogenase 6"""	MTND6			Standard			Approved	NAD6, ND6		P03923		ENST00000361681.2:c.67C>T	chrM.hg19:g.14607G>A	ENSP00000354665:p.Pro23Ser	172.0	1.0		417.0	349.0	ENST00000361681	Q34774|Q8HG30	Missense_Mutation	SNP	ENST00000361681.2	hg19																																																																																				.	.		0.408	MT-ND6-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024037	
KRT2	3849	hgsc.bcm.edu	37	12	53045630	53045631	+	In_Frame_Ins	INS	-	-	CCGCCTCCAAAGCCGCTG			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr12:53045630_53045631insCCGCCTCCAAAGCCGCTG	ENST00000309680.3	-	1	317_318	c.296_297insCAGCGGCTTTGGAGGCGG	c.(295-297)ggc>ggCAGCGGCTTTGGAGGCGGc	p.99_99G>GSGFGGG		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	99	Head.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		caaagctgctgccgcctccaaa	0.619																																					p.G99delinsGSGFGGG		Atlas-INDEL	.											.	KRT2	94	.	0			c.297_298insCAGCGGCTTTGGAGGCGG						.																																			SO:0001652	inframe_insertion	3849	exon1			.		CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.296_297insCAGCGGCTTTGGAGGCGG	chr12.hg19:g.53045630_53045631insCCGCCTCCAAAGCCGCTG	Exception_encountered	210.0	0.0		181.0	23.0	NM_000423	Q4VAQ2	In_Frame_Ins	INS	ENST00000309680.3	hg19	CCDS8835.1																																																																																			.	.		0.619	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405704.1	NM_000423	
CHST10	9486	hgsc.bcm.edu	37	2	101019079	101019080	+	Frame_Shift_Ins	INS	-	-	GG			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:101019079_101019080insGG	ENST00000264249.3	-	4	523_524	c.138_139insCC	c.(136-141)accatgfs	p.M47fs	CHST10_ENST00000409701.1_Frame_Shift_Ins_p.M47fs|CHST10_ENST00000542617.1_Frame_Shift_Ins_p.M95fs	NM_004854.4	NP_004845.1	O43529	CHSTA_HUMAN	carbohydrate sulfotransferase 10	47					carbohydrate biosynthetic process (GO:0016051)|cell adhesion (GO:0007155)|learning (GO:0007612)|long-term memory (GO:0007616)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	HNK-1 sulfotransferase activity (GO:0016232)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)	16						ACTTCCGGCATGGTTGTCAGGA	0.525																																					p.M47fs		Atlas-INDEL	.											.	CHST10	42	.	0			c.139_140insCC						.																																			SO:0001589	frameshift_variant	9486	exon4			.	BC010441	CCDS2047.1	2q11.2	2008-02-05			ENSG00000115526	ENSG00000115526		"""Sulfotransferases, membrane-bound"""	19650	protein-coding gene	gene with protein product		606376				12080076	Standard	NM_004854		Approved	HNK-1ST	uc002tam.3	O43529	OTTHUMG00000130669	ENST00000264249.3:c.137_138dupCC	chr2.hg19:g.101019080_101019081dupGG	ENSP00000264249:p.Met47fs	50.0	0.0		52.0	12.0	NM_004854	Q53T18	Frame_Shift_Ins	INS	ENST00000264249.3	hg19	CCDS2047.1																																																																																			.	.		0.525	CHST10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253162.1	NM_004854	
CCDC17	149483	hgsc.bcm.edu	37	1	46088424	46088429	+	Splice_Site	DEL	GGATTT	GGATTT	-	rs143656439		TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	GGATTT	GGATTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr1:46088424_46088429delGGATTT	ENST00000528266.1	-	5	881_886	c.734_739delAAATCC	c.(733-741)gaaatccgg>ggg	p.245_247EIR>G	CCDC17_ENST00000343901.2_Splice_Site_p.213_215EIR>G|CCDC17_ENST00000445048.2_Intron|CCDC17_ENST00000464739.1_5'UTR|CCDC17_ENST00000421127.2_Splice_Site_p.236_238EIR>G			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	245										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					GGCTCTCACCGGATTTCGGCAGCCAG	0.655																																					p.245_247del		Atlas-INDEL	.											.	CCDC17	54	.	0			c.735_740del						.																																			SO:0001630	splice_region_variant	149483	exon5			.		CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.740+1AAATCC>-	chr1.hg19:g.46088424_46088429delGGATTT		187.0	0.0		127.0	14.0	NM_001114938	A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	In_Frame_Del	DEL	ENST00000528266.1	hg19	CCDS44131.2																																																																																			.	.		0.655	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386833.1	NM_152500	In_Frame_Del
ING5	84289	hgsc.bcm.edu	37	2	242662681	242662681	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr2:242662681delA	ENST00000313552.6	+	7	701	c.675delA	c.(673-675)ggafs	p.G225fs	AC114730.11_ENST00000435195.1_RNA|ING5_ENST00000406941.1_Frame_Shift_Del_p.G225fs	NM_032329.4	NP_115705.2	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5	225					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|skin(1)	3		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		AACCCAAAGGAAAATGGTGAG	0.542																																					p.G225fs		Atlas-INDEL	.											.	ING5	14	.	0			c.674delG						.						208.0	216.0	213.0					2																	242662681		2203	4300	6503	SO:0001589	frameshift_variant	84289	exon7			.	AF189286	CCDS33425.1	2q37.3	2013-01-28			ENSG00000168395	ENSG00000168395		"""Zinc fingers, PHD-type"""	19421	protein-coding gene	gene with protein product		608525				12750254	Standard	NM_032329		Approved	FLJ23842, p28ING5	uc002wcd.3	Q8WYH8	OTTHUMG00000151501	ENST00000313552.6:c.675delA	chr2.hg19:g.242662681delA	ENSP00000322142:p.Gly225fs	134.0	0.0		126.0	38.0	NM_032329	A8K1P3|Q53NU6|Q57Z54|Q9BS30	Frame_Shift_Del	DEL	ENST00000313552.6	hg19	CCDS33425.1																																																																																			.	.		0.542	ING5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322901.3	NM_032329	
SYCP2	10388	hgsc.bcm.edu	37	20	58470629	58470631	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	TTC	TTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr20:58470629_58470631delTTC	ENST00000357552.3	-	20	1751_1753	c.1526_1528delGAA	c.(1525-1530)agaatt>att	p.R509del	SYCP2_ENST00000371001.2_In_Frame_Del_p.R509del			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	509					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.R509K(1)		NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GGTGGTTTAATTCTTCTTCTTCG	0.374																																					p.509_510del		Atlas-INDEL	.											.	SYCP2	204	.	1	Substitution - Missense(1)	NS(1)	c.1527_1529del						.			1,4263		0,1,2131						-3.3	0.5			191	2,8252		0,2,4125	no	coding	SYCP2	NM_014258.2		0,3,6256	A1A1,A1R,RR		0.0242,0.0235,0.024				3,12515				SO:0001651	inframe_deletion	10388	exon19			.	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1526_1528delGAA	chr20.hg19:g.58470638_58470640delTTC	ENSP00000350162:p.Arg509del	129.0	0.0		118.0	12.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	In_Frame_Del	DEL	ENST00000357552.3	hg19	CCDS13482.1																																																																																			.	.		0.374	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
PTPN9	5780	hgsc.bcm.edu	37	15	75798259	75798283	+	Frame_Shift_Del	DEL	TCAATTTTGACGTACCCACCCAGGT	TCAATTTTGACGTACCCACCCAGGT	-	rs371087693|rs551948447|rs530559093	byFrequency	TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	TCAATTTTGACGTACCCACCCAGGT	TCAATTTTGACGTACCCACCCAGGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr15:75798259_75798283delTCAATTTTGACGTACCCACCCAGGT	ENST00000306726.2	-	7	1213_1237	c.701_725delACCTGGGTGGGTACGTCAAAATTGA	c.(700-726)aacctgggtgggtacgtcaaaattgatfs	p.NLGGYVKID234fs	PTPN9_ENST00000564970.1_5'Flank	NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	234	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGTGGCGAGATCAATTTTGACGTACCCACCCAGGTTTTCTGGAAG	0.502																																					p.234_242del		Atlas-INDEL	.											.	PTPN9	53	.	0			c.702_726del						.																																			SO:0001589	frameshift_variant	5780	exon7			.		CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.701_725delACCTGGGTGGGTACGTCAAAATTGA	chr15.hg19:g.75798259_75798283delTCAATTTTGACGTACCCACCCAGGT	ENSP00000303554:p.Asn234fs	163.0	0.0		175.0	12.0	NM_002833	Q53XR9	Frame_Shift_Del	DEL	ENST00000306726.2	hg19	CCDS10280.1																																																																																			.	.		0.502	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286474.1		
TAB2	23118	hgsc.bcm.edu	37	6	149699603	149699604	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAEK-01A-11D-A40R-10	TCGA-DD-AAEK-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d0714057-ac5a-402f-b552-a914b5564c0c	4037ad92-fc4e-4737-8fb7-e3c276624c39	g.chr6:149699603_149699604insA	ENST00000367456.1	+	4	1129_1130	c.552_553insA	c.(553-555)atcfs	p.I185fs	TAB2_ENST00000392282.1_Frame_Shift_Ins_p.I185fs|TAB2_ENST00000538427.1_Frame_Shift_Ins_p.I185fs|TAB2_ENST00000536230.1_Frame_Shift_Ins_p.I153fs|TAB2_ENST00000286332.5_Frame_Shift_Ins_p.I185fs			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	185					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						TAGCCCCAAATATCCAGACTGG	0.416																																					p.N184fs		Atlas-INDEL	.											.	TAB2	55	.	0			c.552_553insA						.																																			SO:0001589	frameshift_variant	23118	exon5			.	AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.553dupA	chr6.hg19:g.149699604_149699604dupA	ENSP00000356426:p.Ile185fs	85.0	0.0		56.0	18.0	NM_015093	B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Frame_Shift_Ins	INS	ENST00000367456.1	hg19	CCDS5214.1																																																																																			.	.		0.416	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042633.3		
