#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM88B	643965	hgsc.bcm.edu	37	1	1361567	1361567	+	Silent	SNP	A	A	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:1361567A>T	ENST00000378821.3	+	1	60	c.60A>T	c.(58-60)acA>acT	p.T20T		NM_001146685.1	NP_001140157.1	A6NKF7	TM88B_HUMAN	transmembrane protein 88B	20						integral component of membrane (GO:0016021)											CTTCCGACACAGCGCCCATGC	0.736																																					p.T20T		Atlas-SNP	.											.	.	.	.	0			c.A60T						.						16.0	25.0	22.0					1																	1361567		686	1586	2272	SO:0001819	synonymous_variant	643965	exon1			CGACACAGCGCCC		CCDS57964.1	1p36.33	2013-01-16			ENSG00000205116	ENSG00000205116			37099	protein-coding gene	gene with protein product							Standard	NM_001146685		Approved		uc010nyp.2	A6NKF7	OTTHUMG00000153395	ENST00000378821.3:c.60A>T	chr1.hg19:g.1361567A>T		136.0	0.0		80.0	29.0	NM_001146685		Silent	SNP	ENST00000378821.3	hg19	CCDS57964.1																																																																																			.	.		0.736	TMEM88B-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331012.2	NM_001146685	
CSF3R	1441	hgsc.bcm.edu	37	1	36937988	36937988	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:36937988C>T	ENST00000373106.1	-	8	1395	c.848G>A	c.(847-849)gGc>gAc	p.G283D	CSF3R_ENST00000331941.5_Missense_Mutation_p.G283D|CSF3R_ENST00000487540.2_5'UTR|CSF3R_ENST00000361632.4_Missense_Mutation_p.G283D|CSF3R_ENST00000373104.1_Missense_Mutation_p.G283D|CSF3R_ENST00000373103.1_Missense_Mutation_p.G283D|CSF3R_ENST00000338937.5_Missense_Mutation_p.G283D|CSF3R_ENST00000418048.2_Missense_Mutation_p.G283D|CSF3R_ENST00000440588.2_Missense_Mutation_p.G283D	NM_000760.3	NP_000751.1	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor (granulocyte)	283	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|defense response (GO:0006952)|neutrophil chemotaxis (GO:0030593)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	GGGGAGGGGGCCCACCTGGTG	0.682																																					p.G283D		Atlas-SNP	.											.	CSF3R	157	.	0			c.G848A						.						25.0	29.0	28.0					1																	36937988		2201	4294	6495	SO:0001583	missense	1441	exon8			AGGGGGCCCACCT	M59820	CCDS412.1, CCDS413.1, CCDS414.1	1p35-p34.3	2014-09-17			ENSG00000119535	ENSG00000119535		"""CD molecules"", ""Fibronectin type III domain containing"""	2439	protein-coding gene	gene with protein product		138971		CD114		1371413	Standard	NM_000760		Approved	GCSFR	uc001cax.2	Q99062	OTTHUMG00000008010	ENST00000373106.1:c.848G>A	chr1.hg19:g.36937988C>T	ENSP00000362198:p.Gly283Asp	53.0	0.0		46.0	9.0	NM_156039		Missense_Mutation	SNP	ENST00000373106.1	hg19	CCDS413.1	.	.	.	.	.	.	.	.	.	.	C	4.946	0.175825	0.09443	.	.	ENSG00000119535	ENST00000373106;ENST00000373104;ENST00000373103;ENST00000361632;ENST00000331941;ENST00000418048;ENST00000338937;ENST00000440588	T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	4.02	-3.66	0.04489	Fibronectin, type III (3);Immunoglobulin-like fold (1);	2.017800	0.01587	N	0.021342	T	0.33760	0.0874	L	0.40543	1.245	0.09310	N	1	P;P;P;B	0.41947	0.766;0.664;0.534;0.379	B;B;B;B	0.32211	0.142;0.095;0.047;0.082	T	0.26189	-1.0110	10	0.13108	T	0.6	-0.0929	5.3844	0.16211	0.1783:0.2865:0.4562:0.0789	.	283;283;283;283	E1B6W6;Q99062-3;Q99062;Q99062-4	.;.;CSF3R_HUMAN;.	D	283	ENSP00000362198:G283D;ENSP00000362196:G283D;ENSP00000362195:G283D;ENSP00000355406:G283D;ENSP00000332180:G283D;ENSP00000401588:G283D;ENSP00000345013:G283D;ENSP00000397568:G283D	ENSP00000332180:G283D	G	-	2	0	CSF3R	36710575	0.000000	0.05858	0.017000	0.16124	0.034000	0.12701	-0.100000	0.10990	-0.709000	0.05008	0.655000	0.94253	GGC	.	.		0.682	CSF3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021997.2	NM_156039	
PTCH2	8643	hgsc.bcm.edu	37	1	45288095	45288095	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:45288095T>C	ENST00000372192.3	-	22	3734	c.3604A>G	c.(3604-3606)Act>Gct	p.T1202A	PTCH2_ENST00000447098.2_Intron|RNU5E-6P_ENST00000365574.1_RNA	NM_003738.4	NP_003729.3	Q9Y6C5	PTC2_HUMAN	patched 2	1202					epidermis development (GO:0008544)|hair cycle (GO:0042633)|negative regulation of smoothened signaling pathway (GO:0045879)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	hedgehog family protein binding (GO:0097108)|hedgehog receptor activity (GO:0008158)|smoothened binding (GO:0005119)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	50	Acute lymphoblastic leukemia(166;0.155)					TTTCACCCAGTGGCTGGACCT	0.622									Basal Cell Nevus syndrome																												p.T1202A		Atlas-SNP	.											.	PTCH2	96	.	0			c.A3604G						.						44.0	48.0	47.0					1																	45288095		2203	4300	6503	SO:0001583	missense	8643	exon22	Familial Cancer Database	Gorlin syndrome, Gorlin-Golz syndrome, Naevoid Basal Cell Carcinoma syndrome, NBCCS	ACCCAGTGGCTGG	AF091501	CCDS516.1, CCDS53312.1	1p34.1	2010-06-24	2010-06-24		ENSG00000117425	ENSG00000117425			9586	protein-coding gene	gene with protein product		603673	"""patched (Drosophila) homolog 2"", ""patched homolog 2 (Drosophila)"""			9811851, 9931336	Standard	NM_003738		Approved		uc010olf.2	Q9Y6C5	OTTHUMG00000008490	ENST00000372192.3:c.3604A>G	chr1.hg19:g.45288095T>C	ENSP00000361266:p.Thr1202Ala	49.0	0.0		32.0	10.0	NM_003738	O95341|O95856|Q53Z57|Q5QP87|Q6UX14	Missense_Mutation	SNP	ENST00000372192.3	hg19	CCDS516.1	.	.	.	.	.	.	.	.	.	.	t	17.42	3.383974	0.61845	.	.	ENSG00000117425	ENST00000372192	D	0.92199	-2.99	4.96	0.975	0.19721	.	1.395140	0.05215	N	0.507480	D	0.82995	0.5158	N	0.08118	0	0.09310	N	1	B	0.18461	0.028	B	0.16722	0.016	T	0.72697	-0.4215	10	0.87932	D	0	-0.5648	5.8512	0.18694	0.1591:0.0:0.3301:0.5108	.	1202	Q9Y6C5	PTC2_HUMAN	A	1202	ENSP00000361266:T1202A	ENSP00000361266:T1202A	T	-	1	0	PTCH2	45060682	0.111000	0.22076	0.006000	0.13384	0.400000	0.30750	0.415000	0.21181	0.338000	0.23692	0.451000	0.29950	ACT	.	.		0.622	PTCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023428.4	NM_003738	
SIKE1	80143	hgsc.bcm.edu	37	1	115318966	115318966	+	Splice_Site	SNP	C	C	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:115318966C>G	ENST00000060969.5	-	4	592		c.e4+1		SIKE1_ENST00000506320.1_5'Flank|SIKE1_ENST00000369528.5_Splice_Site			Q9BRV8	SIKE1_HUMAN	suppressor of IKBKE 1						innate immune response (GO:0045087)	cytosol (GO:0005829)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)	6						TACAATCTTACCTCTAATTGG	0.373																																					.		Atlas-SNP	.											SIKE1,bladder,carcinoma,0,1	SIKE1	12	.	0			c.534+1G>C						.						150.0	146.0	147.0					1																	115318966		2203	4300	6503	SO:0001630	splice_region_variant	80143	exon5			ATCTTACCTCTAA	AK024821	CCDS878.1, CCDS41371.1	1p13.1	2009-08-13			ENSG00000052723	ENSG00000052723			26119	protein-coding gene	gene with protein product	"""suppressor of IKK epsilon"""	611656				16281057	Standard	NM_025073		Approved	FLJ21168, SIKE	uc001efp.4	Q9BRV8	OTTHUMG00000012061	ENST00000060969.5:c.522+1G>C	chr1.hg19:g.115318966C>G		76.0	0.0		69.0	8.0	NM_001102396	Q5TEZ7|Q5TEZ9|Q68DZ4|Q9H778	Splice_Site	SNP	ENST00000060969.5	hg19	CCDS878.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.628525	0.87560	.	.	ENSG00000052723	ENST00000369528;ENST00000060969	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6101	0.95602	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIKE1	115120489	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.217000	0.77982	2.717000	0.92951	0.585000	0.79938	.	.	.		0.373	SIKE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033401.1	NM_025073	Intron
HCN3	57657	hgsc.bcm.edu	37	1	155247573	155247573	+	Silent	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:155247573G>T	ENST00000368358.3	+	1	200	c.192G>T	c.(190-192)gtG>gtT	p.V64V	HCN3_ENST00000496230.1_3'UTR|CLK2_ENST00000536801.1_5'Flank	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3	64	Involved in subunit assembly. {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CCCTTCGGGTGTTCGGCAGCC	0.622																																					p.V64V		Atlas-SNP	.											.	HCN3	74	.	0			c.G192T						.						23.0	25.0	24.0					1																	155247573		2202	4299	6501	SO:0001819	synonymous_variant	57657	exon1			TCGGGTGTTCGGC	AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.192G>T	chr1.hg19:g.155247573G>T		258.0	1.0		317.0	205.0	NM_020897	D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	Silent	SNP	ENST00000368358.3	hg19	CCDS1108.1																																																																																			.	.		0.622	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087388.1	NM_020897	
KIRREL	55243	hgsc.bcm.edu	37	1	158054346	158054346	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:158054346C>G	ENST00000359209.6	+	4	554	c.487C>G	c.(487-489)Cag>Gag	p.Q163E	KIRREL_ENST00000368173.3_Missense_Mutation_p.Q163E|KIRREL_ENST00000392272.2_Intron|KIRREL_ENST00000368172.1_5'Flank|KIRREL_ENST00000360089.4_Intron|KIRREL_ENST00000416935.2_Missense_Mutation_p.Q63E			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	163	Ig-like C2-type 2.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CGGGACGCAGCAGGAGGGCGC	0.647																																					p.Q163E		Atlas-SNP	.											.	KIRREL	346	.	0			c.C487G						.						46.0	51.0	50.0					1																	158054346		692	1591	2283	SO:0001583	missense	55243	exon4			ACGCAGCAGGAGG	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.487C>G	chr1.hg19:g.158054346C>G	ENSP00000352138:p.Gln163Glu	164.0	0.0		183.0	9.0	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	hg19	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	C	18.65	3.669125	0.67814	.	.	ENSG00000183853	ENST00000368173;ENST00000359209;ENST00000416935	T;T;T	0.75367	-0.93;-0.93;-0.93	5.77	5.77	0.91146	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41001	D	0.000980	T	0.53029	0.1771	N	0.24115	0.695	0.41596	D	0.988823	B;P	0.43578	0.293;0.811	B;B	0.43575	0.275;0.424	T	0.54649	-0.8262	10	0.15066	T	0.55	-25.9084	17.4764	0.87660	0.0:1.0:0.0:0.0	.	63;163	B4DN67;Q96J84	.;KIRR1_HUMAN	E	163;163;63	ENSP00000357155:Q163E;ENSP00000352138:Q163E;ENSP00000389674:Q63E	ENSP00000352138:Q163E	Q	+	1	0	KIRREL	156320970	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	2.569000	0.45973	2.734000	0.93682	0.650000	0.86243	CAG	.	.		0.647	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
HMCN1	83872	hgsc.bcm.edu	37	1	186056407	186056407	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:186056407T>G	ENST00000271588.4	+	59	9334	c.9105T>G	c.(9103-9105)tgT>tgG	p.C3035W	HMCN1_ENST00000367492.2_Missense_Mutation_p.C3035W	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3035	Ig-like C2-type 28.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AATACACTTGTATAGCTATCA	0.368																																					p.C3035W		Atlas-SNP	.											.	HMCN1	797	.	0			c.T9105G						.						146.0	141.0	143.0					1																	186056407		2203	4300	6503	SO:0001583	missense	83872	exon59			CACTTGTATAGCT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9105T>G	chr1.hg19:g.186056407T>G	ENSP00000271588:p.Cys3035Trp	191.0	0.0		242.0	54.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	T	18.37	3.609223	0.66558	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.58358	0.34;0.34	5.84	0.748	0.18376	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81498	0.4835	H	0.99435	4.565	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82450	-0.0451	10	0.87932	D	0	.	9.4068	0.38466	0.0:0.2709:0.0:0.7291	.	3035	Q96RW7	HMCN1_HUMAN	W	3035	ENSP00000271588:C3035W;ENSP00000356462:C3035W	ENSP00000271588:C3035W	C	+	3	2	HMCN1	184323030	1.000000	0.71417	0.969000	0.41365	0.998000	0.95712	1.260000	0.32968	0.093000	0.17368	0.533000	0.62120	TGT	.	.		0.368	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
BRINP3	339479	hgsc.bcm.edu	37	1	190068054	190068054	+	Silent	SNP	G	G	T	rs370368224		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:190068054G>T	ENST00000367462.3	-	8	1626	c.1395C>A	c.(1393-1395)acC>acA	p.T465T	BRINP3_ENST00000534846.1_Silent_p.T363T	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	465					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)		p.T465T(1)									GCATGTAGCCGGTGTTGCAGG	0.597																																					p.T465T		Atlas-SNP	.											FAM5C,NS,carcinoma,-2,1	FAM5C	343	.	1	Substitution - coding silent(1)	lung(1)	c.C1395A						.						88.0	89.0	89.0					1																	190068054		2203	4300	6503	SO:0001819	synonymous_variant	339479	exon8			GTAGCCGGTGTTG	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1395C>A	chr1.hg19:g.190068054G>T		102.0	0.0		140.0	30.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Silent	SNP	ENST00000367462.3	hg19	CCDS1373.1																																																																																			.	.		0.597	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
SYT14	255928	hgsc.bcm.edu	37	1	210332796	210332796	+	Intron	SNP	T	T	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:210332796T>A	ENST00000472886.1	+	8	1368				SYT14_ENST00000422431.1_Missense_Mutation_p.I507K|SYT14_ENST00000537238.1_Intron|SYT14_ENST00000367019.1_Missense_Mutation_p.I462K|SYT14_ENST00000534859.1_Missense_Mutation_p.I469K|SYT14_ENST00000399639.2_3'UTR|SYT14_ENST00000367015.1_Intron|SYT14_ENST00000271745.7_Intron			Q8NB59	SYT14_HUMAN	synaptotagmin XIV						cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		AAACACTTGATAGGTGGACAG	0.418																																					p.I507K		Atlas-SNP	.											.	SYT14	89	.	0			c.T1520A						.						211.0	173.0	184.0					1																	210332796		692	1591	2283	SO:0001627	intron_variant	255928	exon9			ACTTGATAGGTGG	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1355-1278T>A	chr1.hg19:g.210332796T>A		183.0	0.0		221.0	56.0	NM_001146261	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	hg19	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	T	18.90	3.722460	0.68959	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000367019	T;T;T	0.07327	3.4;3.2;3.28	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.17746	0.0426	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.997;0.999	P;D	0.66351	0.881;0.943	T	0.01208	-1.1418	10	0.87932	D	0	-19.5701	16.226	0.82293	0.0:0.0:0.0:1.0	.	462;507	Q8NB59-6;F5H426	.;.	K	507;469;462	ENSP00000389039:I507K;ENSP00000442891:I469K;ENSP00000355986:I462K	ENSP00000355986:I462K	I	+	2	0	SYT14	208399419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.590000	0.82653	2.292000	0.77174	0.482000	0.46254	ATA	.	.		0.418	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
OBSCN	84033	hgsc.bcm.edu	37	1	228496077	228496077	+	Silent	SNP	C	C	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:228496077C>A	ENST00000422127.1	+	47	12776	c.12732C>A	c.(12730-12732)acC>acA	p.T4244T	OBSCN_ENST00000366707.4_Silent_p.T1878T|OBSCN_ENST00000284548.11_Silent_p.T4244T|OBSCN_ENST00000366709.4_Silent_p.T1363T|OBSCN_ENST00000570156.2_Silent_p.T5201T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4244					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCCAGCTCACCGTCAGAGGTA	0.617																																					p.T5201T		Atlas-SNP	.											.	OBSCN	2142	.	0			c.C15603A						.																																			SO:0001819	synonymous_variant	84033	exon58			GCTCACCGTCAGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12732C>A	chr1.hg19:g.228496077C>A		60.0	0.0		73.0	18.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	ENST00000422127.1	hg19	CCDS58065.1																																																																																			.	.		0.617	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
DPYSL5	56896	hgsc.bcm.edu	37	2	27121441	27121441	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr2:27121441A>G	ENST00000288699.6	+	2	232	c.74A>G	c.(73-75)gAg>gGg	p.E25G	DPYSL5_ENST00000401478.1_Missense_Mutation_p.E25G	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	25					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCACCCACGAGGCTGACGTC	0.567																																					p.E25G		Atlas-SNP	.											.	DPYSL5	69	.	0			c.A74G						.						167.0	140.0	149.0					2																	27121441		2203	4300	6503	SO:0001583	missense	56896	exon2			CCCACGAGGCTGA	AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.74A>G	chr2.hg19:g.27121441A>G	ENSP00000288699:p.Glu25Gly	181.0	0.0		166.0	68.0	NM_001253724	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	ENST00000288699.6	hg19	CCDS1730.1	.	.	.	.	.	.	.	.	.	.	A	15.85	2.956193	0.53293	.	.	ENSG00000157851	ENST00000450961;ENST00000288699;ENST00000401478;ENST00000431402;ENST00000434719	T;D;D;T;T	0.86030	-1.15;-2.06;-2.06;-1.14;-1.15	4.61	4.61	0.57282	Metal-dependent hydrolase, composite domain (1);	0.048925	0.85682	D	0.000000	T	0.79118	0.4392	L	0.43598	1.365	0.50467	D	0.999877	B	0.33940	0.433	B	0.31495	0.131	T	0.77718	-0.2483	10	0.34782	T	0.22	-30.9847	13.2923	0.60278	1.0:0.0:0.0:0.0	.	25	Q9BPU6	DPYL5_HUMAN	G	25	ENSP00000407174:E25G;ENSP00000288699:E25G;ENSP00000385549:E25G;ENSP00000399581:E25G;ENSP00000413075:E25G	ENSP00000288699:E25G	E	+	2	0	DPYSL5	26974945	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.624000	0.67764	1.854000	0.53819	0.459000	0.35465	GAG	.	.		0.567	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214187.2	NM_020134	
SLC30A3	7781	hgsc.bcm.edu	37	2	27481124	27481124	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr2:27481124A>T	ENST00000233535.4	-	3	681	c.329T>A	c.(328-330)cTg>cAg	p.L110Q	SLC30A3_ENST00000447008.2_Missense_Mutation_p.L105Q	NM_003459.4	NP_003450.2	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter), member 3	110					positive regulation of transport (GO:0051050)|regulation of sequestering of zinc ion (GO:0061088)|transmembrane transport (GO:0055085)|transport (GO:0006810)|zinc ion transmembrane transport (GO:0071577)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	zinc transporting ATPase activity (GO:0015633)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|pancreas(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CACATCCGCCAGCAAGTGGGC	0.577																																					p.L110Q		Atlas-SNP	.											.	SLC30A3	39	.	0			c.T329A						.						46.0	47.0	46.0					2																	27481124		2203	4300	6503	SO:0001583	missense	7781	exon3			TCCGCCAGCAAGT	U76010	CCDS1743.1	2p23.3	2013-05-22			ENSG00000115194	ENSG00000115194		"""Solute carriers"""	11014	protein-coding gene	gene with protein product		602878		ZNT3		8962159	Standard	NM_003459		Approved		uc002rjj.3	Q99726	OTTHUMG00000128409	ENST00000233535.4:c.329T>A	chr2.hg19:g.27481124A>T	ENSP00000233535:p.Leu110Gln	117.0	0.0		79.0	27.0	NM_003459	Q8TC03	Missense_Mutation	SNP	ENST00000233535.4	hg19	CCDS1743.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.757108	0.89843	.	.	ENSG00000115194	ENST00000233535;ENST00000447008;ENST00000432351;ENST00000426924;ENST00000424577;ENST00000450118;ENST00000426569	T;T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.89431	0.6713	H	0.97365	3.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.92754	0.6218	10	0.87932	D	0	-11.5116	13.8767	0.63657	1.0:0.0:0.0:0.0	.	105;110	F5H3B7;Q99726	.;ZNT3_HUMAN	Q	110;105;61;97;88;61;61	ENSP00000233535:L110Q;ENSP00000415226:L105Q;ENSP00000414320:L61Q;ENSP00000393545:L97Q;ENSP00000403959:L88Q;ENSP00000403912:L61Q;ENSP00000392673:L61Q	ENSP00000233535:L110Q	L	-	2	0	SLC30A3	27334628	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	9.251000	0.95483	2.234000	0.73211	0.459000	0.35465	CTG	.	.		0.577	SLC30A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250189.2		
FSIP2	401024	hgsc.bcm.edu	37	2	186671383	186671383	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr2:186671383G>A	ENST00000424728.1	+	17	17350	c.17350G>A	c.(17350-17352)Gct>Act	p.A5784T	FSIP2_ENST00000343098.5_Missense_Mutation_p.A5873T			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	5784										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AATTTTTCCCGCTAAGTTTTT	0.333																																					p.A5873T		Atlas-SNP	.											.	FSIP2	251	.	0			c.G17617A						.						72.0	68.0	69.0					2																	186671383		1804	4072	5876	SO:0001583	missense	401024	exon17			TTTCCCGCTAAGT	AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.17350G>A	chr2.hg19:g.186671383G>A	ENSP00000401306:p.Ala5784Thr	254.0	0.0		243.0	102.0	NM_173651	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	ENST00000424728.1	hg19		.	.	.	.	.	.	.	.	.	.	G	11.81	1.748834	0.30955	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.62364	0.03;0.04	5.06	2.27	0.28462	.	.	.	.	.	T	0.50667	0.1629	L	0.34521	1.04	0.09310	N	1	.	.	.	.	.	.	T	0.44817	-0.9303	7	0.51188	T	0.08	.	4.4373	0.11557	0.1844:0.0:0.6388:0.1768	.	.	.	.	T	5873;5784	ENSP00000344403:A5873T;ENSP00000401306:A5784T	ENSP00000344403:A5873T	A	+	1	0	FSIP2	186379628	0.151000	0.22747	0.096000	0.21009	0.298000	0.27526	0.723000	0.25939	0.299000	0.22661	-0.194000	0.12790	GCT	.	.		0.333	FSIP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000332778.3	NM_173651	
SPEG	10290	hgsc.bcm.edu	37	2	220344828	220344828	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr2:220344828A>C	ENST00000312358.7	+	25	5440	c.5308A>C	c.(5308-5310)Aat>Cat	p.N1770H	SPEG_ENST00000485813.1_3'UTR|AC053503.11_ENST00000429882.1_RNA	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1770	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CGAGATTGTCAATCAGAGCCC	0.617																																					p.N1770H		Atlas-SNP	.											.	SPEG	272	.	0			c.A5308C						.						80.0	84.0	83.0					2																	220344828		2089	4221	6310	SO:0001583	missense	10290	exon25			ATTGTCAATCAGA	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.5308A>C	chr2.hg19:g.220344828A>C	ENSP00000311684:p.Asn1770His	40.0	0.0		29.0	12.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	ENST00000312358.7	hg19	CCDS42824.1	.	.	.	.	.	.	.	.	.	.	a	14.57	2.574323	0.45902	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.66638	-0.22	4.55	3.38	0.38709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.45361	D	0.000361	T	0.61627	0.2362	L	0.41632	1.29	0.80722	D	1	P	0.40602	0.723	P	0.44990	0.466	T	0.63278	-0.6673	10	0.72032	D	0.01	.	10.2244	0.43216	0.921:0.0:0.079:0.0	.	1770	Q15772	SPEG_HUMAN	H	1770	ENSP00000311684:N1770H	ENSP00000265327:N1770H	N	+	1	0	SPEG	220053072	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.791000	0.69045	0.880000	0.35969	0.492000	0.49549	AAT	.	.		0.617	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266107	41266107	+	Missense_Mutation	SNP	T	T	G	rs121913416		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr3:41266107T>G	ENST00000349496.5	+	3	384	c.104T>G	c.(103-105)aTc>aGc	p.I35S	CTNNB1_ENST00000396185.3_Missense_Mutation_p.I35S|CTNNB1_ENST00000396183.3_Missense_Mutation_p.I35S|CTNNB1_ENST00000405570.1_Missense_Mutation_p.I35S|CTNNB1_ENST00000453024.1_Missense_Mutation_p.I28S	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	35			I -> S (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.I35S(20)|p.I35T(13)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35N(1)|p.I35_G38del(1)|p.I35K(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GACTCTGGAATCCATTCTGGT	0.493		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.I35S	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	169	Deletion - In frame(107)|Substitution - Missense(35)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(3)	liver(118)|large_intestine(19)|salivary_gland(12)|stomach(7)|soft_tissue(2)|small_intestine(2)|endometrium(2)|skin(2)|adrenal_gland(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|pituitary(1)|kidney(1)	c.T104G						.						95.0	80.0	85.0					3																	41266107		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGAATCCATTC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.104T>G	chr3.hg19:g.41266107T>G	ENSP00000344456:p.Ile35Ser	107.0	0.0		97.0	34.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.188620	0.78789	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69548	0.3123	M	0.79614	2.46	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	T	0.73949	-0.3821	10	0.87932	D	0	-3.5499	16.0677	0.80897	0.0:0.0:0.0:1.0	.	35	P35222	CTNB1_HUMAN	S	28;35;35;35;35;28;35;35;35	ENSP00000400508:I28S;ENSP00000385604:I35S;ENSP00000412219:I35S;ENSP00000379486:I35S;ENSP00000344456:I35S;ENSP00000411226:I28S;ENSP00000379488:I35S;ENSP00000409302:I35S;ENSP00000401599:I35S	ENSP00000344456:I35S	I	+	2	0	CTNNB1	41241111	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	ATC	.	.		0.493	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
SPATA16	83893	hgsc.bcm.edu	37	3	172834939	172834940	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr3:172834939_172834940CC>AA	ENST00000351008.3	-	2	765_766	c.582_583GG>TT	c.(580-585)ttGGca>ttTTca	p.194_195LA>FS		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	194					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			TGTCCTGCTGCCAAGGCGTATT	0.406																																					p.A195S|p.L194F		Atlas-SNP	.											.	SPATA16	111	.	0			c.G583T|c.G582T						.																																			SO:0001583	missense	83893	exon2			CTGCTGCCAAGGC|TGCTGCCAAGGCG	AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.582_583delinsAA	chr3.hg19:g.172834939_172834940delinsAA	ENSP00000341765:p.L194_A195delinsFS	91.0|92.0	0.0		70.0	22.0|21.0	NM_031955	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	ENST00000351008.3	hg19	CCDS3221.1																																																																																			.	.		0.406	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346322.1	NM_031955	
SEL1L3	23231	hgsc.bcm.edu	37	4	25836840	25836840	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr4:25836840C>T	ENST00000399878.3	-	3	961	c.839G>A	c.(838-840)cGc>cAc	p.R280H	SEL1L3_ENST00000502949.1_Missense_Mutation_p.R127H|SEL1L3_ENST00000513364.1_5'UTR|SEL1L3_ENST00000264868.5_Missense_Mutation_p.R245H	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	280						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						CATCCTCTGGCGTCGAGTGGC	0.532																																					p.R280H		Atlas-SNP	.											.	SEL1L3	62	.	0			c.G839A						.						124.0	125.0	125.0					4																	25836840		1969	4148	6117	SO:0001583	missense	23231	exon3			CTCTGGCGTCGAG	BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.839G>A	chr4.hg19:g.25836840C>T	ENSP00000382767:p.Arg280His	65.0	0.0		61.0	17.0	NM_015187	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	ENST00000399878.3	hg19	CCDS47037.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.994514	0.54041	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.16457	2.34;2.34;2.34	6.02	5.18	0.71444	.	0.782834	0.13011	N	0.420833	T	0.14657	0.0354	L	0.47716	1.5	0.27456	N	0.953299	P	0.51147	0.942	B	0.37346	0.247	T	0.13098	-1.0522	10	0.42905	T	0.14	-0.3889	9.2909	0.37786	0.0:0.8388:0.0:0.1612	.	280	Q68CR1	SE1L3_HUMAN	H	280;245;127	ENSP00000382767:R280H;ENSP00000264868:R245H;ENSP00000425438:R127H	ENSP00000264868:R245H	R	-	2	0	SEL1L3	25445938	0.992000	0.36948	0.997000	0.53966	0.966000	0.64601	0.551000	0.23361	1.569000	0.49696	0.655000	0.94253	CGC	.	.		0.532	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360261.1	NM_015187	
KIT	3815	hgsc.bcm.edu	37	4	55564702	55564702	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr4:55564702C>T	ENST00000288135.5	+	3	687	c.590C>T	c.(589-591)tCg>tTg	p.S197L		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	197	Ig-like C2-type 2.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCAGTGCTGTCGGAAAAATTC	0.498		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.S197L		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,NS,haematopoietic_neoplasm,0,1	KIT	7396	.	0			c.C590T						.						104.0	94.0	98.0					4																	55564702		2203	4300	6503	SO:0001583	missense	3815	exon3	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TGCTGTCGGAAAA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.590C>T	chr4.hg19:g.55564702C>T	ENSP00000288135:p.Ser197Leu	59.0	0.0		41.0	16.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	hg19	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.836686	0.50951	.	.	ENSG00000157404	ENST00000288135;ENST00000412167;ENST00000536403	D;D	0.81659	-1.52;-1.51	5.75	4.91	0.64330	Immunoglobulin-like fold (1);	0.113900	0.39834	N	0.001251	D	0.86548	0.5959	M	0.78637	2.42	0.53005	D	0.999969	D;D	0.71674	0.982;0.998	P;P	0.56216	0.674;0.794	D	0.88178	0.2869	10	0.87932	D	0	.	12.9428	0.58354	0.0:0.9253:0.0:0.0747	.	197;197	P10721-2;P10721	.;KIT_HUMAN	L	197	ENSP00000288135:S197L;ENSP00000390987:S197L	ENSP00000288135:S197L	S	+	2	0	KIT	55259459	0.999000	0.42202	0.062000	0.19696	0.022000	0.10575	5.295000	0.65692	1.440000	0.47531	0.643000	0.83706	TCG	.	.		0.498	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
WDFY3	23001	hgsc.bcm.edu	37	4	85719181	85719181	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr4:85719181G>A	ENST00000295888.4	-	18	3310	c.2903C>T	c.(2902-2904)cCa>cTa	p.P968L	WDFY3_ENST00000322366.6_Missense_Mutation_p.P968L	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	968					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CAGTGAACTTGGTTTGTGGAC	0.333																																					p.P968L		Atlas-SNP	.											.	WDFY3	314	.	0			c.C2903T						.						133.0	133.0	133.0					4																	85719181		2203	4300	6503	SO:0001583	missense	23001	exon18			GAACTTGGTTTGT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2903C>T	chr4.hg19:g.85719181G>A	ENSP00000295888:p.Pro968Leu	88.0	0.0		60.0	18.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	G	33	5.221059	0.95139	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.62941	-0.01;-0.01	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.60505	-0.7250	10	0.15952	T	0.53	.	19.7348	0.96198	0.0:0.0:1.0:0.0	.	968	Q8IZQ1	WDFY3_HUMAN	L	968	ENSP00000318466:P968L;ENSP00000295888:P968L	ENSP00000295888:P968L	P	-	2	0	WDFY3	85938205	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.416000	0.97383	2.716000	0.92895	0.655000	0.94253	CCA	.	.		0.333	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
LVRN	206338	hgsc.bcm.edu	37	5	115318983	115318983	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr5:115318983G>T	ENST00000357872.4	+	2	819		c.e2-1		AQPEP_ENST00000395528.2_Splice_Site	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN								integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										ATGTATTTCAGGGCCCTGTTA	0.373																																					.		Atlas-SNP	.											.	.	.	.	0			c.696-1G>T						.						43.0	40.0	41.0					5																	115318983		2200	4296	6496	SO:0001630	splice_region_variant	0	exon2			ATTTCAGGGCCCT																												ENST00000357872.4:c.696-1G>T	chr5.hg19:g.115318983G>T		442.0	0.0		353.0	130.0	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Splice_Site	SNP	ENST00000357872.4	hg19	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943841	0.73672	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3048	0.90176	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC010282.1	115346882	1.000000	0.71417	0.986000	0.45419	0.836000	0.47400	8.536000	0.90627	2.681000	0.91329	0.650000	0.86243	.	.	.		0.373	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		Intron
SLIT3	6586	hgsc.bcm.edu	37	5	168189636	168189636	+	Silent	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr5:168189636G>A	ENST00000519560.1	-	15	1937	c.1518C>T	c.(1516-1518)ccC>ccT	p.P506P	SLIT3_ENST00000404867.3_Silent_p.P506P|SLIT3_ENST00000332966.8_Silent_p.P506P	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	506	LRRNT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GACACTTCTCGGGGCACACGA	0.607																																					p.P506P	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.C1518T						.						151.0	144.0	146.0					5																	168189636		2203	4300	6503	SO:0001819	synonymous_variant	6586	exon15			CTTCTCGGGGCAC	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.1518C>T	chr5.hg19:g.168189636G>A		80.0	0.0		56.0	18.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Silent	SNP	ENST00000519560.1	hg19	CCDS4369.1																																																																																			.	.		0.607	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
MDFI	4188	hgsc.bcm.edu	37	6	41613971	41613972	+	Intron	DNP	CC	CC	AA			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:41613971_41613972CC>AA	ENST00000373050.4	+	3	263							Q99750	MDFI_HUMAN	MyoD family inhibitor						activation of JUN kinase activity (GO:0007257)|cytoplasmic sequestering of transcription factor (GO:0042994)|dorsal/ventral axis specification (GO:0009950)|embryo development (GO:0009790)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|prostate(2)|skin(1)|urinary_tract(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.121)		Colorectal(64;0.0123)|COAD - Colon adenocarcinoma(64;0.0264)|KIRC - Kidney renal clear cell carcinoma(1;0.138)			AACCCCCATGCCCCAAGGCAAT	0.649																																					p.P62T|p.P62H		Atlas-SNP	.											MDFI,NS,malignant_melanoma,0,1|.	MDFI	19	.	0			c.C184A|c.C185A						.																																			SO:0001627	intron_variant	4188	exon3			CCCATGCCCCAAG|CCATGCCCCAAGG	U78313	CCDS4857.1, CCDS75451.1	6p21	2008-08-29			ENSG00000112559	ENSG00000112559			6967	protein-coding gene	gene with protein product	"""inhibitor of MyoD family a"""	604971				9250874, 17289077	Standard	NM_005586		Approved	I-mfa	uc003oqq.4	Q99750	OTTHUMG00000014681	Exception_encountered	chr6.hg19:g.41613971_41613972delinsAA		225.0|223.0	0.0		140.0|142.0	62.0|61.0	NM_005586		Missense_Mutation	SNP	ENST00000373050.4	hg19																																																																																				.	.		0.649	MDFI-002	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000040519.2	NM_005586	
CRIP3	401262	hgsc.bcm.edu	37	6	43274226	43274226	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:43274226C>T	ENST00000274990.4	-	5	362	c.358G>A	c.(358-360)Gag>Aag	p.E120K	CRIP3_ENST00000372569.3_Missense_Mutation_p.E120K|ZNF318_ENST00000607252.1_5'Flank			Q6Q6R5	CRIP3_HUMAN	cysteine-rich protein 3	120					T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			AGCGAGGTCTCCCCAGTGAAT	0.587																																					p.E120K		Atlas-SNP	.											.	CRIP3	30	.	0			c.G358A						.						59.0	58.0	59.0					6																	43274226		2203	4300	6503	SO:0001583	missense	401262	exon5			AGGTCTCCCCAGT	AY555741	CCDS4894.2	6p21	2008-02-05			ENSG00000146215	ENSG00000146215			17751	protein-coding gene	gene with protein product						15380775	Standard	NM_206922		Approved	TLP-A, bA480N24.2, TLP	uc003ouu.1	Q6Q6R5	OTTHUMG00000014727	ENST00000274990.4:c.358G>A	chr6.hg19:g.43274226C>T	ENSP00000274990:p.Glu120Lys	81.0	0.0		51.0	21.0	NM_206922	A2A436|Q5T043|Q6Q6R4|Q6Q6R6|Q6Q6R7	Missense_Mutation	SNP	ENST00000274990.4	hg19		.	.	.	.	.	.	.	.	.	.	C	25.2	4.616203	0.87359	.	.	ENSG00000146215	ENST00000372569;ENST00000274990	T;T	0.44482	0.92;0.92	4.75	4.75	0.60458	.	0.481258	0.19617	N	0.109984	T	0.39708	0.1088	N	0.19112	0.55	0.54753	D	0.999987	P;D	0.67145	0.698;0.996	B;D	0.77557	0.14;0.99	T	0.36383	-0.9750	10	0.44086	T	0.13	-23.322	15.6048	0.76658	0.0:1.0:0.0:0.0	.	120;120	Q6Q6R5;Q6Q6R5-3	CRIP3_HUMAN;.	K	120	ENSP00000361650:E120K;ENSP00000274990:E120K	ENSP00000274990:E120K	E	-	1	0	CRIP3	43382204	1.000000	0.71417	0.995000	0.50966	0.901000	0.52897	6.082000	0.71318	2.343000	0.79666	0.561000	0.74099	GAG	.	.		0.587	CRIP3-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000313968.1		
GPR110	266977	hgsc.bcm.edu	37	6	46976900	46976900	+	Silent	SNP	C	C	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:46976900C>A	ENST00000371253.2	-	11	2486	c.2271G>T	c.(2269-2271)gtG>gtT	p.V757V	GPR110_ENST00000449332.2_5'UTR|GPR110_ENST00000283297.5_Silent_p.V560V	NM_153840.2	NP_722582.2	Q5T601	GP110_HUMAN	G protein-coupled receptor 110	757					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	29						CAACGAAGTTCACAGCCACAA	0.517																																					p.V757V		Atlas-SNP	.											.	GPR110	102	.	0			c.G2271T						.						80.0	85.0	83.0					6																	46976900		2203	4300	6503	SO:0001819	synonymous_variant	266977	exon11			GAAGTTCACAGCC	AB083618	CCDS4920.1, CCDS34471.1	6p21.1	2014-08-08			ENSG00000153292	ENSG00000153292		"""-"", ""GPCR / Class B : Orphans"""	18990	protein-coding gene	gene with protein product						12435584, 14623098	Standard	XM_005249006		Approved	hGPCR36, PGR19	uc003oyt.3	Q5T601	OTTHUMG00000014795	ENST00000371253.2:c.2271G>T	chr6.hg19:g.46976900C>A		191.0	0.0		163.0	58.0	NM_153840	Q5KU15|Q5T5Z9|Q5T600|Q86SM1|Q8IXE3|Q8IZF8|Q96DQ1|Q9H615	Silent	SNP	ENST00000371253.2	hg19	CCDS34471.1																																																																																			.	.		0.517	GPR110-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040810.2	NM_153840	
TNFRSF21	27242	hgsc.bcm.edu	37	6	47251829	47251829	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:47251829A>T	ENST00000296861.2	-	3	1481	c.1088T>A	c.(1087-1089)gTg>gAg	p.V363E		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	363					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CACAATCACCACAAGCACCAG	0.522																																					p.V363E		Atlas-SNP	.											.	TNFRSF21	61	.	0			c.T1088A						.						157.0	148.0	152.0					6																	47251829		2203	4300	6503	SO:0001583	missense	27242	exon3			ATCACCACAAGCA	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1088T>A	chr6.hg19:g.47251829A>T	ENSP00000296861:p.Val363Glu	89.0	0.0		79.0	34.0	NM_014452	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	hg19	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	A	26.8	4.773108	0.90108	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.74737	-0.87	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.82250	0.4996	M	0.63843	1.955	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.84347	0.0530	10	0.87932	D	0	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	363	O75509	TNR21_HUMAN	E	363;52	ENSP00000296861:V363E	ENSP00000296861:V363E	V	-	2	0	TNFRSF21	47359788	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.659000	0.91116	2.371000	0.80710	0.533000	0.62120	GTG	.	.		0.522	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
HDAC2	3066	hgsc.bcm.edu	37	6	114277278	114277278	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:114277278C>A	ENST00000519065.1	-	5	772	c.396G>T	c.(394-396)atG>atT	p.M132I	HDAC2_ENST00000398283.2_Missense_Mutation_p.M226I|HDAC2_ENST00000368632.2_Missense_Mutation_p.M102I|HDAC2_ENST00000519108.1_Missense_Mutation_p.M102I			Q92769	HDAC2_HUMAN	histone deacetylase 2	132	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|cardiac muscle cell development (GO:0055013)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|dendrite development (GO:0016358)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|hair follicle placode formation (GO:0060789)|hippocampus development (GO:0021766)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|maintenance of chromatin silencing (GO:0006344)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell cycle (GO:0045786)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of neuron projection development (GO:0010977)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of proteolysis (GO:0045862)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein deacetylation (GO:0090311)|regulation of protein kinase B signaling (GO:0051896)|regulation of sarcomere organization (GO:0060297)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|replication fork (GO:0005657)|Sin3 complex (GO:0016580)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|poly(A) RNA binding (GO:0044822)|protein deacetylase activity (GO:0033558)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			biliary_tract(1)|central_nervous_system(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Aminophylline(DB01223)|Lovastatin(DB00227)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Valproic Acid(DB00313)|Vorinostat(DB02546)	AATTAACAGCCATATCAGTCT	0.358																																					p.M132I		Atlas-SNP	.											.	HDAC2	102	.	0			c.G396T						.						106.0	102.0	103.0					6																	114277278		1857	4101	5958	SO:0001583	missense	3066	exon5			AACAGCCATATCA	U31814	CCDS43493.1, CCDS43493.2	6q21	2008-08-29			ENSG00000196591	ENSG00000196591			4853	protein-coding gene	gene with protein product		605164				9782097	Standard	NM_001527		Approved	RPD3, YAF1	uc003pwd.2	Q92769	OTTHUMG00000015411	ENST00000519065.1:c.396G>T	chr6.hg19:g.114277278C>A	ENSP00000430432:p.Met132Ile	91.0	0.0		56.0	37.0	NM_001527	B3KRS5|B4DL58|E1P561|Q5SRI8|Q5SZ86|Q8NEH4	Missense_Mutation	SNP	ENST00000519065.1	hg19	CCDS43493.2	.	.	.	.	.	.	.	.	.	.	C	5.579	0.291725	0.10567	.	.	ENSG00000196591	ENST00000519065;ENST00000398283;ENST00000519108;ENST00000368632;ENST00000425835;ENST00000523628	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.56	5.56	0.83823	Histone deacetylase domain (2);	0.000000	0.85682	D	0.000000	T	0.06325	0.0163	N	0.00006	-3.24	0.51482	D	0.999924	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.54741	-0.8248	10	0.02654	T	1	-11.9209	14.6977	0.69134	0.1451:0.8549:0.0:0.0	.	102;132	B3KRS5;Q92769	.;HDAC2_HUMAN	I	132;226;102;102;122;102	ENSP00000430432:M132I;ENSP00000381331:M226I;ENSP00000430008:M102I;ENSP00000357621:M102I;ENSP00000417026:M122I	ENSP00000357621:M102I	M	-	3	0	HDAC2	114383971	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.075000	0.41538	2.763000	0.94921	0.585000	0.79938	ATG	.	.		0.358	HDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041909.2		
MTRF1L	54516	hgsc.bcm.edu	37	6	153316354	153316354	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:153316354G>A	ENST00000367233.5	-	3	439	c.440C>T	c.(439-441)tCa>tTa	p.S147L	MTRF1L_ENST00000367231.5_Missense_Mutation_p.S147L|MTRF1L_ENST00000367230.1_Intron|MTRF1L_ENST00000464135.1_5'UTR	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	147						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		AAATATCTCTGATGTAAACAA	0.358																																					p.S147L		Atlas-SNP	.											.	MTRF1L	21	.	0			c.C440T						.						38.0	36.0	36.0					6																	153316354		2201	4277	6478	SO:0001583	missense	54516	exon3			ATCTCTGATGTAA	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.440C>T	chr6.hg19:g.153316354G>A	ENSP00000356202:p.Ser147Leu	211.0	0.0		194.0	71.0	NM_019041	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	ENST00000367233.5	hg19	CCDS5243.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467480	0.43839	.	.	ENSG00000112031	ENST00000367233;ENST00000367231	T;T	0.12361	2.69;2.69	5.43	4.56	0.56223	Peptide chain release factor (2);	0.397901	0.25327	N	0.031474	T	0.11580	0.0282	M	0.80332	2.49	0.80722	D	1	B;B	0.13594	0.003;0.008	B;B	0.16289	0.007;0.015	T	0.03184	-1.1063	10	0.87932	D	0	-0.1384	14.4477	0.67364	0.0715:0.0:0.9285:0.0	.	147;147	Q9UGC7-2;Q9UGC7	.;RF1ML_HUMAN	L	147	ENSP00000356202:S147L;ENSP00000356200:S147L	ENSP00000356200:S147L	S	-	2	0	MTRF1L	153358047	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	6.227000	0.72282	1.293000	0.44690	0.585000	0.79938	TCA	.	.		0.358	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
THBS2	7058	hgsc.bcm.edu	37	6	169620434	169620434	+	Splice_Site	SNP	T	T	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:169620434T>G	ENST00000366787.3	-	22	3621		c.e22-2		XXyac-YX65C7_A.2_ENST00000444188.1_RNA|THBS2_ENST00000488355.1_Splice_Site	NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2						cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ACTAAGACTCTAAAAATGGTG	0.463																																					.	Esophageal Squamous(91;219 1934 18562 44706)	Atlas-SNP	.											.	THBS2	230	.	0			c.3372-2A>C						.						109.0	116.0	114.0					6																	169620434		2203	4300	6503	SO:0001630	splice_region_variant	7058	exon23			AGACTCTAAAAAT		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.3372-2A>C	chr6.hg19:g.169620434T>G		113.0	0.0		83.0	32.0	NM_003247	A6H8N1|A7E232|Q5RI52	Splice_Site	SNP	ENST00000366787.3	hg19	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.776717	0.49786	.	.	ENSG00000186340	ENST00000366787;ENST00000392099	.	.	.	4.64	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.078	0.64903	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	THBS2	169362359	1.000000	0.71417	0.689000	0.30133	0.553000	0.35397	7.474000	0.81024	1.719000	0.51432	0.391000	0.25812	.	.	.		0.463	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	Intron
THBS2	7058	hgsc.bcm.edu	37	6	169646339	169646339	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:169646339G>T	ENST00000366787.3	-	5	896	c.647C>A	c.(646-648)tCt>tAt	p.S216Y		NM_003247.2	NP_003238.2	P35442	TSP2_HUMAN	thrombospondin 2	216	Heparin-binding. {ECO:0000255}.				cell adhesion (GO:0007155)|negative regulation of angiogenesis (GO:0016525)|positive regulation of synapse assembly (GO:0051965)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|platelet alpha granule (GO:0031091)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(3)|biliary_tract(1)|endometrium(8)|kidney(3)|large_intestine(23)|liver(1)|lung(56)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	111		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		ATCTTCCACAGAGTTTTCAAA	0.408																																					p.S216Y	Esophageal Squamous(91;219 1934 18562 44706)	Atlas-SNP	.											.	THBS2	230	.	0			c.C647A						.						117.0	112.0	114.0					6																	169646339		2203	4300	6503	SO:0001583	missense	7058	exon5			TCCACAGAGTTTT		CCDS34574.1	6q27	2008-07-28			ENSG00000186340	ENSG00000186340			11786	protein-coding gene	gene with protein product		188061				18455130	Standard	NM_003247		Approved	TSP2	uc003qwt.3	P35442	OTTHUMG00000045408	ENST00000366787.3:c.647C>A	chr6.hg19:g.169646339G>T	ENSP00000355751:p.Ser216Tyr	88.0	0.0		66.0	25.0	NM_003247	A6H8N1|A7E232|Q5RI52	Missense_Mutation	SNP	ENST00000366787.3	hg19	CCDS34574.1	.	.	.	.	.	.	.	.	.	.	G	16.63	3.177219	0.57692	.	.	ENSG00000186340	ENST00000366787	T	0.02177	4.41	5.13	5.13	0.70059	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.39687	U	0.001289	T	0.05502	0.0145	M	0.67953	2.075	0.37885	D	0.930523	D	0.63880	0.993	P	0.59056	0.851	T	0.13602	-1.0503	10	0.72032	D	0.01	-28.4404	16.1088	0.81244	0.0:0.0:1.0:0.0	.	216	P35442	TSP2_HUMAN	Y	216	ENSP00000355751:S216Y	ENSP00000355751:S216Y	S	-	2	0	THBS2	169388264	0.997000	0.39634	0.046000	0.18839	0.006000	0.05464	8.596000	0.90844	2.381000	0.81170	0.655000	0.94253	TCT	.	.		0.408	THBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105439.1	NM_003247	
TNRC18	84629	hgsc.bcm.edu	37	7	5352833	5352833	+	Silent	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr7:5352833G>A	ENST00000430969.1	-	27	8037	c.7689C>T	c.(7687-7689)agC>agT	p.S2563S	TNRC18_ENST00000399537.4_Silent_p.S2563S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2563	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		tgccactactgctgctgctgc	0.672																																					p.S2563S		Atlas-SNP	.											.	TNRC18	311	.	0			c.C7689T						.						3.0	5.0	4.0					7																	5352833		1128	2739	3867	SO:0001819	synonymous_variant	84629	exon27			ACTACTGCTGCTG	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7689C>T	chr7.hg19:g.5352833G>A		47.0	0.0		78.0	5.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	g	0.008	-1.904535	0.00512	.	.	ENSG00000182095	ENST00000328270	.	.	.	4.38	1.45	0.22620	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.8385	0.08905	0.1403:0.149:0.519:0.1916	.	.	.	.	X	377	.	.	Q	-	1	0	TNRC18	5319359	0.004000	0.15560	0.014000	0.15608	0.007000	0.05969	-0.229000	0.09098	-0.173000	0.10761	-1.164000	0.01763	CAG	.	.		0.672	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CUX1	1523	hgsc.bcm.edu	37	7	101844891	101844891	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr7:101844891G>C	ENST00000292535.7	+	18	2352	c.2314G>C	c.(2314-2316)Gag>Cag	p.E772Q	CUX1_ENST00000549414.2_Missense_Mutation_p.E750Q|CUX1_ENST00000550008.2_Missense_Mutation_p.E716Q|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.E614Q|CUX1_ENST00000546411.2_Missense_Mutation_p.E670Q|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Missense_Mutation_p.E783Q	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	772					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						CGCAGCTCCTGAGGCCGGTGC	0.677																																					p.E783Q		Atlas-SNP	.											.	CUX1	253	.	0			c.G2347C						.						91.0	101.0	97.0					7																	101844891		2203	4300	6503	SO:0001583	missense	1523	exon18			GCTCCTGAGGCCG	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2314G>C	chr7.hg19:g.101844891G>C	ENSP00000292535:p.Glu772Gln	59.0	0.0		55.0	16.0	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	G	7.010	0.556633	0.13436	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.60548	0.19;0.2;0.19;0.18;0.2;0.2	5.44	5.44	0.79542	.	0.275088	0.35407	N	0.003235	T	0.50786	0.1636	L	0.36672	1.1	0.80722	D	1	B;B	0.30361	0.181;0.277	B;B	0.32289	0.042;0.143	T	0.42865	-0.9426	10	0.20046	T	0.44	-2.9602	19.279	0.94044	0.0:0.0:1.0:0.0	.	772;783	P39880;P39880-3	CUX1_HUMAN;.	Q	783;772;750;716;670;614	ENSP00000353401:E783Q;ENSP00000292535:E772Q;ENSP00000446630:E750Q;ENSP00000447373:E716Q;ENSP00000450125:E670Q;ENSP00000451558:E614Q	ENSP00000292535:E772Q	E	+	1	0	CUX1	101631611	1.000000	0.71417	0.388000	0.26195	0.057000	0.15508	5.272000	0.65559	2.560000	0.86352	0.655000	0.94253	GAG	.	.		0.677	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
PLXNA4	91584	hgsc.bcm.edu	37	7	132192829	132192829	+	Silent	SNP	A	A	C	rs142932361		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr7:132192829A>C	ENST00000359827.3	-	2	1586	c.624T>G	c.(622-624)tcT>tcG	p.S208S	PLXNA4_ENST00000321063.4_Silent_p.S208S|PLXNA4_ENST00000378539.5_Silent_p.S208S|PLXNA4_ENST00000423507.2_Silent_p.S208S			Q9HCM2	PLXA4_HUMAN	plexin A4	208	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CATCCGCCTCAGAGTTCTTGG	0.522																																					p.S208S		Atlas-SNP	.											.	PLXNA4	873	.	0			c.T624G						.						144.0	138.0	140.0					7																	132192829		2203	4300	6503	SO:0001819	synonymous_variant	91584	exon2			CGCCTCAGAGTTC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.624T>G	chr7.hg19:g.132192829A>C		57.0	0.0		52.0	22.0	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	hg19	CCDS43646.1																																																																																			.	A|1.000;G|0.000		0.522	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
GPR124	25960	hgsc.bcm.edu	37	8	37699548	37699548	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr8:37699548T>A	ENST00000412232.2	+	19	3705	c.3692T>A	c.(3691-3693)cTg>cAg	p.L1231Q	GPR124_ENST00000315215.7_Missense_Mutation_p.L1014Q	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	1231					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			GACAGCTACCTGGGCAGCAGC	0.731																																					p.L1231Q		Atlas-SNP	.											.	GPR124	85	.	0			c.T3692A						.						2.0	3.0	2.0					8																	37699548		1145	2256	3401	SO:0001583	missense	25960	exon19			GCTACCTGGGCAG	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.3692T>A	chr8.hg19:g.37699548T>A	ENSP00000406367:p.Leu1231Gln	9.0	0.0		26.0	11.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	hg19	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	T	2.846	-0.239458	0.05944	.	.	ENSG00000020181	ENST00000315215;ENST00000412232	T;T	0.56776	0.44;0.56	3.52	0.358	0.16084	.	0.680781	0.13068	U	0.416315	T	0.27241	0.0668	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20773	-1.0265	10	0.11794	T	0.64	-6.7977	5.1621	0.15066	0.43:0.3919:0.0:0.1781	.	1014;1231	Q96PE1-2;Q96PE1	.;GP124_HUMAN	Q	1014;1231	ENSP00000323508:L1014Q;ENSP00000406367:L1231Q	ENSP00000323508:L1014Q	L	+	2	0	GPR124	37818706	0.000000	0.05858	0.365000	0.25901	0.420000	0.31355	-0.519000	0.06260	-0.089000	0.12484	-0.736000	0.03550	CTG	.	.		0.731	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
PAG1	55824	hgsc.bcm.edu	37	8	81888943	81888943	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr8:81888943G>A	ENST00000220597.4	-	9	1845	c.1135C>T	c.(1135-1137)Ccc>Tcc	p.P379S	PAG1_ENST00000523463.1_5'Flank	NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	379					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			TCCTCGCTGGGCCTCCCTGCT	0.542																																					p.P379S		Atlas-SNP	.											.	PAG1	39	.	0			c.C1135T						.						83.0	78.0	80.0					8																	81888943		2203	4300	6503	SO:0001583	missense	55824	exon9			CGCTGGGCCTCCC	AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.1135C>T	chr8.hg19:g.81888943G>A	ENSP00000220597:p.Pro379Ser	123.0	0.0		92.0	30.0	NM_018440	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	ENST00000220597.4	hg19	CCDS6227.1	.	.	.	.	.	.	.	.	.	.	G	2.287	-0.363324	0.05103	.	.	ENSG00000076641	ENST00000220597	.	.	.	4.52	1.65	0.23941	.	0.268289	0.36234	N	0.002720	T	0.26448	0.0646	L	0.36672	1.1	0.09310	N	1	B	0.14805	0.011	B	0.17098	0.017	T	0.17167	-1.0378	9	0.14656	T	0.56	-15.8353	6.8149	0.23824	0.1608:0.2739:0.5654:0.0	.	379	Q9NWQ8	PAG1_HUMAN	S	379	.	ENSP00000220597:P379S	P	-	1	0	PAG1	82051498	0.241000	0.23857	0.021000	0.16686	0.038000	0.13279	0.508000	0.22692	0.604000	0.29930	0.655000	0.94253	CCC	.	.		0.542	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379352.3	NM_018440	
CDH17	1015	hgsc.bcm.edu	37	8	95188826	95188826	+	Silent	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr8:95188826G>T	ENST00000027335.3	-	5	491	c.367C>A	c.(367-369)Cga>Aga	p.R123R	CDH17_ENST00000441892.2_Silent_p.R123R|CDH17_ENST00000450165.2_Silent_p.R123R	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	123	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)	p.R123*(1)		NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			AACGTGGGTCGATTGTCGTTG	0.493																																					p.R123R		Atlas-SNP	.											CDH17,NS,malignant_melanoma,+1,1	CDH17	119	.	1	Substitution - Nonsense(1)	ovary(1)	c.C367A						.						255.0	214.0	228.0					8																	95188826		2203	4300	6503	SO:0001819	synonymous_variant	1015	exon5			TGGGTCGATTGTC	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.367C>A	chr8.hg19:g.95188826G>T		176.0	0.0		149.0	54.0	NM_004063	Q15336|Q2M2E0	Silent	SNP	ENST00000027335.3	hg19	CCDS6260.1																																																																																			.	.		0.493	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
MFSD3	113655	hgsc.bcm.edu	37	8	145738712	145738712	+	IGR	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr8:145738712C>T	ENST00000301327.4	+	0	1548				RECQL4_ENST00000428558.2_Silent_p.R784R|RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GCAGCACAGCCCGCACATCTG	0.711																																					p.R784R		Atlas-SNP	.											.	RECQL4	75	.	0			c.G2352A						.						13.0	18.0	16.0					8																	145738712		2052	4173	6225	SO:0001628	intergenic_variant	9401	exon15			CACAGCCCGCACA		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		chr8.hg19:g.145738712C>T		61.0	0.0		52.0	18.0	NM_004260		Silent	SNP	ENST00000301327.4	hg19	CCDS6431.1																																																																																			.	.		0.711	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
MLANA	2315	hgsc.bcm.edu	37	9	5906982	5906982	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr9:5906982A>C	ENST00000381477.3	+	4	432	c.272A>C	c.(271-273)aAa>aCa	p.K91T	MLANA_ENST00000490518.1_3'UTR|MLANA_ENST00000381471.1_Missense_Mutation_p.K91T|MLANA_ENST00000381476.1_Missense_Mutation_p.K91T|KIAA2026_ENST00000443149.2_Intron	NM_005511.1	NP_005502.1	Q16655	MAR1_HUMAN	melan-A	91						endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|melanosome (GO:0042470)|trans-Golgi network (GO:0005802)				central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(1)	8		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(1;1.15e-06)|Lung(218;0.103)		CTTCAAGAGAAAAACTGTGAA	0.378																																					p.K91T		Atlas-SNP	.											.	MLANA	16	.	0			c.A272C						.						90.0	88.0	89.0					9																	5906982		2203	4300	6503	SO:0001583	missense	2315	exon4			AAGAGAAAAACTG		CCDS6466.1	9p24.1	2008-02-05			ENSG00000120215	ENSG00000120215			7124	protein-coding gene	gene with protein product		605513					Standard	NM_005511		Approved	MART1	uc003zjo.1	Q16655	OTTHUMG00000019510	ENST00000381477.3:c.272A>C	chr9.hg19:g.5906982A>C	ENSP00000370886:p.Lys91Thr	120.0	0.0		80.0	24.0	NM_005511	Q6ICU4	Missense_Mutation	SNP	ENST00000381477.3	hg19	CCDS6466.1	.	.	.	.	.	.	.	.	.	.	A	4.134	0.023132	0.08006	.	.	ENSG00000120215	ENST00000381477;ENST00000381476;ENST00000381471	.	.	.	6.07	2.35	0.29111	.	0.545956	0.21417	N	0.074892	T	0.29817	0.0745	L	0.44542	1.39	0.27103	N	0.962564	B	0.28636	0.218	B	0.31101	0.124	T	0.17379	-1.0371	9	0.28530	T	0.3	-2.2595	4.2637	0.10752	0.6935:0.0:0.1596:0.1469	.	91	Q16655	MAR1_HUMAN	T	91	.	ENSP00000370880:K91T	K	+	2	0	MLANA	5896982	0.036000	0.19791	0.674000	0.29902	0.339000	0.28857	0.333000	0.19768	0.150000	0.19136	-0.263000	0.10527	AAA	.	.		0.378	MLANA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051643.1		
OR1J1	347168	hgsc.bcm.edu	37	9	125239744	125239744	+	Silent	SNP	C	C	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr9:125239744C>A	ENST00000259357.2	-	1	491	c.462G>T	c.(460-462)gcG>gcT	p.A154A	RP11-542K23.9_ENST00000412262.2_RNA	NM_001004451.1	NP_001004451.1	Q8NGS3	OR1J1_HUMAN	olfactory receptor, family 1, subfamily J, member 1	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	16						AAAGAGCACACGCACAAGCGA	0.537																																					p.A154A		Atlas-SNP	.											.	OR1J1	46	.	0			c.G462T						.						91.0	79.0	83.0					9																	125239744		2203	4300	6503	SO:0001819	synonymous_variant	347168	exon1			AGCACACGCACAA	AL353767	CCDS35120.1	9q33.2	2013-09-20			ENSG00000136834	ENSG00000136834		"""GPCR / Class A : Olfactory receptors"""	8208	protein-coding gene	gene with protein product							Standard	NM_001004451		Approved	hg32	uc011lyu.2	Q8NGS3	OTTHUMG00000020603	ENST00000259357.2:c.462G>T	chr9.hg19:g.125239744C>A		96.0	0.0		82.0	31.0	NM_001004451	A3KFL8|Q6IF10|Q96R88	Silent	SNP	ENST00000259357.2	hg19	CCDS35120.1																																																																																			.	.		0.537	OR1J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053931.1		
GATA3	2625	hgsc.bcm.edu	37	10	8106026	8106026	+	Silent	SNP	C	C	T	rs138698611		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr10:8106026C>T	ENST00000346208.3	+	4	1301	c.846C>T	c.(844-846)taC>taT	p.Y282Y	GATA3_ENST00000379328.3_Silent_p.Y283Y|GATA3_ENST00000461472.1_Intron			P23771	GATA3_HUMAN	GATA binding protein 3	282					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CGGGACACTACCTGTGCAACG	0.557			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.Y283Y		Atlas-SNP	.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	GATA3	182	.	0			c.C849T						.	C	,	0,4406		0,0,2203	143.0	113.0	123.0		849,846	5.6	1.0	10	dbSNP_134	123	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	GATA3	NM_001002295.1,NM_002051.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	283/445,282/444	8106026	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2625	exon4			ACACTACCTGTGC	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.846C>T	chr10.hg19:g.8106026C>T		159.0	0.0		107.0	35.0	NM_001002295	Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	ENST00000346208.3	hg19	CCDS7083.1																																																																																			.	C|1.000;T|0.000		0.557	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
CUBN	8029	hgsc.bcm.edu	37	10	17147494	17147494	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr10:17147494T>G	ENST00000377833.4	-	11	1257	c.1192A>C	c.(1192-1194)Att>Ctt	p.I398L		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	398	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTAGGCAAATATTACTGAGC	0.428																																					p.I398L		Atlas-SNP	.											.	CUBN	515	.	0			c.A1192C						.						165.0	144.0	151.0					10																	17147494		2203	4300	6503	SO:0001583	missense	8029	exon11			GGCAAATATTACT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.1192A>C	chr10.hg19:g.17147494T>G	ENSP00000367064:p.Ile398Leu	92.0	0.0		60.0	29.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	7.847	0.723232	0.15439	.	.	ENSG00000107611	ENST00000377833	D	0.94862	-3.54	5.65	0.386	0.16254	Growth factor, receptor (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.659509	0.13242	N	0.402767	D	0.86180	0.5871	N	0.17474	0.49	0.09310	N	0.999998	B	0.15719	0.014	B	0.12837	0.008	T	0.73251	-0.4042	10	0.28530	T	0.3	.	6.3365	0.21298	0.0:0.132:0.2485:0.6194	.	398	O60494	CUBN_HUMAN	L	398	ENSP00000367064:I398L	ENSP00000367064:I398L	I	-	1	0	CUBN	17187500	0.047000	0.20315	0.002000	0.10522	0.116000	0.19942	1.078000	0.30754	-0.165000	0.10908	-0.353000	0.07706	ATT	.	.		0.428	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
ZMIZ1	57178	hgsc.bcm.edu	37	10	81064989	81064989	+	Splice_Site	SNP	G	G	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr10:81064989G>C	ENST00000334512.5	+	20	2926		c.e20+1		ZMIZ1_ENST00000446377.2_5'Flank	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1						artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			CTGTGTGCAAGTGAGTGATGC	0.597																																					.		Atlas-SNP	.											.	ZMIZ1	101	.	0			c.2354+1G>C						.						121.0	101.0	108.0					10																	81064989		2203	4300	6503	SO:0001630	splice_region_variant	57178	exon20			GTGCAAGTGAGTG	AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.2354+1G>C	chr10.hg19:g.81064989G>C		80.0	0.0		40.0	6.0	NM_020338	Q5JSH9|Q7Z7E6	Splice_Site	SNP	ENST00000334512.5	hg19	CCDS7357.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264298	0.80358	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9192	0.92518	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZMIZ1	80734995	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.476000	0.97823	2.475000	0.83589	0.591000	0.81541	.	.	.		0.597	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048944.2	NM_020338	Intron
MAT1A	4143	hgsc.bcm.edu	37	10	82034403	82034403	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr10:82034403A>T	ENST00000372213.3	-	8	1218	c.958T>A	c.(958-960)Tat>Aat	p.Y320N	MAT1A_ENST00000485270.1_5'UTR	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	320					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CCAATGGCATAGGAAACCTTC	0.557																																					p.Y320N		Atlas-SNP	.											.	MAT1A	52	.	0			c.T958A						.						108.0	96.0	100.0					10																	82034403		2203	4300	6503	SO:0001583	missense	4143	exon8			TGGCATAGGAAAC		CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.958T>A	chr10.hg19:g.82034403A>T	ENSP00000361287:p.Tyr320Asn	71.0	0.0		45.0	17.0	NM_000429	D3DWD5|Q5QP09	Missense_Mutation	SNP	ENST00000372213.3	hg19	CCDS7365.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.214920	0.79352	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.98792	-5.14	5.16	5.16	0.70880	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99504	0.9823	H	0.98701	4.305	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97962	1.0338	10	0.87932	D	0	-21.5107	13.249	0.60041	1.0:0.0:0.0:0.0	.	320	Q00266	METK1_HUMAN	N	320	ENSP00000361287:Y320N	ENSP00000361280:Y320N	Y	-	1	0	MAT1A	82024383	1.000000	0.71417	0.999000	0.59377	0.715000	0.41141	8.962000	0.93254	2.081000	0.62600	0.533000	0.62120	TAT	.	.		0.557	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049070.1	NM_000429	
ARFIP2	23647	hgsc.bcm.edu	37	11	6500162	6500162	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr11:6500162A>G	ENST00000254584.2	-	5	426	c.343T>C	c.(343-345)Ttt>Ctt	p.F115L	ARFIP2_ENST00000396777.3_Missense_Mutation_p.F115L|ARFIP2_ENST00000445086.2_Missense_Mutation_p.F30L|ARFIP2_ENST00000423813.2_Missense_Mutation_p.F77L|TIMM10B_ENST00000472836.1_5'Flank|ARFIP2_ENST00000525235.1_Missense_Mutation_p.F115L|TIMM10B_ENST00000530751.1_5'Flank|TIMM10B_ENST00000254616.6_5'Flank	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	115					actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CCTCGACCAAATCGTTCTGAT	0.537																																					p.F148L	Melanoma(119;796 1674 9049 20480 24794)	Atlas-SNP	.											.	ARFIP2	23	.	0			c.T442C						.						73.0	55.0	61.0					11																	6500162		2201	4296	6497	SO:0001583	missense	23647	exon5			GACCAAATCGTTC	BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.343T>C	chr11.hg19:g.6500162A>G	ENSP00000254584:p.Phe115Leu	69.0	0.0		46.0	19.0	NM_001242854	B4DX86|B4E306|D3DQT5	Missense_Mutation	SNP	ENST00000254584.2	hg19	CCDS7765.1	.	.	.	.	.	.	.	.	.	.	A	11.57	1.678795	0.29783	.	.	ENSG00000132254	ENST00000254584;ENST00000396777;ENST00000445086;ENST00000423813;ENST00000525235	T;T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.74;-0.74	5.68	5.68	0.88126	Arfaptin-like (1);	0.000000	0.85682	D	0.000000	T	0.73505	0.3595	N	0.19112	0.55	0.80722	D	1	D;B;D	0.69078	0.997;0.004;0.992	D;B;D	0.80764	0.994;0.004;0.987	T	0.68273	-0.5452	10	0.02654	T	1	.	15.5881	0.76502	1.0:0.0:0.0:0.0	.	148;30;115	B4DUZ3;B4E306;P53365	.;.;ARFP2_HUMAN	L	115;115;30;77;115	ENSP00000254584:F115L;ENSP00000379998:F115L;ENSP00000391427:F30L;ENSP00000398375:F77L;ENSP00000434124:F115L	ENSP00000254584:F115L	F	-	1	0	ARFIP2	6456738	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.156000	0.71840	2.177000	0.69029	0.402000	0.26972	TTT	.	.		0.537	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387044.1	NM_012402	
ZDHHC13	54503	hgsc.bcm.edu	37	11	19173800	19173800	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr11:19173800C>T	ENST00000446113.2	+	7	801	c.680C>T	c.(679-681)gCa>gTa	p.A227V	ZDHHC13_ENST00000532812.1_3'UTR|ZDHHC13_ENST00000399351.3_Missense_Mutation_p.A97V	NM_019028.2	NP_061901.2	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC-type containing 13	227					metabolic process (GO:0008152)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	magnesium ion transmembrane transporter activity (GO:0015095)|palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			NS(1)|kidney(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	6						GCAGTTGCAGCAGGAAATGTT	0.393																																					p.A227V		Atlas-SNP	.											.	ZDHHC13	40	.	0			c.C680T						.						132.0	121.0	125.0					11																	19173800		1858	4092	5950	SO:0001583	missense	54503	exon7			TTGCAGCAGGAAA	AB024495	CCDS44550.1, CCDS44551.1	11p15.1	2013-01-10			ENSG00000177054	ENSG00000177054		"""Zinc fingers, DHHC-type"", ""Ankyrin repeat domain containing"""	18413	protein-coding gene	gene with protein product		612815				18794299	Standard	NM_001001483		Approved	FLJ10852, FLJ10941, HIP14L	uc001mpi.3	Q8IUH4	OTTHUMG00000166099	ENST00000446113.2:c.680C>T	chr11.hg19:g.19173800C>T	ENSP00000400113:p.Ala227Val	154.0	0.0		104.0	38.0	NM_019028	Q7Z2D3|Q86VK2|Q9NV30|Q9NV99	Missense_Mutation	SNP	ENST00000446113.2	hg19	CCDS44550.1	.	.	.	.	.	.	.	.	.	.	C	23.6	4.434257	0.83776	.	.	ENSG00000177054	ENST00000446113;ENST00000399351	T;T	0.53206	0.63;0.63	5.47	5.47	0.80525	Ankyrin repeat-containing domain (4);	0.000000	0.56097	D	0.000036	T	0.47911	0.1471	L	0.28740	0.885	0.80722	D	1	P	0.52577	0.954	P	0.48952	0.596	T	0.43718	-0.9374	10	0.45353	T	0.12	0.1598	18.9329	0.92574	0.0:1.0:0.0:0.0	.	227	Q8IUH4	ZDH13_HUMAN	V	227;97	ENSP00000400113:A227V;ENSP00000382288:A97V	ENSP00000382288:A97V	A	+	2	0	ZDHHC13	19130376	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.913000	0.69957	2.582000	0.87167	0.591000	0.81541	GCA	.	.		0.393	ZDHHC13-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387821.1	NM_019028	
OR8K3	219473	hgsc.bcm.edu	37	11	56086232	56086232	+	Silent	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr11:56086232C>T	ENST00000312711.1	+	1	450	c.450C>T	c.(448-450)ctC>ctT	p.L150L		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					TCCCTTACCTCTATTGCACAT	0.428																																					p.L150L		Atlas-SNP	.											.	OR8K3	92	.	0			c.C450T						.						119.0	117.0	118.0					11																	56086232		2201	4296	6497	SO:0001819	synonymous_variant	219473	exon1			TTACCTCTATTGC	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.450C>T	chr11.hg19:g.56086232C>T		115.0	0.0		86.0	28.0	NM_001005202	Q6IFC4	Silent	SNP	ENST00000312711.1	hg19	CCDS31527.1																																																																																			.	.		0.428	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
FAM111A	63901	hgsc.bcm.edu	37	11	58919496	58919496	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr11:58919496G>T	ENST00000528737.1	+	5	3173	c.355G>T	c.(355-357)Gaa>Taa	p.E119*	FAM111A_ENST00000531147.1_Nonsense_Mutation_p.E119*|FAM111A_ENST00000361723.3_Nonsense_Mutation_p.E119*|FAM111A_ENST00000420244.1_Nonsense_Mutation_p.E119*|FAM111A_ENST00000533703.1_Nonsense_Mutation_p.E119*			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	119					defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				AAAAGAGATAGAAACTCACCA	0.443																																					p.E119X		Atlas-SNP	.											.	FAM111A	57	.	0			c.G355T						.						77.0	74.0	75.0					11																	58919496		2201	4295	6496	SO:0001587	stop_gained	63901	exon5			GAGATAGAAACTC	AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.355G>T	chr11.hg19:g.58919496G>T	ENSP00000434435:p.Glu119*	150.0	0.0		123.0	43.0	NM_001142520	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Nonsense_Mutation	SNP	ENST00000528737.1	hg19	CCDS7973.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.215064	0.79352	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000527629;ENST00000533703;ENST00000531147	.	.	.	5.49	-2.03	0.07365	.	0.921525	0.09200	N	0.834797	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-5.4258	10.0867	0.42423	0.5176:0.0:0.4824:0.0	.	.	.	.	X	119	.	ENSP00000355264:E119X	E	+	1	0	FAM111A	58676072	0.000000	0.05858	0.000000	0.03702	0.333000	0.28666	-0.513000	0.06305	-0.607000	0.05738	0.650000	0.86243	GAA	.	.		0.443	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393975.1	NM_022074	
PLCB3	5331	hgsc.bcm.edu	37	11	64023939	64023939	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr11:64023939T>A	ENST00000540288.1	+	9	893	c.790T>A	c.(790-792)Tac>Aac	p.Y264N	PLCB3_ENST00000279230.6_Missense_Mutation_p.Y264N|PLCB3_ENST00000325234.5_Missense_Mutation_p.Y197N	NM_000932.2	NP_000923.1	Q01970	PLCB3_HUMAN	phospholipase C, beta 3 (phosphatidylinositol-specific)	264					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|regulation of systemic arterial blood pressure (GO:0003073)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|urinary_tract(1)	33						CGAAGTGCTGTACCCGCCCCT	0.632																																					p.Y264N		Atlas-SNP	.											.	PLCB3	103	.	0			c.T790A						.						77.0	95.0	89.0					11																	64023939		2200	4295	6495	SO:0001583	missense	5331	exon9			GTGCTGTACCCGC	Z26649	CCDS8064.1, CCDS53654.1	11q13	2008-03-18			ENSG00000149782	ENSG00000149782	3.1.4.11		9056	protein-coding gene	gene with protein product		600230				7849701	Standard	NM_000932		Approved		uc009ypg.2	Q01970	OTTHUMG00000167816	ENST00000540288.1:c.790T>A	chr11.hg19:g.64023939T>A	ENSP00000443631:p.Tyr264Asn	120.0	0.0		123.0	44.0	NM_000932	A5PKZ6|G5E960|Q8N1A4	Missense_Mutation	SNP	ENST00000540288.1	hg19	CCDS8064.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.833406	0.91036	.	.	ENSG00000149782	ENST00000279230;ENST00000540288;ENST00000325234	T;T;T	0.48201	0.82;0.82;0.82	5.32	5.32	0.75619	Phospholipase C, phosphoinositol-specific, EF-hand-like (1);EF-hand-like domain (1);	0.060377	0.64402	D	0.000002	T	0.71324	0.3326	M	0.85197	2.74	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.78314	0.977;0.991	T	0.77008	-0.2747	10	0.87932	D	0	.	14.2567	0.66058	0.0:0.0:0.0:1.0	.	197;264	G5E960;Q01970	.;PLCB3_HUMAN	N	264;264;197	ENSP00000279230:Y264N;ENSP00000443631:Y264N;ENSP00000324660:Y197N	ENSP00000279230:Y264N	Y	+	1	0	PLCB3	63780515	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.924000	0.87555	2.019000	0.59389	0.459000	0.35465	TAC	.	.		0.632	PLCB3-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396405.1		
PRSS23	11098	hgsc.bcm.edu	37	11	86518742	86518742	+	Silent	SNP	G	G	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr11:86518742G>C	ENST00000280258.5	+	2	482	c.57G>C	c.(55-57)ggG>ggC	p.G19G	PRSS23_ENST00000441050.1_Silent_p.G19G|PRSS23_ENST00000533902.2_Intron	NM_007173.4	NP_009104.1	O95084	PRS23_HUMAN	protease, serine, 23	19						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				GTGCTGTTGGGCAAGTGAGCC	0.557																																					p.G19G		Atlas-SNP	.											.	PRSS23	49	.	0			c.G57C						.						135.0	138.0	137.0					11																	86518742		2201	4299	6500	SO:0001819	synonymous_variant	11098	exon2			TGTTGGGCAAGTG	AF015287	CCDS8278.1	11q14.2	2010-05-12			ENSG00000150687	ENSG00000150687		"""Serine peptidases / Serine peptidases"""	14370	protein-coding gene	gene with protein product							Standard	XM_005273727		Approved	SPUVE, SIG13	uc001pcb.3	O95084		ENST00000280258.5:c.57G>C	chr11.hg19:g.86518742G>C		99.0	0.0		68.0	28.0	NM_007173	B2RDJ1|B4E2J3|Q6IBI0	Silent	SNP	ENST00000280258.5	hg19	CCDS8278.1																																																																																			.	.		0.557	PRSS23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393805.2	NM_007173	
CNTN1	1272	hgsc.bcm.edu	37	12	41387040	41387040	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr12:41387040A>G	ENST00000551295.2	+	17	2199	c.2082A>G	c.(2080-2082)atA>atG	p.I694M	CNTN1_ENST00000348761.2_Missense_Mutation_p.I683M|CNTN1_ENST00000347616.1_Missense_Mutation_p.I694M	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	694	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				AGCCCAGTATACCATCTAACA	0.398																																					p.I694M		Atlas-SNP	.											.	CNTN1	207	.	0			c.A2082G						.						81.0	81.0	81.0					12																	41387040		2203	4300	6503	SO:0001583	missense	1272	exon17			CAGTATACCATCT	Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.2082A>G	chr12.hg19:g.41387040A>G	ENSP00000447006:p.Ile694Met	136.0	0.0		112.0	38.0	NM_001843	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	ENST00000551295.2	hg19	CCDS8737.1	.	.	.	.	.	.	.	.	.	.	A	10.79	1.448564	0.26074	.	.	ENSG00000018236	ENST00000551295;ENST00000347616;ENST00000348761	T;T;T	0.53857	0.6;0.6;0.6	5.2	5.2	0.72013	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.544953	0.22402	N	0.060529	T	0.25865	0.0630	N	0.02802	-0.49	0.80722	D	1	B;B	0.09022	0.002;0.001	B;B	0.12156	0.007;0.003	T	0.11012	-1.0605	10	0.46703	T	0.11	.	5.8337	0.18594	0.7886:0.0:0.2114:0.0	.	683;694	Q12860-2;Q12860	.;CNTN1_HUMAN	M	694;694;683	ENSP00000447006:I694M;ENSP00000325660:I694M;ENSP00000261160:I683M	ENSP00000325660:I694M	I	+	3	3	CNTN1	39673307	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	1.302000	0.33459	2.083000	0.62718	0.454000	0.30748	ATA	.	.		0.398	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403692.2	NM_001843	
NBEA	26960	hgsc.bcm.edu	37	13	35624441	35624441	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr13:35624441A>G	ENST00000400445.3	+	6	1415	c.881A>G	c.(880-882)cAt>cGt	p.H294R	NBEA_ENST00000379939.2_Missense_Mutation_p.H294R|NBEA_ENST00000540320.1_Missense_Mutation_p.H294R|NBEA_ENST00000310336.4_Missense_Mutation_p.H294R	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	294					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TACTCTGCTCATTTTGTTGGC	0.353																																					p.H294R		Atlas-SNP	.											.	NBEA	340	.	0			c.A881G						.						73.0	63.0	66.0					13																	35624441		1828	4082	5910	SO:0001583	missense	26960	exon6			CTGCTCATTTTGT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.881A>G	chr13.hg19:g.35624441A>G	ENSP00000383295:p.His294Arg	131.0	0.0		78.0	33.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.500365	0.85176	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.84009	0.5378	M	0.77616	2.38	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.85642	0.1277	10	0.56958	D	0.05	.	15.5853	0.76475	1.0:0.0:0.0:0.0	.	294	Q5T321	.	R	294	ENSP00000440951:H294R;ENSP00000383295:H294R;ENSP00000369271:H294R;ENSP00000308534:H294R	ENSP00000308534:H294R	H	+	2	0	NBEA	34522441	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.287000	0.95975	2.146000	0.66826	0.477000	0.44152	CAT	.	.		0.353	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
OR11H12	440153	hgsc.bcm.edu	37	14	19378063	19378063	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr14:19378063C>T	ENST00000550708.1	+	1	542	c.470C>T	c.(469-471)gCc>gTc	p.A157V		NM_001013354.1|NM_001197287.1	NP_001013372.1|NP_001184216.1	B2RN74	O11HC_HUMAN	olfactory receptor, family 11, subfamily H, member 12	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A157D(1)		NS(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	22	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CATCTCTGTGCCAAACTGGTC	0.468																																					p.A157V		Atlas-SNP	.											OR11H12,NS,carcinoma,0,1	OR11H12	58	.	1	Substitution - Missense(1)	lung(1)	c.C470T						.						168.0	179.0	175.0					14																	19378063		2201	4294	6495	SO:0001583	missense	440153	exon1			TCTGTGCCAAACT		CCDS32017.1	14q11.2	2013-01-25			ENSG00000257115	ENSG00000257115		"""GPCR / Class A : Olfactory receptors"""	30738	protein-coding gene	gene with protein product							Standard	NM_001013354		Approved		uc010tkp.2	B2RN74	OTTHUMG00000170298	ENST00000550708.1:c.470C>T	chr14.hg19:g.19378063C>T	ENSP00000449002:p.Ala157Val	530.0	0.0		395.0	35.0	NM_001013354		Missense_Mutation	SNP	ENST00000550708.1	hg19	CCDS32017.1	.	.	.	.	.	.	.	.	.	.	c	0.025	-1.382542	0.01204	.	.	ENSG00000257115	ENST00000550708	T	0.36157	1.27	0.585	0.585	0.17428	GPCR, rhodopsin-like superfamily (1);	1.418070	0.05301	N	0.523033	T	0.16938	0.0407	N	0.11818	0.18	0.23823	N	0.996741	B	0.10296	0.003	B	0.15484	0.013	T	0.24440	-1.0160	9	0.07813	T	0.8	.	3.0137	0.06052	0.0:0.6523:0.0:0.3477	.	157	B2RN74	O11HC_HUMAN	V	157	ENSP00000449002:A157V	ENSP00000449002:A157V	A	+	2	0	CR383656.1	18448063	0.000000	0.05858	0.869000	0.34112	0.213000	0.24496	-2.442000	0.01014	0.619000	0.30197	0.064000	0.15345	GCC	.	.		0.468	OR11H12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408402.1	NM_001013354	
MIPOL1	145282	hgsc.bcm.edu	37	14	37754588	37754588	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr14:37754588T>G	ENST00000327441.7	+	8	1025	c.559T>G	c.(559-561)Tta>Gta	p.L187V	MIPOL1_ENST00000556451.1_Missense_Mutation_p.L156V|MIPOL1_ENST00000537471.1_Missense_Mutation_p.L187V|MIPOL1_ENST00000545536.1_Missense_Mutation_p.L156V|MIPOL1_ENST00000536774.1_Missense_Mutation_p.L6V|MIPOL1_ENST00000539062.2_Missense_Mutation_p.L156V|MIPOL1_ENST00000396294.2_Missense_Mutation_p.L187V	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	187						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		TAGACTGCAATTAGCCATTGA	0.378																																					p.L187V		Atlas-SNP	.											.	MIPOL1	50	.	0			c.T559G						.						216.0	198.0	204.0					14																	37754588		2203	4300	6503	SO:0001583	missense	145282	exon9			CTGCAATTAGCCA	AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.559T>G	chr14.hg19:g.37754588T>G	ENSP00000333539:p.Leu187Val	86.0	0.0		81.0	32.0	NM_001195296	D3DSA4|Q7Z3J0|Q8IV14	Missense_Mutation	SNP	ENST00000327441.7	hg19	CCDS9664.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.374018	0.61735	.	.	ENSG00000151338	ENST00000327441;ENST00000536774;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	T;T;T;T;T;T	0.58060	0.39;0.4;0.36;0.39;0.39;0.36	5.4	3.0	0.34707	.	0.073027	0.56097	D	0.000027	T	0.65101	0.2659	M	0.75777	2.31	0.33826	D	0.629676	D;D	0.76494	0.992;0.999	P;D	0.68353	0.857;0.957	T	0.69339	-0.5171	10	0.31617	T	0.26	-0.5021	7.2328	0.26053	0.13:0.0708:0.0:0.7992	.	187;156	Q8TD10;Q49AL5	MIPO1_HUMAN;.	V	187;6;156;156;187;187;156	ENSP00000333539:L187V;ENSP00000438319:L156V;ENSP00000450479:L156V;ENSP00000379589:L187V;ENSP00000444254:L187V;ENSP00000442529:L156V	ENSP00000333539:L187V	L	+	1	2	MIPOL1	36824339	1.000000	0.71417	0.448000	0.26945	0.990000	0.78478	2.679000	0.46909	0.344000	0.23847	0.459000	0.35465	TTA	.	.		0.378	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276734.1	NM_138731	
LRFN5	145581	hgsc.bcm.edu	37	14	42360572	42360572	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr14:42360572T>C	ENST00000298119.4	+	4	2694	c.1505T>C	c.(1504-1506)gTc>gCc	p.V502A	LRFN5_ENST00000554171.1_Intron|LRFN5_ENST00000554120.1_Intron	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5	502	Fibronectin type-III.					integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GCCACAAGAGTCGTGGGTTGC	0.433										HNSCC(30;0.082)																											p.V502A		Atlas-SNP	.											.	LRFN5	269	.	0			c.T1505C						.						224.0	198.0	207.0					14																	42360572		2203	4300	6503	SO:0001583	missense	145581	exon4			CAAGAGTCGTGGG	AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.1505T>C	chr14.hg19:g.42360572T>C	ENSP00000298119:p.Val502Ala	71.0	0.0		54.0	20.0	NM_152447	B3KU78|Q86XL2	Missense_Mutation	SNP	ENST00000298119.4	hg19	CCDS9678.1	.	.	.	.	.	.	.	.	.	.	T	16.52	3.147527	0.57151	.	.	ENSG00000165379	ENST00000298119	T	0.52526	0.66	5.68	5.68	0.88126	Fibronectin, type III (1);	0.000000	0.49305	D	0.000154	T	0.43853	0.1266	L	0.55481	1.735	0.80722	D	1	B	0.33826	0.427	B	0.33799	0.17	T	0.32771	-0.9894	10	0.26408	T	0.33	.	13.8872	0.63714	0.0:0.0:0.0:1.0	.	502	Q96NI6	LRFN5_HUMAN	A	502	ENSP00000298119:V502A	ENSP00000298119:V502A	V	+	2	0	LRFN5	41430322	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.040000	0.89188	2.159000	0.67721	0.528000	0.53228	GTC	.	.		0.433	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276786.1	NM_152447	
VPS39	23339	hgsc.bcm.edu	37	15	42458377	42458377	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr15:42458377A>T	ENST00000348544.4	-	17	1692	c.1693T>A	c.(1693-1695)Ttc>Atc	p.F565I	VPS39_ENST00000318006.5_Missense_Mutation_p.F554I			Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39 homolog (S. cerevisiae)	565					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	endosome (GO:0005768)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	small GTPase regulator activity (GO:0005083)			breast(2)|kidney(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		TCTTCTGGGAAGTCTCTCAGC	0.493																																					p.F554I		Atlas-SNP	.											.	VPS39	53	.	0			c.T1660A						.						119.0	118.0	118.0					15																	42458377		2203	4299	6502	SO:0001583	missense	23339	exon16			CTGGGAAGTCTCT	AF280814	CCDS10083.1, CCDS73710.1	15q14	2008-02-05	2006-12-19		ENSG00000166887	ENSG00000166887			20593	protein-coding gene	gene with protein product		612188	"""vacuolar protein sorting 39 (yeast)"""			11448994	Standard	XM_005254259		Approved	KIAA0770, VAM6	uc001zpc.3	Q96JC1	OTTHUMG00000130467	ENST00000348544.4:c.1693T>A	chr15.hg19:g.42458377A>T	ENSP00000335193:p.Phe565Ile	127.0	0.0		82.0	27.0	NM_015289	O94869|Q71SQ6|Q7Z3V3|Q96B93|Q96RM0	Missense_Mutation	SNP	ENST00000348544.4	hg19	CCDS10083.1	.	.	.	.	.	.	.	.	.	.	A	13.90	2.374423	0.42105	.	.	ENSG00000166887	ENST00000318006;ENST00000348544	T;T	0.42513	0.97;0.97	5.89	5.89	0.94794	.	0.207418	0.52532	D	0.000076	T	0.29556	0.0737	N	0.22421	0.69	0.39583	D	0.969463	B;B	0.18610	0.009;0.029	B;B	0.23574	0.021;0.047	T	0.15235	-1.0444	10	0.28530	T	0.3	-22.2276	10.6236	0.45495	0.9288:0.0:0.0712:0.0	.	565;554	Q96JC1;Q96JC1-2	VPS39_HUMAN;.	I	554;565	ENSP00000326534:F554I;ENSP00000335193:F565I	ENSP00000326534:F554I	F	-	1	0	VPS39	40245669	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.843000	0.69424	2.254000	0.74563	0.533000	0.62120	TTC	.	.		0.493	VPS39-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000420472.1	NM_015289	
HCN4	10021	hgsc.bcm.edu	37	15	73615463	73615463	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr15:73615463G>T	ENST00000261917.3	-	8	3964	c.2971C>A	c.(2971-2973)Ctg>Atg	p.L991M		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	991	Pro-rich.				blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GGCGTGCTCAGTGGGCCAGTG	0.697																																					p.L991M		Atlas-SNP	.											HCN4,NS,carcinoma,0,1	HCN4	150	.	0			c.C2971A						.						6.0	8.0	7.0					15																	73615463		1978	4069	6047	SO:0001583	missense	10021	exon8			TGCTCAGTGGGCC	AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2971C>A	chr15.hg19:g.73615463G>T	ENSP00000261917:p.Leu991Met	104.0	0.0		57.0	22.0	NM_005477	Q9UMQ7	Missense_Mutation	SNP	ENST00000261917.3	hg19	CCDS10248.1	.	.	.	.	.	.	.	.	.	.	G	0.261	-0.999387	0.02128	.	.	ENSG00000138622	ENST00000261917	D	0.97575	-4.44	2.76	-0.591	0.11675	.	.	.	.	.	D	0.90086	0.6903	N	0.14661	0.345	0.09310	N	1	B	0.25105	0.118	B	0.17722	0.019	T	0.81217	-0.1033	9	0.30078	T	0.28	.	4.6093	0.12395	0.2179:0.1794:0.6027:0.0	.	991	Q9Y3Q4	HCN4_HUMAN	M	991	ENSP00000261917:L991M	ENSP00000261917:L991M	L	-	1	2	HCN4	71402516	0.039000	0.19947	0.001000	0.08648	0.002000	0.02628	2.080000	0.41586	-0.433000	0.07286	-0.537000	0.04273	CTG	.	.		0.697	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268900.2	NM_005477	
IL16	3603	hgsc.bcm.edu	37	15	81598392	81598392	+	Silent	SNP	C	C	G	rs145310121		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr15:81598392C>G	ENST00000302987.4	+	16	3564	c.3564C>G	c.(3562-3564)ccC>ccG	p.P1188P	IL16_ENST00000394660.2_Silent_p.P1188P|RP11-761I4.4_ENST00000607019.1_RNA|IL16_ENST00000394652.2_Silent_p.P487P			Q14005	IL16_HUMAN	interleukin 16	1188	Interaction with PPP1R12A, PPP1R12B and PPP1R12C.|PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						CTCGAGAGCCCAGGCAAGCTG	0.572																																					p.P1188P		Atlas-SNP	.											.	IL16	254	.	0			c.C3564G						.						128.0	129.0	129.0					15																	81598392		2203	4300	6503	SO:0001819	synonymous_variant	3603	exon17			AGAGCCCAGGCAA	U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.3564C>G	chr15.hg19:g.81598392C>G		31.0	0.0		50.0	19.0	NM_001172128	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Silent	SNP	ENST00000302987.4	hg19	CCDS42069.1																																																																																			.	C|1.000;T|0.000		0.572	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000303952.1	NM_172217	
IGF1R	3480	hgsc.bcm.edu	37	15	99465501	99465501	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr15:99465501C>A	ENST00000268035.6	+	11	2937	c.2326C>A	c.(2326-2328)Cct>Act	p.P776T	IGF1R_ENST00000558762.1_Missense_Mutation_p.P776T	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	776	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GACAGAGTACCCTTTCTTTGA	0.527																																					p.P776T		Atlas-SNP	.											.	IGF1R	147	.	0			c.C2326A						.						107.0	105.0	106.0					15																	99465501		2197	4297	6494	SO:0001583	missense	3480	exon11			GAGTACCCTTTCT	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2326C>A	chr15.hg19:g.99465501C>A	ENSP00000268035:p.Pro776Thr	93.0	0.0		82.0	26.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	hg19	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523365	0.64747	.	.	ENSG00000140443	ENST00000268035	T	0.73897	-0.79	5.49	5.49	0.81192	Fibronectin, type III (2);	0.000000	0.56097	D	0.000021	T	0.75737	0.3890	M	0.76574	2.34	0.80722	D	1	P;B	0.42010	0.768;0.017	B;B	0.37692	0.256;0.008	T	0.78600	-0.2141	10	0.48119	T	0.1	.	19.3821	0.94542	0.0:1.0:0.0:0.0	.	776;776	C9J5X1;P08069	.;IGF1R_HUMAN	T	776	ENSP00000268035:P776T	ENSP00000268035:P776T	P	+	1	0	IGF1R	97283024	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	3.880000	0.56145	2.562000	0.86427	0.650000	0.86243	CCT	.	.		0.527	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
PDIA2	64714	hgsc.bcm.edu	37	16	335428	335428	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr16:335428C>A	ENST00000219406.6	+	6	930	c.912C>A	c.(910-912)ttC>ttA	p.F304L	PDIA2_ENST00000404312.1_Missense_Mutation_p.F301L|PDIA2_ENST00000462950.1_3'UTR	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	304					cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				CTCCCCGCTTCCGGGGGCAGG	0.682																																					p.F304L		Atlas-SNP	.											.	PDIA2	51	.	0			c.C912A						.						16.0	18.0	18.0					16																	335428		1842	4083	5925	SO:0001583	missense	64714	exon6			CCGCTTCCGGGGG	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.912C>A	chr16.hg19:g.335428C>A	ENSP00000219406:p.Phe304Leu	33.0	0.0		45.0	13.0	NM_006849	A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Missense_Mutation	SNP	ENST00000219406.6	hg19	CCDS42089.1	.	.	.	.	.	.	.	.	.	.	c	13.73	2.325259	0.41197	.	.	ENSG00000185615	ENST00000219406;ENST00000455994;ENST00000404312	T;T	0.11385	2.78;2.78	4.03	4.03	0.46877	Thioredoxin-like fold (1);	0.055174	0.64402	D	0.000001	T	0.29817	0.0745	M	0.83223	2.63	0.51767	D	0.99993	P	0.49961	0.93	P	0.61722	0.893	T	0.02868	-1.1100	10	0.87932	D	0	.	8.9865	0.35997	0.0:0.8943:0.0:0.1057	.	304	Q13087	PDIA2_HUMAN	L	304;273;301	ENSP00000219406:F304L;ENSP00000384410:F301L	ENSP00000219406:F304L	F	+	3	2	PDIA2	275429	0.950000	0.32346	0.941000	0.38009	0.207000	0.24258	0.162000	0.16501	2.092000	0.63282	0.486000	0.48141	TTC	.	.		0.682	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849	
ZNF768	79724	hgsc.bcm.edu	37	16	30536540	30536540	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr16:30536540G>T	ENST00000380412.5	-	2	1096	c.921C>A	c.(919-921)caC>caA	p.H307Q	ZNF768_ENST00000562803.1_Missense_Mutation_p.H276Q	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	307					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						GGGTGCGCTGGTGTTTGATGA	0.612																																					p.H307Q		Atlas-SNP	.											.	ZNF768	28	.	0			c.C921A						.						82.0	81.0	81.0					16																	30536540		2197	4300	6497	SO:0001583	missense	79724	exon2			GCGCTGGTGTTTG	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.921C>A	chr16.hg19:g.30536540G>T	ENSP00000369777:p.His307Gln	64.0	0.0		61.0	21.0	NM_024671	Q569L7|Q96CX4	Missense_Mutation	SNP	ENST00000380412.5	hg19	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	G	18.29	3.592346	0.66219	.	.	ENSG00000169957	ENST00000380412	D	0.86865	-2.18	4.7	3.67	0.42095	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.46758	D	0.000272	D	0.93249	0.7849	M	0.91818	3.245	0.34117	D	0.663656	D	0.69078	0.997	D	0.71870	0.975	D	0.94734	0.7912	10	0.87932	D	0	-16.102	8.1632	0.31211	0.1661:0.0:0.8339:0.0	.	307	Q9H5H4	ZN768_HUMAN	Q	307	ENSP00000369777:H307Q	ENSP00000369777:H307Q	H	-	3	2	ZNF768	30444041	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.034000	0.49751	2.448000	0.82819	0.407000	0.27541	CAC	.	.		0.612	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671	
LCAT	3931	hgsc.bcm.edu	37	16	67977971	67977971	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr16:67977971T>G	ENST00000264005.5	-	1	63	c.34A>C	c.(34-36)Acg>Ccg	p.T12P	CTC-479C5.17_ENST00000590594.1_lincRNA|SLC12A4_ENST00000422611.2_3'UTR	NM_000229.1	NP_000220.1	P04180	LCAT_HUMAN	lecithin-cholesterol acyltransferase	12					cholesterol esterification (GO:0034435)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|high-density lipoprotein particle remodeling (GO:0034375)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of high-density lipoprotein particle assembly (GO:0090107)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)	apolipoprotein A-I binding (GO:0034186)|phosphatidylcholine-sterol O-acyltransferase activity (GO:0004607)			cervix(4)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)	16		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00418)|Epithelial(162;0.0183)|all cancers(182;0.12)		AGCAGCAGCGTCACCCACTGC	0.662																																					p.T12P		Atlas-SNP	.											.	LCAT	31	.	0			c.A34C						.						13.0	13.0	13.0					16																	67977971		1958	3860	5818	SO:0001583	missense	3931	exon1			GCAGCGTCACCCA		CCDS10854.1	16q22.1	2012-10-02			ENSG00000213398	ENSG00000213398	2.3.1.43		6522	protein-coding gene	gene with protein product		606967					Standard	NM_000229		Approved		uc002euy.1	P04180	OTTHUMG00000137551	ENST00000264005.5:c.34A>C	chr16.hg19:g.67977971T>G	ENSP00000264005:p.Thr12Pro	143.0	0.0		101.0	39.0	NM_000229	Q53XQ3	Missense_Mutation	SNP	ENST00000264005.5	hg19	CCDS10854.1	.	.	.	.	.	.	.	.	.	.	T	7.861	0.726005	0.15439	.	.	ENSG00000213398	ENST00000264005	D	0.96491	-4.03	4.55	3.6	0.41247	.	1.493400	0.04986	N	0.466591	D	0.91379	0.7280	N	0.08118	0	0.40066	D	0.97595	B	0.02656	0.0	B	0.01281	0.0	T	0.77864	-0.2429	10	0.48119	T	0.1	.	10.4368	0.44441	0.0:0.0:0.8041:0.1959	.	12	P04180	LCAT_HUMAN	P	12	ENSP00000264005:T12P	ENSP00000264005:T12P	T	-	1	0	LCAT	66535472	0.737000	0.28175	0.985000	0.45067	0.752000	0.42762	0.712000	0.25779	1.067000	0.40740	-0.708000	0.03648	ACG	.	.		0.662	LCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268885.3		
PLEKHM1	9842	hgsc.bcm.edu	37	17	43531021	43531021	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr17:43531021C>A	ENST00000430334.3	-	7	2330	c.2197G>T	c.(2197-2199)Gac>Tac	p.D733Y	PLEKHM1_ENST00000421073.2_Missense_Mutation_p.D644Y|AC091132.1_ENST00000433601.1_RNA	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1	733	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					GGCAGGATGTCCCGGATGGTC	0.562																																					p.D733Y		Atlas-SNP	.											.	PLEKHM1	69	.	0			c.G2197T						.						9.0	8.0	8.0					17																	43531021		2079	4103	6182	SO:0001583	missense	9842	exon7			GGATGTCCCGGAT	X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.2197G>T	chr17.hg19:g.43531021C>A	ENSP00000389913:p.Asp733Tyr	162.0	0.0		139.0	52.0	NM_014798	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	Missense_Mutation	SNP	ENST00000430334.3	hg19	CCDS32671.1	.	.	.	.	.	.	.	.	.	.	C	16.01	3.000014	0.54147	.	.	ENSG00000225190	ENST00000430334;ENST00000446609;ENST00000421073	T;T	0.62788	0.0;0.0	4.91	4.91	0.64330	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.71117	0.3302	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.994	T	0.74244	-0.3728	10	0.72032	D	0.01	.	16.8908	0.86087	0.0:1.0:0.0:0.0	.	644;682;733	F8W648;B4DRX1;Q9Y4G2	.;.;PKHM1_HUMAN	Y	733;682;644	ENSP00000389913:D733Y;ENSP00000414352:D644Y	ENSP00000414352:D644Y	D	-	1	0	PLEKHM1	40886804	1.000000	0.71417	0.997000	0.53966	0.233000	0.25261	7.279000	0.78599	2.572000	0.86782	0.586000	0.80456	GAC	.	.		0.562	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444659.1	NM_014798	
NOTUM	147111	hgsc.bcm.edu	37	17	79914895	79914895	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr17:79914895T>A	ENST00000409678.3	-	7	1134	c.751A>T	c.(751-753)Aag>Tag	p.K251*		NM_178493.5	NP_848588.3	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog (Drosophila)	251						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	15	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			TAGCCCAGCTTCTCCAGCTGC	0.652																																					p.K251X		Atlas-SNP	.											.	NOTUM	50	.	0			c.A751T						.						71.0	58.0	62.0					17																	79914895		2203	4300	6503	SO:0001587	stop_gained	147111	exon7			CCAGCTTCTCCAG	BC060882	CCDS32771.2	17q25.3	2008-02-05			ENSG00000185269	ENSG00000185269			27106	protein-coding gene	gene with protein product		609847					Standard	NM_178493		Approved		uc010wvg.2	Q6P988	OTTHUMG00000154416	ENST00000409678.3:c.751A>T	chr17.hg19:g.79914895T>A	ENSP00000387310:p.Lys251*	41.0	0.0		39.0	11.0	NM_178493	Q8N410|Q8NI82	Nonsense_Mutation	SNP	ENST00000409678.3	hg19	CCDS32771.2	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982752	0.93044	.	.	ENSG00000185269	ENST00000409678;ENST00000425009	.	.	.	4.54	3.54	0.40534	.	0.297193	0.37053	N	0.002272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	.	9.0322	0.36264	0.0:0.643:0.2784:0.0786	.	.	.	.	X	251	.	ENSP00000387310:K251X	K	-	1	0	NOTUM	77508185	1.000000	0.71417	0.998000	0.56505	0.697000	0.40408	2.238000	0.43070	0.330000	0.23485	-0.642000	0.03964	AAG	.	.		0.652	NOTUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335123.2	NM_178493	
HMHA1	23526	hgsc.bcm.edu	37	19	1084297	1084297	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr19:1084297G>A	ENST00000313093.2	+	22	3247	c.3016G>A	c.(3016-3018)Gag>Aag	p.E1006K	HMHA1_ENST00000591169.1_3'UTR|HMHA1_ENST00000590577.1_Missense_Mutation_p.E641K|HMHA1_ENST00000590214.1_Missense_Mutation_p.E1033K|HMHA1_ENST00000586866.1_Missense_Mutation_p.E1010K|HMHA1_ENST00000543365.1_Missense_Mutation_p.E889K|HMHA1_ENST00000536472.1_Missense_Mutation_p.E874K|HMHA1_ENST00000539243.2_Missense_Mutation_p.E1022K	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	1006					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGGCGGGCGAGGCGGTGGT	0.687																																					p.E1022K		Atlas-SNP	.											.	HMHA1	78	.	0			c.G3064A						.						52.0	54.0	53.0					19																	1084297		2203	4294	6497	SO:0001583	missense	23526	exon22			GCGGGCGAGGCGG	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.3016G>A	chr19.hg19:g.1084297G>A	ENSP00000316772:p.Glu1006Lys	146.0	0.0		109.0	10.0	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	hg19	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	G	6.135	0.393087	0.11638	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.21932	2.02;2.04;2.02;1.98	3.85	1.6	0.23607	.	1.281560	0.05837	N	0.618602	T	0.15609	0.0376	L	0.40543	1.245	0.09310	N	1	B;B;B;B;B;B	0.21381	0.055;0.055;0.033;0.001;0.055;0.019	B;B;B;B;B;B	0.10450	0.005;0.005;0.002;0.002;0.005;0.002	T	0.34179	-0.9839	10	0.08381	T	0.77	-3.2296	6.8237	0.23870	0.2324:0.0:0.7676:0.0	.	874;1022;888;641;889;1006	F5H4A3;F6QP70;B3KXW7;B3KVA9;F5H1R4;Q92619	.;.;.;.;.;HMHA1_HUMAN	K	1022;1006;874;1000;889	ENSP00000439601:E1022K;ENSP00000316772:E1006K;ENSP00000445109:E874K;ENSP00000438979:E889K	ENSP00000316772:E1006K	E	+	1	0	HMHA1	1035297	0.590000	0.26815	0.000000	0.03702	0.010000	0.07245	1.452000	0.35156	0.227000	0.20999	-0.258000	0.10820	GAG	.	.		0.687	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
ZNF560	147741	hgsc.bcm.edu	37	19	9583900	9583900	+	Silent	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr19:9583900A>G	ENST00000301480.4	-	5	406	c.193T>C	c.(193-195)Ttg>Ctg	p.L65L		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	65	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TCTTCTTCCAACCAAGAGATG	0.433																																					p.L65L		Atlas-SNP	.											.	ZNF560	162	.	0			c.T193C						.						188.0	189.0	188.0					19																	9583900		2203	4300	6503	SO:0001819	synonymous_variant	147741	exon5			CTTCCAACCAAGA	AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.193T>C	chr19.hg19:g.9583900A>G		51.0	0.0		28.0	9.0	NM_152476	Q495S9|Q495T1	Silent	SNP	ENST00000301480.4	hg19	CCDS12214.1																																																																																			.	.		0.433	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449901.1	NM_152476	
KCTD15	79047	hgsc.bcm.edu	37	19	34291425	34291425	+	Splice_Site	SNP	G	G	T	rs142074601		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr19:34291425G>T	ENST00000430256.3	+	2	474	c.66G>T	c.(64-66)gcG>gcT	p.A22A	KCTD15_ENST00000589786.1_Splice_Site_p.A22A|KCTD15_ENST00000284006.6_Splice_Site_p.A22A|KCTD15_ENST00000588881.1_Splice_Site_p.A22A			Q96SI1	KCD15_HUMAN	potassium channel tetramerization domain containing 15	22					multicellular organismal development (GO:0007275)|protein homooligomerization (GO:0051260)					endometrium(1)|lung(2)|pancreas(1)|urinary_tract(1)	5	Esophageal squamous(110;0.162)					CCGGCACCGCGGTGAGCCTGC	0.642																																					p.A22A	Melanoma(36;646 1094 5145 14504 45302)|GBM(25;193 541 1518 14388 52178)	Atlas-SNP	.											.	KCTD15	18	.	0			c.G66T						.						15.0	17.0	17.0					19																	34291425		2199	4288	6487	SO:0001630	splice_region_variant	79047	exon3			CACCGCGGTGAGC	AK025590	CCDS12434.1, CCDS46039.1	19q13.12	2013-06-20	2013-06-20			ENSG00000153885			23297	protein-coding gene	gene with protein product		615240	"""potassium channel tetramerisation domain containing 15"""			12477932	Standard	NM_024076		Approved	MGC25497	uc002nuw.4	Q96SI1		ENST00000430256.3:c.66+1G>T	chr19.hg19:g.34291425G>T		153.0	0.0		136.0	59.0	NM_001129995	A8K600|Q9BVI6	Silent	SNP	ENST00000430256.3	hg19	CCDS46039.1																																																																																			.	G|1.000;A|0.000		0.642	KCTD15-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451462.2	NM_024076	Silent
UBA2	10054	hgsc.bcm.edu	37	19	34925843	34925843	+	Silent	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr19:34925843G>A	ENST00000246548.4	+	5	499	c.429G>A	c.(427-429)ggG>ggA	p.G143G	UBA2_ENST00000439527.2_Silent_p.G47G	NM_005499.2	NP_005490.1	Q9UBT2	SAE2_HUMAN	ubiquitin-like modifier activating enzyme 2	143					cellular protein metabolic process (GO:0044267)|positive regulation of catalytic activity (GO:0043085)|post-translational protein modification (GO:0043687)|protein sumoylation (GO:0016925)|SMT3-dependent protein catabolic process (GO:0019950)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|SUMO activating enzyme complex (GO:0031510)	ATP binding (GO:0005524)|enzyme activator activity (GO:0008047)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|SUMO activating enzyme activity (GO:0019948)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	20	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.211)			GAACAGCTGGGTATCTTGGAC	0.358																																					p.G143G		Atlas-SNP	.											.	UBA2	53	.	0			c.G429A						.						40.0	39.0	39.0					19																	34925843		2202	4300	6502	SO:0001819	synonymous_variant	10054	exon5			AGCTGGGTATCTT	BC003153	CCDS12439.1	19q13.11	2008-02-05	2007-11-30	2007-11-30		ENSG00000126261		"""Ubiquitin-like modifier activating enzymes"""	30661	protein-coding gene	gene with protein product	"""UBA2, ubiquitin-activating enzyme E1 homolog (yeast)"""	613295	"""SUMO1 activating enzyme subunit 2"""	SAE2		10187858, 9920803	Standard	NM_005499		Approved	FLJ13058, HRIHFB2115, ARX	uc002nvk.3	Q9UBT2		ENST00000246548.4:c.429G>A	chr19.hg19:g.34925843G>A		421.0	0.0		338.0	129.0	NM_005499	B3KWB9|O95605|Q59H87|Q6IBP6|Q9NTJ1|Q9UED2	Silent	SNP	ENST00000246548.4	hg19	CCDS12439.1																																																																																			.	.		0.358	UBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459257.3	NM_005499	
ZNF30	90075	hgsc.bcm.edu	37	19	35435358	35435358	+	Silent	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr19:35435358C>T	ENST00000601142.1	+	5	1725	c.1488C>T	c.(1486-1488)gcC>gcT	p.A496A	ZNF30_ENST00000439785.1_Silent_p.A497A|ZNF30_ENST00000601957.1_3'UTR|ZNF30_ENST00000426813.2_Silent_p.A415A|ZNF30_ENST00000303586.7_Silent_p.A497A			P17039	ZNF30_HUMAN	zinc finger protein 30	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)	16	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		TTAGTCGAGCCTCGTACCTTG	0.453																																					p.A497A		Atlas-SNP	.											.	ZNF30	44	.	0			c.C1491T						.						87.0	94.0	91.0					19																	35435358		2196	4299	6495	SO:0001819	synonymous_variant	90075	exon5			TCGAGCCTCGTAC	X52359	CCDS46044.1, CCDS46045.1	19q13.13	2013-01-08	2006-05-10			ENSG00000168661		"""Zinc fingers, C2H2-type"", ""-"""	13090	protein-coding gene	gene with protein product			"""zinc finger protein 30 (KOX 28)"""				Standard	NM_001099437		Approved	KOX28, DKFZp686N19164, FLJ20562	uc010edq.1	P17039		ENST00000601142.1:c.1488C>T	chr19.hg19:g.35435358C>T		73.0	0.0		71.0	23.0	NM_001099438	A5PLP1|A8K320|B4DIC0|Q6N068	Silent	SNP	ENST00000601142.1	hg19	CCDS46045.1																																																																																			.	.		0.453	ZNF30-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464432.1	NM_194325	
ZNF114	163071	hgsc.bcm.edu	37	19	48789079	48789079	+	Silent	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr19:48789079A>G	ENST00000595607.1	+	6	692	c.198A>G	c.(196-198)agA>agG	p.R66R	ZNF114_ENST00000315849.1_Silent_p.R66R|ZNF114_ENST00000597695.1_Silent_p.R32R|ZNF114_ENST00000600687.1_Silent_p.R66R			Q8NC26	ZN114_HUMAN	zinc finger protein 114	66	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(6)|lung(11)	18		all_epithelial(76;8.01e-05)|all_lung(116;0.000112)|Lung NSC(112;0.000192)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;7.56e-05)|all cancers(93;0.000113)|Epithelial(262;0.00962)|GBM - Glioblastoma multiforme(486;0.0153)		TTCCTAAAAGAACATTTCCTG	0.443																																					p.R66R		Atlas-SNP	.											.	ZNF114	46	.	0			c.A198G						.						91.0	84.0	86.0					19																	48789079		2203	4300	6503	SO:0001819	synonymous_variant	163071	exon5			TAAAAGAACATTT	BC014935	CCDS12713.1, CCDS74412.1	19q13.32	2013-01-08			ENSG00000178150	ENSG00000178150		"""Zinc fingers, C2H2-type"", ""-"""	12894	protein-coding gene	gene with protein product		603996					Standard	XM_005258580		Approved	MGC17986	uc002pim.1	Q8NC26		ENST00000595607.1:c.198A>G	chr19.hg19:g.48789079A>G		139.0	0.0		88.0	37.0	NM_153608	A8K6B0|Q08AQ6	Silent	SNP	ENST00000595607.1	hg19	CCDS12713.1																																																																																			.	.		0.443	ZNF114-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465601.1	NM_153608	
PPP6R1	22870	hgsc.bcm.edu	37	19	55751023	55751023	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr19:55751023C>T	ENST00000412770.2	-	14	2158	c.1592G>A	c.(1591-1593)aGt>aAt	p.S531N	PPP6R1_ENST00000587283.1_Missense_Mutation_p.S531N	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	531					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CTCATCGTCACTGGAGGAGTG	0.657																																					p.S531N		Atlas-SNP	.											.	PPP6R1	63	.	0			c.G1592A						.						58.0	63.0	61.0					19																	55751023		2104	4197	6301	SO:0001583	missense	22870	exon14			TCGTCACTGGAGG	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.1592G>A	chr19.hg19:g.55751023C>T	ENSP00000414202:p.Ser531Asn	62.0	0.0		61.0	18.0	NM_014931	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	ENST00000412770.2	hg19	CCDS46186.1	.	.	.	.	.	.	.	.	.	.	C	17.53	3.411497	0.62399	.	.	ENSG00000105063	ENST00000412770	T	0.53857	0.6	5.04	4.01	0.46588	.	0.071856	0.56097	N	0.000037	T	0.65471	0.2694	L	0.55213	1.73	0.35795	D	0.82266	D	0.89917	1.0	D	0.73380	0.98	T	0.73275	-0.4034	10	0.46703	T	0.11	-18.0612	12.9362	0.58316	0.0:0.9197:0.0:0.0803	.	531	Q9UPN7	PP6R1_HUMAN	N	531	ENSP00000414202:S531N	ENSP00000414202:S531N	S	-	2	0	PPP6R1	60442835	1.000000	0.71417	0.988000	0.46212	0.392000	0.30506	5.298000	0.65710	1.497000	0.48584	0.650000	0.86243	AGT	.	.		0.657	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
ZNF335	63925	hgsc.bcm.edu	37	20	44590731	44590731	+	Missense_Mutation	SNP	C	C	A	rs140842666		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr20:44590731C>A	ENST00000322927.2	-	10	1724	c.1624G>T	c.(1624-1626)Gcc>Tcc	p.A542S	ZNF335_ENST00000426788.1_Missense_Mutation_p.A387S	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	542					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				TGCACAGCGGCGTGCCGAATG	0.627																																					p.A542S		Atlas-SNP	.											.	ZNF335	115	.	0			c.G1624T						.						143.0	114.0	124.0					20																	44590731		2203	4300	6503	SO:0001583	missense	63925	exon10			CAGCGGCGTGCCG	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.1624G>T	chr20.hg19:g.44590731C>A	ENSP00000325326:p.Ala542Ser	25.0	0.0		33.0	13.0	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	hg19	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	C	6.876	0.531010	0.13127	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.28255	1.62;1.62	4.87	3.86	0.44501	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.302185	0.31989	N	0.006749	T	0.09818	0.0241	N	0.01576	-0.805	0.37479	D	0.915939	B;B	0.19073	0.008;0.033	B;B	0.15052	0.009;0.012	T	0.22034	-1.0228	10	0.09084	T	0.74	-21.3424	10.2106	0.43138	0.347:0.653:0.0:0.0	.	387;542	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	S	542;319;387	ENSP00000325326:A542S;ENSP00000397098:A387S	ENSP00000243961:A319S	A	-	1	0	ZNF335	44024138	1.000000	0.71417	0.468000	0.27192	0.198000	0.23893	5.009000	0.63998	2.526000	0.85167	0.491000	0.48974	GCC	.	C|1.000;T|0.000		0.627	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
LCA5L	150082	hgsc.bcm.edu	37	21	40778273	40778273	+	Silent	SNP	G	G	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr21:40778273G>T	ENST00000358268.2	-	10	2076	c.1548C>A	c.(1546-1548)ggC>ggA	p.G516G	LCA5L_ENST00000288350.3_Silent_p.G516G|LCA5L_ENST00000380671.2_Silent_p.G516G|WRB_ENST00000541890.1_Intron|LCA5L_ENST00000495240.1_5'UTR			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	516										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				GTCTGAGGGGGCCTTTCGTGT	0.473																																					p.G516G		Atlas-SNP	.											.	LCA5L	57	.	0			c.C1548A						.						111.0	92.0	98.0					21																	40778273		2203	4300	6503	SO:0001819	synonymous_variant	150082	exon10			GAGGGGGCCTTTC	AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1548C>A	chr21.hg19:g.40778273G>T		90.0	0.0		99.0	4.0	NM_152505	D3DSI0|Q3ZCT0	Silent	SNP	ENST00000358268.2	hg19	CCDS13665.1																																																																																			.	.		0.473	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141807.2	NM_152505	
C22orf39	128977	hgsc.bcm.edu	37	22	19435059	19435059	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr22:19435059G>A	ENST00000399562.4	-	2	577	c.145C>T	c.(145-147)Ccc>Tcc	p.P49S	C22orf39_ENST00000542103.1_Missense_Mutation_p.P49S|AC000068.5_ENST00000431090.1_RNA|HIRA_ENST00000546308.1_5'UTR|C22orf39_ENST00000399568.1_Missense_Mutation_p.P12S|C22orf39_ENST00000333059.5_Missense_Mutation_p.P12S|HIRA_ENST00000541063.1_Intron	NM_173793.4	NP_776154.3	Q6P5X5	CV039_HUMAN	chromosome 22 open reading frame 39	49												Colorectal(54;0.0993)					GCCTCGCAGGGGCGCGGCGGC	0.756																																					p.P49S		Atlas-SNP	.											.	C22orf39	11	.	0			c.C145T						.						2.0	3.0	3.0					22																	19435059		1722	3580	5302	SO:0001583	missense	128977	exon2			CGCAGGGGCGCGG		CCDS33599.1, CCDS33599.2, CCDS54498.1	22q11.21	2008-10-31			ENSG00000242259	ENSG00000242259			27012	protein-coding gene	gene with protein product							Standard	NM_173793		Approved	MGC74441	uc002zpk.2	Q6P5X5	OTTHUMG00000150137	ENST00000399562.4:c.145C>T	chr22.hg19:g.19435059G>A	ENSP00000382474:p.Pro49Ser	13.0	0.0		33.0	14.0	NM_173793	A8MTW6|D3DX18|F5H3A8|J3KNP9	Missense_Mutation	SNP	ENST00000399562.4	hg19	CCDS33599.2	.	.	.	.	.	.	.	.	.	.	G	16.90	3.250273	0.59212	.	.	ENSG00000242259	ENST00000399568;ENST00000542103;ENST00000399562;ENST00000333059	.	.	.	5.91	2.57	0.30868	.	0.567884	0.17718	N	0.164343	T	0.37625	0.1010	M	0.64260	1.97	0.28944	N	0.890821	B;B	0.20887	0.018;0.049	B;B	0.21151	0.011;0.033	T	0.27606	-1.0069	8	.	.	.	-33.0879	2.2481	0.04036	0.2197:0.1825:0.4621:0.1357	.	12;49	Q6P5X5;F5H3A8	CV039_HUMAN;.	S	12;49;12;49	.	.	P	-	1	0	C22orf39	17815059	0.053000	0.20554	0.999000	0.59377	0.973000	0.67179	0.315000	0.19451	0.839000	0.34971	-0.152000	0.13540	CCC	.	.		0.756	C22orf39-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000316494.3	NM_173793	
XG	7499	hgsc.bcm.edu	37	X	2712585	2712585	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chrX:2712585A>G	ENST00000381174.5	+	6	488	c.263A>G	c.(262-264)aAt>aGt	p.N88S	XG_ENST00000419513.2_Missense_Mutation_p.N88S|XG_ENST00000426774.1_Missense_Mutation_p.N89S			P55808	XG_HUMAN	Xg blood group	88						integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(3)|ovary(1)	8		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				GGTTACTTCAATGATGTGGAC	0.617																																					p.N89S		Atlas-SNP	.											.	XG	22	.	0			c.A266G						.						60.0	48.0	52.0					X																	2712585		2203	4298	6501	SO:0001583	missense	7499	exon6			ACTTCAATGATGT	AF380356	CCDS14120.1, CCDS48073.1	Xp22.32	2014-07-19	2006-01-12		ENSG00000124343	ENSG00000124343		"""Blood group antigens"", ""Pseudoautosomal regions / PAR1"""	12806	protein-coding gene	gene with protein product		300879	"""Xg blood group (pseudoautosomal boundary-divided on the X chromosome)"""	PBDX		8054981	Standard	NM_175569		Approved		uc004cqp.3	P55808	OTTHUMG00000021075	ENST00000381174.5:c.263A>G	chrX.hg19:g.2712585A>G	ENSP00000370566:p.Asn88Ser	57.0	0.0		71.0	62.0	NM_001141920	E9PCH1|Q496N8|Q496N9|Q496P0|Q71BZ5	Missense_Mutation	SNP	ENST00000381174.5	hg19	CCDS14120.1	.	.	.	.	.	.	.	.	.	.	a	6.207	0.406353	0.11754	.	.	ENSG00000124343	ENST00000381174;ENST00000419513;ENST00000426774;ENST00000509484	T;T;T;T	0.15372	2.43;2.43;2.43;2.43	1.95	-0.83	0.10792	.	0.909679	0.09269	U	0.825452	T	0.05135	0.0137	N	0.03324	-0.35	0.09310	N	1	B;B	0.10296	0.001;0.003	B;B	0.14023	0.01;0.006	T	0.40572	-0.9556	10	0.02654	T	1	.	4.5196	0.11952	0.5027:0.0:0.4973:0.0	.	88;88	P55808;P55808-3	XG_HUMAN;.	S	88;88;89;66	ENSP00000370566:N88S;ENSP00000411004:N88S;ENSP00000398503:N89S;ENSP00000430005:N66S	ENSP00000370566:N88S	N	+	2	0	XG	2722585	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.086000	0.14935	-0.240000	0.09696	0.478000	0.44815	AAT	.	.		0.617	XG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055633.2	NM_175569	
STAG2	10735	hgsc.bcm.edu	37	X	123182871	123182871	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chrX:123182871A>G	ENST00000371160.1	+	10	1126	c.836A>G	c.(835-837)gAt>gGt	p.D279G	STAG2_ENST00000354548.5_Missense_Mutation_p.D210G|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.D279G|STAG2_ENST00000371157.3_Missense_Mutation_p.D279G|STAG2_ENST00000371144.3_Missense_Mutation_p.D279G|STAG2_ENST00000371145.3_Missense_Mutation_p.D279G	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	279					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GAAAATCAAGATGAAATAGAA	0.284																																					p.D279G		Atlas-SNP	.											.	STAG2	309	.	0			c.A836G						.						95.0	88.0	90.0					X																	123182871		2203	4297	6500	SO:0001583	missense	10735	exon10			ATCAAGATGAAAT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.836A>G	chrX.hg19:g.123182871A>G	ENSP00000360202:p.Asp279Gly	337.0	0.0		627.0	192.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	hg19	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.542588	0.85917	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42;1.42;1.42	5.61	5.61	0.85477	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.49287	0.1548	M	0.80422	2.495	0.80722	D	1	P;P	0.41008	0.735;0.616	P;B	0.49853	0.624;0.418	T	0.51293	-0.8724	10	0.48119	T	0.1	-1.4563	14.3807	0.66908	1.0:0.0:0.0:0.0	.	279;279	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	G	279;279;210;279;279;279;279	ENSP00000218089:D279G;ENSP00000397265:D279G;ENSP00000346555:D210G;ENSP00000360202:D279G;ENSP00000360199:D279G;ENSP00000360187:D279G;ENSP00000360186:D279G	ENSP00000218089:D279G	D	+	2	0	STAG2	123010552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.228000	0.95250	1.860000	0.53959	0.486000	0.48141	GAT	.	.		0.284	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
SMARCA1	6594	hgsc.bcm.edu	37	X	128645791	128645791	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chrX:128645791T>C	ENST00000371122.4	-	6	929	c.800A>G	c.(799-801)aAg>aGg	p.K267R	SMARCA1_ENST00000371121.3_Missense_Mutation_p.K267R|SMARCA1_ENST00000371123.1_Missense_Mutation_p.K267R|SMARCA1_ENST00000478420.1_5'UTR	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	267	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						TCTGGCATCCTTGTCTCCGAC	0.363																																					p.K267R		Atlas-SNP	.											.	SMARCA1	126	.	0			c.A800G						.						123.0	119.0	120.0					X																	128645791		2203	4300	6503	SO:0001583	missense	6594	exon6			GCATCCTTGTCTC	M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.800A>G	chrX.hg19:g.128645791T>C	ENSP00000360163:p.Lys267Arg	156.0	0.0		434.0	406.0	NM_139035	Q5JV41|Q5JV42	Missense_Mutation	SNP	ENST00000371122.4	hg19	CCDS14612.1	.	.	.	.	.	.	.	.	.	.	T	16.06	3.015612	0.54468	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23	5.5	5.5	0.81552	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.64402	D	0.000002	D	0.89924	0.6856	L	0.37697	1.125	0.50467	D	0.999873	B;B;B;B	0.14012	0.009;0.009;0.007;0.009	B;B;B;B	0.17979	0.013;0.02;0.011;0.02	D	0.86433	0.1762	10	0.54805	T	0.06	-15.7599	14.5783	0.68265	0.0:0.0:0.0:1.0	.	246;267;267;267	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	R	267;267;267;246	ENSP00000360162:K267R;ENSP00000360164:K267R;ENSP00000360163:K267R;ENSP00000404275:K246R	ENSP00000360162:K267R	K	-	2	0	SMARCA1	128473472	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.953000	0.63624	1.823000	0.53134	0.486000	0.48141	AAG	.	.		0.363	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058206.1	NM_003069	
SAGE1	55511	hgsc.bcm.edu	37	X	134990278	134990278	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chrX:134990278A>T	ENST00000370709.3	+	10	1190	c.1190A>T	c.(1189-1191)gAg>gTg	p.E397V	SAGE1_ENST00000324447.3_Missense_Mutation_p.E397V|SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000535938.1_Missense_Mutation_p.E397V			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	397						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					CTGCGTGAAGAGAAGAAAGAT	0.463																																					p.E397V		Atlas-SNP	.											.	SAGE1	160	.	0			c.A1190T						.						159.0	135.0	143.0					X																	134990278		2203	4300	6503	SO:0001583	missense	55511	exon11			GTGAAGAGAAGAA	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.1190A>T	chrX.hg19:g.134990278A>T	ENSP00000359743:p.Glu397Val	101.0	0.0		193.0	172.0	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	hg19	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	A	12.37	1.917113	0.33815	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.49720	0.77;0.77;0.77	1.17	1.17	0.20885	.	.	.	.	.	T	0.47266	0.1436	L	0.29908	0.895	0.09310	N	0.999994	D	0.69078	0.997	D	0.66497	0.944	T	0.25950	-1.0117	9	0.36615	T	0.2	.	4.2197	0.10552	1.0:0.0:0.0:0.0	.	397	Q9NXZ1	SAGE1_HUMAN	V	397	ENSP00000323191:E397V;ENSP00000445959:E397V;ENSP00000359743:E397V	ENSP00000323191:E397V	E	+	2	0	SAGE1	134817944	0.985000	0.35326	0.130000	0.21974	0.208000	0.24298	2.468000	0.45102	0.724000	0.32296	0.046000	0.15203	GAG	.	.		0.463	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
PODXL	5420	hgsc.bcm.edu	37	7	131241049	131241050	+	In_Frame_Ins	INS	-	-	CGACGC	rs201847316		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr7:131241049_131241050insCGACGC	ENST00000378555.3	-	1	316_317	c.69_70insGCGTCG	c.(67-72)tcgccg>tcgGCGTCGccg	p.22_23insSA	PODXL_ENST00000322985.9_In_Frame_Ins_p.22_23insSA|PODXL_ENST00000465001.1_Intron|PODXL_ENST00000541194.1_In_Frame_Ins_p.22_23insSA|PODXL_ENST00000537928.1_In_Frame_Ins_p.22_23insSA			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacggcgacgacggca	0.738																																					p.P24delinsASP		Atlas-INDEL	.											.	PODXL	53	.	0			c.70_71insGCGTCG						.																																			SO:0001652	inframe_insertion	5420	exon1			.		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.69_70insGCGTCG	chr7.hg19:g.131241049_131241050insCGACGC	ENSP00000367817:p.Ser22_Ser23insSerAla	75.0	0.0		65.0	27.0	NM_005397	A6NHX8|Q52LZ7|Q53ER6	In_Frame_Ins	INS	ENST00000378555.3	hg19	CCDS34755.1																																																																																			.	.		0.738	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
ARVCF	421	hgsc.bcm.edu	37	22	19960689	19960692	+	Frame_Shift_Del	DEL	GAGC	GAGC	-	rs538460279		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	GAGC	GAGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr22:19960689_19960692delGAGC	ENST00000263207.3	-	14	2679_2682	c.2388_2391delGCTC	c.(2386-2391)tcgctcfs	p.SL796fs	ARVCF_ENST00000406259.1_Frame_Shift_Del_p.SL790fs|ARVCF_ENST00000401994.1_Frame_Shift_Del_p.SL733fs|ARVCF_ENST00000344269.3_Frame_Shift_Del_p.SL733fs|ARVCF_ENST00000406522.1_Frame_Shift_Del_p.SL727fs	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	796					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					GTGCCTGCAGGAGCGAGCGCGCGT	0.716																																					p.797_798del		Atlas-INDEL	.											.	ARVCF	54	.	0			c.2389_2392del						.																																			SO:0001589	frameshift_variant	421	exon14			.		CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.2388_2391delGCTC	chr22.hg19:g.19960693_19960696delGAGC	ENSP00000263207:p.Ser796fs	51.0	0.0		49.0	23.0	NM_001670	B7WNV2	Frame_Shift_Del	DEL	ENST00000263207.3	hg19	CCDS13771.1																																																																																			.	.		0.716	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000075314.5	NM_001670	
HERC4	26091	hgsc.bcm.edu	37	10	69750905	69750906	+	Frame_Shift_Ins	INS	-	-	A	rs370234029		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr10:69750905_69750906insA	ENST00000395198.3	-	12	1569_1570	c.1322_1323insT	c.(1321-1323)ttafs	p.L441fs	HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000373700.4_Frame_Shift_Ins_p.L441fs|HERC4_ENST00000277817.6_Frame_Shift_Ins_p.L331fs|HERC4_ENST00000412272.2_Frame_Shift_Ins_p.L441fs	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	441					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L441fs*4(1)		NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ACCTAACAGCTAAAAAACTTCC	0.223																																					p.L441fs		Atlas-INDEL	.											.,1	HERC4	78	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1323_1324insT						.																																			SO:0001589	frameshift_variant	26091	exon12			.	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1323dupT	chr10.hg19:g.69750911_69750911dupA	ENSP00000378624:p.Leu441fs	645.0	0.0		501.0	158.0	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Frame_Shift_Ins	INS	ENST00000395198.3	hg19	CCDS41533.1																																																																																			.	.		0.223	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
WDR63	126820	hgsc.bcm.edu	37	1	85598554	85598555	+	Frame_Shift_Ins	INS	-	-	A	rs371944443		TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr1:85598554_85598555insA	ENST00000294664.6	+	23	2729_2730	c.2549_2550insA	c.(2548-2553)tcaaaafs	p.SK850fs	MIR4423_ENST00000580922.1_RNA|WDR63_ENST00000326813.8_Frame_Shift_Ins_p.SK811fs|WDR63_ENST00000370596.1_Frame_Shift_Ins_p.SK811fs	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	850										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TATCAGAAGTCAAAAGAACAAA	0.376																																					p.S850fs		Atlas-INDEL	.											.	WDR63	91	.	0			c.2549_2550insA						.																																			SO:0001589	frameshift_variant	126820	exon23			.		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.2553dupA	chr1.hg19:g.85598558_85598558dupA	ENSP00000294664:p.Ser850fs	76.0	0.0		66.0	26.0	NM_145172	A8K988|Q96L72|Q96NU4	Frame_Shift_Ins	INS	ENST00000294664.6	hg19	CCDS702.1																																																																																			.	.		0.376	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172	
ATXN1	6310	hgsc.bcm.edu	37	6	16327918	16327919	+	In_Frame_Ins	INS	-	-	TGCTGA	rs28555263	byFrequency	TCGA-DD-AAVP-01A-11D-A40R-10	TCGA-DD-AAVP-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4ee32767-8d4e-47ab-bbf6-9f623159f16b	c86ff390-e3fe-44f9-8f26-e7c7dd6c5536	g.chr6:16327918_16327919insTGCTGA	ENST00000244769.4	-	8	1559_1560	c.623_624insTCAGCA	c.(622-624)cag>caTCAGCAg	p.207_208insHQ	ATXN1_ENST00000436367.1_In_Frame_Ins_p.207_208insHQ	NM_000332.3	NP_000323.2	P54253	ATX1_HUMAN	ataxin 1	207	Poly-Gln.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|nuclear export (GO:0051168)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear inclusion body (GO:0042405)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|poly(G) binding (GO:0034046)|poly(U) RNA binding (GO:0008266)|protein C-terminus binding (GO:0008022)|protein self-association (GO:0043621)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|lung(12)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)	44	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)				gatgctgatgctgctgctgctg	0.663																																					p.Q208delinsHQQ		Atlas-INDEL	.											ATXN1,rectum,carcinoma,0,1	ATXN1	117	.	0			c.624_625insTCAGCA						.																																			SO:0001652	inframe_insertion	6310	exon8			.	X79204	CCDS34342.1	6p23	2014-09-17	2004-08-12	2004-08-13	ENSG00000124788	ENSG00000124788		"""Ataxins"""	10548	protein-coding gene	gene with protein product		601556	"""spinocerebellar ataxia 1 (olivopontocerebellar ataxia 1, autosomal dominant, ataxin 1)"""	SCA1		1582256	Standard	NM_000332		Approved	D6S504E, ATX1	uc010jpi.3	P54253	OTTHUMG00000014303	ENST00000244769.4:c.623_624insTCAGCA	chr6.hg19:g.16327918_16327919insTGCTGA	ENSP00000244769:p.Gln207_Gln208insHisGln	35.0	0.0		25.0	12.0	NM_000332	Q17S02|Q9UJG2|Q9Y4J1	In_Frame_Ins	INS	ENST00000244769.4	hg19	CCDS34342.1																																																																																			.	.		0.663	ATXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039943.3	NM_000332	
