#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
INPP5B	3633	hgsc.bcm.edu	37	1	38357094	38357094	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:38357094C>T	ENST00000373026.1	-	7	805	c.805G>A	c.(805-807)Ggg>Agg	p.G269R	INPP5B_ENST00000373027.1_Missense_Mutation_p.G25R|INPP5B_ENST00000373024.3_Missense_Mutation_p.G189R|INPP5B_ENST00000373023.2_Missense_Mutation_p.G269R|INPP5B_ENST00000458109.2_5'Flank			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	269					in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ACTCCCTTCCCATTTGGTCTC	0.448																																					p.G189R		Atlas-SNP	.											.	INPP5B	76	.	0			c.G565A						.						171.0	173.0	172.0					1																	38357094		1893	4106	5999	SO:0001583	missense	3633	exon8			CCTTCCCATTTGG	M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.805G>A	chr1.hg19:g.38357094C>T	ENSP00000362117:p.Gly269Arg	106.0	0.0		91.0	9.0	NM_005540	C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Missense_Mutation	SNP	ENST00000373026.1	hg19		.	.	.	.	.	.	.	.	.	.	C	9.412	1.080806	0.20309	.	.	ENSG00000204084	ENST00000373027;ENST00000373023;ENST00000373029;ENST00000373026;ENST00000373024	D;D;D;D	0.93189	-3.18;-3.05;-3.05;-3.06	5.38	4.47	0.54385	.	903.776000	0.00166	N	0.000000	D	0.93374	0.7887	M	0.65498	2.005	0.80722	D	1	B;P	0.41929	0.045;0.765	B;B	0.42593	0.014;0.392	T	0.81040	-0.1113	10	0.21014	T	0.42	.	10.3144	0.43727	0.0:0.9087:0.0:0.0913	.	269;189	P32019;P32019-2	I5P2_HUMAN;.	R	25;269;269;269;189	ENSP00000362118:G25R;ENSP00000362114:G269R;ENSP00000362117:G269R;ENSP00000362115:G189R	ENSP00000362114:G269R	G	-	1	0	INPP5B	38129681	1.000000	0.71417	0.746000	0.31095	0.118000	0.20060	1.497000	0.35649	1.404000	0.46819	0.650000	0.86243	GGG	.	.		0.448	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000012968.1	NM_005540	
NRD1	4898	hgsc.bcm.edu	37	1	52306125	52306125	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:52306125C>G	ENST00000354831.7	-	2	592	c.403G>C	c.(403-405)Ggt>Cgt	p.G135R	NRD1_ENST00000544028.1_Missense_Mutation_p.G3R|NRD1_ENST00000539524.1_Missense_Mutation_p.G3R|NRD1_ENST00000352171.7_Missense_Mutation_p.G135R|NRD1_ENST00000485608.1_5'UTR	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)	135					cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CCTGTTTTACCTTCCATATTA	0.383																																					p.G135R		Atlas-SNP	.											.	NRD1	89	.	0			c.G403C						.						99.0	94.0	96.0					1																	52306125		2203	4300	6503	SO:0001583	missense	4898	exon2			TTTTACCTTCCAT	X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.403G>C	chr1.hg19:g.52306125C>G	ENSP00000346890:p.Gly135Arg	100.0	0.0		95.0	15.0	NM_002525	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Missense_Mutation	SNP	ENST00000354831.7	hg19	CCDS559.1	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285951	0.40394	.	.	ENSG00000078618	ENST00000352171;ENST00000354831;ENST00000539524;ENST00000546169;ENST00000544028	T;T;T;T	0.39787	1.52;3.76;1.06;1.39	5.57	4.46	0.54185	Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.647627	0.16001	N	0.234318	T	0.35335	0.0928	N	0.24115	0.695	0.38173	D	0.939382	P;P;P	0.50272	0.933;0.89;0.89	P;B;P	0.47470	0.548;0.42;0.544	T	0.08764	-1.0706	10	0.26408	T	0.33	-4.142	13.2931	0.60282	0.0:0.9117:0.0:0.0883	.	135;135;135	F5H6R2;O43847;B1AKJ5	.;NRDC_HUMAN;.	R	135;135;3;135;3	ENSP00000262679:G135R;ENSP00000346890:G135R;ENSP00000444416:G3R;ENSP00000442262:G3R	ENSP00000262679:G135R	G	-	1	0	NRD1	52078713	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	3.237000	0.51344	2.608000	0.88229	0.555000	0.69702	GGT	.	.		0.383	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000023045.1	NM_002525	
WDR63	126820	hgsc.bcm.edu	37	1	85589863	85589863	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:85589863T>C	ENST00000294664.6	+	19	2221	c.2041T>C	c.(2041-2043)Tca>Cca	p.S681P	WDR63_ENST00000326813.8_Missense_Mutation_p.S642P|WDR63_ENST00000370596.1_Missense_Mutation_p.S642P	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	681										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TATTCAGAGATCACCTTTCTA	0.443																																					p.S681P		Atlas-SNP	.											.	WDR63	91	.	0			c.T2041C						.						371.0	293.0	320.0					1																	85589863		2203	4300	6503	SO:0001583	missense	126820	exon19			CAGAGATCACCTT		CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.2041T>C	chr1.hg19:g.85589863T>C	ENSP00000294664:p.Ser681Pro	112.0	0.0		108.0	41.0	NM_145172	A8K988|Q96L72|Q96NU4	Missense_Mutation	SNP	ENST00000294664.6	hg19	CCDS702.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.281164	0.80692	.	.	ENSG00000162643	ENST00000370596;ENST00000326813;ENST00000294664	T;T;T	0.71817	-0.6;-0.6;-0.6	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.059390	0.64402	N	0.000001	D	0.82935	0.5145	M	0.84683	2.71	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	D	0.86103	0.1557	10	0.72032	D	0.01	-16.4183	15.4425	0.75195	0.0:0.0:0.0:1.0	.	642;681	Q8IWG1-2;Q8IWG1	.;WDR63_HUMAN	P	642;642;681	ENSP00000359628:S642P;ENSP00000317463:S642P;ENSP00000294664:S681P	ENSP00000294664:S681P	S	+	1	0	WDR63	85362451	1.000000	0.71417	0.990000	0.47175	0.837000	0.47467	6.815000	0.75242	2.188000	0.69820	0.482000	0.46254	TCA	.	.		0.443	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027565.2	NM_145172	
GFI1	2672	hgsc.bcm.edu	37	1	92944171	92944171	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:92944171A>G	ENST00000370332.1	-	6	1382	c.1064T>C	c.(1063-1065)aTg>aCg	p.M355T	GFI1_ENST00000294702.5_Missense_Mutation_p.M355T|GFI1_ENST00000427103.1_Missense_Mutation_p.M355T	NM_001127215.1	NP_001120687.1	Q99684	GFI1_HUMAN	growth factor independent 1 transcription repressor	355					auditory receptor cell differentiation (GO:0042491)|cell fate commitment (GO:0045165)|cellular response to lipopolysaccharide (GO:0071222)|inner ear morphogenesis (GO:0042472)|mechanosensory behavior (GO:0007638)|negative regulation of calcidiol 1-monooxygenase activity (GO:0010956)|negative regulation of cell fate specification (GO:0009996)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vitamin D biosynthetic process (GO:0010957)|positive regulation of cell fate specification (GO:0042660)|positive regulation of interleukin-6-mediated signaling pathway (GO:0070105)|regulation of toll-like receptor signaling pathway (GO:0034121)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|viral process (GO:0016032)	nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		GTGTTTCTTCATGTCTGACTT	0.502																																					p.M355T		Atlas-SNP	.											.	GFI1	41	.	0			c.T1064C						.						222.0	191.0	201.0					1																	92944171		2203	4300	6503	SO:0001583	missense	2672	exon6			TTCTTCATGTCTG	U67369	CCDS30773.1	1p22	2014-09-17	2007-10-04		ENSG00000162676	ENSG00000162676		"""Zinc fingers, C2H2-type"""	4237	protein-coding gene	gene with protein product		600871	"""growth factor independent 1"""	ZNF163		7789186	Standard	NM_005263		Approved	GFI1A, GFI-1	uc001dov.4	Q99684	OTTHUMG00000010897	ENST00000370332.1:c.1064T>C	chr1.hg19:g.92944171A>G	ENSP00000359357:p.Met355Thr	162.0	0.0		182.0	9.0	NM_005263	Q8N564	Missense_Mutation	SNP	ENST00000370332.1	hg19	CCDS30773.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.990322	0.74589	.	.	ENSG00000162676	ENST00000370332;ENST00000427103;ENST00000294702	T;T;T	0.18174	2.23;2.23;2.23	5.39	5.39	0.77823	Zinc finger, C2H2-like (1);Zinc finger, CCHC-type (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.30541	0.0768	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.06698	-1.0812	10	0.87932	D	0	-32.7457	15.4083	0.74897	1.0:0.0:0.0:0.0	.	355	Q99684	GFI1_HUMAN	T	355	ENSP00000359357:M355T;ENSP00000399719:M355T;ENSP00000294702:M355T	ENSP00000294702:M355T	M	-	2	0	GFI1	92716759	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	9.339000	0.96797	2.046000	0.60703	0.254000	0.18369	ATG	.	.		0.502	GFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030054.1	NM_005263	
CCDC18	343099	hgsc.bcm.edu	37	1	93704961	93704961	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:93704961A>G	ENST00000343253.7	+	20	3197	c.2695A>G	c.(2695-2697)Atg>Gtg	p.M899V	CCDC18_ENST00000401026.3_Missense_Mutation_p.M900V|CCDC18_ENST00000557479.1_Missense_Mutation_p.M1018V|CCDC18_ENST00000334652.5_Missense_Mutation_p.M195V|CCDC18_ENST00000421014.2_3'UTR|CCDC18_ENST00000338949.4_Missense_Mutation_p.M655V			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	899										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		AAATAAAGCAATGCACCTCTC	0.363																																					p.M900V		Atlas-SNP	.											.	CCDC18	93	.	0			c.A2698G						.						112.0	103.0	105.0					1																	93704961		1854	4090	5944	SO:0001583	missense	343099	exon20			AAAGCAATGCACC			1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2695A>G	chr1.hg19:g.93704961A>G	ENSP00000343377:p.Met899Val	401.0	0.0		421.0	17.0	NM_206886	Q6ZU17	Missense_Mutation	SNP	ENST00000343253.7	hg19		.	.	.	.	.	.	.	.	.	.	A	0.017	-1.502820	0.00992	.	.	ENSG00000122483	ENST00000343253;ENST00000401026;ENST00000557479;ENST00000338949;ENST00000334652;ENST00000455267	T;T;T	0.77750	-1.12;-1.12;1.06	5.26	1.49	0.22878	.	0.793259	0.12376	N	0.474351	T	0.29850	0.0746	N	0.08118	0	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.10450	0.0;0.005	T	0.19614	-1.0300	10	0.24483	T	0.36	.	3.1048	0.06337	0.5697:0.1179:0.0673:0.2451	.	899;1018	Q5T9S5;G3V388	CCD18_HUMAN;.	V	899;900;1018;655;195;575	ENSP00000383808:M900V;ENSP00000451099:M1018V;ENSP00000334084:M195V	ENSP00000334084:M195V	M	+	1	0	CCDC18	93477549	0.278000	0.24230	0.331000	0.25455	0.666000	0.39218	0.950000	0.29122	0.285000	0.22329	-0.490000	0.04691	ATG	.	.		0.363	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000382327.1	NM_206886	
CNN3	1266	hgsc.bcm.edu	37	1	95363516	95363516	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:95363516T>C	ENST00000370206.4	-	7	1155	c.772A>G	c.(772-774)Atg>Gtg	p.M258V	CNN3_ENST00000538964.1_Missense_Mutation_p.M258V|CNN3_ENST00000487539.1_5'UTR|CNN3_ENST00000545882.1_Missense_Mutation_p.M217V|CNN3_ENST00000394202.4_Missense_Mutation_p.M212V	NM_001839.3	NP_001830.1	Q15417	CNN3_HUMAN	calponin 3, acidic	258					actomyosin structure organization (GO:0031032)|epithelial cell differentiation (GO:0030855)	focal adhesion (GO:0005925)				breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(1)|stomach(1)|urinary_tract(2)	18		all_lung(203;0.00206)|Lung NSC(277;0.00948)		all cancers(265;0.0325)|Epithelial(280;0.0861)		TACACACTCATTCCTTTCTGG	0.463																																					p.M258V		Atlas-SNP	.											.	CNN3	23	.	0			c.A772G						.						202.0	193.0	196.0					1																	95363516		2203	4300	6503	SO:0001583	missense	1266	exon7			CACTCATTCCTTT	BC025372	CCDS30775.1, CCDS65592.1, CCDS65593.1	1p22-p21	2010-07-08			ENSG00000117519	ENSG00000117519			2157	protein-coding gene	gene with protein product		602374				8526917	Standard	NM_001839		Approved		uc001dqz.4	Q15417	OTTHUMG00000010783	ENST00000370206.4:c.772A>G	chr1.hg19:g.95363516T>C	ENSP00000359225:p.Met258Val	142.0	0.0		147.0	32.0	NM_001839	B4DFK6|B4DP09|F8WA86|Q6FHA7	Missense_Mutation	SNP	ENST00000370206.4	hg19	CCDS30775.1	.	.	.	.	.	.	.	.	.	.	T	17.40	3.380639	0.61845	.	.	ENSG00000117519	ENST00000370206;ENST00000538964;ENST00000394202;ENST00000545882	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.55593	0.1930	M	0.81341	2.54	0.46011	D	0.998819	P;B	0.40083	0.702;0.001	P;B	0.45449	0.481;0.003	T	0.61662	-0.7017	10	0.54805	T	0.06	-16.4132	16.8222	0.85835	0.0:0.0:0.0:1.0	.	212;258	F8WA86;Q15417	.;CNN3_HUMAN	V	258;258;212;217	ENSP00000359225:M258V;ENSP00000437665:M258V;ENSP00000377752:M212V;ENSP00000440081:M217V	ENSP00000359225:M258V	M	-	1	0	CNN3	95136104	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.675000	0.61619	2.371000	0.80710	0.533000	0.62120	ATG	.	.		0.463	CNN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029702.2	NM_001839	
COL11A1	1301	hgsc.bcm.edu	37	1	103491357	103491357	+	Intron	SNP	T	T	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:103491357T>A	ENST00000370096.3	-	7	1210				COL11A1_ENST00000512756.1_Intron|COL11A1_ENST00000353414.4_Intron|COL11A1_ENST00000358392.2_Splice_Site_p.K311M	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1						cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTTCGCTACCTTTACCCCTAG	0.363																																					p.K311M		Atlas-SNP	.											.	COL11A1	972	.	0			c.A932T						.						159.0	152.0	154.0					1																	103491357		2203	4300	6503	SO:0001627	intron_variant	1301	exon6			GCTACCTTTACCC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.898-188A>T	chr1.hg19:g.103491357T>A		61.0	0.0		63.0	18.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	T	11.30	1.598020	0.28445	.	.	ENSG00000060718	ENST00000358392;ENST00000427239	T;T	0.72942	-0.67;-0.7	5.5	4.31	0.51392	.	1.072480	0.07007	N	0.824529	T	0.36908	0.0984	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.10450	0.005	T	0.10520	-1.0626	10	0.42905	T	0.14	.	10.6667	0.45734	0.2424:0.0:0.0:0.7576	.	311	P12107-2	.	M	311	ENSP00000351163:K311M;ENSP00000408640:K311M	ENSP00000351163:K311M	K	-	2	0	COL11A1	103263945	1.000000	0.71417	0.939000	0.37840	0.968000	0.65278	2.249000	0.43169	2.106000	0.64143	0.519000	0.50382	AAG	.	.		0.363	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
HSD3B1	3283	hgsc.bcm.edu	37	1	120057095	120057095	+	Missense_Mutation	SNP	C	C	T	rs587764853		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:120057095C>T	ENST00000369413.3	+	4	1094	c.949C>T	c.(949-951)Cgc>Tgc	p.R317C	HSD3B1_ENST00000528909.1_Missense_Mutation_p.R317C|HSD3B1_ENST00000235547.6_Missense_Mutation_p.R319C			P14060	3BHS1_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1	317					androgen biosynthetic process (GO:0006702)|estrogen biosynthetic process (GO:0006703)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(18)|ovary(2)|prostate(1)|skin(1)	32	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	Trilostane(DB01108)	GCCCTTCAACCGCCACATAGT	0.473													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21606	0.0		0.0	False		,,,				2504	0.0				p.R317C		Atlas-SNP	.											.	HSD3B1	53	.	0			c.C949T						.						120.0	117.0	118.0					1																	120057095		2203	4300	6503	SO:0001583	missense	3283	exon4			TTCAACCGCCACA	S45679	CCDS903.1	1p12	2014-06-03			ENSG00000203857	ENSG00000203857	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5217	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 1"""	109715		HSDB3, HSD3B		2779585, 19027726	Standard	NM_000862		Approved	SDR11E1	uc001ehv.1	P14060	OTTHUMG00000012525	ENST00000369413.3:c.949C>T	chr1.hg19:g.120057095C>T	ENSP00000358421:p.Arg317Cys	129.0	0.0		162.0	39.0	NM_000862	A8K691|Q14545|Q8IV65	Missense_Mutation	SNP	ENST00000369413.3	hg19	CCDS903.1	.	.	.	.	.	.	.	.	.	.	C	6.817	0.519780	0.13005	.	.	ENSG00000203857	ENST00000369413;ENST00000235547;ENST00000528909	T;T;T	0.71579	-0.58;-0.58;-0.58	3.26	2.31	0.28768	.	0.052103	0.85682	N	0.000000	T	0.63988	0.2558	H	0.94306	3.52	0.80722	D	1	P;B	0.39665	0.682;0.12	B;B	0.34385	0.181;0.04	T	0.69569	-0.5110	10	0.66056	D	0.02	0.9198	8.7277	0.34480	0.0:0.8787:0.0:0.1213	.	319;317	Q5TDG2;P14060	.;3BHS1_HUMAN	C	317;319;317	ENSP00000358421:R317C;ENSP00000235547:R319C;ENSP00000432268:R317C	ENSP00000235547:R319C	R	+	1	0	HSD3B1	119858618	0.785000	0.28726	0.440000	0.26846	0.008000	0.06430	1.417000	0.34770	0.653000	0.30826	0.313000	0.20887	CGC	.	.		0.473	HSD3B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000034993.3	NM_000862	
AXDND1	126859	hgsc.bcm.edu	37	1	179504037	179504037	+	Missense_Mutation	SNP	G	G	C	rs200097954|rs368406759|rs6425573	byFrequency	TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:179504037G>C	ENST00000367618.3	+	25	3358	c.2971G>C	c.(2971-2973)Gaa>Caa	p.E991Q		NM_144696.4	NP_653297.3	Q5T1B0	AXDN1_HUMAN	axonemal dynein light chain domain containing 1	991	Glu-rich.		E -> Q (in dbSNP:rs6425573).					p.E991_Q992delEQ(1)		NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(27)|ovary(1)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	59						agaagaagaagaacaacaaga	0.318													G|||	14	0.00279553	0.0	0.0058	5008	,	,		17137	0.002		0.004	False		,,,				2504	0.0041				p.E991Q		Atlas-SNP	.											.	AXDND1	142	.	1	Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.G2971C						.						49.0	51.0	50.0					1																	179504037		2152	4286	6438	SO:0001583	missense	126859	exon25			GAAGAAGAACAAC	BX647935	CCDS30948.1	1q25.2	2011-02-18	2011-02-18	2011-02-18	ENSG00000162779	ENSG00000162779			26564	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 125"""	C1orf125		14702039	Standard	NM_144696		Approved	FLJ32940	uc001gmo.3	Q5T1B0	OTTHUMG00000035266	ENST00000367618.3:c.2971G>C	chr1.hg19:g.179504037G>C	ENSP00000356590:p.Glu991Gln	342.0	0.0		523.0	28.0	NM_144696	Q6AWB2|Q96LJ3|Q96M01	Missense_Mutation	SNP	ENST00000367618.3	hg19	CCDS30948.1	.	.	.	.	.	.	.	.	.	.	G	9.300	1.052898	0.19907	.	.	ENSG00000162779	ENST00000367618;ENST00000360322;ENST00000434088	T;T	0.19105	2.17;2.17	4.89	-6.02	0.02192	.	0.508747	0.16499	N	0.211773	T	0.08980	0.0222	N	0.24115	0.695	0.09310	N	1	B;B	0.24186	0.099;0.099	B;B	0.10450	0.003;0.005	T	0.15838	-1.0423	10	0.28530	T	0.3	-2.8152	6.1976	0.20557	0.4456:0.3814:0.173:0.0	rs6425573	875;991	E9PCJ4;Q5T1B0	.;AXDN1_HUMAN	Q	991;875;851	ENSP00000356590:E991Q;ENSP00000391716:E851Q	ENSP00000353471:E875Q	E	+	1	0	AXDND1	177770660	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.365000	0.20348	-1.164000	0.02790	-1.047000	0.02352	GAA	.	G|1.000;|0.000		0.318	AXDND1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085312.1	NM_144696	
TDRD5	163589	hgsc.bcm.edu	37	1	179561766	179561766	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:179561766C>G	ENST00000367614.1	+	2	375	c.16C>G	c.(16-18)Cgt>Ggt	p.R6G	TDRD5_ENST00000444136.1_Missense_Mutation_p.R6G|RP11-545A16.4_ENST00000567150.1_RNA|TDRD5_ENST00000294848.8_Missense_Mutation_p.R6G	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	6					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TGAACAAGAGCGTATACAGGA	0.438																																					p.R6G		Atlas-SNP	.											.	TDRD5	149	.	0			c.C16G						.						137.0	131.0	133.0					1																	179561766		2203	4300	6503	SO:0001583	missense	163589	exon2			CAAGAGCGTATAC	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.16C>G	chr1.hg19:g.179561766C>G	ENSP00000356586:p.Arg6Gly	71.0	0.0		91.0	5.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313125	0.60414	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	T;T;T	0.12672	2.66;2.66;2.84	5.91	3.79	0.43588	.	0.294107	0.32328	N	0.006241	T	0.31482	0.0798	L	0.51422	1.61	0.34761	D	0.732786	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.988	T	0.47849	-0.9085	10	0.62326	D	0.03	1.786	15.7448	0.77929	0.2675:0.7325:0.0:0.0	.	6;6	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	G	6	ENSP00000356586:R6G;ENSP00000294848:R6G;ENSP00000406052:R6G	ENSP00000294848:R6G	R	+	1	0	TDRD5	177828389	0.109000	0.22037	0.846000	0.33378	0.857000	0.48899	0.475000	0.22164	1.418000	0.47098	0.655000	0.94253	CGT	.	.		0.438	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
RGS18	64407	hgsc.bcm.edu	37	1	192153515	192153515	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:192153515T>A	ENST00000367460.3	+	5	720	c.539T>A	c.(538-540)gTg>gAg	p.V180E		NM_130782.2	NP_570138.1	Q9NS28	RGS18_HUMAN	regulator of G-protein signaling 18	180	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			kidney(1)|large_intestine(2)|lung(15)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CAAAGCAGAGTGTATCAGCTC	0.398																																					p.V180E		Atlas-SNP	.											.	RGS18	54	.	0			c.T539A						.						144.0	135.0	138.0					1																	192153515		2203	4300	6503	SO:0001583	missense	64407	exon5			GCAGAGTGTATCA	AF268036	CCDS1374.1	1q31.2	2008-02-05	2007-08-14		ENSG00000150681	ENSG00000150681		"""Regulators of G-protein signaling"""	14261	protein-coding gene	gene with protein product		607192	"""regulator of G-protein signalling 18"""			11042171	Standard	NM_130782		Approved	RGS13	uc001gsg.3	Q9NS28	OTTHUMG00000035592	ENST00000367460.3:c.539T>A	chr1.hg19:g.192153515T>A	ENSP00000356430:p.Val180Glu	191.0	0.0		266.0	38.0	NM_130782	B2RD23	Missense_Mutation	SNP	ENST00000367460.3	hg19	CCDS1374.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.611330	0.87258	.	.	ENSG00000150681	ENST00000367460	T	0.72725	-0.68	5.62	5.62	0.85841	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.106857	0.64402	D	0.000004	D	0.87775	0.6262	M	0.93420	3.415	0.58432	D	0.999999	D	0.76494	0.999	D	0.78314	0.991	D	0.90862	0.4739	10	0.87932	D	0	.	14.661	0.68870	0.0:0.0:0.0:1.0	.	180	Q9NS28	RGS18_HUMAN	E	180	ENSP00000356430:V180E	ENSP00000356430:V180E	V	+	2	0	RGS18	190420138	1.000000	0.71417	0.955000	0.39395	0.968000	0.65278	7.534000	0.82004	2.140000	0.66376	0.460000	0.39030	GTG	.	.		0.398	RGS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086382.1	NM_130782	
CAMSAP2	23271	hgsc.bcm.edu	37	1	200827018	200827018	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:200827018C>T	ENST00000236925.4	+	18	4350	c.4301C>T	c.(4300-4302)aCt>aTt	p.T1434I	CAMSAP2_ENST00000413307.2_Missense_Mutation_p.T1407I|CAMSAP2_ENST00000358823.2_Missense_Mutation_p.T1423I			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	1434	CKK. {ECO:0000255|PROSITE- ProRule:PRU00841}.				microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										AAATCTATCACTAAAAAAATG	0.373																																					p.T1423I		Atlas-SNP	.											.	.	.	.	0			c.C4268T						.						68.0	72.0	71.0					1																	200827018		2203	4300	6503	SO:0001583	missense	23271	exon17			CTATCACTAAAAA	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.4301C>T	chr1.hg19:g.200827018C>T	ENSP00000236925:p.Thr1434Ile	271.0	0.0		436.0	71.0	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	ENST00000236925.4	hg19		.	.	.	.	.	.	.	.	.	.	C	13.21	2.169395	0.38315	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.17528	2.28;2.27;2.28	5.34	4.42	0.53409	PRC-barrel-like (1);Microtubule-binding calmodulin-regulated spectrin-associated, C-terminal (2);	0.198232	0.53938	D	0.000050	T	0.30479	0.0766	L	0.56769	1.78	0.48341	D	0.999631	B;B;P	0.45672	0.25;0.294;0.864	B;P;P	0.51895	0.145;0.514;0.683	T	0.04333	-1.0959	10	0.59425	D	0.04	-24.5764	15.4309	0.75099	0.0:0.737:0.263:0.0	.	1407;1434;1423	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	I	1423;1407;1434	ENSP00000351684:T1423I;ENSP00000416800:T1407I;ENSP00000236925:T1434I	ENSP00000236925:T1434I	T	+	2	0	CAMSAP1L1	199093641	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.066000	0.41452	1.356000	0.45884	0.563000	0.77884	ACT	.	.		0.373	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
SYT2	127833	hgsc.bcm.edu	37	1	202568364	202568364	+	Silent	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:202568364G>A	ENST00000367267.1	-	8	1227	c.1035C>T	c.(1033-1035)atC>atT	p.I345I	SYT2_ENST00000367268.4_Silent_p.I345I	NM_001136504.1	NP_001129976.1	Q8N9I0	SYT2_HUMAN	synaptotagmin II	345	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000250}.				neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	29			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GCTCGAAGGGGATCTCAAAGC	0.522																																					p.I345I		Atlas-SNP	.											.	SYT2	51	.	0			c.C1035T						.						277.0	267.0	270.0					1																	202568364		2203	4300	6503	SO:0001819	synonymous_variant	127833	exon8			GAAGGGGATCTCA	AK090672	CCDS1427.1	1q32.1	2013-01-21			ENSG00000143858	ENSG00000143858		"""Synaptotagmins"""	11510	protein-coding gene	gene with protein product		600104				7749232	Standard	NM_177402		Approved		uc010pqb.2	Q8N9I0	OTTHUMG00000041388	ENST00000367267.1:c.1035C>T	chr1.hg19:g.202568364G>A		82.0	0.0		115.0	16.0	NM_177402	Q496K5|Q8NBE5	Silent	SNP	ENST00000367267.1	hg19	CCDS1427.1																																																																																			.	.		0.522	SYT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099157.1	NM_177402	
MDM4	4194	hgsc.bcm.edu	37	1	204513690	204513690	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:204513690A>T	ENST00000367182.3	+	9	862	c.700A>T	c.(700-702)Act>Tct	p.T234S	MDM4_ENST00000391947.2_3'UTR|MDM4_ENST00000507825.2_Intron|MDM4_ENST00000454264.2_Intron|MDM4_ENST00000463049.1_3'UTR|MDM4_ENST00000367183.3_Intron	NM_001204171.1|NM_001278516.1|NM_001278517.1|NM_001278518.1|NM_001278519.1|NM_002393.4	NP_001191100.1|NP_001265445.1|NP_001265446.1|NP_001265447.1|NP_001265448.1|NP_002384.2	O15151	MDM4_HUMAN	MDM4, p53 regulator	234					cell proliferation (GO:0008283)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|G0 to G1 transition (GO:0045023)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00146)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.112)|all_epithelial(62;0.118)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;3.15e-47)|all cancers(3;3.56e-32)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|Epithelial(59;0.143)|BRCA - Breast invasive adenocarcinoma(75;0.143)			TGTTTCAGATACTACAGATGA	0.358			A		"""GBM, bladder, retinoblastoma"""																																p.T234S		Atlas-SNP	.		Dom	yes		1	1q32	4194	Mdm4 p53 binding protein homolog		M	.	MDM4	57	.	0			c.A700T						.						142.0	133.0	136.0					1																	204513690		2203	4300	6503	SO:0001583	missense	4194	exon9			TCAGATACTACAG	AF007111	CCDS1447.1, CCDS55674.1, CCDS55675.1, CCDS60396.1, CCDS73007.1, CCDS73008.1, CCDS73009.1	1q32	2014-03-03	2014-03-03		ENSG00000198625	ENSG00000198625			6974	protein-coding gene	gene with protein product		602704	"""mouse double minute 4, human homolog of; p53-binding protein"", ""Mdm4, transformed 3T3 cell double minute 4, p53 binding protein (mouse)"", ""Mdm4 p53 binding protein homolog (mouse)"""			9226370, 14660608	Standard	NM_002393		Approved	MDMX, HDMX	uc001hba.3	O15151	OTTHUMG00000035877	ENST00000367182.3:c.700A>T	chr1.hg19:g.204513690A>T	ENSP00000356150:p.Thr234Ser	110.0	0.0		138.0	6.0	NM_002393	Q2M2Y2|Q32SL2|Q6GS18|Q8IV83	Missense_Mutation	SNP	ENST00000367182.3	hg19	CCDS1447.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.954273	0.73902	.	.	ENSG00000198625	ENST00000367182;ENST00000367179	T;T	0.09817	2.94;2.94	5.62	4.5	0.54988	.	0.133960	0.64402	D	0.000002	T	0.21186	0.0510	L	0.47190	1.495	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.05971	-1.0853	10	0.15499	T	0.54	-1.6684	10.0491	0.42205	0.9229:0.0:0.0771:0.0	.	234	O15151	MDM4_HUMAN	S	234;119	ENSP00000356150:T234S;ENSP00000356147:T119S	ENSP00000356147:T119S	T	+	1	0	MDM4	202780313	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	5.221000	0.65272	0.992000	0.38840	-0.404000	0.06349	ACT	.	.		0.358	MDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087415.2	NM_002393	
KLHDC8A	55220	hgsc.bcm.edu	37	1	205308358	205308358	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:205308358A>G	ENST00000367156.3	-	7	1537	c.721T>C	c.(721-723)Ttc>Ctc	p.F241L	KLHDC8A_ENST00000539253.1_Missense_Mutation_p.F241L|KLHDC8A_ENST00000460687.1_Missense_Mutation_p.F107L|KLHDC8A_ENST00000537168.1_Missense_Mutation_p.F128L|KLHDC8A_ENST00000367155.3_Missense_Mutation_p.F241L	NM_001271863.1	NP_001258792.1	Q8IYD2	KLD8A_HUMAN	kelch domain containing 8A	241										breast(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(84;0.23)		BRCA - Breast invasive adenocarcinoma(75;0.117)			GTCCGCAGGAACTTGGGCTGC	0.612																																					p.F241L		Atlas-SNP	.											.	KLHDC8A	31	.	0			c.T721C						.						52.0	46.0	48.0					1																	205308358		2203	4300	6503	SO:0001583	missense	55220	exon4			GCAGGAACTTGGG		CCDS30985.1	1q32.1	2008-02-05			ENSG00000162873	ENSG00000162873			25573	protein-coding gene	gene with protein product		614503					Standard	NM_018203		Approved	FLJ10748	uc031prx.1	Q8IYD2	OTTHUMG00000037199	ENST00000367156.3:c.721T>C	chr1.hg19:g.205308358A>G	ENSP00000356124:p.Phe241Leu	95.0	0.0		121.0	26.0	NM_018203	B3KU70|Q9NVG5	Missense_Mutation	SNP	ENST00000367156.3	hg19	CCDS30985.1	.	.	.	.	.	.	.	.	.	.	A	33	5.211477	0.95069	.	.	ENSG00000162873	ENST00000367155;ENST00000367156;ENST00000539253;ENST00000537168	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	5.43	5.43	0.79202	Kelch-type beta propeller (1);	0.000000	0.85682	D	0.000000	T	0.79964	0.4537	L	0.58810	1.83	0.58432	D	0.999996	D;P	0.67145	0.996;0.956	D;D	0.73380	0.98;0.931	T	0.76534	-0.2924	10	0.21014	T	0.42	-26.2882	15.1399	0.72601	1.0:0.0:0.0:0.0	.	128;241	F5H5F1;Q8IYD2	.;KLD8A_HUMAN	L	241;241;241;128	ENSP00000356123:F241L;ENSP00000356124:F241L;ENSP00000442229:F241L;ENSP00000443447:F128L	ENSP00000356123:F241L	F	-	1	0	KLHDC8A	203574981	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.300000	0.96151	2.063000	0.61619	0.533000	0.62120	TTC	.	.		0.612	KLHDC8A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090397.1	NM_018203	
DNAH14	127602	hgsc.bcm.edu	37	1	225510413	225510413	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:225510413T>C	ENST00000445597.2	+	42	7145	c.7145T>C	c.(7144-7146)gTg>gCg	p.V2382A	DNAH14_ENST00000430092.1_Missense_Mutation_p.V3035A|DNAH14_ENST00000439375.2_Missense_Mutation_p.V3035A			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2382					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						ATGAATGCAGTGTGTATTCTT	0.383																																					p.V3035A		Atlas-SNP	.											.	DNAH14	300	.	0			c.T9104C						.						146.0	122.0	130.0					1																	225510413		692	1591	2283	SO:0001583	missense	127602	exon60			ATGCAGTGTGTAT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7145T>C	chr1.hg19:g.225510413T>C	ENSP00000409472:p.Val2382Ala	242.0	0.0		399.0	16.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	T	23.1	4.371898	0.82573	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.80123	-1.34;-1.34;-1.34	5.73	5.73	0.89815	.	.	.	.	.	D	0.91341	0.7269	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.93003	0.6425	9	0.87932	D	0	.	15.0108	0.71547	0.0:0.0:0.0:1.0	.	3035	Q0VDD8-4	.	A	2382;3035;3035	ENSP00000409472:V2382A;ENSP00000414402:V3035A;ENSP00000392061:V3035A	ENSP00000414402:V3035A	V	+	2	0	DNAH14	223577036	1.000000	0.71417	0.909000	0.35828	0.971000	0.66376	5.081000	0.64444	2.179000	0.69175	0.491000	0.48974	GTG	.	.		0.383	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
OBSCN	84033	hgsc.bcm.edu	37	1	228444576	228444576	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:228444576T>C	ENST00000422127.1	+	15	4578	c.4534T>C	c.(4534-4536)Tac>Cac	p.Y1512H	OBSCN_ENST00000359599.6_Missense_Mutation_p.Y76H|OBSCN_ENST00000570156.2_Missense_Mutation_p.Y1604H|OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000366709.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.Y1512H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1512	Ig-like 15.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CGCCGGGGAGTACAGCTGCGA	0.647																																					p.Y1604H		Atlas-SNP	.											.	OBSCN	2142	.	0			c.T4810C						.						40.0	48.0	45.0					1																	228444576		2045	4176	6221	SO:0001583	missense	84033	exon16			GGGGAGTACAGCT	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.4534T>C	chr1.hg19:g.228444576T>C	ENSP00000409493:p.Tyr1512His	197.0	0.0		322.0	81.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	.	16.23	3.063488	0.55432	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000359599	T;T;D	0.87491	1.74;1.74;-2.26	4.6	4.6	0.57074	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000007	D	0.95730	0.8611	H	0.97659	4.05	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97099	0.9796	10	0.87932	D	0	.	13.9628	0.64191	0.0:0.0:0.0:1.0	.	1512;1512	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	H	1512;1512;76	ENSP00000284548:Y1512H;ENSP00000409493:Y1512H;ENSP00000352613:Y76H	ENSP00000284548:Y1512H	Y	+	1	0	OBSCN	226511199	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	7.178000	0.77657	1.704000	0.51252	0.402000	0.26972	TAC	.	.		0.647	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
CHRM3	1131	hgsc.bcm.edu	37	1	240071874	240071874	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:240071874A>C	ENST00000255380.4	+	5	1902	c.1123A>C	c.(1123-1125)Agc>Cgc	p.S375R		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	375					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	TCCGGGTCACAGCACCATCCT	0.597																																					p.S375R		Atlas-SNP	.											.	CHRM3	118	.	0			c.A1123C						.						34.0	27.0	29.0					1																	240071874		2203	4300	6503	SO:0001583	missense	1131	exon5			GGTCACAGCACCA	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1123A>C	chr1.hg19:g.240071874A>C	ENSP00000255380:p.Ser375Arg	214.0	0.0		397.0	24.0	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Missense_Mutation	SNP	ENST00000255380.4	hg19	CCDS1616.1	.	.	.	.	.	.	.	.	.	.	A	11.50	1.658630	0.29515	.	.	ENSG00000133019	ENST00000255380	T	0.59224	0.28	5.97	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.326816	0.37136	N	0.002237	T	0.29588	0.0738	N	0.05230	-0.09	0.39017	D	0.959672	P	0.40360	0.714	B	0.33960	0.173	T	0.13229	-1.0517	10	0.23891	T	0.37	-28.8937	9.814	0.40840	0.8623:0.0:0.1377:0.0	.	375	P20309	ACM3_HUMAN	R	375	ENSP00000255380:S375R	ENSP00000255380:S375R	S	+	1	0	CHRM3	238138497	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	6.338000	0.72963	1.074000	0.40909	0.533000	0.62120	AGC	.	.		0.597	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
OR2M3	127062	hgsc.bcm.edu	37	1	248367250	248367250	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr1:248367250A>G	ENST00000456743.1	+	1	919	c.881A>G	c.(880-882)aAc>aGc	p.N294S		NM_001004689.1	NP_001004689.1	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M, member 3	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|large_intestine(4)|lung(33)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	50	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			AGCCTCCGCAACAAGGAGGTG	0.478																																					p.N294S		Atlas-SNP	.											OR2M3,NS,carcinoma,0,1	OR2M3	116	.	0			c.A881G						.						112.0	105.0	107.0					1																	248367250		2203	4300	6503	SO:0001583	missense	127062	exon1			TCCGCAACAAGGA		CCDS31107.1	1q44	2012-08-09		2004-03-10	ENSG00000228198	ENSG00000228198		"""GPCR / Class A : Olfactory receptors"""	8269	protein-coding gene	gene with protein product				OR2M6, OR2M3P			Standard	NM_001004689		Approved	OST003	uc010pzg.2	Q8NG83	OTTHUMG00000040459	ENST00000456743.1:c.881A>G	chr1.hg19:g.248367250A>G	ENSP00000389625:p.Asn294Ser	96.0	0.0		156.0	7.0	NM_001004689	B9EH06|Q6IEY0	Missense_Mutation	SNP	ENST00000456743.1	hg19	CCDS31107.1	.	.	.	.	.	.	.	.	.	.	A	9.927	1.213667	0.22289	.	.	ENSG00000228198	ENST00000456743	T	0.39997	1.05	2.7	2.7	0.31948	.	.	.	.	.	T	0.65533	0.2700	H	0.96777	3.88	0.09310	N	1	P	0.44690	0.841	P	0.49140	0.601	T	0.62407	-0.6861	9	0.87932	D	0	.	10.7308	0.46096	1.0:0.0:0.0:0.0	.	294	Q8NG83	OR2M3_HUMAN	S	294	ENSP00000389625:N294S	ENSP00000389625:N294S	N	+	2	0	OR2M3	246433873	0.023000	0.18921	0.045000	0.18777	0.020000	0.10135	0.687000	0.25407	1.237000	0.43756	0.433000	0.28618	AAC	.	.		0.478	OR2M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097355.1	NM_001004689	
GREB1	9687	hgsc.bcm.edu	37	2	11773162	11773162	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:11773162A>G	ENST00000381486.2	+	28	5264	c.4964A>G	c.(4963-4965)gAt>gGt	p.D1655G	GREB1_ENST00000234142.5_Missense_Mutation_p.D1655G|GREB1_ENST00000396123.1_Missense_Mutation_p.D653G	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1655						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		AACGTGGTGGATGTCAACTCT	0.562																																					p.D1655G	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.A4964G						.						125.0	136.0	133.0					2																	11773162		2159	4252	6411	SO:0001583	missense	9687	exon28			TGGTGGATGTCAA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4964A>G	chr2.hg19:g.11773162A>G	ENSP00000370896:p.Asp1655Gly	116.0	0.0		68.0	7.0	NM_014668	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.474159	0.43942	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.49139	0.79;0.79;0.79	5.3	5.3	0.74995	.	0.047110	0.85682	D	0.000000	T	0.47002	0.1422	L	0.55481	1.735	0.80722	D	1	B	0.17465	0.022	B	0.23716	0.048	T	0.42982	-0.9419	10	0.51188	T	0.08	-25.1792	15.224	0.73336	1.0:0.0:0.0:0.0	.	1655	Q4ZG55	GREB1_HUMAN	G	1655;1655;653	ENSP00000370896:D1655G;ENSP00000234142:D1655G;ENSP00000379429:D653G	ENSP00000234142:D1655G	D	+	2	0	GREB1	11690613	1.000000	0.71417	0.290000	0.24890	0.054000	0.15201	6.604000	0.74150	1.998000	0.58463	0.455000	0.32223	GAT	.	.		0.562	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
LPIN1	23175	hgsc.bcm.edu	37	2	11911691	11911691	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:11911691A>G	ENST00000256720.2	+	4	575	c.482A>G	c.(481-483)aAg>aGg	p.K161R	LPIN1_ENST00000396099.1_Missense_Mutation_p.K167R|LPIN1_ENST00000425416.2_Missense_Mutation_p.K167R|LPIN1_ENST00000396098.1_Missense_Mutation_p.K167R|LPIN1_ENST00000449576.2_Missense_Mutation_p.K210R	NM_145693.2	NP_663731.1	Q14693	LPIN1_HUMAN	lipin 1	161					cellular lipid metabolic process (GO:0044255)|fatty acid catabolic process (GO:0009062)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)|triglyceride mobilization (GO:0006642)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(15)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	45	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		AGGAGGAGAAAGTCACAGCTG	0.542																																					p.K210R		Atlas-SNP	.											.	LPIN1	99	.	0			c.A629G						.						68.0	54.0	59.0					2																	11911691		2203	4300	6503	SO:0001583	missense	23175	exon5			GGAGAAAGTCACA	D80010	CCDS1682.1, CCDS58699.1, CCDS58700.1, CCDS58701.1	2p25.1	2008-05-23			ENSG00000134324	ENSG00000134324			13345	protein-coding gene	gene with protein product		605518				11138012, 8724849, 16950137	Standard	NM_145693		Approved	KIAA0188	uc010yjm.3	Q14693	OTTHUMG00000119082	ENST00000256720.2:c.482A>G	chr2.hg19:g.11911691A>G	ENSP00000256720:p.Lys161Arg	172.0	0.0		161.0	24.0	NM_001261428	A8MU38|B4DET9|B4DGS4|B4DGZ6|B5MC18|B7Z858|D6W506|E7ESE7|F5GY24|Q53T25	Missense_Mutation	SNP	ENST00000256720.2	hg19	CCDS1682.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.520378	0.64747	.	.	ENSG00000134324	ENST00000449576;ENST00000396098;ENST00000396099;ENST00000425416;ENST00000256720	D;D;D;D;D	0.91011	-1.71;-2.77;-1.68;-1.55;-1.55	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	D	0.93736	0.7998	M	0.63428	1.95	0.80722	D	1	D;P;D	0.64830	0.994;0.948;0.977	D;P;P	0.74348	0.983;0.591;0.751	D	0.91716	0.5385	10	0.17832	T	0.49	-35.8192	16.1502	0.81611	1.0:0.0:0.0:0.0	.	210;161;167	F5GY24;Q14693;A8MU38	.;LPIN1_HUMAN;.	R	210;167;167;167;161	ENSP00000397908:K210R;ENSP00000379405:K167R;ENSP00000379406:K167R;ENSP00000401522:K167R;ENSP00000256720:K161R	ENSP00000256720:K161R	K	+	2	0	LPIN1	11829142	1.000000	0.71417	0.991000	0.47740	0.585000	0.36419	8.850000	0.92190	2.224000	0.72417	0.533000	0.62120	AAG	.	.		0.542	LPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239296.3	NM_145693	
RHOB	388	hgsc.bcm.edu	37	2	20647549	20647549	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:20647549C>T	ENST00000272233.4	+	1	715	c.323C>T	c.(322-324)cCc>cTc	p.P108L		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	108					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	CACTTCTGTCCCAATGTGCCC	0.612																																					p.P108L		Atlas-SNP	.											RHOB,NS,carcinoma,0,1	RHOB	18	.	0			c.C323T						.						84.0	93.0	90.0					2																	20647549		2203	4300	6503	SO:0001583	missense	388	exon1			TCTGTCCCAATGT		CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.323C>T	chr2.hg19:g.20647549C>T	ENSP00000272233:p.Pro108Leu	229.0	0.0		161.0	9.0	NM_004040	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Missense_Mutation	SNP	ENST00000272233.4	hg19	CCDS1699.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.056970	0.76074	.	.	ENSG00000143878	ENST00000272233	T	0.76968	-1.06	5.39	5.39	0.77823	Small GTP-binding protein domain (1);	0.000000	0.85682	U	0.000000	D	0.89928	0.6857	M	0.87682	2.9	0.80722	D	1	D	0.67145	0.996	D	0.72075	0.976	D	0.91181	0.4976	10	0.87932	D	0	-11.2596	19.5316	0.95231	0.0:1.0:0.0:0.0	.	108	P62745	RHOB_HUMAN	L	108	ENSP00000272233:P108L	ENSP00000272233:P108L	P	+	2	0	RHOB	20511030	1.000000	0.71417	1.000000	0.80357	0.361000	0.29550	7.665000	0.83852	2.690000	0.91761	0.650000	0.86243	CCC	.	.		0.612	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207500.1	NM_004040	
EHD3	30845	hgsc.bcm.edu	37	2	31489355	31489355	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:31489355G>A	ENST00000322054.5	+	6	1678	c.1393G>A	c.(1393-1395)Gct>Act	p.A465T	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	465	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					GATCACAGGCGCTAATGCCAA	0.562																																					p.A465T		Atlas-SNP	.											EHD3,NS,carcinoma,0,1	EHD3	90	.	0			c.G1393A						.						106.0	88.0	94.0					2																	31489355		2203	4300	6503	SO:0001583	missense	30845	exon6			ACAGGCGCTAATG	AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1393G>A	chr2.hg19:g.31489355G>A	ENSP00000327116:p.Ala465Thr	99.0	0.0		82.0	22.0	NM_014600	B4DFR5|D6W574|Q8N514|Q9NZB3	Missense_Mutation	SNP	ENST00000322054.5	hg19	CCDS1774.1	.	.	.	.	.	.	.	.	.	.	G	19.68	3.872563	0.72180	.	.	ENSG00000013016	ENST00000322054	T	0.30182	1.54	5.71	5.71	0.89125	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.044640	0.85682	D	0.000000	T	0.32734	0.0839	L	0.48986	1.54	0.80722	D	1	B	0.22003	0.063	B	0.18263	0.021	T	0.04191	-1.0970	10	0.29301	T	0.29	-17.9785	19.8586	0.96775	0.0:0.0:1.0:0.0	.	465	Q9NZN3	EHD3_HUMAN	T	465	ENSP00000327116:A465T	ENSP00000327116:A465T	A	+	1	0	EHD3	31342859	1.000000	0.71417	0.947000	0.38551	0.991000	0.79684	8.004000	0.88535	2.701000	0.92244	0.462000	0.41574	GCT	.	.		0.562	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216810.1	NM_014600	
VRK2	7444	hgsc.bcm.edu	37	2	58386637	58386637	+	Silent	SNP	A	A	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:58386637A>C	ENST00000435505.2	+	16	2081	c.1336A>C	c.(1336-1338)Aga>Cga	p.R446R	VRK2_ENST00000417641.2_3'UTR|FANCL_ENST00000402135.3_3'UTR|VRK2_ENST00000340157.4_Silent_p.R446R|VRK2_ENST00000412104.2_3'UTR|FANCL_ENST00000403295.3_3'UTR|FANCL_ENST00000233741.4_3'UTR|VRK2_ENST00000440705.2_Silent_p.R423R			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	446	Interaction with MAP3K7.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						CAAGAAGTCAAGATCTCCATC	0.383																																					p.R446R		Atlas-SNP	.											.	VRK2	46	.	0			c.A1336C						.						78.0	78.0	78.0					2																	58386637		2203	4300	6503	SO:0001819	synonymous_variant	7444	exon13			AAGTCAAGATCTC	AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.1336A>C	chr2.hg19:g.58386637A>C		169.0	0.0		159.0	21.0	NM_001130480	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Silent	SNP	ENST00000435505.2	hg19	CCDS1859.1																																																																																			.	.		0.383	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325304.2	NM_006296	
BCL11A	53335	hgsc.bcm.edu	37	2	60688438	60688438	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:60688438C>T	ENST00000335712.6	-	4	1836	c.1609G>A	c.(1609-1611)Ggc>Agc	p.G537S	BCL11A_ENST00000538214.1_Missense_Mutation_p.G503S|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000356842.4_Missense_Mutation_p.G537S|BCL11A_ENST00000537768.1_Missense_Mutation_p.G206S|BCL11A_ENST00000358510.4_Missense_Mutation_p.G503S	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	537					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CTCTCGTCGCCCACGCCCACG	0.701			T	IGH@	B-CLL																																p.G537S		Atlas-SNP	.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A	298	.	0			c.G1609A						.						14.0	14.0	14.0					2																	60688438		2193	4279	6472	SO:0001583	missense	53335	exon4			CGTCGCCCACGCC	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.1609G>A	chr2.hg19:g.60688438C>T	ENSP00000338774:p.Gly537Ser	72.0	0.0		38.0	8.0	NM_018014	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	hg19	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	C	2.644	-0.283581	0.05642	.	.	ENSG00000119866	ENST00000356842;ENST00000378117;ENST00000538214;ENST00000537768;ENST00000335712;ENST00000358510	T;T;T;T;T	0.08102	3.13;3.42;3.29;3.44;3.37	5.19	4.3	0.51218	.	1.710350	0.02984	N	0.146061	T	0.08044	0.0201	L	0.31664	0.95	0.37417	D	0.913468	B;B;B;B;B	0.25667	0.001;0.131;0.093;0.102;0.126	B;B;B;B;B	0.29440	0.002;0.064;0.102;0.05;0.055	T	0.40289	-0.9571	10	0.10902	T	0.67	-2.9045	5.8478	0.18675	0.1608:0.6845:0.0:0.1547	.	503;206;503;537;537	F5H2Y4;B4DT16;Q9H165-6;Q9H165;D9YZV9	.;.;.;BC11A_HUMAN;.	S	537;562;503;206;537;503	ENSP00000349300:G537S;ENSP00000438303:G503S;ENSP00000443712:G206S;ENSP00000338774:G537S;ENSP00000351307:G503S	ENSP00000338774:G537S	G	-	1	0	BCL11A	60541942	0.968000	0.33430	0.997000	0.53966	0.298000	0.27526	1.622000	0.36997	1.168000	0.42723	-0.188000	0.12872	GGC	.	.		0.701	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
PNO1	56902	hgsc.bcm.edu	37	2	68385547	68385547	+	Silent	SNP	A	A	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:68385547A>C	ENST00000263657.2	+	2	334	c.243A>C	c.(241-243)ccA>ccC	p.P81P	WDR92_ENST00000492039.2_5'Flank|WDR92_ENST00000409164.1_5'Flank|WDR92_ENST00000406245.2_5'Flank|WDR92_ENST00000295121.6_5'Flank|RP11-474G23.1_ENST00000406334.3_Intron	NM_020143.2	NP_064528.1	Q9NRX1	PNO1_HUMAN	partner of NOB1 homolog (S. cerevisiae)	81						nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						TTCCAGTCCCAGCTAACAGAT	0.383																																					p.P81P	NSCLC(83;642 1410 13044 32832 40058)	Atlas-SNP	.											.	PNO1	17	.	0			c.A243C						.						111.0	114.0	113.0					2																	68385547		2203	4300	6503	SO:0001819	synonymous_variant	56902	exon2			AGTCCCAGCTAAC	AF164799	CCDS1885.1	2p14	2010-07-06			ENSG00000115946	ENSG00000115946			32790	protein-coding gene	gene with protein product	"""RNA binding protein"""		"""KH-type RNA binding protein 1"", ""KH-type RNA-binding protein 1"""	KHRBP1		15497447	Standard	NM_020143		Approved	RRP20	uc002seh.3	Q9NRX1	OTTHUMG00000129563	ENST00000263657.2:c.243A>C	chr2.hg19:g.68385547A>C		155.0	0.0		108.0	29.0	NM_020143	A8K6Q0|Q53G13|Q8WVB8	Silent	SNP	ENST00000263657.2	hg19	CCDS1885.1																																																																																			.	.		0.383	PNO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251756.1	NM_020143	
GALNT5	11227	hgsc.bcm.edu	37	2	158115035	158115035	+	Silent	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:158115035A>G	ENST00000259056.4	+	1	926	c.441A>G	c.(439-441)agA>agG	p.R147R		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	147					cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						CAGACGGGAGAGGCACCAAAC	0.562																																					p.R147R		Atlas-SNP	.											.	GALNT5	112	.	0			c.A441G						.						66.0	68.0	67.0					2																	158115035		2203	4300	6503	SO:0001819	synonymous_variant	11227	exon1			CGGGAGAGGCACC	AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.441A>G	chr2.hg19:g.158115035A>G		81.0	0.0		83.0	10.0	NM_014568	A5PKZ1|Q9UGK7|Q9UHL6	Silent	SNP	ENST00000259056.4	hg19	CCDS2203.1																																																																																			.	.		0.562	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254925.2	NM_014568	
IDH1	3417	hgsc.bcm.edu	37	2	209108256	209108256	+	Missense_Mutation	SNP	T	T	G	rs374340555		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:209108256T>G	ENST00000415913.1	-	6	974	c.593A>C	c.(592-594)cAa>cCa	p.Q198P	IDH1_ENST00000345146.2_Missense_Mutation_p.Q198P|IDH1_ENST00000446179.1_Missense_Mutation_p.Q198P	NM_001282387.1	NP_001269316.1	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	198					2-oxoglutarate metabolic process (GO:0006103)|cellular lipid metabolic process (GO:0044255)|female gonad development (GO:0008585)|glutathione metabolic process (GO:0006749)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|NADPH regeneration (GO:0006740)|response to oxidative stress (GO:0006979)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|biliary_tract(24)|bone(237)|central_nervous_system(3764)|endometrium(3)|haematopoietic_and_lymphoid_tissue(794)|kidney(2)|large_intestine(7)|lung(7)|prostate(6)|skin(5)|soft_tissue(12)|thyroid(22)|urinary_tract(1)	4887				Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)		CAGAGCCATTTGGAAGGAACT	0.408			Mis		gliobastoma																																p.Q198P	Pancreas(158;264 1958 3300 35450 36047)	Atlas-SNP	.		Dom	yes		2	2q33.3	3417	"""isocitrate dehydrogenase 1 (NADP+), soluble"""		O	.	IDH1	6310	.	0			c.A593C						.						106.0	102.0	103.0					2																	209108256		2203	4300	6503	SO:0001583	missense	3417	exon6			GCCATTTGGAAGG		CCDS2381.1	2q34	2014-09-17			ENSG00000138413	ENSG00000138413	1.1.1.42		5382	protein-coding gene	gene with protein product		147700					Standard	NM_005896		Approved		uc002vcu.3	O75874	OTTHUMG00000132943	ENST00000415913.1:c.593A>C	chr2.hg19:g.209108256T>G	ENSP00000390265:p.Gln198Pro	65.0	0.0		56.0	13.0	NM_005896	Q567U4|Q6FHQ6|Q7Z3V0|Q93090|Q9NTJ9|Q9UKW8	Missense_Mutation	SNP	ENST00000415913.1	hg19	CCDS2381.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008438	0.75046	.	.	ENSG00000138413	ENST00000345146;ENST00000446179;ENST00000415913	T;T;T	0.78364	-1.17;-1.17;-1.17	5.91	3.49	0.39957	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.85392	0.5686	M	0.93062	3.375	0.80722	D	1	P	0.38335	0.627	P	0.46320	0.512	D	0.84940	0.0865	10	0.56958	D	0.05	-7.9797	11.4134	0.49939	0.2411:0.0:0.0:0.7589	.	198	O75874	IDHC_HUMAN	P	198	ENSP00000260985:Q198P;ENSP00000410513:Q198P;ENSP00000390265:Q198P	ENSP00000260985:Q198P	Q	-	2	0	IDH1	208816501	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.293000	0.72731	0.468000	0.27243	0.454000	0.30748	CAA	.	.		0.408	IDH1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336672.1		
TNS1	7145	hgsc.bcm.edu	37	2	218713775	218713775	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:218713775T>A	ENST00000171887.4	-	17	1542	c.1090A>T	c.(1090-1092)Agc>Tgc	p.S364C	TNS1_ENST00000419504.1_Missense_Mutation_p.S364C|TNS1_ENST00000430930.1_Missense_Mutation_p.S364C|TNS1_ENST00000480665.1_5'UTR	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	364					cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GCATACAGGCTCCCATCTAGT	0.597																																					p.S364C		Atlas-SNP	.											.	TNS1	251	.	0			c.A1090T						.						117.0	114.0	115.0					2																	218713775		2203	4300	6503	SO:0001583	missense	7145	exon17			ACAGGCTCCCATC	AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1090A>T	chr2.hg19:g.218713775T>A	ENSP00000171887:p.Ser364Cys	58.0	0.0		65.0	14.0	NM_022648	Q4ZG71|Q6IPI5	Missense_Mutation	SNP	ENST00000171887.4	hg19	CCDS2407.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.040514	0.75732	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554	D;D;D;D;D	0.96232	-3.31;-3.3;-3.32;-3.71;-3.95	5.22	5.22	0.72569	.	0.126908	0.64402	D	0.000001	D	0.97952	0.9326	M	0.81942	2.565	0.80722	D	1	D;P;D;D;D	0.89917	1.0;0.953;0.972;1.0;1.0	D;P;P;D;D	0.76071	0.987;0.627;0.614;0.972;0.972	D	0.98900	1.0776	10	0.87932	D	0	.	15.265	0.73654	0.0:0.0:0.0:1.0	.	364;418;364;364;364	B2RU35;A1L0S7;Q9HBL0;E9PGF5;E9PF55	.;.;TENS1_HUMAN;.;.	C	364;364;364;489;432	ENSP00000171887:S364C;ENSP00000408724:S364C;ENSP00000406016:S364C;ENSP00000405460:S489C;ENSP00000400383:S432C	ENSP00000171887:S364C	S	-	1	0	TNS1	218422020	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.827000	0.86722	2.188000	0.69820	0.533000	0.62120	AGC	.	.		0.597	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256672.2	NM_022648	
COL4A4	1286	hgsc.bcm.edu	37	2	227920768	227920768	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr2:227920768C>A	ENST00000396625.3	-	30	2816	c.2609G>T	c.(2608-2610)gGc>gTc	p.G870V	COL4A4_ENST00000329662.7_Missense_Mutation_p.G870V	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	870	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TCCGGGGAGGCCTTTCATTCC	0.632																																					p.G870V		Atlas-SNP	.											.	COL4A4	215	.	0			c.G2609T						.						42.0	45.0	44.0					2																	227920768		1857	4084	5941	SO:0001583	missense	1286	exon30			GGGAGGCCTTTCA		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2609G>T	chr2.hg19:g.227920768C>A	ENSP00000379866:p.Gly870Val	134.0	0.0		103.0	5.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	hg19	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481060	0.44147	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.99353	-5.77;-5.77	5.64	5.64	0.86602	.	.	.	.	.	D	0.99635	0.9866	H	0.95950	3.745	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97808	1.0249	9	0.87932	D	0	.	17.476	0.87659	0.0:1.0:0.0:0.0	.	870	P53420	CO4A4_HUMAN	V	870	ENSP00000379866:G870V;ENSP00000328553:G870V	ENSP00000328553:G870V	G	-	2	0	COL4A4	227629012	1.000000	0.71417	0.985000	0.45067	0.311000	0.27955	5.917000	0.69989	2.660000	0.90430	0.655000	0.94253	GGC	.	.		0.632	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CNTN4	152330	hgsc.bcm.edu	37	3	2777928	2777928	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:2777928A>G	ENST00000397461.1	+	4	469	c.85A>G	c.(85-87)Att>Gtt	p.I29V	CNTN4_ENST00000418658.1_Missense_Mutation_p.I29V|CNTN4_ENST00000427331.1_Missense_Mutation_p.I29V	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	29					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		CCCGATTTTTATTCAAGAACC	0.373																																					p.I29V		Atlas-SNP	.											.	CNTN4	335	.	0			c.A85G						.						173.0	164.0	167.0					3																	2777928		1827	4081	5908	SO:0001583	missense	152330	exon5			ATTTTTATTCAAG	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.85A>G	chr3.hg19:g.2777928A>G	ENSP00000380602:p.Ile29Val	104.0	0.0		80.0	14.0	NM_175607	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	hg19	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	A	10.37	1.332566	0.24167	.	.	ENSG00000144619	ENST00000422330;ENST00000455083;ENST00000418658;ENST00000397461;ENST00000434053;ENST00000427331	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	6.07	-3.9	0.04181	Immunoglobulin-like fold (1);	0.723211	0.13014	N	0.420610	T	0.22003	0.0530	L	0.28776	0.89	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.33394	-0.9870	10	0.10377	T	0.69	.	7.4138	0.27032	0.3362:0.3286:0.3353:0.0	.	29;29	B3KTK4;Q8IWV2	.;CNTN4_HUMAN	V	29;29;29;29;47;29	ENSP00000408594:I29V;ENSP00000396010:I29V;ENSP00000380602:I29V;ENSP00000404085:I47V;ENSP00000413642:I29V	ENSP00000380602:I29V	I	+	1	0	CNTN4	2752928	0.023000	0.18921	0.001000	0.08648	0.979000	0.70002	0.353000	0.20130	-0.934000	0.03733	0.533000	0.62120	ATT	.	.		0.373	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2		
DYNC1LI1	51143	hgsc.bcm.edu	37	3	32612261	32612261	+	Start_Codon_SNP	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:32612261A>T	ENST00000273130.4	-	1	105	c.2T>A	c.(1-3)aTg>aAg	p.M1K	DYNC1LI1_ENST00000432458.2_Start_Codon_SNP_p.M1K	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	1					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						CACGGCCGCCATCTTGGTCGG	0.652																																					p.M1K		Atlas-SNP	.											.	DYNC1LI1	23	.	0			c.T2A						.						20.0	23.0	22.0					3																	32612261		2203	4300	6503	SO:0001582	initiator_codon_variant	51143	exon1			GCCGCCATCTTGG	AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.2T>A	chr3.hg19:g.32612261A>T	ENSP00000273130:p.Met1Lys	169.0	0.0		140.0	17.0	NM_016141	A2RRG7|Q53HC8|Q53HK7	Missense_Mutation	SNP	ENST00000273130.4	hg19	CCDS2654.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.473173	0.63737	.	.	ENSG00000144635	ENST00000273130;ENST00000432458;ENST00000424991	T;T;T	0.51325	2.27;0.71;1.76	5.13	3.89	0.44902	.	0.000000	0.64402	D	0.000002	T	0.33760	0.0874	.	.	.	0.80722	D	1	B;B	0.33073	0.396;0.261	B;B	0.20767	0.031;0.031	T	0.36672	-0.9738	9	0.87932	D	0	-17.5505	9.7465	0.40451	0.8266:0.1734:0.0:0.0	.	1;1	E9PHI6;Q9Y6G9	.;DC1L1_HUMAN	K	1	ENSP00000273130:M1K;ENSP00000407279:M1K;ENSP00000409019:M1K	ENSP00000273130:M1K	M	-	2	0	DYNC1LI1	32587265	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	2.000000	0.40816	2.063000	0.61619	0.459000	0.35465	ATG	.	.		0.652	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253250.1	NM_016141	Missense_Mutation
DNAH12	201625	hgsc.bcm.edu	37	3	57445491	57445491	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:57445491C>A	ENST00000351747.2	-	20	2870	c.2690G>T	c.(2689-2691)cGa>cTa	p.R897L		NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	897	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TTCTTGTATTCGAATCAAGCG	0.348																																					p.R897L		Atlas-SNP	.											DNAH12,colon,carcinoma,0,1	DNAH12	182	.	0			c.G2690T						.						158.0	121.0	132.0					3																	57445491		692	1591	2283	SO:0001583	missense	201625	exon20			TGTATTCGAATCA	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.2690G>T	chr3.hg19:g.57445491C>A	ENSP00000295937:p.Arg897Leu	54.0	0.0		57.0	15.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	hg19		.	.	.	.	.	.	.	.	.	.	C	6.624	0.483655	0.12581	.	.	ENSG00000174844	ENST00000351747;ENST00000495027	T;T	0.60171	0.21;0.21	5.36	5.36	0.76844	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.37865	0.1019	N	0.04746	-0.17	0.80722	D	1	P	0.48503	0.911	P	0.48063	0.565	T	0.40720	-0.9548	9	0.02654	T	1	.	12.8732	0.57977	0.0:0.9156:0.0:0.0844	.	897	Q6ZR08	DYH12_HUMAN	L	897;920	ENSP00000295937:R897L;ENSP00000418137:R920L	ENSP00000295937:R897L	R	-	2	0	DNAH12	57420531	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.820000	0.39032	2.509000	0.84616	0.655000	0.94253	CGA	.	.		0.348	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
EPHA3	2042	hgsc.bcm.edu	37	3	89156944	89156944	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:89156944C>G	ENST00000336596.2	+	1	271	c.46C>G	c.(46-48)Ctc>Gtc	p.L16V	EPHA3_ENST00000494014.1_Missense_Mutation_p.L16V|EPHA3_ENST00000452448.2_Missense_Mutation_p.L16V	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	16					cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CTGCTCTGTTCTCGACAGCTT	0.577										TSP Lung(6;0.00050)																											p.L16V		Atlas-SNP	.											.	EPHA3	501	.	0			c.C46G						.						170.0	130.0	144.0					3																	89156944		2203	4300	6503	SO:0001583	missense	2042	exon1			TCTGTTCTCGACA	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.46C>G	chr3.hg19:g.89156944C>G	ENSP00000337451:p.Leu16Val	72.0	0.0		55.0	6.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	hg19	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	C	5.616	0.298298	0.10622	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.73469	-0.73;2.65;-0.75	5.59	4.72	0.59763	.	0.329134	0.28901	N	0.013763	T	0.63248	0.2495	L	0.29908	0.895	0.19300	N	0.999973	B;B	0.21606	0.005;0.058	B;B	0.23574	0.007;0.047	T	0.49899	-0.8890	9	.	.	.	.	13.9221	0.63937	0.0:0.926:0.0:0.0739	.	16;16	P29320;P29320-2	EPHA3_HUMAN;.	V	16	ENSP00000337451:L16V;ENSP00000399926:L16V;ENSP00000419190:L16V	.	L	+	1	0	EPHA3	89239634	0.738000	0.28186	0.079000	0.20413	0.004000	0.04260	1.640000	0.37186	1.363000	0.46019	0.561000	0.74099	CTC	.	.		0.577	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
EPHA3	2042	hgsc.bcm.edu	37	3	89478259	89478259	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:89478259A>G	ENST00000336596.2	+	12	2303	c.2078A>G	c.(2077-2079)aAg>aGg	p.K693R	EPHA3_ENST00000494014.1_Missense_Mutation_p.K693R	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	693	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TATCTAGGTAAGCCAGTTATG	0.299										TSP Lung(6;0.00050)																											p.K693R		Atlas-SNP	.											.	EPHA3	501	.	0			c.A2078G						.						95.0	100.0	98.0					3																	89478259		2203	4300	6503	SO:0001583	missense	2042	exon12			TAGGTAAGCCAGT	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2078A>G	chr3.hg19:g.89478259A>G	ENSP00000337451:p.Lys693Arg	122.0	0.0		96.0	8.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	hg19	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	A	15.59	2.878195	0.51801	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	T;T	0.62364	0.03;0.03	5.68	5.68	0.88126	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	N	0.02345	-0.59	0.80722	D	1	D	0.60160	0.987	D	0.73380	0.98	T	0.63972	-0.6516	9	.	.	.	.	16.2237	0.82280	1.0:0.0:0.0:0.0	.	693	P29320	EPHA3_HUMAN	R	693	ENSP00000337451:K693R;ENSP00000419190:K693R	.	K	+	2	0	EPHA3	89560949	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.287000	0.95975	2.289000	0.77006	0.482000	0.46254	AAG	.	.		0.299	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
KALRN	8997	hgsc.bcm.edu	37	3	124438224	124438224	+	Silent	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:124438224A>G	ENST00000291478.5	+	27	3940	c.3777A>G	c.(3775-3777)gcA>gcG	p.A1259A	KALRN_ENST00000428018.2_Silent_p.A1227A|KALRN_ENST00000360013.3_Silent_p.A2956A	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2955					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						CCCGCCTAGCATGCTTCATAG	0.562																																					p.A2956A		Atlas-SNP	.											.	KALRN	556	.	0			c.A8868G						.						57.0	59.0	58.0					3																	124438224		2200	4299	6499	SO:0001819	synonymous_variant	8997	exon60			CCTAGCATGCTTC	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.3777A>G	chr3.hg19:g.124438224A>G		135.0	0.0		108.0	31.0	NM_001024660	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000291478.5	hg19	CCDS3028.1	.	.	.	.	.	.	.	.	.	.	A	6.955	0.546063	0.13312	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.3	-10.0	0.00425	.	.	.	.	.	T	0.34600	0.0903	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41787	-0.9489	4	.	.	.	.	3.3715	0.07223	0.5127:0.1749:0.1801:0.1324	.	.	.	.	R	2925	.	.	H	+	2	0	KALRN	125920914	0.000000	0.05858	0.626000	0.29213	0.983000	0.72400	-1.636000	0.02016	-1.789000	0.01264	-0.376000	0.06991	CAT	.	.		0.562	KALRN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000246891.5	NM_003947	
TIPARP	25976	hgsc.bcm.edu	37	3	156396043	156396043	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:156396043C>T	ENST00000461166.1	+	2	1145	c.557C>T	c.(556-558)cCa>cTa	p.P186L	TIPARP_ENST00000542783.1_Missense_Mutation_p.P186L|TIPARP_ENST00000486483.1_Missense_Mutation_p.P186L|TIPARP_ENST00000295924.7_Missense_Mutation_p.P186L	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	186					androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GATTATGTTCCAGGCATTTTC	0.423																																					p.P186L	Ovarian(171;276 1987 3319 6837 11197)	Atlas-SNP	.											.	TIPARP	50	.	0			c.C557T						.						119.0	121.0	120.0					3																	156396043		2203	4300	6503	SO:0001583	missense	25976	exon2			ATGTTCCAGGCAT	BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.557C>T	chr3.hg19:g.156396043C>T	ENSP00000420612:p.Pro186Leu	113.0	0.0		123.0	6.0	NM_015508	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Missense_Mutation	SNP	ENST00000461166.1	hg19	CCDS3177.1	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942230	0.34283	.	.	ENSG00000163659	ENST00000486483;ENST00000295924;ENST00000461166;ENST00000473702;ENST00000481853;ENST00000542783	T;T;T;T;T;T	0.24723	2.87;2.87;2.87;1.84;2.87;2.87	5.11	5.11	0.69529	.	0.222920	0.37095	N	0.002254	T	0.18130	0.0435	N	0.14661	0.345	0.49213	D	0.999769	B	0.29432	0.244	B	0.22386	0.039	T	0.07009	-1.0795	10	0.87932	D	0	.	18.1531	0.89682	0.0:1.0:0.0:0.0	.	186	Q7Z3E1	PARPT_HUMAN	L	186	ENSP00000418757:P186L;ENSP00000295924:P186L;ENSP00000420612:P186L;ENSP00000419982:P186L;ENSP00000418829:P186L;ENSP00000438345:P186L	ENSP00000295924:P186L	P	+	2	0	TIPARP	157878737	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	3.739000	0.55075	2.390000	0.81377	0.563000	0.77884	CCA	.	.		0.423	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351618.1	NM_015508	
WDR49	151790	hgsc.bcm.edu	37	3	167196762	167196762	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr3:167196762C>A	ENST00000308378.3	-	15	2303	c.1998G>T	c.(1996-1998)gaG>gaT	p.E666D	WDR49_ENST00000453925.2_Missense_Mutation_p.E631D|WDR49_ENST00000479765.1_3'UTR|WDR49_ENST00000476376.1_Missense_Mutation_p.E491D|SERPINI2_ENST00000476257.1_5'UTR	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49	666										breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						ACAGGTTTTTCTCATCAAATA	0.313																																					p.E666D		Atlas-SNP	.											.	WDR49	188	.	0			c.G1998T						.						67.0	64.0	65.0					3																	167196762		2201	4296	6497	SO:0001583	missense	151790	exon15			GTTTTTCTCATCA	AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.1998G>T	chr3.hg19:g.167196762C>A	ENSP00000311343:p.Glu666Asp	59.0	0.0		80.0	16.0	NM_178824	Q8N297	Missense_Mutation	SNP	ENST00000308378.3	hg19	CCDS3201.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.35|11.35	1.612536|1.612536	0.28712|0.28712	.|.	.|.	ENSG00000174776|ENSG00000174776	ENST00000308378;ENST00000476376;ENST00000453925|ENST00000472600	T;T;T|.	0.62639|.	0.01;1.25;0.14|.	5.61|5.61	1.9|1.9	0.25705|0.25705	.|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.51126|0.51126	0.1656|0.1656	M|M	0.66939|0.66939	2.045|2.045	0.20307|0.20307	N|N	0.999917|0.999917	D;D|.	0.76494|.	0.999;0.999|.	D;D|.	0.78314|.	0.991;0.991|.	T|T	0.40979|0.40979	-0.9534|-0.9534	10|5	0.49607|.	T|.	0.09|.	.|.	8.8004|8.8004	0.34905|0.34905	0.0:0.6197:0.0:0.3803|0.0:0.6197:0.0:0.3803	.|.	631;666|.	E7EQK3;Q8IV35|.	.;WDR49_HUMAN|.	D|I	666;491;631|643	ENSP00000311343:E666D;ENSP00000420508:E491D;ENSP00000410863:E631D|.	ENSP00000311343:E666D|.	E|R	-|-	3|2	2|0	WDR49|WDR49	168679456|168679456	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.249000|0.249000	0.25844|0.25844	1.135000|1.135000	0.31454|0.31454	0.074000|0.074000	0.16767|0.16767	-0.136000|-0.136000	0.14681|0.14681	GAG|AGA	.	.		0.313	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350592.3	NM_178824	
UGT2B11	10720	hgsc.bcm.edu	37	4	70079851	70079851	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr4:70079851A>G	ENST00000446444.1	-	1	598	c.590T>C	c.(589-591)gTt>gCt	p.V197A	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	197					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)	p.V197G(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						TTTTGACATAACAATAGGTAT	0.373																																					p.V197A		Atlas-SNP	.											UGT2B11,colon,carcinoma,0,1	UGT2B11	92	.	1	Substitution - Missense(1)	large_intestine(1)	c.T590C						.						64.0	64.0	64.0					4																	70079851		2202	4295	6497	SO:0001583	missense	10720	exon1			GACATAACAATAG	AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.590T>C	chr4.hg19:g.70079851A>G	ENSP00000387683:p.Val197Ala	196.0	0.0		165.0	8.0	NM_001073	Q3KNV9	Missense_Mutation	SNP	ENST00000446444.1	hg19	CCDS3527.1	.	.	.	.	.	.	.	.	.	.	-	0.015	-1.542083	0.00934	.	.	ENSG00000213759	ENST00000446444	T	0.60424	0.19	1.96	0.78	0.18556	.	1.185740	0.06681	U	0.767952	T	0.36441	0.0967	N	0.20610	0.595	0.09310	N	1	B	0.09022	0.002	B	0.15484	0.013	T	0.23833	-1.0177	10	0.16420	T	0.52	.	3.4697	0.07562	0.592:0.0:0.408:0.0	.	197	O75310	UDB11_HUMAN	A	197	ENSP00000387683:V197A	ENSP00000387683:V197A	V	-	2	0	UGT2B11	70114440	0.000000	0.05858	0.027000	0.17364	0.141000	0.21300	-0.772000	0.04694	0.898000	0.36418	0.155000	0.16302	GTT	.	.		0.373	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251551.2	NM_001073	
LIN54	132660	hgsc.bcm.edu	37	4	83861045	83861045	+	Silent	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr4:83861045T>C	ENST00000340417.3	-	6	1616	c.1239A>G	c.(1237-1239)aaA>aaG	p.K413K	LIN54_ENST00000442461.2_Silent_p.K192K|LIN54_ENST00000395283.2_Silent_p.K324K|LIN54_ENST00000446851.2_Silent_p.K192K|LIN54_ENST00000510557.1_Silent_p.K192K|LIN54_ENST00000395282.2_3'UTR|LIN54_ENST00000505397.1_Silent_p.K413K|LIN54_ENST00000506560.1_Silent_p.K324K	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	413					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				TACTTACTTGTTTGACAGCCT	0.348																																					p.K413K		Atlas-SNP	.											.	LIN54	50	.	0			c.A1239G						.						131.0	140.0	137.0					4																	83861045		2203	4300	6503	SO:0001819	synonymous_variant	132660	exon6			TACTTGTTTGACA	BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.1239A>G	chr4.hg19:g.83861045T>C		174.0	0.0		127.0	11.0	NM_194282	Q32M68|Q32M69|Q6N071|Q76B60	Silent	SNP	ENST00000340417.3	hg19	CCDS3599.1																																																																																			.	.		0.348	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252626.2	NM_194282	
FAT4	79633	hgsc.bcm.edu	37	4	126240520	126240520	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr4:126240520A>C	ENST00000394329.3	+	1	2967	c.2954A>C	c.(2953-2955)tAt>tCt	p.Y985S		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	985	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTAACAGTTTATGTCCATGAT	0.438																																					p.Y985S		Atlas-SNP	.											.	FAT4	1752	.	0			c.A2954C						.						104.0	101.0	102.0					4																	126240520		1950	4140	6090	SO:0001583	missense	79633	exon1			CAGTTTATGTCCA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.2954A>C	chr4.hg19:g.126240520A>C	ENSP00000377862:p.Tyr985Ser	59.0	0.0		65.0	6.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	A	0.079	-1.187918	0.01607	.	.	ENSG00000196159	ENST00000394329	T	0.01560	4.77	5.1	1.3	0.21679	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	0.275088	0.19205	U	0.120080	T	0.00724	0.0024	N	0.02775	-0.495	0.54753	D	0.999988	B	0.02656	0.0	B	0.06405	0.002	T	0.47142	-0.9140	10	0.06099	T	0.92	.	5.8147	0.18486	0.5054:0.3124:0.1823:0.0	.	985	Q6V0I7	FAT4_HUMAN	S	985	ENSP00000377862:Y985S	ENSP00000377862:Y985S	Y	+	2	0	FAT4	126459970	1.000000	0.71417	0.544000	0.28141	0.326000	0.28443	2.648000	0.46647	0.419000	0.25927	-0.250000	0.11733	TAT	.	.		0.438	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
FAT4	79633	hgsc.bcm.edu	37	4	126242187	126242187	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr4:126242187G>T	ENST00000394329.3	+	1	4634	c.4621G>T	c.(4621-4623)Gct>Tct	p.A1541S		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1541	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						AGACCCATCAGCTGTGATTGG	0.443																																					p.A1541S		Atlas-SNP	.											.	FAT4	1752	.	0			c.G4621T						.						150.0	139.0	143.0					4																	126242187		1959	4165	6124	SO:0001583	missense	79633	exon1			CCATCAGCTGTGA	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4621G>T	chr4.hg19:g.126242187G>T	ENSP00000377862:p.Ala1541Ser	130.0	0.0		91.0	4.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	10.25	1.297405	0.23650	.	.	ENSG00000196159	ENST00000394329	T	0.54479	0.57	4.35	3.5	0.40072	Cadherin (2);Cadherin-like (1);	0.236802	0.20899	U	0.083677	T	0.39911	0.1096	L	0.28556	0.865	0.52501	D	0.99995	B	0.29862	0.259	B	0.35859	0.212	T	0.15407	-1.0438	10	0.25751	T	0.34	.	8.3353	0.32211	0.0833:0.1559:0.7608:0.0	.	1541	Q6V0I7	FAT4_HUMAN	S	1541	ENSP00000377862:A1541S	ENSP00000377862:A1541S	A	+	1	0	FAT4	126461637	0.994000	0.37717	0.666000	0.29783	0.988000	0.76386	3.084000	0.50143	1.186000	0.42985	0.655000	0.94253	GCT	.	.		0.443	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
F11	2160	hgsc.bcm.edu	37	4	187201692	187201692	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr4:187201692G>A	ENST00000403665.2	+	10	1445	c.1093G>A	c.(1093-1095)Ggc>Agc	p.G365S	F11_ENST00000264692.4_Missense_Mutation_p.G313S	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	365	Apple 4. {ECO:0000255|PROSITE- ProRule:PRU00315}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	CGGGAGAGGAGGCATCTCTGG	0.368																																					p.G365S		Atlas-SNP	.											.	F11	65	.	0			c.G1093A						.						100.0	95.0	96.0					4																	187201692		2203	4300	6503	SO:0001583	missense	2160	exon10			AGAGGAGGCATCT	M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.1093G>A	chr4.hg19:g.187201692G>A	ENSP00000384957:p.Gly365Ser	218.0	0.0		178.0	18.0	NM_000128	D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	ENST00000403665.2	hg19	CCDS3847.1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180702	0.57800	.	.	ENSG00000088926	ENST00000403665;ENST00000264692	D;D	0.88586	-2.4;-2.4	5.37	2.65	0.31530	Apple domain (2);PAN-1 domain (1);Apple-like (1);	0.446139	0.22798	N	0.055505	D	0.83505	0.5269	L	0.50333	1.59	0.27106	N	0.962503	B	0.15719	0.014	B	0.30401	0.115	T	0.65051	-0.6262	10	0.08599	T	0.76	.	8.3232	0.32140	0.4049:0.0:0.5951:0.0	.	365	P03951	FA11_HUMAN	S	365;313	ENSP00000384957:G365S;ENSP00000264692:G313S	ENSP00000264692:G313S	G	+	1	0	F11	187438686	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	1.354000	0.34056	0.310000	0.22990	0.655000	0.94253	GGC	.	.		0.368	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317519.4		
ICE1	23379	hgsc.bcm.edu	37	5	5464791	5464791	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:5464791G>C	ENST00000296564.7	+	13	5566	c.5344G>C	c.(5344-5346)Gac>Cac	p.D1782H		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1782					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TCCGCCTGCTGACTGTAAGAA	0.493																																					p.D1782H		Atlas-SNP	.											KIAA0947_ENST00000296564,right_upper_lobe,carcinoma,0,1	KIAA0947	301	.	0			c.G5344C						.						29.0	30.0	30.0					5																	5464791		1923	4125	6048	SO:0001583	missense	23379	exon13			CCTGCTGACTGTA																												ENST00000296564.7:c.5344G>C	chr5.hg19:g.5464791G>C	ENSP00000296564:p.Asp1782His	144.0	0.0		202.0	42.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	G	17.79	3.477002	0.63849	.	.	ENSG00000164151	ENST00000296564	T	0.14640	2.49	5.41	3.62	0.41486	.	.	.	.	.	T	0.27454	0.0674	L	0.47716	1.5	0.09310	N	0.999997	D	0.76494	0.999	D	0.71870	0.975	T	0.03534	-1.1027	9	0.72032	D	0.01	-9.2346	9.3324	0.38030	0.1737:0.0:0.8263:0.0	.	1782	Q9Y2F5	K0947_HUMAN	H	1782	ENSP00000296564:D1782H	ENSP00000296564:D1782H	D	+	1	0	KIAA0947	5517791	1.000000	0.71417	0.036000	0.18154	0.429000	0.31625	4.908000	0.63307	1.282000	0.44496	0.467000	0.42956	GAC	.	.		0.493	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
SLC1A3	6507	hgsc.bcm.edu	37	5	36629633	36629633	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:36629633T>C	ENST00000265113.4	+	3	739	c.263T>C	c.(262-264)cTg>cCg	p.L88P	SLC1A3_ENST00000381918.3_Missense_Mutation_p.L88P	NM_004172.4	NP_004163.3	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 3	88					auditory behavior (GO:0031223)|cell morphogenesis involved in neuron differentiation (GO:0048667)|cranial nerve development (GO:0021545)|D-aspartate import (GO:0070779)|gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate biosynthetic process (GO:0006537)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter uptake (GO:0001504)|positive regulation of synaptic transmission (GO:0050806)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to wounding (GO:0009611)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cell surface (GO:0009986)|fibril (GO:0043205)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|high-affinity glutamate transmembrane transporter activity (GO:0005314)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(23)|skin(1)	41	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GGGGAACTTCTGATGAGGATG	0.413																																					p.L88P		Atlas-SNP	.											.	SLC1A3	88	.	0			c.T263C						.						266.0	245.0	252.0					5																	36629633		2203	4300	6503	SO:0001583	missense	6507	exon3			AACTTCTGATGAG		CCDS3919.1, CCDS54844.1	5p13	2013-05-22			ENSG00000079215	ENSG00000079215		"""Solute carriers"""	10941	protein-coding gene	gene with protein product	"""glutamate transporter variant EAAT1ex9skip"""	600111				7521911, 7698014	Standard	NM_004172		Approved	EAAT1, GLAST, EA6	uc003jkj.4	P43003	OTTHUMG00000090793	ENST00000265113.4:c.263T>C	chr5.hg19:g.36629633T>C	ENSP00000265113:p.Leu88Pro	133.0	0.0		146.0	44.0	NM_004172	B2R5T3|Q4JCQ8	Missense_Mutation	SNP	ENST00000265113.4	hg19	CCDS3919.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.225763	0.79576	.	.	ENSG00000079215	ENST00000265113;ENST00000513903;ENST00000505202;ENST00000513646;ENST00000381918	T;T;T;T;T	0.60672	0.17;0.17;0.17;0.17;0.17	5.77	5.77	0.91146	Sodium:dicarboxylate symporter, conserved site (1);	0.000000	0.64402	D	0.000001	T	0.81351	0.4804	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.99;0.998	D	0.85795	0.1370	10	0.87932	D	0	-9.3688	16.0914	0.81091	0.0:0.0:0.0:1.0	.	88;88	Q4JCQ8;P43003	.;EAA1_HUMAN	P	88	ENSP00000265113:L88P;ENSP00000427203:L88P;ENSP00000424986:L88P;ENSP00000420992:L88P;ENSP00000371343:L88P	ENSP00000265113:L88P	L	+	2	0	SLC1A3	36665390	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.669000	0.83911	2.184000	0.69523	0.533000	0.62120	CTG	.	.		0.413	SLC1A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207579.2	NM_004172	
NIPBL	25836	hgsc.bcm.edu	37	5	36976040	36976040	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:36976040T>C	ENST00000282516.8	+	9	1530	c.1031T>C	c.(1030-1032)aTg>aCg	p.M344T	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.M344T	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	344					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AAAGCGGCAATGTATGATATA	0.378																																					p.M344T		Atlas-SNP	.											.	NIPBL	513	.	0			c.T1031C						.						105.0	111.0	109.0					5																	36976040		2203	4300	6503	SO:0001583	missense	25836	exon9			CGGCAATGTATGA	AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1031T>C	chr5.hg19:g.36976040T>C	ENSP00000282516:p.Met344Thr	231.0	0.0		246.0	70.0	NM_015384	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	ENST00000282516.8	hg19	CCDS3920.1	.	.	.	.	.	.	.	.	.	.	T	14.75	2.629755	0.46944	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.94092	-3.35;-3.35	5.14	5.14	0.70334	.	0.044753	0.85682	D	0.000000	D	0.87981	0.6315	N	0.24115	0.695	0.49798	D	0.999827	P;P	0.40834	0.61;0.73	B;B	0.38020	0.135;0.263	D	0.88167	0.2861	10	0.40728	T	0.16	.	14.9485	0.71050	0.0:0.0:0.0:1.0	.	344;344	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	T	344	ENSP00000282516:M344T;ENSP00000406266:M344T	ENSP00000282516:M344T	M	+	2	0	NIPBL	37011797	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.698000	0.84413	1.935000	0.56089	0.383000	0.25322	ATG	.	.		0.378	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207582.1	NM_015384	
EGFLAM	133584	hgsc.bcm.edu	37	5	38435262	38435262	+	Silent	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:38435262C>T	ENST00000354891.3	+	16	2536	c.2190C>T	c.(2188-2190)tgC>tgT	p.C730C	EGFLAM_ENST00000336740.6_Silent_p.C496C|EGFLAM_ENST00000397202.2_Silent_p.C96C|EGFLAM_ENST00000322350.5_Silent_p.C730C	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	730	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGATTAAGTGCAACACAGACA	0.423																																					p.C730C	Colon(62;485 1295 3347 17454)	Atlas-SNP	.											.	EGFLAM	302	.	0			c.C2190T						.						104.0	103.0	104.0					5																	38435262		2203	4300	6503	SO:0001819	synonymous_variant	133584	exon16			TAAGTGCAACACA	AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2190C>T	chr5.hg19:g.38435262C>T		85.0	0.0		117.0	35.0	NM_001205301	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Silent	SNP	ENST00000354891.3	hg19	CCDS56363.1																																																																																			.	.		0.423	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367323.1	NM_152403	
POLK	51426	hgsc.bcm.edu	37	5	74880726	74880726	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:74880726G>T	ENST00000241436.4	+	9	1373	c.1201G>T	c.(1201-1203)Ggt>Tgt	p.G401C	POLK_ENST00000504026.1_Missense_Mutation_p.G401C|POLK_ENST00000515295.1_Missense_Mutation_p.G401C|POLK_ENST00000380481.3_Missense_Mutation_p.G311C|POLK_ENST00000352007.5_Intron|POLK_ENST00000506928.1_3'UTR|POLK_ENST00000508526.1_Intron	NM_016218.2	NP_057302.1	Q9UBT6	POLK_HUMAN	polymerase (DNA directed) kappa	401					DNA repair (GO:0006281)|nucleotide-excision repair, DNA gap filling (GO:0006297)	nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			endometrium(1)|kidney(4)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	27		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;2.9e-54)|all cancers(79;1.27e-42)		TATCTCCTTGGGTCTAGGTTC	0.388								DNA polymerases (catalytic subunits)																													p.G401C		Atlas-SNP	.											.	POLK	123	.	0			c.G1201T						.						202.0	196.0	198.0					5																	74880726		2203	4300	6503	SO:0001583	missense	51426	exon9			TCCTTGGGTCTAG	AB027564	CCDS4030.1	5q13	2012-05-18			ENSG00000122008	ENSG00000122008		"""DNA polymerases"""	9183	protein-coding gene	gene with protein product	"""polymerase (DNA-directed) kappa"", ""DINB protein"", ""DNA polymerase kappa"""	605650		DINB1		10887153, 10518552	Standard	NM_016218		Approved	POLQ, DINP	uc003kdw.3	Q9UBT6	OTTHUMG00000102107	ENST00000241436.4:c.1201G>T	chr5.hg19:g.74880726G>T	ENSP00000241436:p.Gly401Cys	199.0	0.0		185.0	42.0	NM_016218	B2RBD2|Q5Q9G5|Q5Q9G6|Q5Q9G7|Q5Q9G8|Q86VJ8|Q8IZY0|Q8IZY1|Q8NB30|Q96L01|Q96Q86|Q96Q87|Q9UHC5	Missense_Mutation	SNP	ENST00000241436.4	hg19	CCDS4030.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990151	0.74589	.	.	ENSG00000122008	ENST00000241436;ENST00000515295;ENST00000504026;ENST00000380481	D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.34	5.25	5.25	0.73442	DNA polymerase, Y-family, little finger domain (1);	0.000000	0.85682	D	0.000000	D	0.97971	0.9332	H	0.95850	3.73	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99044	1.0825	10	0.87932	D	0	-18.937	19.2037	0.93722	0.0:0.0:1.0:0.0	.	401;401;401	Q5Q9G5;Q9UBT6-2;Q9UBT6	.;.;POLK_HUMAN	C	401;401;401;311	ENSP00000241436:G401C;ENSP00000424174:G401C;ENSP00000425075:G401C;ENSP00000369848:G311C	ENSP00000241436:G401C	G	+	1	0	POLK	74916482	1.000000	0.71417	0.999000	0.59377	0.485000	0.33311	9.792000	0.99085	2.606000	0.88127	0.491000	0.48974	GGT	.	.		0.388	POLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219945.3	NM_016218	
MCTP1	79772	hgsc.bcm.edu	37	5	94204080	94204081	+	Nonsense_Mutation	DNP	GC	GC	TT			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:94204080_94204081GC>TT	ENST00000515393.1	-	17	2392_2393	c.2393_2394GC>AA	c.(2392-2394)tGC>tAA	p.C798*	MCTP1_ENST00000312216.8_Nonsense_Mutation_p.C577*|MCTP1_ENST00000505208.1_Nonsense_Mutation_p.C577*|MCTP1_ENST00000505078.1_Nonsense_Mutation_p.C314*|MCTP1_ENST00000429576.2_Nonsense_Mutation_p.C531*	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	798					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.C798C(1)		breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CCCAATCAAAGCAACTATTAAC	0.356																																					p.C798X|p.C798Y		Atlas-SNP	.											MCTP1,NS,carcinoma,0,2|.	MCTP1	110	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C2394A|c.G2393A						.																																			SO:0001587	stop_gained	79772	exon17			ATCAAAGCAACTA|TCAAAGCAACTAT		CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.2393_2394delinsTT	chr5.hg19:g.94204080_94204081delinsTT	ENSP00000424126:p.Cys798*	110.0|111.0	0.0		111.0|109.0	22.0	NM_024717	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Nonsense_Mutation|Missense_Mutation	SNP	ENST00000515393.1	hg19	CCDS34203.1																																																																																			.	.		0.356	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
FBN2	2201	hgsc.bcm.edu	37	5	127610297	127610297	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:127610297C>T	ENST00000508053.1	-	66	8647	c.7673G>A	c.(7672-7674)tGt>tAt	p.C2558Y	FBN2_ENST00000262464.4_Missense_Mutation_p.C2558Y			P35556	FBN2_HUMAN	fibrillin 2	2558	EGF-like 43; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ACCAGGTGGACATTTACAGGT	0.398																																					p.C2558Y		Atlas-SNP	.											.	FBN2	858	.	0			c.G7673A						.						99.0	95.0	97.0					5																	127610297		2203	4300	6503	SO:0001583	missense	2201	exon60			GGTGGACATTTAC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.7673G>A	chr5.hg19:g.127610297C>T	ENSP00000424571:p.Cys2558Tyr	169.0	0.0		127.0	6.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.709294	0.89018	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.99445	-5.91;-5.91	4.92	4.92	0.64577	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000004	D	0.99743	0.9898	H	0.97214	3.96	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	D	0.97148	0.9829	10	0.87932	D	0	.	18.6729	0.91518	0.0:1.0:0.0:0.0	.	2558	P35556	FBN2_HUMAN	Y	2558	ENSP00000262464:C2558Y;ENSP00000424571:C2558Y	ENSP00000262464:C2558Y	C	-	2	0	FBN2	127638196	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.609000	0.82925	2.701000	0.92244	0.585000	0.79938	TGT	.	.		0.398	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
GRIA1	2890	hgsc.bcm.edu	37	5	153144134	153144134	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:153144134A>G	ENST00000285900.5	+	12	2307	c.1964A>G	c.(1963-1965)aAg>aGg	p.K655R	GRIA1_ENST00000340592.5_Missense_Mutation_p.K655R|GRIA1_ENST00000518783.1_Missense_Mutation_p.K665R|GRIA1_ENST00000521843.2_Missense_Mutation_p.K586R|GRIA1_ENST00000448073.4_Missense_Mutation_p.K665R|GRIA1_ENST00000518142.1_Missense_Mutation_p.K575R	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	655					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GACCTAGCGAAGCAGACAGAA	0.502																																					p.K665R		Atlas-SNP	.											.	GRIA1	321	.	0			c.A1994G						.						117.0	97.0	104.0					5																	153144134		2203	4300	6503	SO:0001583	missense	2890	exon12			TAGCGAAGCAGAC		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1964A>G	chr5.hg19:g.153144134A>G	ENSP00000285900:p.Lys655Arg	109.0	0.0		121.0	12.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	ENST00000285900.5	hg19	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.573999	0.86542	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.38401	1.68;1.68;1.14;1.68;1.68;1.68;1.14	5.27	5.27	0.74061	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.46521	0.1397	N	0.21142	0.635	0.80722	D	1	D;D;B;D;D	0.76494	0.999;0.999;0.022;0.999;0.997	D;D;B;D;D	0.85130	0.997;0.997;0.071;0.995;0.951	T	0.51317	-0.8721	10	0.87932	D	0	.	14.3539	0.66722	1.0:0.0:0.0:0.0	.	665;665;575;655;655	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	R	655;655;575;609;655;588;586;665;665	ENSP00000285900:K655R;ENSP00000427920:K575R;ENSP00000339343:K655R;ENSP00000427864:K588R;ENSP00000442108:K586R;ENSP00000428994:K665R;ENSP00000415569:K665R	ENSP00000285900:K655R	K	+	2	0	GRIA1	153124327	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.125000	0.94402	1.980000	0.57719	0.459000	0.35465	AAG	.	.		0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
KIF4B	285643	hgsc.bcm.edu	37	5	154393731	154393731	+	Silent	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:154393731G>A	ENST00000435029.4	+	1	472	c.312G>A	c.(310-312)gcG>gcA	p.A104A		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	104	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CATACACTGCGGAGCAGGAGA	0.413																																					p.A104A		Atlas-SNP	.											.	KIF4B	307	.	0			c.G312A						.						100.0	106.0	104.0					5																	154393731		2203	4300	6503	SO:0001819	synonymous_variant	285643	exon1			CACTGCGGAGCAG	AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.312G>A	chr5.hg19:g.154393731G>A		296.0	0.0		322.0	24.0	NM_001099293		Silent	SNP	ENST00000435029.4	hg19	CCDS47324.1																																																																																			.	.		0.413	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377478.1		
SH3PXD2B	285590	hgsc.bcm.edu	37	5	171766310	171766310	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:171766310T>G	ENST00000311601.5	-	13	1969	c.1799A>C	c.(1798-1800)cAc>cCc	p.H600P	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	600					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAAGACCTTGTGGCCACACTC	0.557																																					p.H600P		Atlas-SNP	.											.	SH3PXD2B	91	.	0			c.A1799C						.						54.0	62.0	59.0					5																	171766310		2200	4300	6500	SO:0001583	missense	285590	exon13			ACCTTGTGGCCAC	AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1799A>C	chr5.hg19:g.171766310T>G	ENSP00000309714:p.His600Pro	70.0	0.0		77.0	23.0	NM_001017995	B6F0V2|Q9P2Q1	Missense_Mutation	SNP	ENST00000311601.5	hg19	CCDS34291.1	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735696	0.69189	.	.	ENSG00000174705	ENST00000311601	T	0.65178	-0.14	5.74	5.74	0.90152	.	2.017670	0.02558	N	0.096410	T	0.75903	0.3913	L	0.36672	1.1	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.55173	-0.8182	9	.	.	.	-34.7274	13.975	0.64268	0.0:0.0:0.0:1.0	.	600	A1X283	SPD2B_HUMAN	P	600	ENSP00000309714:H600P	.	H	-	2	0	SH3PXD2B	171698915	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.843000	0.69424	2.189000	0.69895	0.459000	0.35465	CAC	.	.		0.557	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372449.1	NM_017963	
RASGEF1C	255426	hgsc.bcm.edu	37	5	179555536	179555536	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr5:179555536T>G	ENST00000393371.2	-	4	809	c.513A>C	c.(511-513)gaA>gaC	p.E171D	RASGEF1C_ENST00000519883.1_5'UTR|RASGEF1C_ENST00000522500.1_Missense_Mutation_p.E20D|RASGEF1C_ENST00000361132.4_Missense_Mutation_p.E171D			Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	171					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	12	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCACCAGACCTTCTGGCCCCT	0.627																																					p.E171D		Atlas-SNP	.											.	RASGEF1C	81	.	0			c.A513C						.						73.0	63.0	67.0					5																	179555536		2203	4300	6503	SO:0001583	missense	255426	exon5			CAGACCTTCTGGC	AK093160	CCDS4452.1	5q35.3	2005-08-16			ENSG00000146090	ENSG00000146090			27400	protein-coding gene	gene with protein product						12477932	Standard	XM_006714839		Approved	FLJ35841	uc003mlr.3	Q8N431	OTTHUMG00000130914	ENST00000393371.2:c.513A>C	chr5.hg19:g.179555536T>G	ENSP00000377037:p.Glu171Asp	90.0	0.0		81.0	5.0	NM_175062	D3DWQ7|Q7Z4T0|Q8NA49	Missense_Mutation	SNP	ENST00000393371.2	hg19	CCDS4452.1	.	.	.	.	.	.	.	.	.	.	T	11.96	1.794274	0.31777	.	.	ENSG00000146090	ENST00000361132;ENST00000393371;ENST00000522500	T;T;T	0.29655	1.56;1.56;1.56	4.31	3.09	0.35607	Ras guanine nucleotide exchange factor, domain (1);	0.058075	0.64402	N	0.000002	T	0.32496	0.0831	M	0.69823	2.125	0.41724	D	0.98952	B	0.25235	0.121	B	0.31751	0.135	T	0.06954	-1.0798	10	0.26408	T	0.33	.	9.057	0.36412	0.165:0.0:0.0:0.835	.	171	Q8N431	RGF1C_HUMAN	D	171;171;20	ENSP00000354963:E171D;ENSP00000377037:E171D;ENSP00000429114:E20D	ENSP00000354963:E171D	E	-	3	2	RASGEF1C	179488142	1.000000	0.71417	0.438000	0.26821	0.077000	0.17291	1.678000	0.37586	0.595000	0.29777	0.402000	0.26972	GAA	.	.		0.627	RASGEF1C-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253506.2	NM_175062	
SLC44A4	80736	hgsc.bcm.edu	37	6	31839271	31839271	+	Silent	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr6:31839271G>A	ENST00000229729.6	-	8	617	c.597C>T	c.(595-597)acC>acT	p.T199T	SLC44A4_ENST00000544672.1_Silent_p.T123T|SLC44A4_ENST00000375562.4_Silent_p.T157T	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	199					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GCTGTATGGTGGTGTCATTGG	0.642																																					p.T199T		Atlas-SNP	.											.	SLC44A4	67	.	0			c.C597T						.						163.0	139.0	147.0					6																	31839271		2203	4300	6503	SO:0001819	synonymous_variant	80736	exon8			TATGGTGGTGTCA	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.597C>T	chr6.hg19:g.31839271G>A		114.0	0.0		104.0	5.0	NM_025257	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Silent	SNP	ENST00000229729.6	hg19	CCDS4724.2	.	.	.	.	.	.	.	.	.	.	G	3.640	-0.073786	0.07184	.	.	ENSG00000204385	ENST00000414427	.	.	.	4.07	-1.19	0.09585	.	.	.	.	.	T	0.07324	0.0185	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35822	-0.9773	4	.	.	.	-3.2465	1.5687	0.02610	0.1916:0.2999:0.3552:0.1533	.	.	.	.	L	195	.	.	P	-	2	0	SLC44A4	31947250	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.391000	0.07323	-0.192000	0.10432	0.491000	0.48974	CCA	.	.		0.642	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
EPHA7	2045	hgsc.bcm.edu	37	6	93956641	93956641	+	Silent	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr6:93956641A>T	ENST00000369303.4	-	15	2779	c.2595T>A	c.(2593-2595)ctT>ctA	p.L865L		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	865	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTAGCTGGTGAAGGCCAGCTG	0.388																																					p.L865L		Atlas-SNP	.											.	EPHA7	251	.	0			c.T2595A						.						94.0	93.0	94.0					6																	93956641		2203	4300	6503	SO:0001819	synonymous_variant	2045	exon15			CTGGTGAAGGCCA	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2595T>A	chr6.hg19:g.93956641A>T		171.0	0.0		162.0	7.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Silent	SNP	ENST00000369303.4	hg19	CCDS5031.1																																																																																			.	.		0.388	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
KIAA1919	91749	hgsc.bcm.edu	37	6	111587870	111587870	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr6:111587870A>G	ENST00000368847.4	+	4	1458	c.1105A>G	c.(1105-1107)Att>Gtt	p.I369V		NM_153369.2	NP_699200.2	Q5TF39	NAGT1_HUMAN	KIAA1919	369					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			large_intestine(3)|lung(2)|ovary(4)|skin(3)	12		all_cancers(87;2.35e-05)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.0209)		OV - Ovarian serous cystadenocarcinoma(136;0.055)|all cancers(137;0.0871)|Epithelial(106;0.0884)		AGAAATGGCTATTCCTGCAGT	0.423																																					p.I369V		Atlas-SNP	.											.	KIAA1919	54	.	0			c.A1105G						.						102.0	104.0	103.0					6																	111587870		2203	4300	6503	SO:0001583	missense	91749	exon4			ATGGCTATTCCTG	BC036115	CCDS5090.1	6q22	2013-10-02			ENSG00000173214	ENSG00000173214			21053	protein-coding gene	gene with protein product							Standard	NM_153369		Approved	MGC33953, MFSD4B	uc003puv.4	Q5TF39	OTTHUMG00000015372	ENST00000368847.4:c.1105A>G	chr6.hg19:g.111587870A>G	ENSP00000357840:p.Ile369Val	113.0	0.0		98.0	24.0	NM_153369	A8K9M0|Q8IYB6|Q96PW9|Q9P0D6	Missense_Mutation	SNP	ENST00000368847.4	hg19	CCDS5090.1	.	.	.	.	.	.	.	.	.	.	A	13.41	2.229792	0.39399	.	.	ENSG00000173214	ENST00000368847	T	0.80566	-1.39	5.92	5.92	0.95590	Major facilitator superfamily domain, general substrate transporter (1);	0.106561	0.64402	D	0.000003	T	0.69196	0.3084	L	0.58428	1.81	0.35933	D	0.832676	B	0.21606	0.058	B	0.18871	0.023	T	0.68731	-0.5331	10	0.39692	T	0.17	-14.5832	16.3615	0.83270	1.0:0.0:0.0:0.0	.	369	Q5TF39	NAGT1_HUMAN	V	369	ENSP00000357840:I369V	ENSP00000357840:I369V	I	+	1	0	KIAA1919	111694563	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	5.017000	0.64047	2.264000	0.75181	0.450000	0.29827	ATT	.	.		0.423	KIAA1919-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041827.1	NM_153369	
TCF21	6943	hgsc.bcm.edu	37	6	134210652	134210652	+	Silent	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr6:134210652G>A	ENST00000367882.4	+	1	377	c.117G>A	c.(115-117)gaG>gaA	p.E39E	TCF21_ENST00000237316.3_Silent_p.E39E|RP3-323P13.2_ENST00000606544.1_RNA|RP3-323P13.2_ENST00000607573.1_RNA|RP3-323P13.2_ENST00000607641.1_RNA|RP3-323P13.2_ENST00000607033.1_RNA	NM_003206.3	NP_003197.2	O43680	TCF21_HUMAN	transcription factor 21	39					branching involved in ureteric bud morphogenesis (GO:0001658)|branchiomeric skeletal muscle development (GO:0014707)|bronchiole development (GO:0060435)|diaphragm development (GO:0060539)|embryonic digestive tract morphogenesis (GO:0048557)|epithelial cell differentiation (GO:0030855)|gland development (GO:0048732)|glomerulus development (GO:0032835)|kidney development (GO:0001822)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|lung vasculature development (GO:0060426)|metanephric glomerular capillary formation (GO:0072277)|metanephric mesenchymal cell differentiation (GO:0072162)|morphogenesis of a branching structure (GO:0001763)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|reproductive structure development (GO:0048608)|respiratory system development (GO:0060541)|Sertoli cell differentiation (GO:0060008)|sex determination (GO:0007530)|spleen development (GO:0048536)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			cervix(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	13	Colorectal(23;0.221)|Breast(56;0.247)			GBM - Glioblastoma multiforme(68;0.00518)|OV - Ovarian serous cystadenocarcinoma(155;0.00783)		AGAGCACCGAGGAGAGCTCCA	0.582																																					p.E39E		Atlas-SNP	.											.	TCF21	30	.	0			c.G117A						.						53.0	61.0	58.0					6																	134210652		2203	4300	6503	SO:0001819	synonymous_variant	6943	exon1			CACCGAGGAGAGC	AF047419	CCDS5167.1	6q23.2	2014-09-17			ENSG00000118526	ENSG00000118526		"""Basic helix-loop-helix proteins"""	11632	protein-coding gene	gene with protein product		603306				9507058	Standard	NM_198392		Approved	POD1, bHLHa23	uc003qei.4	O43680	OTTHUMG00000015608	ENST00000367882.4:c.117G>A	chr6.hg19:g.134210652G>A		183.0	0.0		159.0	34.0	NM_003206	E1P581|O43545|Q6ICV0|Q9BZ14	Silent	SNP	ENST00000367882.4	hg19	CCDS5167.1																																																																																			.	.		0.582	TCF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042292.1	NM_198392	
FNDC1	84624	hgsc.bcm.edu	37	6	159646690	159646690	+	Silent	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr6:159646690T>C	ENST00000297267.9	+	8	1208	c.1008T>C	c.(1006-1008)cgT>cgC	p.R336R	FNDC1_ENST00000480856.1_3'UTR|FNDC1_ENST00000340366.6_Silent_p.R336R	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	336	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TTGCAGTCCGTATTTCACAGG	0.438																																					p.R336R		Atlas-SNP	.											FNDC1,NS,carcinoma,+2,1	FNDC1	250	.	0			c.T1008C						.						157.0	159.0	159.0					6																	159646690		1925	4128	6053	SO:0001819	synonymous_variant	84624	exon8			AGTCCGTATTTCA	AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.1008T>C	chr6.hg19:g.159646690T>C		97.0	0.0		122.0	10.0	NM_032532	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Silent	SNP	ENST00000297267.9	hg19	CCDS47512.1	.	.	.	.	.	.	.	.	.	.	T	10.06	1.247955	0.22880	.	.	ENSG00000164694	ENST00000329629	.	.	.	5.75	-8.09	0.01090	.	.	.	.	.	T	0.20170	0.0485	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40646	-0.9552	4	.	.	.	-17.9844	3.6242	0.08107	0.1139:0.3912:0.2554:0.2395	.	.	.	.	H	295	.	.	Y	+	1	0	FNDC1	159566678	0.000000	0.05858	0.310000	0.25168	0.981000	0.71138	-2.427000	0.01026	-1.615000	0.01573	-0.389000	0.06534	TAT	.	.		0.438	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042897.3	NM_032532	
ERMARD	55780	hgsc.bcm.edu	37	6	170156445	170156445	+	Silent	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr6:170156445A>G	ENST00000366773.3	+	4	360	c.327A>G	c.(325-327)gaA>gaG	p.E109E	ERMARD_ENST00000392095.4_5'UTR|ERMARD_ENST00000588451.1_5'UTR|ERMARD_ENST00000366772.2_Silent_p.E109E|ERMARD_ENST00000418781.3_Silent_p.E109E	NM_001278532.1|NM_018341.1	NP_001265461.1|NP_060811.1	Q5T6L9	EMARD_HUMAN	ER membrane-associated RNA degradation	109					multicellular organismal development (GO:0007275)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											TATTTCCTGAAATATTTGATG	0.338																																					p.E109E		Atlas-SNP	.											.	C6orf70	63	.	0			c.A327G						.						97.0	95.0	96.0					6																	170156445		2203	4300	6503	SO:0001819	synonymous_variant	55780	exon4			TCCTGAAATATTT	AK002014	CCDS34576.1, CCDS64572.1, CCDS64573.1, CCDS64574.1	6q27	2013-08-28	2013-08-28	2013-08-28	ENSG00000130023	ENSG00000130023			21056	protein-coding gene	gene with protein product		615532	"""chromosome 6 open reading frame 70"""	C6orf70		23768067	Standard	NM_018341		Approved	FLJ11152, dJ266L20.3	uc003qxg.1	Q5T6L9	OTTHUMG00000016067	ENST00000366773.3:c.327A>G	chr6.hg19:g.170156445A>G		112.0	0.0		118.0	12.0	NM_018341	B4DFH0|F8WAF1|Q3ZCS8|Q5T6L8|Q9NUT5|Q9NVU2	Silent	SNP	ENST00000366773.3	hg19	CCDS34576.1																																																																																			.	.		0.338	ERMARD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043238.2	NM_018341	
CHST12	55501	hgsc.bcm.edu	37	7	2473077	2473077	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr7:2473077G>T	ENST00000258711.6	+	2	938	c.803G>T	c.(802-804)cGc>cTc	p.R268L		NM_001243794.1|NM_001243795.1|NM_018641.4	NP_001230723.1|NP_001230724.1|NP_061111.1	Q9NRB3	CHSTC_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 12	268					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|chondroitin 4-sulfotransferase activity (GO:0047756)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	21		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0847)|OV - Ovarian serous cystadenocarcinoma(56;2.25e-13)		GAGTTCTACCGCAAGTTCGCC	0.647																																					p.R268L		Atlas-SNP	.											CHST12,NS,carcinoma,0,1	CHST12	39	.	0			c.G803T						.						67.0	59.0	62.0					7																	2473077		2203	4299	6502	SO:0001583	missense	55501	exon2			TCTACCGCAAGTT	AF239822	CCDS5333.1	7p22	2007-03-14			ENSG00000136213	ENSG00000136213	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17423	protein-coding gene	gene with protein product		610129				10781601	Standard	NM_018641		Approved	C4S-2, C4ST2	uc021zyu.1	Q9NRB3	OTTHUMG00000023849	ENST00000258711.6:c.803G>T	chr7.hg19:g.2473077G>T	ENSP00000258711:p.Arg268Leu	44.0	0.0		39.0	2.0	NM_018641	A4D1Z9|Q502W3|Q9NXY7	Missense_Mutation	SNP	ENST00000258711.6	hg19	CCDS5333.1	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134208	0.56828	.	.	ENSG00000136213	ENST00000258711	T	0.74315	-0.83	5.27	3.34	0.38264	.	0.206543	0.40469	N	0.001098	T	0.75591	0.3870	L	0.51422	1.61	0.45097	D	0.998116	D	0.54397	0.966	P	0.54270	0.747	T	0.74352	-0.3693	10	0.41790	T	0.15	-4.7691	10.7909	0.46432	0.1619:0.0:0.8381:0.0	.	268	Q9NRB3	CHSTC_HUMAN	L	268	ENSP00000258711:R268L	ENSP00000258711:R268L	R	+	2	0	CHST12	2439603	1.000000	0.71417	0.818000	0.32626	0.982000	0.71751	2.055000	0.41345	1.111000	0.41721	0.462000	0.41574	CGC	.	.		0.647	CHST12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060170.3	NM_018641	
DGKI	9162	hgsc.bcm.edu	37	7	137092695	137092695	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr7:137092695G>T	ENST00000288490.5	-	31	2870	c.2870C>A	c.(2869-2871)cCa>cAa	p.P957Q	DGKI_ENST00000446122.1_Missense_Mutation_p.P939Q|DGKI_ENST00000424189.2_Missense_Mutation_p.P970Q|DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000453654.2_Missense_Mutation_p.P626Q	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	957					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						ACAGTGGTCTGGTCCCTGAAT	0.433																																					p.P957Q		Atlas-SNP	.											.	DGKI	335	.	0			c.C2870A						.						198.0	175.0	183.0					7																	137092695		2203	4300	6503	SO:0001583	missense	9162	exon31			TGGTCTGGTCCCT	AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2870C>A	chr7.hg19:g.137092695G>T	ENSP00000288490:p.Pro957Gln	154.0	0.0		129.0	9.0	NM_004717	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	ENST00000288490.5	hg19	CCDS5845.1	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010151	0.35415	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.33654	1.4;1.4;1.4	5.7	5.7	0.88788	Ankyrin repeat-containing domain (2);	0.169399	0.53938	D	0.000047	T	0.21590	0.0520	N	0.08118	0	0.46927	D	0.999257	B;B	0.16396	0.002;0.017	B;B	0.12837	0.004;0.008	T	0.09773	-1.0659	10	0.14656	T	0.56	.	18.0216	0.89257	0.0:0.0:1.0:0.0	.	626;957	E9PFX6;O75912	.;DGKI_HUMAN	Q	626;874;960;957;939	ENSP00000392161:P626Q;ENSP00000288490:P957Q;ENSP00000399131:P939Q	ENSP00000288490:P957Q	P	-	2	0	DGKI	136743235	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.370000	0.73114	2.683000	0.91414	0.655000	0.94253	CCA	.	.		0.433	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341286.3	NM_004717	
AGAP3	116988	hgsc.bcm.edu	37	7	150814237	150814237	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr7:150814237C>T	ENST00000397238.2	+	3	446	c.446C>T	c.(445-447)aCg>aTg	p.T149M	AGAP3_ENST00000473312.1_Missense_Mutation_p.T149M|AGAP3_ENST00000479901.1_Missense_Mutation_p.T149M|AGAP3_ENST00000463381.1_5'UTR|AGAP3_ENST00000335367.3_Missense_Mutation_p.T329M|AGAP3_ENST00000476375.1_3'UTR	NM_031946.4	NP_114152.3	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	113	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						CGCTATCTGACGGGGACCTAT	0.667																																					p.T149M		Atlas-SNP	.											.	AGAP3	121	.	0			c.C446T						.						57.0	61.0	60.0					7																	150814237		2099	4266	6365	SO:0001583	missense	116988	exon3			ATCTGACGGGGAC	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000397238.2:c.446C>T	chr7.hg19:g.150814237C>T	ENSP00000380413:p.Thr149Met	115.0	0.0		114.0	21.0	NM_001042535	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000397238.2	hg19	CCDS43681.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.561984|4.561984	0.86335|0.86335	.|.	.|.	ENSG00000133612|ENSG00000133612	ENST00000469901|ENST00000473312;ENST00000479901;ENST00000397238;ENST00000335355;ENST00000335367	.|T;T;T;T	.|0.23552	.|1.9;1.9;1.9;1.9	4.42|4.42	3.52|3.52	0.40303|0.40303	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.57621|0.57621	0.2066|0.2066	M|M	0.91717|0.91717	3.235|3.235	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.81914	.|0.989;0.974;0.955;0.995	T|T	0.68588|0.68588	-0.5369|-0.5369	5|10	.|0.87932	.|D	.|0	.|.	13.4421|13.4421	0.61119|0.61119	0.0:0.8416:0.1584:0.0|0.0:0.8416:0.1584:0.0	.|.	.|149;329;149;149	.|C9J975;E7ESL9;Q96P47-4;E9PAL8	.|.;.;.;.	W|M	85|149;149;149;113;329	.|ENSP00000418921:T149M;ENSP00000418125:T149M;ENSP00000380413:T149M;ENSP00000335589:T329M	.|ENSP00000334157:T113M	R|T	+|+	1|2	2|0	AGAP3|AGAP3	150445170|150445170	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.985000|0.985000	0.73830|0.73830	7.569000|7.569000	0.82380|0.82380	1.070000|1.070000	0.40811|0.40811	0.407000|0.407000	0.27541|0.27541	CGG|ACG	.	.		0.667	AGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351908.3	NM_031946	
REEP4	80346	hgsc.bcm.edu	37	8	21998971	21998971	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr8:21998971G>T	ENST00000306306.3	-	1	493	c.25C>A	c.(25-27)Ctg>Atg	p.L9M	REEP4_ENST00000523293.1_Missense_Mutation_p.L9M|REEP4_ENST00000334530.5_Missense_Mutation_p.L9M	NM_025232.2	NP_079508.2	Q9H6H4	REEP4_HUMAN	receptor accessory protein 4	9					mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|nuclear envelope organization (GO:0006998)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)	microtubule binding (GO:0008017)			kidney(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	7				Colorectal(74;0.00187)|COAD - Colon adenocarcinoma(73;0.061)|READ - Rectum adenocarcinoma(644;0.0993)		CACACCACCAGGCGACAGATC	0.642																																					p.L9M		Atlas-SNP	.											.	REEP4	13	.	0			c.C25A						.						133.0	128.0	130.0					8																	21998971		2203	4300	6503	SO:0001583	missense	80346	exon1			CCACCAGGCGACA	BC013048	CCDS6024.1	8p21.3	2008-05-02	2006-02-07	2006-02-07	ENSG00000168476	ENSG00000168476		"""Receptor accessory proteins"""	26176	protein-coding gene	gene with protein product		609349	"""chromosome 8 open reading frame 20"""	C8orf20		16271481, 15550249	Standard	NM_025232		Approved	FLJ22246, FLJ22277, PP432	uc003xau.1	Q9H6H4	OTTHUMG00000131491	ENST00000306306.3:c.25C>A	chr8.hg19:g.21998971G>T	ENSP00000303482:p.Leu9Met	113.0	0.0		129.0	29.0	NM_025232	D3DSQ9|Q86VL1|Q9H6I5|Q9HBP4	Missense_Mutation	SNP	ENST00000306306.3	hg19	CCDS6024.1	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561571	0.65538	.	.	ENSG00000168476	ENST00000334530;ENST00000306306;ENST00000523293;ENST00000518664;ENST00000521744	D;D;D;D;D	0.94184	-3.37;-3.37;-3.37;-3.37;-3.37	5.48	2.68	0.31781	.	0.000000	0.35805	N	0.002973	D	0.96207	0.8763	M	0.93016	3.37	0.35947	D	0.833635	D;P;P	0.54964	0.969;0.553;0.8	P;B;B	0.61275	0.886;0.26;0.404	D	0.96684	0.9506	10	0.66056	D	0.02	-15.4853	7.1705	0.25717	0.2624:0.0:0.7376:0.0	.	9;9;9	B4DYB6;Q9H6H4-2;Q9H6H4	.;.;REEP4_HUMAN	M	9	ENSP00000333889:L9M;ENSP00000303482:L9M;ENSP00000428709:L9M;ENSP00000428160:L9M;ENSP00000429451:L9M	ENSP00000303482:L9M	L	-	1	2	REEP4	22054916	0.977000	0.34250	1.000000	0.80357	0.993000	0.82548	0.215000	0.17562	1.317000	0.45149	0.511000	0.50034	CTG	.	.		0.642	REEP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254337.2	NM_025232	
PREX2	80243	hgsc.bcm.edu	37	8	69021855	69021855	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr8:69021855A>T	ENST00000288368.4	+	25	3420	c.3143A>T	c.(3142-3144)gAt>gTt	p.D1048V		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1048					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TGTCAAATAGATGAGTAAGTG	0.343																																					p.D1048V		Atlas-SNP	.											.	PREX2	614	.	0			c.A3143T						.						103.0	101.0	102.0					8																	69021855		2203	4300	6503	SO:0001583	missense	80243	exon25			AAATAGATGAGTA	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3143A>T	chr8.hg19:g.69021855A>T	ENSP00000288368:p.Asp1048Val	155.0	0.0		185.0	25.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	A	25.6	4.652602	0.88056	.	.	ENSG00000046889	ENST00000288368	T	0.60171	0.21	5.72	5.72	0.89469	.	.	.	.	.	T	0.53883	0.1824	L	0.29908	0.895	0.80722	D	1	P	0.49090	0.919	P	0.46543	0.52	T	0.59830	-0.7380	9	0.87932	D	0	.	16.0037	0.80327	1.0:0.0:0.0:0.0	.	1048	Q70Z35	PREX2_HUMAN	V	1048	ENSP00000288368:D1048V	ENSP00000288368:D1048V	D	+	2	0	PREX2	69184409	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.730000	0.91510	2.184000	0.69523	0.533000	0.62120	GAT	.	.		0.343	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
EIF3H	8667	hgsc.bcm.edu	37	8	117671203	117671203	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr8:117671203T>G	ENST00000276682.4	-	5	1114	c.348A>C	c.(346-348)gaA>gaC	p.E116D	EIF3H_ENST00000521861.1_Missense_Mutation_p.E102D					eukaryotic translation initiation factor 3, subunit H											large_intestine(2)|lung(10)|skin(1)	13	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					TCCGCATCATTTCCATCTGAT	0.418																																					p.E102D		Atlas-SNP	.											.	EIF3H	28	.	0			c.A306C						.						99.0	88.0	92.0					8																	117671203		2203	4300	6503	SO:0001583	missense	8667	exon3			CATCATTTCCATC	U54559	CCDS6319.1	8q24.11	2007-07-27	2007-07-27	2007-07-27	ENSG00000147677	ENSG00000147677			3273	protein-coding gene	gene with protein product		603912	"""eukaryotic translation initiation factor 3, subunit 3 gamma, 40kDa"""	EIF3S3		9341143	Standard	NM_003756		Approved	eIF3-gamma, eIF3-p40, eIF3h	uc003yoa.3	O15372	OTTHUMG00000164919	ENST00000276682.4:c.348A>C	chr8.hg19:g.117671203T>G	ENSP00000276682:p.Glu116Asp	159.0	0.0		160.0	22.0	NM_003756		Missense_Mutation	SNP	ENST00000276682.4	hg19		.	.	.	.	.	.	.	.	.	.	T	12.50	1.956634	0.34565	.	.	ENSG00000147677	ENST00000521861;ENST00000276682;ENST00000518949;ENST00000518995;ENST00000522453	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	6.17	-1.6	0.08426	.	0.000000	0.85682	D	0.000000	T	0.43634	0.1256	N	0.20881	0.62	0.53688	D	0.999974	B;P;P	0.41978	0.003;0.767;0.767	B;P;P	0.49752	0.018;0.621;0.621	T	0.23048	-1.0199	10	0.39692	T	0.17	-28.2358	11.0707	0.48002	0.0:0.3826:0.0:0.6174	.	102;116;102	B4DJN9;B3KS98;O15372	.;.;EIF3H_HUMAN	D	102;116;70;118;126	ENSP00000429931:E102D;ENSP00000276682:E116D;ENSP00000428195:E70D;ENSP00000428669:E118D	ENSP00000276682:E116D	E	-	3	2	EIF3H	117740384	1.000000	0.71417	0.980000	0.43619	0.942000	0.58702	2.028000	0.41088	-0.494000	0.06669	-0.250000	0.11733	GAA	.	.		0.418	EIF3H-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000380913.1	NM_003756	
MED30	90390	hgsc.bcm.edu	37	8	118540924	118540924	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr8:118540924A>T	ENST00000297347.3	+	2	376	c.212A>T	c.(211-213)tAt>tTt	p.Y71F	MED30_ENST00000522839.1_Missense_Mutation_p.Y71F	NM_080651.2	NP_542382.1	Q96HR3	MED30_HUMAN	mediator complex subunit 30	71					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			kidney(1)|lung(3)|prostate(3)	7	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			ACTGGAACATATCAAGACCGG	0.343																																					p.Y71F	Melanoma(81;817 1341 9674 26244 29255)	Atlas-SNP	.											.	MED30	15	.	0			c.A212T						.						116.0	110.0	112.0					8																	118540924		2203	4300	6503	SO:0001583	missense	90390	exon2			GAACATATCAAGA	AY083305	CCDS6323.1, CCDS64959.1	8q24.11	2007-07-30	2007-07-30	2007-07-30	ENSG00000164758	ENSG00000164758			23032	protein-coding gene	gene with protein product		610237	"""thyroid hormone receptor associated protein 6"""	THRAP6			Standard	NM_080651		Approved	TRAP25	uc003yoj.3	Q96HR3	OTTHUMG00000164920	ENST00000297347.3:c.212A>T	chr8.hg19:g.118540924A>T	ENSP00000297347:p.Tyr71Phe	150.0	0.0		160.0	9.0	NM_080651	C6GKU9	Missense_Mutation	SNP	ENST00000297347.3	hg19	CCDS6323.1	.	.	.	.	.	.	.	.	.	.	A	16.20	3.056900	0.55325	.	.	ENSG00000164758	ENST00000297347;ENST00000522839	.	.	.	5.95	5.95	0.96441	Mediator complex, subunit Med30, metazoa (1);	0.112845	0.64402	D	0.000009	T	0.49406	0.1555	L	0.36672	1.1	0.46927	D	0.999259	P;P	0.37176	0.586;0.586	B;B	0.37015	0.239;0.239	T	0.45848	-0.9233	9	0.29301	T	0.29	-2.2429	15.5881	0.76502	1.0:0.0:0.0:0.0	.	71;71	C6GKU9;Q96HR3	.;MED30_HUMAN	F	71	.	ENSP00000297347:Y71F	Y	+	2	0	MED30	118610105	1.000000	0.71417	0.035000	0.18076	0.312000	0.27988	8.896000	0.92521	2.272000	0.75746	0.460000	0.39030	TAT	.	.		0.343	MED30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380923.1	NM_080651	
EPPK1	83481	hgsc.bcm.edu	37	8	144942098	144942098	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr8:144942098T>C	ENST00000525985.1	-	2	5395	c.5324A>G	c.(5323-5325)cAc>cGc	p.H1775R				P58107	EPIPL_HUMAN	epiplakin 1	1775						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTGCAACACGTGTCTCGTGGC	0.527																																					p.H1775R		Atlas-SNP	.											EPPK1,NS,NS,0,1	EPPK1	199	.	0			c.A5324G						.						124.0	120.0	122.0					8																	144942098		1984	4171	6155	SO:0001583	missense	83481	exon1			AACACGTGTCTCG	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.5324A>G	chr8.hg19:g.144942098T>C	ENSP00000436337:p.His1775Arg	123.0	0.0		177.0	33.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	T	3.728	-0.056063	0.07362	.	.	ENSG00000227184	ENST00000525985	T	0.64260	-0.09	5.1	-0.169	0.13339	.	.	.	.	.	T	0.26810	0.0656	N	0.01874	-0.695	0.09310	N	1	B	0.26318	0.146	B	0.19148	0.024	T	0.19160	-1.0314	9	0.15066	T	0.55	.	4.968	0.14100	0.0:0.3454:0.1605:0.4941	.	1775	E9PPU0	.	R	1775	ENSP00000436337:H1775R	ENSP00000436337:H1775R	H	-	2	0	EPPK1	145014086	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.438000	0.06905	-0.156000	0.11079	0.477000	0.44152	CAC	.	.		0.527	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
OPLAH	26873	hgsc.bcm.edu	37	8	145114666	145114666	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr8:145114666G>A	ENST00000426825.1	-	3	280	c.199C>T	c.(199-201)Cag>Tag	p.Q67*	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	67					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCCAGCGGCTGGTCCCGGGGC	0.706																																					p.Q67X		Atlas-SNP	.											.	OPLAH	78	.	0			c.C199T						.						20.0	27.0	25.0					8																	145114666		2156	4238	6394	SO:0001587	stop_gained	26873	exon3			GCGGCTGGTCCCG	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.199C>T	chr8.hg19:g.145114666G>A	ENSP00000475943:p.Gln67*	37.0	0.0		48.0	10.0	NM_017570	A5PKY8|Q75W65|Q9Y4Q0	Nonsense_Mutation	SNP	ENST00000426825.1	hg19		.	.	.	.	.	.	.	.	.	.	G	11.04	1.521209	0.27211	.	.	ENSG00000178814	ENST00000426825	.	.	.	5.24	3.31	0.37934	.	0.441737	0.25538	N	0.029986	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	.	12.1388	0.53986	0.0:0.0:0.691:0.309	.	.	.	.	X	67	.	ENSP00000412071:Q67X	Q	-	1	0	OPLAH	145186654	0.969000	0.33509	0.965000	0.40720	0.206000	0.24218	2.964000	0.49192	1.157000	0.42530	0.462000	0.41574	CAG	.	.		0.706	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
RECQL4	9401	hgsc.bcm.edu	37	8	145739845	145739845	+	Missense_Mutation	SNP	C	C	T	rs375562152		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr8:145739845C>T	ENST00000428558.2	-	10	1726	c.1685G>A	c.(1684-1686)cGg>cAg	p.R562Q	CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'UTR	NM_004260.3	NP_004251.3	O94761	RECQ4_HUMAN	RecQ protein-like 4	562	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|bubble DNA binding (GO:0000405)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GACAGATTCCCGTTGCTTCCT	0.637			"""N, F, S"""			"""osteosarcoma, skin basal and sqamous cell"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Rothmund-Thomson syndrome;RAPADILINO syndrome;Baller-Gerold syndrome																												p.R562Q		Atlas-SNP	.	yes	Rec		Rothmund-Thompson Syndrome	8	8q24.3	9401	RecQ protein-like 4		M	.	RECQL4	75	.	0			c.G1685A						.	C	GLN/ARG	2,4144		0,2,2071	46.0	50.0	48.0		1685	2.5	0.0	8		48	0,8394		0,0,4197	no	missense	RECQL4	NM_004260.3	43	0,2,6268	TT,TC,CC		0.0,0.0482,0.0159	possibly-damaging	562/1209	145739845	2,12538	2073	4197	6270	SO:0001583	missense	9401	exon10	Familial Cancer Database	RTS, Poikiloderma Atrophicans and Cataract, Congenital Poikiloderma; ;Craniosynostosis with Radial Defects	GATTCCCGTTGCT	AB006532	CCDS75804.1	8q24.3	2014-09-17	2014-03-07	2014-03-07		ENSG00000160957			9949	protein-coding gene	gene with protein product		603780				9878247, 15960976	Standard	NM_004260		Approved	RecQ4	uc003zdj.3	O94761		ENST00000428558.2:c.1685G>A	chr8.hg19:g.145739845C>T	ENSP00000475456:p.Arg562Gln	67.0	0.0		70.0	27.0	NM_004260	Q3Y424|Q96DW2|Q96F55	Missense_Mutation	SNP	ENST00000428558.2	hg19																																																																																				.	.		0.637	RECQL4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_004260	
RLN1	6013	hgsc.bcm.edu	37	9	5335462	5335462	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr9:5335462A>T	ENST00000223862.1	-	2	473	c.347T>A	c.(346-348)gTa>gAa	p.V116E	RLN1_ENST00000487557.2_5'UTR|RLN1_ENST00000223858.4_3'UTR	NM_006911.2	NP_008842.1	P04808	REL1_HUMAN	relaxin 1	116					female pregnancy (GO:0007565)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			large_intestine(1)|lung(4)	5	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.02)|Lung(218;0.0984)		TAATGCAGGTACATACTGCTG	0.398																																					p.V116E		Atlas-SNP	.											.	RLN1	16	.	0			c.T347A						.						110.0	106.0	107.0					9																	5335462		2203	4300	6503	SO:0001583	missense	6013	exon2			GCAGGTACATACT		CCDS6462.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107018	ENSG00000107018		"""Endogenous ligands"""	10026	protein-coding gene	gene with protein product	"""prorelaxin H1"""	179730	"""relaxin 1 (H1)"""				Standard	NM_006911		Approved	H1	uc003zjb.2	P04808	OTTHUMG00000019495	ENST00000223862.1:c.347T>A	chr9.hg19:g.5335462A>T	ENSP00000223862:p.Val116Glu	73.0	0.0		79.0	9.0	NM_006911	Q99936|Q9UQJ1	Missense_Mutation	SNP	ENST00000223862.1	hg19	CCDS6462.1	.	.	.	.	.	.	.	.	.	.	A	10.11	1.260126	0.23051	.	.	ENSG00000107018	ENST00000223862	T	0.19532	2.14	1.38	-1.67	0.08238	Insulin-like (3);	7.519490	0.00166	N	0.000004	T	0.16171	0.0389	L	0.50333	1.59	0.09310	N	1	P	0.45594	0.862	B	0.41988	0.372	T	0.27938	-1.0059	10	0.05721	T	0.95	.	2.195	0.03908	0.4306:0.3207:0.2487:0.0	.	116	P04808	REL1_HUMAN	E	116	ENSP00000223862:V116E	ENSP00000223862:V116E	V	-	2	0	RLN1	5325462	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.238000	0.02919	-0.401000	0.07644	-0.986000	0.02555	GTA	.	.		0.398	RLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051617.1		
TAF1L	138474	hgsc.bcm.edu	37	9	32632416	32632416	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr9:32632416T>A	ENST00000242310.4	-	1	3251	c.3162A>T	c.(3160-3162)gaA>gaT	p.E1054D	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1054					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		AATGAGCCTGTTCTGTTGACA	0.473																																					p.E1054D		Atlas-SNP	.											.	TAF1L	382	.	0			c.A3162T						.						222.0	220.0	221.0					9																	32632416		2203	4300	6503	SO:0001583	missense	138474	exon1			AGCCTGTTCTGTT	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3162A>T	chr9.hg19:g.32632416T>A	ENSP00000418379:p.Glu1054Asp	171.0	0.0		181.0	37.0	NM_153809	Q0VG57	Missense_Mutation	SNP	ENST00000242310.4	hg19	CCDS35003.1	.	.	.	.	.	.	.	.	.	.	T	19.17	3.776719	0.70107	.	.	ENSG00000122728	ENST00000242310	T	0.20069	2.1	0.479	0.479	0.16796	.	0.000000	0.85682	D	0.000000	T	0.38108	0.1028	M	0.79805	2.47	0.48452	D	0.999659	D	0.63880	0.993	D	0.64506	0.926	T	0.17930	-1.0353	10	0.72032	D	0.01	.	5.1959	0.15236	0.0:1.0E-4:0.0:0.9999	.	1054	Q8IZX4	TAF1L_HUMAN	D	1054	ENSP00000418379:E1054D	ENSP00000418379:E1054D	E	-	3	2	TAF1L	32622416	1.000000	0.71417	0.986000	0.45419	0.847000	0.48162	1.724000	0.38064	0.426000	0.26116	0.164000	0.16699	GAA	.	.		0.473	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
SPATA31C1	441452	hgsc.bcm.edu	37	9	90534168	90534168	+	RNA	SNP	A	A	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr9:90534168A>C	ENST00000602681.1	+	0	914							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTTGTCTCCCAGCGTCATCTT	0.597																																					.		Atlas-SNP	.											.	.	.	.	0			c.190-2A>C						.						99.0	84.0	89.0					9																	90534168		692	1591	2283			441452	exon2			TCTCCCAGCGTCA	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		chr9.hg19:g.90534168A>C		352.0	0.0		302.0	15.0	NM_001145124		Splice_Site	SNP	ENST00000602681.1	hg19																																																																																				.	.		0.597	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
OR13C5	138799	hgsc.bcm.edu	37	9	107360936	107360936	+	Silent	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr9:107360936C>A	ENST00000374779.2	-	1	852	c.759G>T	c.(757-759)ggG>ggT	p.G253G		NM_001004482.1	NP_001004482.1	Q8NGS8	O13C5_HUMAN	olfactory receptor, family 13, subfamily C, member 5	253						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(4)	28						GGAAGATGGTCCCACAGAATG	0.428																																					p.G253G		Atlas-SNP	.											.	OR13C5	60	.	0			c.G759T						.						140.0	125.0	130.0					9																	107360936		2203	4300	6503	SO:0001819	synonymous_variant	138799	exon1			GATGGTCCCACAG		CCDS35091.1	9q31.1	2012-10-03			ENSG00000255800	ENSG00000277556		"""GPCR / Class A : Olfactory receptors"""	15100	protein-coding gene	gene with protein product							Standard	NM_001004482		Approved		uc011lvp.2	Q8NGS8	OTTHUMG00000020408	ENST00000374779.2:c.759G>T	chr9.hg19:g.107360936C>A		164.0	0.0		126.0	33.0	NM_001004482	B2RNE5|B9EGW5|Q6IF53	Silent	SNP	ENST00000374779.2	hg19	CCDS35091.1																																																																																			.	.		0.428	OR13C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053479.2	NM_001004482	
OR1Q1	158131	hgsc.bcm.edu	37	9	125377800	125377800	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr9:125377800C>A	ENST00000297913.2	+	1	853	c.784C>A	c.(784-786)Ccc>Acc	p.P262T	RP11-64P14.7_ENST00000431442.1_RNA	NM_012364.1	NP_036496.1	Q15612	OR1Q1_HUMAN	olfactory receptor, family 1, subfamily Q, member 1	262					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	17						CTACTTCCGGCCCCTTTCCAG	0.547																																					p.P262T		Atlas-SNP	.											.	OR1Q1	46	.	0			c.C784A						.						63.0	64.0	64.0					9																	125377800		2203	4300	6503	SO:0001583	missense	158131	exon1			TTCCGGCCCCTTT		CCDS35125.1	9q33.2	2013-09-20			ENSG00000165202	ENSG00000165202		"""GPCR / Class A : Olfactory receptors"""	8223	protein-coding gene	gene with protein product				OR1Q2, OR1Q3			Standard	NM_012364		Approved	OST226, OR9-A, HSTPCR106, OST226OR9-A, TPCR106	uc011lyy.2	Q15612	OTTHUMG00000020615	ENST00000297913.2:c.784C>A	chr9.hg19:g.125377800C>A	ENSP00000297913:p.Pro262Thr	138.0	0.0		128.0	29.0	NM_012364	Q6IFN4|Q8NGR7|Q96R82	Missense_Mutation	SNP	ENST00000297913.2	hg19	CCDS35125.1	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208968	0.58343	.	.	ENSG00000165202	ENST00000297913	T	0.00274	8.35	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000157	T	0.01092	0.0036	M	0.93978	3.48	0.09310	N	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.27971	-1.0058	10	0.87932	D	0	-18.8882	18.1511	0.89675	0.0:1.0:0.0:0.0	.	262	Q15612	OR1Q1_HUMAN	T	262	ENSP00000297913:P262T	ENSP00000297913:P262T	P	+	1	0	OR1Q1	124417621	0.306000	0.24490	0.989000	0.46669	0.953000	0.61014	4.529000	0.60588	2.826000	0.97356	0.650000	0.86243	CCC	.	.		0.547	OR1Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053946.1		
SVIL	6840	hgsc.bcm.edu	37	10	29822162	29822162	+	Silent	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr10:29822162C>T	ENST00000355867.4	-	8	1886	c.1134G>A	c.(1132-1134)aaG>aaA	p.K378K	SVIL_ENST00000375398.2_Silent_p.K378K|SVIL_ENST00000375400.3_Intron	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	378					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				GCGTCACTAGCTTGGCGGTGT	0.562																																					p.K378K		Atlas-SNP	.											.	SVIL	226	.	0			c.G1134A						.						89.0	75.0	79.0					10																	29822162		2203	4300	6503	SO:0001819	synonymous_variant	6840	exon8			CACTAGCTTGGCG	AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.1134G>A	chr10.hg19:g.29822162C>T		105.0	0.0		69.0	7.0	NM_021738	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Silent	SNP	ENST00000355867.4	hg19	CCDS7164.1																																																																																			.	.		0.562	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047395.1		
PRKG1	5592	hgsc.bcm.edu	37	10	53822361	53822362	+	Missense_Mutation	DNP	GA	GA	TT	rs145917628	byFrequency	TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr10:53822361_53822362GA>TT	ENST00000401604.2	+	7	1054_1055	c.860_861GA>TT	c.(859-861)gGA>gTT	p.G287V	PRKG1_ENST00000373985.1_Missense_Mutation_p.G275V|PRKG1_ENST00000373975.2_5'UTR|PRKG1_ENST00000373980.4_Missense_Mutation_p.G302V			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	287	cGMP-binding, low affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TTAGGAAAAGGAGACTGGTTTG	0.401																																					p.G302V|p.G302G		Atlas-SNP	.											.	PRKG1	167	.	0			c.G905T|c.A906T						.																																			SO:0001583	missense	5592	exon7			GAAAAGGAGACTG|AAAAGGAGACTGG		CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	Exception_encountered	chr10.hg19:g.53822361_53822362delinsTT	ENSP00000384200:p.Gly287Val	144.0|146.0	0.0		136.0	30.0	NM_006258	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Missense_Mutation|Silent	SNP	ENST00000401604.2	hg19	CCDS44399.1																																																																																			.	.|A|0.998;C|0.002		0.401	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
LIPF	8513	hgsc.bcm.edu	37	10	90435976	90435976	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr10:90435976C>A	ENST00000238983.4	+	9	945	c.899C>A	c.(898-900)tCt>tAt	p.S300Y	LIPF_ENST00000608620.1_Missense_Mutation_p.S267Y|LIPF_ENST00000355843.2_Missense_Mutation_p.S277Y|LIPF_ENST00000394375.3_Missense_Mutation_p.S310Y	NM_004190.3	NP_004181.1	P07098	LIPG_HUMAN	lipase, gastric	300					lipid catabolic process (GO:0016042)|malate metabolic process (GO:0006108)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|mitochondrion (GO:0005739)	lipid binding (GO:0008289)|malate dehydrogenase activity (GO:0016615)|triglyceride lipase activity (GO:0004806)			NS(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(6)	13		Colorectal(252;0.0161)		Colorectal(12;3.91e-05)|COAD - Colon adenocarcinoma(12;5.43e-05)	Orlistat(DB01083)	GCTGTTAAGTCTGGGAAATTC	0.303																																					p.S310Y		Atlas-SNP	.											.	LIPF	62	.	0			c.C929A						.						64.0	63.0	63.0					10																	90435976		2203	4299	6502	SO:0001583	missense	8513	exon10			TTAAGTCTGGGAA	X05997	CCDS7389.1, CCDS55718.1, CCDS55719.1, CCDS65896.1	10q23	2005-10-30			ENSG00000182333	ENSG00000182333	3.1.1.3		6622	protein-coding gene	gene with protein product		601980				3304425, 9186906	Standard	NM_004190		Approved	HGL, HLAL	uc010qmt.2	P07098	OTTHUMG00000018695	ENST00000238983.4:c.899C>A	chr10.hg19:g.90435976C>A	ENSP00000238983:p.Ser300Tyr	216.0	0.0		187.0	58.0	NM_001198829	B7Z723|F5H1P4|Q2M1P6|Q5VXI7|Q5VXI8|Q658L8	Missense_Mutation	SNP	ENST00000238983.4	hg19	CCDS7389.1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938676	0.34189	.	.	ENSG00000182333	ENST00000394375;ENST00000238983;ENST00000355843	T;T;T	0.72725	-0.68;-0.68;-0.68	4.88	3.93	0.45458	Alpha/beta hydrolase fold-1 (1);	0.378707	0.23041	N	0.052602	D	0.83427	0.5252	M	0.85099	2.735	0.32362	N	0.556991	B;D;B;D	0.89917	0.347;1.0;0.31;1.0	B;D;B;D	0.77557	0.248;0.983;0.168;0.99	D	0.85522	0.1204	10	0.52906	T	0.07	-17.2739	11.2164	0.48830	0.0:0.8156:0.1844:0.0	.	267;310;277;300	Q5VXI8;F5H1P4;Q658L8;P07098	.;.;.;LIPG_HUMAN	Y	310;300;267	ENSP00000377900:S310Y;ENSP00000238983:S300Y;ENSP00000348101:S267Y	ENSP00000238983:S300Y	S	+	2	0	LIPF	90425956	0.001000	0.12720	0.745000	0.31077	0.347000	0.29111	0.091000	0.15046	2.528000	0.85240	0.551000	0.68910	TCT	.	.		0.303	LIPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049256.1		
MUC2	4583	hgsc.bcm.edu	37	11	1092362	1092362	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:1092362A>T	ENST00000441003.2	+	30	4208	c.4181A>T	c.(4180-4182)aAg>aTg	p.K1394M	MUC2_ENST00000333592.6_5'Flank|MUC2_ENST00000359061.5_Missense_Mutation_p.K1395M|MUC2_ENST00000361558.6_Intron	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	1394					cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	CCCATGGATAAGTGTATCACC	0.532																																					p.K1394M		Atlas-SNP	.											.	MUC2	614	.	0			c.A4181T						.						157.0	198.0	184.0					11																	1092362		2145	4218	6363	SO:0001583	missense	4583	exon30			TGGATAAGTGTAT	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.4181A>T	chr11.hg19:g.1092362A>T	ENSP00000415183:p.Lys1394Met	153.0	0.0		131.0	8.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	hg19		.	.	.	.	.	.	.	.	.	.	a	1.529	-0.544746	0.04024	.	.	ENSG00000198788	ENST00000441003;ENST00000359061	T;T	0.13538	2.61;2.58	2.27	1.0	0.19881	.	0.642064	0.11985	U	0.510401	T	0.05135	0.0137	N	0.14661	0.345	0.09310	N	1	P	0.44659	0.84	B	0.29176	0.099	T	0.34875	-0.9811	10	0.35671	T	0.21	.	5.3746	0.16158	0.7073:0.2927:0.0:0.0	.	1394	E7EUV1	.	M	1394;1395	ENSP00000415183:K1394M;ENSP00000351956:K1395M	ENSP00000351956:K1395M	K	+	2	0	MUC2	1082362	0.000000	0.05858	0.001000	0.08648	0.273000	0.26683	-1.729000	0.01856	0.123000	0.18342	0.063000	0.15292	AAG	.	.		0.532	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
OR51L1	119682	hgsc.bcm.edu	37	11	5020271	5020271	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:5020271C>T	ENST00000321543.1	+	1	59	c.59C>T	c.(58-60)cCt>cTt	p.P20L		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P20L(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGGGGTTTTCCTGGACTGGAG	0.428																																					p.P20L		Atlas-SNP	.											OR51L1,NS,carcinoma,0,1	OR51L1	60	.	1	Substitution - Missense(1)	lung(1)	c.C59T						.						215.0	204.0	208.0					11																	5020271		2201	4298	6499	SO:0001583	missense	119682	exon1			GTTTTCCTGGACT	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.59C>T	chr11.hg19:g.5020271C>T	ENSP00000322156:p.Pro20Leu	134.0	0.0		138.0	12.0	NM_001004755	Q6IFE5	Missense_Mutation	SNP	ENST00000321543.1	hg19	CCDS31369.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.591576	0.46214	.	.	ENSG00000176798	ENST00000321543	T	0.00493	7.0	5.58	4.67	0.58626	.	0.000000	0.43919	D	0.000507	T	0.00845	0.0028	M	0.88775	2.98	0.36136	D	0.846497	P	0.43287	0.802	B	0.34489	0.184	T	0.57481	-0.7804	10	0.72032	D	0.01	.	14.7839	0.69787	0.1453:0.8547:0.0:0.0	.	20	Q8NGJ5	O51L1_HUMAN	L	20	ENSP00000322156:P20L	ENSP00000322156:P20L	P	+	2	0	OR51L1	4976847	0.161000	0.22892	0.972000	0.41901	0.492000	0.33523	1.815000	0.38981	1.580000	0.49851	0.655000	0.94253	CCT	.	.		0.428	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755	
OR2AG1	144125	hgsc.bcm.edu	37	11	6806278	6806278	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:6806278T>C	ENST00000307401.4	+	1	31	c.10T>C	c.(10-12)Tgg>Cgg	p.W4R		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	4						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CATGGAGCTCTGGAACTTCAC	0.408																																					p.W4R		Atlas-SNP	.											.	OR2AG1	57	.	0			c.T10C						.						103.0	99.0	100.0					11																	6806278		2201	4296	6497	SO:0001583	missense	144125	exon1			GAGCTCTGGAACT	AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.10T>C	chr11.hg19:g.6806278T>C	ENSP00000307447:p.Trp4Arg	93.0	0.0		89.0	10.0	NM_001004489	B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	SNP	ENST00000307401.4	hg19	CCDS31414.1	.	.	.	.	.	.	.	.	.	.	T	0.034	-1.316255	0.01331	.	.	ENSG00000170803	ENST00000307401	T	0.19105	2.17	4.25	0.383	0.16239	.	0.616819	0.14159	N	0.337530	T	0.07548	0.0190	N	0.05078	-0.115	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.40572	-0.9556	10	0.11485	T	0.65	.	5.2336	0.15436	0.0:0.1828:0.1536:0.6636	.	4	Q9H205	O2AG1_HUMAN	R	4	ENSP00000307447:W4R	ENSP00000307447:W4R	W	+	1	0	OR2AG1	6762854	0.071000	0.21146	0.103000	0.21229	0.012000	0.07955	0.219000	0.17641	-0.024000	0.13941	-1.541000	0.00910	TGG	.	.		0.408	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385980.1	NM_001004489	
SVIP	258010	hgsc.bcm.edu	37	11	22851254	22851254	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:22851254G>T	ENST00000354193.4	-	1	157	c.41C>A	c.(40-42)cCc>cAc	p.P14H	RP11-17A1.3_ENST00000499625.1_RNA|RP11-17A1.3_ENST00000525963.1_RNA|SVIP_ENST00000533774.1_5'Flank|RP11-17A1.3_ENST00000528701.1_RNA	NM_148893.1	NP_683691.1	Q8NHG7	SVIP_HUMAN	small VCP/p97-interacting protein	14					negative regulation of ER-associated ubiquitin-dependent protein catabolic process (GO:1903070)|negative regulation of protein complex assembly (GO:0031333)|positive regulation of autophagy (GO:0010508)|positive regulation of protein lipidation (GO:1903061)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	protein self-association (GO:0043621)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)	3						GTCCGGCGTGGGAGGCGCGGA	0.701																																					p.P14H		Atlas-SNP	.											.	SVIP	10	.	0			c.C41A						.						12.0	16.0	15.0					11																	22851254		1861	4075	5936	SO:0001583	missense	258010	exon1			GGCGTGGGAGGCG	AF527534	CCDS41627.1	11p14.2	2009-03-10				ENSG00000198168			25238	protein-coding gene	gene with protein product						18793143, 17872946, 12529442	Standard	NM_148893		Approved	DKFZp313A2432	uc001mqp.4	Q8NHG7		ENST00000354193.4:c.41C>A	chr11.hg19:g.22851254G>T	ENSP00000346130:p.Pro14His	292.0	0.0		219.0	41.0	NM_148893		Missense_Mutation	SNP	ENST00000354193.4	hg19	CCDS41627.1	.	.	.	.	.	.	.	.	.	.	G	6.846	0.525399	0.13066	.	.	ENSG00000198168	ENST00000354193	.	.	.	3.98	3.06	0.35304	.	0.222161	0.23083	N	0.052125	T	0.27731	0.0682	.	.	.	0.09310	N	1	P	0.37276	0.589	B	0.37144	0.242	T	0.15838	-1.0423	8	0.62326	D	0.03	-1.9713	7.5771	0.27942	0.1193:0.0:0.8807:0.0	.	14	Q8NHG7	SVIP_HUMAN	H	14	.	ENSP00000346130:P14H	P	-	2	0	SVIP	22807830	0.308000	0.24509	0.020000	0.16555	0.443000	0.32047	1.076000	0.30729	1.007000	0.39238	-0.339000	0.08088	CCC	.	.		0.701	SVIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387725.2	NM_148893	
OR5J2	282775	hgsc.bcm.edu	37	11	55944169	55944169	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:55944169G>T	ENST00000312298.1	+	1	76	c.76G>T	c.(76-78)Gtg>Ttg	p.V26L		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					ACTAAAAGCTGTGCTTTTTGT	0.388																																					p.V26L		Atlas-SNP	.											.	OR5J2	98	.	0			c.G76T						.						170.0	163.0	165.0					11																	55944169		2201	4295	6496	SO:0001583	missense	282775	exon1			AAAGCTGTGCTTT	AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.76G>T	chr11.hg19:g.55944169G>T	ENSP00000310788:p.Val26Leu	111.0	0.0		71.0	10.0	NM_001005492	Q6IEU5	Missense_Mutation	SNP	ENST00000312298.1	hg19	CCDS31522.1	.	.	.	.	.	.	.	.	.	.	G	0.790	-0.759158	0.03019	.	.	ENSG00000174957	ENST00000312298	T	0.00063	8.78	4.32	-8.38	0.00973	.	1.628360	0.03583	N	0.230428	T	0.00039	0.0001	N	0.03238	-0.38	0.09310	N	1	B	0.19583	0.037	B	0.17098	0.017	T	0.37911	-0.9685	10	0.06236	T	0.91	.	2.8179	0.05463	0.1185:0.3675:0.1343:0.3796	.	26	Q8NH18	OR5J2_HUMAN	L	26	ENSP00000310788:V26L	ENSP00000310788:V26L	V	+	1	0	OR5J2	55700745	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.136000	0.00588	-0.952000	0.03649	-0.294000	0.09567	GTG	.	.		0.388	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391544.1	NM_001005492	
OR8K3	219473	hgsc.bcm.edu	37	11	56086057	56086057	+	Missense_Mutation	SNP	T	T	G	rs141217471		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:56086057T>G	ENST00000312711.1	+	1	275	c.275T>G	c.(274-276)aTt>aGt	p.I92S		NM_001005202.1	NP_001005202.1	Q8NH51	OR8K3_HUMAN	olfactory receptor, family 8, subfamily K, member 3	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|ovary(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	40	Esophageal squamous(21;0.00448)					AAGAATATAATTTCTTATTAT	0.358																																					p.I92S		Atlas-SNP	.											.	OR8K3	92	.	0			c.T275G						.						74.0	80.0	78.0					11																	56086057		2201	4296	6497	SO:0001583	missense	219473	exon1			ATATAATTTCTTA	AB065541	CCDS31527.1	11q11	2012-08-09			ENSG00000181689	ENSG00000181689		"""GPCR / Class A : Olfactory receptors"""	15313	protein-coding gene	gene with protein product							Standard	NM_001005202		Approved		uc010rjf.2	Q8NH51	OTTHUMG00000166855	ENST00000312711.1:c.275T>G	chr11.hg19:g.56086057T>G	ENSP00000323555:p.Ile92Ser	147.0	0.0		144.0	6.0	NM_001005202	Q6IFC4	Missense_Mutation	SNP	ENST00000312711.1	hg19	CCDS31527.1	.	.	.	.	.	.	.	.	.	.	T	13.01	2.110663	0.37242	.	.	ENSG00000181689	ENST00000312711	T	0.01359	4.98	4.65	4.65	0.58169	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	T	0.11793	0.0287	H	0.94542	3.55	0.35935	D	0.832798	D	0.63880	0.993	D	0.64410	0.925	T	0.13845	-1.0494	10	0.87932	D	0	.	13.7071	0.62646	0.0:0.0:0.0:1.0	.	92	Q8NH51	OR8K3_HUMAN	S	92	ENSP00000323555:I92S	ENSP00000323555:I92S	I	+	2	0	OR8K3	55842633	1.000000	0.71417	0.053000	0.19242	0.001000	0.01503	5.351000	0.66022	2.074000	0.62210	0.519000	0.50382	ATT	.	T|1.000;A|0.000		0.358	OR8K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391602.1	NM_001005202	
MS4A4A	51338	hgsc.bcm.edu	37	11	60068517	60068517	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:60068517C>G	ENST00000337908.4	+	4	464	c.374C>G	c.(373-375)aCt>aGt	p.T125S	MS4A4A_ENST00000355131.3_Missense_Mutation_p.T106S|MS4A4A_ENST00000532114.1_Missense_Mutation_p.T125S|MS4A4A_ENST00000395016.3_Missense_Mutation_p.T106S	NM_148975.2	NP_683876.1	Q96JQ5	M4A4A_HUMAN	membrane-spanning 4-domains, subfamily A, member 4A	125						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(12)|prostate(1)|skin(4)	23						GGAATTAGAACTACAAAAGGC	0.308																																					p.T125S		Atlas-SNP	.											.	MS4A4A	76	.	0			c.C374G						.						73.0	74.0	74.0					11																	60068517		2203	4298	6501	SO:0001583	missense	51338	exon4			TTAGAACTACAAA	AB013102	CCDS7982.1, CCDS58135.1	11q12	2012-02-28	2012-02-28		ENSG00000110079	ENSG00000110079			13371	protein-coding gene	gene with protein product		606547	"""membrane-spanning 4-domains, subfamily A, member 4"""	MS4A4		11245982, 11401424	Standard	NM_148975		Approved	CD20L1, MS4A7	uc001noz.3	Q96JQ5	OTTHUMG00000154949	ENST00000337908.4:c.374C>G	chr11.hg19:g.60068517C>G	ENSP00000338648:p.Thr125Ser	38.0	0.0		29.0	8.0	NM_148975	Q8TEZ6|Q96PG7|Q9BY18|Q9H3V3|Q9P1S3	Missense_Mutation	SNP	ENST00000337908.4	hg19	CCDS7982.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.593060	0.28357	.	.	ENSG00000110079	ENST00000532114;ENST00000337908;ENST00000355131;ENST00000395016	T;T;T;T	0.02158	4.42;4.42;4.42;4.42	4.3	0.305	0.15801	.	0.806785	0.10939	N	0.617534	T	0.02494	0.0076	L	0.39085	1.19	0.21802	N	0.999534	P;P	0.46142	0.873;0.793	P;B	0.47673	0.554;0.354	T	0.30090	-0.9990	10	0.07325	T	0.83	-2.0932	6.5799	0.22588	0.0:0.5889:0.0:0.4111	.	125;125	Q96JQ5-2;Q96JQ5	.;M4A4A_HUMAN	S	125;125;106;106	ENSP00000434506:T125S;ENSP00000338648:T125S;ENSP00000347252:T106S;ENSP00000378462:T106S	ENSP00000338648:T125S	T	+	2	0	MS4A4A	59825093	0.159000	0.22864	0.838000	0.33150	0.790000	0.44656	0.291000	0.18994	-0.022000	0.13986	-0.373000	0.07131	ACT	.	.		0.308	MS4A4A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000337774.2		
MS4A10	341116	hgsc.bcm.edu	37	11	60563034	60563034	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:60563034A>C	ENST00000308287.1	+	6	595	c.499A>C	c.(499-501)Atc>Ctc	p.I167L		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	167						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						TCAGGTCCACATCCAGAGGCT	0.617																																					p.I167L		Atlas-SNP	.											.	MS4A10	38	.	0			c.A499C						.						86.0	63.0	71.0					11																	60563034		2203	4299	6502	SO:0001583	missense	341116	exon6			GTCCACATCCAGA	AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.499A>C	chr11.hg19:g.60563034A>C	ENSP00000311862:p.Ile167Leu	57.0	0.0		41.0	7.0	NM_206893	B2RP45|Q96PG3	Missense_Mutation	SNP	ENST00000308287.1	hg19	CCDS7992.1	.	.	.	.	.	.	.	.	.	.	A	12.22	1.872317	0.33069	.	.	ENSG00000172689	ENST00000308287	T	0.01902	4.57	4.01	-0.103	0.13609	.	0.427442	0.17384	N	0.176188	T	0.02807	0.0084	L	0.60455	1.87	0.23607	N	0.997302	B	0.31256	0.316	B	0.36666	0.23	T	0.40905	-0.9538	10	0.27785	T	0.31	-11.3484	4.405	0.11406	0.4777:0.4074:0.1149:0.0	.	167	Q96PG2	M4A10_HUMAN	L	167	ENSP00000311862:I167L	ENSP00000311862:I167L	I	+	1	0	MS4A10	60319610	0.812000	0.29077	0.938000	0.37757	0.404000	0.30871	0.489000	0.22387	0.189000	0.20188	0.533000	0.62120	ATC	.	.		0.617	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395619.1	NM_206893	
GAB2	9846	hgsc.bcm.edu	37	11	77991812	77991812	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:77991812C>T	ENST00000361507.4	-	2	296	c.211G>A	c.(211-213)Gca>Aca	p.A71T	GAB2_ENST00000526030.1_5'UTR|GAB2_ENST00000340149.2_Missense_Mutation_p.A33T	NM_080491.2	NP_536739.1	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2	71	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell degranulation (GO:0043306)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)		INTS4/GAB2(2)	NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|ovary(5)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			GTCAGGCCTGCATCTACCTGC	0.493																																					p.A71T		Atlas-SNP	.											.	GAB2	63	.	0			c.G211A						.						153.0	135.0	141.0					11																	77991812		2200	4292	6492	SO:0001583	missense	9846	exon2			GGCCTGCATCTAC	AB011143	CCDS8259.1, CCDS8260.1	11q13.4-q13.5	2013-01-10			ENSG00000033327	ENSG00000033327		"""Pleckstrin homology (PH) domain containing"""	14458	protein-coding gene	gene with protein product	"""Grb2-associated binder 2"""	606203				10391903, 10068651	Standard	NM_080491		Approved	KIAA0571	uc001ozh.3	Q9UQC2	OTTHUMG00000166673	ENST00000361507.4:c.211G>A	chr11.hg19:g.77991812C>T	ENSP00000354952:p.Ala71Thr	99.0	0.0		99.0	14.0	NM_080491	A2RRM2|A6NEW9|A7MD36|O60317	Missense_Mutation	SNP	ENST00000361507.4	hg19	CCDS8259.1	.	.	.	.	.	.	.	.	.	.	C	34	5.394558	0.96009	.	.	ENSG00000033327	ENST00000340149;ENST00000361507;ENST00000528886;ENST00000530915	T;T;T;T	0.77358	-1.09;2.64;-1.09;-1.09	5.37	5.37	0.77165	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	U	0.000001	D	0.85461	0.5702	L	0.46670	1.46	0.80722	D	1	D	0.76494	0.999	D	0.79108	0.992	D	0.86228	0.1635	10	0.72032	D	0.01	-9.0531	19.4818	0.95013	0.0:1.0:0.0:0.0	.	71	Q9UQC2	GAB2_HUMAN	T	33;71;33;33	ENSP00000343959:A33T;ENSP00000354952:A71T;ENSP00000433762:A33T;ENSP00000431868:A33T	ENSP00000343959:A33T	A	-	1	0	GAB2	77669460	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.880000	0.69698	2.667000	0.90743	0.563000	0.77884	GCA	.	.		0.493	GAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391085.1	NM_080491	
PRDM10	56980	hgsc.bcm.edu	37	11	129801056	129801056	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:129801056G>A	ENST00000360871.3	-	11	1616	c.1385C>T	c.(1384-1386)cCt>cTt	p.P462L	PRDM10_ENST00000358825.5_Missense_Mutation_p.P462L|PRDM10_ENST00000526082.1_Missense_Mutation_p.P376L|PRDM10_ENST00000423662.2_Missense_Mutation_p.P376L|PRDM10_ENST00000528746.1_Missense_Mutation_p.P436L|PRDM10_ENST00000304538.6_Missense_Mutation_p.P376L	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		TGGCAGCTGAGGGATTGGGAT	0.542																																					p.P462L		Atlas-SNP	.											.	PRDM10	120	.	0			c.C1385T						.						180.0	179.0	179.0					11																	129801056		2201	4297	6498	SO:0001583	missense	56980	exon11			AGCTGAGGGATTG	AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.1385C>T	chr11.hg19:g.129801056G>A	ENSP00000354118:p.Pro462Leu	85.0	0.0		69.0	6.0	NM_020228	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	ENST00000360871.3	hg19	CCDS8484.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.040970	0.75732	.	.	ENSG00000170325	ENST00000358825;ENST00000304538;ENST00000360871;ENST00000423662;ENST00000528746;ENST00000526082;ENST00000533431	T;T;T;T;T;T;T	0.10763	2.86;2.84;2.85;2.85;2.9;2.84;2.94	4.97	4.97	0.65823	.	0.277127	0.36134	N	0.002766	T	0.12902	0.0313	N	0.24115	0.695	0.47905	D	0.999544	B;D;P;B;P;P;P	0.57571	0.437;0.98;0.573;0.437;0.573;0.612;0.573	B;P;B;B;B;B;B	0.49085	0.098;0.6;0.199;0.098;0.199;0.138;0.199	T	0.02431	-1.1160	10	0.56958	D	0.05	-16.3028	16.09	0.81086	0.0:0.0:1.0:0.0	.	376;462;462;462;376;376;376	B7ZL72;Q9NQV6-4;G3XAE5;Q9NQV6;Q9NQV6-5;Q9NQV6-2;Q9NQV6-1	.;.;.;PRD10_HUMAN;.;.;.	L	462;376;462;376;436;376;179	ENSP00000351686:P462L;ENSP00000302669:P376L;ENSP00000354118:P462L;ENSP00000398431:P376L;ENSP00000431262:P436L;ENSP00000432237:P376L;ENSP00000435940:P179L	ENSP00000302669:P376L	P	-	2	0	PRDM10	129306266	1.000000	0.71417	0.962000	0.40283	0.972000	0.66771	5.558000	0.67319	2.461000	0.83175	0.585000	0.79938	CCT	.	.		0.542	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386076.1	NM_199437	
ZNF384	171017	hgsc.bcm.edu	37	12	6787319	6787319	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr12:6787319G>T	ENST00000396801.3	-	6	867	c.660C>A	c.(658-660)gaC>gaA	p.D220E	ZNF384_ENST00000355772.4_Missense_Mutation_p.D165E|ZNF384_ENST00000319770.3_Missense_Mutation_p.D204E|ZNF384_ENST00000396795.1_Missense_Mutation_p.D220E|ZNF384_ENST00000396799.2_Missense_Mutation_p.D220E|ZNF384_ENST00000361959.3_Missense_Mutation_p.D220E	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	220					nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						CTTTCTGATGGTCATCATCAT	0.572			T	"""EWSR1, TAF15 """	ALL																																p.D220E		Atlas-SNP	.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	.	ZNF384	102	.	0			c.C660A						.						159.0	149.0	152.0					12																	6787319		2203	4300	6503	SO:0001583	missense	171017	exon6			CTGATGGTCATCA	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.660C>A	chr12.hg19:g.6787319G>T	ENSP00000380019:p.Asp220Glu	46.0	0.0		29.0	8.0	NM_133476	O15407|Q7Z722|Q8N938	Missense_Mutation	SNP	ENST00000396801.3	hg19	CCDS44817.1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528617	0.27299	.	.	ENSG00000126746	ENST00000319770;ENST00000396795;ENST00000396801;ENST00000361959;ENST00000355772;ENST00000396799;ENST00000417772;ENST00000436774;ENST00000542796	T;T;T;T;T;T;T	0.76186	3.27;3.2;-1.0;-1.0;3.26;3.2;3.56	5.48	4.6	0.57074	.	0.353173	0.29113	N	0.013103	T	0.52725	0.1752	N	0.04508	-0.205	0.36089	D	0.843333	B;P;B;B;B	0.35894	0.145;0.526;0.049;0.165;0.165	B;B;B;B;B	0.37601	0.048;0.254;0.028;0.069;0.069	T	0.59311	-0.7478	10	0.19590	T	0.45	-15.1413	12.5638	0.56297	0.0768:0.0:0.9232:0.0	.	220;220;165;204;220	Q8TF68;E9PHB3;Q8TF68-3;F8W6Q3;Q8TF68-2	ZN384_HUMAN;.;.;.;.	E	204;220;220;220;165;220;220;204;204	ENSP00000321650:D204E;ENSP00000380013:D220E;ENSP00000380019:D220E;ENSP00000354592:D220E;ENSP00000348018:D165E;ENSP00000380017:D220E;ENSP00000412911:D204E	ENSP00000321650:D204E	D	-	3	2	ZNF384	6657580	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.274000	0.65569	1.310000	0.45006	0.591000	0.81541	GAC	.	.		0.572	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
TAS2R7	50837	hgsc.bcm.edu	37	12	10955114	10955114	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr12:10955114A>T	ENST00000240687.2	-	1	112	c.56T>A	c.(55-57)gTg>gAg	p.V19E		NM_023919.2	NP_076408.1	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	19					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			kidney(1)|large_intestine(1)|lung(3)|skin(2)|stomach(3)	10						TAAGATCCCCACTGAAAACTC	0.403																																					p.V19E		Atlas-SNP	.											.	TAS2R7	35	.	0			c.T56A						.						113.0	118.0	116.0					12																	10955114		2203	4300	6503	SO:0001583	missense	50837	exon1			ATCCCCACTGAAA	AF227133	CCDS8631.1	12p13	2012-08-22			ENSG00000121377	ENSG00000121377		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14913	protein-coding gene	gene with protein product		604793				10761934, 10766242	Standard	NM_023919		Approved	T2R7, TRB4	uc001qyv.3	Q9NYW3	OTTHUMG00000168505	ENST00000240687.2:c.56T>A	chr12.hg19:g.10955114A>T	ENSP00000240687:p.Val19Glu	119.0	0.0		95.0	13.0	NM_023919	Q645Y1	Missense_Mutation	SNP	ENST00000240687.2	hg19	CCDS8631.1	.	.	.	.	.	.	.	.	.	.	A	12.16	1.854547	0.32791	.	.	ENSG00000121377	ENST00000240687	T	0.44881	0.91	5.36	4.2	0.49525	.	0.475878	0.18998	N	0.125423	T	0.57858	0.2082	M	0.78049	2.395	0.21675	N	0.999593	P	0.52463	0.953	P	0.56865	0.808	T	0.53078	-0.8489	10	0.87932	D	0	.	9.9143	0.41425	0.8476:0.0:0.0:0.1524	.	19	Q9NYW3	TA2R7_HUMAN	E	19	ENSP00000240687:V19E	ENSP00000240687:V19E	V	-	2	0	TAS2R7	10846381	0.001000	0.12720	0.022000	0.16811	0.011000	0.07611	1.165000	0.31822	1.026000	0.39733	0.455000	0.32223	GTG	.	.		0.403	TAS2R7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399931.1		
CEP290	80184	hgsc.bcm.edu	37	12	88508214	88508214	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr12:88508214G>T	ENST00000552810.1	-	20	2378	c.2035C>A	c.(2035-2037)Ctt>Att	p.L679I	CEP290_ENST00000397838.3_5'UTR|CEP290_ENST00000309041.7_Missense_Mutation_p.L681I	NM_025114.3	NP_079390.3	O15078	CE290_HUMAN	centrosomal protein 290kDa	679					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|G2/M transition of mitotic cell cycle (GO:0000086)|hindbrain development (GO:0030902)|mitotic cell cycle (GO:0000278)|otic vesicle formation (GO:0030916)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)|protein transport (GO:0015031)|regulation of cAMP metabolic process (GO:0030814)|regulation of establishment of protein localization (GO:0070201)|retina development in camera-type eye (GO:0060041)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|protein complex (GO:0043234)|TCTN-B9D complex (GO:0036038)				breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|liver(1)|lung(18)|ovary(5)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	73						AGTCTTTCAAGGCTAGGGATA	0.338																																					p.L679I		Atlas-SNP	.											.	CEP290	195	.	0			c.C2035A						.						156.0	138.0	144.0					12																	88508214		1602	3564	5166	SO:0001583	missense	80184	exon20			TTTCAAGGCTAGG	AB002371	CCDS55858.1	12q21.33	2014-09-17				ENSG00000198707			29021	protein-coding gene	gene with protein product	"""Joubert syndrome 5"", ""nephrocystin-6"", ""cancer/testis antigen 87"", ""POC3 centriolar protein homolog (Chlamydomonas)"", ""Meckel syndrome, type 4"""	610142				15474516, 16682973, 16632484	Standard	NM_025114		Approved	KIAA0373, FLJ13615, 3H11Ag, rd16, NPHP6, JBTS5, SLSN6, LCA10, MKS4, BBS14, CT87, POC3	uc001tar.3	O15078		ENST00000552810.1:c.2035C>A	chr12.hg19:g.88508214G>T	ENSP00000448012:p.Leu679Ile	76.0	0.0		84.0	4.0	NM_025114	Q1PSK5|Q66GS8|Q9H2G6|Q9H6Q7|Q9H8I0	Missense_Mutation	SNP	ENST00000552810.1	hg19	CCDS55858.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995407	0.74703	.	.	ENSG00000198707	ENST00000552810;ENST00000309041;ENST00000536998	T;T	0.79352	-1.26;-1.26	6.06	6.06	0.98353	.	0.000000	0.64402	D	0.000001	D	0.84750	0.5541	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.78314	0.945;0.991	T	0.82500	-0.0426	10	0.34782	T	0.22	.	11.8573	0.52446	0.1342:0.0:0.8658:0.0	.	679;679	Q05BJ6;O15078	.;CE290_HUMAN	I	679;681;679	ENSP00000448012:L679I;ENSP00000308021:L681I	ENSP00000308021:L681I	L	-	1	0	CEP290	87032345	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.264000	0.58859	2.880000	0.98712	0.650000	0.86243	CTT	.	.		0.338	CEP290-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406344.1	NM_025114	
PLXNC1	10154	hgsc.bcm.edu	37	12	94697637	94697637	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr12:94697637T>G	ENST00000258526.4	+	29	4741	c.4492T>G	c.(4492-4494)Tca>Gca	p.S1498A	PLXNC1_ENST00000547057.1_Missense_Mutation_p.S545A|PLXNC1_ENST00000545312.1_Missense_Mutation_p.S237A	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1498					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						ATTGTCATCCTCAGAAATGGA	0.343																																					p.S1498A		Atlas-SNP	.											.	PLXNC1	135	.	0			c.T4492G						.						83.0	86.0	85.0					12																	94697637		2203	4300	6503	SO:0001583	missense	10154	exon29			TCATCCTCAGAAA	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.4492T>G	chr12.hg19:g.94697637T>G	ENSP00000258526:p.Ser1498Ala	310.0	0.0		243.0	23.0	NM_005761	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	hg19	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	T	11.58	1.679831	0.29783	.	.	ENSG00000136040	ENST00000258526;ENST00000547057;ENST00000545312	T;T;T	0.11495	2.77;2.77;2.77	5.27	4.12	0.48240	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.479350	0.22467	N	0.059664	T	0.04543	0.0124	N	0.03608	-0.345	0.25912	N	0.983229	B;B	0.13594	0.0;0.008	B;B	0.15870	0.0;0.014	T	0.36456	-0.9747	10	0.31617	T	0.26	.	7.0673	0.25159	0.0:0.0739:0.2727:0.6534	.	545;1498	B4DHQ7;O60486	.;PLXC1_HUMAN	A	1498;545;237	ENSP00000258526:S1498A;ENSP00000446720:S545A;ENSP00000439225:S237A	ENSP00000258526:S1498A	S	+	1	0	PLXNC1	93221768	0.259000	0.24043	1.000000	0.80357	0.994000	0.84299	0.697000	0.25556	0.839000	0.34971	0.533000	0.62120	TCA	.	.		0.343	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
CCDC63	160762	hgsc.bcm.edu	37	12	111345215	111345215	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr12:111345215G>A	ENST00000308208.5	+	12	1869	c.1627G>A	c.(1627-1629)Gtg>Atg	p.V543M	CCDC63_ENST00000552694.1_Missense_Mutation_p.V464M|CCDC63_ENST00000545036.1_Missense_Mutation_p.V503M	NM_152591.1	NP_689804.1	Q8NA47	CCD63_HUMAN	coiled-coil domain containing 63	543										NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(1)	39						GAGTAAGGAAGTGCGCGGAGA	0.527																																					p.V543M		Atlas-SNP	.											.	CCDC63	89	.	0			c.G1627A						.						95.0	74.0	81.0					12																	111345215		2203	4300	6503	SO:0001583	missense	160762	exon12			AAGGAAGTGCGCG	AK093162	CCDS9151.1, CCDS66470.1, CCDS73528.1	12q24.11	2013-02-19				ENSG00000173093			26669	protein-coding gene	gene with protein product	"""outer row dynein assembly 5 homolog (Chlamydomonas)"""						Standard	NM_001286243		Approved	ODA5, FLJ35843	uc001trv.1	Q8NA47	OTTHUMG00000169534	ENST00000308208.5:c.1627G>A	chr12.hg19:g.111345215G>A	ENSP00000312399:p.Val543Met	97.0	0.0		79.0	6.0	NM_152591	B4DY03|Q0P603|Q6P2E1	Missense_Mutation	SNP	ENST00000308208.5	hg19	CCDS9151.1	.	.	.	.	.	.	.	.	.	.	G	2.280	-0.365001	0.05103	.	.	ENSG00000173093	ENST00000545036;ENST00000308208;ENST00000552694	T;T;T	0.32272	1.46;1.46;1.46	3.21	-6.43	0.01926	.	2.903520	0.01240	N	0.008599	T	0.12944	0.0314	N	0.08118	0	0.09310	N	1	B	0.16166	0.016	B	0.09377	0.004	T	0.13361	-1.0512	10	0.30078	T	0.28	.	2.1649	0.03834	0.18:0.2014:0.4094:0.2092	.	543	Q8NA47	CCD63_HUMAN	M	503;543;464	ENSP00000445881:V503M;ENSP00000312399:V543M;ENSP00000450217:V464M	ENSP00000312399:V543M	V	+	1	0	CCDC63	109829598	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-5.477000	0.00119	-3.043000	0.00262	-0.511000	0.04467	GTG	.	.		0.527	CCDC63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000404673.2	NM_152591	
FLT1	2321	hgsc.bcm.edu	37	13	29041086	29041086	+	Silent	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr13:29041086A>G	ENST00000282397.4	-	3	593	c.342T>C	c.(340-342)acT>acC	p.T114T	FLT1_ENST00000541932.1_Silent_p.T114T|FLT1_ENST00000539099.1_Silent_p.T114T	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	114	Ig-like C2-type 1.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTTCTTTGAAGTAGGTACAG	0.368																																					p.T114T		Atlas-SNP	.											.	FLT1	393	.	0			c.T342C						.						143.0	137.0	139.0					13																	29041086		2203	4300	6503	SO:0001819	synonymous_variant	2321	exon3			CTTTGAAGTAGGT	AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.342T>C	chr13.hg19:g.29041086A>G		100.0	0.0		71.0	7.0	NM_002019	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Silent	SNP	ENST00000282397.4	hg19	CCDS9330.1																																																																																			.	.		0.368	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044322.1		
FNDC3A	22862	hgsc.bcm.edu	37	13	49649455	49649455	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr13:49649455G>A	ENST00000492622.2	+	3	435	c.130G>A	c.(130-132)Gca>Aca	p.A44T	FNDC3A_ENST00000541916.1_Missense_Mutation_p.A44T	NM_001079673.1	NP_001073141.1	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	44					fertilization (GO:0009566)|Sertoli cell development (GO:0060009)|single organismal cell-cell adhesion (GO:0016337)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle membrane (GO:0012506)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|prostate(5)|skin(2)|urinary_tract(1)	41		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		CCCAGGAGAAGCATTTACAAT	0.303																																					p.A44T		Atlas-SNP	.											.	FNDC3A	93	.	0			c.G130A						.						151.0	151.0	151.0					13																	49649455		1820	4076	5896	SO:0001583	missense	22862	exon3			GGAGAAGCATTTA	AB023187	CCDS9413.2, CCDS41886.1	13q14.12	2013-02-11	2005-01-20	2005-01-22	ENSG00000102531	ENSG00000102531		"""Fibronectin type III domain containing"""	20296	protein-coding gene	gene with protein product		615794	"""fibronectin type III domain containing 3"""	FNDC3			Standard	NM_001079673		Approved	bA203I16.5, KIAA0970	uc001vcm.3	Q9Y2H6	OTTHUMG00000016911	ENST00000492622.2:c.130G>A	chr13.hg19:g.49649455G>A	ENSP00000417257:p.Ala44Thr	404.0	0.0		280.0	16.0	NM_001079673	B4DYG1|Q5HYC9|Q5JVF8|Q5JVF9|Q6EVH3|Q6EVH4|Q6N020|Q6P9D5|Q6ZME4|Q9H1W1	Missense_Mutation	SNP	ENST00000492622.2	hg19	CCDS41886.1	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256911	0.22965	.	.	ENSG00000102531	ENST00000492622;ENST00000541916	T;T	0.32272	1.46;1.46	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000002	T	0.17577	0.0422	N	0.11154	0.105	0.49299	D	0.999776	B	0.21225	0.053	B	0.19666	0.026	T	0.08493	-1.0719	10	0.02654	T	1	-8.388	18.8844	0.92370	0.0:0.0:1.0:0.0	.	44	Q9Y2H6	FND3A_HUMAN	T	44	ENSP00000417257:A44T;ENSP00000441831:A44T	ENSP00000420275:A44T	A	+	1	0	FNDC3A	48547456	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	5.980000	0.70516	2.809000	0.96659	0.655000	0.94253	GCA	.	.		0.303	FNDC3A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354845.2	NM_014923	
OR4K1	79544	hgsc.bcm.edu	37	14	20403852	20403852	+	Silent	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr14:20403852G>A	ENST00000285600.4	+	1	86	c.27G>A	c.(25-27)gtG>gtA	p.V9V		NM_001004063.2	NP_001004063.2	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(24)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		AATCGATGGTGTCTGAGTTTG	0.368																																					p.V9V		Atlas-SNP	.											.	OR4K1	108	.	0			c.G27A						.						339.0	379.0	366.0					14																	20403852		2203	4300	6503	SO:0001819	synonymous_variant	79544	exon1			GATGGTGTCTGAG		CCDS32025.1	14q11.2	2013-09-23			ENSG00000155249	ENSG00000155249		"""GPCR / Class A : Olfactory receptors"""	14726	protein-coding gene	gene with protein product							Standard	NM_001004063		Approved		uc001vwj.2	Q8NGD4	OTTHUMG00000170633	ENST00000285600.4:c.27G>A	chr14.hg19:g.20403852G>A		93.0	0.0		97.0	39.0	NM_001004063	B9EKV9|Q8NGD6|Q96R73	Silent	SNP	ENST00000285600.4	hg19	CCDS32025.1																																																																																			.	.		0.368	OR4K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409881.1		
FSIP1	161835	hgsc.bcm.edu	37	15	40005705	40005705	+	Silent	SNP	G	G	C	rs557574177	byFrequency	TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr15:40005705G>C	ENST00000350221.3	-	10	1337	c.1128C>G	c.(1126-1128)cgC>cgG	p.R376R		NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	376										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		TATGCAGATCGCGTTGCTCTT	0.313																																					p.R376R		Atlas-SNP	.											.	FSIP1	53	.	0			c.C1128G						.						232.0	231.0	232.0					15																	40005705		2203	4300	6503	SO:0001819	synonymous_variant	161835	exon10			CAGATCGCGTTGC	BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.1128C>G	chr15.hg19:g.40005705G>C		98.0	0.0		104.0	31.0	NM_152597	Q6X2C8|Q86Y89	Silent	SNP	ENST00000350221.3	hg19	CCDS10050.1																																																																																			.	.		0.313	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597	
HERC1	8925	hgsc.bcm.edu	37	15	63970130	63970130	+	Silent	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr15:63970130A>G	ENST00000443617.2	-	37	7071	c.6984T>C	c.(6982-6984)acT>acC	p.T2328T	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2328					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CATGGCGCCCAGTTTGCTTGT	0.532																																					p.T2328T		Atlas-SNP	.											.	HERC1	624	.	0			c.T6984C						.						153.0	159.0	157.0					15																	63970130		2149	4256	6405	SO:0001819	synonymous_variant	8925	exon37			GCGCCCAGTTTGC	U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.6984T>C	chr15.hg19:g.63970130A>G		87.0	0.0		59.0	4.0	NM_003922	Q8IW65	Silent	SNP	ENST00000443617.2	hg19	CCDS45277.1																																																																																			.	.		0.532	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418523.1	NM_003922	
IGDCC4	57722	hgsc.bcm.edu	37	15	65694784	65694784	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr15:65694784A>G	ENST00000352385.2	-	4	814	c.605T>C	c.(604-606)gTt>gCt	p.V202A		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	202	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						ACTCTCCTGAACATCCAGGAT	0.637																																					p.V202A		Atlas-SNP	.											.	IGDCC4	95	.	0			c.T605C						.						48.0	41.0	44.0					15																	65694784		2196	4291	6487	SO:0001583	missense	57722	exon4			TCCTGAACATCCA		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.605T>C	chr15.hg19:g.65694784A>G	ENSP00000319623:p.Val202Ala	98.0	0.0		74.0	9.0	NM_020962	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	hg19	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	A	24.6	4.545597	0.86022	.	.	ENSG00000103742	ENST00000352385	T	0.68624	-0.34	5.17	5.17	0.71159	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.203210	0.41605	D	0.000850	T	0.72399	0.3455	L	0.41356	1.27	0.53688	D	0.99997	P	0.52692	0.955	P	0.60173	0.87	T	0.74970	-0.3482	10	0.62326	D	0.03	-2.7325	13.9984	0.64416	1.0:0.0:0.0:0.0	.	202	Q8TDY8	IGDC4_HUMAN	A	202	ENSP00000319623:V202A	ENSP00000319623:V202A	V	-	2	0	IGDCC4	63481837	0.999000	0.42202	0.165000	0.22776	0.944000	0.59088	8.393000	0.90182	1.946000	0.56461	0.459000	0.35465	GTT	.	.		0.637	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
CRAMP1L	57585	hgsc.bcm.edu	37	16	1706116	1706116	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr16:1706116G>C	ENST00000397412.3	+	10	1457	c.1358G>C	c.(1357-1359)gGg>gCg	p.G453A	CRAMP1L_ENST00000262317.4_Intron|CRAMP1L_ENST00000436138.3_Missense_Mutation_p.G450A|LA16c-431H6.6_ENST00000454337.1_Intron|CRAMP1L_ENST00000293925.5_Missense_Mutation_p.G453A			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	453						nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						ATCCAGAGTGGGCAGGGCACG	0.716																																					p.G453A		Atlas-SNP	.											.	CRAMP1L	60	.	0			c.G1358C						.						9.0	12.0	11.0					16																	1706116		1904	4060	5964	SO:0001583	missense	57585	exon9			AGAGTGGGCAGGG	AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.1358G>C	chr16.hg19:g.1706116G>C	ENSP00000380559:p.Gly453Ala	142.0	0.0		132.0	6.0	NM_020825	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Missense_Mutation	SNP	ENST00000397412.3	hg19	CCDS10440.2	.	.	.	.	.	.	.	.	.	.	G	9.846	1.192246	0.21954	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138	.	.	.	5.02	5.02	0.67125	.	0.062767	0.64402	D	0.000006	T	0.50326	0.1609	N	0.17082	0.46	0.80722	D	1	P	0.36110	0.537	B	0.42555	0.391	T	0.52351	-0.8587	9	0.41790	T	0.15	-34.9142	18.5282	0.90981	0.0:0.0:1.0:0.0	.	453	Q96RY5	CRML_HUMAN	A	453;453;450	.	ENSP00000293925:G453A	G	+	2	0	CRAMP1L	1646117	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	5.129000	0.64739	2.592000	0.87571	0.655000	0.94253	GGG	.	.		0.716	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157297.4		
TP53	7157	hgsc.bcm.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.V157F|TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V157F	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,+1,5	TP53	33396	.	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	c.G469T						.						50.0	52.0	51.0					17																	7578461		2202	4300	6502	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGCGGACGCGGGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	chr17.hg19:g.7578461C>A	ENSP00000269305:p.Val157Phe	118.0	0.0		111.0	48.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	.	.		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
DNAH9	1770	hgsc.bcm.edu	37	17	11783485	11783485	+	Silent	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr17:11783485C>T	ENST00000262442.4	+	54	10637	c.10569C>T	c.(10567-10569)ccC>ccT	p.P3523P	DNAH9_ENST00000454412.2_Silent_p.P3523P|DNAH9_ENST00000608377.1_5'Flank	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3523	AAA 5. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTCTGGGACCCCTGCTTGGGA	0.507																																					p.P3523P		Atlas-SNP	.											.	DNAH9	695	.	0			c.C10569T						.						100.0	99.0	99.0					17																	11783485		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon54			GGGACCCCTGCTT	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.10569C>T	chr17.hg19:g.11783485C>T		83.0	0.0		74.0	4.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	hg19	CCDS11160.1																																																																																			.	.		0.507	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
GPR179	440435	hgsc.bcm.edu	37	17	36486669	36486669	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr17:36486669A>T	ENST00000342292.4	-	11	2803	c.2783T>A	c.(2782-2784)cTg>cAg	p.L928Q	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	928					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TGGATGAGGCAGCCTTCTCCT	0.632																																					p.L928Q		Atlas-SNP	.											.	GPR179	170	.	0			c.T2783A						.						15.0	17.0	17.0					17																	36486669		2112	4237	6349	SO:0001583	missense	440435	exon11			TGAGGCAGCCTTC		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.2783T>A	chr17.hg19:g.36486669A>T	ENSP00000345060:p.Leu928Gln	44.0	0.0		53.0	11.0	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	hg19	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	A	9.380	1.072728	0.20147	.	.	ENSG00000188888	ENST00000342292	T	0.56611	0.45	4.98	1.51	0.23008	.	0.565570	0.15109	N	0.280073	T	0.30947	0.0781	L	0.29908	0.895	0.09310	N	1	P	0.40083	0.702	B	0.34418	0.182	T	0.10177	-1.0641	10	0.19147	T	0.46	0.0032	5.776	0.18279	0.5798:0.0:0.4202:0.0	.	928	Q6PRD1	GP179_HUMAN	Q	928	ENSP00000345060:L928Q	ENSP00000345060:L928Q	L	-	2	0	GPR179	33740195	0.113000	0.22115	0.211000	0.23655	0.161000	0.22273	0.627000	0.24506	0.413000	0.25759	0.459000	0.35465	CTG	.	.		0.632	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
EXOC7	23265	hgsc.bcm.edu	37	17	74084172	74084172	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr17:74084172T>C	ENST00000335146.7	-	12	1537	c.1484A>G	c.(1483-1485)aAg>aGg	p.K495R	EXOC7_ENST00000332065.5_Missense_Mutation_p.K413R|EXOC7_ENST00000607838.1_Missense_Mutation_p.K467R|EXOC7_ENST00000405575.4_Missense_Mutation_p.K467R|EXOC7_ENST00000589210.1_Missense_Mutation_p.K444R|EXOC7_ENST00000411744.2_Missense_Mutation_p.K436R|EXOC7_ENST00000467929.2_Missense_Mutation_p.K403R			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	495					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			GGTGCCGTCCTTCGGCATGTT	0.647																																					p.K495R		Atlas-SNP	.											.	EXOC7	47	.	0			c.A1484G						.						125.0	107.0	113.0					17																	74084172		2203	4300	6503	SO:0001583	missense	23265	exon12			CCGTCCTTCGGCA	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.1484A>G	chr17.hg19:g.74084172T>C	ENSP00000334100:p.Lys495Arg	66.0	0.0		64.0	19.0	NM_001145297	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	hg19	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.145341	0.77888	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	4.86	4.86	0.63082	Cullin repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.39860	0.1094	L	0.33485	1.01	0.80722	D	1	B;B;B;B;B;P;B	0.40230	0.218;0.007;0.368;0.035;0.034;0.708;0.063	B;B;B;B;B;B;B	0.36534	0.087;0.009;0.199;0.029;0.05;0.227;0.037	T	0.20773	-1.0265	9	0.18710	T	0.47	-27.8942	14.4628	0.67462	0.0:0.0:0.0:1.0	.	436;467;403;403;495;413;444	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	R	413;333;467;495;444;403;436	.	ENSP00000333806:K413R	K	-	2	0	EXOC7	71595767	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	7.720000	0.84759	1.807000	0.52817	0.528000	0.53228	AAG	.	.		0.647	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
FASN	2194	hgsc.bcm.edu	37	17	80038728	80038728	+	Silent	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr17:80038728C>A	ENST00000306749.2	-	39	6884	c.6666G>T	c.(6664-6666)ctG>ctT	p.L2222L	FASN_ENST00000579758.1_Intron	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	2222	Thioesterase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGTTCACCAGCAGGGAGCGCA	0.672																																					p.L2222L	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.G6666T						.						24.0	28.0	26.0					17																	80038728		2198	4294	6492	SO:0001819	synonymous_variant	2194	exon39			CACCAGCAGGGAG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.6666G>T	chr17.hg19:g.80038728C>A		111.0	0.0		96.0	9.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	hg19	CCDS11801.1																																																																																			.	.		0.672	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
RNF152	220441	hgsc.bcm.edu	37	18	59483459	59483459	+	Missense_Mutation	SNP	C	C	T	rs561051015	byFrequency	TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr18:59483459C>T	ENST00000312828.3	-	2	1337	c.238G>A	c.(238-240)Gcc>Acc	p.A80T		NM_173557.2	NP_775828.1	Q8N8N0	RN152_HUMAN	ring finger protein 152	80					apoptotic process (GO:0006915)|protein K48-linked ubiquitination (GO:0070936)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)	17		Colorectal(73;0.186)				TGTGGAATGGCGATGACAGCC	0.637													C|||	2	0.000399361	0.0	0.0029	5008	,	,		18371	0.0		0.0	False		,,,				2504	0.0				p.A80T		Atlas-SNP	.											.	RNF152	37	.	0			c.G238A						.						85.0	92.0	90.0					18																	59483459		2203	4300	6503	SO:0001583	missense	220441	exon2			GAATGGCGATGAC	AK096495	CCDS11978.1	18q21.33	2013-01-09			ENSG00000176641	ENSG00000176641		"""RING-type (C3HC4) zinc fingers"""	26811	protein-coding gene	gene with protein product							Standard	XM_005266650		Approved	FLJ39176	uc002lih.1	Q8N8N0	OTTHUMG00000132774	ENST00000312828.3:c.238G>A	chr18.hg19:g.59483459C>T	ENSP00000316628:p.Ala80Thr	123.0	0.0		85.0	7.0	NM_173557	B3KV99|Q52LA4	Missense_Mutation	SNP	ENST00000312828.3	hg19	CCDS11978.1	.	.	.	.	.	.	.	.	.	.	C	16.58	3.163620	0.57476	.	.	ENSG00000176641	ENST00000312828	D	0.83419	-1.72	4.97	4.97	0.65823	.	0.122835	0.53938	D	0.000044	T	0.69895	0.3162	N	0.12182	0.205	0.49213	D	0.999769	B	0.10296	0.003	B	0.04013	0.001	T	0.64462	-0.6402	10	0.13470	T	0.59	-3.2112	18.4187	0.90579	0.0:1.0:0.0:0.0	.	80	Q8N8N0	RN152_HUMAN	T	80	ENSP00000316628:A80T	ENSP00000316628:A80T	A	-	1	0	RNF152	57634439	0.999000	0.42202	0.997000	0.53966	0.898000	0.52572	4.107000	0.57811	2.600000	0.87896	0.655000	0.94253	GCC	.	.		0.637	RNF152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256180.1	NM_173557	
FZR1	51343	hgsc.bcm.edu	37	19	3531921	3531921	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:3531921G>A	ENST00000395095.3	+	9	836	c.836G>A	c.(835-837)tGg>tAg	p.W279*	FZR1_ENST00000441788.2_Nonsense_Mutation_p.W279*|FZR1_ENST00000313639.8_Nonsense_Mutation_p.W190*	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	279					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCTGGCCTGGAATGCTGAG	0.721																																					p.W279X		Atlas-SNP	.											.	FZR1	42	.	0			c.G836A						.						12.0	16.0	15.0					19																	3531921		2190	4282	6472	SO:0001587	stop_gained	51343	exon9			TGGCCTGGAATGC	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.836G>A	chr19.hg19:g.3531921G>A	ENSP00000378529:p.Trp279*	76.0	0.0		58.0	5.0	NM_001136198	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Nonsense_Mutation	SNP	ENST00000395095.3	hg19	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	G	37	6.052137	0.97236	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.2653	16.6845	0.85301	0.0:0.0:1.0:0.0	.	.	.	.	X	279;279;190	.	ENSP00000321800:W190X	W	+	2	0	FZR1	3482921	1.000000	0.71417	1.000000	0.80357	0.749000	0.42624	7.689000	0.84165	2.544000	0.85801	0.561000	0.74099	TGG	.	.		0.721	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
CATSPERD	257062	hgsc.bcm.edu	37	19	5778649	5778649	+	Missense_Mutation	SNP	C	C	T	rs373865922		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:5778649C>T	ENST00000381624.3	+	22	2420	c.2359C>T	c.(2359-2361)Cgc>Tgc	p.R787C	CATSPERD_ENST00000309164.7_3'UTR	NM_152784.3	NP_689997.3	Q86XM0	CTSRD_HUMAN	catsper channel auxiliary subunit delta	787					multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)											GCCCCCGGGACGCCACCGCAC	0.582																																					p.R787C		Atlas-SNP	.											.	.	.	.	0			c.C2359T						.	C	CYS/ARG	0,4240		0,0,2120	44.0	50.0	48.0		2359	-2.2	0.0	19		48	1,8451		0,1,4225	no	missense	TMEM146	NM_152784.3	180	0,1,6345	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	787/799	5778649	1,12691	2120	4226	6346	SO:0001583	missense	257062	exon22			CCGGGACGCCACC	BC043005	CCDS12149.2	19p13.3	2013-10-11	2012-02-22	2012-02-22	ENSG00000174898	ENSG00000174898			28598	protein-coding gene	gene with protein product			"""transmembrane protein 146"""	TMEM146		21224844	Standard	NM_152784		Approved	MGC39581	uc002mda.3	Q86XM0	OTTHUMG00000143036	ENST00000381624.3:c.2359C>T	chr19.hg19:g.5778649C>T	ENSP00000371037:p.Arg787Cys	184.0	0.0		140.0	10.0	NM_152784	Q6ZRP1	Missense_Mutation	SNP	ENST00000381624.3	hg19	CCDS12149.2	.	.	.	.	.	.	.	.	.	.	C	5.711	0.315605	0.10789	0.0	1.18E-4	ENSG00000174898	ENST00000381624;ENST00000381613	T	0.26373	1.74	1.09	-2.19	0.07015	.	.	.	.	.	T	0.11537	0.0281	L	0.29908	0.895	0.09310	N	1	P	0.46512	0.879	B	0.28553	0.091	T	0.13818	-1.0495	9	0.87932	D	0	.	5.3079	0.15813	0.4202:0.5798:0.0:0.0	.	787	Q86XM0	TM146_HUMAN	C	787;456	ENSP00000371037:R787C	ENSP00000371026:R456C	R	+	1	0	TMEM146	5729649	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	-0.438000	0.06905	-0.731000	0.04862	-0.410000	0.06199	CGC	.	.		0.582	CATSPERD-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000286953.2	NM_152784	
SH2D3A	10045	hgsc.bcm.edu	37	19	6755043	6755043	+	Silent	SNP	G	G	A	rs145201987		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:6755043G>A	ENST00000245908.6	-	5	1049	c.780C>T	c.(778-780)gcC>gcT	p.A260A	SH2D3A_ENST00000599563.1_5'UTR|SH2D3A_ENST00000437152.3_Silent_p.A138A	NM_005490.2	NP_005481.2	Q9BRG2	SH23A_HUMAN	SH2 domain containing 3A	260	Poly-Glu.				JNK cascade (GO:0007254)|positive regulation of signal transduction (GO:0009967)|small GTPase mediated signal transduction (GO:0007264)		guanyl-nucleotide exchange factor activity (GO:0005085)|SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|urinary_tract(1)	24						CATCCTCCTCGGCCTCCCACC	0.627																																					p.A260A		Atlas-SNP	.											.	SH2D3A	53	.	0			c.C780T						.	G		0,4406		0,0,2203	160.0	183.0	175.0		780	-9.1	0.0	19	dbSNP_134	175	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	SH2D3A	NM_005490.2		0,1,6501	AA,AG,GG		0.0116,0.0,0.0077		260/577	6755043	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	10045	exon5			CTCCTCGGCCTCC	AF124249	CCDS12173.1	19p13.3	2013-02-14	2002-01-14			ENSG00000125731		"""SH2 domain containing"""	16885	protein-coding gene	gene with protein product		604721	"""SH2 domain-containing 3A"""			10187783	Standard	NM_005490		Approved	NSP1	uc002mft.3	Q9BRG2		ENST00000245908.6:c.780C>T	chr19.hg19:g.6755043G>A		77.0	0.0		53.0	16.0	NM_005490	A8K9R6|B4DRS7|Q9Y2X4	Silent	SNP	ENST00000245908.6	hg19	CCDS12173.1																																																																																			.	G|1.000;A|0.000		0.627	SH2D3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458016.1	NM_005490	
ZNF729	100287226	hgsc.bcm.edu	37	19	22487545	22487545	+	Silent	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:22487545T>C	ENST00000601693.1	+	3	331	c.213T>C	c.(211-213)ccT>ccC	p.P71P	ZNF729_ENST00000357491.6_Silent_p.P71P			A6NN14	ZN729_HUMAN	zinc finger protein 729	71	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|lung(32)|ovary(3)	41						GGAAAGAGCCTTGGAATATGA	0.383																																					p.P71P		Atlas-SNP	.											.	ZNF729	78	.	0			c.T213C						.																																			SO:0001819	synonymous_variant	100287226	exon3			AGAGCCTTGGAAT		CCDS59368.1	19p12	2014-02-14			ENSG00000196350	ENSG00000196350		"""Zinc fingers, C2H2-type"", ""-"""	32464	protein-coding gene	gene with protein product							Standard	NM_001242680		Approved		uc021urs.1	A6NN14	OTTHUMG00000182938	ENST00000601693.1:c.213T>C	chr19.hg19:g.22487545T>C		129.0	0.0		115.0	5.0	NM_001242680	M0QY45	Silent	SNP	ENST00000601693.1	hg19	CCDS59368.1																																																																																			.	.		0.383	ZNF729-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464396.1	XM_496301	
DPY19L3	147991	hgsc.bcm.edu	37	19	32930029	32930029	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:32930029C>T	ENST00000342179.5	+	7	823	c.608C>T	c.(607-609)aCa>aTa	p.T203I	DPY19L3_ENST00000392250.2_Missense_Mutation_p.T203I|DPY19L3_ENST00000586987.1_Missense_Mutation_p.T203I	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	203						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					ATAGATACCACAAGAGTTGAG	0.378																																					p.T203I		Atlas-SNP	.											.	DPY19L3	70	.	0			c.C608T						.						178.0	172.0	174.0					19																	32930029		2203	4300	6503	SO:0001583	missense	147991	exon7			ATACCACAAGAGT		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.608C>T	chr19.hg19:g.32930029C>T	ENSP00000344937:p.Thr203Ile	88.0	0.0		117.0	23.0	NM_001172774	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	hg19	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.599513	0.87055	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179	T;T	0.59083	0.29;0.29	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.79335	0.4428	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80632	-0.1296	10	0.54805	T	0.06	-20.3538	19.4882	0.95039	0.0:1.0:0.0:0.0	.	203	Q6ZPD9	D19L3_HUMAN	I	203	ENSP00000376081:T203I;ENSP00000344937:T203I	ENSP00000315672:T203I	T	+	2	0	DPY19L3	37621869	1.000000	0.71417	0.974000	0.42286	0.996000	0.88848	7.601000	0.82783	2.618000	0.88619	0.563000	0.77884	ACA	.	.		0.378	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325	
RYR1	6261	hgsc.bcm.edu	37	19	38960049	38960049	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:38960049G>T	ENST00000359596.3	+	27	3661	c.3661G>T	c.(3661-3663)Ggc>Tgc	p.G1221C	RYR1_ENST00000360985.3_Missense_Mutation_p.G1221C|RYR1_ENST00000355481.4_Missense_Mutation_p.G1221C			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1221	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCTCCAGGAAGGCTTCGAGCC	0.602																																					p.G1221C		Atlas-SNP	.											.	RYR1	708	.	0			c.G3661T						.						149.0	141.0	144.0					19																	38960049		2203	4300	6503	SO:0001583	missense	6261	exon27			CAGGAAGGCTTCG	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3661G>T	chr19.hg19:g.38960049G>T	ENSP00000352608:p.Gly1221Cys	75.0	0.0		96.0	36.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	g	16.57	3.160975	0.57368	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98684	-5.06;-5.06;-5.07	3.48	3.48	0.39840	.	0.000000	0.64402	U	0.000008	D	0.98795	0.9594	M	0.68952	2.095	0.58432	D	0.999992	D;D	0.89917	1.0;1.0	D;D	0.83275	0.991;0.996	D	0.99525	1.0959	10	0.87932	D	0	.	14.86	0.70372	0.0:0.0:1.0:0.0	.	1221;1221	P21817-2;P21817	.;RYR1_HUMAN	C	1221	ENSP00000352608:G1221C;ENSP00000347667:G1221C;ENSP00000354254:G1221C	ENSP00000347667:G1221C	G	+	1	0	RYR1	43651889	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.278000	0.95766	1.816000	0.52996	0.434000	0.28630	GGC	.	.		0.602	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
GLTSCR1	29998	hgsc.bcm.edu	37	19	48185376	48185376	+	Silent	SNP	C	C	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:48185376C>G	ENST00000396720.3	+	7	2444	c.2250C>G	c.(2248-2250)ccC>ccG	p.P750P	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	750										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CTCAGGCCCCCGACAGCCAGG	0.746																																					p.P750P		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.C2250G						.						4.0	6.0	5.0					19																	48185376		1808	3914	5722	SO:0001819	synonymous_variant	29998	exon7			GGCCCCCGACAGC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.2250C>G	chr19.hg19:g.48185376C>G		97.0	0.0		115.0	20.0	NM_015711	A8MW01	Silent	SNP	ENST00000396720.3	hg19	CCDS46134.1																																																																																			.	.		0.746	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
IL4I1	259307	hgsc.bcm.edu	37	19	50397537	50397537	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:50397537C>A	ENST00000391826.2	-	5	697	c.555G>T	c.(553-555)atG>atT	p.M185I	IL4I1_ENST00000341114.3_Missense_Mutation_p.M207I|IL4I1_ENST00000595948.1_Missense_Mutation_p.M207I	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	185						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	GGTTGAGAGCCATCTGGTAGA	0.617																																					p.M207I		Atlas-SNP	.											.	IL4I1	50	.	0			c.G621T						.						92.0	89.0	90.0					19																	50397537		2203	4300	6503	SO:0001583	missense	259307	exon7			GAGAGCCATCTGG	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.555G>T	chr19.hg19:g.50397537C>A	ENSP00000375702:p.Met185Ile	71.0	0.0		82.0	23.0	NM_172374	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Missense_Mutation	SNP	ENST00000391826.2	hg19	CCDS12787.1	.	.	.	.	.	.	.	.	.	.	C	10.78	1.445856	0.25987	.	.	ENSG00000104951	ENST00000341114;ENST00000391826	D;D	0.92048	-2.96;-2.96	5.38	5.38	0.77491	Amine oxidase (1);	0.433635	0.28647	N	0.014620	D	0.89153	0.6634	L	0.54323	1.7	0.35942	D	0.833319	P;P;P	0.44521	0.804;0.837;0.837	B;B;B	0.38755	0.184;0.281;0.281	D	0.91209	0.4997	10	0.34782	T	0.22	-44.905	14.6045	0.68466	0.0:1.0:0.0:0.0	.	207;207;185	Q96RQ9-2;Q1WMJ3;Q96RQ9	.;.;OXLA_HUMAN	I	207;185	ENSP00000342557:M207I;ENSP00000375702:M185I	ENSP00000342557:M207I	M	-	3	0	IL4I1	55089349	1.000000	0.71417	1.000000	0.80357	0.754000	0.42855	0.759000	0.26461	2.521000	0.84997	0.491000	0.48974	ATG	.	.		0.617	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1		
KLK6	5653	hgsc.bcm.edu	37	19	51466671	51466671	+	Missense_Mutation	SNP	C	C	A	rs553226234		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:51466671C>A	ENST00000376851.3	-	4	771	c.332G>T	c.(331-333)cGc>cTc	p.R111L	KLK6_ENST00000376853.4_Intron|KLK6_ENST00000310157.2_Missense_Mutation_p.R111L|KLK6_ENST00000456750.2_Missense_Mutation_p.R4L|KLK6_ENST00000391808.1_Missense_Mutation_p.R4L|CTB-147C22.8_ENST00000601506.1_RNA|KLK6_ENST00000594641.1_Missense_Mutation_p.R111L	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	111	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		GCGTGCCAGGCGCAACAGCAT	0.617																																					p.R111L		Atlas-SNP	.											KLK6,NS,carcinoma,0,1	KLK6	35	.	0			c.G332T						.						90.0	64.0	73.0					19																	51466671		2203	4300	6503	SO:0001583	missense	5653	exon4			GCCAGGCGCAACA	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.332G>T	chr19.hg19:g.51466671C>A	ENSP00000366047:p.Arg111Leu	72.0	0.0		100.0	20.0	NM_001012964	A6NJA1|A8MW09|Q6H301	Missense_Mutation	SNP	ENST00000376851.3	hg19	CCDS12811.1	.	.	.	.	.	.	.	.	.	.	N	24.5	4.536267	0.85812	.	.	ENSG00000167755	ENST00000310157;ENST00000376851;ENST00000391808;ENST00000456750	D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58	4.69	-0.0942	0.13646	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.185873	0.26723	N	0.022831	D	0.88250	0.6386	L	0.61387	1.9	0.09310	N	1	D;P	0.56968	0.978;0.678	P;B	0.55222	0.771;0.071	T	0.79586	-0.1742	10	0.87932	D	0	.	3.6265	0.08114	0.1695:0.4454:0.0:0.3851	.	111;4	Q92876;Q92876-2	KLK6_HUMAN;.	L	111;111;4;4	ENSP00000309148:R111L;ENSP00000366047:R111L;ENSP00000375684:R4L;ENSP00000409241:R4L	ENSP00000309148:R111L	R	-	2	0	KLK6	56158483	0.093000	0.21703	0.396000	0.26296	0.892000	0.51952	0.379000	0.20585	0.178000	0.19917	0.486000	0.48141	CGC	.	.		0.617	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
ZNF616	90317	hgsc.bcm.edu	37	19	52618477	52618477	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr19:52618477T>C	ENST00000600228.1	-	4	2201	c.1940A>G	c.(1939-1941)cAt>cGt	p.H647R	ZNF616_ENST00000330123.5_3'UTR	NM_178523.3	NP_848618.2	Q08AN1	ZN616_HUMAN	zinc finger protein 616	647					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(14)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		AAGTCTAAGATGGACACGCTG	0.423																																					p.H647R		Atlas-SNP	.											.	ZNF616	109	.	0			c.A1940G						.						123.0	116.0	118.0					19																	52618477		2203	4300	6503	SO:0001583	missense	90317	exon4			CTAAGATGGACAC	AK092266	CCDS33090.1	19q13.41	2013-01-08				ENSG00000204611		"""Zinc fingers, C2H2-type"", ""-"""	28062	protein-coding gene	gene with protein product							Standard	NM_178523		Approved	MGC45556	uc002pym.3	Q08AN1		ENST00000600228.1:c.1940A>G	chr19.hg19:g.52618477T>C	ENSP00000471000:p.His647Arg	96.0	0.0		107.0	11.0	NM_178523	B3KRV1|Q0P658|Q658V7	Missense_Mutation	SNP	ENST00000600228.1	hg19	CCDS33090.1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.549047	0.00926	.	.	ENSG00000204611	ENST00000330123	.	.	.	1.93	-1.05	0.10036	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24431	0.0592	L	0.41027	1.25	0.09310	N	1	B	0.16396	0.017	B	0.10450	0.005	T	0.24621	-1.0155	8	0.17369	T	0.5	.	0.6266	0.00787	0.1979:0.1454:0.2006:0.456	.	647	Q08AN1	ZN616_HUMAN	R	647	.	ENSP00000328722:H647R	H	-	2	0	ZNF616	57310289	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.579000	0.05834	-0.006000	0.14370	-0.686000	0.03744	CAT	.	.		0.423	ZNF616-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462451.1	XM_030892	
MYH7B	57644	hgsc.bcm.edu	37	20	33575452	33575452	+	Missense_Mutation	SNP	G	G	A	rs371353626		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr20:33575452G>A	ENST00000262873.7	+	15	1458	c.1366G>A	c.(1366-1368)Gtg>Atg	p.V456M	MIR499A_ENST00000384903.1_RNA	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	414	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GAACGAGTACGTGACCAAGGG	0.662																																					p.V456M		Atlas-SNP	.											.	MYH7B	145	.	0			c.G1366A						.	G	MET/VAL	0,4150		0,0,2075	98.0	108.0	105.0		1366	3.5	1.0	20		105	1,8409		0,1,4204	no	missense	MYH7B	NM_020884.3	21	0,1,6279	AA,AG,GG		0.0119,0.0,0.0080	probably-damaging	456/1984	33575452	1,12559	2075	4205	6280	SO:0001583	missense	57644	exon17			GAGTACGTGACCA	AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.1366G>A	chr20.hg19:g.33575452G>A	ENSP00000262873:p.Val456Met	167.0	0.0		132.0	27.0	NM_020884	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	ENST00000262873.7	hg19	CCDS42869.1	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632777	0.67015	0.0	1.19E-4	ENSG00000078814	ENST00000262873	D	0.90324	-2.65	3.53	3.53	0.40419	Myosin head, motor domain (2);	0.000000	0.32624	N	0.005849	D	0.95674	0.8593	M	0.93197	3.39	0.53688	D	0.999977	D	0.60160	0.987	P	0.58660	0.843	D	0.97087	0.9788	10	0.87932	D	0	.	16.3928	0.83545	0.0:0.0:1.0:0.0	.	414	A7E2Y1	MYH7B_HUMAN	M	456	ENSP00000262873:V456M	ENSP00000262873:V456M	V	+	1	0	MYH7B	33039113	1.000000	0.71417	0.983000	0.44433	0.774000	0.43823	4.655000	0.61476	2.279000	0.76181	0.561000	0.74099	GTG	.	.		0.662	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000078833.2	NM_020884	
TOX2	84969	hgsc.bcm.edu	37	20	42697300	42697300	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr20:42697300A>T	ENST00000358131.5	+	8	1649	c.1441A>T	c.(1441-1443)Agg>Tgg	p.R481W	TOX2_ENST00000341197.4_Missense_Mutation_p.R499W|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000372999.1_Missense_Mutation_p.R457W|TOX2_ENST00000423191.2_Missense_Mutation_p.R457W	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	481					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCTGCTCCCCAGGGACAAATC	0.627																																					p.R499W		Atlas-SNP	.											.	TOX2	158	.	0			c.A1495T						.						187.0	141.0	157.0					20																	42697300		2203	4300	6503	SO:0001583	missense	84969	exon9			CTCCCCAGGGACA	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1441A>T	chr20.hg19:g.42697300A>T	ENSP00000350849:p.Arg481Trp	107.0	0.0		78.0	16.0	NM_001098797	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Missense_Mutation	SNP	ENST00000358131.5	hg19	CCDS42875.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.129675	0.77549	.	.	ENSG00000124191	ENST00000341197;ENST00000423191;ENST00000372999;ENST00000358131;ENST00000435864	T;T;T;T;T	0.38560	1.59;1.63;1.63;1.35;1.13	5.05	5.05	0.67936	.	0.133094	0.33732	N	0.004601	T	0.61464	0.2349	M	0.61703	1.905	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.993	D;D;D;P	0.85130	0.997;0.997;0.99;0.849	T	0.65413	-0.6174	10	0.87932	D	0	.	13.9946	0.64388	1.0:0.0:0.0:0.0	.	377;499;481;457	B4DQV8;G3XAC7;Q96NM4;E1P5X0	.;.;TOX2_HUMAN;.	W	499;457;457;481;377	ENSP00000344724:R499W;ENSP00000390278:R457W;ENSP00000362090:R457W;ENSP00000350849:R481W;ENSP00000396777:R377W	ENSP00000344724:R499W	R	+	1	2	TOX2	42130714	1.000000	0.71417	1.000000	0.80357	0.573000	0.36030	3.545000	0.53648	1.900000	0.55004	0.533000	0.62120	AGG	.	.		0.627	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2		
NPEPL1	79716	hgsc.bcm.edu	37	20	57276110	57276110	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr20:57276110G>T	ENST00000356091.6	+	6	1006	c.718G>T	c.(718-720)Gcc>Tcc	p.A240S	NPEPL1_ENST00000525967.1_Missense_Mutation_p.A212S|NPEPL1_ENST00000525817.1_Missense_Mutation_p.A192S|STX16-NPEPL1_ENST00000530122.1_3'UTR	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1	240						cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			GCATCCCCCAGCCCTGGCCGT	0.622																																					p.A240S		Atlas-SNP	.											.	NPEPL1	36	.	0			c.G718T						.						21.0	24.0	23.0					20																	57276110		1988	4150	6138	SO:0001583	missense	79716	exon6			CCCCCAGCCCTGG	AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060	ENST00000356091.6:c.718G>T	chr20.hg19:g.57276110G>T	ENSP00000348395:p.Ala240Ser	111.0	0.0		146.0	7.0	NM_024663	A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	Missense_Mutation	SNP	ENST00000356091.6	hg19	CCDS46621.1	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187283	0.57909	.	.	ENSG00000215440	ENST00000525967;ENST00000525817;ENST00000356091	T;T;T	0.42513	0.97;0.97;0.97	5.11	5.11	0.69529	Peptidase M17, leucyl aminopeptidase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.65407	0.2688	M	0.77406	2.37	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.988;0.979;0.997;0.996	T	0.67138	-0.5746	10	0.46703	T	0.11	-16.1524	15.6983	0.77517	0.0:0.0:1.0:0.0	.	240;192;212;240	Q8NDH3;G5EA34;E9PN47;Q8NDH3-3	PEPL1_HUMAN;.;.;.	S	212;192;240	ENSP00000434810:A212S;ENSP00000437112:A192S;ENSP00000348395:A240S	ENSP00000348395:A240S	A	+	1	0	NPEPL1	56709517	1.000000	0.71417	0.113000	0.21522	0.023000	0.10783	9.375000	0.97178	2.365000	0.80145	0.655000	0.94253	GCC	.	.		0.622	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080402.6	NM_024663	
COL9A3	1299	hgsc.bcm.edu	37	20	61453479	61453479	+	Missense_Mutation	SNP	C	C	T	rs373399710		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr20:61453479C>T	ENST00000343916.3	+	9	443	c.440C>T	c.(439-441)cCc>cTc	p.P147L		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	147	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					TCTGGACTCCCCGGCCTCCCT	0.647																																					p.P147L		Atlas-SNP	.											.	COL9A3	70	.	0			c.C440T						.						61.0	65.0	63.0					20																	61453479		2203	4299	6502	SO:0001583	missense	1299	exon9			GACTCCCCGGCCT	AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.440C>T	chr20.hg19:g.61453479C>T	ENSP00000341640:p.Pro147Leu	319.0	0.0		406.0	73.0	NM_001853	Q13681|Q9H4G9|Q9UPE2	Missense_Mutation	SNP	ENST00000343916.3	hg19	CCDS13505.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.863005	0.32884	.	.	ENSG00000092758	ENST00000343916;ENST00000452372;ENST00000537652	D;D	0.96885	-4.16;-3.08	5.18	5.18	0.71444	.	0.000000	0.85682	U	0.000000	D	0.97851	0.9294	M	0.85041	2.73	0.80722	D	1	D	0.71674	0.998	D	0.67900	0.954	D	0.97905	1.0305	10	0.51188	T	0.08	.	13.0729	0.59072	0.0:0.8382:0.1618:0.0	.	147	Q14050	CO9A3_HUMAN	L	147;110;110	ENSP00000341640:P147L;ENSP00000394280:P110L	ENSP00000341640:P147L	P	+	2	0	COL9A3	60923924	0.367000	0.25023	0.871000	0.34182	0.232000	0.25224	1.840000	0.39230	2.412000	0.81896	0.591000	0.81541	CCC	.	.		0.647	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080071.2	NM_001853	
BCL2L13	23786	hgsc.bcm.edu	37	22	18171844	18171844	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr22:18171844G>C	ENST00000317582.5	+	4	669	c.322G>C	c.(322-324)Gga>Cga	p.G108R	BCL2L13_ENST00000399782.1_Missense_Mutation_p.G108R|BCL2L13_ENST00000337612.5_Intron|BCL2L13_ENST00000543133.1_Intron|BCL2L13_ENST00000418951.2_3'UTR|BCL2L13_ENST00000493680.1_Missense_Mutation_p.G108R|BCL2L13_ENST00000538149.1_Intron|BCL2L13_ENST00000355028.3_Missense_Mutation_p.G108R	NM_015367.3	NP_056182.2	Q9BXK5	B2L13_HUMAN	BCL2-like 13 (apoptosis facilitator)	108					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			breast(2)|central_nervous_system(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(3)|urinary_tract(2)	15		all_epithelial(15;0.123)		Lung(27;0.199)		GGCCCATCTTGGAGAAAAAGT	0.493																																					p.G132R		Atlas-SNP	.											.	BCL2L13	27	.	0			c.G394C						.						97.0	86.0	90.0					22																	18171844		2203	4300	6503	SO:0001583	missense	23786	exon3			CATCTTGGAGAAA	AF146568	CCDS13746.1, CCDS59447.1, CCDS59448.1, CCDS74810.1, CCDS74811.1, CCDS74812.1, CCDS74813.1, CCDS74814.1	22q11	2014-03-07			ENSG00000099968	ENSG00000099968			17164	protein-coding gene	gene with protein product						11262395, 11381032	Standard	NM_015367		Approved	MIL1, BCL-RAMBO	uc002zmw.4	Q9BXK5	OTTHUMG00000150088	ENST00000317582.5:c.322G>C	chr22.hg19:g.18171844G>C	ENSP00000318883:p.Gly108Arg	124.0	0.0		121.0	6.0	NM_001270726	B3KPE7|Q96B37|Q96IB7|Q9BY01|Q9HC05|Q9UFE0|Q9UKN3	Missense_Mutation	SNP	ENST00000317582.5	hg19	CCDS13746.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546642	0.86022	.	.	ENSG00000099968	ENST00000399782;ENST00000317582;ENST00000493680;ENST00000355028	T;T;T;T	0.10860	2.83;2.83;2.83;2.83	5.7	5.7	0.88788	Apoptosis regulator, Bcl2-like (1);Apoptosis regulator, Bcl-2, BH (2);	0.054761	0.64402	D	0.000001	T	0.32734	0.0839	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.991;0.997;0.995	T	0.01143	-1.1438	10	0.72032	D	0.01	-19.6057	14.6525	0.68808	0.0:0.0:0.8547:0.1453	.	108;108;108	E9PDD6;Q9BXK5;Q9BXK5-2	.;B2L13_HUMAN;.	R	108	ENSP00000382682:G108R;ENSP00000318883:G108R;ENSP00000434764:G108R;ENSP00000347133:G108R	ENSP00000318883:G108R	G	+	1	0	BCL2L13	16551844	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.897000	0.75671	2.683000	0.91414	0.650000	0.86243	GGA	.	.		0.493	BCL2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316184.1	NM_015367	
PIWIL3	440822	hgsc.bcm.edu	37	22	25144937	25144937	+	Silent	SNP	G	G	T			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr22:25144937G>T	ENST00000332271.5	-	12	1802	c.1386C>A	c.(1384-1386)acC>acA	p.T462T	PIWIL3_ENST00000527701.1_Silent_p.T353T|PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_Silent_p.T353T	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	462					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						ACAAAAAATTGGTATCAAATT	0.353																																					p.T462T		Atlas-SNP	.											.	PIWIL3	115	.	0			c.C1386A						.						95.0	91.0	93.0					22																	25144937		2202	4300	6502	SO:0001819	synonymous_variant	440822	exon12			AAAATTGGTATCA	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.1386C>A	chr22.hg19:g.25144937G>T		84.0	0.0		68.0	7.0	NM_001008496		Silent	SNP	ENST00000332271.5	hg19	CCDS33623.1																																																																																			.	.		0.353	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
MYO18B	84700	hgsc.bcm.edu	37	22	26222449	26222449	+	Silent	SNP	G	G	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr22:26222449G>C	ENST00000407587.2	+	14	2938	c.2769G>C	c.(2767-2769)gtG>gtC	p.V923V	MYO18B_ENST00000536101.1_Silent_p.V923V|MYO18B_ENST00000335473.7_Silent_p.V923V			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	923	Myosin motor.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TTGCGGCTGTGGTCTCACTCA	0.542																																					p.V923V		Atlas-SNP	.											.	MYO18B	322	.	0			c.G2769C						.						164.0	157.0	159.0					22																	26222449		1959	4155	6114	SO:0001819	synonymous_variant	84700	exon14			GGCTGTGGTCTCA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.2769G>C	chr22.hg19:g.26222449G>C		91.0	0.0		92.0	15.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Silent	SNP	ENST00000407587.2	hg19																																																																																				.	.		0.542	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
TUBGCP6	85378	hgsc.bcm.edu	37	22	50664306	50664306	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr22:50664306T>C	ENST00000248846.5	-	10	2004	c.1900A>G	c.(1900-1902)Aag>Gag	p.K634E	TUBGCP6_ENST00000439308.2_Missense_Mutation_p.K634E|TUBGCP6_ENST00000491449.1_5'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	634					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TCAATCTCCTTCAACTCCTCA	0.597																																					p.K634E		Atlas-SNP	.											.	TUBGCP6	132	.	0			c.A1900G						.						76.0	70.0	72.0					22																	50664306		2203	4300	6503	SO:0001583	missense	85378	exon10			TCTCCTTCAACTC	AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.1900A>G	chr22.hg19:g.50664306T>C	ENSP00000248846:p.Lys634Glu	116.0	0.0		89.0	6.0	NM_020461	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	ENST00000248846.5	hg19	CCDS14087.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.939131	0.73557	.	.	ENSG00000128159	ENST00000248846;ENST00000439308	T;T	0.12879	2.98;2.64	5.19	5.19	0.71726	.	0.832577	0.11242	N	0.584580	T	0.22205	0.0535	L	0.47716	1.5	0.40156	D	0.977009	P;P	0.40282	0.711;0.649	P;B	0.46917	0.531;0.336	T	0.01914	-1.1248	10	0.33141	T	0.24	.	15.0451	0.71822	0.0:0.0:0.0:1.0	.	634;634	B2RWN4;Q96RT7	.;GCP6_HUMAN	E	634	ENSP00000248846:K634E;ENSP00000397387:K634E	ENSP00000248846:K634E	K	-	1	0	TUBGCP6	49006433	1.000000	0.71417	1.000000	0.80357	0.763000	0.43281	4.445000	0.60007	1.967000	0.57214	0.379000	0.24179	AAG	.	.		0.597	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075004.3	NM_020461	
RBM10	8241	hgsc.bcm.edu	37	X	47030585	47030585	+	Missense_Mutation	SNP	T	T	G	rs377667483		TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chrX:47030585T>G	ENST00000377604.3	+	4	1102	c.360T>G	c.(358-360)gaT>gaG	p.D120E	RBM10_ENST00000329236.7_Intron|RBM10_ENST00000345781.6_Intron	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	120	Poly-Glu.				3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						aggaggaggatgaggaggagg	0.667													T|||	2	0.000529801	0.0	0.0	3775	,	,		8316	0.002		0.0	False		,,,				2504	0.0				p.D185E	Melanoma(171;120 2705 19495 39241)	Atlas-SNP	.											.	RBM10	117	.	0			c.T555G						.						20.0	19.0	20.0					X																	47030585		2202	4297	6499	SO:0001583	missense	8241	exon4			GGAGGATGAGGAG	U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.360T>G	chrX.hg19:g.47030585T>G	ENSP00000366829:p.Asp120Glu	54.0	0.0		72.0	5.0	NM_001204468	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Missense_Mutation	SNP	ENST00000377604.3	hg19	CCDS14274.1	.	.	.	.	.	.	.	.	.	.	T	1.034	-0.680868	0.03353	.	.	ENSG00000182872	ENST00000377604	T	0.10960	2.82	2.89	-2.28	0.06826	Nucleotide-binding, alpha-beta plait (1);	0.397395	0.18197	N	0.148658	T	0.03783	0.0107	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.49153	-0.8969	10	0.02654	T	1	-3.1034	10.6013	0.45369	0.0:0.0:0.7699:0.2301	.	185;120;120	Q7Z3D7;P98175-2;P98175	.;.;RBM10_HUMAN	E	120	ENSP00000366829:D120E	ENSP00000366829:D120E	D	+	3	2	RBM10	46915529	0.996000	0.38824	0.881000	0.34555	0.930000	0.56654	-0.096000	0.11059	-0.655000	0.05387	-0.549000	0.04216	GAT	.	.		0.667	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056381.1	NM_005676	
PCDH11X	27328	hgsc.bcm.edu	37	X	91137937	91137937	+	Intron	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chrX:91137937G>A	ENST00000373094.1	+	2	3878				PCDH11X_ENST00000504220.2_Intron|PCDH11X_ENST00000406881.1_Intron|PCDH11X_ENST00000361655.2_Intron|PCDH11X_ENST00000298274.8_Intron|PCDH11X_ENST00000395337.2_Missense_Mutation_p.C1022Y|PCDH11X_ENST00000373097.1_Intron|PCDH11X_ENST00000373088.1_Intron	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked						homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ATTGAAATCTGCAGTGAGATA	0.328																																					p.C1022Y	NSCLC(38;925 1092 2571 38200 45895)	Atlas-SNP	.											.	PCDH11X	714	.	0			c.G3065A						.						154.0	137.0	143.0					X																	91137937		2203	4300	6503	SO:0001627	intron_variant	27328	exon6			AAATCTGCAGTGA	AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3033+3665G>A	chrX.hg19:g.91137937G>A		421.0	1.0		460.0	271.0	NM_032967	A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	ENST00000373094.1	hg19	CCDS14461.1	.	.	.	.	.	.	.	.	.	.	G	4.232	0.041892	0.08196	.	.	ENSG00000102290	ENST00000395337	T	0.52754	0.65	3.42	0.464	0.16706	.	.	.	.	.	T	0.22003	0.0530	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10382	-1.0632	8	0.11182	T	0.66	.	2.3067	0.04176	0.3074:0.0:0.4504:0.2421	.	1022	Q9BZA7-2	.	Y	1022	ENSP00000378746:C1022Y	ENSP00000378746:C1022Y	C	+	2	0	PCDH11X	91024593	1.000000	0.71417	0.998000	0.56505	0.335000	0.28730	1.212000	0.32394	-0.030000	0.13804	-0.365000	0.07479	TGC	.	.		0.328	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057436.1	NM_032969	
GLA	2717	hgsc.bcm.edu	37	X	100662799	100662799	+	Silent	SNP	T	T	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chrX:100662799T>A	ENST00000218516.3	-	1	114	c.93A>T	c.(91-93)gcA>gcT	p.A31A	RPL36A-HNRNPH2_ENST00000409170.3_Intron|GLA_ENST00000479445.1_5'UTR|HNRNPH2_ENST00000316594.5_5'Flank	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	31			A -> V (in FD). {ECO:0000269|PubMed:15712228, ECO:0000269|PubMed:9100224}.		glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CATTGTCCAGTGCTCTAGCCC	0.592																																					p.A31A	Colon(193;776 2816 31189 44474)	Atlas-SNP	.											.	GLA	43	.	0			c.A93T						.						99.0	98.0	98.0					X																	100662799		2203	4300	6503	SO:0001819	synonymous_variant	2717	exon1			GTCCAGTGCTCTA	X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.93A>T	chrX.hg19:g.100662799T>A		140.0	0.0		222.0	12.0	NM_000169	Q6LER7	Silent	SNP	ENST00000218516.3	hg19	CCDS14484.1																																																																																			.	.		0.592	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057540.1		
IGSF1	3547	hgsc.bcm.edu	37	X	130420435	130420435	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chrX:130420435T>G	ENST00000361420.3	-	3	152	c.73A>C	c.(73-75)Atg>Ctg	p.M25L	IGSF1_ENST00000370900.1_Missense_Mutation_p.M25L|IGSF1_ENST00000370901.4_Missense_Mutation_p.M25L|IGSF1_ENST00000370910.1_Intron|IGSF1_ENST00000370904.1_Intron|IGSF1_ENST00000370903.3_Missense_Mutation_p.M25L			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	25					regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						CCCAGACTCATCCCTGAAAAG	0.498																																					p.M25L		Atlas-SNP	.											.	IGSF1	231	.	0			c.A73C						.						128.0	100.0	109.0					X																	130420435		2203	4300	6503	SO:0001583	missense	3547	exon3			GACTCATCCCTGA	AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.73A>C	chrX.hg19:g.130420435T>G	ENSP00000355010:p.Met25Leu	73.0	0.0		109.0	5.0	NM_001555	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	ENST00000361420.3	hg19	CCDS14629.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.518450	0.00967	.	.	ENSG00000147255	ENST00000361420;ENST00000370903;ENST00000370901;ENST00000370900	T;T;T;T	0.00585	6.39;6.39;6.8;6.8	4.15	1.31	0.21738	.	.	.	.	.	T	0.00271	0.0008	N	0.02539	-0.55	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.40608	-0.9554	9	0.02654	T	1	.	4.2705	0.10783	0.1161:0.0:0.4603:0.4236	.	25;25	Q8N6C5-3;Q8N6C5	.;IGSF1_HUMAN	L	25	ENSP00000355010:M25L;ENSP00000359940:M25L;ENSP00000359938:M25L;ENSP00000359937:M25L	ENSP00000355010:M25L	M	-	1	0	IGSF1	130248116	0.999000	0.42202	0.718000	0.30602	0.521000	0.34408	0.283000	0.18846	0.140000	0.18849	-0.269000	0.10298	ATG	.	.		0.498	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058288.1		
ARHGAP4	393	hgsc.bcm.edu	37	X	153173335	153173335	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chrX:153173335T>A	ENST00000350060.5	-	22	2730	c.2689A>T	c.(2689-2691)Acc>Tcc	p.T897S	ARHGAP4_ENST00000537206.1_Missense_Mutation_p.T874S|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.T876S|ARHGAP4_ENST00000370028.3_Missense_Mutation_p.T937S|ARHGAP4_ENST00000393721.1_Missense_Mutation_p.T719S|ARHGAP4_ENST00000467421.1_5'Flank	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	897					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGAGAGGTGGTAGATGCTGGC	0.647																																					p.T937S		Atlas-SNP	.											.	ARHGAP4	103	.	0			c.A2809T						.						48.0	53.0	52.0					X																	153173335		2203	4299	6502	SO:0001583	missense	393	exon23			AGGTGGTAGATGC	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2689A>T	chrX.hg19:g.153173335T>A	ENSP00000203786:p.Thr897Ser	139.0	0.0		114.0	12.0	NM_001164741	Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	hg19	CCDS14736.1	.	.	.	.	.	.	.	.	.	.	c	11.70	1.716606	0.30413	.	.	ENSG00000089820	ENST00000393721;ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206	T;T;T;T;T	0.10382	2.88;2.89;2.89;2.88;2.89	4.33	-5.22	0.02806	.	.	.	.	.	T	0.05502	0.0145	N	0.24115	0.695	0.09310	N	1	B;B	0.12630	0.006;0.006	B;B	0.15870	0.014;0.014	T	0.45687	-0.9244	9	0.15952	T	0.53	.	7.2357	0.26067	0.0:0.3153:0.2472:0.4375	.	937;897	Q86UY3;P98171	.;RHG04_HUMAN	S	719;937;897;876;874	ENSP00000377322:T719S;ENSP00000359045:T937S;ENSP00000203786:T897S;ENSP00000359033:T876S;ENSP00000444169:T874S	ENSP00000203786:T897S	T	-	1	0	ARHGAP4	152826529	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-0.210000	0.09345	-0.760000	0.04677	-0.283000	0.09986	ACC	.	.		0.647	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	
ARHGAP4	393	hgsc.bcm.edu	37	X	153173337	153173337	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chrX:153173337G>A	ENST00000350060.5	-	22	2728	c.2687C>T	c.(2686-2688)tCt>tTt	p.S896F	ARHGAP4_ENST00000537206.1_Missense_Mutation_p.S873F|ARHGAP4_ENST00000370016.1_Missense_Mutation_p.S875F|ARHGAP4_ENST00000370028.3_Missense_Mutation_p.S936F|ARHGAP4_ENST00000393721.1_Missense_Mutation_p.S718F|ARHGAP4_ENST00000467421.1_5'Flank	NM_001666.4	NP_001657.3	P98171	RHG04_HUMAN	Rho GTPase activating protein 4	896					apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|negative regulation of axon extension (GO:0030517)|negative regulation of fibroblast migration (GO:0010764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of signal transduction (GO:0009967)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)	Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.S896C(1)|p.S936C(1)		central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	14	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGAGGTGGTAGATGCTGGCCC	0.652																																					p.S936F		Atlas-SNP	.											.	ARHGAP4	103	.	2	Substitution - Missense(2)	lung(2)	c.C2807T						.						50.0	54.0	53.0					X																	153173337		2203	4300	6503	SO:0001583	missense	393	exon23			GTGGTAGATGCTG	X78817	CCDS14736.1, CCDS55540.1	Xq28	2010-02-09			ENSG00000089820	ENSG00000089820		"""Rho GTPase activating proteins"""	674	protein-coding gene	gene with protein product	"""Rho-GAP hematopoietic protein C1"""	300023				8570618	Standard	NM_001666		Approved	KIAA0131, C1, p115, RhoGAP4, SrGAP4	uc004fjk.2	P98171	OTTHUMG00000024226	ENST00000350060.5:c.2687C>T	chrX.hg19:g.153173337G>A	ENSP00000203786:p.Ser896Phe	144.0	0.0		115.0	8.0	NM_001164741	Q14144|Q86UY3	Missense_Mutation	SNP	ENST00000350060.5	hg19	CCDS14736.1	.	.	.	.	.	.	.	.	.	.	g	13.04	2.117537	0.37339	.	.	ENSG00000089820	ENST00000393721;ENST00000370028;ENST00000350060;ENST00000370016;ENST00000537206	T;T;T;T;T	0.11930	2.73;2.73;2.73;2.73;2.73	4.01	3.14	0.36123	.	1.074070	0.07411	N	0.892394	T	0.11495	0.0280	N	0.19112	0.55	0.09310	N	1	P;B	0.37955	0.612;0.303	B;B	0.37833	0.259;0.172	T	0.36359	-0.9751	10	0.59425	D	0.04	.	10.2604	0.43423	0.1043:0.0:0.8957:0.0	.	936;896	Q86UY3;P98171	.;RHG04_HUMAN	F	718;936;896;875;873	ENSP00000377322:S718F;ENSP00000359045:S936F;ENSP00000203786:S896F;ENSP00000359033:S875F;ENSP00000444169:S873F	ENSP00000203786:S896F	S	-	2	0	ARHGAP4	152826531	0.005000	0.15991	0.000000	0.03702	0.015000	0.08874	1.381000	0.34362	0.549000	0.28973	0.513000	0.50165	TCT	.	.		0.652	ARHGAP4-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061119.1	NM_001666	
IGF2	3481	hgsc.bcm.edu	37	11	2154351	2154351	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:2154351delG	ENST00000416167.2	-	4	1575	c.409delC	c.(409-411)cgcfs	p.R138fs	IGF2_ENST00000434045.2_Frame_Shift_Del_p.R194fs|IGF2_ENST00000381395.1_Frame_Shift_Del_p.R138fs|IGF2_ENST00000300632.5_Frame_Shift_Del_p.R138fs|IGF2_ENST00000381392.1_Frame_Shift_Del_p.R141fs|IGF2_ENST00000381406.4_Frame_Shift_Del_p.R141fs|IGF2_ENST00000418738.2_Frame_Shift_Del_p.R138fs|IGF2_ENST00000381389.1_Frame_Shift_Del_p.R138fs|MIR483_ENST00000385070.1_RNA			P01344	IGF2_HUMAN	insulin-like growth factor 2	138					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|exocrine pancreas development (GO:0031017)|female pregnancy (GO:0007565)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|memory (GO:0007613)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of catalytic activity (GO:0043085)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nicotine (GO:0035094)|response to nutrient levels (GO:0031667)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|striated muscle cell differentiation (GO:0051146)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	growth factor activity (GO:0008083)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protein serine/threonine kinase activator activity (GO:0043539)|receptor activator activity (GO:0030546)			central_nervous_system(1)|kidney(1)|lung(1)|pancreas(1)|skin(1)|urinary_tract(1)	6		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		TGACCCCGGCGGGCACGCAGG	0.667																																					p.R193fs		Atlas-INDEL	.											.	IGF2	54	.	0			c.578delG						.						33.0	33.0	33.0					11																	2154351		2201	4298	6499	SO:0001589	frameshift_variant	3481	exon5			.	M29645, AK025719	CCDS7728.1, CCDS44517.1	11p15.5	2014-09-16	2014-09-16		ENSG00000167244	ENSG00000167244			5466	protein-coding gene	gene with protein product	"""somatomedin A"""	147470	"""chromosome 11 open reading frame 43"""	C11orf43		2450353, 3167054	Standard	NM_000612		Approved	FLJ44734, IGF-II	uc009ydf.3	P01344	OTTHUMG00000009395	ENST00000416167.2:c.409delC	chr11.hg19:g.2154351delG	ENSP00000414497:p.Arg138fs	185.0	0.0		147.0	32.0	NM_001127598	B3KX48|B7WP08|C9JAF2|E3UN45|P78449|Q14299|Q1WM26|Q9UC68|Q9UC69	Frame_Shift_Del	DEL	ENST00000416167.2	hg19	CCDS7728.1																																																																																			.	.		0.667	IGF2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026053.2	NM_000612	
MRPL49	740	hgsc.bcm.edu	37	11	64888473	64888473	+	5'Flank	DEL	C	C	-			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr11:64888473delC	ENST00000279242.2	+	0	0				MRPL49_ENST00000526171.1_5'Flank|FAU_ENST00000525297.1_Frame_Shift_Del_p.V51fs|FAU_ENST00000527548.1_Frame_Shift_Del_p.V86fs|FAU_ENST00000529259.1_3'UTR|FAU_ENST00000529639.1_Frame_Shift_Del_p.V86fs|MRPL49_ENST00000534078.1_5'Flank|FAU_ENST00000531743.1_Frame_Shift_Del_p.V86fs|FAU_ENST00000279259.3_Intron|MRPL49_ENST00000531705.1_5'Flank	NM_004927.3	NP_004918.1	Q13405	RM49_HUMAN	mitochondrial ribosomal protein L49						translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			endometrium(1)|ovary(1)	2						TGACCTCTCACTTTTCCAGCA	0.512																																					p.V86fs		Atlas-INDEL	.											.	FAU	17	.	0			c.257delT						.						220.0	216.0	217.0					11																	64888473		2201	4297	6498	SO:0001631	upstream_gene_variant	2197	exon4			.		CCDS8096.1	11q13.1	2012-11-14	2001-10-16	2001-10-19	ENSG00000149792	ENSG00000149792		"""Mitochondrial ribosomal proteins / large subunits"""	1176	protein-coding gene	gene with protein product	"""neighbor of FAU"", ""next to FAU"""	606866	"""chromosome 11 open reading frame 4"""	C11orf4		8786148	Standard	NM_004927		Approved	NOF, NOF1, L49mt	uc001oda.2	Q13405	OTTHUMG00000165608		chr11.hg19:g.64888473delC	Exception_encountered	145.0	0.0		119.0	15.0	NM_001997	B2R4G6	Frame_Shift_Del	DEL	ENST00000279242.2	hg19	CCDS8096.1																																																																																			.	.		0.512	MRPL49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385293.1	NM_004927	
VIPAS39	63894	hgsc.bcm.edu	37	14	77919642	77919642	+	Splice_Site	DEL	T	T	-			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr14:77919642delT	ENST00000553888.1	-	3	706	c.196delA	c.(196-198)agt>gt	p.S66fs	VIPAS39_ENST00000557658.1_Splice_Site_p.S66fs|VIPAS39_ENST00000327028.4_Splice_Site_p.S66fs|VIPAS39_ENST00000343765.2_Splice_Site_p.S66fs|VIPAS39_ENST00000448935.2_Splice_Site_p.S66fs|VIPAS39_ENST00000556412.1_Splice_Site_p.S92fs	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	66					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											TTCTACTTACTTCCCACAGGT	0.498																																					.		Atlas-INDEL	.											.	.	.	.	0			c.196+1A>-						.						268.0	263.0	265.0					14																	77919642		2203	4300	6503	SO:0001630	splice_region_variant	63894	exon4			.	AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.196+1A>-	chr14.hg19:g.77919642delT		86.0	0.0		72.0	27.0	NM_001193316	B4DPI6|O95434|Q9H7E1|Q9H9I9	Splice_Site	DEL	ENST00000553888.1	hg19	CCDS9862.1																																																																																			.	.		0.498	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414008.1	NM_022067	Frame_Shift_Del
PTPN3	5774	hgsc.bcm.edu	37	9	112151605	112151606	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-DD-AAVV-01A-11D-A40R-10	TCGA-DD-AAVV-10A-01D-A40U-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9d4bac19-b9ce-4a48-8dad-da0dd93ff952	332d7d8c-8386-44c8-8720-3e2ba050cbdf	g.chr9:112151605_112151606delGG	ENST00000374541.2	-	22	2264_2265	c.2160_2161delCC	c.(2158-2163)cccctgfs	p.L721fs	PTPN3_ENST00000497739.1_5'UTR|PTPN3_ENST00000446349.1_Frame_Shift_Del_p.L545fs|PTPN3_ENST00000412145.1_Frame_Shift_Del_p.L590fs|PTPN3_ENST00000262539.3_Frame_Shift_Del_p.L567fs|PTPN3_ENST00000394827.3_Frame_Shift_Del_p.L189fs	NM_001145368.1|NM_002829.3	NP_001138840.1|NP_002820.3	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type 3	721	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of mitotic cell cycle (GO:0045930)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of membrane depolarization during action potential (GO:0098902)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	ATPase binding (GO:0051117)|phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	41						GTATGCGGCAGGGGCCCCTGAG	0.495																																					p.721_721del		Atlas-INDEL	.											.	PTPN3	106	.	0			c.2161_2162del						.																																			SO:0001589	frameshift_variant	5774	exon22			.		CCDS6776.1, CCDS48000.1, CCDS48001.1	9q31	2011-06-09			ENSG00000070159	ENSG00000070159		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9655	protein-coding gene	gene with protein product		176877				1648725	Standard	NM_002829		Approved	PTPH1	uc004bed.2	P26045	OTTHUMG00000020475	ENST00000374541.2:c.2160_2161delCC	chr9.hg19:g.112151607_112151608delGG	ENSP00000363667:p.Leu721fs	73.0	0.0		74.0	18.0	NM_002829	A0AUW9|E7EN99|E9PGU7	Frame_Shift_Del	DEL	ENST00000374541.2	hg19	CCDS6776.1																																																																																			.	.		0.495	PTPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053598.4		
