#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TMEM39B	55116	hgsc.bcm.edu	37	1	32540608	32540608	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:32540608G>T	ENST00000336294.5	+	2	207	c.61G>T	c.(61-63)Gga>Tga	p.G21*	TMEM39B_ENST00000487305.1_3'UTR|TMEM39B_ENST00000427288.1_5'UTR|RP11-277A4.4_ENST00000366152.3_RNA|TMEM39B_ENST00000456834.2_Nonsense_Mutation_p.G21*|TMEM39B_ENST00000373634.4_5'UTR	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	21						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				CTGTGAGCCGGGATCCTCGGG	0.567																																					p.G21X		Atlas-SNP	.											.	TMEM39B	66	.	0			c.G61T						.						45.0	51.0	49.0					1																	32540608		692	1591	2283	SO:0001587	stop_gained	55116	exon2			GAGCCGGGATCCT	AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.61G>T	chr1.hg19:g.32540608G>T	ENSP00000338165:p.Gly21*	62.0	0.0		68.0	44.0	NM_018056	B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Nonsense_Mutation	SNP	ENST00000336294.5	hg19	CCDS351.2	.	.	.	.	.	.	.	.	.	.	G	35	5.543470	0.96474	.	.	ENSG00000121775	ENST00000336294;ENST00000373633;ENST00000438825;ENST00000456834	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-5.1175	18.2567	0.90022	0.0:0.0:1.0:0.0	.	.	.	.	X	21	.	ENSP00000338165:G21X	G	+	1	0	TMEM39B	32313195	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.733000	0.84916	2.384000	0.81235	0.655000	0.94253	GGA	.	.		0.567	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011489.2	NM_018056	
CSMD2	114784	hgsc.bcm.edu	37	1	34238304	34238304	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:34238304C>T	ENST00000338325.1	-	7	948	c.536G>A	c.(535-537)cGg>cAg	p.R179Q	CSMD2_ENST00000373381.4_Missense_Mutation_p.R571Q			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	531	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCCTTCCCTCCGGCCATATGC	0.522																																					p.R531Q		Atlas-SNP	.											CSMD2_ENST00000373381,colon,carcinoma,-1,2	CSMD2	946	.	0			c.G1592A						.						93.0	91.0	92.0					1																	34238304		2203	4300	6503	SO:0001583	missense	114784	exon13			TCCCTCCGGCCAT	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.536G>A	chr1.hg19:g.34238304C>T	ENSP00000340311:p.Arg179Gln	60.0	0.0		50.0	39.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000338325.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.21	2.467050	0.43839	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.63255	-0.03;-0.03	6.06	0.689	0.18033	Complement control module (2);Sushi/SCR/CCP (3);	0.190177	0.44097	N	0.000482	T	0.46171	0.1379	L	0.48935	1.535	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.13407	0.009;0.005	T	0.14337	-1.0476	10	0.27082	T	0.32	.	3.8697	0.09031	0.2561:0.4376:0.0:0.3063	.	531;571	Q7Z408;E7EUA6	CSMD2_HUMAN;.	Q	571;179	ENSP00000362479:R571Q;ENSP00000340311:R179Q	ENSP00000241312:R531Q	R	-	2	0	CSMD2	34010891	0.761000	0.28439	0.987000	0.45799	0.987000	0.75469	0.464000	0.21988	-0.117000	0.11872	-0.137000	0.14449	CGG	.	.		0.522	CSMD2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000036404.2	NM_052896	
JAK1	3716	hgsc.bcm.edu	37	1	65310503	65310503	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:65310503T>A	ENST00000342505.4	-	16	2433	c.2185A>T	c.(2185-2187)Agt>Tgt	p.S729C	JAK1_ENST00000465376.1_5'UTR	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	729	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CCACACTCACTGTCGATGCCC	0.547			Mis		ALL																																p.S729C		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	JAK1,NS,carcinoma,0,2	JAK1	209	.	0			c.A2185T						.						96.0	113.0	107.0					1																	65310503		2115	4222	6337	SO:0001583	missense	3716	exon16			ACTCACTGTCGAT	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2185A>T	chr1.hg19:g.65310503T>A	ENSP00000343204:p.Ser729Cys	125.0	0.0		96.0	72.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	T	15.37	2.814614	0.50527	.	.	ENSG00000162434	ENST00000342505	T	0.76839	-1.05	5.0	2.65	0.31530	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.65312	0.2679	L	0.54965	1.715	0.22552	N	0.998997	P	0.46142	0.873	P	0.46850	0.529	T	0.57177	-0.7856	9	0.72032	D	0.01	-5.9131	9.7115	0.40247	0.0:0.1625:0.0:0.8375	.	729	P23458	JAK1_HUMAN	C	729	ENSP00000343204:S729C	ENSP00000343204:S729C	S	-	1	0	JAK1	65083091	0.100000	0.21855	0.477000	0.27303	0.441000	0.31987	2.149000	0.42244	0.940000	0.37473	0.460000	0.39030	AGT	.	.		0.547	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
LHX8	431707	hgsc.bcm.edu	37	1	75602886	75602886	+	Silent	SNP	T	T	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:75602886T>A	ENST00000294638.5	+	4	871	c.207T>A	c.(205-207)ccT>ccA	p.P69P	LHX8_ENST00000356261.3_Silent_p.P59P|LHX8_ENST00000559413.1_3'UTR	NM_001001933.1	NP_001001933.1	Q68G74	LHX8_HUMAN	LIM homeobox 8	69					female gonad development (GO:0008585)|forebrain neuron development (GO:0021884)|learning or memory (GO:0007611)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	female germ cell nucleus (GO:0001674)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(18)|ovary(3)|urinary_tract(1)	30						CCGGCTGCCCTCCTGGCAAGT	0.687																																					p.P69P		Atlas-SNP	.											.	LHX8	73	.	0			c.T207A						.						26.0	28.0	28.0					1																	75602886		2203	4300	6503	SO:0001819	synonymous_variant	431707	exon4			CTGCCCTCCTGGC	AB050476	CCDS30756.1, CCDS58008.1	1p31.1	2011-06-20			ENSG00000162624	ENSG00000162624		"""Homeoboxes / LIM class"""	28838	protein-coding gene	gene with protein product		604425				9598319	Standard	NM_001256114		Approved	Lhx7	uc031pmx.1	Q68G74	OTTHUMG00000009692	ENST00000294638.5:c.207T>A	chr1.hg19:g.75602886T>A		219.0	0.0		153.0	69.0	NM_001001933	E9PGE3	Silent	SNP	ENST00000294638.5	hg19	CCDS30756.1																																																																																			.	.		0.687	LHX8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026700.1	NM_001001933	
RUSC1	23623	hgsc.bcm.edu	37	1	155291207	155291207	+	Intron	SNP	G	G	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:155291207G>C	ENST00000368352.5	+	2	65				RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368347.4_5'Flank|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368354.3_Intron|RUSC1-AS1_ENST00000446880.1_RNA|RUSC1-AS1_ENST00000443642.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			TCTGGGCCCGGACCTCTTCCA	0.672																																					p.P25A		Atlas-SNP	.											.	.	.	.	0			c.C73G						.						12.0	14.0	13.0					1																	155291207		1834	4079	5913	SO:0001627	intron_variant	284618	exon2			GGCCCGGACCTCT	AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.-86-272G>C	chr1.hg19:g.155291207G>C		127.0	0.0		109.0	39.0	NM_001039517	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Missense_Mutation	SNP	ENST00000368352.5	hg19	CCDS41410.1																																																																																			.	.		0.672	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039071.1		
TDRD5	163589	hgsc.bcm.edu	37	1	179632575	179632575	+	Silent	SNP	A	A	G	rs147178825		TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:179632575A>G	ENST00000367614.1	+	15	2795	c.2436A>G	c.(2434-2436)ccA>ccG	p.P812P	TDRD5_ENST00000294848.8_Silent_p.P812P|TDRD5_ENST00000444136.1_Silent_p.P866P	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	812					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TTCATAAGCCAGAAGTACTGG	0.418																																					p.P866P		Atlas-SNP	.											.	TDRD5	149	.	0			c.A2598G						.	A	,,,,	1,4405	2.1+/-5.4	0,1,2202	83.0	80.0	81.0		2598,2598,2436,1101,2436	1.0	0.2	1	dbSNP_134	81	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TDRD5	NM_001199085.1,NM_001199089.1,NM_001199091.1,NM_001199092.1,NM_173533.3	,,,,	0,1,6502	GG,GA,AA		0.0,0.0227,0.0077	,,,,	866/1036,866/1036,812/982,367/537,812/982	179632575	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	163589	exon16			TAAGCCAGAAGTA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2436A>G	chr1.hg19:g.179632575A>G		126.0	0.0		93.0	29.0	NM_001199085	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Silent	SNP	ENST00000367614.1	hg19	CCDS1332.1																																																																																			.	A|1.000;G|0.000		0.418	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
BRINP3	339479	hgsc.bcm.edu	37	1	190250879	190250879	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:190250879C>T	ENST00000367462.3	-	3	469	c.238G>A	c.(238-240)Gag>Aag	p.E80K	RP11-547I7.1_ENST00000452178.1_RNA|BRINP3_ENST00000534846.1_Intron	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	80	MACPF.				cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CGGCCAAACTCCCTGAAAAGC	0.393																																					p.E80K		Atlas-SNP	.											.	FAM5C	343	.	0			c.G238A						.						53.0	53.0	53.0					1																	190250879		2203	4300	6503	SO:0001630	splice_region_variant	339479	exon3			CAAACTCCCTGAA	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.237-1G>A	chr1.hg19:g.190250879C>T		224.0	0.0		184.0	69.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	hg19	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	C	34	5.329455	0.95733	.	.	ENSG00000162670	ENST00000367462	D	0.83755	-1.76	5.67	5.67	0.87782	Membrane attack complex component/perforin (MACPF) domain (2);	0.000000	0.85682	D	0.000000	D	0.90532	0.7033	M	0.71581	2.175	0.80722	D	1	D	0.69078	0.997	D	0.77004	0.989	D	0.91027	0.4861	10	0.72032	D	0.01	.	17.2529	0.87047	0.0:1.0:0.0:0.0	.	80	Q76B58	FAM5C_HUMAN	K	80	ENSP00000356432:E80K	ENSP00000356432:E80K	E	-	1	0	FAM5C	188517502	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	2.677000	0.91161	0.585000	0.79938	GAG	.	.		0.393	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	Missense_Mutation
CENPF	1063	hgsc.bcm.edu	37	1	214816385	214816385	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:214816385G>T	ENST00000366955.3	+	12	4872	c.4704G>T	c.(4702-4704)gaG>gaT	p.E1568D		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1664	2 X 96 AA approximate tandem repeats.		Missing. {ECO:0000269|PubMed:7651420}.		cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.E1568D(2)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGCTAGAAGAGAAAATGGAAA	0.473																																					p.E1568D	Colon(80;575 1284 11000 14801 43496)	Atlas-SNP	.											CENPF,NS,carcinoma,0,2	CENPF	321	.	2	Substitution - Missense(2)	large_intestine(1)|endometrium(1)	c.G4704T						.						49.0	53.0	52.0					1																	214816385		2203	4300	6503	SO:0001583	missense	1063	exon12			AGAAGAGAAAATG	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4704G>T	chr1.hg19:g.214816385G>T	ENSP00000355922:p.Glu1568Asp	138.0	0.0		125.0	33.0	NM_016343	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	ENST00000366955.3	hg19	CCDS31023.1	.	.	.	.	.	.	.	.	.	.	G	6.808	0.518239	0.13005	.	.	ENSG00000117724	ENST00000366955	T	0.03635	3.86	4.9	1.75	0.24633	.	0.694331	0.11888	N	0.519839	T	0.01695	0.0054	N	0.05306	-0.075	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.49143	-0.8970	10	0.19147	T	0.46	.	3.1187	0.06383	0.1682:0.2768:0.4361:0.1189	.	1664	P49454	CENPF_HUMAN	D	1568	ENSP00000355922:E1568D	ENSP00000355922:E1568D	E	+	3	2	CENPF	212883008	0.241000	0.23857	0.964000	0.40570	0.972000	0.66771	-0.553000	0.06012	0.436000	0.26393	0.655000	0.94253	GAG	.	.		0.473	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
OBSCN	84033	hgsc.bcm.edu	37	1	228537683	228537683	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:228537683G>T	ENST00000422127.1	+	76	18285	c.18241G>T	c.(18241-18243)Gac>Tac	p.D6081Y	OBSCN_ENST00000366707.4_Missense_Mutation_p.D3715Y|OBSCN_ENST00000284548.11_Missense_Mutation_p.D6081Y|OBSCN_ENST00000366709.4_Missense_Mutation_p.D3200Y|OBSCN_ENST00000570156.2_Missense_Mutation_p.D7038Y	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6081	Ig-like 52.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GACCGGTGTGGACTCTGGCCA	0.607																																					p.D7038Y		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G21112T						.						34.0	42.0	39.0					1																	228537683		2101	4126	6227	SO:0001583	missense	84033	exon87			GGTGTGGACTCTG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18241G>T	chr1.hg19:g.228537683G>T	ENSP00000409493:p.Asp6081Tyr	51.0	0.0		43.0	15.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.94|17.94	3.512604|3.512604	0.64522|0.64522	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709|ENST00000441106	D;D;D;D|.	0.81821|.	-1.54;-1.54;-1.54;-1.54|.	5.39|5.39	5.39|5.39	0.77823|0.77823	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.000000|.	0.64402|.	D|.	0.000001|.	D|D	0.87892|0.87892	0.6292|0.6292	H|H	0.95712|0.95712	3.71|3.71	0.53005|0.53005	D|D	0.999969|0.999969	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.81914|.	0.995;0.992|.	D|D	0.91351|0.91351	0.5104|0.5104	10|5	0.87932|.	D|.	0|.	.|.	19.1538|19.1538	0.93502|0.93502	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	6081;6081|.	Q5VST9;Q5VST9-3|.	OBSCN_HUMAN;.|.	Y|V	6081;6081;3715;3200|697	ENSP00000284548:D6081Y;ENSP00000409493:D6081Y;ENSP00000355668:D3715Y;ENSP00000355670:D3200Y|.	ENSP00000284548:D6081Y|.	D|G	+|+	1|2	0|0	OBSCN|OBSCN	226604306|226604306	1.000000|1.000000	0.71417|0.71417	0.897000|0.897000	0.35233|0.35233	0.050000|0.050000	0.14768|0.14768	9.692000|9.692000	0.98682|0.98682	2.517000|2.517000	0.84864|0.84864	0.491000|0.491000	0.48974|0.48974	GAC|GGA	.	.		0.607	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
SMYD3	64754	hgsc.bcm.edu	37	1	245912933	245912933	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:245912933C>T	ENST00000388985.4	-	12	1218	c.1219G>A	c.(1219-1221)Gaa>Aaa	p.E407K	SMYD3_ENST00000366517.1_5'UTR|SMYD3_ENST00000541742.1_Missense_Mutation_p.E348K|SMYD3_ENST00000490107.1_Missense_Mutation_p.E348K			Q9H7B4	SMYD3_HUMAN	SET and MYND domain containing 3	407					cellular response to dexamethasone stimulus (GO:0071549)|establishment of protein localization (GO:0045184)|myotube cell development (GO:0014904)|negative regulation of protein kinase activity (GO:0006469)|nucleosome assembly (GO:0006334)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)			breast(3)|large_intestine(5)|lung(8)|skin(1)	17	all_cancers(71;0.000291)|all_epithelial(71;0.000174)|Ovarian(71;0.0377)|all_lung(81;0.0568)|Lung NSC(105;0.0804)|Breast(184;0.173)|Melanoma(84;0.242)	all_cancers(173;0.0496)|Acute lymphoblastic leukemia(190;0.164)	OV - Ovarian serous cystadenocarcinoma(106;0.0129)	all cancers(4;0.028)|GBM - Glioblastoma multiforme(49;0.0537)		AGGCTGTGTTCTCTGCCATGT	0.458																																					p.E407K		Atlas-SNP	.											.	SMYD3	77	.	0			c.G1219A						.						139.0	114.0	122.0					1																	245912933		2203	4300	6503	SO:0001583	missense	64754	exon12			TGTGTTCTCTGCC	AK023594	CCDS31083.1	1q44	2011-07-01	2003-05-14	2003-05-16	ENSG00000185420	ENSG00000185420		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	15513	protein-coding gene	gene with protein product		608783	"""zinc finger, MYND domain containing 1"""	ZNFN3A1, ZMYND1			Standard	NM_022743		Approved	KMT3E	uc001ibl.3	Q9H7B4	OTTHUMG00000040508	ENST00000388985.4:c.1219G>A	chr1.hg19:g.245912933C>T	ENSP00000373637:p.Glu407Lys	63.0	0.0		42.0	10.0	NM_001167740	A8K0P0|B1AN38|Q86TL8|Q8N5Z6|Q96AI5	Missense_Mutation	SNP	ENST00000388985.4	hg19	CCDS53486.1	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365464	0.61513	.	.	ENSG00000185420	ENST00000541742;ENST00000490107;ENST00000544586;ENST00000388985	T;T;T	0.21932	1.98;1.98;1.98	5.41	4.5	0.54988	.	0.215542	0.41605	D	0.000842	T	0.11196	0.0273	N	0.12746	0.255	0.38254	D	0.94169	B	0.09022	0.002	B	0.06405	0.002	T	0.17440	-1.0369	10	0.16420	T	0.52	-0.2064	11.865	0.52488	0.0:0.9198:0.0:0.0802	.	407	Q9H7B4	SMYD3_HUMAN	K	348;348;237;407	ENSP00000444184:E348K;ENSP00000419184:E348K;ENSP00000373637:E407K	ENSP00000373637:E407K	E	-	1	0	SMYD3	243979556	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	3.222000	0.51223	2.538000	0.85594	0.563000	0.77884	GAA	.	.		0.458	SMYD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022743	
AHCTF1	25909	hgsc.bcm.edu	37	1	247071004	247071004	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:247071004T>C	ENST00000391829.2	-	5	736	c.613A>G	c.(613-615)Atg>Gtg	p.M205V	AHCTF1_ENST00000366508.1_Missense_Mutation_p.M240V|AHCTF1_ENST00000326225.3_Missense_Mutation_p.M214V			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	205	Necessary for cytoplasmic localization. {ECO:0000250}.|Seven-bladed beta propeller repeats. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CCTTGTCTCATTACACTTTCT	0.388																																					p.M214V	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.A640G						.						129.0	121.0	124.0					1																	247071004		2203	4300	6503	SO:0001583	missense	25909	exon5			GTCTCATTACACT		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.613A>G	chr1.hg19:g.247071004T>C	ENSP00000375705:p.Met205Val	207.0	0.0		153.0	40.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	ENST00000391829.2	hg19		.	.	.	.	.	.	.	.	.	.	T	6.556	0.470887	0.12461	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.39229	1.09;1.09;1.09	5.76	5.76	0.90799	.	0.135213	0.64402	D	0.000002	T	0.26882	0.0658	N	0.14661	0.345	0.32138	N	0.585823	B;B	0.21225	0.053;0.04	B;B	0.18561	0.022;0.008	T	0.27673	-1.0067	10	0.52906	T	0.07	-10.9719	10.6901	0.45867	0.0:0.0712:0.0:0.9288	.	240;205	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	V	240;214;205	ENSP00000355464:M240V;ENSP00000355465:M214V;ENSP00000375705:M205V	ENSP00000355465:M214V	M	-	1	0	AHCTF1	245137627	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	3.893000	0.56243	2.323000	0.78572	0.528000	0.53228	ATG	.	.		0.388	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
OR2L8	391190	hgsc.bcm.edu	37	1	248112399	248112399	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:248112399G>A	ENST00000357191.3	+	1	240	c.240G>A	c.(238-240)atG>atA	p.M80I	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	80						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTCCTAAGATGGCATCTGATT	0.443																																					p.M80I		Atlas-SNP	.											.	OR2L8	92	.	0			c.G240A						.						298.0	263.0	275.0					1																	248112399		2203	4297	6500	SO:0001583	missense	391190	exon1			TAAGATGGCATCT	BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.240G>A	chr1.hg19:g.248112399G>A	ENSP00000349719:p.Met80Ile	99.0	0.0		44.0	18.0	NM_001001963	Q6IF03	Missense_Mutation	SNP	ENST00000357191.3	hg19	CCDS31101.1	.	.	.	.	.	.	.	.	.	.	G	9.559	1.118018	0.20877	.	.	ENSG00000196936	ENST00000357191	T	0.05513	3.43	1.64	1.64	0.23874	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38272	U	0.001749	T	0.09905	0.0243	M	0.64404	1.975	0.09310	N	0.999999	P	0.39391	0.671	B	0.44163	0.443	T	0.07751	-1.0756	10	0.66056	D	0.02	.	7.9631	0.30083	0.0:0.5367:0.4633:0.0	.	80	Q8NGY9	OR2L8_HUMAN	I	80	ENSP00000349719:M80I	ENSP00000349719:M80I	M	+	3	0	OR2L8	246179022	0.000000	0.05858	0.478000	0.27316	0.189000	0.23516	-1.430000	0.02434	0.905000	0.36596	0.479000	0.44913	ATG	.	.		0.443	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096853.2		
CCDC142	84865	hgsc.bcm.edu	37	2	74709806	74709806	+	Silent	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr2:74709806C>T	ENST00000393965.3	-	1	555	c.159G>A	c.(157-159)ggG>ggA	p.G53G	CCDC142_ENST00000290418.4_Silent_p.G53G|CCDC142_ENST00000471713.1_Intron|TTC31_ENST00000410003.1_5'Flank|TTC31_ENST00000442235.2_5'Flank|TTC31_ENST00000233623.5_5'Flank	NM_032779.3	NP_116168.3	Q17RM4	CC142_HUMAN	coiled-coil domain containing 142	53										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	16						ACCACGGCGTCCCTCCAGAAG	0.721																																					p.G53G		Atlas-SNP	.											.	CCDC142	40	.	0			c.G159A						.						39.0	39.0	39.0					2																	74709806		2171	4265	6436	SO:0001819	synonymous_variant	84865	exon1			CGGCGTCCCTCCA	AK075543	CCDS1945.1	2p13.1	2008-02-05			ENSG00000135637	ENSG00000135637			25889	protein-coding gene	gene with protein product							Standard	NM_032779		Approved	FLJ14397	uc002slq.3	Q17RM4	OTTHUMG00000129962	ENST00000393965.3:c.159G>A	chr2.hg19:g.74709806C>T		90.0	0.0		59.0	21.0	NM_032779	B7ZKV5|Q8NBJ3|Q8NBV2|Q96KA7	Silent	SNP	ENST00000393965.3	hg19																																																																																				.	.		0.721	CCDC142-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000328391.1	NM_032779	
MAP4K4	9448	hgsc.bcm.edu	37	2	102477449	102477449	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr2:102477449G>T	ENST00000347699.4	+	16	1866		c.e16+1		MAP4K4_ENST00000350878.4_Intron|MAP4K4_ENST00000413150.2_Intron|MAP4K4_ENST00000350198.4_Intron|MAP4K4_ENST00000456652.1_Intron|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000324219.4_Splice_Site|MAP4K4_ENST00000425019.1_Splice_Site	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4						intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGAGCCACAGGTAGCGACAGC	0.557																																					.		Atlas-SNP	.											.	MAP4K4	111	.	0			c.1773+1G>T						.						27.0	25.0	26.0					2																	102477449		2018	4188	6206	SO:0001630	splice_region_variant	9448	exon16			CCACAGGTAGCGA	AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.1866+1G>T	chr2.hg19:g.102477449G>T		37.0	0.0		29.0	8.0	NM_145686	O75172|Q9NST7	Splice_Site	SNP	ENST00000347699.4	hg19	CCDS56130.1	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897335	0.91962	.	.	ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000347699;ENST00000417294;ENST00000421882	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1865	0.98220	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP4K4	101843881	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.017000	0.93651	2.775000	0.95449	0.655000	0.94253	.	.	.		0.557	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000339839.1	NM_004834	Intron
PRPF40A	55660	hgsc.bcm.edu	37	2	153526802	153526802	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr2:153526802C>A	ENST00000410080.1	-	15	2114	c.1573G>T	c.(1573-1575)Gaa>Taa	p.E525*		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	552					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						TGCTGGGCTTCAGACCAAGTG	0.378																																					p.E525X		Atlas-SNP	.											.	PRPF40A	149	.	0			c.G1573T						.						148.0	132.0	137.0					2																	153526802		1847	4112	5959	SO:0001587	stop_gained	55660	exon15			GGGCTTCAGACCA	AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.1573G>T	chr2.hg19:g.153526802C>A	ENSP00000386458:p.Glu525*	87.0	0.0		80.0	26.0	NM_017892	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Nonsense_Mutation	SNP	ENST00000410080.1	hg19	CCDS46430.1	.	.	.	.	.	.	.	.	.	.	C	44	10.859167	0.99479	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-25.4456	19.1932	0.93675	0.0:1.0:0.0:0.0	.	.	.	.	X	525;534;421;472	.	ENSP00000348770:E534X	E	-	1	0	PRPF40A	153235048	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.754000	0.85163	2.603000	0.88011	0.555000	0.69702	GAA	.	.		0.378	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333559.2	XM_371575	
GRB14	2888	hgsc.bcm.edu	37	2	165381556	165381556	+	Silent	SNP	T	T	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr2:165381556T>A	ENST00000263915.3	-	5	1174	c.636A>T	c.(634-636)gcA>gcT	p.A212A	GRB14_ENST00000543549.1_Silent_p.A125A	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	212					blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TGGTTTCAGTTGCAAAAGATA	0.269																																					p.A212A		Atlas-SNP	.											.	GRB14	73	.	0			c.A636T						.						66.0	72.0	70.0					2																	165381556		2202	4298	6500	SO:0001819	synonymous_variant	2888	exon5			TTCAGTTGCAAAA		CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.636A>T	chr2.hg19:g.165381556T>A		431.0	0.0		323.0	98.0	NM_004490	B7Z7F9|Q7Z6I1	Silent	SNP	ENST00000263915.3	hg19	CCDS2222.1																																																																																			.	.		0.269	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255180.2		
COL3A1	1281	hgsc.bcm.edu	37	2	189859318	189859318	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr2:189859318C>T	ENST00000304636.3	+	19	1515	c.1345C>T	c.(1345-1347)Cgc>Tgc	p.R449C	COL3A1_ENST00000317840.5_Missense_Mutation_p.R449C	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	449	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)	p.R449C(1)		NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	ACGTGGTGAACGCGTAAGTTT	0.388																																					p.R449C		Atlas-SNP	.											COL3A1,NS,carcinoma,-1,1	COL3A1	292	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.C1345T						.						100.0	99.0	100.0					2																	189859318		2203	4300	6503	SO:0001583	missense	1281	exon19			GGTGAACGCGTAA	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.1345C>T	chr2.hg19:g.189859318C>T	ENSP00000304408:p.Arg449Cys	210.0	0.0		180.0	63.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	hg19	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	C	16.77	3.215950	0.58452	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	D;D	0.83755	-1.76;-1.76	6.17	6.17	0.99709	.	0.000000	0.51477	D	0.000094	D	0.88706	0.6509	M	0.79926	2.475	0.58432	D	0.999999	D	0.69078	0.997	P	0.53593	0.73	D	0.89397	0.3693	10	0.66056	D	0.02	.	15.581	0.76439	0.1377:0.8623:0.0:0.0	.	449	P02461	CO3A1_HUMAN	C	449	ENSP00000304408:R449C;ENSP00000315243:R449C	ENSP00000304408:R449C	R	+	1	0	COL3A1	189567563	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.010000	0.49559	2.941000	0.99782	0.655000	0.94253	CGC	.	.		0.388	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
NAB1	4664	hgsc.bcm.edu	37	2	191548503	191548503	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr2:191548503T>C	ENST00000337386.5	+	7	1506	c.1045T>C	c.(1045-1047)Ttc>Ctc	p.F349L	NAB1_ENST00000409581.1_Missense_Mutation_p.F349L|AC006460.2_ENST00000421437.1_RNA|NAB1_ENST00000357215.5_Intron|NAB1_ENST00000484774.1_3'UTR|NAB1_ENST00000545490.1_Intron|NAB1_ENST00000409641.1_Missense_Mutation_p.F349L|AC006460.2_ENST00000411949.1_RNA|AC006460.2_ENST00000428032.1_RNA	NM_005966.3	NP_005957.2	Q13506	NAB1_HUMAN	NGFI-A binding protein 1 (EGR1 binding protein 1)	349					endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of epidermis development (GO:0045682)|regulation of transcription, DNA-templated (GO:0006355)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(2)|large_intestine(2)|lung(1)|prostate(1)|skin(1)	7			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0405)|all cancers(119;0.109)			GCAAACACTCTTCCAGCAGGC	0.358																																					p.F349L		Atlas-SNP	.											.	NAB1	31	.	0			c.T1045C						.						76.0	76.0	76.0					2																	191548503		2203	4300	6503	SO:0001583	missense	4664	exon7			ACACTCTTCCAGC		CCDS2307.1	2q32.3-q33	2008-05-23			ENSG00000138386	ENSG00000138386			7626	protein-coding gene	gene with protein product	"""EGR1 binding protein 1"""	600800				7624335, 8668170, 9418898	Standard	XM_005246579		Approved		uc002usb.3	Q13506	OTTHUMG00000132689	ENST00000337386.5:c.1045T>C	chr2.hg19:g.191548503T>C	ENSP00000336894:p.Phe349Leu	62.0	0.0		44.0	14.0	NM_005966	O75383|O75384|Q6GTU1|Q9UEV1	Missense_Mutation	SNP	ENST00000337386.5	hg19	CCDS2307.1	.	.	.	.	.	.	.	.	.	.	T	13.35	2.212113	0.39102	.	.	ENSG00000138386	ENST00000409581;ENST00000337386;ENST00000409641	.	.	.	5.34	4.15	0.48705	Nab1, C-terminal (1);	0.115720	0.64402	D	0.000015	T	0.28499	0.0705	N	0.08118	0	0.80722	D	1	B;B	0.23650	0.089;0.089	B;B	0.25614	0.062;0.062	T	0.06006	-1.0851	9	0.11182	T	0.66	-12.3801	9.5719	0.39433	0.1562:0.0:0.0:0.8438	.	349;349	B8ZZS2;Q13506	.;NAB1_HUMAN	L	349	.	ENSP00000336894:F349L	F	+	1	0	NAB1	191256748	1.000000	0.71417	0.998000	0.56505	0.784000	0.44337	2.515000	0.45512	1.007000	0.39238	0.528000	0.53228	TTC	.	.		0.358	NAB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255986.1	NM_005966	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	G	rs121913416|rs121913400		TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr3:41266101C>G	ENST00000349496.5	+	3	378	c.98C>G	c.(97-99)tCt>tGt	p.S33C	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33C|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33C|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26C	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33C	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,359	CTNNB1	4904	.	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98G						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>G	chr3.hg19:g.41266101C>G	ENSP00000344456:p.Ser33Cys	136.0	0.0		92.0	38.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381716	0.82792	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72;0.72	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	C	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26C;ENSP00000385604:S33C;ENSP00000412219:S33C;ENSP00000379486:S33C;ENSP00000344456:S33C;ENSP00000411226:S26C;ENSP00000379488:S33C;ENSP00000409302:S33C;ENSP00000401599:S33C	ENSP00000344456:S33C	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LTF	4057	hgsc.bcm.edu	37	3	46501175	46501175	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr3:46501175A>G	ENST00000231751.4	-	2	473	c.178T>C	c.(178-180)Tcc>Ccc	p.S60P	LTF_ENST00000417439.1_Missense_Mutation_p.S60P|LTF_ENST00000426532.2_Missense_Mutation_p.S16P	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	60	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		TGGATGGGGGAGTCTCTCTTT	0.522																																					p.S60P		Atlas-SNP	.											LTF,rectum,carcinoma,0,1	LTF	98	.	0			c.T178C						.						124.0	115.0	118.0					3																	46501175		2203	4300	6503	SO:0001583	missense	4057	exon2			TGGGGGAGTCTCT		CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.178T>C	chr3.hg19:g.46501175A>G	ENSP00000231751:p.Ser60Pro	89.0	2.0		73.0	4.0	NM_002343	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Missense_Mutation	SNP	ENST00000231751.4	hg19	CCDS33747.1	.	.	.	.	.	.	.	.	.	.	A	15.32	2.799070	0.50208	.	.	ENSG00000012223	ENST00000231751;ENST00000426532;ENST00000417439;ENST00000443496;ENST00000443743;ENST00000431944;ENST00000415180	T;T;T;T;T;T	0.36878	2.25;2.25;2.25;2.25;1.23;1.23	4.62	3.42	0.39159	.	0.334073	0.32769	N	0.005661	T	0.64583	0.2611	M	0.93898	3.47	0.09310	N	1	D;D;D	0.65815	0.994;0.995;0.994	D;D;D	0.72625	0.978;0.946;0.978	T	0.59064	-0.7524	10	0.72032	D	0.01	-23.6303	8.032	0.30470	0.8192:0.0:0.0:0.1808	.	60;47;60	E7ER44;E7EQB2;P02788	.;.;TRFL_HUMAN	P	60;16;60;47;60;71;16	ENSP00000231751:S60P;ENSP00000405719:S16P;ENSP00000405546:S60P;ENSP00000397427:S47P;ENSP00000395234:S71P;ENSP00000400254:S16P	ENSP00000231751:S60P	S	-	1	0	LTF	46476179	0.136000	0.22515	0.002000	0.10522	0.006000	0.05464	1.447000	0.35101	0.839000	0.34971	0.528000	0.53228	TCC	.	.		0.522	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000343951.2	NM_002343	
ALS2CL	259173	hgsc.bcm.edu	37	3	46722032	46722032	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr3:46722032C>A	ENST00000318962.4	-	14	1520		c.e14-1		ALS2CL_ENST00000415953.1_Splice_Site	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like						endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GCGCTCACCTCTGGAAGGAGA	0.632																																					.		Atlas-SNP	.											.	ALS2CL	78	.	0			c.1437-1G>T						.						65.0	60.0	62.0					3																	46722032		2203	4300	6503	SO:0001630	splice_region_variant	259173	exon15			TCACCTCTGGAAG	AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.1437-1G>T	chr3.hg19:g.46722032C>A		20.0	0.0		13.0	4.0	NM_001190707	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Splice_Site	SNP	ENST00000318962.4	hg19	CCDS2743.1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.646713	0.29246	.	.	ENSG00000178038	ENST00000318962;ENST00000415953	.	.	.	4.55	4.55	0.56014	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8401	0.70217	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ALS2CL	46697036	1.000000	0.71417	0.997000	0.53966	0.082000	0.17680	6.497000	0.73674	2.355000	0.79922	0.462000	0.41574	.	.	.		0.632	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250567.3	NM_147129	Intron
CCDC66	285331	hgsc.bcm.edu	37	3	56627035	56627035	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr3:56627035A>C	ENST00000394672.3	+	8	1044	c.974A>C	c.(973-975)aAa>aCa	p.K325T	CCDC66_ENST00000326595.7_Missense_Mutation_p.K291T|CCDC66_ENST00000436465.2_Missense_Mutation_p.K325T	NM_001012506.4|NM_001141947.1	NP_001012524.4|NP_001135419.1	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66	325					post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|retinal rod cell development (GO:0046548)					breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(2)|urinary_tract(1)	12				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		AGTGCTGTGAAACAAGAACTG	0.338																																					p.K325T		Atlas-SNP	.											.	CCDC66	145	.	0			c.A974C						.						103.0	111.0	109.0					3																	56627035		2203	4300	6503	SO:0001583	missense	285331	exon8			CTGTGAAACAAGA	AL832692	CCDS33770.2, CCDS46852.1	3p14.3	2006-03-27			ENSG00000180376	ENSG00000180376			27709	protein-coding gene	gene with protein product						14702039	Standard	NR_024460		Approved	DKFZp686C0433	uc003dhz.3	A2RUB6	OTTHUMG00000155748	ENST00000394672.3:c.974A>C	chr3.hg19:g.56627035A>C	ENSP00000378167:p.Lys325Thr	161.0	0.0		130.0	48.0	NM_001141947	B3KWL8|Q4VC34|Q8N949	Missense_Mutation	SNP	ENST00000394672.3	hg19	CCDS46852.1	.	.	.	.	.	.	.	.	.	.	A	14.56	2.572501	0.45798	.	.	ENSG00000180376	ENST00000394672;ENST00000326595;ENST00000436465	T;T;T	0.32023	1.47;1.48;1.47	5.5	1.73	0.24493	.	0.274651	0.34959	N	0.003556	T	0.39600	0.1084	M	0.75264	2.295	0.80722	D	1	P	0.51351	0.944	P	0.52957	0.714	T	0.20009	-1.0288	10	0.66056	D	0.02	-15.4739	4.6077	0.12385	0.7009:0.0:0.1584:0.1407	.	325	A2RUB6	CCD66_HUMAN	T	325;291;325	ENSP00000378167:K325T;ENSP00000326050:K291T;ENSP00000404320:K325T	ENSP00000326050:K291T	K	+	2	0	CCDC66	56602075	0.992000	0.36948	0.607000	0.28956	0.908000	0.53690	1.559000	0.36320	0.375000	0.24679	-0.333000	0.08304	AAA	.	.		0.338	CCDC66-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000341473.1	NM_001012506	
ETV5	2119	hgsc.bcm.edu	37	3	185797732	185797732	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr3:185797732G>A	ENST00000306376.5	-	7	770	c.524C>T	c.(523-525)gCc>gTc	p.A175V	ETV5_ENST00000434744.1_Missense_Mutation_p.A175V|ETV5_ENST00000537818.1_Missense_Mutation_p.A217V|ETV5-AS1_ENST00000453370.1_RNA	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	175					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GGGGGCGGGGGCGGGGCCCAC	0.632			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.A175V		Atlas-SNP	.		Dom	yes		3	3q28	2119	ets variant gene 5		E	.	ETV5	106	.	0			c.C524T						.						39.0	48.0	45.0					3																	185797732		2203	4300	6503	SO:0001583	missense	2119	exon7			GCGGGGGCGGGGC	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.524C>T	chr3.hg19:g.185797732G>A	ENSP00000306894:p.Ala175Val	53.0	0.0		43.0	15.0	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	hg19	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	G	3.829	-0.036156	0.07497	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.10005	2.94;2.94;2.92	5.19	0.569	0.17340	PEA3-type ETS-domain transcription factor, N-terminal (1);	1.096050	0.06836	N	0.794816	T	0.09598	0.0236	L	0.38531	1.155	0.09310	N	0.999998	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.38308	-0.9667	10	0.45353	T	0.12	.	7.0571	0.25106	0.1759:0.2676:0.5565:0.0	.	175;217	P41161;B7Z7D7	ETV5_HUMAN;.	V	175;175;217	ENSP00000306894:A175V;ENSP00000413755:A175V;ENSP00000441737:A217V	ENSP00000306894:A175V	A	-	2	0	ETV5	187280426	0.538000	0.26394	0.026000	0.17262	0.029000	0.11900	2.650000	0.46665	0.171000	0.19730	-0.499000	0.04595	GCC	.	.		0.632	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
SLC34A2	10568	hgsc.bcm.edu	37	4	25676185	25676185	+	Silent	SNP	C	C	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr4:25676185C>G	ENST00000382051.3	+	12	1442	c.1392C>G	c.(1390-1392)ggC>ggG	p.G464G	SLC34A2_ENST00000504570.1_Silent_p.G463G|SLC34A2_ENST00000503434.1_Silent_p.G463G	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	464	Poly-Thr.				aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				CCAACATCGGCACCACCACCA	0.592			T	ROS1	NSCLC																																p.G464G		Atlas-SNP	.		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	.	SLC34A2	93	.	0			c.C1392G						.						92.0	87.0	89.0					4																	25676185		2203	4300	6503	SO:0001819	synonymous_variant	10568	exon12			CATCGGCACCACC	AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1392C>G	chr4.hg19:g.25676185C>G		161.0	0.0		116.0	47.0	NM_006424	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Silent	SNP	ENST00000382051.3	hg19	CCDS3435.1																																																																																			.	.		0.592	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214990.1	NM_006424	
GYPB	2994	hgsc.bcm.edu	37	4	145035877	145035877	+	Intron	SNP	T	T	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr4:145035877T>A	ENST00000283126.7	-	1	93				GYPA_ENST00000503627.1_Missense_Mutation_p.D89V|GYPA_ENST00000360771.4_Missense_Mutation_p.D134V|GYPA_ENST00000512789.1_Missense_Mutation_p.D69V|GYPA_ENST00000324022.10_Missense_Mutation_p.D101V|GYPA_ENST00000535709.1_Missense_Mutation_p.D108V|RP11-673E1.4_ENST00000506982.1_RNA|GYPA_ENST00000504786.1_Missense_Mutation_p.D102V|GYPA_ENST00000512064.1_Missense_Mutation_p.D121V			P06028	GLPB_HUMAN	glycophorin B (MNS blood group)							integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					TAAAGGCACGTCTGTGTCAGG	0.338																																					p.D134V		Atlas-SNP	.											.	GYPA	27	.	0			c.A401T						.						81.0	83.0	83.0					4																	145035877		2203	4300	6503	SO:0001627	intron_variant	2993	exon6			GGCACGTCTGTGT		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000283126.7:c.37+25874A>T	chr4.hg19:g.145035877T>A		104.0	0.0		64.0	27.0	NM_002099	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	ENST00000283126.7	hg19		.	.	.	.	.	.	.	.	.	.	T	13.63	2.293261	0.40594	.	.	ENSG00000170180	ENST00000360771;ENST00000324022;ENST00000535709;ENST00000512064;ENST00000512789;ENST00000504786;ENST00000503627	T;T;T;T;T;T;T	0.18502	2.21;2.21;2.21;2.21;2.21;2.21;2.21	4.72	-7.29	0.01451	.	2.245640	0.01908	N	0.039644	T	0.17619	0.0423	L	0.53249	1.67	0.09310	N	1	B;B;B;B;B	0.21688	0.059;0.019;0.059;0.033;0.059	B;B;B;B;B	0.22880	0.042;0.029;0.042;0.029;0.042	T	0.38757	-0.9646	10	0.87932	D	0	0.3478	9.7604	0.40528	0.1153:0.1589:0.0:0.7258	.	101;69;121;102;134	B8Q185;Q13030;E9PD10;E7EQF3;P02724	.;.;.;.;GLPA_HUMAN	V	134;101;108;121;69;102;89	ENSP00000354003:D134V;ENSP00000324483:D101V;ENSP00000445398:D108V;ENSP00000426130:D121V;ENSP00000425193:D69V;ENSP00000425549:D102V;ENSP00000421243:D89V	ENSP00000324483:D101V	D	-	2	0	GYPA	145255327	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.807000	0.00361	-1.430000	0.01985	-0.472000	0.04984	GAC	.	.		0.338	GYPB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_002100	
RXFP1	59350	hgsc.bcm.edu	37	4	159568206	159568206	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr4:159568206A>G	ENST00000307765.5	+	16	1860	c.1609A>G	c.(1609-1611)Att>Gtt	p.I537V	RXFP1_ENST00000460056.2_Missense_Mutation_p.I456V|RXFP1_ENST00000343542.5_Missense_Mutation_p.I489V|RXFP1_ENST00000470033.1_Missense_Mutation_p.I504V|RXFP1_ENST00000448688.2_Missense_Mutation_p.I432V	NM_001253727.1|NM_001253728.1|NM_001253730.1|NM_001253732.1|NM_001253733.1|NM_021634.3	NP_001240656.1|NP_001240657.1|NP_001240659.1|NP_001240661.1|NP_001240662.1|NP_067647.2	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	537					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|lung connective tissue development (GO:0060427)|nipple morphogenesis (GO:0060658)|parturition (GO:0007567)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|liver(2)|lung(22)|prostate(1)|skin(10)	49	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		TCTCATTTGGATTACTGGTTT	0.353																																					p.I564V		Atlas-SNP	.											.	RXFP1	98	.	0			c.A1690G						.						105.0	99.0	101.0					4																	159568206		1846	4090	5936	SO:0001583	missense	59350	exon16			ATTTGGATTACTG	AF190500	CCDS43276.1, CCDS58929.1, CCDS58930.1, CCDS75204.1, CCDS75205.1, CCDS75206.1	4q31.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000171509	ENSG00000171509		"""GPCR / Class A : Relaxin family peptide receptors"""	19718	protein-coding gene	gene with protein product		606654	"""leucine-rich repeat-containing G protein-coupled receptor 7"""	LGR7		15956688, 16507880	Standard	NM_021634		Approved	RXFPR1	uc003ipz.3	Q9HBX9	OTTHUMG00000149973	ENST00000307765.5:c.1609A>G	chr4.hg19:g.159568206A>G	ENSP00000303248:p.Ile537Val	79.0	0.0		71.0	33.0	NM_001253727	B4DHD1|B4DTV2|Q2M215|Q3KU24|Q3KU25|Q3KU26	Missense_Mutation	SNP	ENST00000307765.5	hg19	CCDS43276.1	.	.	.	.	.	.	.	.	.	.	A	8.057	0.767314	0.15983	.	.	ENSG00000171509	ENST00000460056;ENST00000307765;ENST00000448688;ENST00000343542;ENST00000470033;ENST00000440678	T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22	5.6	5.6	0.85130	GPCR, rhodopsin-like superfamily (1);	0.473362	0.24985	N	0.034030	T	0.18215	0.0437	N	0.12443	0.215	0.36487	D	0.868187	B;B;B;B;B;B;B;B	0.06786	0.0;0.001;0.0;0.0;0.0;0.0;0.0;0.001	B;B;B;B;B;B;B;B	0.11329	0.004;0.006;0.002;0.002;0.002;0.005;0.004;0.004	T	0.20739	-1.0266	10	0.10377	T	0.69	.	8.2529	0.31737	0.7945:0.1345:0.071:0.0	.	548;564;432;489;504;456;407;537	B3KV27;B4DGP2;B4DHD1;Q9HBX9-4;Q9HBX9-2;E9PCA3;Q59H16;Q9HBX9	.;.;.;.;.;.;.;RXFP1_HUMAN	V	456;537;432;489;504;407	ENSP00000423306:I456V;ENSP00000303248:I537V;ENSP00000414885:I432V;ENSP00000345889:I489V;ENSP00000420712:I504V	ENSP00000303248:I537V	I	+	1	0	RXFP1	159787656	1.000000	0.71417	0.972000	0.41901	0.893000	0.52053	1.792000	0.38754	2.128000	0.65567	0.528000	0.53228	ATT	.	.		0.353	RXFP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314865.1	NM_021634	
ZNF608	57507	hgsc.bcm.edu	37	5	123980027	123980028	+	Missense_Mutation	DNP	AC	AC	TA			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A|C	A|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr5:123980027_123980028AC>TA	ENST00000306315.5	-	5	4467_4468	c.4032_4033GT>TA	c.(4030-4035)caGTac>caTAac	p.1344_1345QY>HN	ZNF608_ENST00000513985.1_5'UTR|ZNF608_ENST00000504926.1_Missense_Mutation_p.917_918QY>HN	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1344							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		GCATGCAAGTACTGTATGTATG	0.495																																					p.Y1345N|p.Q1344H		Atlas-SNP	.											.	ZNF608	117	.	0			c.T4033A|c.G4032T						.																																			SO:0001583	missense	57507	exon5			GCAAGTACTGTAT|CAAGTACTGTATG	AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.4032_4033delinsTA	chr5.hg19:g.123980027_123980028delinsTA	ENSP00000307746:p.Q1344_Y1345delinsHN	108.0	0.0		106.0|108.0	24.0	NM_020747	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	ENST00000306315.5	hg19	CCDS34219.1																																																																																			.	.		0.495	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371300.1	XM_114432	
PCDHGB3	56102	hgsc.bcm.edu	37	5	140750610	140750610	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr5:140750610G>A	ENST00000576222.1	+	1	780	c.649G>A	c.(649-651)Ggg>Agg	p.G217R	PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018924.2|NM_032097.1	NP_061747.1|NP_115268.1	Q9Y5G1	PCDGF_HUMAN	protocadherin gamma subfamily B, 3	217	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGTGGATGGGGGCGAGCC	0.547																																					p.G217R		Atlas-SNP	.											.	PCDHGB3	168	.	0			c.G649A						.						49.0	52.0	51.0					5																	140750610		2025	4204	6229	SO:0001583	missense	56102	exon1			GTGGATGGGGGCG	AF152519	CCDS58980.1, CCDS75334.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8710	other	protocadherin		606301				10380929	Standard	NM_018924		Approved	PCDH-GAMMA-B3		Q9Y5G1		ENST00000576222.1:c.649G>A	chr5.hg19:g.140750610G>A	ENSP00000461862:p.Gly217Arg	92.0	0.0		94.0	21.0	NM_018924	A7E229|Q9Y5C7	Missense_Mutation	SNP	ENST00000576222.1	hg19	CCDS58980.1																																																																																			.	.		0.547	PCDHGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437094.1	NM_018924	
GPLD1	2822	hgsc.bcm.edu	37	6	24429303	24429303	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:24429303C>T	ENST00000230036.1	-	25	2590	c.2480G>A	c.(2479-2481)cGa>cAa	p.R827Q		NM_001503.3	NP_001494.2	P80108	PHLD_HUMAN	glycosylphosphatidylinositol specific phospholipase D1	827					cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to calcium ion (GO:0071277)|cellular response to cholesterol (GO:0071397)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|cellular response to pH (GO:0071467)|cellular response to triglyceride (GO:0071401)|chondrocyte differentiation (GO:0002062)|complement receptor mediated signaling pathway (GO:0002430)|GPI anchor release (GO:0006507)|hematopoietic stem cell migration (GO:0035701)|hematopoietic stem cell migration to bone marrow (GO:0097241)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cell proliferation (GO:0008285)|negative regulation of triglyceride catabolic process (GO:0010897)|ossification (GO:0001503)|phosphatidylcholine metabolic process (GO:0046470)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of secretion (GO:0051047)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cellular response to insulin stimulus (GO:1900076)|response to glucose (GO:0009749)|transepithelial transport (GO:0070633)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|proteinaceous extracellular matrix (GO:0005578)	glycosylphosphatidylinositol phospholipase D activity (GO:0004621)|phospholipase D activity (GO:0004630)|sodium channel regulator activity (GO:0017080)			breast(3)|endometrium(5)|kidney(1)|large_intestine(11)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	32						CCCGGAGAGTCGGGCTCCCAA	0.483																																					p.R827Q		Atlas-SNP	.											.	GPLD1	91	.	0			c.G2480A						.						93.0	82.0	86.0					6																	24429303		2203	4300	6503	SO:0001583	missense	2822	exon25			GAGAGTCGGGCTC	L11701	CCDS4553.1	6p22.1	2008-02-05			ENSG00000112293	ENSG00000112293			4459	protein-coding gene	gene with protein product		602515				11072085	Standard	NM_001503		Approved		uc003ned.2	P80108	OTTHUMG00000016104	ENST00000230036.1:c.2480G>A	chr6.hg19:g.24429303C>T	ENSP00000230036:p.Arg827Gln	65.0	0.0		59.0	11.0	NM_001503	Q15127|Q15128|Q2M2F2|Q5T3Y0|Q7Z6T8|Q8TCV0|Q8WW82|Q96ID6|Q9H167|Q9H4M1|Q9UJC9	Missense_Mutation	SNP	ENST00000230036.1	hg19	CCDS4553.1	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385727	0.61956	.	.	ENSG00000112293	ENST00000230036	T	0.67698	-0.28	5.29	5.29	0.74685	.	0.000000	0.64402	D	0.000009	T	0.66499	0.2795	M	0.73962	2.25	0.80722	D	1	D	0.71674	0.998	P	0.49502	0.613	T	0.65080	-0.6255	10	0.29301	T	0.29	-19.612	17.8579	0.88771	0.0:1.0:0.0:0.0	.	827	P80108	PHLD_HUMAN	Q	827	ENSP00000230036:R827Q	ENSP00000230036:R827Q	R	-	2	0	GPLD1	24537282	1.000000	0.71417	0.999000	0.59377	0.619000	0.37552	4.423000	0.59861	2.744000	0.94065	0.655000	0.94253	CGA	.	.		0.483	GPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043315.1	NM_001503	
HIST1H2AG	8969	hgsc.bcm.edu	37	6	27101233	27101233	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:27101233A>T	ENST00000359193.2	+	1	402	c.383A>T	c.(382-384)aAg>aTg	p.K128M	HIST1H2BJ_ENST00000607124.1_5'Flank|HIST1H2BJ_ENST00000339812.2_5'Flank|HIST1H2BJ_ENST00000541790.1_5'Flank	NM_021064.4	NP_066408.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ag	128						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	17						CACAAGGCGAAGGGCAAGTAA	0.517																																					p.K128M		Atlas-SNP	.											.	HIST1H2AG	37	.	0			c.A383T						.						65.0	63.0	64.0					6																	27101233		2203	4300	6503	SO:0001583	missense	8969	exon1			AGGCGAAGGGCAA	L19778	CCDS4619.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196787	ENSG00000196787		"""Histones / Replication-dependent"""	4737	protein-coding gene	gene with protein product		615012	"""H2A histone family, member P"", ""histone 1, H2ag"""	H2AFP		8179821, 12408966	Standard	NM_021064		Approved	pH2A/f, H2A/p, H2A.1b	uc003niw.3	P0C0S8	OTTHUMG00000014469	ENST00000359193.2:c.383A>T	chr6.hg19:g.27101233A>T	ENSP00000352119:p.Lys128Met	203.0	0.0		133.0	43.0	NM_021064	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	ENST00000359193.2	hg19	CCDS4619.1	.	.	.	.	.	.	.	.	.	.	.	13.89	2.371254	0.42003	.	.	ENSG00000196787	ENST00000359193	T	0.47869	0.83	4.08	4.08	0.47627	.	0.000000	0.41938	D	0.000781	T	0.26521	0.0648	.	.	.	0.34292	D	0.683351	B	0.26547	0.152	B	0.28991	0.097	T	0.33163	-0.9879	9	0.87932	D	0	.	11.6705	0.51399	1.0:0.0:0.0:0.0	.	128	P0C0S8	H2A1_HUMAN	M	128	ENSP00000352119:K128M	ENSP00000352119:K128M	K	+	2	0	HIST1H2AG	27209212	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	8.002000	0.88514	1.801000	0.52704	0.533000	0.62120	AAG	.	.		0.517	HIST1H2AG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040137.1	NM_021064	
NRM	11270	hgsc.bcm.edu	37	6	30656498	30656498	+	Silent	SNP	C	C	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:30656498C>A	ENST00000259953.4	-	5	1080	c.729G>T	c.(727-729)cgG>cgT	p.R243R	NRM_ENST00000376420.5_Silent_p.R184R|PPP1R18_ENST00000488324.1_5'Flank|NRM_ENST00000470733.1_5'UTR|NRM_ENST00000376421.5_Silent_p.R243R|PPP1R18_ENST00000399199.3_5'Flank|PPP1R18_ENST00000274853.3_5'Flank	NM_007243.2	NP_009174.1	Q8IXM6	NRM_HUMAN	nurim (nuclear envelope membrane protein)	243	Leu-rich.					integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)				large_intestine(1)|lung(2)	3						GTAGCTGGGCCCGGAGGTAGC	0.607																																					p.R249R		Atlas-SNP	.											.	NRM	7	.	0			c.G747T						.						53.0	58.0	56.0					6																	30656498		2203	4300	6503	SO:0001819	synonymous_variant	11270	exon4			CTGGGCCCGGAGG	AF143676	CCDS4686.1, CCDS59498.1	6p21.3	2010-02-17			ENSG00000137404	ENSG00000137404			8003	protein-coding gene	gene with protein product						10402458, 17517639	Standard	NM_007243		Approved	NRM29	uc031sng.1	Q8IXM6	OTTHUMG00000031223	ENST00000259953.4:c.729G>T	chr6.hg19:g.30656498C>A		109.0	0.0		85.0	21.0	NM_001270707	B0S7R0|B0S7R1|I3XIE2|I3XIE3|Q5JP57|Q5JP58|Q5JP59|Q5JP60|Q8WU45|Q9BSX3|Q9UN92	Silent	SNP	ENST00000259953.4	hg19	CCDS4686.1	.	.	.	.	.	.	.	.	.	.	C	7.108	0.575416	0.13623	.	.	ENSG00000137404	ENST00000444096	.	.	.	5.26	2.13	0.27403	.	.	.	.	.	T	0.30792	0.0776	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.14420	-1.0473	4	.	.	.	-18.1619	4.1973	0.10450	0.2804:0.5101:0.125:0.0845	.	.	.	.	C	243	.	.	G	-	1	0	NRM	30764477	0.808000	0.29022	0.990000	0.47175	0.643000	0.38383	-0.117000	0.10708	0.603000	0.29913	-0.169000	0.13324	GGC	.	.		0.607	NRM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076466.2		
TNXB	7148	hgsc.bcm.edu	37	6	32036842	32036842	+	Silent	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:32036842A>G	ENST00000375244.3	-	16	5860	c.5659T>C	c.(5659-5661)Ttg>Ctg	p.L1887L	TNXB_ENST00000375247.2_Silent_p.L1887L			P22105	TENX_HUMAN	tenascin XB	1969	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TCCACTGTCAACTCCCCGAGG	0.582																																					p.L1887L		Atlas-SNP	.											.	TNXB	553	.	0			c.T5659C						.						57.0	64.0	61.0					6																	32036842		1306	2575	3881	SO:0001819	synonymous_variant	7148	exon16			CTGTCAACTCCCC	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5659T>C	chr6.hg19:g.32036842A>G		71.0	0.0		63.0	22.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	ENST00000375244.3	hg19																																																																																				.	.		0.582	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
PXT1	222659	hgsc.bcm.edu	37	6	36359627	36359627	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:36359627C>T	ENST00000454782.2	-	5	808	c.325G>A	c.(325-327)Gca>Aca	p.A109T	RP1-50J22.4_ENST00000411643.1_RNA	NM_152990.3	NP_694535.2	Q8NFP0	PXT1_HUMAN	peroxisomal, testis specific 1	109					positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|peroxisome (GO:0005777)											TGATCTAGTGCATCTCTGCCA	0.323																																					p.A109T		Atlas-SNP	.											.	PXT1	6	.	0			c.G325A						.						101.0	103.0	102.0					6																	36359627		2203	4300	6503	SO:0001583	missense	222659	exon5			CTAGTGCATCTCT	AF486827	CCDS4820.2	6p21.31	2004-04-30			ENSG00000179165	ENSG00000179165			18312	protein-coding gene	gene with protein product							Standard	NM_152990		Approved	STEPP	uc003omd.2	Q8NFP0	OTTHUMG00000159815	ENST00000454782.2:c.325G>A	chr6.hg19:g.36359627C>T	ENSP00000419944:p.Ala109Thr	84.0	0.0		80.0	17.0	NM_152990	J3KR74	Missense_Mutation	SNP	ENST00000454782.2	hg19	CCDS4820.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.98|10.98	1.505291|1.505291	0.26949|0.26949	.|.	.|.	ENSG00000179165|ENSG00000179165	ENST00000454782;ENST00000538109|ENST00000459696	.|.	.|.	.|.	4.84|4.84	0.817|0.817	0.18773|0.18773	.|.	0.885835|.	0.09360|.	N|.	0.812898|.	T|T	0.15089|0.15089	0.0364|0.0364	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	P|.	0.51351|.	0.944|.	P|.	0.52957|.	0.714|.	T|T	0.29671|0.29671	-1.0004|-1.0004	8|4	0.23891|.	T|.	0.37|.	3.3413|3.3413	7.9695|7.9695	0.30119|0.30119	0.0:0.4374:0.4695:0.0931|0.0:0.4374:0.4695:0.0931	.|.	26|.	Q8NFP0|.	PXT1_HUMAN|.	T|I	109;26|32	.|.	ENSP00000419944:A109T|.	A|M	-|-	1|3	0|0	PXT1|PXT1	36467605|36467605	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.306000|-0.306000	0.08178|0.08178	0.020000|0.020000	0.15106|0.15106	-0.165000|-0.165000	0.13383|0.13383	GCA|ATG	.	.		0.323	PXT1-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357516.2	NM_152990	
CRISP1	167	hgsc.bcm.edu	37	6	49814359	49814359	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:49814359C>T	ENST00000335847.4	-	5	410	c.309G>A	c.(307-309)atG>atA	p.M103I	CRISP1_ENST00000355791.2_Missense_Mutation_p.M103I|CRISP1_ENST00000505118.1_Missense_Mutation_p.M103I|CRISP1_ENST00000507853.1_Missense_Mutation_p.M103I|CRISP1_ENST00000329411.5_Missense_Mutation_p.M103I|CRISP1_ENST00000536021.1_Missense_Mutation_p.M103I	NM_001131.2	NP_001122.2	P54107	CRIS1_HUMAN	cysteine-rich secretory protein 1	103	SCP.				binding of sperm to zona pellucida (GO:0007339)|fusion of sperm to egg plasma membrane (GO:0007342)|regulation of acrosome reaction (GO:0060046)	extracellular space (GO:0005615)|nucleus (GO:0005634)	calcium channel regulator activity (GO:0005246)			endometrium(1)|kidney(2)|large_intestine(6)|lung(15)|skin(2)|upper_aerodigestive_tract(1)	27	Lung NSC(77;0.0358)					ATGTCATATGCATATTTTCTC	0.378																																					p.M103I		Atlas-SNP	.											.	CRISP1	45	.	0			c.G309A						.						184.0	157.0	166.0					6																	49814359		2203	4300	6503	SO:0001583	missense	167	exon5			CATATGCATATTT	D38451	CCDS4931.1, CCDS4932.1	6p21.2-p21.1	2008-02-05	2003-09-03	2003-09-05	ENSG00000124812	ENSG00000124812			304	protein-coding gene	gene with protein product		601193	"""acidic epididymal glycoprotein-like 1"""	AEGL1		8838800	Standard	NM_001131		Approved	CRISP-1, ARP, HUMARP, HSCRISP1D, HSCRISP1G	uc003ozw.2	P54107	OTTHUMG00000014827	ENST00000335847.4:c.309G>A	chr6.hg19:g.49814359C>T	ENSP00000338276:p.Met103Ile	72.0	0.0		73.0	27.0	NM_001205220	B5BU98|O00698|Q13248|Q14082|Q96SF6	Missense_Mutation	SNP	ENST00000335847.4	hg19	CCDS4931.1	.	.	.	.	.	.	.	.	.	.	C	10.18	1.278026	0.23307	.	.	ENSG00000124812	ENST00000507853;ENST00000335847;ENST00000355791;ENST00000329411;ENST00000505118;ENST00000536021	T;T;T;T;T;T	0.06768	3.26;3.26;3.26;3.26;3.26;3.26	5.34	2.52	0.30459	CAP domain (3);	0.558033	0.18817	N	0.130353	T	0.00815	0.0027	N	0.03194	-0.395	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.47623	-0.9103	9	.	.	.	.	4.7058	0.12849	0.1868:0.6303:0.0:0.1829	.	103;103	P54107-2;P54107	.;CRIS1_HUMAN	I	103	ENSP00000425020:M103I;ENSP00000338276:M103I;ENSP00000348044:M103I;ENSP00000331317:M103I;ENSP00000427589:M103I;ENSP00000441798:M103I	.	M	-	3	0	CRISP1	49922318	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.244000	0.08903	0.209000	0.20645	-0.145000	0.13849	ATG	.	.		0.378	CRISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040875.2	NM_001131	
VGLL2	245806	hgsc.bcm.edu	37	6	117589350	117589350	+	Silent	SNP	A	A	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:117589350A>C	ENST00000326274.5	+	2	277	c.87A>C	c.(85-87)ctA>ctC	p.L29L	VGLL2_ENST00000352536.3_Silent_p.L29L	NM_182645.3	NP_872586.1	Q8N8G2	VGLL2_HUMAN	vestigial-like family member 2	29					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			central_nervous_system(1)|kidney(1)|lung(3)	5				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		AACAGAAACTAGCCTATTATT	0.468																																					p.L29L		Atlas-SNP	.											.	VGLL2	18	.	0			c.A87C						.						124.0	151.0	142.0					6																	117589350		2202	4300	6502	SO:0001819	synonymous_variant	245806	exon2			GAAACTAGCCTAT	AY056583	CCDS5114.1, CCDS5115.1	6q22.31	2014-03-03	2014-03-03		ENSG00000170162	ENSG00000170162			20232	protein-coding gene	gene with protein product		609979	"""vestigial like 2 (Drosophila)"""			12376544	Standard	NM_153453		Approved		uc003pxn.3	Q8N8G2	OTTHUMG00000015451	ENST00000326274.5:c.87A>C	chr6.hg19:g.117589350A>C		193.0	0.0		159.0	56.0	NM_182645	Q8WWX1	Silent	SNP	ENST00000326274.5	hg19	CCDS5115.1																																																																																			.	.		0.468	VGLL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041975.2	NM_153453	
HSF2	3298	hgsc.bcm.edu	37	6	122749064	122749064	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr6:122749064T>C	ENST00000368455.4	+	11	1385	c.1193T>C	c.(1192-1194)gTg>gCg	p.V398A	HSF2_ENST00000452194.1_Intron	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2	398					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		ACTAGTTCTGTGCAGATGAAT	0.294																																					p.V398A		Atlas-SNP	.											.	HSF2	43	.	0			c.T1193C						.						71.0	68.0	69.0					6																	122749064		2203	4299	6502	SO:0001583	missense	3298	exon11			GTTCTGTGCAGAT	M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.1193T>C	chr6.hg19:g.122749064T>C	ENSP00000357440:p.Val398Ala	216.0	0.0		156.0	55.0	NM_004506	B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Missense_Mutation	SNP	ENST00000368455.4	hg19	CCDS5124.1	.	.	.	.	.	.	.	.	.	.	T	17.43	3.387601	0.61956	.	.	ENSG00000025156	ENST00000368455	.	.	.	5.87	4.71	0.59529	Vertebrate heat shock transcription factor (1);	0.312857	0.25302	N	0.031646	T	0.28566	0.0707	L	0.50333	1.59	0.80722	D	1	B	0.27416	0.178	B	0.28991	0.097	T	0.12400	-1.0549	9	0.08179	T	0.78	-2.0516	10.4216	0.44354	0.0:0.0735:0.0:0.9265	.	398	Q03933	HSF2_HUMAN	A	398	.	ENSP00000357440:V398A	V	+	2	0	HSF2	122790763	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.172000	0.65003	1.051000	0.40369	0.528000	0.53228	GTG	.	.		0.294	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043520.1	NM_004506	
IGFBP1	3484	hgsc.bcm.edu	37	7	45931536	45931536	+	Silent	SNP	C	C	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr7:45931536C>G	ENST00000275525.3	+	3	821	c.525C>G	c.(523-525)ccC>ccG	p.P175P	IGFBP1_ENST00000457280.1_Silent_p.P175P|IGFBP1_ENST00000468955.1_Intron	NM_000596.2	NP_000587.1	P08833	IBP1_HUMAN	insulin-like growth factor binding protein 1	175	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)|tissue regeneration (GO:0042246)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	insulin-like growth factor binding (GO:0005520)	p.P175P(1)		large_intestine(2)|lung(4)	6						CTTAGGAGCCCTGCCGAATAG	0.418											OREG0018048	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P175P		Atlas-SNP	.											IGFBP1,NS,carcinoma,0,1	IGFBP1	19	.	1	Substitution - coding silent(1)	lung(1)	c.C525G						.						65.0	64.0	64.0					7																	45931536		2203	4300	6503	SO:0001819	synonymous_variant	3484	exon3			GGAGCCCTGCCGA		CCDS5504.1	7p12.3	2014-09-16			ENSG00000146678	ENSG00000146678			5469	protein-coding gene	gene with protein product	"""placental protein 12"", ""amniotic fluid binding protein"", ""alpha-pregnancy-associated endometrial globulin"", ""growth hormone independent-binding protein"", ""binding protein-28"", ""binding protein-26"", ""binding protein-25"", ""IGF-binding protein 1"""	146730		IBP1		2461294	Standard	NM_000596		Approved	IGF-BP25, AFBP, hIGFBP-1, PP12	uc003tnp.3	P08833	OTTHUMG00000152343	ENST00000275525.3:c.525C>G	chr7.hg19:g.45931536C>G		72.0	0.0	935	48.0	19.0	NM_000596	A4D2F4|D3DVL9|Q8IYP5	Silent	SNP	ENST00000275525.3	hg19	CCDS5504.1																																																																																			.	.		0.418	IGFBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251355.2	NM_000596	
TRIM56	81844	hgsc.bcm.edu	37	7	100731596	100731596	+	Silent	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr7:100731596C>T	ENST00000306085.6	+	3	1300	c.1003C>T	c.(1003-1005)Ctg>Ttg	p.L335L		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	335					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					GCTCAGGCAGCTGCAGGGCTG	0.716																																					p.L335L	Ovarian(89;1092 1379 22756 38989 39611)	Atlas-SNP	.											.	TRIM56	123	.	0			c.C1003T						.						11.0	13.0	12.0					7																	100731596		1913	4108	6021	SO:0001819	synonymous_variant	81844	exon3			AGGCAGCTGCAGG	BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.1003C>T	chr7.hg19:g.100731596C>T		26.0	0.0		48.0	11.0	NM_030961	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Silent	SNP	ENST00000306085.6	hg19	CCDS43625.1																																																																																			.	.		0.716	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347185.1	NM_030961	
PDP1	54704	hgsc.bcm.edu	37	8	94935709	94935709	+	Silent	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr8:94935709G>A	ENST00000297598.4	+	2	1691	c.1422G>A	c.(1420-1422)gaG>gaA	p.E474E	PDP1_ENST00000520728.1_Silent_p.E474E|PDP1_ENST00000517764.1_Silent_p.E474E|PDP1_ENST00000396200.3_Silent_p.E499E	NM_001161781.1|NM_018444.3	NP_001155253.1|NP_060914.2	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic subunit 1	474					cellular metabolic process (GO:0044237)|peptidyl-threonine dephosphorylation (GO:0035970)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	[pyruvate dehydrogenase (lipoamide)] phosphatase activity (GO:0004741)|metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)	18						CGGTATTTGAGGATCAGAACG	0.488																																					p.E499E		Atlas-SNP	.											.	PDP1	97	.	0			c.G1497A						.						141.0	130.0	134.0					8																	94935709		2203	4300	6503	SO:0001819	synonymous_variant	54704	exon3			ATTTGAGGATCAG	AF155661	CCDS6259.1, CCDS55262.1	8q22.1	2012-04-17	2009-06-12	2009-06-12	ENSG00000164951	ENSG00000164951	3.1.3.43	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9279	protein-coding gene	gene with protein product		605993	"""protein phosphatase 2C, magnesium-dependent, catalytic subunit"""	PPM2C		8396421	Standard	NM_001161779		Approved	PDP, PDH	uc003ygf.3	Q9P0J1		ENST00000297598.4:c.1422G>A	chr8.hg19:g.94935709G>A		71.0	0.0		122.0	72.0	NM_001161780	B3KX71|J3KPU0|Q5U5K1	Silent	SNP	ENST00000297598.4	hg19	CCDS6259.1																																																																																			.	.		0.488	PDP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378415.2	NM_018444	
TONSL	4796	hgsc.bcm.edu	37	8	145666384	145666384	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr8:145666384C>G	ENST00000409379.3	-	8	1005	c.976G>C	c.(976-978)Gac>Cac	p.D326H	AC084125.4_ENST00000544423.1_RNA|AC084125.4_ENST00000442850.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	326					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						CTGGGAAAGTCTCCTGCCTTG	0.647																																					p.D326H		Atlas-SNP	.											.	TONSL	128	.	0			c.G976C						.						99.0	96.0	97.0					8																	145666384		2203	4300	6503	SO:0001583	missense	4796	exon8			GAAAGTCTCCTGC		CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.976G>C	chr8.hg19:g.145666384C>G	ENSP00000386239:p.Asp326His	74.0	0.0		110.0	49.0	NM_013432	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	ENST00000409379.3	hg19	CCDS34968.2	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899950	0.33535	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.77489	-1.1	5.45	3.62	0.41486	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.247196	0.47852	D	0.000213	T	0.81273	0.4788	L	0.60455	1.87	0.26142	N	0.980262	D	0.89917	1.0	D	0.68192	0.956	T	0.70371	-0.4890	10	0.45353	T	0.12	-38.2468	4.2365	0.10628	0.163:0.5937:0.1577:0.0856	.	326	Q96HA7	TONSL_HUMAN	H	326	ENSP00000386239:D326H	ENSP00000386239:D326H	D	-	1	0	TONSL	145637192	0.992000	0.36948	0.633000	0.29310	0.501000	0.33797	3.102000	0.50291	0.649000	0.30751	0.561000	0.74099	GAC	.	.		0.647	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329668.2	NM_013432	
IZUMO3	100129669	hgsc.bcm.edu	37	9	24545239	24545239	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr9:24545239A>T	ENST00000543880.2	-	2	503	c.272T>A	c.(271-273)tTt>tAt	p.F91Y	IZUMO3_ENST00000604921.1_Missense_Mutation_p.F91Y|RP11-20A20.2_ENST00000602851.1_lincRNA			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	91						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										CAGTTTATAAAATTCATTCTT	0.388																																					p.F91Y		Atlas-SNP	.											.	.	.	.	0			c.T272A						.																																			SO:0001583	missense	100129669	exon2			TTATAAAATTCAT		CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.272T>A	chr9.hg19:g.24545239A>T	ENSP00000438895:p.Phe91Tyr	113.0	0.0		98.0	34.0	NM_001271706		Missense_Mutation	SNP	ENST00000543880.2	hg19		.	.	.	.	.	.	.	.	.	.	A	12.18	1.859888	0.32884	.	.	ENSG00000205442	ENST00000543880	T	0.23754	1.89	5.5	5.5	0.81552	.	.	.	.	.	T	0.37812	0.1017	.	.	.	.	.	.	.	.	.	.	.	.	T	0.51284	-0.8725	5	0.49607	T	0.09	.	11.9251	0.52814	1.0:0.0:0.0:0.0	.	.	.	.	Y	91	ENSP00000438895:F91Y	ENSP00000438895:F91Y	F	-	2	0	IZUMO3	24535239	0.883000	0.30277	0.908000	0.35775	0.242000	0.25591	1.629000	0.37071	2.308000	0.77769	0.533000	0.62120	TTT	.	.		0.388	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000467652.1	NM_001271706	
ACO1	48	hgsc.bcm.edu	37	9	32431729	32431729	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr9:32431729A>G	ENST00000309951.6	+	15	1877	c.1739A>G	c.(1738-1740)aAg>aGg	p.K580R	ACO1_ENST00000541043.1_Missense_Mutation_p.K481R|ACO1_ENST00000379923.1_Missense_Mutation_p.K580R	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	580					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		GTAAATGCAAAGGGACAGCAG	0.418																																					p.K580R		Atlas-SNP	.											.	ACO1	149	.	0			c.A1739G						.						99.0	95.0	96.0					9																	32431729		2203	4300	6503	SO:0001583	missense	48	exon15			ATGCAAAGGGACA	M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.1739A>G	chr9.hg19:g.32431729A>G	ENSP00000309477:p.Lys580Arg	102.0	0.0		78.0	37.0	NM_002197	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	ENST00000309951.6	hg19	CCDS6525.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918383	0.52546	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000541043	T;T;T	0.17528	2.27;2.27;2.27	5.49	4.35	0.52113	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (1);	0.440276	0.27008	N	0.021391	T	0.12433	0.0302	N	0.21282	0.65	0.29079	N	0.882805	B;B	0.12013	0.005;0.001	B;B	0.12156	0.007;0.002	T	0.09378	-1.0677	10	0.59425	D	0.04	-10.1376	10.9111	0.47110	0.925:0.0:0.075:0.0	.	616;580	Q59FI0;P21399	.;ACOC_HUMAN	R	616;580;580;481	ENSP00000309477:K580R;ENSP00000369255:K580R;ENSP00000438733:K481R	ENSP00000309477:K580R	K	+	2	0	ACO1	32421729	1.000000	0.71417	0.992000	0.48379	0.910000	0.53928	4.321000	0.59209	1.027000	0.39758	-0.264000	0.10439	AAG	.	.		0.418	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051998.3	NM_002197	
NOTCH1	4851	hgsc.bcm.edu	37	9	139395113	139395113	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr9:139395113T>A	ENST00000277541.6	-	31	5900	c.5825A>T	c.(5824-5826)gAt>gTt	p.D1942V		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	1942					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CTTGGCGGCATCAGAGCGTGA	0.662			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.D1942V		Atlas-SNP	.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1	1980	.	0			c.A5825T						.						90.0	109.0	103.0					9																	139395113		2197	4297	6494	SO:0001583	missense	4851	exon31			GCGGCATCAGAGC	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.5825A>T	chr9.hg19:g.139395113T>A	ENSP00000277541:p.Asp1942Val	55.0	0.0		46.0	10.0	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	hg19	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.392163	0.83011	.	.	ENSG00000148400	ENST00000277541	T	0.58060	0.36	4.68	4.68	0.58851	Ankyrin repeat-containing domain (3);	0.100236	0.64402	D	0.000003	T	0.61726	0.2370	M	0.72576	2.205	0.80722	D	1	P	0.51933	0.949	P	0.50970	0.655	T	0.66236	-0.5974	10	0.52906	T	0.07	.	13.646	0.62281	0.0:0.0:0.0:1.0	.	1942	P46531	NOTC1_HUMAN	V	1942	ENSP00000277541:D1942V	ENSP00000277541:D1942V	D	-	2	0	NOTCH1	138514934	1.000000	0.71417	0.442000	0.26870	0.930000	0.56654	7.797000	0.85911	1.881000	0.54492	0.454000	0.30748	GAT	.	.		0.662	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
MASTL	84930	hgsc.bcm.edu	37	10	27454042	27454042	+	Silent	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr10:27454042A>G	ENST00000375940.4	+	5	660	c.603A>G	c.(601-603)agA>agG	p.R201R	MASTL_ENST00000342386.6_Silent_p.R201R|MASTL_ENST00000375946.4_Silent_p.R201R			Q96GX5	GWL_HUMAN	microtubule associated serine/threonine kinase-like	201	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to DNA damage stimulus (GO:0006974)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of protein phosphatase type 2A activity (GO:0034048)|regulation of cell cycle (GO:0051726)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein phosphatase 2A binding (GO:0051721)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|cervix(2)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CAAAACCTAGACAAGATTATT	0.343																																					p.R201R		Atlas-SNP	.											.	MASTL	81	.	0			c.A603G						.						105.0	104.0	104.0					10																	27454042		2203	4300	6503	SO:0001819	synonymous_variant	84930	exon5			ACCTAGACAAGAT	BC009107	CCDS7153.1, CCDS53502.1, CCDS53503.1	10p12.1	2005-11-03			ENSG00000120539	ENSG00000120539			19042	protein-coding gene	gene with protein product		608221					Standard	NM_001172303		Approved	FLJ14813, THC2	uc001itm.3	Q96GX5	OTTHUMG00000017855	ENST00000375940.4:c.603A>G	chr10.hg19:g.27454042A>G		173.0	0.0		124.0	34.0	NM_032844	Q5T8D5|Q5T8D7|Q8NCD6|Q96SJ5	Silent	SNP	ENST00000375940.4	hg19	CCDS53502.1																																																																																			.	.		0.343	MASTL-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047320.1	NM_032844	
NRG3	10718	hgsc.bcm.edu	37	10	84745207	84745207	+	Missense_Mutation	SNP	G	G	T	rs150401464	byFrequency	TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr10:84745207G>T	ENST00000404547.1	+	10	2009	c.2009G>T	c.(2008-2010)cGg>cTg	p.R670L	NRG3_ENST00000372141.2_Missense_Mutation_p.R646L|NRG3_ENST00000537893.1_Missense_Mutation_p.R296L|NRG3_ENST00000404576.2_Missense_Mutation_p.R450L|NRG3_ENST00000545131.1_Missense_Mutation_p.R296L|NRG3_ENST00000556918.1_Missense_Mutation_p.R476L|NRG3_ENST00000372142.2_Missense_Mutation_p.R449L			P56975	NRG3_HUMAN	neuregulin 3	670					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		GATGCCAGACGGTCAGAAGAC	0.483																																					p.R646L		Atlas-SNP	.											.	NRG3	301	.	0			c.G1937T						.						72.0	69.0	70.0					10																	84745207		2203	4300	6503	SO:0001583	missense	10718	exon9			CCAGACGGTCAGA	AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.2009G>T	chr10.hg19:g.84745207G>T	ENSP00000384796:p.Arg670Leu	105.0	0.0		67.0	26.0	NM_001010848	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	ENST00000404547.1	hg19	CCDS31233.1	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190993	0.58017	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	T;T;T;T;T;T;T	0.68903	0.27;0.44;0.5;-0.36;0.21;-0.18;-0.18	5.54	4.63	0.57726	.	0.071482	0.52532	D	0.000073	T	0.75874	0.3909	L	0.53249	1.67	0.53688	D	0.999976	B;D;P;D	0.71674	0.364;0.997;0.841;0.998	B;D;B;D	0.65987	0.168;0.919;0.358;0.94	T	0.78127	-0.2325	10	0.87932	D	0	-32.1113	12.5326	0.56124	0.0814:0.0:0.9186:0.0	.	645;670;449;646	B9EGV5;P56975;P56975-3;P56975-4	.;NRG3_HUMAN;.;.	L	646;670;645;449;450;476;296;296	ENSP00000361214:R646L;ENSP00000384796:R670L;ENSP00000361215:R449L;ENSP00000385804:R450L;ENSP00000451376:R476L;ENSP00000441201:R296L;ENSP00000440377:R296L	ENSP00000361214:R646L	R	+	2	0	NRG3	84735187	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.005000	0.63972	1.334000	0.45468	0.655000	0.94253	CGG	.	G|1.000;A|0.000		0.483	NRG3-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412262.1	XM_166086	
TBC1D12	23232	hgsc.bcm.edu	37	10	96162647	96162647	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr10:96162647G>A	ENST00000225235.4	+	1	387	c.277G>A	c.(277-279)Ggc>Agc	p.G93S		NM_015188.1	NP_056003.1	O60347	TBC12_HUMAN	TBC1 domain family, member 12	93							Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|upper_aerodigestive_tract(2)	20		Colorectal(252;0.0429)				GCTCCCCGCTGGCCAGGCCGG	0.761																																					p.G93S		Atlas-SNP	.											.	TBC1D12	51	.	0			c.G277A						.						2.0	2.0	2.0					10																	96162647		832	2135	2967	SO:0001583	missense	23232	exon1			CCCGCTGGCCAGG	AB011180	CCDS41553.1	10q23.33	2013-09-20			ENSG00000108239	ENSG00000108239			29082	protein-coding gene	gene with protein product						9628581	Standard	NM_015188		Approved	KIAA0608	uc001kjr.2	O60347	OTTHUMG00000018794	ENST00000225235.4:c.277G>A	chr10.hg19:g.96162647G>A	ENSP00000225235:p.Gly93Ser	34.0	0.0		30.0	11.0	NM_015188	Q5VYA6|Q8WX26|Q8WX59|Q9UG83	Missense_Mutation	SNP	ENST00000225235.4	hg19	CCDS41553.1	.	.	.	.	.	.	.	.	.	.	G	7.829	0.719332	0.15372	.	.	ENSG00000108239	ENST00000225235	T	0.04194	3.68	3.2	1.22	0.21188	.	4.432070	0.01305	U	0.010416	T	0.04182	0.0116	N	0.19112	0.55	0.09310	N	1	B	0.10296	0.003	B	0.04013	0.001	T	0.37686	-0.9695	10	0.27082	T	0.32	-0.033	5.8994	0.18957	0.1241:0.203:0.6728:0.0	.	93	O60347	TBC12_HUMAN	S	93	ENSP00000225235:G93S	ENSP00000225235:G93S	G	+	1	0	TBC1D12	96152637	0.390000	0.25213	0.187000	0.23214	0.547000	0.35210	0.977000	0.29475	0.662000	0.31006	0.298000	0.19748	GGC	.	.		0.761	TBC1D12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049482.2		
CYP2C8	1558	hgsc.bcm.edu	37	10	96826978	96826978	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr10:96826978C>G	ENST00000371270.3	-	3	562	c.468G>C	c.(466-468)ttG>ttC	p.L156F	CYP2C8_ENST00000539050.1_Missense_Mutation_p.L70F|CYP2C8_ENST00000535898.1_Missense_Mutation_p.L54F	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	156					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	TGGTTTTTCTCAACTCCTCCA	0.517																																					p.L156F		Atlas-SNP	.											.	CYP2C8	73	.	0			c.G468C						.						240.0	216.0	224.0					10																	96826978		2203	4300	6503	SO:0001583	missense	1558	exon3			TTTTCTCAACTCC	M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.468G>C	chr10.hg19:g.96826978C>G	ENSP00000360317:p.Leu156Phe	117.0	0.0		106.0	25.0	NM_000770	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Missense_Mutation	SNP	ENST00000371270.3	hg19	CCDS7438.1	.	.	.	.	.	.	.	.	.	.	c	10.95	1.494613	0.26774	.	.	ENSG00000138115	ENST00000371270;ENST00000535868;ENST00000535898;ENST00000539050	T;T;T	0.73575	-0.76;-0.76;-0.76	4.64	-2.0	0.07433	.	0.353824	0.23879	U	0.043675	T	0.58206	0.2106	L	0.35644	1.08	0.09310	N	1	B;B;B;B	0.27765	0.156;0.075;0.188;0.188	B;B;B;B	0.34418	0.114;0.113;0.182;0.182	T	0.46373	-0.9196	10	0.22706	T	0.39	.	5.8812	0.18856	0.0:0.3175:0.2401:0.4423	.	70;54;124;156	F5H7Q9;B7Z1F6;B7Z8S1;P10632	.;.;.;CP2C8_HUMAN	F	156;123;54;70	ENSP00000360317:L156F;ENSP00000445062:L54F;ENSP00000442343:L70F	ENSP00000360317:L156F	L	-	3	2	CYP2C8	96816968	0.000000	0.05858	0.081000	0.20488	0.956000	0.61745	-2.103000	0.01341	-0.024000	0.13941	-0.215000	0.12644	TTG	.	.		0.517	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049499.2	NM_000770	
ZFYVE27	118813	hgsc.bcm.edu	37	10	99509255	99509255	+	Silent	SNP	A	A	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr10:99509255A>T	ENST00000393677.4	+	6	780	c.576A>T	c.(574-576)acA>acT	p.T192T	ZFYVE27_ENST00000357540.4_Silent_p.T106T|ZFYVE27_ENST00000370613.3_Silent_p.T74T|ZFYVE27_ENST00000370610.3_Silent_p.T94T|ZFYVE27_ENST00000453958.2_Silent_p.T192T|ZFYVE27_ENST00000337540.7_Silent_p.T160T|ZFYVE27_ENST00000356257.4_Silent_p.T192T|ZFYVE27_ENST00000359980.3_Silent_p.T192T	NM_144588.6	NP_653189.3	Q5T4F4	ZFY27_HUMAN	zinc finger, FYVE domain containing 27	192					cell death (GO:0008219)|neuron projection development (GO:0031175)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein localization to plasma membrane (GO:0072659)	axon (GO:0030424)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)	metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	8		Colorectal(252;0.0846)		Epithelial(162;7.08e-10)|all cancers(201;5.18e-08)		TTCTGGGCACAGTCTGCATGC	0.517																																					p.T192T		Atlas-SNP	.											.	ZFYVE27	31	.	0			c.A576T						.						142.0	118.0	126.0					10																	99509255		2203	4300	6503	SO:0001819	synonymous_variant	118813	exon5			GGGCACAGTCTGC	BC030621	CCDS31263.1, CCDS31264.1, CCDS53562.1, CCDS53563.1, CCDS53564.1, CCDS53565.1	10q24.2	2013-09-11			ENSG00000155256	ENSG00000155256		"""Zinc fingers, FYVE domain containing"""	26559	protein-coding gene	gene with protein product	"""protrudin"""	610243				14702039	Standard	NM_144588		Approved	FLJ32919, SPG33	uc001kol.2	Q5T4F4	OTTHUMG00000018867	ENST00000393677.4:c.576A>T	chr10.hg19:g.99509255A>T		58.0	0.0		51.0	21.0	NM_001002261	B7Z3S0|B7Z404|B7Z626|G8JLC3|G8JLF0|J3KP98|Q5T4F1|Q5T4F2|Q5T4F3|Q8N1K0|Q8N6D6|Q8NCA0|Q8NDE4|Q96M08	Silent	SNP	ENST00000393677.4	hg19	CCDS31263.1																																																																																			.	.		0.517	ZFYVE27-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049745.2	NM_144588	
MKI67	4288	hgsc.bcm.edu	37	10	129903317	129903317	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr10:129903317C>A	ENST00000368654.3	-	13	7162	c.6787G>T	c.(6787-6789)Ggg>Tgg	p.G2263W	MKI67_ENST00000368653.3_Missense_Mutation_p.G1903W	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2263	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				ATAGCTTTCCCTACTGATGGT	0.473																																					p.G2263W		Atlas-SNP	.											.	MKI67	363	.	0			c.G6787T						.						318.0	289.0	299.0					10																	129903317		2203	4300	6503	SO:0001583	missense	4288	exon13			CTTTCCCTACTGA	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6787G>T	chr10.hg19:g.129903317C>A	ENSP00000357643:p.Gly2263Trp	82.0	0.0		68.0	22.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687573	0.29962	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.04360	3.64;3.64	2.65	-0.558	0.11796	.	2.301870	0.02101	N	0.053950	T	0.17365	0.0417	M	0.68952	2.095	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.992;0.999;0.999	T	0.11891	-1.0569	10	0.66056	D	0.02	.	3.705	0.08397	0.0:0.2846:0.4109:0.3045	.	2262;1903;2263	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	W	2263;1903;2262	ENSP00000357643:G2263W;ENSP00000357642:G1903W	ENSP00000357642:G1903W	G	-	1	0	MKI67	129793307	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.329000	0.02677	-0.109000	0.12044	-0.136000	0.14681	GGG	.	.		0.473	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
POU2AF1	5450	hgsc.bcm.edu	37	11	111228301	111228301	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr11:111228301C>T	ENST00000393067.3	-	4	839	c.325G>A	c.(325-327)Gtg>Atg	p.V109M		NM_006235.2	NP_006226.2	Q16633	OBF1_HUMAN	POU class 2 associating factor 1	109					humoral immune response (GO:0006959)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			breast(1)|kidney(2)|lung(2)	5		all_cancers(61;1.36e-12)|all_epithelial(67;1.87e-07)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|all_neural(223;0.0146)|Medulloblastoma(222;0.0245)|Breast(348;0.0389)		Epithelial(105;1.01e-06)|BRCA - Breast invasive adenocarcinoma(274;3.12e-06)|all cancers(92;1.8e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0364)		TCATGGGGCACATACTCGGTG	0.647			T	BCL6	NHL																																p.V109M		Atlas-SNP	.		Dom	yes		11	11q23.1	5450	"""POU domain, class 2, associating factor 1 (OBF1)"""		L	.	POU2AF1	23	.	0			c.G325A						.						48.0	46.0	47.0					11																	111228301		2201	4297	6498	SO:0001583	missense	5450	exon4			GGGGCACATACTC		CCDS31675.1	11q23.1	2011-06-01	2007-07-13			ENSG00000110777			9211	protein-coding gene	gene with protein product		601206	"""POU domain class 2, associating factor 1"""			8617501	Standard	NM_006235		Approved	OBF1	uc001plg.4	Q16633		ENST00000393067.3:c.325G>A	chr11.hg19:g.111228301C>T	ENSP00000376786:p.Val109Met	178.0	0.0		130.0	45.0	NM_006235	B2R8Z9|Q14983	Missense_Mutation	SNP	ENST00000393067.3	hg19	CCDS31675.1	.	.	.	.	.	.	.	.	.	.	C	10.65	1.409405	0.25378	.	.	ENSG00000110777	ENST00000393067;ENST00000531398	T;T	0.35421	1.31;1.31	4.87	2.67	0.31697	.	0.545614	0.19102	N	0.122673	T	0.18257	0.0438	N	0.12182	0.205	0.28599	N	0.909276	B	0.22541	0.071	B	0.22152	0.038	T	0.06058	-1.0848	10	0.45353	T	0.12	.	6.008	0.19557	0.1683:0.6612:0.0:0.1706	.	109	Q16633	OBF1_HUMAN	M	109;111	ENSP00000376786:V109M;ENSP00000433527:V111M	ENSP00000376786:V109M	V	-	1	0	POU2AF1	110733511	0.658000	0.27402	1.000000	0.80357	0.711000	0.40976	0.464000	0.21988	2.249000	0.74217	0.498000	0.49722	GTG	.	.		0.647	POU2AF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391002.1	NM_006235	
AMICA1	120425	hgsc.bcm.edu	37	11	118067460	118067460	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr11:118067460T>C	ENST00000356289.5	-	9	1255	c.1082A>G	c.(1081-1083)tAc>tGc	p.Y361C	AMICA1_ENST00000526620.1_Missense_Mutation_p.Y322C|AMICA1_ENST00000292067.7_Missense_Mutation_p.Y351C|AMICA1_ENST00000533261.1_Missense_Mutation_p.Y350C	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	361					blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CATGGTCATGTAGGTGGCCTC	0.522																																					p.Y361C		Atlas-SNP	.											.	AMICA1	49	.	0			c.A1082G						.						232.0	192.0	205.0					11																	118067460		2200	4296	6496	SO:0001583	missense	120425	exon9			GTCATGTAGGTGG	AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.1082A>G	chr11.hg19:g.118067460T>C	ENSP00000348635:p.Tyr361Cys	68.0	0.0		52.0	15.0	NM_001098526	B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Missense_Mutation	SNP	ENST00000356289.5	hg19	CCDS41723.1	.	.	.	.	.	.	.	.	.	.	T	17.62	3.435333	0.62955	.	.	ENSG00000160593	ENST00000356289;ENST00000292067;ENST00000533261;ENST00000526620	D;D;D;D	0.99319	-5.23;-5.22;-5.41;-5.74	5.19	5.19	0.71726	.	0.000000	0.39544	N	0.001325	D	0.98738	0.9576	L	0.34521	1.04	0.41522	D	0.988405	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.997;0.999	D	0.99264	1.0891	10	0.87932	D	0	-16.9565	11.3658	0.49671	0.0:0.0:0.0:1.0	.	361;350;351	Q86YT9;E9PR26;Q86YT9-2	JAML1_HUMAN;.;.	C	361;351;350;322	ENSP00000348635:Y361C;ENSP00000292067:Y351C;ENSP00000436117:Y350C;ENSP00000431218:Y322C	ENSP00000292067:Y351C	Y	-	2	0	AMICA1	117572670	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	3.432000	0.52824	2.179000	0.69175	0.482000	0.46254	TAC	.	.		0.522	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392105.2	NM_153206	
PANX3	116337	hgsc.bcm.edu	37	11	124489377	124489377	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr11:124489377G>A	ENST00000284288.2	+	4	792	c.725G>A	c.(724-726)tGc>tAc	p.C242Y		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	242					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		GAATTCAGCTGCTCCATCAAG	0.493																																					p.C242Y		Atlas-SNP	.											.	PANX3	52	.	0			c.G725A						.						114.0	94.0	101.0					11																	124489377		2201	4299	6500	SO:0001583	missense	116337	exon4			TCAGCTGCTCCAT	AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.725G>A	chr11.hg19:g.124489377G>A	ENSP00000284288:p.Cys242Tyr	104.0	0.0		85.0	26.0	NM_052959		Missense_Mutation	SNP	ENST00000284288.2	hg19	CCDS8447.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202208	0.79127	.	.	ENSG00000154143	ENST00000284288	T	0.28454	1.61	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.61476	0.2350	M	0.82323	2.585	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.67530	-0.5647	10	0.87932	D	0	-14.9584	18.8151	0.92073	0.0:0.0:1.0:0.0	.	242	Q96QZ0	PANX3_HUMAN	Y	242	ENSP00000284288:C242Y	ENSP00000284288:C242Y	C	+	2	0	PANX3	123994587	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.234000	0.95347	2.459000	0.83118	0.561000	0.74099	TGC	.	.		0.493	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387064.1		
DENND5B	160518	hgsc.bcm.edu	37	12	31586180	31586180	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr12:31586180C>T	ENST00000389082.5	-	8	2279	c.2015G>A	c.(2014-2016)cGc>cAc	p.R672H	DENND5B_ENST00000536562.1_Missense_Mutation_p.R707H|DENND5B_ENST00000306833.6_Missense_Mutation_p.R707H|DENND5B_ENST00000354285.4_Missense_Mutation_p.R694H	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	672					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						ACTTACCCAGCGACTGAAACA	0.418																																					p.R672H		Atlas-SNP	.											.	DENND5B	114	.	0			c.G2015A						.						132.0	136.0	135.0					12																	31586180		2058	4214	6272	SO:0001583	missense	160518	exon8			ACCCAGCGACTGA	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.2015G>A	chr12.hg19:g.31586180C>T	ENSP00000373734:p.Arg672His	77.0	0.0		49.0	13.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	ENST00000389082.5	hg19	CCDS44857.1	.	.	.	.	.	.	.	.	.	.	C	29.4	5.000420	0.93227	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562;ENST00000354285	T;T;T;T	0.09350	3.64;3.74;3.74;2.99	4.13	4.13	0.48395	.	0.165830	0.40554	N	0.001071	T	0.24624	0.0597	L	0.47716	1.5	0.52501	D	0.999958	D;D;D	0.71674	0.998;0.996;0.996	D;P;P	0.64877	0.93;0.742;0.852	T	0.01309	-1.1389	10	0.42905	T	0.14	-10.7244	16.6004	0.84815	0.0:1.0:0.0:0.0	.	694;672;707	Q6ZUT9-4;Q6ZUT9;G3V1S3	.;DEN5B_HUMAN;.	H	672;707;707;694	ENSP00000373734:R672H;ENSP00000306482:R707H;ENSP00000444889:R707H;ENSP00000346238:R694H	ENSP00000306482:R707H	R	-	2	0	DENND5B	31477447	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.306000	0.65756	2.131000	0.65755	0.655000	0.94253	CGC	.	.		0.418	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
KRT81	3887	hgsc.bcm.edu	37	12	52681031	52681031	+	Silent	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr12:52681031G>A	ENST00000327741.5	-	7	1170	c.1102C>T	c.(1102-1104)Ctg>Ttg	p.L368L	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	368	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		AGCTCGGCCAGCTTGCAGCGG	0.622																																					p.L368L		Atlas-SNP	.											KRT81,NS,carcinoma,0,1	KRT81	46	.	0			c.C1102T						.						43.0	41.0	42.0					12																	52681031		2203	4297	6500	SO:0001819	synonymous_variant	3887	exon7			CGGCCAGCTTGCA	X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.1102C>T	chr12.hg19:g.52681031G>A		95.0	0.0		68.0	29.0	NM_002281	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Silent	SNP	ENST00000327741.5	hg19	CCDS31805.1																																																																																			.	.		0.622	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395128.2	NM_002281	
ZNF140	7699	hgsc.bcm.edu	37	12	133682814	133682814	+	Silent	SNP	T	T	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr12:133682814T>G	ENST00000355557.2	+	5	2234	c.951T>G	c.(949-951)acT>acG	p.T317T	ZNF140_ENST00000544426.1_Silent_p.T214T|ZNF140_ENST00000440550.2_3'UTR	NM_003440.2	NP_003431.2	P52738	ZN140_HUMAN	zinc finger protein 140	317					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;1.28e-06)|all_epithelial(31;0.0051)|Lung NSC(355;0.114)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CACACCTTACTCGACATCAGA	0.423																																					p.T317T		Atlas-SNP	.											.	ZNF140	18	.	0			c.T951G						.						116.0	107.0	110.0					12																	133682814		2203	4300	6503	SO:0001819	synonymous_variant	7699	exon5			CCTTACTCGACAT	U09368	CCDS9282.1, CCDS73550.1	12q24.33	2013-01-08	2006-06-13		ENSG00000196387	ENSG00000196387		"""Zinc fingers, C2H2-type"", ""-"""	12925	protein-coding gene	gene with protein product		604082	"""zinc finger protein 140 (clone pHZ-39)"""			7557990	Standard	XR_245353		Approved	pHZ-39	uc001ulo.3	P52738	OTTHUMG00000167942	ENST00000355557.2:c.951T>G	chr12.hg19:g.133682814T>G		91.0	0.0		98.0	31.0	NM_003440	D3DXJ3|Q05CP6|Q8IV75	Silent	SNP	ENST00000355557.2	hg19	CCDS9282.1																																																																																			.	.		0.423	ZNF140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397169.1	NM_003440	
ZC3H13	23091	hgsc.bcm.edu	37	13	46541986	46541986	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr13:46541986C>A	ENST00000242848.4	-	15	4322	c.3974G>T	c.(3973-3975)cGa>cTa	p.R1325L	ZC3H13_ENST00000378921.2_Missense_Mutation_p.R281L|ZC3H13_ENST00000282007.3_Missense_Mutation_p.R1325L			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	1325							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		atcagcatctcggtcccattc	0.488																																					p.R1325L	Esophageal Squamous(187;747 2077 11056 31291 44172)	Atlas-SNP	.											.	ZC3H13	197	.	0			c.G3974T						.						314.0	210.0	246.0					13																	46541986		2203	4300	6503	SO:0001583	missense	23091	exon15			GCATCTCGGTCCC	AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.3974G>T	chr13.hg19:g.46541986C>A	ENSP00000242848:p.Arg1325Leu	52.0	0.0		62.0	27.0	NM_015070	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	ENST00000242848.4	hg19		.	.	.	.	.	.	.	.	.	.	C	16.16	3.045346	0.55110	.	.	ENSG00000123200	ENST00000242848;ENST00000378921;ENST00000282007	T;T;T	0.37915	2.19;1.91;1.17	5.28	5.28	0.74379	.	0.000000	0.45606	D	0.000345	T	0.57475	0.2056	L	0.55481	1.735	0.58432	D	0.999998	D;D	0.67145	0.993;0.996	D;D	0.79108	0.982;0.992	T	0.59526	-0.7438	10	0.72032	D	0.01	.	18.5206	0.90951	0.0:1.0:0.0:0.0	.	1325;1325	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	L	1325;281;1325	ENSP00000242848:R1325L;ENSP00000368201:R281L;ENSP00000282007:R1325L	ENSP00000242848:R1325L	R	-	2	0	ZC3H13	45439987	1.000000	0.71417	0.928000	0.36995	0.570000	0.35934	5.336000	0.65935	2.461000	0.83175	0.591000	0.81541	CGA	.	.		0.488	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000044789.1	NM_015070	
VIPAS39	63894	hgsc.bcm.edu	37	14	77900204	77900204	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr14:77900204T>C	ENST00000553888.1	-	16	1670	c.1160A>G	c.(1159-1161)gAt>gGt	p.D387G	VIPAS39_ENST00000557658.1_Missense_Mutation_p.D387G|VIPAS39_ENST00000327028.4_Missense_Mutation_p.D374G|VIPAS39_ENST00000343765.2_Missense_Mutation_p.D387G|VIPAS39_ENST00000448935.2_Missense_Mutation_p.D338G|VIPAS39_ENST00000556412.1_Missense_Mutation_p.D413G	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	387					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											GAATAGGGCATCTACATCATT	0.498																																					p.D387G		Atlas-SNP	.											.	.	.	.	0			c.A1160G						.						106.0	94.0	98.0					14																	77900204		2203	4300	6503	SO:0001583	missense	63894	exon16			AGGGCATCTACAT	AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.1160A>G	chr14.hg19:g.77900204T>C	ENSP00000452181:p.Asp387Gly	198.0	0.0		174.0	51.0	NM_001193314	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	ENST00000553888.1	hg19	CCDS9862.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.436693	0.83885	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412	T;T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4;0.4	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.982	T	0.72293	-0.4336	10	0.87932	D	0	-16.3086	15.0021	0.71483	0.0:0.0:0.0:1.0	.	338;387	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	G	387;387;374;387;338;413	ENSP00000339122:D387G;ENSP00000452181:D387G;ENSP00000313098:D374G;ENSP00000452191:D387G;ENSP00000404815:D338G;ENSP00000451857:D413G	ENSP00000313098:D374G	D	-	2	0	VIPAR	76969957	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	6.964000	0.76061	2.034000	0.60081	0.482000	0.46254	GAT	.	.		0.498	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414008.1	NM_022067	
VIPAS39	63894	hgsc.bcm.edu	37	14	77900210	77900210	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr14:77900210T>G	ENST00000553888.1	-	16	1664	c.1154A>C	c.(1153-1155)gAt>gCt	p.D385A	VIPAS39_ENST00000557658.1_Missense_Mutation_p.D385A|VIPAS39_ENST00000327028.4_Missense_Mutation_p.D372A|VIPAS39_ENST00000343765.2_Missense_Mutation_p.D385A|VIPAS39_ENST00000448935.2_Missense_Mutation_p.D336A|VIPAS39_ENST00000556412.1_Missense_Mutation_p.D411A	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	385					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											GGCATCTACATCATTCCAGGC	0.502																																					p.D385A		Atlas-SNP	.											.	.	.	.	0			c.A1154C						.						107.0	95.0	99.0					14																	77900210		2203	4300	6503	SO:0001583	missense	63894	exon16			TCTACATCATTCC	AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.1154A>C	chr14.hg19:g.77900210T>G	ENSP00000452181:p.Asp385Ala	202.0	0.0		172.0	52.0	NM_001193314	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	ENST00000553888.1	hg19	CCDS9862.1	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785578	0.70337	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412	T;T;T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03;-0.03;-0.03	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.62097	0.2400	L	0.55481	1.735	0.80722	D	1	B;P	0.39696	0.437;0.683	B;B	0.42798	0.17;0.398	T	0.61138	-0.7123	10	0.32370	T	0.25	-16.3401	15.0021	0.71483	0.0:0.0:0.0:1.0	.	336;385	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	A	385;385;372;385;336;411	ENSP00000339122:D385A;ENSP00000452181:D385A;ENSP00000313098:D372A;ENSP00000452191:D385A;ENSP00000404815:D336A;ENSP00000451857:D411A	ENSP00000313098:D372A	D	-	2	0	VIPAR	76969963	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	6.964000	0.76061	2.034000	0.60081	0.482000	0.46254	GAT	.	.		0.502	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414008.1	NM_022067	
PPP2R5C	5527	hgsc.bcm.edu	37	14	102285330	102285330	+	Intron	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr14:102285330G>A	ENST00000334743.5	+	1	142				PPP2R5C_ENST00000445439.3_Intron|PPP2R5C_ENST00000350249.3_Intron|PPP2R5C_ENST00000328724.5_Intron|PPP2R5C_ENST00000557714.1_Intron|PPP2R5C_ENST00000422945.2_Splice_Site_p.G32E|PPP2R5C_ENST00000557095.1_Intron|PPP2R5C_ENST00000556068.1_3'UTR|PPP2R5C_ENST00000554442.1_Intron|PPP2R5C_ENST00000556946.1_Intron	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma						DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						TCACTCTAGGGAACAAGTCCT	0.403																																					p.G32E		Atlas-SNP	.											.	PPP2R5C	74	.	0			c.G95A						.						121.0	101.0	107.0					14																	102285330		692	1591	2283	SO:0001627	intron_variant	5527	exon3			TCTAGGGAACAAG	L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.94+8957G>A	chr14.hg19:g.102285330G>A		77.0	0.0		68.0	16.0	NM_001161725	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	ENST00000334743.5	hg19	CCDS9964.1	.	.	.	.	.	.	.	.	.	.	G	0.163	-1.078923	0.01903	.	.	ENSG00000078304	ENST00000422945;ENST00000557268	T;T	0.41065	1.04;1.01	3.38	2.49	0.30216	.	.	.	.	.	T	0.24736	0.0600	L	0.34521	1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.31194	-0.9952	9	0.02654	T	1	.	6.8767	0.24151	0.1274:0.0:0.8726:0.0	.	32	F5GWP3	.	E	32;30	ENSP00000412324:G32E;ENSP00000450931:G30E	ENSP00000412324:G32E	G	+	2	0	PPP2R5C	101355083	0.004000	0.15560	0.004000	0.12327	0.103000	0.19146	0.519000	0.22862	1.003000	0.39130	-0.137000	0.14449	GGA	.	.		0.403	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414373.2	NM_002719	
CEP170B	283638	hgsc.bcm.edu	37	14	105359964	105359964	+	Silent	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr14:105359964C>T	ENST00000414716.3	+	15	4371	c.4143C>T	c.(4141-4143)gaC>gaT	p.D1381D	CEP170B_ENST00000418279.1_Silent_p.D1311D|CEP170B_ENST00000453495.1_Silent_p.D1417D|CEP170B_ENST00000556508.1_Silent_p.D1346D	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1416						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GCTGTGAGGACGCCCTGGCCA	0.672																																					p.D1381D		Atlas-SNP	.											.	.	.	.	0			c.C4143T						.						15.0	19.0	17.0					14																	105359964		2133	4221	6354	SO:0001819	synonymous_variant	283638	exon15			TGAGGACGCCCTG	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.4143C>T	chr14.hg19:g.105359964C>T		118.0	0.0		125.0	11.0	NM_001112726	Q2KHR7|Q86TI7	Silent	SNP	ENST00000414716.3	hg19	CCDS45175.1																																																																																			.	.		0.672	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
SLC24A5	283652	hgsc.bcm.edu	37	15	48431227	48431227	+	Silent	SNP	C	C	T	rs112771038		TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr15:48431227C>T	ENST00000341459.3	+	7	1006	c.933C>T	c.(931-933)tcC>tcT	p.S311S	SLC24A5_ENST00000449382.2_Silent_p.S251S	NM_205850.2	NP_995322.1	Q71RS6	NCKX5_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 5	311					ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|negative regulation of melanin biosynthetic process (GO:0048022)|response to stimulus (GO:0050896)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|skin(1)|upper_aerodigestive_tract(1)	27		all_lung(180;0.00217)		all cancers(107;3.29e-10)|GBM - Glioblastoma multiforme(94;7.32e-07)		GGGTATTATCCCTTCCTATTA	0.318																																					p.S311S		Atlas-SNP	.											.	SLC24A5	64	.	0			c.C933T						.						61.0	63.0	62.0					15																	48431227		2197	4292	6489	SO:0001819	synonymous_variant	283652	exon7			ATTATCCCTTCCT	AF348468	CCDS10128.1	15q21.1	2014-01-28	2013-07-18		ENSG00000188467	ENSG00000188467		"""Solute carriers"""	20611	protein-coding gene	gene with protein product	"""oculocutaneous albinism 6 (autosomal recessive)"""	609802	"""solute carrier family 24, member 5"""			23364476	Standard	XM_005254308		Approved	JSX, OCA6	uc001zwe.3	Q71RS6	OTTHUMG00000131494	ENST00000341459.3:c.933C>T	chr15.hg19:g.48431227C>T		229.0	0.0		172.0	53.0	NM_205850	A5X8Z8|A5X8Z9|Q14CT4|Q6DKH3	Silent	SNP	ENST00000341459.3	hg19	CCDS10128.1																																																																																			.	T|1.000;|0.000		0.318	SLC24A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254340.2	NM_205850	
UNC13C	440279	hgsc.bcm.edu	37	15	54542554	54542554	+	Silent	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr15:54542554C>T	ENST00000260323.11	+	7	3360	c.3360C>T	c.(3358-3360)ggC>ggT	p.G1120G	UNC13C_ENST00000537900.1_Silent_p.G1118G|UNC13C_ENST00000545554.1_Silent_p.G1120G	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1120					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCCTGTGGGGCATTGCAAGGC	0.512																																					p.G1120G		Atlas-SNP	.											.	UNC13C	674	.	0			c.C3360T						.						102.0	100.0	101.0					15																	54542554		2145	4280	6425	SO:0001819	synonymous_variant	440279	exon6			GTGGGGCATTGCA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.3360C>T	chr15.hg19:g.54542554C>T		76.0	0.0		77.0	21.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Silent	SNP	ENST00000260323.11	hg19	CCDS45264.1																																																																																			.	.		0.512	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
ZNF768	79724	hgsc.bcm.edu	37	16	30536644	30536644	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr16:30536644C>T	ENST00000380412.5	-	2	992	c.817G>A	c.(817-819)Ggc>Agc	p.G273S	ZNF768_ENST00000562803.1_Missense_Mutation_p.G242S	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	273					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						AGGGTGGAGCCCCGCCCGAAG	0.652																																					p.G273S		Atlas-SNP	.											.	ZNF768	28	.	0			c.G817A						.						56.0	56.0	56.0					16																	30536644		2197	4300	6497	SO:0001583	missense	79724	exon2			TGGAGCCCCGCCC	BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.817G>A	chr16.hg19:g.30536644C>T	ENSP00000369777:p.Gly273Ser	40.0	0.0		42.0	19.0	NM_024671	Q569L7|Q96CX4	Missense_Mutation	SNP	ENST00000380412.5	hg19	CCDS10681.2	.	.	.	.	.	.	.	.	.	.	C	11.35	1.611572	0.28712	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	T	0.07114	3.22	4.99	4.99	0.66335	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.139827	0.33438	N	0.004919	T	0.02083	0.0065	N	0.01091	-1.02	0.22693	N	0.998843	B	0.30326	0.276	B	0.29267	0.1	T	0.45071	-0.9286	10	0.02654	T	1	-13.8205	7.4079	0.27001	0.0:0.8227:0.0:0.1773	.	273	Q9H5H4	ZN768_HUMAN	S	273;242	ENSP00000369777:G273S	ENSP00000369777:G273S	G	-	1	0	ZNF768	30444145	0.000000	0.05858	1.000000	0.80357	0.646000	0.38490	0.329000	0.19698	2.601000	0.87937	0.462000	0.41574	GGC	.	.		0.652	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255522.2	NM_024671	
SPG7	6687	hgsc.bcm.edu	37	16	89620237	89620237	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr16:89620237G>T	ENST00000268704.2	+	15	1987	c.1972G>T	c.(1972-1974)Gcc>Tcc	p.A658S		NM_003119.2	NP_003110.1	Q9UQ90	SPG7_HUMAN	spastic paraplegia 7 (pure and complicated autosomal recessive)	658					anterograde axon cargo transport (GO:0008089)|cell death (GO:0008219)|mitochondrion organization (GO:0007005)|nervous system development (GO:0007399)|proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|peptidase activity (GO:0008233)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|urinary_tract(1)	20		all_hematologic(23;0.00824)|Colorectal(91;0.102)		all cancers(4;1.39e-07)|OV - Ovarian serous cystadenocarcinoma(4;5.64e-06)|BRCA - Breast invasive adenocarcinoma(80;0.015)		CACCCGCATCGCCTACTCCAT	0.672																																					p.A658S		Atlas-SNP	.											.	SPG7	75	.	0			c.G1972T						.						96.0	76.0	83.0					16																	89620237		2198	4300	6498	SO:0001583	missense	6687	exon15			CGCATCGCCTACT	Y16610	CCDS10977.1, CCDS10978.1	16q24.3	2010-04-21	2007-04-23		ENSG00000197912	ENSG00000197912		"""ATPases / AAA-type"""	11237	protein-coding gene	gene with protein product	"""paraplegin"""	602783	"""cell matrix adhesion regulator"""	CMAR		9635427, 9634528	Standard	XM_006721264		Approved	CAR, SPG5C	uc002fnj.3	Q9UQ90	OTTHUMG00000138046	ENST00000268704.2:c.1972G>T	chr16.hg19:g.89620237G>T	ENSP00000268704:p.Ala658Ser	102.0	0.0		68.0	4.0	NM_003119	O75756|Q2TB70|Q58F00|Q96IB0	Missense_Mutation	SNP	ENST00000268704.2	hg19	CCDS10977.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834236	0.91036	.	.	ENSG00000197912	ENST00000268704	D	0.90788	-2.73	5.06	5.06	0.68205	Peptidase M41 (1);Peptidase M41, FtsH (2);	0.000000	0.85682	D	0.000000	D	0.96608	0.8893	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97636	1.0145	10	0.72032	D	0.01	.	17.4535	0.87599	0.0:0.0:1.0:0.0	.	658	Q9UQ90	SPG7_HUMAN	S	658	ENSP00000268704:A658S	ENSP00000268704:A658S	A	+	1	0	SPG7	88147738	1.000000	0.71417	0.928000	0.36995	0.675000	0.39556	9.423000	0.97461	2.342000	0.79632	0.563000	0.77884	GCC	.	.		0.672	SPG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269921.2	NM_003119	
ZZEF1	23140	hgsc.bcm.edu	37	17	4016072	4016072	+	Silent	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr17:4016072C>T	ENST00000381638.2	-	5	1021	c.897G>A	c.(895-897)agG>agA	p.R299R	ZZEF1_ENST00000574474.1_5'UTR|snoU13_ENST00000459263.1_RNA	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	299	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.						calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						TGGACAGGTGCCTAAGCACAA	0.473																																					p.R299R		Atlas-SNP	.											.	ZZEF1	195	.	0			c.G897A						.						58.0	44.0	49.0					17																	4016072		2203	4300	6503	SO:0001819	synonymous_variant	23140	exon5			CAGGTGCCTAAGC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.897G>A	chr17.hg19:g.4016072C>T		60.0	0.0		41.0	13.0	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Silent	SNP	ENST00000381638.2	hg19	CCDS11043.1																																																																																			.	.		0.473	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
GID4	79018	hgsc.bcm.edu	37	17	17962265	17962265	+	Silent	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr17:17962265C>T	ENST00000268719.4	+	4	863	c.690C>T	c.(688-690)taC>taT	p.Y230Y		NM_024052.4	NP_076957.3	Q8IVV7	GID4_HUMAN	GID complex subunit 4	230								p.Y230Y(1)									ATGGAGACTACGTCTTCATGA	0.463																																					p.Y230Y		Atlas-SNP	.											C17orf39,NS,carcinoma,0,1	.	.	.	1	Substitution - coding silent(1)	ovary(1)	c.C690T						.						74.0	67.0	70.0					17																	17962265		2203	4300	6503	SO:0001819	synonymous_variant	79018	exon4			AGACTACGTCTTC	AK127580	CCDS11190.1	17p11.2	2013-07-31	2013-07-31	2012-07-20	ENSG00000141034	ENSG00000141034			28453	protein-coding gene	gene with protein product	"""vacuolar import and degradation 24"""		"""chromosome 17 open reading frame 39"", ""GID complex subunit 4, VID24 homolog (S. cerevisiae)"""	C17orf39		11997338	Standard	NM_024052		Approved	VID24	uc002gsg.1	Q8IVV7	OTTHUMG00000059398	ENST00000268719.4:c.690C>T	chr17.hg19:g.17962265C>T		87.0	0.0		82.0	4.0	NM_024052	Q8TEB5|Q9BW50	Silent	SNP	ENST00000268719.4	hg19	CCDS11190.1																																																																																			.	.		0.463	GID4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132071.2	NM_024052	
AANAT	15	hgsc.bcm.edu	37	17	74465835	74465835	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr17:74465835G>A	ENST00000392492.3	+	4	641	c.407G>A	c.(406-408)gGc>gAc	p.G136D	AANAT_ENST00000250615.3_Missense_Mutation_p.G181D	NM_001088.2	NP_001079.1	Q16613	SNAT_HUMAN	aralkylamine N-acetyltransferase	136	Acetyl-CoA binding. {ECO:0000250}.|N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.				cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|N-terminal protein amino acid acetylation (GO:0006474)|response to calcium ion (GO:0051592)|response to copper ion (GO:0046688)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to insulin (GO:0032868)|response to light stimulus (GO:0009416)|response to prostaglandin E (GO:0034695)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	aralkylamine N-acetyltransferase activity (GO:0004059)|arylamine N-acetyltransferase activity (GO:0004060)			lung(1)	1						CAGGGCAGGGGCCCCATCCTG	0.706																																					p.G181D		Atlas-SNP	.											.	AANAT	7	.	0			c.G542A						.						8.0	8.0	8.0					17																	74465835		2174	4251	6425	SO:0001583	missense	15	exon7			GCAGGGGCCCCAT	U40347	CCDS11745.1, CCDS54169.1	17q25.1	2013-10-15	2010-05-07		ENSG00000129673	ENSG00000129673	2.3.1.87		19	protein-coding gene	gene with protein product	"""serotonin N-acetyltransferase"""	600950	"""arylalkylamine N-acetyltransferase"""			8661026	Standard	NM_001088		Approved	SNAT	uc002jro.3	Q16613	OTTHUMG00000180179	ENST00000392492.3:c.407G>A	chr17.hg19:g.74465835G>A	ENSP00000376282:p.Gly136Asp	63.0	0.0		46.0	13.0	NM_001166579	A0AVF2|J3KMZ5|Q562F4	Missense_Mutation	SNP	ENST00000392492.3	hg19	CCDS11745.1	.	.	.	.	.	.	.	.	.	.	G	31	5.065866	0.93898	.	.	ENSG00000129673	ENST00000250615;ENST00000392492	T;T	0.57436	0.4;0.4	5.13	5.13	0.70059	GCN5-related N-acetyltransferase (GNAT) domain (2);Acyl-CoA N-acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.83552	0.5279	H	0.98068	4.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90212	0.4265	10	0.87932	D	0	-7.8365	18.5824	0.91176	0.0:0.0:1.0:0.0	.	136	Q16613	SNAT_HUMAN	D	181;136	ENSP00000250615:G181D;ENSP00000376282:G136D	ENSP00000250615:G181D	G	+	2	0	AANAT	71977430	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	9.252000	0.95491	2.380000	0.81148	0.462000	0.41574	GGC	.	.		0.706	AANAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450130.1	NM_001088	
TMC6	11322	hgsc.bcm.edu	37	17	76120700	76120700	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr17:76120700G>C	ENST00000590602.1	-	8	955	c.796C>G	c.(796-798)Ctg>Gtg	p.L266V	TMC6_ENST00000592076.1_5'Flank|TMC6_ENST00000322914.3_Missense_Mutation_p.L266V|TMC6_ENST00000392467.3_Missense_Mutation_p.L266V|TMC6_ENST00000591436.1_5'Flank|TMC6_ENST00000589553.1_Missense_Mutation_p.L39V|TMC6_ENST00000306591.7_Missense_Mutation_p.L266V|TMC6_ENST00000322933.4_5'UTR			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	266				L -> P (in Ref. 2; AAP69874). {ECO:0000305}.	ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			AAGGCCACCAGCAGCAGCAGC	0.672																																					p.L266V		Atlas-SNP	.											.	TMC6	42	.	0			c.C796G						.						19.0	19.0	19.0					17																	76120700		2183	4244	6427	SO:0001583	missense	11322	exon8			CCACCAGCAGCAG	AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.796C>G	chr17.hg19:g.76120700G>C	ENSP00000465261:p.Leu266Val	73.0	0.0		74.0	4.0	NM_001127198	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Missense_Mutation	SNP	ENST00000590602.1	hg19	CCDS32748.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.650996	0.29336	.	.	ENSG00000141524	ENST00000322914;ENST00000392467;ENST00000306591	T;T;T	0.54279	0.58;0.58;0.58	3.64	1.38	0.22167	.	1.022600	0.07798	N	0.955959	T	0.53498	0.1800	L	0.53249	1.67	0.33038	D	0.531028	P;D;D;D;B	0.58268	0.713;0.981;0.981;0.982;0.23	B;P;P;P;B	0.57101	0.246;0.813;0.761;0.664;0.082	T	0.56974	-0.7890	10	0.06891	T	0.86	-10.1151	4.5808	0.12257	0.211:0.184:0.605:0.0	.	103;266;39;266;266	B4E003;Q7Z403-2;Q7Z403-4;B3KTU5;Q7Z403	.;.;.;.;TMC6_HUMAN	V	266	ENSP00000313408:L266V;ENSP00000376260:L266V;ENSP00000306405:L266V	ENSP00000306405:L266V	L	-	1	2	TMC6	73632295	0.228000	0.23718	0.981000	0.43875	0.146000	0.21551	0.651000	0.24873	0.497000	0.27926	0.462000	0.41574	CTG	.	.		0.672	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437146.1		
PRODH2	58510	hgsc.bcm.edu	37	19	36291013	36291013	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr19:36291013C>T	ENST00000301175.3	-	11	1555	c.1538G>A	c.(1537-1539)cGc>cAc	p.R513H	AC002398.5_ENST00000433059.1_lincRNA	NM_021232.1	NP_067055.1	Q9UF12	PROD2_HUMAN	proline dehydrogenase (oxidase) 2	513					proline catabolic process to glutamate (GO:0010133)	mitochondrial inner membrane (GO:0005743)	proline dehydrogenase activity (GO:0004657)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	21	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGTTCCCTGCGGGCACCCTG	0.597																																					p.R513H		Atlas-SNP	.											.	PRODH2	68	.	0			c.G1538A						.						36.0	29.0	31.0					19																	36291013		2203	4299	6502	SO:0001583	missense	58510	exon11			TCCCTGCGGGCAC	U80018	CCDS12478.1	19q13.1	2014-07-11				ENSG00000250799			17325	protein-coding gene	gene with protein product							Standard	NM_021232		Approved	HSPOX1	uc002obx.1	Q9UF12		ENST00000301175.3:c.1538G>A	chr19.hg19:g.36291013C>T	ENSP00000301175:p.Arg513His	72.0	0.0		50.0	4.0	NM_021232		Missense_Mutation	SNP	ENST00000301175.3	hg19	CCDS12478.1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.399030	0.83120	.	.	ENSG00000250799	ENST00000301175	T	0.33438	1.41	5.26	4.21	0.49690	Proline dehydrogenase (1);	.	.	.	.	T	0.53916	0.1826	M	0.80508	2.5	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.53542	-0.8424	9	0.46703	T	0.11	.	12.0582	0.53548	0.0:0.9145:0.0:0.0855	.	513	Q9UF12	PROD2_HUMAN	H	513	ENSP00000301175:R513H	ENSP00000301175:R513H	R	-	2	0	PRODH2	40982853	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.796000	0.38794	2.766000	0.95052	0.650000	0.86243	CGC	.	.		0.597	PRODH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452552.2	NM_021232	
SIGLEC9	27180	hgsc.bcm.edu	37	19	51630327	51630327	+	Silent	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr19:51630327A>G	ENST00000250360.3	+	4	856	c.789A>G	c.(787-789)ccA>ccG	p.P263P	SIGLEC9_ENST00000440804.3_Silent_p.P263P	NM_014441.2	NP_055256.1	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9	263	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(3)|lung(25)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	45		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		TGTCACTCCCAGAGGGCCAGT	0.537																																					p.P263P		Atlas-SNP	.											.	SIGLEC9	85	.	0			c.A789G						.						99.0	97.0	97.0					19																	51630327		2203	4300	6503	SO:0001819	synonymous_variant	27180	exon4			ACTCCCAGAGGGC	AF135027	CCDS12825.1, CCDS56100.1	19q13.3-q13.4	2013-01-29			ENSG00000129450	ENSG00000129450		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10878	protein-coding gene	gene with protein product		605640				10903842	Standard	NM_014441		Approved	CD329	uc002pvu.3	Q9Y336		ENST00000250360.3:c.789A>G	chr19.hg19:g.51630327A>G		64.0	0.0		46.0	16.0	NM_001198558	Q6GTU4|Q9BYI9	Silent	SNP	ENST00000250360.3	hg19	CCDS12825.1																																																																																			.	.		0.537	SIGLEC9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464224.1	NM_014441	
ZNF808	388558	hgsc.bcm.edu	37	19	53058362	53058362	+	Silent	SNP	T	T	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr19:53058362T>A	ENST00000359798.4	+	5	2373	c.2193T>A	c.(2191-2193)ggT>ggA	p.G731G		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	731					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		TTCATAGTGGTGAGAAACCTT	0.433																																					p.G731G		Atlas-SNP	.											.	ZNF808	81	.	0			c.T2193A						.						197.0	193.0	194.0					19																	53058362		2203	4300	6503	SO:0001819	synonymous_variant	388558	exon5			TAGTGGTGAGAAA	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.2193T>A	chr19.hg19:g.53058362T>A		134.0	0.0		95.0	27.0	NM_001039886	Q68CN7	Silent	SNP	ENST00000359798.4	hg19	CCDS46167.1																																																																																			.	.		0.433	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
SLC2A10	81031	hgsc.bcm.edu	37	20	45354676	45354676	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr20:45354676A>G	ENST00000359271.2	+	2	1251	c.1001A>G	c.(1000-1002)aAt>aGt	p.N334S		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	334					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GCTGTGCCCAATGCCACCGGG	0.622																																					p.N334S		Atlas-SNP	.											.	SLC2A10	75	.	0			c.A1001G						.						58.0	54.0	55.0					20																	45354676		2203	4300	6503	SO:0001583	missense	81031	exon2			TGCCCAATGCCAC	AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.1001A>G	chr20.hg19:g.45354676A>G	ENSP00000352216:p.Asn334Ser	34.0	0.0		35.0	11.0	NM_030777	A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	ENST00000359271.2	hg19	CCDS13402.1	.	.	.	.	.	.	.	.	.	.	A	5.952	0.359626	0.11239	.	.	ENSG00000197496	ENST00000359271	T	0.81415	-1.49	5.86	4.7	0.59300	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	7.882870	0.00166	N	0.000000	T	0.65657	0.2712	N	0.08118	0	0.24389	N	0.994754	B	0.22346	0.068	B	0.13407	0.009	T	0.56001	-0.8051	10	0.14656	T	0.56	0.9681	8.8693	0.35305	0.7909:0.1384:0.0707:0.0	.	334	O95528	GTR10_HUMAN	S	334	ENSP00000352216:N334S	ENSP00000352216:N334S	N	+	2	0	SLC2A10	44788083	0.986000	0.35501	0.980000	0.43619	0.410000	0.31052	2.777000	0.47717	2.240000	0.73641	0.533000	0.62120	AAT	.	.		0.622	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079578.2		
NCOA3	8202	hgsc.bcm.edu	37	20	46265302	46265303	+	Nonsense_Mutation	DNP	GG	GG	TT			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr20:46265302_46265303GG>TT	ENST00000371998.3	+	12	2363_2364	c.2172_2173GG>TT	c.(2170-2175)caGGag>caTTag	p.724_725QE>H*	NCOA3_ENST00000372004.3_Nonsense_Mutation_p.724_725QE>H*|NCOA3_ENST00000341724.6_Nonsense_Mutation_p.734_735QE>H*|NCOA3_ENST00000371997.3_Nonsense_Mutation_p.734_735QE>H*			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	724					androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TTGTCAAGCAGGAGCAGCTAAG	0.47																																					p.Q734H|p.E735X		Atlas-SNP	.											.	NCOA3	156	.	0			c.G2202T|c.G2203T						.																																			SO:0001587	stop_gained	8202	exon12			CAAGCAGGAGCAG|AAGCAGGAGCAGC	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	Exception_encountered	chr20.hg19:g.46265302_46265303delinsTT	ENSP00000361066:p.Q724_E725delinsH*	140.0|143.0	0.0		130.0|129.0	39.0|38.0	NM_001174088	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000371998.3	hg19	CCDS13407.1																																																																																			.	.		0.470	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
SEPT5	5413	hgsc.bcm.edu	37	22	19707954	19707954	+	Silent	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr22:19707954C>T	ENST00000455784.2	+	6	599	c.474C>T	c.(472-474)taC>taT	p.Y158Y	SEPT5_ENST00000383045.3_Silent_p.Y167Y|GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000438754.2_Silent_p.Y167Y|SEPT5_ENST00000406395.1_Silent_p.Y158Y	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	158	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					GCTGCCTATACTTCATCTCCC	0.592																																					p.Y167Y		Atlas-SNP	.											.	SEPT5	32	.	0			c.C501T						.						112.0	107.0	108.0					22																	19707954		2203	4298	6501	SO:0001819	synonymous_variant	5413	exon5			CCTATACTTCATC	Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.474C>T	chr22.hg19:g.19707954C>T		99.0	0.0		79.0	24.0	NM_001009939	O15251|Q96MY5	Silent	SNP	ENST00000455784.2	hg19	CCDS13764.1	.	.	.	.	.	.	.	.	.	.	C	10.54	1.379782	0.24944	.	.	ENSG00000184702	ENST00000413258	.	.	.	3.6	1.45	0.22620	.	.	.	.	.	T	0.55673	0.1935	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47446	-0.9117	4	.	.	.	.	8.1217	0.30976	0.0:0.7258:0.0:0.2742	.	.	.	.	F	55	.	.	L	+	1	0	SEPT5	18087954	1.000000	0.71417	0.993000	0.49108	0.957000	0.61999	0.864000	0.27926	0.322000	0.23283	0.313000	0.20887	CTT	.	.		0.592	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317937.1	NM_002688	
ZNF280B	140883	hgsc.bcm.edu	37	22	22842882	22842882	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr22:22842882G>A	ENST00000406426.1	-	4	1584	c.842C>T	c.(841-843)cCc>cTc	p.P281L	ZNF280B_ENST00000360412.2_Missense_Mutation_p.P281L			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	281					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		TAACACAATGGGATTTTCTTT	0.388																																					p.P281L		Atlas-SNP	.											.	ZNF280B	67	.	0			c.C842T						.						119.0	111.0	114.0					22																	22842882		2203	4300	6503	SO:0001583	missense	140883	exon4			ACAATGGGATTTT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.842C>T	chr22.hg19:g.22842882G>A	ENSP00000385998:p.Pro281Leu	96.0	0.0		71.0	35.0	NM_080764		Missense_Mutation	SNP	ENST00000406426.1	hg19	CCDS13799.1	.	.	.	.	.	.	.	.	.	.	G	0	-2.642443	0.00112	.	.	ENSG00000198477	ENST00000406426;ENST00000360412	T;T	0.02216	4.39;4.39	4.43	2.14	0.27477	.	.	.	.	.	T	0.00552	0.0018	N	0.00186	-1.895	0.34395	D	0.69463	B	0.02656	0.0	B	0.01281	0.0	T	0.34551	-0.9824	9	0.02654	T	1	-0.7367	4.5432	0.12067	0.7234:0.0:0.1044:0.1722	.	281	Q86YH2	Z280B_HUMAN	L	281	ENSP00000385998:P281L;ENSP00000353586:P281L	ENSP00000353586:P281L	P	-	2	0	ZNF280B	21172882	1.000000	0.71417	0.010000	0.14722	0.076000	0.17211	2.654000	0.46699	0.860000	0.35481	-0.302000	0.09304	CCC	.	.		0.388	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
MPPED1	758	hgsc.bcm.edu	37	22	43870642	43870642	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr22:43870642G>C	ENST00000417669.2	+	4	877	c.433G>C	c.(433-435)Gtg>Ctg	p.V145L	MPPED1_ENST00000443721.1_Missense_Mutation_p.V145L|MPPED1_ENST00000542779.1_Missense_Mutation_p.V145L|MPPED1_ENST00000538182.1_Missense_Mutation_p.V178L|MPPED1_ENST00000439548.1_5'UTR|MPPED1_ENST00000414469.2_Missense_Mutation_p.V39L			O15442	MPPD1_HUMAN	metallophosphoesterase domain containing 1	145							hydrolase activity (GO:0016787)			endometrium(3)|large_intestine(3)|lung(4)|prostate(2)|skin(1)	13		all_neural(38;0.0244)|Ovarian(80;0.0694)				GTACAAGATCGTGATCGCAGG	0.567																																					p.V145L		Atlas-SNP	.											.	MPPED1	59	.	0			c.G433C						.						119.0	121.0	121.0					22																	43870642		2115	4252	6367	SO:0001583	missense	758	exon4			AAGATCGTGATCG	U84894	CCDS46723.1	22q13.2	2013-09-20	2005-10-10	2005-10-10	ENSG00000186732	ENSG00000186732			1306	protein-coding gene	gene with protein product		602112	"""chromosome 22 open reading frame 1"""	C22orf1		9266672, 10591208	Standard	NM_001044370		Approved	239AB, FAM1A	uc011apv.2	O15442	OTTHUMG00000150566	ENST00000417669.2:c.433G>C	chr22.hg19:g.43870642G>C	ENSP00000388137:p.Val145Leu	54.0	0.0		50.0	23.0	NM_001044370	A8K159|B7Z2S9|Q8N361	Missense_Mutation	SNP	ENST00000417669.2	hg19	CCDS46723.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.980655	0.92982	.	.	ENSG00000186732	ENST00000417669;ENST00000443721;ENST00000545165;ENST00000414469;ENST00000542779;ENST00000538182	T;T;D;T;T	0.83755	0.77;0.77;-1.76;0.77;0.77	5.08	5.08	0.68730	Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	D	0.86003	0.5829	M	0.64567	1.98	0.80722	D	1	D;P	0.53619	0.961;0.895	P;P	0.50136	0.632;0.632	D	0.86675	0.1913	10	0.48119	T	0.1	-35.2044	18.5263	0.90974	0.0:0.0:1.0:0.0	.	178;145	B7Z2S9;O15442	.;MPPD1_HUMAN	L	145;145;123;39;145;178	ENSP00000388137:V145L;ENSP00000400686:V145L;ENSP00000388245:V39L;ENSP00000444532:V145L;ENSP00000438335:V178L	ENSP00000388245:V39L	V	+	1	0	MPPED1	42200586	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	9.457000	0.97630	2.365000	0.80145	0.551000	0.68910	GTG	.	.		0.567	MPPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318938.2	NM_001044370	
WNK3	65267	hgsc.bcm.edu	37	X	54321102	54321102	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chrX:54321102A>G	ENST00000375159.2	-	7	1576	c.1577T>C	c.(1576-1578)tTa>tCa	p.L526S	WNK3_ENST00000354646.2_Missense_Mutation_p.L526S|WNK3_ENST00000375169.3_Missense_Mutation_p.L526S			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	526					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						AGCAAGGGGTAAAGTTGTATT	0.473																																					p.L526S		Atlas-SNP	.											.	WNK3	218	.	0			c.T1577C						.						84.0	73.0	77.0					X																	54321102		2203	4300	6503	SO:0001583	missense	65267	exon8			AGGGGTAAAGTTG	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1577T>C	chrX.hg19:g.54321102A>G	ENSP00000364301:p.Leu526Ser	42.0	0.0		43.0	27.0	NM_001002838	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	ENST00000375159.2	hg19	CCDS14357.1	.	.	.	.	.	.	.	.	.	.	A	0.909	-0.719772	0.03182	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.71222	-0.53;-0.55;-0.55	3.66	2.5	0.30297	.	0.420263	0.17020	N	0.190176	T	0.53029	0.1771	L	0.32530	0.975	0.09310	N	1	B;B	0.29085	0.232;0.069	B;B	0.30251	0.113;0.053	T	0.33214	-0.9877	10	0.15499	T	0.54	0.0899	5.8579	0.18730	0.7614:0.0:0.2386:0.0	.	526;526	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	S	526	ENSP00000364312:L526S;ENSP00000346667:L526S;ENSP00000364301:L526S	ENSP00000346667:L526S	L	-	2	0	WNK3	54337827	0.012000	0.17670	0.017000	0.16124	0.464000	0.32679	1.405000	0.34635	0.603000	0.29913	0.481000	0.45027	TTA	.	.		0.473	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	
AVPR2	554	hgsc.bcm.edu	37	X	153171432	153171432	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chrX:153171432C>T	ENST00000358927.2	+	3	681	c.472C>T	c.(472-474)Cgg>Tgg	p.R158W	AVPR2_ENST00000370049.1_Missense_Mutation_p.R158W|AVPR2_ENST00000337474.5_Missense_Mutation_p.R158W			P30518	V2R_HUMAN	arginine vasopressin receptor 2	158					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	TCACTGGAACCGGCCGGTGCT	0.647																																					p.R158W		Atlas-SNP	.											.	AVPR2	43	.	0			c.C472T						.						60.0	45.0	50.0					X																	153171432		2203	4300	6503	SO:0001583	missense	554	exon2			TGGAACCGGCCGG	Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.472C>T	chrX.hg19:g.153171432C>T	ENSP00000351805:p.Arg158Trp	18.0	0.0		16.0	12.0	NM_001146151	C5HF20|O43192|Q3MJD3|Q9UCV9	Missense_Mutation	SNP	ENST00000358927.2	hg19	CCDS14735.1	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883490	0.33255	.	.	ENSG00000126895	ENST00000358927;ENST00000430697;ENST00000337474;ENST00000370049	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	3.54	1.36	0.22044	GPCR, rhodopsin-like superfamily (1);	0.514798	0.19600	N	0.110416	T	0.76449	0.3989	M	0.72894	2.215	0.34355	D	0.690286	D;D	0.69078	0.997;0.996	P;P	0.58970	0.764;0.849	T	0.79315	-0.1854	10	0.37606	T	0.19	-19.1325	9.3327	0.38032	0.5202:0.4797:0.0:0.0	.	158;158	P30518-2;P30518	.;V2R_HUMAN	W	158	ENSP00000351805:R158W;ENSP00000393513:R158W;ENSP00000338072:R158W;ENSP00000359066:R158W	ENSP00000338072:R158W	R	+	1	2	AVPR2	152824626	0.021000	0.18746	1.000000	0.80357	0.211000	0.24417	0.176000	0.16782	0.569000	0.29329	0.279000	0.19357	CGG	.	.		0.647	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061127.2		
PLXNA3	55558	hgsc.bcm.edu	37	X	153691734	153691734	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chrX:153691734G>T	ENST00000369682.3	+	5	1493	c.1318G>T	c.(1318-1320)Gtg>Ttg	p.V440L		NM_017514.3	NP_059984.3	P51805	PLXA3_HUMAN	plexin A3	440	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|branchiomotor neuron axon guidance (GO:0021785)|facial nerve structural organization (GO:0021612)|hippocampus development (GO:0021766)|multicellular organismal development (GO:0007275)|negative chemotaxis (GO:0050919)|negative regulation of axon extension involved in axon guidance (GO:0048843)|positive regulation of cytoskeleton organization (GO:0051495)|pyramidal neuron development (GO:0021860)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|trigeminal nerve structural organization (GO:0021637)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	48	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TGTGGCTCAGGTGCGGGTCGA	0.617																																					p.V440L		Atlas-SNP	.											.	PLXNA3	156	.	0			c.G1318T						.						142.0	133.0	136.0					X																	153691734		2203	4300	6503	SO:0001630	splice_region_variant	55558	exon5			GCTCAGGTGCGGG	X74609	CCDS14752.1	Xq28	2008-02-05			ENSG00000130827	ENSG00000130827		"""Plexins"""	9101	protein-coding gene	gene with protein product		300022		PLXN4		8248200, 8733135	Standard	NM_017514		Approved	SEX, XAP-6, 6.3, Plxn3	uc004flm.3	P51805	OTTHUMG00000033290	ENST00000369682.3:c.1318-1G>T	chrX.hg19:g.153691734G>T		36.0	0.0		33.0	21.0	NM_017514	Q5HY36	Missense_Mutation	SNP	ENST00000369682.3	hg19	CCDS14752.1	.	.	.	.	.	.	.	.	.	.	G	14.82	2.650243	0.47362	.	.	ENSG00000130827	ENST00000369682	T	0.07327	3.2	4.8	4.8	0.61643	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.059469	0.64402	D	0.000003	T	0.12603	0.0306	M	0.80982	2.52	0.44627	D	0.997609	B	0.06786	0.001	B	0.15484	0.013	T	0.03051	-1.1078	9	.	.	.	.	9.5302	0.39189	0.1003:0.0:0.8997:0.0	.	440	P51805	PLXA3_HUMAN	L	440	ENSP00000358696:V440L	.	V	+	1	0	PLXNA3	153344928	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	3.760000	0.55235	2.229000	0.72834	0.525000	0.51046	GTG	.	.		0.617	PLXNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081634.1	NM_017514	Missense_Mutation
MT-ND5	4540	hgsc.bcm.edu	37	M	13707	13707	+	Silent	SNP	G	G	A			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chrM:13707G>A	ENST00000361567.2	+	1	1371	c.1371G>A	c.(1369-1371)ctG>ctA	p.L457L	MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	457					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ATTAAACGCCTGGCAGCCGGA	0.478																																					p.L457L		Atlas-SNP	.											.	.	.	.	0			c.G1371A						.																																			SO:0001819	synonymous_variant	0	exon1			ACGCCTGGCAGCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1371G>A	chrM.hg19:g.13707G>A		22.0	0.0		38.0	7.0	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.478	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
ARID1A	8289	hgsc.bcm.edu	37	1	27106484	27106484	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr1:27106484delA	ENST00000324856.7	+	20	6466	c.6095delA	c.(6094-6096)gaafs	p.E2032fs	ARID1A_ENST00000457599.2_Frame_Shift_Del_p.E1815fs|ARID1A_ENST00000374152.2_Frame_Shift_Del_p.E1649fs|ARID1A_ENST00000540690.1_Frame_Shift_Del_p.E360fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2032					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		CTAACTTATGAAAAGGAGGAG	0.552			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.E2032fs		Atlas-INDEL	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,NS,carcinoma,0,1	ARID1A	842	.	0			c.6094delG						.						134.0	128.0	130.0					1																	27106484		2203	4300	6503	SO:0001589	frameshift_variant	8289	exon20			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6095delA	chr1.hg19:g.27106484delA	ENSP00000320485:p.Glu2032fs	130.0	0.0		103.0	69.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Del	DEL	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.		0.552	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
YLPM1	56252	hgsc.bcm.edu	37	14	75248349	75248357	+	In_Frame_Del	DEL	CCTCCAGTG	CCTCCAGTG	-	rs549952937		TCGA-DD-AAVX-01A-11D-A40R-10	TCGA-DD-AAVX-10A-01D-A40U-10	CCTCCAGTG	CCTCCAGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	e8170e1d-9a50-4822-84ec-8750c4a174cb	65b44904-6523-4508-b745-d3af723355fc	g.chr14:75248349_75248357delCCTCCAGTG	ENST00000552421.1	+	4	1727_1735	c.1603_1611delCCTCCAGTG	c.(1603-1611)cctccagtgdel	p.PPV535del	YLPM1_ENST00000325680.7_In_Frame_Del_p.PPV535del|YLPM1_ENST00000238571.3_Intron			P49750	YLPM1_HUMAN	YLP motif containing 1	0					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TACAATGCCCCCTCCAGTGTTGCCTCCTT	0.526																																					p.534_537del		Atlas-INDEL	.											.	YLPM1	298	.	0			c.1602_1610del						.																																			SO:0001651	inframe_deletion	56252	exon4			.	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.1603_1611delCCTCCAGTG	chr14.hg19:g.75248349_75248357delCCTCCAGTG	ENSP00000447921:p.Pro535_Val537del	63.0	0.0		59.0	16.0	NM_019589	P49752|Q96I64|Q9P1V7	In_Frame_Del	DEL	ENST00000552421.1	hg19																																																																																				.	.		0.526	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
