#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FBXO44	93611	hgsc.bcm.edu	37	1	11721248	11721248	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr1:11721248G>A	ENST00000251547.5	+	6	768	c.686G>A	c.(685-687)gGc>gAc	p.G229D	FBXO44_ENST00000376770.1_Missense_Mutation_p.G229D|FBXO44_ENST00000251546.4_Silent_p.R187R|FBXO44_ENST00000376768.1_Silent_p.R219R|FBXO6_ENST00000376753.4_5'Flank|FBXO44_ENST00000376762.4_Silent_p.R187R|FBXO44_ENST00000376760.1_Silent_p.R187R	NM_033182.5	NP_149438.2	Q9H4M3	FBX44_HUMAN	F-box protein 44	229	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.					SCF ubiquitin ligase complex (GO:0019005)				kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	8	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.41e-06)|COAD - Colon adenocarcinoma(227;0.000255)|BRCA - Breast invasive adenocarcinoma(304;0.0003)|Kidney(185;0.000758)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CAGCACGGCGGCGTGGACACT	0.657																																					p.G229D		Atlas-SNP	.											.	FBXO44	20	.	0			c.G686A						.						90.0	90.0	90.0					1																	11721248		2203	4300	6503	SO:0001583	missense	93611	exon6			ACGGCGGCGTGGA	AY040878	CCDS131.1, CCDS132.1	1p36.21	2008-03-26			ENSG00000132879	ENSG00000132879		"""F-boxes /  ""other"""""	24847	protein-coding gene	gene with protein product		609111				12383498	Standard	XM_005263535		Approved	FBX30, FBG3, MGC14140, Fbxo6a, Fbx44	uc001asm.3	Q9H4M3	OTTHUMG00000002071	ENST00000251547.5:c.686G>A	chr1.hg19:g.11721248G>A	ENSP00000251547:p.Gly229Asp	54.0	0.0		63.0	14.0	NM_033182	B3KNZ2|B7Z743|Q5TGX2|Q5TGX4|Q5TGX5|Q68DJ9|Q8WWY2	Missense_Mutation	SNP	ENST00000251547.5	hg19	CCDS132.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770421	0.90108	.	.	ENSG00000132879	ENST00000376770;ENST00000251547	T;T	0.35973	1.28;1.28	4.82	4.82	0.62117	Galactose-binding domain-like (1);F-box associated (FBA) domain (2);	.	.	.	.	T	0.61299	0.2336	.	.	.	0.41476	D	0.988139	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.67205	-0.5729	8	0.72032	D	0.01	-25.2829	15.0549	0.71908	0.0:0.0:1.0:0.0	.	89;229	B7Z3K4;Q9H4M3	.;FBX44_HUMAN	D	229	ENSP00000365961:G229D;ENSP00000251547:G229D	ENSP00000251547:G229D	G	+	2	0	FBXO44	11643835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.613000	0.82986	2.228000	0.72767	0.561000	0.74099	GGC	.	.		0.657	FBXO44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005761.1	NM_183412	
HEYL	26508	hgsc.bcm.edu	37	1	40092692	40092692	+	Silent	SNP	G	G	A	rs372712511		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr1:40092692G>A	ENST00000372852.3	-	5	793	c.474C>T	c.(472-474)gcC>gcT	p.A158A	HEYL_ENST00000535435.1_Silent_p.A130A	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	158					atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GCTCCATCTCGGCTGCGTAGC	0.642																																					p.A158A		Atlas-SNP	.											HEYL,colon,carcinoma,0,1	HEYL	27	.	0			c.C474T						.	G		0,4406		0,0,2203	64.0	58.0	60.0		474	-9.9	0.9	1		60	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HEYL	NM_014571.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		158/329	40092692	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	26508	exon5			CATCTCGGCTGCG	BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.474C>T	chr1.hg19:g.40092692G>A		157.0	0.0		171.0	11.0	NM_014571	Q5TG99	Silent	SNP	ENST00000372852.3	hg19	CCDS439.1																																																																																			.	.		0.642	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001179.2	NM_014571	
LRRC7	57554	hgsc.bcm.edu	37	1	70502269	70502269	+	Silent	SNP	A	A	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr1:70502269A>T	ENST00000035383.5	+	18	2166	c.2136A>T	c.(2134-2136)acA>acT	p.T712T	LRRC7_ENST00000415775.2_Intron|LRRC7_ENST00000310961.5_Silent_p.T717T	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	712						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						TGCAGACAACAGCTAAAGATG	0.423																																					p.T712T		Atlas-SNP	.											.	LRRC7	400	.	0			c.A2136T						.						134.0	147.0	142.0					1																	70502269		2203	4300	6503	SO:0001819	synonymous_variant	57554	exon18			GACAACAGCTAAA		CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.2136A>T	chr1.hg19:g.70502269A>T		117.0	0.0		174.0	35.0	NM_020794	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Silent	SNP	ENST00000035383.5	hg19	CCDS645.1																																																																																			.	.		0.423	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131261.1	NM_020794	
PSMA5	5686	hgsc.bcm.edu	37	1	109944673	109944673	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr1:109944673T>A	ENST00000271308.4	-	9	708	c.688A>T	c.(688-690)Aca>Tca	p.T230S	PSMA5_ENST00000490870.1_5'UTR|PSMA5_ENST00000538610.1_Missense_Mutation_p.T172S	NM_002790.3	NP_002781.2	P28066	PSA5_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 5	230					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			kidney(1)|large_intestine(2)|lung(2)	5		all_epithelial(167;2.83e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.045)|Colorectal(144;0.116)|Epithelial(280;0.187)|all cancers(265;0.196)|LUSC - Lung squamous cell carcinoma(189;0.235)		TCTTCCTTTGTGAACATGTGG	0.428																																					p.T230S		Atlas-SNP	.											.	PSMA5	14	.	0			c.A688T						.						137.0	136.0	137.0					1																	109944673		2203	4300	6503	SO:0001583	missense	5686	exon9			CCTTTGTGAACAT	X61970	CCDS799.1, CCDS55619.1	1p13	2008-02-05			ENSG00000143106	ENSG00000143106		"""Proteasome (prosome, macropain) subunits"""	9534	protein-coding gene	gene with protein product		176844				1888762	Standard	NM_002790		Approved	ZETA	uc001dxn.3	P28066	OTTHUMG00000012001	ENST00000271308.4:c.688A>T	chr1.hg19:g.109944673T>A	ENSP00000271308:p.Thr230Ser	49.0	0.0		51.0	12.0	NM_002790	B2R8F6|B4E2V4|Q3T1C1|Q6IBF7	Missense_Mutation	SNP	ENST00000271308.4	hg19	CCDS799.1	.	.	.	.	.	.	.	.	.	.	T	8.614	0.889832	0.17540	.	.	ENSG00000143106	ENST00000538610;ENST00000271308	T;T	0.63096	-0.02;1.02	5.53	4.41	0.53225	.	0.117922	0.56097	D	0.000028	T	0.17534	0.0421	N	0.16233	0.39	0.42692	D	0.993584	B	0.02656	0.0	B	0.01281	0.0	T	0.19679	-1.0298	10	0.06625	T	0.88	-11.8279	5.7885	0.18347	0.1485:0.0791:0.0:0.7724	.	230	P28066	PSA5_HUMAN	S	172;230	ENSP00000440618:T172S;ENSP00000271308:T230S	ENSP00000271308:T230S	T	-	1	0	PSMA5	109746196	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.902000	0.56310	1.126000	0.42016	0.533000	0.62120	ACA	.	.		0.428	PSMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033192.2	NM_002790	
SHCBP1L	81626	hgsc.bcm.edu	37	1	182920459	182920459	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr1:182920459C>A	ENST00000367547.3	-	2	785	c.549G>T	c.(547-549)ttG>ttT	p.L183F	SHCBP1L_ENST00000423786.1_Missense_Mutation_p.L64F|SHCBP1L_ENST00000488956.1_5'UTR	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	255										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TTACCTCAACCAATATACCAA	0.294																																					p.L183F		Atlas-SNP	.											.	SHCBP1L	64	.	0			c.G549T						.						48.0	50.0	49.0					1																	182920459		2202	4295	6497	SO:0001583	missense	81626	exon2			CTCAACCAATATA	AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.549G>T	chr1.hg19:g.182920459C>A	ENSP00000356518:p.Leu183Phe	221.0	0.0		407.0	47.0	NM_030933	Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	ENST00000367547.3	hg19	CCDS30955.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395843	0.42512	.	.	ENSG00000157060	ENST00000367547;ENST00000287709;ENST00000423786	T;T	0.58506	0.33;0.48	5.58	-0.551	0.11822	.	0.289408	0.24330	N	0.039469	T	0.48040	0.1478	M	0.66939	2.045	0.29710	N	0.839469	B;B	0.24186	0.099;0.099	B;B	0.26202	0.067;0.067	T	0.46373	-0.9196	10	0.59425	D	0.04	-15.1293	3.8021	0.08763	0.3028:0.4067:0.2129:0.0776	.	64;183	Q9BZQ2-2;Q9BZQ2-3	.;.	F	183;252;64	ENSP00000356518:L183F;ENSP00000397308:L64F	ENSP00000287709:L252F	L	-	3	2	SHCBP1L	181187082	0.485000	0.25972	0.996000	0.52242	0.992000	0.81027	-0.837000	0.04377	0.023000	0.15187	0.655000	0.94253	TTG	.	.		0.294	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085956.1	NM_030933	
MARK1	4139	hgsc.bcm.edu	37	1	220826619	220826619	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr1:220826619C>T	ENST00000366917.4	+	16	2179	c.1913C>T	c.(1912-1914)aCg>aTg	p.T638M	MARK1_ENST00000366918.4_Missense_Mutation_p.T616M|MARK1_ENST00000402574.1_Missense_Mutation_p.T503M					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		TCCCATGAAACGGGTGCATTT	0.512																																					p.T638M		Atlas-SNP	.											.	MARK1	161	.	0			c.C1913T						.						86.0	82.0	84.0					1																	220826619		2203	4300	6503	SO:0001583	missense	4139	exon16			ATGAAACGGGTGC	AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1913C>T	chr1.hg19:g.220826619C>T	ENSP00000355884:p.Thr638Met	141.0	0.0		291.0	12.0	NM_018650		Missense_Mutation	SNP	ENST00000366917.4	hg19	CCDS31029.2	.	.	.	.	.	.	.	.	.	.	C	20.6	4.017294	0.75161	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.73469	-0.63;-0.42;-0.75	4.94	4.94	0.65067	.	0.120309	0.56097	D	0.000034	T	0.73953	0.3653	M	0.64997	1.995	0.45914	D	0.998752	P;B;B;B	0.52170	0.951;0.131;0.022;0.037	P;B;B;B	0.46237	0.508;0.102;0.018;0.041	T	0.76812	-0.2821	10	0.54805	T	0.06	.	11.6333	0.51189	0.0:0.9178:0.0:0.0822	.	638;503;638;616	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	M	503;616;638	ENSP00000386017:T503M;ENSP00000355885:T616M;ENSP00000355884:T638M	ENSP00000355884:T638M	T	+	2	0	MARK1	218893242	0.589000	0.26807	0.005000	0.12908	0.979000	0.70002	5.859000	0.69539	2.267000	0.75376	0.462000	0.41574	ACG	.	.		0.512	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090899.1		
MYT1L	23040	hgsc.bcm.edu	37	2	1842975	1842975	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr2:1842975G>T	ENST00000399161.2	-	21	3773	c.3026C>A	c.(3025-3027)aCg>aAg	p.T1009K	MYT1L_ENST00000471668.1_5'UTR|MYT1L_ENST00000407844.1_Missense_Mutation_p.T5K|MYT1L_ENST00000428368.2_Missense_Mutation_p.T1007K	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1009					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GCATCCTGGCGTGGGGCAGGA	0.667																																					p.T1007K		Atlas-SNP	.											MYT1L,NS,carcinoma,0,1	MYT1L	241	.	0			c.C3020A						.						29.0	35.0	33.0					2																	1842975		2046	4189	6235	SO:0001583	missense	23040	exon21			CCTGGCGTGGGGC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.3026C>A	chr2.hg19:g.1842975G>T	ENSP00000382114:p.Thr1009Lys	135.0	0.0		167.0	35.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	G	34	5.327901	0.95733	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000407844;ENST00000399157;ENST00000428368	T;T	0.59772	0.25;0.24	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.81044	0.4741	M	0.88775	2.98	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.969;1.0;0.999	T	0.82991	-0.0182	10	0.52906	T	0.07	-32.9984	19.5365	0.95255	0.0:0.0:1.0:0.0	.	5;1009;1007	Q9UL68-3;Q9UL68;Q9UL68-4	.;MYT1L_HUMAN;.	K	1009;955;5;63;1007	ENSP00000382114:T1009K;ENSP00000396103:T1007K	ENSP00000295067:T955K	T	-	2	0	MYT1L	1821982	1.000000	0.71417	0.967000	0.41034	0.927000	0.56198	9.780000	0.99024	2.618000	0.88619	0.563000	0.77884	ACG	.	.		0.667	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
ASXL2	55252	hgsc.bcm.edu	37	2	25966307	25966307	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr2:25966307T>C	ENST00000435504.4	-	13	3192	c.2899A>G	c.(2899-2901)Att>Gtt	p.I967V	ASXL2_ENST00000404843.1_Intron|ASXL2_ENST00000272341.4_Intron|ASXL2_ENST00000336112.4_Missense_Mutation_p.I939V			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	967					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTAGGCAGAATTTGCTCCATG	0.448																																					p.I967V		Atlas-SNP	.											.	ASXL2	217	.	0			c.A2899G						.						154.0	148.0	150.0					2																	25966307		1889	4110	5999	SO:0001583	missense	55252	exon12			GCAGAATTTGCTC			2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.2899A>G	chr2.hg19:g.25966307T>C	ENSP00000391447:p.Ile967Val	59.0	0.0		69.0	26.0	NM_018263	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	ENST00000435504.4	hg19		.	.	.	.	.	.	.	.	.	.	T	16.00	2.998443	0.54147	.	.	ENSG00000143970	ENST00000435504;ENST00000336112	T;T	0.26223	1.75;1.75	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.49490	0.1560	M	0.74258	2.255	0.80722	D	1	P	0.48640	0.913	P	0.61592	0.891	T	0.52381	-0.8583	10	0.87932	D	0	-16.8414	14.5345	0.67950	0.0:0.0:0.0:1.0	.	967	Q76L83	ASXL2_HUMAN	V	967;939	ENSP00000391447:I967V;ENSP00000337250:I939V	ENSP00000337250:I939V	I	-	1	0	ASXL2	25819811	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.451000	0.80668	2.112000	0.64535	0.460000	0.39030	ATT	.	.		0.448	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000325593.3	NM_018263	
GALNT14	79623	hgsc.bcm.edu	37	2	31154985	31154985	+	Missense_Mutation	SNP	C	C	T	rs368328840		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr2:31154985C>T	ENST00000349752.5	-	10	1646	c.1007G>A	c.(1006-1008)cGg>cAg	p.R336Q	GALNT14_ENST00000324589.5_Missense_Mutation_p.R341Q|GALNT14_ENST00000356174.3_Missense_Mutation_p.R303Q|GALNT14_ENST00000420311.2_Missense_Mutation_p.R301Q|GALNT14_ENST00000486564.1_5'UTR|GALNT14_ENST00000406653.1_Missense_Mutation_p.R316Q	NM_024572.3	NP_078848.2	Q96FL9	GLT14_HUMAN	polypeptide N-acetylgalactosaminyltransferase 14	336	Catalytic subdomain B.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(3)|large_intestine(10)|liver(1)|lung(21)|ovary(1)|skin(3)|upper_aerodigestive_tract(3)	43	Acute lymphoblastic leukemia(172;0.155)					GTGCTTCTTCCGGAAGACGTG	0.592																																					p.R341Q		Atlas-SNP	.											.	GALNT14	103	.	0			c.G1022A						.	C	GLN/ARG	0,4406		0,0,2203	96.0	89.0	91.0		1007	5.0	1.0	2		91	1,8599	1.2+/-3.3	0,1,4299	no	missense	GALNT14	NM_024572.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	336/553	31154985	1,13005	2203	4300	6503	SO:0001583	missense	79623	exon11			TTCTTCCGGAAGA	AB078144	CCDS1773.2, CCDS58705.1, CCDS58706.1	2p23.2	2014-03-13	2014-03-13		ENSG00000158089	ENSG00000158089	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	22946	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 14"""	608225	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14)"""			12507512	Standard	NM_024572		Approved	GalNac-T10, FLJ12691, GalNac-T14	uc002rns.3	Q96FL9	OTTHUMG00000074077	ENST00000349752.5:c.1007G>A	chr2.hg19:g.31154985C>T	ENSP00000288988:p.Arg336Gln	69.0	0.0		90.0	22.0	NM_001253826	B3KV89|Q4ZG75|Q53SU1|Q53TJ0|Q8IVI4|Q9BRH1|Q9H827|Q9H9J8	Missense_Mutation	SNP	ENST00000349752.5	hg19	CCDS1773.2	.	.	.	.	.	.	.	.	.	.	C	36	5.858980	0.97036	0.0	1.16E-4	ENSG00000158089	ENST00000349752;ENST00000324589;ENST00000406653;ENST00000356174;ENST00000420311;ENST00000430167	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	D	0.87188	0.6115	H	0.94222	3.51	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.996;0.999;1.0;0.999	D	0.91118	0.4927	10	0.87932	D	0	.	18.2582	0.90025	0.0:1.0:0.0:0.0	.	301;303;341;336;316	F5H263;Q96FL9-2;Q96FL9-3;Q96FL9;B3KV89	.;.;.;GLT14_HUMAN;.	Q	336;341;316;303;301;303	ENSP00000288988:R336Q;ENSP00000314500:R341Q;ENSP00000385435:R316Q;ENSP00000348497:R303Q;ENSP00000415514:R301Q;ENSP00000406399:R303Q	ENSP00000314500:R341Q	R	-	2	0	GALNT14	31008489	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.315000	0.78130	0.561000	0.74099	CGG	.	.		0.592	GALNT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157264.1	NM_024572	
AFTPH	54812	hgsc.bcm.edu	37	2	64779969	64779969	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr2:64779969A>G	ENST00000422803.1	+	2	1675	c.1361A>G	c.(1360-1362)gAt>gGt	p.D454G	AFTPH_ENST00000238855.7_Missense_Mutation_p.D454G|AFTPH_ENST00000238856.4_Missense_Mutation_p.D454G|AFTPH_ENST00000409183.1_Missense_Mutation_p.D85G|AFTPH_ENST00000409933.1_Missense_Mutation_p.D454G			Q6ULP2	AFTIN_HUMAN	aftiphilin	454					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						GGTACTCAAGATTCAATGAGT	0.398																																					p.D454G		Atlas-SNP	.											.	AFTPH	117	.	0			c.A1361G						.						175.0	167.0	170.0					2																	64779969		2203	4300	6503	SO:0001583	missense	54812	exon2			CTCAAGATTCAAT	AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.1361A>G	chr2.hg19:g.64779969A>G	ENSP00000397726:p.Asp454Gly	112.0	0.0		151.0	39.0	NM_017657	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	hg19		.	.	.	.	.	.	.	.	.	.	A	14.42	2.530860	0.45073	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933;ENST00000409183	T;T;T;T;T	0.52526	1.64;1.64;1.63;1.63;0.66	5.8	4.64	0.57946	.	0.326289	0.32503	N	0.006018	T	0.60143	0.2246	L	0.60455	1.87	0.35589	D	0.806924	B;B;D;D	0.71674	0.275;0.275;0.998;0.998	B;B;D;D	0.81914	0.055;0.12;0.995;0.995	T	0.68108	-0.5496	10	0.48119	T	0.1	-4.2067	8.3905	0.32526	0.7984:0.1309:0.0707:0.0	.	454;454;454;454	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	G	454;454;454;454;85	ENSP00000238856:D454G;ENSP00000397726:D454G;ENSP00000238855:D454G;ENSP00000387071:D454G;ENSP00000386913:D85G	ENSP00000238855:D454G	D	+	2	0	AFTPH	64633473	0.970000	0.33590	1.000000	0.80357	0.958000	0.62258	2.369000	0.44231	2.213000	0.71641	0.528000	0.53228	GAT	.	.		0.398	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657	
CD207	50489	hgsc.bcm.edu	37	2	71060827	71060827	+	Missense_Mutation	SNP	C	C	T	rs567546839	byFrequency	TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr2:71060827C>T	ENST00000410009.3	-	3	560	c.515G>A	c.(514-516)cGg>cAg	p.R172Q		NM_015717.3	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 molecule, langerin	172					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|defense response to virus (GO:0051607)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome membrane (GO:0031901)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|mannose binding (GO:0005537)			endometrium(1)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|stomach(1)	20						CTGGAGTGCCCGGATCTTTGT	0.428													C|||	13	0.00259585	0.0	0.0	5008	,	,		20139	0.0		0.0	False		,,,				2504	0.0133				p.R172Q		Atlas-SNP	.											.	CD207	47	.	0			c.G515A						.						81.0	72.0	75.0					2																	71060827		1862	4104	5966	SO:0001583	missense	50489	exon3			AGTGCCCGGATCT	AJ242859	CCDS74520.1	2p13	2011-08-30	2006-03-28		ENSG00000116031	ENSG00000116031		"""C-type lectin domain containing"", ""CD molecules"""	17935	protein-coding gene	gene with protein product		604862	"""CD207 antigen, langerin"""			10661407, 9847074	Standard	NM_015717		Approved	Langerin, CLEC4K	uc002shg.3	Q9UJ71	OTTHUMG00000153176	ENST00000410009.3:c.515G>A	chr2.hg19:g.71060827C>T	ENSP00000386378:p.Arg172Gln	89.0	0.0		106.0	19.0	NM_015717		Missense_Mutation	SNP	ENST00000410009.3	hg19		.	.	.	.	.	.	.	.	.	.	C	0.319	-0.962903	0.02249	.	.	ENSG00000116031	ENST00000410009	T	0.28069	1.63	4.12	-3.86	0.04230	.	1.382280	0.04510	N	0.382668	T	0.12263	0.0298	N	0.04245	-0.25	0.09310	N	1	B	0.14012	0.009	B	0.01281	0.0	T	0.21552	-1.0242	10	0.15499	T	0.54	.	6.1748	0.20437	0.1481:0.2122:0.0:0.6397	.	172	Q9UJ71	CLC4K_HUMAN	Q	172	ENSP00000386378:R172Q	ENSP00000386378:R172Q	R	-	2	0	CD207	70914335	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.572000	0.05881	-0.912000	0.03837	-0.181000	0.13052	CGG	.	.		0.428	CD207-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000329959.4	NM_015717	
CTNNA2	1496	hgsc.bcm.edu	37	2	79971559	79971559	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr2:79971559A>C	ENST00000402739.4	+	2	154	c.149A>C	c.(148-150)aAg>aCg	p.K50T	CTNNA2_ENST00000466387.1_Missense_Mutation_p.K50T|CTNNA2_ENST00000496558.1_Missense_Mutation_p.K50T|CTNNA2_ENST00000541047.1_Missense_Mutation_p.K50T|CTNNA2_ENST00000361291.4_Missense_Mutation_p.K84T|CTNNA2_ENST00000540488.1_Missense_Mutation_p.K50T	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	50					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						TCTGGTAAAAAGAAAGGGAGG	0.408																																					p.K50T		Atlas-SNP	.											.	CTNNA2	462	.	0			c.A149C						.						73.0	70.0	71.0					2																	79971559		1868	4112	5980	SO:0001583	missense	1496	exon3			GTAAAAAGAAAGG		CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.149A>C	chr2.hg19:g.79971559A>C	ENSP00000384638:p.Lys50Thr	223.0	0.0		253.0	67.0	NM_001164883	B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	ENST00000402739.4	hg19		.	.	.	.	.	.	.	.	.	.	A	25.7	4.669299	0.88348	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000451966;ENST00000409971;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488	T;T;T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15;1.15;1.15	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.61949	0.2388	M	0.89095	3.005	0.80722	D	1	P;D;D	0.56035	0.775;0.974;0.974	P;P;P	0.60609	0.665;0.877;0.877	T	0.67389	-0.5683	10	0.45353	T	0.12	.	13.5353	0.61644	1.0:0.0:0.0:0.0	.	50;50;50	P26232;P26232-3;P26232-2	CTNA2_HUMAN;.;.	T	50;50;50;50;84;50;50;50	ENSP00000418191:K50T;ENSP00000419295:K50T;ENSP00000400105:K50T;ENSP00000387073:K50T;ENSP00000355398:K84T;ENSP00000384638:K50T;ENSP00000444675:K50T;ENSP00000441705:K50T	ENSP00000355398:K84T	K	+	2	0	CTNNA2	79825067	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.339000	0.96797	2.087000	0.62958	0.377000	0.23210	AAG	.	.		0.408	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000328511.4	NM_004389	
FAM178B	51252	hgsc.bcm.edu	37	2	97637835	97637835	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr2:97637835G>T	ENST00000417561.3	-	7	810	c.811C>A	c.(811-813)Ctg>Atg	p.L271M	FAM178B_ENST00000327896.3_Missense_Mutation_p.L91M|FAM178B_ENST00000490605.2_Missense_Mutation_p.L123M			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	271										large_intestine(1)|ovary(1)	2						CTGGCCTGCAGCACCCTCGGG	0.667																																					p.L123M		Atlas-SNP	.											.	FAM178B	35	.	0			c.C367A						.						4.0	7.0	6.0					2																	97637835		675	1553	2228	SO:0001583	missense	51252	exon3			CCTGCAGCACCCT	AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.811C>A	chr2.hg19:g.97637835G>T	ENSP00000413245:p.Leu271Met	303.0	0.0		373.0	88.0	NM_001122646	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Missense_Mutation	SNP	ENST00000417561.3	hg19		.	.	.	.	.	.	.	.	.	.	G	12.00	1.806872	0.31961	.	.	ENSG00000168754	ENST00000417561;ENST00000327896;ENST00000490605	T;T;T	0.51071	0.72;0.81;0.78	3.18	1.24	0.21308	.	.	.	.	.	T	0.32556	0.0833	N	0.14661	0.345	0.09310	N	1	.	.	.	.	.	.	T	0.27673	-1.0067	7	0.48119	T	0.1	0.113	9.0114	0.36144	0.0:0.4492:0.5507:0.0	.	.	.	.	M	271;91;123	ENSP00000413245:L271M;ENSP00000333553:L91M;ENSP00000429896:L123M	ENSP00000333553:L91M	L	-	1	2	FAM178B	97001562	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.451000	0.21779	0.326000	0.23384	-0.175000	0.13238	CTG	.	.		0.667	FAM178B-202	KNOWN	basic	protein_coding	protein_coding		NM_016490	
PRRT3	285368	hgsc.bcm.edu	37	3	9988877	9988877	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:9988877C>T	ENST00000412055.1	-	4	2109	c.1980G>A	c.(1978-1980)tgG>tgA	p.W660*	PRRT3-AS1_ENST00000431558.1_RNA	NM_207351.3	NP_997234.3	Q5FWE3	PRRT3_HUMAN	proline-rich transmembrane protein 3	660						integral component of membrane (GO:0016021)				NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(1)|skin(1)|stomach(2)	13						CCGGGTACAGCCAGAGCGCAG	0.751																																					p.W660X		Atlas-SNP	.											.	PRRT3	35	.	0			c.G1980A						.						1.0	1.0	1.0					3																	9988877		1069	2388	3457	SO:0001587	stop_gained	285368	exon4			GTACAGCCAGAGC	AK090993	CCDS43049.1	3p25.3	2011-10-10			ENSG00000163704	ENSG00000163704		"""Proline-rich transmembrane proteins"""	26591	protein-coding gene	gene with protein product							Standard	NM_207351		Approved	FLJ33674	uc003bul.2	Q5FWE3	OTTHUMG00000155285	ENST00000412055.1:c.1980G>A	chr3.hg19:g.9988877C>T	ENSP00000392511:p.Trp660*	32.0	0.0		35.0	8.0	NM_207351	Q49AD0|Q6UXY6|Q8NBC9	Nonsense_Mutation	SNP	ENST00000412055.1	hg19	CCDS43049.1	.	.	.	.	.	.	.	.	.	.	C	39	7.548770	0.98352	.	.	ENSG00000163704	ENST00000412055	.	.	.	4.16	4.16	0.48862	.	0.000000	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-9.3143	14.006	0.64463	0.0:1.0:0.0:0.0	.	.	.	.	X	660	.	.	W	-	3	0	PRRT3	9963877	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	3.636000	0.54317	2.144000	0.66660	0.313000	0.20887	TGG	.	.		0.751	PRRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339322.1	NM_207351	
VILL	50853	hgsc.bcm.edu	37	3	38043300	38043300	+	Silent	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:38043300C>T	ENST00000283713.6	+	13	1694	c.1428C>T	c.(1426-1428)agC>agT	p.S476S	VILL_ENST00000465644.1_Silent_p.S194S|VILL_ENST00000383759.2_Silent_p.S476S			O15195	VILL_HUMAN	villin-like	476					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		CCATGGGCAGCGAGCCCCCCC	0.592																																					p.S476S		Atlas-SNP	.											.	VILL	61	.	0			c.C1428T						.						144.0	123.0	130.0					3																	38043300		2203	4300	6503	SO:0001819	synonymous_variant	50853	exon12			GGGCAGCGAGCCC		CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.1428C>T	chr3.hg19:g.38043300C>T		94.0	0.0		104.0	30.0	NM_015873	A8MZP1|Q9BT80|Q9BWH7	Silent	SNP	ENST00000283713.6	hg19	CCDS2670.2																																																																																			.	.		0.592	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253360.3	NM_015873	
ERC2	26059	hgsc.bcm.edu	37	3	56026116	56026116	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:56026116C>G	ENST00000288221.6	-	11	2479	c.2224G>C	c.(2224-2226)Gac>Cac	p.D742H		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	742						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTGTCCTTGTCATTCTTCTCA	0.498																																					p.D742H		Atlas-SNP	.											.	ERC2	221	.	0			c.G2224C						.						201.0	201.0	201.0					3																	56026116		1951	4143	6094	SO:0001583	missense	26059	exon11			CCTTGTCATTCTT	AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.2224G>C	chr3.hg19:g.56026116C>G	ENSP00000288221:p.Asp742His	111.0	0.0		139.0	34.0	NM_015576	Q2T9F6|Q86TK4	Missense_Mutation	SNP	ENST00000288221.6	hg19	CCDS46851.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.3|20.3	3.959686|3.959686	0.74016|0.74016	.|.	.|.	ENSG00000187672|ENSG00000187672	ENST00000288221|ENST00000492584	T|.	0.48836|.	0.8|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76579|0.76579	0.4007|0.4007	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.87578|.	0.998|.	T|T	0.74466|0.74466	-0.3656|-0.3656	10|5	0.72032|.	D|.	0.01|.	-23.7434|-23.7434	19.824|19.824	0.96608|0.96608	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	742|.	O15083|.	ERC2_HUMAN|.	H|I	742|392	ENSP00000288221:D742H|.	ENSP00000288221:D742H|.	D|M	-|-	1|3	0|0	ERC2|ERC2	56001156|56001156	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.928000|0.928000	0.56348|0.56348	7.818000|7.818000	0.86416|0.86416	2.699000|2.699000	0.92147|0.92147	0.591000|0.591000	0.81541|0.81541	GAC|ATG	.	.		0.498	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350884.2	NM_015576	
SHQ1	55164	hgsc.bcm.edu	37	3	72799710	72799710	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:72799710T>C	ENST00000325599.8	-	11	1598	c.1459A>G	c.(1459-1461)Aca>Gca	p.T487A	SHQ1_ENST00000463369.1_Missense_Mutation_p.T459A|SHQ1_ENST00000468371.1_5'UTR	NM_018130.2	NP_060600.2	Q6PI26	SHQ1_HUMAN	SHQ1, H/ACA ribonucleoprotein assembly factor	487	Ser-rich.				negative regulation of rRNA processing (GO:2000233)|positive regulation of apoptotic process (GO:0043065)|ribonucleoprotein complex assembly (GO:0022618)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		GAACTGACTGTCTCAGATGGA	0.473																																					p.T487A		Atlas-SNP	.											.	SHQ1	60	.	0			c.A1459G						.						122.0	117.0	119.0					3																	72799710		2203	4300	6503	SO:0001583	missense	55164	exon11			TGACTGTCTCAGA	BC025270	CCDS33788.1	3p13	2013-01-08	2013-01-08		ENSG00000144736	ENSG00000144736			25543	protein-coding gene	gene with protein product		613663	"""SHQ1 homolog (S. cerevisiae)"""			12477932	Standard	NM_018130		Approved	FLJ10539, Shq1p	uc003dpf.3	Q6PI26	OTTHUMG00000158814	ENST00000325599.8:c.1459A>G	chr3.hg19:g.72799710T>C	ENSP00000315182:p.Thr487Ala	93.0	0.0		97.0	19.0	NM_018130	B4DL05|Q6MZJ4|Q7Z748|Q9H7E5|Q9NVS8	Missense_Mutation	SNP	ENST00000325599.8	hg19	CCDS33788.1	.	.	.	.	.	.	.	.	.	.	T	3.669	-0.067834	0.07228	.	.	ENSG00000144736	ENST00000325599;ENST00000463369	T;T	0.28895	1.6;1.59	5.52	-10.3	0.00346	.	1.051930	0.07459	N	0.900307	T	0.12860	0.0312	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.18304	-1.0341	10	0.08381	T	0.77	-1.4086	4.418	0.11466	0.1545:0.4539:0.188:0.2036	.	487	Q6PI26	SHQ1_HUMAN	A	487;459	ENSP00000315182:T487A;ENSP00000417452:T459A	ENSP00000315182:T487A	T	-	1	0	SHQ1	72882400	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.330000	0.02675	-2.208000	0.00740	-0.290000	0.09829	ACA	.	.		0.473	SHQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352310.1	NM_018130	
PPP4R2	151987	hgsc.bcm.edu	37	3	73046215	73046215	+	Silent	SNP	G	G	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:73046215G>T	ENST00000356692.5	+	1	280	c.27G>T	c.(25-27)gcG>gcT	p.A9A	PPP4R2_ENST00000394284.3_Silent_p.A9A|PPP4R2_ENST00000495566.1_Silent_p.A9A|PPP4R2_ENST00000295862.9_5'UTR			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	9					cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)			breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		TCCAGGAGGCGCTGAAAGGTG	0.692																																					p.A9A		Atlas-SNP	.											.	PPP4R2	30	.	0			c.G27T						.						32.0	32.0	32.0					3																	73046215		1821	3381	5202	SO:0001819	synonymous_variant	151987	exon1			GGAGGCGCTGAAA	AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.27G>T	chr3.hg19:g.73046215G>T		232.0	0.0		275.0	72.0	NM_174907	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Silent	SNP	ENST00000356692.5	hg19	CCDS2917.1																																																																																			.	.		0.692	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352321.1	NM_174907	
OR5H14	403273	hgsc.bcm.edu	37	3	97868486	97868486	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:97868486T>C	ENST00000437310.1	+	1	317	c.257T>C	c.(256-258)tTa>tCa	p.L86S	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						ATCAACTTCTTAGCTAAGAGT	0.393																																					p.L86S		Atlas-SNP	.											.	OR5H14	56	.	0			c.T257C						.						244.0	244.0	244.0					3																	97868486		2203	4298	6501	SO:0001583	missense	403273	exon1			ACTTCTTAGCTAA		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.257T>C	chr3.hg19:g.97868486T>C	ENSP00000401706:p.Leu86Ser	201.0	0.0		265.0	66.0	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	hg19	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	T	8.975	0.973948	0.18736	.	.	ENSG00000236032	ENST00000437310	T	0.00540	6.7	2.49	1.2	0.21068	GPCR, rhodopsin-like superfamily (1);	1.060770	0.07510	N	0.908663	T	0.00936	0.0031	M	0.84156	2.68	0.09310	N	1	B	0.20671	0.047	B	0.21151	0.033	T	0.42599	-0.9442	10	0.87932	D	0	.	6.5981	0.22685	0.0:0.0:0.2461:0.7539	.	86	A6NHG9	O5H14_HUMAN	S	86	ENSP00000401706:L86S	ENSP00000401706:L86S	L	+	2	0	OR5H14	99351176	0.123000	0.22298	0.003000	0.11579	0.083000	0.17756	2.548000	0.45794	0.165000	0.19558	0.164000	0.16699	TTA	.	.		0.393	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
GTF2E1	2960	hgsc.bcm.edu	37	3	120500204	120500204	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:120500204T>C	ENST00000283875.5	+	5	1300	c.1207T>C	c.(1207-1209)Ttc>Ctc	p.F403L		NM_005513.2	NP_005504.2	P29083	T2EA_HUMAN	general transcription factor IIE, polypeptide 1, alpha 56kDa	403					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)	22				GBM - Glioblastoma multiforme(114;0.159)		TGGCCGTCCGTTCTCCTACAG	0.507																																					p.F403L		Atlas-SNP	.											.	GTF2E1	52	.	0			c.T1207C						.						149.0	148.0	148.0					3																	120500204		2203	4300	6503	SO:0001583	missense	2960	exon5			CGTCCGTTCTCCT	S67859	CCDS3002.1	3q21-q24	2010-03-23	2002-08-29		ENSG00000153767	ENSG00000153767		"""General transcription factors"""	4650	protein-coding gene	gene with protein product		189962	"""general transcription factor IIE, polypeptide 1 (alpha subunit, 56kD)"""			1454543, 8162052	Standard	NM_005513		Approved	TFIIE-A, FE	uc003edz.4	P29083	OTTHUMG00000159667	ENST00000283875.5:c.1207T>C	chr3.hg19:g.120500204T>C	ENSP00000283875:p.Phe403Leu	194.0	0.0		213.0	38.0	NM_005513	Q16103	Missense_Mutation	SNP	ENST00000283875.5	hg19	CCDS3002.1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.082794	0.55861	.	.	ENSG00000153767	ENST00000283875	T	0.53423	0.62	5.39	4.2	0.49525	.	0.257074	0.46442	D	0.000300	T	0.38639	0.1048	L	0.50919	1.6	0.43499	D	0.99574	B	0.25206	0.12	B	0.27500	0.08	T	0.25187	-1.0139	10	0.40728	T	0.16	-31.3621	5.5133	0.16892	0.1557:0.0863:0.0:0.758	.	403	P29083	T2EA_HUMAN	L	403	ENSP00000283875:F403L	ENSP00000283875:F403L	F	+	1	0	GTF2E1	121982894	1.000000	0.71417	0.967000	0.41034	0.953000	0.61014	5.707000	0.68370	1.027000	0.39758	0.528000	0.53228	TTC	.	.		0.507	GTF2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356770.1	NM_005513	
CNOT6L	246175	hgsc.bcm.edu	37	4	78694248	78694248	+	Silent	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr4:78694248A>G	ENST00000504123.1	-	4	517	c.387T>C	c.(385-387)acT>acC	p.T129T	CNOT6L_ENST00000264903.4_Silent_p.T129T|CNOT6L_ENST00000506166.1_5'UTR			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	129	Required for interaction with CNOT1, CNOT3 and CNOT7.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						TCAAACCTAGAGTTTGTAGCT	0.318																																					p.T129T		Atlas-SNP	.											.	CNOT6L	57	.	0			c.T387C						.						42.0	42.0	42.0					4																	78694248		1797	4073	5870	SO:0001819	synonymous_variant	246175	exon4			ACCTAGAGTTTGT	AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.387T>C	chr4.hg19:g.78694248A>G		558.0	0.0		549.0	165.0	NM_144571	Q9UF92	Silent	SNP	ENST00000504123.1	hg19		.	.	.	.	.	.	.	.	.	.	A	9.392	1.075869	0.20227	.	.	ENSG00000138767	ENST00000515506	.	.	.	4.78	2.18	0.27775	.	.	.	.	.	T	0.41373	0.1156	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.41805	-0.9488	4	.	.	.	-10.062	0.6411	0.00810	0.4491:0.1804:0.1952:0.1754	.	.	.	.	P	158	.	.	S	-	1	0	CNOT6L	78913272	0.945000	0.32115	1.000000	0.80357	0.997000	0.91878	0.163000	0.16520	1.779000	0.52309	0.454000	0.30748	TCT	.	.		0.318	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1		
BANK1	55024	hgsc.bcm.edu	37	4	102839251	102839251	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr4:102839251G>C	ENST00000322953.4	+	7	1385	c.1111G>C	c.(1111-1113)Gca>Cca	p.A371P	BANK1_ENST00000508653.1_Missense_Mutation_p.A238P|BANK1_ENST00000504592.1_Missense_Mutation_p.A356P|BANK1_ENST00000428908.1_Missense_Mutation_p.A238P|BANK1_ENST00000444316.2_Missense_Mutation_p.A341P	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	371					B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		AGCAACCTGGGCATCTAAGAT	0.408																																					p.A371P		Atlas-SNP	.											.	BANK1	95	.	0			c.G1111C						.						82.0	83.0	82.0					4																	102839251		2203	4298	6501	SO:0001583	missense	55024	exon7			ACCTGGGCATCTA	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1111G>C	chr4.hg19:g.102839251G>C	ENSP00000320509:p.Ala371Pro	318.0	0.0		317.0	100.0	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	hg19	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111316	0.77210	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62	4.66	4.66	0.58398	Ankyrin repeat-containing domain (1);	0.191497	0.32868	N	0.005558	T	0.66436	0.2789	M	0.68317	2.08	0.44261	D	0.997113	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	T	0.69363	-0.5165	10	0.62326	D	0.03	.	15.1095	0.72343	0.0:0.0:1.0:0.0	.	238;371;356	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	P	356;371;238;238;341	ENSP00000421443:A356P;ENSP00000320509:A371P;ENSP00000412748:A238P;ENSP00000422314:A238P;ENSP00000388817:A341P	ENSP00000320509:A371P	A	+	1	0	BANK1	103058274	1.000000	0.71417	0.980000	0.43619	0.986000	0.74619	4.846000	0.62860	2.409000	0.81822	0.655000	0.94253	GCA	.	.		0.408	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
TRPC3	7222	hgsc.bcm.edu	37	4	122828649	122828649	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr4:122828649G>C	ENST00000379645.3	-	7	1939	c.1866C>G	c.(1864-1866)agC>agG	p.S622R	TRPC3_ENST00000513531.1_Missense_Mutation_p.S494R|TRPC3_ENST00000264811.5_Missense_Mutation_p.S549R	NM_001130698.1	NP_001124170.1	Q13507	TRPC3_HUMAN	transient receptor potential cation channel, subfamily C, member 3	537					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|phototransduction (GO:0007602)|platelet activation (GO:0030168)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of cardiac muscle hypertrophy in response to stress (GO:1903244)|response to ATP (GO:0033198)|response to calcium ion (GO:0051592)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(12)|lung(13)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TCCGAGAGAAGCTGAGCACAA	0.448																																					p.S622R		Atlas-SNP	.											.	TRPC3	201	.	0			c.C1866G						.						98.0	97.0	97.0					4																	122828649		2203	4299	6502	SO:0001583	missense	7222	exon7			AGAGAAGCTGAGC	Y13758	CCDS3725.1, CCDS47130.1	4q27	2011-12-14			ENSG00000138741	ENSG00000138741		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12335	protein-coding gene	gene with protein product		602345				8646775, 16382100	Standard	NM_003305		Approved		uc003ieg.2	Q13507	OTTHUMG00000133069	ENST00000379645.3:c.1866C>G	chr4.hg19:g.122828649G>C	ENSP00000368966:p.Ser622Arg	361.0	0.0		301.0	81.0	NM_001130698	A7VJS1|E9PCJ9|O00593|Q15660|Q52M35|Q5G1L5	Missense_Mutation	SNP	ENST00000379645.3	hg19	CCDS47130.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078863	0.76528	.	.	ENSG00000138741	ENST00000264811;ENST00000379645;ENST00000513531	D;D;D	0.97256	-4.31;-4.31;-4.31	5.3	5.3	0.74995	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98957	0.9645	M	0.94142	3.5	0.58432	D	0.999992	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.99568	1.0970	10	0.87932	D	0	-23.1109	18.9622	0.92681	0.0:0.0:1.0:0.0	.	537;494;622	Q13507;E9PCJ9;Q5G1L5	TRPC3_HUMAN;.;.	R	549;622;494	ENSP00000264811:S549R;ENSP00000368966:S622R;ENSP00000426899:S494R	ENSP00000264811:S549R	S	-	3	2	TRPC3	123048099	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.145000	0.31577	2.465000	0.83290	0.655000	0.94253	AGC	.	.		0.448	TRPC3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364252.1	NM_003305	
CLGN	1047	hgsc.bcm.edu	37	4	141323176	141323176	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr4:141323176T>C	ENST00000325617.5	-	6	904	c.464A>G	c.(463-465)tAc>tGc	p.Y155C	CLGN_ENST00000414773.1_Missense_Mutation_p.Y155C|CLGN_ENST00000537281.1_Missense_Mutation_p.Y155C	NM_004362.2	NP_004353.1	O14967	CLGN_HUMAN	calmegin	155					binding of sperm to zona pellucida (GO:0007339)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|single fertilization (GO:0007338)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	calcium ion binding (GO:0005509)|unfolded protein binding (GO:0051082)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(5)|ovary(2)|prostate(3)|skin(4)|urinary_tract(1)	25	all_hematologic(180;0.162)					GAGTTTAATGTATGCACCTCC	0.274																																					p.Y155C		Atlas-SNP	.											.	CLGN	76	.	0			c.A464G						.						63.0	68.0	66.0					4																	141323176		2202	4283	6485	SO:0001583	missense	1047	exon7			TTAATGTATGCAC	D86322	CCDS3751.1	4q28.3-q31.1	2008-02-05			ENSG00000153132	ENSG00000153132			2060	protein-coding gene	gene with protein product		601858					Standard	NM_004362		Approved		uc003iii.3	O14967	OTTHUMG00000133414	ENST00000325617.5:c.464A>G	chr4.hg19:g.141323176T>C	ENSP00000326699:p.Tyr155Cys	529.0	0.0		453.0	144.0	NM_001130675	B3KS90|B4DXV8|D3DNY8	Missense_Mutation	SNP	ENST00000325617.5	hg19	CCDS3751.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.364046	0.82353	.	.	ENSG00000153132	ENST00000325617;ENST00000414773;ENST00000537281;ENST00000545667;ENST00000509477	T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2	5.44	5.44	0.79542	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Calreticulin/calnexin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.85669	0.5750	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90356	0.4370	10	0.87932	D	0	-8.9119	15.8087	0.78538	0.0:0.0:0.0:1.0	.	155	O14967	CLGN_HUMAN	C	155;155;155;72;155	ENSP00000326699:Y155C;ENSP00000392782:Y155C;ENSP00000439381:Y155C;ENSP00000424593:Y155C	ENSP00000326699:Y155C	Y	-	2	0	CLGN	141542626	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.191000	0.70037	0.528000	0.53228	TAC	.	.		0.274	CLGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257272.2	NM_004362	
C4orf47	441054	hgsc.bcm.edu	37	4	186357237	186357237	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr4:186357237C>G	ENST00000378850.4	+	3	380	c.358C>G	c.(358-360)Cca>Gca	p.P120A		NM_001114357.1	NP_001107829.1	A7E2U8	CD047_HUMAN	chromosome 4 open reading frame 47	120										breast(2)|endometrium(1)	3						AATAGGTGGTCCAGTCCCATT	0.373																																					p.P120A		Atlas-SNP	.											.	C4orf47	13	.	0			c.C358G						.						49.0	45.0	46.0					4																	186357237		692	1591	2283	SO:0001583	missense	441054	exon3			GGTGGTCCAGTCC	AY947525, BC127739, BC141967	CCDS47169.1	4q35.1	2008-07-18			ENSG00000205129	ENSG00000205129			34346	protein-coding gene	gene with protein product						12477932	Standard	NM_001114357		Approved	LOC441054	uc003ixt.2	A7E2U8	OTTHUMG00000160458	ENST00000378850.4:c.358C>G	chr4.hg19:g.186357237C>G	ENSP00000368127:p.Pro120Ala	595.0	1.0		549.0	157.0	NM_001114357	Q5BLP7	Missense_Mutation	SNP	ENST00000378850.4	hg19	CCDS47169.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050878	0.55218	.	.	ENSG00000205129	ENST00000511138;ENST00000511581;ENST00000378850	.	.	.	5.82	5.82	0.92795	.	0.060731	0.64402	D	0.000003	T	0.67702	0.2921	M	0.77313	2.365	0.50813	D	0.999898	P	0.40230	0.708	B	0.43123	0.409	T	0.70110	-0.4962	9	0.49607	T	0.09	-21.439	13.9518	0.64123	0.0:0.9268:0.0:0.0732	.	120	A7E2U8	CD047_HUMAN	A	120	.	ENSP00000368127:P120A	P	+	1	0	C4orf47	186594231	0.990000	0.36364	0.952000	0.39060	0.925000	0.55904	3.271000	0.51608	2.753000	0.94483	0.585000	0.79938	CCA	.	.		0.373	C4orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360667.1	NM_001114357	
EMB	133418	hgsc.bcm.edu	37	5	49701580	49701580	+	Silent	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:49701580G>A	ENST00000303221.5	-	5	794	c.579C>T	c.(577-579)taC>taT	p.Y193Y	EMB_ENST00000508934.1_Silent_p.Y139Y|EMB_ENST00000514111.1_Silent_p.Y143Y|EMB_ENST00000506190.1_5'UTR	NM_198449.2	NP_940851.1	Q6PCB8	EMB_HUMAN	embigin	193	Ig-like V-type 2.				cell adhesion (GO:0007155)|plasma membrane lactate transport (GO:0035879)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	organic cyclic compound binding (GO:0097159)			breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	15	Lung SC(58;0.218)	Lung NSC(810;0.0795)				CATTACTACTGTACCAGGTCC	0.323																																					p.Y193Y		Atlas-SNP	.											.	EMB	42	.	0			c.C579T						.						58.0	60.0	60.0					5																	49701580		2203	4291	6494	SO:0001819	synonymous_variant	133418	exon5			ACTACTGTACCAG	BC059398	CCDS3953.1	5q11.1	2013-01-29	2010-06-24		ENSG00000170571	ENSG00000170571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	30465	protein-coding gene	gene with protein product		615669	"""embigin homolog (mouse)"""			9438341	Standard	NM_198449		Approved	MGC71745	uc003jom.3	Q6PCB8	OTTHUMG00000131161	ENST00000303221.5:c.579C>T	chr5.hg19:g.49701580G>A		653.0	0.0		767.0	43.0	NM_198449	B7Z6S3|B7Z902	Silent	SNP	ENST00000303221.5	hg19	CCDS3953.1																																																																																			.	.		0.323	EMB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253853.1	NM_198449	
SKIV2L2	23517	hgsc.bcm.edu	37	5	54701259	54701259	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:54701259A>G	ENST00000230640.5	+	22	2742	c.2488A>G	c.(2488-2490)Ata>Gta	p.I830V	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.I729V	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	830					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				TTAGATTGCAATAGATATTAA	0.299																																					p.I830V	Melanoma(2;92 134 23744 29976 33782)	Atlas-SNP	.											.	SKIV2L2	104	.	0			c.A2488G						.						65.0	66.0	66.0					5																	54701259		2203	4300	6503	SO:0001583	missense	23517	exon22			ATTGCAATAGATA	D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.2488A>G	chr5.hg19:g.54701259A>G	ENSP00000230640:p.Ile830Val	114.0	0.0		154.0	42.0	NM_015360	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	ENST00000230640.5	hg19	CCDS3967.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535582	0.27475	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.28895	1.59;1.59	5.51	-5.59	0.02505	.	0.783353	0.13050	N	0.417768	T	0.11196	0.0273	N	0.12746	0.255	0.09310	N	0.999996	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.15093	-1.0449	10	0.30854	T	0.27	-34.3256	3.252	0.06818	0.2805:0.2239:0.3928:0.1028	.	729;830	F5H7E2;P42285	.;SK2L2_HUMAN	V	830;729	ENSP00000230640:I830V;ENSP00000442583:I729V	ENSP00000230640:I830V	I	+	1	0	SKIV2L2	54737016	0.248000	0.23930	0.808000	0.32385	0.913000	0.54294	0.689000	0.25437	-0.779000	0.04560	0.383000	0.25322	ATA	.	.		0.299	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214108.1		
SLC38A9	153129	hgsc.bcm.edu	37	5	54965110	54965110	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:54965110C>T	ENST00000396865.2	-	7	1063	c.472G>A	c.(472-474)Ggc>Agc	p.G158S	SLC38A9_ENST00000416547.2_Missense_Mutation_p.G34S|SLC38A9_ENST00000515629.1_Missense_Mutation_p.G95S|SLC38A9_ENST00000318672.3_Missense_Mutation_p.G158S|SLC38A9_ENST00000539768.1_Missense_Mutation_p.G158S|SLC38A9_ENST00000512595.1_Missense_Mutation_p.G131S	NM_173514.3	NP_775785.2	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	158					amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(3)|lung(3)	8		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				GTTAAAAGGCCCATCAGTATG	0.328																																					p.G158S		Atlas-SNP	.											.	SLC38A9	50	.	0			c.G472A						.						186.0	190.0	189.0					5																	54965110		2203	4300	6503	SO:0001583	missense	153129	exon7			AAAGGCCCATCAG		CCDS3968.1, CCDS58947.1, CCDS58948.1, CCDS75243.1	5q11.2	2013-05-22			ENSG00000177058	ENSG00000177058		"""Solute carriers"""	26907	protein-coding gene	gene with protein product							Standard	NM_173514		Approved	FLJ90709	uc003jqf.3	Q8NBW4	OTTHUMG00000131189	ENST00000396865.2:c.472G>A	chr5.hg19:g.54965110C>T	ENSP00000380074:p.Gly158Ser	97.0	0.0		101.0	22.0	NM_173514	B3KXV1|B7Z7D0|Q0P5S0|Q6MZJ8	Missense_Mutation	SNP	ENST00000396865.2	hg19	CCDS3968.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.957368	0.92726	.	.	ENSG00000177058	ENST00000396865;ENST00000318672;ENST00000539768;ENST00000515629;ENST00000416547;ENST00000512595;ENST00000511233;ENST00000512208;ENST00000503817	T;T;T;T;T;T;T;T;T	0.02787	4.16;4.16;4.16;4.16;4.16;4.16;4.16;4.16;4.16	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.12008	0.0292	L	0.50919	1.6	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.87578	0.952;0.998	T	0.12734	-1.0536	10	0.29301	T	0.29	-18.6055	19.3048	0.94157	0.0:1.0:0.0:0.0	.	131;158	B3KXV1;Q8NBW4	.;S38A9_HUMAN	S	158;158;158;95;34;131;158;95;95	ENSP00000380074:G158S;ENSP00000316596:G158S;ENSP00000437771:G158S;ENSP00000420934:G95S;ENSP00000397429:G34S;ENSP00000427335:G131S;ENSP00000423219:G158S;ENSP00000426413:G95S;ENSP00000424918:G95S	ENSP00000316596:G158S	G	-	1	0	SLC38A9	55000867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.065000	0.76727	2.622000	0.88805	0.650000	0.86243	GGC	.	.		0.328	SLC38A9-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253912.2	NM_173514	
MCCC2	64087	hgsc.bcm.edu	37	5	70952644	70952644	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:70952644A>G	ENST00000340941.6	+	17	1778	c.1649A>G	c.(1648-1650)aAc>aGc	p.N550S	MCCC2_ENST00000323375.8_Missense_Mutation_p.N512S	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)	550	Carboxyltransferase.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	GCAGCCCTCAACGCACCAATA	0.418																																					p.N550S		Atlas-SNP	.											.	MCCC2	47	.	0			c.A1649G						.						227.0	207.0	214.0					5																	70952644		2203	4300	6503	SO:0001583	missense	64087	exon17			CCCTCAACGCACC	AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.1649A>G	chr5.hg19:g.70952644A>G	ENSP00000343657:p.Asn550Ser	110.0	0.0		175.0	34.0	NM_022132	A6NIY9|Q96C27|Q9Y4L7	Missense_Mutation	SNP	ENST00000340941.6	hg19	CCDS34184.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.076929	0.76415	.	.	ENSG00000131844	ENST00000340941;ENST00000323375	D;D	0.97378	-4.36;-4.36	4.94	4.94	0.65067	Acetyl-coenzyme A carboxyltransferase, C-terminal (1);Carboxyl transferase (1);	0.000000	0.85682	D	0.000000	D	0.95645	0.8584	L	0.55990	1.75	0.80722	D	1	P	0.45126	0.851	B	0.43251	0.413	D	0.95765	0.8804	10	0.72032	D	0.01	-12.0809	13.617	0.62115	1.0:0.0:0.0:0.0	.	550	Q9HCC0	MCCB_HUMAN	S	550;512	ENSP00000343657:N550S;ENSP00000327308:N512S	ENSP00000327308:N512S	N	+	2	0	MCCC2	70988400	1.000000	0.71417	0.986000	0.45419	0.679000	0.39708	9.240000	0.95396	1.867000	0.54127	0.528000	0.53228	AAC	.	.		0.418	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369243.4		
FBN2	2201	hgsc.bcm.edu	37	5	127670429	127670429	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:127670429C>T	ENST00000508053.1	-	37	5055	c.4081G>A	c.(4081-4083)Ggg>Agg	p.G1361R	FBN2_ENST00000262464.4_Missense_Mutation_p.G1361R|FBN2_ENST00000508989.1_Missense_Mutation_p.G1328R|FBN2_ENST00000507835.1_Missense_Mutation_p.G211R			P35556	FBN2_HUMAN	fibrillin 2	1361	EGF-like 21; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CCTGTGGTCCCCTTCTTCACT	0.423																																					p.G1361R		Atlas-SNP	.											.	FBN2	858	.	0			c.G4081A						.						146.0	129.0	135.0					5																	127670429		2203	4300	6503	SO:0001583	missense	2201	exon31			TGGTCCCCTTCTT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.4081G>A	chr5.hg19:g.127670429C>T	ENSP00000424571:p.Gly1361Arg	70.0	0.0		94.0	18.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	C	28.8	4.951140	0.92660	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000507835;ENST00000508989	D;D;D;D	0.92249	-3.0;-3.0;-3.0;-3.0	4.96	4.96	0.65561	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.224079	0.32593	N	0.005887	D	0.94712	0.8294	L	0.48935	1.535	0.52501	D	0.999951	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.94977	0.8122	10	0.72032	D	0.01	.	18.8164	0.92079	0.0:1.0:0.0:0.0	.	1328;1361	D6RJI3;P35556	.;FBN2_HUMAN	R	1361;1361;211;1328	ENSP00000262464:G1361R;ENSP00000424571:G1361R;ENSP00000426839:G211R;ENSP00000425596:G1328R	ENSP00000262464:G1361R	G	-	1	0	FBN2	127698328	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.609000	0.82925	2.743000	0.94032	0.650000	0.86243	GGG	.	.		0.423	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
AFAP1L1	134265	hgsc.bcm.edu	37	5	148695457	148695457	+	Missense_Mutation	SNP	G	G	A	rs371511486		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:148695457G>A	ENST00000296721.4	+	10	1192	c.1094G>A	c.(1093-1095)cGc>cAc	p.R365H	AFAP1L1_ENST00000515000.1_Missense_Mutation_p.R365H	NM_001146337.1|NM_152406.2	NP_001139809.1|NP_689619.1	Q8TED9	AF1L1_HUMAN	actin filament associated protein 1-like 1	365						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCCTTGGCCGCCGGGAGACC	0.632																																					p.R365H		Atlas-SNP	.											AFAP1L1,colon,carcinoma,0,1	AFAP1L1	86	.	0			c.G1094A						.	G	HIS/ARG,HIS/ARG	0,4406		0,0,2203	75.0	67.0	70.0		1094,1094	4.6	1.0	5		70	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	AFAP1L1	NM_001146337.1,NM_152406.2	29,29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	365/726,365/769	148695457	1,13005	2203	4300	6503	SO:0001583	missense	134265	exon10			TTGGCCGCCGGGA	AK094067	CCDS34274.1, CCDS54932.1	5q33.1	2013-01-10			ENSG00000157510	ENSG00000157510		"""Pleckstrin homology (PH) domain containing"""	26714	protein-coding gene	gene with protein product		614410					Standard	NM_152406		Approved	FLJ36748	uc003lqh.3	Q8TED9	OTTHUMG00000163441	ENST00000296721.4:c.1094G>A	chr5.hg19:g.148695457G>A	ENSP00000296721:p.Arg365His	114.0	0.0		160.0	25.0	NM_001146337	Q08AN4|Q08AN5|Q8IW82|Q8N8Z5|Q8N9Q4	Missense_Mutation	SNP	ENST00000296721.4	hg19	CCDS34274.1	.	.	.	.	.	.	.	.	.	.	G	10.30	1.311870	0.23821	0.0	1.16E-4	ENSG00000157510	ENST00000296721;ENST00000515000	T;T	0.11821	2.74;2.74	5.46	4.58	0.56647	.	0.239927	0.44285	D	0.000477	T	0.09379	0.0231	L	0.33485	1.01	0.40845	D	0.983701	B;B	0.19706	0.038;0.032	B;B	0.16722	0.016;0.005	T	0.05419	-1.0886	10	0.02654	T	1	-17.0073	12.8176	0.57675	0.0767:0.0:0.9233:0.0	.	365;365	Q8TED9-2;Q8TED9	.;AF1L1_HUMAN	H	365	ENSP00000296721:R365H;ENSP00000424427:R365H	ENSP00000296721:R365H	R	+	2	0	AFAP1L1	148675650	0.977000	0.34250	1.000000	0.80357	0.411000	0.31082	2.625000	0.46452	2.556000	0.86216	0.561000	0.74099	CGC	.	.		0.632	AFAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373443.1	NM_152406	
HMMR	3161	hgsc.bcm.edu	37	5	162901124	162901124	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:162901124A>T	ENST00000358715.3	+	10	999	c.963A>T	c.(961-963)ttA>ttT	p.L321F	HMMR_ENST00000393915.4_Missense_Mutation_p.L322F|HMMR_ENST00000432118.2_Missense_Mutation_p.L235F|HMMR_ENST00000353866.3_Missense_Mutation_p.L306F			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	321					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	TGCAAAACTTAAAACAGAAGT	0.328																																					p.L322F		Atlas-SNP	.											.	HMMR	64	.	0			c.A966T						.						80.0	77.0	78.0					5																	162901124		2203	4300	6503	SO:0001583	missense	3161	exon10			AAACTTAAAACAG	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.963A>T	chr5.hg19:g.162901124A>T	ENSP00000351554:p.Leu321Phe	568.0	0.0		934.0	165.0	NM_001142556	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	hg19	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	A	13.09	2.134729	0.37728	.	.	ENSG00000072571	ENST00000416990;ENST00000353866;ENST00000434157;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.07567	3.18;3.18;3.18;3.18;3.18	5.77	1.65	0.23941	.	0.254173	0.32719	N	0.005734	T	0.21022	0.0506	M	0.69823	2.125	0.21290	N	0.999733	D;D;D;D	0.76494	0.999;0.992;0.999;0.999	D;P;D;D	0.70016	0.967;0.9;0.967;0.967	T	0.02156	-1.1204	10	0.41790	T	0.15	-6.7995	7.8407	0.29397	0.6974:0.0:0.3026:0.0	.	235;322;306;321	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	F	207;306;306;322;298;235;321	ENSP00000400527:L207F;ENSP00000185942:L306F;ENSP00000377492:L322F;ENSP00000402673:L235F;ENSP00000351554:L321F	ENSP00000185942:L306F	L	+	3	2	HMMR	162833702	0.996000	0.38824	0.084000	0.20598	0.457000	0.32468	0.537000	0.23144	0.507000	0.28148	0.533000	0.62120	TTA	.	.		0.328	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484	
SLIT3	6586	hgsc.bcm.edu	37	5	168176483	168176483	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:168176483A>T	ENST00000519560.1	-	19	2550	c.2131T>A	c.(2131-2133)Tgt>Agt	p.C711S	SLIT3_ENST00000332966.8_Missense_Mutation_p.C711S|SLIT3_ENST00000404867.3_Missense_Mutation_p.C711S	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	711	LRRCT 3.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TTACCATCACAGGTGAAGTCC	0.542																																					p.C711S	Ovarian(29;311 847 10864 17279 24903)	Atlas-SNP	.											.	SLIT3	224	.	0			c.T2131A						.						85.0	82.0	83.0					5																	168176483		2203	4300	6503	SO:0001583	missense	6586	exon19			CATCACAGGTGAA	AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2131T>A	chr5.hg19:g.168176483A>T	ENSP00000430333:p.Cys711Ser	93.0	0.0		121.0	27.0	NM_001271946	A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	ENST00000519560.1	hg19	CCDS4369.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.671184	0.88348	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.79033	-1.23;-1.23;-1.22	5.42	5.42	0.78866	Cysteine-rich flanking region, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.91794	0.7404	H	0.96208	3.785	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94324	0.7556	10	0.87932	D	0	.	15.4652	0.75394	1.0:0.0:0.0:0.0	.	711	O75094	SLIT3_HUMAN	S	711	ENSP00000430333:C711S;ENSP00000332164:C711S;ENSP00000384890:C711S	ENSP00000332164:C711S	C	-	1	0	SLIT3	168109061	1.000000	0.71417	0.998000	0.56505	0.893000	0.52053	8.855000	0.92236	2.043000	0.60533	0.533000	0.62120	TGT	.	.		0.542	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252792.4	NM_003062	
SYCP2L	221711	hgsc.bcm.edu	37	6	10911072	10911072	+	Silent	SNP	G	G	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr6:10911072G>T	ENST00000283141.6	+	12	1184	c.888G>T	c.(886-888)ccG>ccT	p.P296P	SYCP2L_ENST00000543878.1_Silent_p.P137P|RP11-637O19.3_ENST00000480294.1_3'UTR	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	296						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			ATTCATTTCCGTGTATTGCTG	0.413																																					p.P296P		Atlas-SNP	.											.	SYCP2L	101	.	0			c.G888T						.						271.0	247.0	255.0					6																	10911072		1921	4126	6047	SO:0001819	synonymous_variant	221711	exon12			ATTTCCGTGTATT	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.888G>T	chr6.hg19:g.10911072G>T		60.0	0.0		78.0	29.0	NM_001040274	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Silent	SNP	ENST00000283141.6	hg19	CCDS43423.1																																																																																			.	.		0.413	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
ATF6B	1388	hgsc.bcm.edu	37	6	32093947	32093947	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr6:32093947G>T	ENST00000375203.3	-	5	457	c.425C>A	c.(424-426)tCc>tAc	p.S142Y	ATF6B_ENST00000375201.4_Missense_Mutation_p.S139Y|ATF6B_ENST00000468502.1_5'UTR	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	142					response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						TTCAAATGAGGATGTTGGGTC	0.532																																					p.S142Y		Atlas-SNP	.											.	ATF6B	40	.	0			c.C425A						.						138.0	121.0	127.0					6																	32093947		2203	4300	6503	SO:0001583	missense	1388	exon5			AATGAGGATGTTG		CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.425C>A	chr6.hg19:g.32093947G>T	ENSP00000364349:p.Ser142Tyr	77.0	0.0		100.0	19.0	NM_004381	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	Missense_Mutation	SNP	ENST00000375203.3	hg19	CCDS4737.1	.	.	.	.	.	.	.	.	.	.	G	13.72	2.321906	0.41096	.	.	ENSG00000213676	ENST00000375203;ENST00000375201	T;T	0.57107	0.42;1.16	5.25	3.46	0.39613	.	0.276444	0.29473	U	0.012047	T	0.19765	0.0475	L	0.56769	1.78	0.25642	N	0.986194	B;B;B	0.28636	0.218;0.178;0.112	B;B;B	0.30495	0.116;0.074;0.034	T	0.35475	-0.9787	10	0.02654	T	1	-1.9902	8.2551	0.31751	0.1806:0.0:0.8194:0.0	.	142;139;142	Q96QL7;Q99941-2;Q99941	.;.;ATF6B_HUMAN	Y	142;139	ENSP00000364349:S142Y;ENSP00000364347:S139Y	ENSP00000364347:S139Y	S	-	2	0	ATF6B	32201925	1.000000	0.71417	0.962000	0.40283	0.911000	0.54048	2.445000	0.44899	0.779000	0.33543	0.650000	0.86243	TCC	.	.		0.532	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076638.2		
RUNX2	860	hgsc.bcm.edu	37	6	45514837	45514837	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr6:45514837A>G	ENST00000371438.1	+	8	1719	c.1361A>G	c.(1360-1362)tAt>tGt	p.Y454C	RUNX2_ENST00000359524.5_Missense_Mutation_p.Y440C|RUNX2_ENST00000352853.5_Missense_Mutation_p.Y522C|RUNX2_ENST00000576263.1_Intron|RUNX2_ENST00000465038.2_Missense_Mutation_p.Y454C|RUNX2_ENST00000541979.1_Missense_Mutation_p.Y500C|RUNX2_ENST00000371436.6_Missense_Mutation_p.Y432C|RUNX2_ENST00000371432.3_Missense_Mutation_p.Y418C	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	454	Interaction with KAT6B.|Pro/Ser/Thr-rich.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						TCAGGATCCTATCAGTTTCCC	0.557																																					p.Y454C		Atlas-SNP	.											.	RUNX2	128	.	0			c.A1361G						.						93.0	83.0	86.0					6																	45514837		2203	4300	6503	SO:0001583	missense	860	exon9			GATCCTATCAGTT	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.1361A>G	chr6.hg19:g.45514837A>G	ENSP00000360493:p.Tyr454Cys	114.0	0.0		174.0	47.0	NM_001024630	O14614|O14615|O95181	Missense_Mutation	SNP	ENST00000371438.1	hg19	CCDS43467.2	.	.	.	.	.	.	.	.	.	.	A	17.52	3.411255	0.62399	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	T;T;T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64;0.64;0.64	5.77	5.77	0.91146	Runx inhibition (1);	0.000000	0.85682	D	0.000000	T	0.63757	0.2538	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	T	0.68731	-0.5331	10	0.87932	D	0	-4.7797	16.3948	0.83586	1.0:0.0:0.0:0.0	.	500;454;440	F6RGB9;Q13950;Q13950-2	.;RUNX2_HUMAN;.	C	454;522;500;454;432;440;418	ENSP00000420707:Y454C;ENSP00000319087:Y522C;ENSP00000446290:Y500C;ENSP00000360493:Y454C;ENSP00000360491:Y432C;ENSP00000352514:Y440C;ENSP00000360486:Y418C	ENSP00000319087:Y522C	Y	+	2	0	RUNX2	45622815	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.910000	0.92685	2.326000	0.78906	0.533000	0.62120	TAT	.	.		0.557	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
MYO6	4646	hgsc.bcm.edu	37	6	76538320	76538320	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr6:76538320A>T	ENST00000369977.3	+	4	390	c.251A>T	c.(250-252)gAc>gTc	p.D84V	MYO6_ENST00000369975.1_Missense_Mutation_p.D84V|MYO6_ENST00000369985.4_Missense_Mutation_p.D84V|MYO6_ENST00000369981.3_Missense_Mutation_p.D84V	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	84	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TATAGTAAAGACAGAATTTAT	0.289																																					p.D84V		Atlas-SNP	.											.	MYO6	124	.	0			c.A251T						.						87.0	96.0	93.0					6																	76538320		2203	4299	6502	SO:0001583	missense	4646	exon4			GTAAAGACAGAAT	U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.251A>T	chr6.hg19:g.76538320A>T	ENSP00000358994:p.Asp84Val	211.0	0.0		269.0	64.0	NM_004999	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	ENST00000369977.3	hg19	CCDS34487.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.376238	0.82682	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.89487	0.6729	H	0.97051	3.93	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.94;0.995	D	0.92940	0.6371	10	0.72032	D	0.01	.	15.6234	0.76829	1.0:0.0:0.0:0.0	.	84;84	Q9UM54-2;Q9UM54-1	.;.	V	84	ENSP00000358998:D84V;ENSP00000359002:D84V;ENSP00000358994:D84V;ENSP00000358992:D84V	ENSP00000358992:D84V	D	+	2	0	MYO6	76595040	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.700000	0.91322	2.097000	0.63578	0.460000	0.39030	GAC	.	.		0.289	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041279.2	NM_004999	
AIM1	202	hgsc.bcm.edu	37	6	106967341	106967341	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr6:106967341T>G	ENST00000369066.3	+	2	1521	c.1034T>G	c.(1033-1035)gTt>gGt	p.V345G		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GAAACCAAAGTTACCGTCTCG	0.438																																					p.V345G		Atlas-SNP	.											.	AIM1	161	.	0			c.T1034G						.						81.0	87.0	85.0					6																	106967341		2203	4300	6503	SO:0001583	missense	202	exon2			CCAAAGTTACCGT	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1034T>G	chr6.hg19:g.106967341T>G	ENSP00000358062:p.Val345Gly	147.0	0.0		261.0	62.0	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	hg19	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	T	10.78	1.447998	0.26074	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.74947	-0.89	5.4	-2.79	0.05841	.	0.760913	0.11214	N	0.587373	T	0.32436	0.0829	L	0.40543	1.245	0.09310	N	0.999995	B	0.06786	0.001	B	0.08055	0.003	T	0.11792	-1.0573	10	0.15499	T	0.54	.	2.6365	0.04959	0.1022:0.3346:0.2286:0.3346	.	345	Q9Y4K1	AIM1_HUMAN	G	753;345	ENSP00000358062:V345G	ENSP00000285105:V753G	V	+	2	0	AIM1	107074034	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	-0.782000	0.04643	-0.072000	0.12864	-0.256000	0.11100	GTT	.	.		0.438	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
SMPD2	6610	hgsc.bcm.edu	37	6	109764501	109764501	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr6:109764501G>A	ENST00000258052.3	+	9	1120	c.761G>A	c.(760-762)aGt>aAt	p.S254N	PPIL6_ENST00000521072.2_5'Flank|PPIL6_ENST00000440797.2_5'Flank|PPIL6_ENST00000424445.2_5'Flank	NM_003080.2	NP_003071.2	O60906	NSMA_HUMAN	sphingomyelin phosphodiesterase 2, neutral membrane (neutral sphingomyelinase)	254					apoptotic signaling pathway (GO:0097190)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|neurotrophin TRK receptor signaling pathway (GO:0048011)|response to mechanical stimulus (GO:0009612)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin metabolic process (GO:0006684)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)		Epithelial(106;0.0137)|all cancers(137;0.0188)|OV - Ovarian serous cystadenocarcinoma(136;0.0228)|BRCA - Breast invasive adenocarcinoma(108;0.0566)		TCCTGTAAGAGTTTTGAAACC	0.527																																					p.S254N		Atlas-SNP	.											.	SMPD2	25	.	0			c.G761A						.						94.0	102.0	99.0					6																	109764501		2203	4300	6503	SO:0001583	missense	6610	exon9			GTAAGAGTTTTGA	AJ222801	CCDS5075.1	6q21	2009-10-23			ENSG00000135587	ENSG00000135587	3.1.4.12		11121	protein-coding gene	gene with protein product		603498				9520418	Standard	XM_005267109		Approved	nSMase, ISC1	uc003pti.3	O60906	OTTHUMG00000015348	ENST00000258052.3:c.761G>A	chr6.hg19:g.109764501G>A	ENSP00000258052:p.Ser254Asn	102.0	0.0		107.0	23.0	NM_003080	Q5TED1|Q9BWR3	Missense_Mutation	SNP	ENST00000258052.3	hg19	CCDS5075.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	3.229|3.229	-0.157778|-0.157778	0.06544|0.06544	.|.	.|.	ENSG00000135587|ENSG00000135587	ENST00000258052|ENST00000458487	T|.	0.31247|.	1.5|.	5.95|5.95	3.16|3.16	0.36331|0.36331	Endonuclease/exonuclease/phosphatase (2);|.	0.609348|.	0.19428|.	N|.	0.114521|.	T|T	0.08802|0.08802	0.0218|0.0218	N|N	0.16166|0.16166	0.38|0.38	0.23492|0.23492	N|N	0.997564|0.997564	B|.	0.02656|.	0.0|.	B|.	0.06405|.	0.002|.	T|T	0.35748|0.35748	-0.9776|-0.9776	10|5	0.15499|.	T|.	0.54|.	-8.1966|-8.1966	9.2681|9.2681	0.37654|0.37654	0.1584:0.5431:0.2985:0.0|0.1584:0.5431:0.2985:0.0	.|.	254|.	O60906|.	NSMA_HUMAN|.	N|I	254|151	ENSP00000258052:S254N|.	ENSP00000258052:S254N|.	S|V	+|+	2|1	0|0	SMPD2|SMPD2	109871194|109871194	0.801000|0.801000	0.28930|0.28930	0.865000|0.865000	0.33974|0.33974	0.615000|0.615000	0.37417|0.37417	0.784000|0.784000	0.26816|0.26816	0.381000|0.381000	0.24851|0.24851	-0.165000|-0.165000	0.13383|0.13383	AGT|GTT	.	.		0.527	SMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041755.1		
RGS17	26575	hgsc.bcm.edu	37	6	153332802	153332802	+	Silent	SNP	A	A	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr6:153332802A>C	ENST00000367225.2	-	4	564	c.540T>G	c.(538-540)acT>acG	p.T180T	RGS17_ENST00000206262.1_Silent_p.T180T			Q9UGC6	RGS17_HUMAN	regulator of G-protein signaling 17	180	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(2)|endometrium(2)|large_intestine(4)|lung(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	14		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		TGTGCATTAAAGTATATATCT	0.353																																					p.T180T	Esophageal Squamous(78;500 1236 6775 24364 49058)	Atlas-SNP	.											.	RGS17	32	.	0			c.T540G						.						59.0	60.0	59.0					6																	153332802		2203	4300	6503	SO:0001819	synonymous_variant	26575	exon5			CATTAAAGTATAT	AF202257	CCDS5244.1	6q25-q26	2009-05-29	2007-08-14		ENSG00000091844	ENSG00000091844		"""Regulators of G-protein signaling"""	14088	protein-coding gene	gene with protein product		607191	"""regulator of G-protein signalling 17"""			10419452	Standard	NM_012419		Approved	RGSZ2, RGS-17	uc003qpm.3	Q9UGC6	OTTHUMG00000015858	ENST00000367225.2:c.540T>G	chr6.hg19:g.153332802A>C		233.0	0.0		209.0	17.0	NM_012419	Q5TF49|Q8TD61|Q9UJS8	Silent	SNP	ENST00000367225.2	hg19	CCDS5244.1																																																																																			.	.		0.353	RGS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042773.2		
SDK1	221935	hgsc.bcm.edu	37	7	4245519	4245519	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr7:4245519A>G	ENST00000404826.2	+	36	5246	c.5107A>G	c.(5107-5109)Atg>Gtg	p.M1703V	SDK1_ENST00000389531.3_Missense_Mutation_p.M1683V	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1703					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		AGCCCCGGCCATGGCCCCGCA	0.662																																					p.M1703V		Atlas-SNP	.											.	SDK1	361	.	0			c.A5107G						.						44.0	36.0	39.0					7																	4245519		2145	4229	6374	SO:0001583	missense	221935	exon36			CCGGCCATGGCCC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.5107A>G	chr7.hg19:g.4245519A>G	ENSP00000385899:p.Met1703Val	93.0	0.0		119.0	29.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	3.942	-0.014093	0.07681	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.52983	0.64;0.64	5.46	1.56	0.23342	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.258281	0.37761	N	0.001956	T	0.17916	0.0430	N	0.02266	-0.62	0.26122	N	0.980538	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.002;0.004;0.002	T	0.11916	-1.0568	10	0.38643	T	0.18	.	4.1767	0.10355	0.4302:0.3811:0.0667:0.1221	.	1683;190;1703	F8W6X9;F2Z3E9;Q7Z5N4	.;.;SDK1_HUMAN	V	1703;1683	ENSP00000385899:M1703V;ENSP00000374182:M1683V	ENSP00000374182:M1683V	M	+	1	0	SDK1	4212045	0.961000	0.32948	0.258000	0.24420	0.067000	0.16453	2.026000	0.41069	0.021000	0.15133	0.533000	0.62120	ATG	.	.		0.662	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
MEOX2	4223	hgsc.bcm.edu	37	7	15725803	15725803	+	Silent	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr7:15725803G>A	ENST00000262041.5	-	1	634	c.225C>T	c.(223-225)caC>caT	p.H75H	AC005550.5_ENST00000438923.1_lincRNA|AC005550.4_ENST00000442176.1_lincRNA	NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	75	Poly-His.				angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		ggtgatggtggtggtggtggt	0.602																																					p.H75H	Esophageal Squamous(140;197 1769 16409 18257 29929)	Atlas-SNP	.											MEOX2,caecum,carcinoma,0,1	MEOX2	68	.	0			c.C225T						.						21.0	22.0	22.0					7																	15725803		2203	4299	6502	SO:0001819	synonymous_variant	4223	exon1			ATGGTGGTGGTGG		CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.225C>T	chr7.hg19:g.15725803G>A		56.0	1.0		58.0	5.0	NM_005924	B2R8I7|O75263|Q9UPL6	Silent	SNP	ENST00000262041.5	hg19	CCDS34605.1																																																																																			.	.		0.602	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326058.2	NM_005924	
HECW1	23072	hgsc.bcm.edu	37	7	43447201	43447201	+	Silent	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr7:43447201C>T	ENST00000395891.2	+	8	1277	c.672C>T	c.(670-672)aaC>aaT	p.N224N	HECW1_ENST00000471043.1_3'UTR|HECW1_ENST00000453890.1_Silent_p.N224N	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	224	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						TGTTTTTCAACCCAGACCCTT	0.428																																					p.N224N		Atlas-SNP	.											.	HECW1	540	.	0			c.C672T						.						50.0	48.0	49.0					7																	43447201		1874	4106	5980	SO:0001819	synonymous_variant	23072	exon8			TTTCAACCCAGAC	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.672C>T	chr7.hg19:g.43447201C>T		242.0	0.0		279.0	22.0	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Silent	SNP	ENST00000395891.2	hg19	CCDS5469.2																																																																																			.	.		0.428	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
CACNA2D1	781	hgsc.bcm.edu	37	7	81603858	81603858	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr7:81603858T>G	ENST00000356253.5	-	25	2257	c.2002A>C	c.(2002-2004)Aat>Cat	p.N668H	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.N656H			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	668					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	TTCAGGTCATTGCAGTAATCT	0.254																																					p.N656H		Atlas-SNP	.											.	CACNA2D1	191	.	0			c.A1966C						.						48.0	47.0	47.0					7																	81603858		2196	4279	6475	SO:0001583	missense	781	exon25			GGTCATTGCAGTA	M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2002A>C	chr7.hg19:g.81603858T>G	ENSP00000348589:p.Asn668His	94.0	0.0		99.0	21.0	NM_000722	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	ENST00000356253.5	hg19		.	.	.	.	.	.	.	.	.	.	T	12.43	1.934787	0.34189	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253	T;T	0.07444	3.24;3.19	4.87	4.87	0.63330	.	0.261789	0.43110	D	0.000608	T	0.13030	0.0316	L	0.34521	1.04	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.02294	-1.1181	10	0.49607	T	0.09	-7.4741	13.9351	0.64021	0.0:0.0:0.0:1.0	.	656	P54289-2	.	H	656;675;668	ENSP00000349320:N656H;ENSP00000348589:N668H	ENSP00000284088:N675H	N	-	1	0	CACNA2D1	81441794	1.000000	0.71417	0.997000	0.53966	0.135000	0.20990	4.445000	0.60007	1.949000	0.56562	0.482000	0.46254	AAT	.	.		0.254	CACNA2D1-201	KNOWN	basic	protein_coding	protein_coding			
KIAA1324L	222223	hgsc.bcm.edu	37	7	86567441	86567441	+	Splice_Site	SNP	C	C	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr7:86567441C>G	ENST00000450689.2	-	8	1275		c.e8+1		KIAA1324L_ENST00000444627.1_Splice_Site|KIAA1324L_ENST00000297222.6_Splice_Site|KIAA1324L_ENST00000416314.1_Splice_Site	NM_001142749.2	NP_001136221.1	A8MWY0	K132L_HUMAN	KIAA1324-like							integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(14)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44	Esophageal squamous(14;0.0058)					ACTGCTGGTACCTTTCCTTCT	0.428																																					.		Atlas-SNP	.											.	KIAA1324L	225	.	0			c.1089+1G>C						.						159.0	137.0	144.0					7																	86567441		2174	4232	6406	SO:0001630	splice_region_variant	222223	exon9			CTGGTACCTTTCC	AK055902	CCDS34677.1, CCDS47632.1, CCDS34677.2	7q21.12	2008-09-18			ENSG00000164659	ENSG00000164659			21945	protein-coding gene	gene with protein product	"""EIG121-like"""	614048					Standard	NM_001142749		Approved	FLJ31340, EIG121L	uc011kha.2	A8MWY0	OTTHUMG00000153995	ENST00000450689.2:c.1089+1G>C	chr7.hg19:g.86567441C>G		68.0	0.0		65.0	13.0	NM_001142749	A4D1C9|B4DJV3|Q17RI6|Q96DP2	Splice_Site	SNP	ENST00000450689.2	hg19	CCDS47632.1	.	.	.	.	.	.	.	.	.	.	C	20.0	3.931219	0.73327	.	.	ENSG00000164659	ENST00000450689;ENST00000297222;ENST00000444627;ENST00000416314;ENST00000423294	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.348	0.90328	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIAA1324L	86405377	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	7.571000	0.82399	2.565000	0.86533	0.563000	0.77884	.	.	.		0.428	KIAA1324L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333372.3	NM_152748	Intron
OPLAH	26873	hgsc.bcm.edu	37	8	145113729	145113729	+	Silent	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr8:145113729C>T	ENST00000426825.1	-	5	615	c.534G>A	c.(532-534)ggG>ggA	p.G178G	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	178					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GAGATAGCAGCCCCTCCAGCT	0.677																																					p.G178G		Atlas-SNP	.											.	OPLAH	78	.	0			c.G534A						.						17.0	23.0	21.0					8																	145113729		2065	4187	6252	SO:0001819	synonymous_variant	26873	exon5			TAGCAGCCCCTCC	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.534G>A	chr8.hg19:g.145113729C>T		91.0	0.0		117.0	50.0	NM_017570	A5PKY8|Q75W65|Q9Y4Q0	Silent	SNP	ENST00000426825.1	hg19																																																																																				.	.		0.677	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
DOCK8	81704	hgsc.bcm.edu	37	9	328171	328171	+	Splice_Site	SNP	G	G	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr9:328171G>C	ENST00000453981.1	+	9	1156	c.1044G>C	c.(1042-1044)aaG>aaC	p.K348N	DOCK8_ENST00000432829.2_Splice_Site_p.K280N|DOCK8_ENST00000469391.1_Splice_Site_p.K280N			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	348					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TGGTAGTCAAGGTAATTCAGT	0.498																																					p.K348N		Atlas-SNP	.											.	DOCK8	401	.	0			c.G1044C						.						78.0	64.0	69.0					9																	328171		2203	4300	6503	SO:0001630	splice_region_variant	81704	exon9			AGTCAAGGTAATT	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1044+1G>C	chr9.hg19:g.328171G>C		76.0	0.0		60.0	12.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.208845	0.79240	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391	T;T;T	0.44881	0.91;0.91;0.91	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.70211	0.3198	M	0.85945	2.785	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.73380	0.98;0.98	T	0.74150	-0.3758	10	0.87932	D	0	.	19.5736	0.95432	0.0:0.0:1.0:0.0	.	280;348	E9PH09;Q8NF50	.;DOCK8_HUMAN	N	348;348;280;280	ENSP00000408464:K348N;ENSP00000394888:K280N;ENSP00000419438:K280N	ENSP00000287364:K348N	K	+	3	2	DOCK8	318171	1.000000	0.71417	1.000000	0.80357	0.365000	0.29674	9.243000	0.95416	2.729000	0.93468	0.555000	0.69702	AAG	.	.		0.498	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	Missense_Mutation
MEGF9	1955	hgsc.bcm.edu	37	9	123476253	123476253	+	Silent	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr9:123476253C>T	ENST00000373930.3	-	1	495	c.384G>A	c.(382-384)ccG>ccA	p.P128P	MEGF9_ENST00000426959.1_Silent_p.P120P	NM_001080497.2	NP_001073966.2	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	128	Pro-rich.					integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	16						GTTCCGCCGCCGGAGGGGTGG	0.716																																					p.P128P		Atlas-SNP	.											.	MEGF9	33	.	0			c.G384A						.						15.0	22.0	20.0					9																	123476253		1870	4076	5946	SO:0001819	synonymous_variant	1955	exon1			CGCCGCCGGAGGG	AB011542	CCDS48010.1, CCDS48010.2	9q32-q33.3	2008-07-21	2006-03-31	2006-03-31	ENSG00000106780	ENSG00000106780			3234	protein-coding gene	gene with protein product		604268	"""EGF-like-domain, multiple 5"""	EGFL5		9693030	Standard	NM_001080497		Approved		uc022bms.1	Q9H1U4	OTTHUMG00000021039	ENST00000373930.3:c.384G>A	chr9.hg19:g.123476253C>T		120.0	0.0		110.0	29.0	NM_001080497	B7Z315|O75098	Silent	SNP	ENST00000373930.3	hg19	CCDS48010.2																																																																																			.	.		0.716	MEGF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055513.1	NM_001080497	
C9orf142	286257	hgsc.bcm.edu	37	9	139886992	139886992	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr9:139886992G>C	ENST00000371620.3	+	1	123	c.97G>C	c.(97-99)Gac>Cac	p.D33H	C9orf142_ENST00000493968.1_3'UTR|CLIC3_ENST00000480181.1_5'Flank	NM_183241.1	NP_899064.1	Q9BUH6	CI142_HUMAN	chromosome 9 open reading frame 142	33						extracellular vesicular exosome (GO:0070062)						all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CGGGGAGGGGGACCGCGGCGG	0.746																																					p.D33H		Atlas-SNP	.											.	C9orf142	8	.	0			c.G97C						.						2.0	2.0	2.0					9																	139886992		1265	2625	3890	SO:0001583	missense	286257	exon1			GAGGGGGACCGCG	BC002613	CCDS7020.1	9q34.3	2008-02-05			ENSG00000148362	ENSG00000148362			27849	protein-coding gene	gene with protein product							Standard	NM_183241		Approved		uc004cki.3	Q9BUH6	OTTHUMG00000020971	ENST00000371620.3:c.97G>C	chr9.hg19:g.139886992G>C	ENSP00000360682:p.Asp33His	39.0	0.0		43.0	5.0	NM_183241	Q8IY19	Missense_Mutation	SNP	ENST00000371620.3	hg19	CCDS7020.1	.	.	.	.	.	.	.	.	.	.	g	16.22	3.062984	0.55432	.	.	ENSG00000148362	ENST00000371620	.	.	.	3.4	2.49	0.30216	.	1.653770	0.03482	N	0.215257	T	0.39091	0.1065	L	0.29908	0.895	0.09310	N	1	P	0.35656	0.514	B	0.40329	0.326	T	0.40646	-0.9552	9	0.54805	T	0.06	-13.2313	8.2554	0.31754	0.1188:0.0:0.8812:0.0	.	33	Q9BUH6	CI142_HUMAN	H	33	.	ENSP00000360682:D33H	D	+	1	0	C9orf142	139006813	0.057000	0.20700	0.001000	0.08648	0.039000	0.13416	3.119000	0.50422	0.990000	0.38787	0.556000	0.70494	GAC	.	.		0.746	C9orf142-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055255.1	NM_183241	
WAC	51322	hgsc.bcm.edu	37	10	28897314	28897314	+	Silent	SNP	G	G	A	rs377502318		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr10:28897314G>A	ENST00000354911.4	+	8	1280	c.1119G>A	c.(1117-1119)acG>acA	p.T373T	WAC_ENST00000428935.1_Silent_p.T328T|WAC_ENST00000375646.1_Silent_p.T225T|WAC_ENST00000347934.4_Silent_p.T270T|WAC_ENST00000375664.4_Silent_p.T328T	NM_016628.4	NP_057712.2	Q9BTA9	WAC_HUMAN	WW domain containing adaptor with coiled-coil	373					cellular response to DNA damage stimulus (GO:0006974)|G1 DNA damage checkpoint (GO:0044783)|histone H2B conserved C-terminal lysine ubiquitination (GO:0071894)|histone monoubiquitination (GO:0010390)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of macroautophagy (GO:0016239)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	chromatin binding (GO:0003682)|RNA polymerase II core binding (GO:0000993)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|urinary_tract(1)	32						TGCAAGCCACGCTGCAGCTTA	0.378																																					p.T373T		Atlas-SNP	.											.	WAC	77	.	0			c.G1119A						.	G	,	0,4406		0,0,2203	40.0	37.0	38.0		1119,810	-10.0	0.5	10		38	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous	WAC	NM_016628.4,NM_100486.3	,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,	373/648,270/545	28897314	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	51322	exon8			AGCCACGCTGCAG	AK055852	CCDS7159.1, CCDS7160.1, CCDS7161.1	10p12.1	2007-05-17	2003-03-19		ENSG00000095787	ENSG00000095787			17327	protein-coding gene	gene with protein product		615049	"""WW domain-containing adaptor with coiled coil"""			11827461	Standard	NR_024557		Approved	Wwp4, FLJ31290, PRO1741, BM-016, MGC10753	uc001iuf.3	Q9BTA9	OTTHUMG00000017872	ENST00000354911.4:c.1119G>A	chr10.hg19:g.28897314G>A		122.0	0.0		126.0	31.0	NM_016628	A8K2A9|C9JBT9|D3DRW5|D3DRW6|D3DRW7|Q53EN9|Q5JU75|Q5JU77|Q5VXK0|Q5VXK2|Q8TCK1|Q96DP3|Q96FW6|Q96JI3	Silent	SNP	ENST00000354911.4	hg19	CCDS7159.1																																																																																			.	.		0.378	WAC-017	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000047371.1	NM_100264	
NFKB2	4791	hgsc.bcm.edu	37	10	104156557	104156557	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr10:104156557C>G	ENST00000369966.3	+	5	470	c.220C>G	c.(220-222)Cga>Gga	p.R74G	NFKB2_ENST00000189444.6_Missense_Mutation_p.R74G|NFKB2_ENST00000428099.1_Missense_Mutation_p.R74G	NM_001077494.2	NP_001070962.1	Q00653	NFKB2_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)	74	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|spleen development (GO:0048536)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|skin(2)	23		Colorectal(252;0.00957)		Epithelial(162;3.4e-08)|all cancers(201;6.41e-07)	Acetylsalicylic acid(DB00945)|Glucosamine(DB01296)	TGAGAAGGGCCGAAAGACCTA	0.597			T	IGH@	B-NHL																																p.R74G		Atlas-SNP	.		Dom	yes		10	10q24	4791	nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100)		L	.	NFKB2	48	.	0			c.C220G						.						84.0	86.0	85.0					10																	104156557		2068	4205	6273	SO:0001583	missense	4791	exon5			AAGGGCCGAAAGA	X61498	CCDS41564.1, CCDS41565.1	10q24	2013-01-10			ENSG00000077150	ENSG00000077150		"""Ankyrin repeat domain containing"""	7795	protein-coding gene	gene with protein product		164012				1876189	Standard	XM_005269860		Approved	LYT-10, p52, p105, NF-kB2	uc001kvb.4	Q00653	OTTHUMG00000018962	ENST00000369966.3:c.220C>G	chr10.hg19:g.104156557C>G	ENSP00000358983:p.Arg74Gly	65.0	0.0		119.0	27.0	NM_001077494	A8K9D9|D3DR83|Q04860|Q9BU75|Q9H471|Q9H472	Missense_Mutation	SNP	ENST00000369966.3	hg19	CCDS41564.1	.	.	.	.	.	.	.	.	.	.	C	17.99	3.523734	0.64747	.	.	ENSG00000077150	ENST00000428099;ENST00000369966;ENST00000336486;ENST00000189444	T;T;T	0.41065	1.01;1.01;1.01	5.15	4.22	0.49857	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.103207	0.64402	D	0.000006	T	0.50905	0.1643	L	0.49778	1.585	0.41585	D	0.98876	P;P;P	0.40875	0.731;0.661;0.528	P;P;P	0.51657	0.676;0.588;0.653	T	0.53837	-0.8382	10	0.66056	D	0.02	.	13.1379	0.59419	0.1603:0.8397:0.0:0.0	.	74;74;74	D3DR86;Q00653;A8K9D9	.;NFKB2_HUMAN;.	G	74	ENSP00000410256:R74G;ENSP00000358983:R74G;ENSP00000189444:R74G	ENSP00000189444:R74G	R	+	1	2	NFKB2	104146547	0.334000	0.24739	1.000000	0.80357	0.979000	0.70002	0.957000	0.29215	1.099000	0.41499	0.561000	0.74099	CGA	.	.		0.597	NFKB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050080.2		
ACSL5	51703	hgsc.bcm.edu	37	10	114169431	114169431	+	Silent	SNP	A	A	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr10:114169431A>T	ENST00000393081.1	+	7	1006	c.699A>T	c.(697-699)ctA>ctT	p.L233L	RP11-324O2.3_ENST00000594870.2_RNA|ACSL5_ENST00000369410.3_5'UTR|RP11-324O2.6_ENST00000424422.1_RNA|RP11-324O2.3_ENST00000449782.2_RNA|ACSL5_ENST00000354273.4_Silent_p.L233L|ACSL5_ENST00000356116.1_Silent_p.L289L|ACSL5_ENST00000354655.4_Silent_p.L233L|ACSL5_ENST00000433418.1_Silent_p.L233L|RP11-324O2.3_ENST00000598447.1_RNA	NM_203380.1	NP_976314.1	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5	233					cellular lipid metabolic process (GO:0044255)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|prostate(1)|skin(2)|stomach(1)	21		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		TCTTATCCCTATATGATGCTG	0.473																																					p.L289L		Atlas-SNP	.											.	ACSL5	51	.	0			c.A867T						.						158.0	140.0	146.0					10																	114169431		2203	4300	6503	SO:0001819	synonymous_variant	51703	exon7			ATCCCTATATGAT	AB033899	CCDS7572.1, CCDS7573.1	10q25.1-q25.2	2004-06-21	2004-02-19	2004-02-20	ENSG00000197142	ENSG00000197142		"""Acyl-CoA synthetase family"""	16526	protein-coding gene	gene with protein product	"""FACL5 for fatty acid coenzyme A ligase 5"", ""long-chain acyl-CoA synthetase 5"", ""long-chain fatty acid coenzyme A ligase 5"", ""fatty-acid-Coenzyme A ligase, long-chain 5"""	605677	"""fatty-acid-Coenzyme A ligase, long-chain 5"""	FACL5		11127823	Standard	NM_016234		Approved	ACS5, ACS2	uc001kzu.3	Q9ULC5	OTTHUMG00000019060	ENST00000393081.1:c.699A>T	chr10.hg19:g.114169431A>T		87.0	0.0		124.0	25.0	NM_016234	A6GV77|D3DRB3|Q6UX44|Q9UIU4	Silent	SNP	ENST00000393081.1	hg19	CCDS7573.1																																																																																			.	.		0.473	ACSL5-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050386.1	NM_016234	
FANCF	2188	hgsc.bcm.edu	37	11	22646577	22646577	+	Silent	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr11:22646577C>T	ENST00000327470.3	-	1	810	c.780G>A	c.(778-780)ttG>ttA	p.L260L	AC103801.2_ENST00000428556.2_5'Flank	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	260					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						TCACTAAAGTCAAAAGCCCGG	0.542			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L260L		Atlas-SNP	.	yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	.	FANCF	24	.	0			c.G780A						.						52.0	62.0	59.0					11																	22646577		2203	4300	6503	SO:0001819	synonymous_variant	2188	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TAAAGTCAAAAGC		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.780G>A	chr11.hg19:g.22646577C>T		113.0	0.0	757	132.0	18.0	NM_022725	Q52LM0	Silent	SNP	ENST00000327470.3	hg19	CCDS7857.1																																																																																			.	.		0.542	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725	
KDM2A	22992	hgsc.bcm.edu	37	11	67015791	67015791	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr11:67015791T>A	ENST00000529006.2	+	16	2451	c.2005T>A	c.(2005-2007)Tgc>Agc	p.C669S	KDM2A_ENST00000308783.5_Missense_Mutation_p.C127S|KDM2A_ENST00000530342.1_Missense_Mutation_p.C230S|KDM2A_ENST00000398645.2_Missense_Mutation_p.C669S|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	669					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						ATTGCCAAATTGCTGGGAATG	0.443																																					p.C669S		Atlas-SNP	.											.	KDM2A	80	.	0			c.T2005A						.						75.0	70.0	72.0					11																	67015791		1919	4121	6040	SO:0001583	missense	22992	exon16			CCAAATTGCTGGG	BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2005T>A	chr11.hg19:g.67015791T>A	ENSP00000432786:p.Cys669Ser	176.0	0.0		206.0	36.0	NM_012308	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	ENST00000529006.2	hg19	CCDS44657.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.458811	0.84317	.	.	ENSG00000173120	ENST00000398645;ENST00000529006;ENST00000530342;ENST00000446134;ENST00000308783	D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13	5.16	5.16	0.70880	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.89729	0.6799	L	0.40543	1.245	0.54753	D	0.999985	D;D	0.76494	0.993;0.999	P;D	0.70227	0.796;0.968	D	0.88441	0.3042	10	0.32370	T	0.25	-12.2836	15.1664	0.72828	0.0:0.0:0.0:1.0	.	127;669	D4QA03;Q9Y2K7	.;KDM2A_HUMAN	S	669;669;230;230;127	ENSP00000381640:C669S;ENSP00000432786:C669S;ENSP00000435776:C230S;ENSP00000309302:C127S	ENSP00000309302:C127S	C	+	1	0	KDM2A	66772367	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.841000	0.86834	2.173000	0.68751	0.533000	0.62120	TGC	.	.		0.443	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393140.2	NM_012308	
CDON	50937	hgsc.bcm.edu	37	11	125830853	125830853	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr11:125830853T>A	ENST00000392693.3	-	20	3975	c.3848A>T	c.(3847-3849)cAg>cTg	p.Q1283L	RP11-680F20.12_ENST00000582823.1_RNA|CDON_ENST00000263577.7_Missense_Mutation_p.Q1260L|CDON_ENST00000531738.1_Missense_Mutation_p.Q637L	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	1283					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTCCCGGGGCTGCTGAAGGAC	0.542																																					p.Q1283L		Atlas-SNP	.											.	CDON	137	.	0			c.A3848T						.						115.0	117.0	116.0					11																	125830853		2201	4299	6500	SO:0001583	missense	50937	exon20			CGGGGCTGCTGAA	AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.3848A>T	chr11.hg19:g.125830853T>A	ENSP00000376458:p.Gln1283Leu	144.0	0.0		194.0	45.0	NM_001243597	O14631	Missense_Mutation	SNP	ENST00000392693.3	hg19	CCDS58192.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.878723	0.33162	.	.	ENSG00000064309	ENST00000392693;ENST00000531738;ENST00000263577	T;T;T	0.74526	-0.85;-0.25;-0.82	5.31	2.99	0.34606	.	0.170681	0.28031	N	0.016877	T	0.81408	0.4816	M	0.62723	1.935	0.09310	N	0.999999	D;D;D	0.63046	0.987;0.992;0.985	D;D;P	0.72982	0.953;0.979;0.643	T	0.71196	-0.4664	10	0.87932	D	0	-2.4337	8.4566	0.32903	0.0:0.1548:0.0:0.8452	.	1283;1260;637	Q4KMG0;Q4KMG0-2;E9PN78	CDON_HUMAN;.;.	L	1283;637;1260	ENSP00000376458:Q1283L;ENSP00000432901:Q637L;ENSP00000263577:Q1260L	ENSP00000263577:Q1260L	Q	-	2	0	CDON	125336063	0.983000	0.35010	0.133000	0.22050	0.005000	0.04900	2.220000	0.42908	0.466000	0.27193	-0.290000	0.09829	CAG	.	.		0.542	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386749.2	NM_016952	
EMP1	2012	hgsc.bcm.edu	37	12	13366426	13366426	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr12:13366426C>A	ENST00000256951.5	+	3	291	c.92C>A	c.(91-93)tCc>tAc	p.S31Y	EMP1_ENST00000544053.1_5'UTR|EMP1_ENST00000542289.1_Intron|EMP1_ENST00000537612.1_Missense_Mutation_p.S31Y|EMP1_ENST00000431267.2_Intron|EMP1_ENST00000396301.3_Missense_Mutation_p.S31Y	NM_001423.2	NP_001414.1	P54849	EMP1_HUMAN	epithelial membrane protein 1	31					cell growth (GO:0016049)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)							Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)		TGGTTGGTTTCCAATACGGTA	0.383																																					p.S31Y		Atlas-SNP	.											.	EMP1	14	.	0			c.C92A						.						158.0	153.0	155.0					12																	13366426		2203	4300	6503	SO:0001583	missense	2012	exon3			TGGTTTCCAATAC	U43916	CCDS8660.1	12p12.3	2008-08-04				ENSG00000134531			3333	protein-coding gene	gene with protein product		602333				8996089, 9126480	Standard	NM_001423		Approved	TMP, CL-20	uc001rbr.3	P54849		ENST00000256951.5:c.92C>A	chr12.hg19:g.13366426C>A	ENSP00000256951:p.Ser31Tyr	163.0	0.0		215.0	39.0	NM_001423	B2R5N1|B4DRR1|O00681|Q13481|Q13834	Missense_Mutation	SNP	ENST00000256951.5	hg19	CCDS8660.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.168324	0.38315	.	.	ENSG00000134531	ENST00000256951;ENST00000538364;ENST00000396301;ENST00000537612	D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.64	5.78	3.88	0.44766	.	1.084740	0.07112	N	0.842346	D	0.88153	0.6360	N	0.17082	0.46	0.09310	N	1	D;D	0.61080	0.989;0.979	P;P	0.58331	0.837;0.837	T	0.72802	-0.4183	10	0.02654	T	1	-1.1021	11.7436	0.51807	0.1252:0.5102:0.3646:0.0	.	31;31	B4DRR1;P54849	.;EMP1_HUMAN	Y	31	ENSP00000256951:S31Y;ENSP00000441223:S31Y;ENSP00000379595:S31Y;ENSP00000445319:S31Y	ENSP00000256951:S31Y	S	+	2	0	EMP1	13257693	0.000000	0.05858	0.001000	0.08648	0.016000	0.09150	0.123000	0.15708	0.843000	0.35070	0.655000	0.94253	TCC	.	.		0.383	EMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401019.1	NM_001423	
PFDN5	5204	hgsc.bcm.edu	37	12	53689386	53689386	+	Missense_Mutation	SNP	T	T	A	rs199718276		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr12:53689386T>A	ENST00000551018.1	+	1	312	c.35T>A	c.(34-36)cTg>cAg	p.L12Q	PFDN5_ENST00000550846.1_Missense_Mutation_p.L12Q|PFDN5_ENST00000334478.4_Missense_Mutation_p.L12Q|PFDN5_ENST00000351500.3_Missense_Mutation_p.L12Q	NM_002624.3	NP_002615.2	Q99471	PFD5_HUMAN	prefoldin subunit 5	12					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(1)	8						GAGCTGAATCTGCCGCAGCTA	0.587																																					p.L12Q		Atlas-SNP	.											PFDN5,NS,carcinoma,0,2	PFDN5	16	.	0			c.T35A						.						109.0	106.0	107.0					12																	53689386		2203	4300	6503	SO:0001583	missense	5204	exon1			TGAATCTGCCGCA	D89667	CCDS8853.1, CCDS8854.1	12q13.13	2008-05-14	2006-02-24						8869	protein-coding gene	gene with protein product		604899	"""prefoldin 5"""			9630229, 9792694	Standard	NM_002624		Approved	PFD5, MM-1	uc001scl.3	Q99471	OTTHUMG00000169675	ENST00000551018.1:c.35T>A	chr12.hg19:g.53689386T>A	ENSP00000447942:p.Leu12Gln	76.0	0.0		150.0	42.0	NM_002624	A8K9A8|Q54AA8|Q9C083|Q9C084	Missense_Mutation	SNP	ENST00000551018.1	hg19	CCDS8853.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.941641	0.92526	.	.	ENSG00000123349	ENST00000551018;ENST00000351500;ENST00000334478	D;T;D	0.82344	-1.6;-1.2;-1.6	5.73	5.73	0.89815	Prefoldin (1);	0.000000	0.64402	D	0.000001	D	0.91355	0.7273	M	0.84948	2.725	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.69824	0.966;0.915	D	0.92579	0.6073	10	0.87932	D	0	.	14.2815	0.66216	0.0:0.0:0.0:1.0	.	12;12	Q9C083;Q99471	.;PFD5_HUMAN	Q	12	ENSP00000447942:L12Q;ENSP00000266964:L12Q;ENSP00000334188:L12Q	ENSP00000243040:L12Q	L	+	2	0	PFDN5	51975653	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	6.030000	0.70903	2.324000	0.78689	0.533000	0.62120	CTG	.	.		0.587	PFDN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405368.2		
ERBB3	2065	hgsc.bcm.edu	37	12	56495091	56495091	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr12:56495091G>C	ENST00000267101.3	+	27	3888	c.3448G>C	c.(3448-3450)Ggg>Cgg	p.G1150R	RP11-603J24.9_ENST00000548861.1_5'Flank|ERBB3_ENST00000549832.1_Missense_Mutation_p.G270R|ERBB3_ENST00000450146.2_Missense_Mutation_p.G507R|ERBB3_ENST00000553131.1_Missense_Mutation_p.G391R|ERBB3_ENST00000415288.2_Missense_Mutation_p.G1091R	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1150					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CTCCCCACCCGGGTTAGAGGA	0.572																																					p.G1150R		Atlas-SNP	.											.	ERBB3	350	.	0			c.G3448C						.						56.0	56.0	56.0					12																	56495091		2203	4300	6503	SO:0001583	missense	2065	exon27			CCACCCGGGTTAG	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3448G>C	chr12.hg19:g.56495091G>C	ENSP00000267101:p.Gly1150Arg	108.0	0.0		140.0	32.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	ENST00000267101.3	hg19	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	G	13.11	2.140072	0.37728	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;D;T;D;D	0.84298	-1.48;-1.6;-1.46;-1.83;-1.7	6.17	5.29	0.74685	.	0.101741	0.44285	N	0.000467	T	0.75708	0.3886	L	0.27053	0.805	0.38516	D	0.948604	B;B;B	0.29612	0.251;0.163;0.017	B;B;B	0.27170	0.077;0.035;0.013	T	0.73675	-0.3908	10	0.26408	T	0.33	.	12.5573	0.56261	0.0769:0.0:0.9231:0.0	.	1091;270;1150	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	R	1150;507;1091;273;391;270	ENSP00000267101:G1150R;ENSP00000399178:G507R;ENSP00000408340:G1091R;ENSP00000449129:G391R;ENSP00000448729:G270R	ENSP00000267101:G1150R	G	+	1	0	ERBB3	54781358	1.000000	0.71417	0.644000	0.29465	0.956000	0.61745	4.269000	0.58890	1.630000	0.50440	0.655000	0.94253	GGG	.	.		0.572	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
LRP1	4035	hgsc.bcm.edu	37	12	57591115	57591115	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr12:57591115A>G	ENST00000243077.3	+	57	9576	c.9110A>G	c.(9109-9111)tAc>tGc	p.Y3037C	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3037					aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GCCAACCGGTACTACCTGCGC	0.597																																					p.Y3037C		Atlas-SNP	.											.	LRP1	428	.	0			c.A9110G						.						209.0	198.0	202.0					12																	57591115		2203	4300	6503	SO:0001583	missense	4035	exon57			ACCGGTACTACCT	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.9110A>G	chr12.hg19:g.57591115A>G	ENSP00000243077:p.Tyr3037Cys	115.0	0.0		136.0	38.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	A	17.21	3.331124	0.60853	.	.	ENSG00000123384	ENST00000243077	D	0.91180	-2.8	5.01	5.01	0.66863	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.64402	D	0.000011	D	0.94938	0.8363	M	0.81682	2.555	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94828	0.7993	10	0.48119	T	0.1	.	13.8388	0.63426	1.0:0.0:0.0:0.0	.	3037	Q07954	LRP1_HUMAN	C	3037	ENSP00000243077:Y3037C	ENSP00000243077:Y3037C	Y	+	2	0	LRP1	55877382	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	8.997000	0.93544	2.100000	0.63781	0.418000	0.28097	TAC	.	.		0.597	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
SLC5A8	160728	hgsc.bcm.edu	37	12	101573838	101573838	+	Missense_Mutation	SNP	G	G	A	rs200408412		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr12:101573838G>A	ENST00000536262.2	-	10	1760	c.1202C>T	c.(1201-1203)gCg>gTg	p.A401V		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TGACGCCAGCGCAGCCATTCC	0.433																																					p.A401V	GBM(60;420 1056 13605 22380 47675)	Atlas-SNP	.											.	SLC5A8	102	.	0			c.C1202T						.						168.0	166.0	167.0					12																	101573838		2203	4300	6503	SO:0001583	missense	160728	exon10			GCCAGCGCAGCCA	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.1202C>T	chr12.hg19:g.101573838G>A	ENSP00000445340:p.Ala401Val	120.0	0.0		197.0	36.0	NM_145913		Missense_Mutation	SNP	ENST00000536262.2	hg19	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	G	10.48	1.361241	0.24684	.	.	ENSG00000256870	ENST00000536262	D	0.86497	-2.13	5.85	3.97	0.46021	.	0.114043	0.64402	N	0.000010	T	0.78451	0.4285	L	0.37561	1.115	0.40320	D	0.978812	B	0.24963	0.115	B	0.23150	0.044	T	0.71533	-0.4564	10	0.15952	T	0.53	.	9.8809	0.41233	0.0703:0.2586:0.6711:0.0	.	401	Q8N695	SC5A8_HUMAN	V	401	ENSP00000445340:A401V	ENSP00000445340:A401V	A	-	2	0	SLC5A8	100097969	0.982000	0.34865	0.895000	0.35142	0.434000	0.31775	1.993000	0.40747	1.484000	0.48361	0.650000	0.86243	GCG	.	G|0.999;A|0.001		0.433	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913	
UBC	7316	hgsc.bcm.edu	37	12	125397889	125397889	+	Silent	SNP	C	C	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr12:125397889C>A	ENST00000538617.1	-	3	745	c.429G>T	c.(427-429)ctG>ctT	p.L143L	UBC_ENST00000536769.1_Silent_p.L143L|UBC_ENST00000546120.1_Intron|MIR5188_ENST00000583467.1_RNA|UBC_ENST00000339647.5_Silent_p.L143L|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	523	Ubiquitin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		GCACCAGGTGCAGGGTAGACT	0.557																																					p.L143L		Atlas-SNP	.											.	UBC	79	.	0			c.G429T						.						102.0	102.0	102.0					12																	125397889		2203	4297	6500	SO:0001819	synonymous_variant	7316	exon2			CAGGTGCAGGGTA		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.429G>T	chr12.hg19:g.125397889C>A		118.0	0.0		145.0	32.0	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	ENST00000538617.1	hg19																																																																																				.	.		0.557	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000400179.1	NM_021009	
EPSTI1	94240	hgsc.bcm.edu	37	13	43566216	43566216	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr13:43566216C>T	ENST00000398762.3	-	1	85	c.86G>A	c.(85-87)gGg>gAg	p.G29E	EPSTI1_ENST00000313640.7_Missense_Mutation_p.G29E|EPSTI1_ENST00000476830.2_5'UTR|EPSTI1_ENST00000313624.7_Missense_Mutation_p.G29E			Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 (breast)	29										endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|skin(1)	17		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		CCCTTGCCGCCCAGAAGGGTC	0.697																																					p.G29E		Atlas-SNP	.											.	EPSTI1	47	.	0			c.G86A						.						23.0	29.0	27.0					13																	43566216		2188	4283	6471	SO:0001583	missense	94240	exon1			TGCCGCCCAGAAG	AF396928	CCDS9387.1, CCDS31964.1	13q13.3	2011-06-27			ENSG00000133106	ENSG00000133106			16465	protein-coding gene	gene with protein product	"""epithelial stromal interaction protein 1"""	607441				11991720	Standard	NM_033255		Approved	BRESI1, MGC29634	uc001uyw.2	Q96J88	OTTHUMG00000016814	ENST00000398762.3:c.86G>A	chr13.hg19:g.43566216C>T	ENSP00000381746:p.Gly29Glu	207.0	0.0		324.0	86.0	NM_001002264	Q8IVC7|Q8NDQ7	Missense_Mutation	SNP	ENST00000398762.3	hg19	CCDS9387.1	.	.	.	.	.	.	.	.	.	.	C	8.049	0.765557	0.15914	.	.	ENSG00000133106	ENST00000313640;ENST00000313624;ENST00000398762	.	.	.	0.757	0.757	0.18427	.	1.221540	0.05757	N	0.604161	T	0.41673	0.1169	L	0.54323	1.7	0.09310	N	1	B;B	0.13145	0.004;0.007	B;B	0.11329	0.006;0.005	T	0.38090	-0.9677	9	0.49607	T	0.09	0.0925	4.7802	0.13199	0.0:1.0:0.0:0.0	.	29;29	Q96J88-2;Q96J88-3	.;.	E	29	.	ENSP00000318643:G29E	G	-	2	0	EPSTI1	42464216	0.000000	0.05858	0.003000	0.11579	0.011000	0.07611	-1.394000	0.02518	0.683000	0.31428	0.305000	0.20034	GGG	.	.		0.697	EPSTI1-010	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400321.1	NM_001002264	
RNF219	79596	hgsc.bcm.edu	37	13	79190261	79190261	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr13:79190261C>T	ENST00000282003.6	-	6	1693	c.1635G>A	c.(1633-1635)atG>atA	p.M545I	RNF219-AS1_ENST00000606429.1_RNA|RNF219-AS1_ENST00000560584.2_RNA|RNF219-AS1_ENST00000560209.2_RNA	NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219	545	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		CTGACTCTGACATCATTGAAT	0.413																																					p.M545I		Atlas-SNP	.											.	RNF219	94	.	0			c.G1635A						.						147.0	147.0	147.0					13																	79190261		2203	4300	6503	SO:0001583	missense	79596	exon6			CTCTGACATCATT	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.1635G>A	chr13.hg19:g.79190261C>T	ENSP00000282003:p.Met545Ile	93.0	0.0		112.0	33.0	NM_024546	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Missense_Mutation	SNP	ENST00000282003.6	hg19	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.234007	0.79688	.	.	ENSG00000152193	ENST00000282003	T	0.14022	2.54	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.37625	0.1010	M	0.61703	1.905	0.58432	D	0.999994	D	0.69078	0.997	D	0.73380	0.98	T	0.00907	-1.1519	10	0.48119	T	0.1	-22.7	20.2019	0.98263	0.0:1.0:0.0:0.0	.	545	Q5W0B1	RN219_HUMAN	I	545	ENSP00000282003:M545I	ENSP00000282003:M545I	M	-	3	0	RNF219	78088262	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.424000	0.66464	2.776000	0.95493	0.655000	0.94253	ATG	.	.		0.413	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	
KLHL28	54813	hgsc.bcm.edu	37	14	45403543	45403543	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr14:45403543T>C	ENST00000396128.4	-	3	1237	c.1118A>G	c.(1117-1119)aAt>aGt	p.N373S	KLHL28_ENST00000355081.2_Missense_Mutation_p.N387S	NM_017658.3	NP_060128.2	Q9NXS3	KLH28_HUMAN	kelch-like family member 28	373										breast(2)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TCGGCTTTCATTCATTCTCTC	0.398																																					p.N373S		Atlas-SNP	.											.	KLHL28	53	.	0			c.A1118G						.						130.0	120.0	124.0					14																	45403543		2203	4300	6503	SO:0001583	missense	54813	exon3			CTTTCATTCATTC	AK000088	CCDS9680.1	14q21.1	2013-02-22	2013-02-22	2007-01-09	ENSG00000179454	ENSG00000179454		"""Kelch-like"", ""BTB/POZ domain containing"""	19741	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 5"", ""kelch-like 28 (Drosophila)"""	BTBD5			Standard	NM_017658		Approved	FLJ20081	uc001wvr.3	Q9NXS3	OTTHUMG00000140263	ENST00000396128.4:c.1118A>G	chr14.hg19:g.45403543T>C	ENSP00000379434:p.Asn373Ser	169.0	0.0		169.0	45.0	NM_017658	Q0VAL5	Missense_Mutation	SNP	ENST00000396128.4	hg19	CCDS9680.1	.	.	.	.	.	.	.	.	.	.	T	1.283	-0.609703	0.03690	.	.	ENSG00000179454	ENST00000396128;ENST00000355081	T;T	0.73469	-0.75;-0.75	5.38	5.38	0.77491	Kelch-type beta propeller (1);	0.379360	0.32563	N	0.005921	T	0.54287	0.1849	L	0.33137	0.985	0.27761	N	0.943838	B	0.02656	0.0	B	0.06405	0.002	T	0.47355	-0.9124	10	0.02654	T	1	.	4.8494	0.13530	0.2666:0.0802:0.0:0.6531	.	373	Q9NXS3	KLH28_HUMAN	S	373;387	ENSP00000379434:N373S;ENSP00000347193:N387S	ENSP00000347193:N387S	N	-	2	0	KLHL28	44473293	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.492000	0.45311	2.157000	0.67596	0.455000	0.32223	AAT	.	.		0.398	KLHL28-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276790.3		
HERC2	8924	hgsc.bcm.edu	37	15	28516001	28516001	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr15:28516001G>A	ENST00000261609.7	-	10	1205	c.1097C>T	c.(1096-1098)cCt>cTt	p.P366L		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGGGCTCAGAGGGCCAGACAA	0.428																																					p.P366L		Atlas-SNP	.											.	HERC2	501	.	0			c.C1097T						.						36.0	33.0	34.0					15																	28516001		2203	4300	6503	SO:0001583	missense	8924	exon10			CTCAGAGGGCCAG	AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.1097C>T	chr15.hg19:g.28516001G>A	ENSP00000261609:p.Pro366Leu	141.0	0.0		178.0	39.0	NM_004667		Missense_Mutation	SNP	ENST00000261609.7	hg19	CCDS10021.1	.	.	.	.	.	.	.	.	.	.	G	11.56	1.676326	0.29783	.	.	ENSG00000128731	ENST00000261609	T	0.38401	1.14	5.74	5.74	0.90152	.	0.118259	0.64402	D	0.000018	T	0.23532	0.0569	N	0.19112	0.55	0.58432	D	0.999999	B	0.27498	0.18	B	0.21917	0.037	T	0.07424	-1.0773	10	0.16420	T	0.52	.	14.7248	0.69336	0.0:0.0:0.8552:0.1448	.	366	O95714	HERC2_HUMAN	L	366	ENSP00000261609:P366L	ENSP00000261609:P366L	P	-	2	0	HERC2	26189596	1.000000	0.71417	0.993000	0.49108	0.373000	0.29922	5.585000	0.67497	2.706000	0.92434	0.650000	0.86243	CCT	.	.		0.428	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251358.2	NM_004667	
DENND4A	10260	hgsc.bcm.edu	37	15	65957785	65957785	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr15:65957785T>C	ENST00000431932.2	-	29	5333	c.5125A>G	c.(5125-5127)Atg>Gtg	p.M1709V	DENND4A_ENST00000443035.3_Missense_Mutation_p.M1752V	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1709					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						TCTTCAGACATACAGTGGCGG	0.303																																					p.M1752V		Atlas-SNP	.											.	DENND4A	217	.	0			c.A5254G						.						110.0	109.0	109.0					15																	65957785		1865	4115	5980	SO:0001583	missense	10260	exon30			CAGACATACAGTG	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.5125A>G	chr15.hg19:g.65957785T>C	ENSP00000396830:p.Met1709Val	104.0	0.0		101.0	28.0	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	ENST00000431932.2	hg19	CCDS45285.1	.	.	.	.	.	.	.	.	.	.	T	13.38	2.219359	0.39201	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.04654	3.6;3.58	5.71	5.71	0.89125	.	0.200060	0.53938	D	0.000057	T	0.08403	0.0209	L	0.44542	1.39	0.46654	D	0.999145	P;D	0.53745	0.691;0.962	B;P	0.46885	0.329;0.53	T	0.31641	-0.9936	10	0.33141	T	0.24	.	15.9781	0.80086	0.0:0.0:0.0:1.0	.	1752;1709	E7EPL3;Q7Z401	.;MYCPP_HUMAN	V	1752;1709	ENSP00000391167:M1752V;ENSP00000396830:M1709V	ENSP00000396830:M1709V	M	-	1	0	DENND4A	63744839	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.531000	0.53546	2.171000	0.68590	0.533000	0.62120	ATG	.	.		0.303	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
PSTPIP1	9051	hgsc.bcm.edu	37	15	77320928	77320928	+	Missense_Mutation	SNP	G	G	T	rs1141043		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr15:77320928G>T	ENST00000558012.1	+	7	940	c.451G>T	c.(451-453)Gcg>Tcg	p.A151S	PSTPIP1_ENST00000557995.1_3'UTR|PSTPIP1_ENST00000267939.5_Missense_Mutation_p.A150S|PSTPIP1_ENST00000379595.3_Missense_Mutation_p.A151S|PSTPIP1_ENST00000559295.1_Missense_Mutation_p.A151S	NM_003978.3	NP_003969.2	O43586	PPIP1_HUMAN	proline-serine-threonine phosphatase interacting protein 1	151			A -> S (in dbSNP:rs1141043). {ECO:0000269|Ref.2}.		cell adhesion (GO:0007155)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|signal transduction (GO:0007165)	actomyosin contractile ring (GO:0005826)|cell projection (GO:0042995)|cleavage furrow (GO:0032154)|cytosol (GO:0005829)|membrane (GO:0016020)|stress fiber (GO:0001725)				breast(1)|endometrium(3)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	9						GTGCCGGGACGCGGACGACGC	0.677																																					p.A151S		Atlas-SNP	.											.	PSTPIP1	50	.	0			c.G451T						.						18.0	22.0	20.0					15																	77320928		2039	4165	6204	SO:0001583	missense	9051	exon7			CGGGACGCGGACG	U94778	CCDS45312.1	15q24.3	2014-09-17			ENSG00000140368	ENSG00000140368			9580	protein-coding gene	gene with protein product	"""CD2 cytoplasmic tail-binding protein"", ""CD2 antigen-binding protein 1"", ""PEST phosphatase-interacting protein 1"""	606347				9857189	Standard	NM_003978		Approved	PSTPIP, CD2BP1L, CD2BP1, CD2BP1S, H-PIP, PAPAS	uc002bcf.2	O43586	OTTHUMG00000172594	ENST00000558012.1:c.451G>T	chr15.hg19:g.77320928G>T	ENSP00000452746:p.Ala151Ser	274.0	0.0		366.0	93.0	NM_003978	B5BU74|B5BUK4|O43585|O95657	Missense_Mutation	SNP	ENST00000558012.1	hg19	CCDS45312.1	.	.	.	.	.	.	.	.	.	.	g	15.55	2.865813	0.51588	.	.	ENSG00000140368	ENST00000379595;ENST00000267939	T;T	0.47177	0.85;2.44	4.55	4.55	0.56014	Prismane-like (1);	0.000000	0.85682	D	0.000000	T	0.60508	0.2274	M	0.68317	2.08	0.58432	D	0.999998	D;P;D;P	0.64830	0.994;0.886;0.983;0.585	P;P;P;B	0.58454	0.839;0.72;0.752;0.235	T	0.58014	-0.7711	10	0.20519	T	0.43	-9.7098	16.0972	0.81135	0.0:0.0:1.0:0.0	rs1141043	29;151;150;151	B4DQC0;O43586-2;C9K004;O43586	.;.;.;PPIP1_HUMAN	S	151;150	ENSP00000368914:A151S;ENSP00000267939:A150S	ENSP00000267939:A150S	A	+	1	0	PSTPIP1	75107983	0.988000	0.35896	0.699000	0.30290	0.158000	0.22134	3.301000	0.51842	2.088000	0.63022	0.443000	0.29094	GCG	.	G|1.000;|0.000		0.677	PSTPIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000419373.2	NM_003978	
GNPTG	84572	hgsc.bcm.edu	37	16	1399610	1399610	+	5'Flank	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr16:1399610C>T	ENST00000204679.4	+	0	0				TSR3_ENST00000007390.2_Splice_Site	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit						carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				CGAGGGCAGCCTGGGAGAGGA	0.627																																					.		Atlas-SNP	.											.	.	.	.	0			c.768-1G>A						.						30.0	35.0	34.0					16																	1399610		2198	4299	6497	SO:0001631	upstream_gene_variant	115939	exon7			GGCAGCCTGGGAG	BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835		chr16.hg19:g.1399610C>T	Exception_encountered	101.0	0.0		142.0	20.0	NM_001001410	B2R556|Q6XYD7|Q96L13	Splice_Site	SNP	ENST00000204679.4	hg19	CCDS10436.1	.	.	.	.	.	.	.	.	.	.	C	8.328	0.825766	0.16749	.	.	ENSG00000007520	ENST00000007390	.	.	.	4.38	2.26	0.28386	.	.	.	.	.	.	.	.	.	.	.	0.22330	N	0.999195	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8635	0.18762	0.1888:0.7032:0.0:0.108	.	.	.	.	.	-1	.	.	.	-	.	.	C16orf42	1339611	0.589000	0.26807	0.058000	0.19502	0.342000	0.28953	1.386000	0.34419	0.973000	0.38340	0.561000	0.74099	.	.	.		0.627	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109058.2	NM_032520	
SRRM2	23524	hgsc.bcm.edu	37	16	2815588	2815588	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr16:2815588C>T	ENST00000301740.8	+	11	5608	c.5059C>T	c.(5059-5061)Cga>Tga	p.R1687*		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1687	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TACACCACCTCGACGTCGCAG	0.567																																					p.R1687X		Atlas-SNP	.											.	SRRM2	263	.	0			c.C5059T						.						104.0	83.0	90.0					16																	2815588		2198	4300	6498	SO:0001587	stop_gained	23524	exon11			CCACCTCGACGTC	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.5059C>T	chr16.hg19:g.2815588C>T	ENSP00000301740:p.Arg1687*	81.0	0.0		87.0	37.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Nonsense_Mutation	SNP	ENST00000301740.8	hg19	CCDS32373.1	.	.	.	.	.	.	.	.	.	.	C	44	10.861450	0.99479	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933	.	.	.	5.47	5.47	0.80525	.	0.000000	0.53938	D	0.000046	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.8877	11.8538	0.52425	0.1747:0.8253:0.0:0.0	.	.	.	.	X	1687;1687;939	.	ENSP00000301740:R1687X	R	+	1	2	SRRM2	2755589	0.997000	0.39634	1.000000	0.80357	0.978000	0.69477	0.858000	0.27845	2.566000	0.86566	0.655000	0.94253	CGA	.	.		0.567	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
MYH10	4628	hgsc.bcm.edu	37	17	8424298	8424298	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:8424298T>A	ENST00000269243.4	-	17	2216	c.2078A>T	c.(2077-2079)cAc>cTc	p.H693L	MYH10_ENST00000360416.3_Missense_Mutation_p.H724L|MYH10_ENST00000396239.1_Missense_Mutation_p.H714L|MYH10_ENST00000379980.4_Missense_Mutation_p.H709L	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	693	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TAGGACTAGGTGTGGATCCAA	0.428																																					p.H724L		Atlas-SNP	.											.	MYH10	148	.	0			c.A2171T						.						77.0	69.0	72.0					17																	8424298		2203	4300	6503	SO:0001583	missense	4628	exon19			ACTAGGTGTGGAT	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.2078A>T	chr17.hg19:g.8424298T>A	ENSP00000269243:p.His693Leu	180.0	0.0		223.0	44.0	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	hg19	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.135891	0.77662	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;D;D	0.86956	-2.19;-2.19;-2.19;-2.19	5.19	5.19	0.71726	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.86602	0.5972	L	0.47078	1.49	0.80722	D	1	P;P;P	0.44946	0.846;0.717;0.846	P;P;P	0.50314	0.614;0.637;0.614	T	0.83269	-0.0044	10	0.12103	T	0.63	.	15.2135	0.73244	0.0:0.0:0.0:1.0	.	702;724;693	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	L	693;724;714;709	ENSP00000269243:H693L;ENSP00000353590:H724L;ENSP00000379539:H714L;ENSP00000369315:H709L	ENSP00000269243:H693L	H	-	2	0	MYH10	8365023	1.000000	0.71417	0.251000	0.24312	0.895000	0.52256	7.714000	0.84703	2.188000	0.69820	0.533000	0.62120	CAC	.	.		0.428	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
MYO18A	399687	hgsc.bcm.edu	37	17	27442372	27442372	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:27442372T>C	ENST00000527372.1	-	13	2495	c.2315A>G	c.(2314-2316)aAt>aGt	p.N772S	MYO18A_ENST00000354329.4_Missense_Mutation_p.N772S|MYO18A_ENST00000531253.1_Missense_Mutation_p.N772S|MYO18A_ENST00000533112.1_Missense_Mutation_p.N772S	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	772	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CACTCACCTATTCACCAGGGA	0.617																																					p.N772S	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.A2315G						.						39.0	47.0	44.0					17																	27442372		1993	4164	6157	SO:0001583	missense	399687	exon13			CACCTATTCACCA	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2315A>G	chr17.hg19:g.27442372T>C	ENSP00000437073:p.Asn772Ser	103.0	0.0		157.0	31.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	ENST00000527372.1	hg19	CCDS45642.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.904880	0.92035	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000458428	D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08	5.43	5.43	0.79202	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.98686	0.9559	H	0.95816	3.725	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.998;0.998;0.998;1.0	D;D;D;D;D	0.91635	0.998;0.994;0.994;0.994;0.999	D	0.99774	1.1025	10	0.87932	D	0	.	15.4894	0.75593	0.0:0.0:0.0:1.0	.	441;384;772;772;772	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	S	772;772;772;772;772;384	ENSP00000346291:N772S;ENSP00000435932:N772S;ENSP00000434228:N772S;ENSP00000437073:N772S	ENSP00000346291:N772S	N	-	2	0	MYO18A	24466498	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.857000	0.69525	2.070000	0.61991	0.533000	0.62120	AAT	.	.		0.617	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
ANKRD13B	124930	hgsc.bcm.edu	37	17	27939496	27939496	+	Silent	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:27939496G>A	ENST00000394859.3	+	12	1489	c.1335G>A	c.(1333-1335)tcG>tcA	p.S445S	RP11-68I3.2_ENST00000581474.1_RNA	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	445	Ser-rich.					endosome (GO:0005768)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						CGGTGCCATCGGTGCGAGGCA	0.642																																					p.S445S		Atlas-SNP	.											.	ANKRD13B	39	.	0			c.G1335A						.						27.0	27.0	27.0					17																	27939496		2200	4296	6496	SO:0001819	synonymous_variant	124930	exon12			GCCATCGGTGCGA	AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.1335G>A	chr17.hg19:g.27939496G>A		221.0	0.0		237.0	61.0	NM_152345	Q8N7S9	Silent	SNP	ENST00000394859.3	hg19	CCDS11251.1																																																																																			.	.		0.642	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256077.1	NM_152345	
KRT10	3858	hgsc.bcm.edu	37	17	38975319	38975319	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:38975319C>T	ENST00000269576.5	-	7	1477	c.1468G>A	c.(1468-1470)Ggc>Agc	p.G490S	TMEM99_ENST00000301665.3_5'Flank	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	490	Gly-rich.|Ser-rich.|Tail.			Missing (in Ref. 8; AAA59199). {ECO:0000305}.	cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				ccgccgtggccgccgccgtgg	0.791																																					p.G490S		Atlas-SNP	.											.	KRT10	56	.	0			c.G1468A						.																																			SO:0001583	missense	3858	exon7			CGTGGCCGCCGCC	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1468G>A	chr17.hg19:g.38975319C>T	ENSP00000269576:p.Gly490Ser	29.0	0.0		65.0	5.0	NM_000421	Q14664|Q8N175	Missense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.546565	0.86022	.	.	ENSG00000186395	ENST00000269576	D	0.96587	-4.06	4.38	4.38	0.52667	.	0.845686	0.09879	N	0.743932	D	0.94778	0.8314	N	0.08118	0	0.27860	N	0.940431	D	0.89917	1.0	D	0.76071	0.987	D	0.87790	0.2618	10	0.18710	T	0.47	.	12.7512	0.57310	0.0:1.0:0.0:0.0	.	490	P13645	K1C10_HUMAN	S	490	ENSP00000269576:G490S	ENSP00000269576:G490S	G	-	1	0	KRT10	36228845	0.019000	0.18553	0.876000	0.34364	0.184000	0.23303	0.448000	0.21726	2.739000	0.93911	0.603000	0.83216	GGC	.	.		0.791	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
KRT12	3859	hgsc.bcm.edu	37	17	39018821	39018821	+	Silent	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:39018821A>G	ENST00000251643.4	-	7	1406	c.1383T>C	c.(1381-1383)tcT>tcC	p.S461S	RP5-1110E20.1_ENST00000579136.1_RNA	NM_000223.3	NP_000214.1	Q99456	K1C12_HUMAN	keratin 12	461	Tail.				visual perception (GO:0007601)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(2)	15		Breast(137;0.000301)			Griseofulvin(DB00400)	GCATACCTTTAGAGGAATCAG	0.353																																					p.S461S		Atlas-SNP	.											.	KRT12	53	.	0			c.T1383C						.						142.0	134.0	137.0					17																	39018821		2203	4300	6503	SO:0001819	synonymous_variant	3859	exon7			ACCTTTAGAGGAA		CCDS11378.1	17q21.2	2013-06-20	2008-08-01		ENSG00000187242	ENSG00000187242		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6414	protein-coding gene	gene with protein product	"""Meesmann corneal dystrophy"""	601687				9171831, 16831889	Standard	NM_000223		Approved	K12	uc002hvk.2	Q99456	OTTHUMG00000133369	ENST00000251643.4:c.1383T>C	chr17.hg19:g.39018821A>G		101.0	0.0		120.0	25.0	NM_000223	B2R9E0	Silent	SNP	ENST00000251643.4	hg19	CCDS11378.1																																																																																			.	.		0.353	KRT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257214.2	NM_000223	
TUBD1	51174	hgsc.bcm.edu	37	17	57963509	57963509	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:57963509T>G	ENST00000592426.1	-	2	255	c.255A>C	c.(253-255)caA>caC	p.Q85H	TUBD1_ENST00000394239.3_Missense_Mutation_p.Q85H|TUBD1_ENST00000539018.1_Intron|TUBD1_ENST00000346141.6_Intron|TUBD1_ENST00000325752.3_Missense_Mutation_p.Q85H|TUBD1_ENST00000340993.6_Missense_Mutation_p.Q85H|TUBD1_ENST00000376094.4_Missense_Mutation_p.Q85H|TUBD1_ENST00000591611.1_5'UTR			Q9UJT1	TBD_HUMAN	tubulin, delta 1	85					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	CATATTTCCATTGGCCAGACT	0.418																																					p.Q85H		Atlas-SNP	.											.	TUBD1	38	.	0			c.A255C						.						127.0	124.0	125.0					17																	57963509		2203	4300	6503	SO:0001583	missense	51174	exon3			TTTCCATTGGCCA	AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.255A>C	chr17.hg19:g.57963509T>G	ENSP00000468518:p.Gln85His	122.0	0.0		175.0	58.0	NM_016261	B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	ENST00000592426.1	hg19	CCDS11620.1	.	.	.	.	.	.	.	.	.	.	T	13.49	2.251660	0.39797	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000394239;ENST00000376094	T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29	6.08	2.67	0.31697	Tubulin/FtsZ, GTPase domain (4);	0.528179	0.20747	N	0.086425	T	0.44117	0.1278	N	0.17474	0.49	0.80722	D	1	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.15484	0.003;0.001;0.0;0.013	T	0.21280	-1.0250	10	0.48119	T	0.1	-0.345	2.9007	0.05705	0.1042:0.1353:0.1539:0.6065	.	85;85;85;85	E9PCA7;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;TBD_HUMAN	H	85	ENSP00000320797:Q85H;ENSP00000342399:Q85H;ENSP00000377785:Q85H;ENSP00000365262:Q85H	ENSP00000320797:Q85H	Q	-	3	2	TUBD1	55318291	0.061000	0.20836	0.938000	0.37757	0.990000	0.78478	0.351000	0.20096	0.179000	0.19938	-0.264000	0.10439	CAA	.	.		0.418	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448815.1	NM_016261	
INTS2	57508	hgsc.bcm.edu	37	17	59968916	59968916	+	Silent	SNP	G	G	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:59968916G>T	ENST00000444766.3	-	14	1932	c.1857C>A	c.(1855-1857)gtC>gtA	p.V619V	INTS2_ENST00000251334.6_Silent_p.V611V	NM_020748.2	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2	619					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|intracellular (GO:0005622)|membrane (GO:0016020)				NS(1)|breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	38						CCTGTTCTGTGACTGGCTGAT	0.343																																					p.V619V		Atlas-SNP	.											.	INTS2	89	.	0			c.C1857A						.						152.0	152.0	152.0					17																	59968916		1869	4095	5964	SO:0001819	synonymous_variant	57508	exon14			TTCTGTGACTGGC	AB033113	CCDS45750.1	17q23.2	2006-04-26	2006-03-15	2006-03-15		ENSG00000108506			29241	protein-coding gene	gene with protein product		611346	"""KIAA1287"""	KIAA1287		16239144	Standard	NR_026641		Approved	INT2	uc002izn.3	Q9H0H0		ENST00000444766.3:c.1857C>A	chr17.hg19:g.59968916G>T		156.0	0.0		190.0	14.0	NM_020748	Q9ULD3	Silent	SNP	ENST00000444766.3	hg19	CCDS45750.1																																																																																			.	.		0.343	INTS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000445368.1	NM_020748	
DDX5	1655	hgsc.bcm.edu	37	17	62496761	62496761	+	Silent	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr17:62496761G>A	ENST00000225792.5	-	12	1748	c.1347C>T	c.(1345-1347)aaC>aaT	p.N449N	DDX5_ENST00000450599.2_Silent_p.N370N|MIR5047_ENST00000579212.1_RNA|MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000580026.1_5'UTR|DDX5_ENST00000578804.1_Silent_p.N449N	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	449	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CTTGCTTTATGTTATTAGGTG	0.423			T	ETV4	prostate																																p.N449N	NSCLC(22;406 813 4871 19580 40307)	Atlas-SNP	.		Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	.	DDX5	101	.	0			c.C1347T						.						162.0	144.0	150.0					17																	62496761		2203	4300	6503	SO:0001819	synonymous_variant	1655	exon12			CTTTATGTTATTA	AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1347C>T	chr17.hg19:g.62496761G>A		132.0	0.0		167.0	47.0	NM_004396	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Silent	SNP	ENST00000225792.5	hg19	CCDS11659.1																																																																																			.	.		0.423	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444030.1	NM_004396	
MIB1	57534	hgsc.bcm.edu	37	18	19399526	19399526	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr18:19399526T>G	ENST00000261537.6	+	12	2012	c.1748T>G	c.(1747-1749)tTg>tGg	p.L583W	SNORA73_ENST00000363107.1_RNA|MIB1_ENST00000578646.1_3'UTR	NM_020774.2	NP_065825.1	Q86YT6	MIB1_HUMAN	mindbomb E3 ubiquitin protein ligase 1	583					blood vessel development (GO:0001568)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|negative regulation of neuron differentiation (GO:0045665)|neural tube formation (GO:0001841)|Notch signaling pathway (GO:0007219)|positive regulation of endocytosis (GO:0045807)|somitogenesis (GO:0001756)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|ovary(5)	27			STAD - Stomach adenocarcinoma(5;0.212)			GCAGTTCTTTTGGAAGCTGGA	0.383																																					p.L583W		Atlas-SNP	.											.	MIB1	87	.	0			c.T1748G						.						149.0	141.0	144.0					18																	19399526		2203	4300	6503	SO:0001583	missense	57534	exon12			TTCTTTTGGAAGC	AB037744	CCDS11871.1	18q11.2	2014-09-17	2012-02-23		ENSG00000101752	ENSG00000101752		"""Zinc fingers, ZZ-type"", ""Ankyrin repeat domain containing"""	21086	protein-coding gene	gene with protein product		608677	"""mindbomb homolog 1 (Drosophila)"""				Standard	NM_020774		Approved	DIP-1, MIB, KIAA1323, ZZANK2, ZZZ6	uc002ktq.3	Q86YT6	OTTHUMG00000131753	ENST00000261537.6:c.1748T>G	chr18.hg19:g.19399526T>G	ENSP00000261537:p.Leu583Trp	101.0	0.0		126.0	36.0	NM_020774	B0YJ38|Q2TB37|Q68D01|Q6YI51|Q8NBY0|Q8TCB5|Q8TCL7|Q9P2M3	Missense_Mutation	SNP	ENST00000261537.6	hg19	CCDS11871.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.953391	0.92660	.	.	ENSG00000101752	ENST00000261537	T	0.19938	2.11	5.4	5.4	0.78164	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000001	T	0.62441	0.2428	H	0.98027	4.13	0.80722	D	1	D	0.76494	0.999	D	0.68943	0.961	T	0.78316	-0.2251	10	0.87932	D	0	-7.3818	15.4268	0.75059	0.0:0.0:0.0:1.0	.	583	Q86YT6	MIB1_HUMAN	W	583	ENSP00000261537:L583W	ENSP00000261537:L583W	L	+	2	0	MIB1	17653524	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.057000	0.61298	0.460000	0.39030	TTG	.	.		0.383	MIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254675.1	NM_020774	
DCC	1630	hgsc.bcm.edu	37	18	50450079	50450079	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr18:50450079C>T	ENST00000442544.2	+	4	1316	c.700C>T	c.(700-702)Cca>Tca	p.P234S	DCC_ENST00000412726.1_Missense_Mutation_p.P82S	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	234	Ig-like C2-type 3.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCTCATAGATCCAGGACTGCA	0.348																																					p.P234S		Atlas-SNP	.											DCC,NS,carcinoma,0,1	DCC	360	.	0			c.C700T						.						107.0	93.0	98.0					18																	50450079		2203	4300	6503	SO:0001583	missense	1630	exon4			ATAGATCCAGGAC	X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.700C>T	chr18.hg19:g.50450079C>T	ENSP00000389140:p.Pro234Ser	120.0	2.0		154.0	32.0	NM_005215		Missense_Mutation	SNP	ENST00000442544.2	hg19	CCDS11952.1	.	.	.	.	.	.	.	.	.	.	C	10.84	1.465056	0.26335	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	T;T	0.62364	0.03;0.03	5.67	5.67	0.87782	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.45094	0.1325	N	0.20574	0.59	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.34104	-0.9842	10	0.21014	T	0.42	.	11.9488	0.52944	0.0:0.9196:0.0:0.0804	.	82;234	E7EQM8;P43146	.;DCC_HUMAN	S	234;167;82	ENSP00000389140:P234S;ENSP00000397322:P82S	ENSP00000304146:P167S	P	+	1	0	DCC	48704077	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	4.027000	0.57239	2.679000	0.91253	0.655000	0.94253	CCA	.	.		0.348	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255996.3	NM_005215	
SALL3	27164	hgsc.bcm.edu	37	18	76753827	76753827	+	Silent	SNP	C	C	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr18:76753827C>A	ENST00000537592.2	+	2	1836	c.1836C>A	c.(1834-1836)ccC>ccA	p.P612P	SALL3_ENST00000575389.2_Silent_p.P612P|SALL3_ENST00000536229.3_Silent_p.P479P	NM_171999.3	NP_741996.2	Q9BXA9	SALL3_HUMAN	spalt-like transcription factor 3	612					forelimb morphogenesis (GO:0035136)|hindlimb morphogenesis (GO:0035137)|negative regulation of smoothened signaling pathway (GO:0045879)|olfactory bulb interneuron development (GO:0021891)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(40)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GGGACGCTCCCGTGGGCGCGC	0.751																																					p.P612P		Atlas-SNP	.											.	SALL3	162	.	0			c.C1836A						.						4.0	5.0	5.0					18																	76753827		1884	3761	5645	SO:0001819	synonymous_variant	27164	exon2			CGCTCCCGTGGGC	AJ007421	CCDS12013.1	18q23	2013-10-17	2013-10-17		ENSG00000256463	ENSG00000256463		"""Zinc fingers, C2H2-type"""	10527	protein-coding gene	gene with protein product		605079	"""sal (Drosophila)-like 3"", ""sal-like 3 (Drosophila)"""			10610715	Standard	NM_171999		Approved	ZNF796	uc002lmt.3	Q9BXA9	OTTHUMG00000132896	ENST00000537592.2:c.1836C>A	chr18.hg19:g.76753827C>A		48.0	0.0		60.0	13.0	NM_171999	Q9UGH1	Silent	SNP	ENST00000537592.2	hg19	CCDS12013.1																																																																																			.	.		0.751	SALL3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256397.1	NM_171999	
CYP2B6	1555	hgsc.bcm.edu	37	19	41518307	41518307	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr19:41518307C>T	ENST00000324071.4	+	7	1076	c.1069C>T	c.(1069-1071)Cag>Tag	p.Q357*	CYP2B6_ENST00000330446.5_Nonsense_Mutation_p.Q157*|CYP2B6_ENST00000593831.1_Nonsense_Mutation_p.Q121*	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	357					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	CTATGAGATTCAGAGATTTTC	0.532																																					p.Q357X		Atlas-SNP	.											.	CYP2B6	79	.	0			c.C1069T						.						123.0	97.0	106.0					19																	41518307		2203	4300	6503	SO:0001587	stop_gained	1555	exon7			GAGATTCAGAGAT	AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.1069C>T	chr19.hg19:g.41518307C>T	ENSP00000324648:p.Gln357*	65.0	0.0		90.0	20.0	NM_000767	B4DWP3|Q2V565|Q9UK46	Nonsense_Mutation	SNP	ENST00000324071.4	hg19	CCDS12570.1	.	.	.	.	.	.	.	.	.	.	.	17.29	3.352729	0.61293	.	.	ENSG00000197408	ENST00000324071;ENST00000330446	.	.	.	4.3	4.3	0.51218	.	0.062472	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.32	0.66479	0.0:1.0:0.0:0.0	.	.	.	.	X	357;157	.	ENSP00000324648:Q357X	Q	+	1	0	CYP2B6	46210147	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	7.136000	0.77285	2.219000	0.72066	0.298000	0.19748	CAG	.	.		0.532	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463260.1	NM_000767	
ZNF211	10520	hgsc.bcm.edu	37	19	58152529	58152529	+	Silent	SNP	A	A	G			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr19:58152529A>G	ENST00000347302.3	+	3	854	c.675A>G	c.(673-675)ggA>ggG	p.G225G	ZNF211_ENST00000541801.1_Silent_p.G216G|ZNF211_ENST00000254182.7_Silent_p.G216G|ZNF211_ENST00000420680.1_Silent_p.G229G|ZNF211_ENST00000240731.4_Silent_p.G238G|ZNF211_ENST00000544273.1_Silent_p.G237G|ZNF211_ENST00000299871.5_Silent_p.G290G|ZNF211_ENST00000391703.3_Silent_p.G164G	NM_198855.2	NP_942152.1	Q13398	ZN211_HUMAN	zinc finger protein 211	225					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TTTACAGTGGAAAAAGTCATC	0.453																																					p.G290G		Atlas-SNP	.											.	ZNF211	78	.	0			c.A870G						.						68.0	69.0	69.0					19																	58152529		2203	4300	6503	SO:0001819	synonymous_variant	10520	exon5			CAGTGGAAAAAGT	U38904	CCDS12956.1, CCDS12957.1, CCDS58686.1, CCDS58687.1, CCDS58688.1, CCDS74468.1	19q13.4	2013-01-08			ENSG00000121417	ENSG00000121417		"""Zinc fingers, C2H2-type"", ""-"""	13003	protein-coding gene	gene with protein product		601856				7633419, 9096115	Standard	NM_006385		Approved	ZNF-25, CH2H2-25	uc031rng.1	Q13398	OTTHUMG00000168012	ENST00000347302.3:c.675A>G	chr19.hg19:g.58152529A>G		106.0	0.0		136.0	32.0	NM_001265597	B4DH10|B4DLC9|B4E3C9|B9ZVS7|B9ZVW1|F8WDV2|Q05BQ7|Q2TAL7|Q59EG4|Q59G36|Q5EBL6	Silent	SNP	ENST00000347302.3	hg19	CCDS12957.1	.	.	.	.	.	.	.	.	.	.	A	5.174	0.217740	0.09810	.	.	ENSG00000121417	ENST00000407202	.	.	.	3.8	-1.57	0.08506	.	.	.	.	.	T	0.32882	0.0844	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34179	-0.9839	4	.	.	.	.	9.7393	0.40409	0.4824:0.0:0.5176:0.0	.	.	.	.	E	229	.	.	K	+	1	0	ZNF211	62844341	0.000000	0.05858	0.000000	0.03702	0.120000	0.20174	-1.932000	0.01554	-0.503000	0.06586	0.482000	0.46254	AAA	.	.		0.453	ZNF211-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000397502.1		
DLGAP4	22839	hgsc.bcm.edu	37	20	35128903	35128903	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr20:35128903C>T	ENST00000373907.2	+	9	2600	c.2401C>T	c.(2401-2403)Cgc>Tgc	p.R801C	DLGAP4_ENST00000339266.5_Missense_Mutation_p.R801C|DLGAP4_ENST00000373913.3_Missense_Mutation_p.R798C|DLGAP4_ENST00000340491.4_Missense_Mutation_p.R262C|DLGAP4_ENST00000475894.1_3'UTR|DLGAP4_ENST00000401952.2_Missense_Mutation_p.R798C			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	801					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				AGGGGCCTGCCGCCGAGACGG	0.652																																					p.R798C		Atlas-SNP	.											.	DLGAP4	111	.	0			c.C2392T						.						25.0	29.0	27.0					20																	35128903		2144	4226	6370	SO:0001583	missense	22839	exon9			GCCTGCCGCCGAG	AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.2401C>T	chr20.hg19:g.35128903C>T	ENSP00000363014:p.Arg801Cys	136.0	0.0		192.0	33.0	NM_014902	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	ENST00000373907.2	hg19		.	.	.	.	.	.	.	.	.	.	C	19.28	3.797198	0.70567	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266;ENST00000340491	T;T;T;T;T	0.20332	2.08;2.08;2.08;2.08;2.08	5.62	4.62	0.57501	.	0.048466	0.85682	D	0.000000	T	0.46249	0.1383	M	0.80183	2.485	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.997	D;D;P;D	0.65010	0.931;0.921;0.861;0.924	T	0.49351	-0.8949	10	0.72032	D	0.01	.	14.4348	0.67274	0.1477:0.8523:0.0:0.0	.	107;262;801;798	F8WF49;Q9Y2H0-3;Q9Y2H0;Q9Y2H0-1	.;.;DLGP4_HUMAN;.	C	798;798;801;801;262	ENSP00000363023:R798C;ENSP00000384954:R798C;ENSP00000363014:R801C;ENSP00000341633:R801C;ENSP00000345700:R262C	ENSP00000341633:R801C	R	+	1	0	DLGAP4	34562317	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.718000	0.38001	2.659000	0.90383	0.655000	0.94253	CGC	.	.		0.652	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000079025.2	NM_014902	
KRTAP24-1	643803	hgsc.bcm.edu	37	21	31654604	31654604	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr21:31654604G>A	ENST00000340345.4	-	1	672	c.647C>T	c.(646-648)aCg>aTg	p.T216M		NM_001085455.1	NP_001078924.1	Q3LI83	KR241_HUMAN	keratin associated protein 24-1	216	6 X 10 AA repeats of Y-[ILR]-[SVPC]- [NRTS]-[SNTG]-X-[QHRP]-[PSY]-[QSL]-[SRK].					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|large_intestine(3)|lung(7)|urinary_tract(3)	14						TCGGCAGCTCGTAGGCCTGTA	0.438																																					p.T216M		Atlas-SNP	.											.	KRTAP24-1	44	.	0			c.C647T						.						100.0	97.0	98.0					21																	31654604		1860	4099	5959	SO:0001583	missense	643803	exon1			CAGCTCGTAGGCC	AB096935	CCDS42915.1	21q22.11	2007-11-23			ENSG00000188694	ENSG00000188694		"""Keratin associated proteins"""	33902	protein-coding gene	gene with protein product							Standard	NM_001085455		Approved	KAP24.1	uc002ynv.3	Q3LI83	OTTHUMG00000125483	ENST00000340345.4:c.647C>T	chr21.hg19:g.31654604G>A	ENSP00000339238:p.Thr216Met	93.0	0.0		141.0	18.0	NM_001085455	Q1XDX0	Missense_Mutation	SNP	ENST00000340345.4	hg19	CCDS42915.1	.	.	.	.	.	.	.	.	.	.	G	5.319	0.244163	0.10077	.	.	ENSG00000188694	ENST00000340345	T	0.30714	1.52	3.63	-4.66	0.03329	.	1.491660	0.04449	N	0.372265	T	0.12860	0.0312	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.26538	-1.0100	10	0.49607	T	0.09	4.086	4.6583	0.12630	0.281:0.3598:0.3592:0.0	.	216	Q3LI83	KR241_HUMAN	M	216	ENSP00000339238:T216M	ENSP00000339238:T216M	T	-	2	0	KRTAP24-1	30576475	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-1.104000	0.03326	-0.515000	0.06479	-0.440000	0.05779	ACG	.	.		0.438	KRTAP24-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246806.2	NM_001085455	
RIMBP3	85376	hgsc.bcm.edu	37	22	20457887	20457887	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr22:20457887C>A	ENST00000426804.1	-	1	3899	c.3415G>T	c.(3415-3417)Gcc>Tcc	p.A1139S	SCARNA17_ENST00000516762.1_RNA|SCARNA18_ENST00000516215.1_RNA|RN7SKP131_ENST00000363006.1_RNA	NM_015672.1	NP_056487.1	Q9UFD9	RIM3A_HUMAN	RIMS binding protein 3	1139	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.									breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	13	Colorectal(54;0.0993)|Melanoma(16;0.165)		LUSC - Lung squamous cell carcinoma(15;0.0405)|Lung(15;0.224)			GTGGCATCGGCGACCTCACAA	0.562																																					p.A1139S		Atlas-SNP	.											.	RIMBP3	42	.	0			c.G3415T						.						75.0	78.0	77.0					22																	20457887		2052	4210	6262	SO:0001583	missense	85376	exon1			CATCGGCGACCTC	AB051453	CCDS46665.1	22q11.21	2014-05-06			ENSG00000196622	ENSG00000275793			29344	protein-coding gene	gene with protein product		612699				11258795, 17855024	Standard	NM_015672		Approved	KIAA1666, RIMBP3.1, RIMBP3A	uc002zsd.4	Q9UFD9	OTTHUMG00000188355	ENST00000426804.1:c.3415G>T	chr22.hg19:g.20457887C>A	ENSP00000391564:p.Ala1139Ser	802.0	0.0		1070.0	97.0	NM_015672	Q8IYP7|Q9BY94|Q9UFQ5	Missense_Mutation	SNP	ENST00000426804.1	hg19	CCDS46665.1	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316786	0.23908	.	.	ENSG00000196622	ENST00000355186;ENST00000426804	T	0.37915	1.17	3.42	-6.84	0.01687	Fibronectin, type III (2);	0.426528	0.23556	N	0.046913	T	0.17280	0.0415	L	0.41027	1.25	0.09310	N	1	P	0.35821	0.523	B	0.33890	0.172	T	0.06752	-1.0809	10	0.34782	T	0.22	1.6997	2.317	0.04201	0.1093:0.1783:0.3527:0.3598	.	1045	Q9UFD9	RIM3A_HUMAN	S	1045;1139	ENSP00000391564:A1139S	ENSP00000347318:A1045S	A	-	1	0	RIMBP3	18837887	0.000000	0.05858	0.000000	0.03702	0.592000	0.36648	-3.329000	0.00510	-1.591000	0.01621	-1.109000	0.02080	GCC	.	.		0.562	RIMBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318945.2	NM_015672	
SUSD2	56241	hgsc.bcm.edu	37	22	24581177	24581177	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr22:24581177G>A	ENST00000358321.3	+	6	1159	c.898G>A	c.(898-900)Gag>Aag	p.E300K		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	300	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.E300Q(1)		NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						GGAGGAGCTGGAGGATCAGCT	0.672																																					p.E300K		Atlas-SNP	.											SUSD2,NS,carcinoma,0,1	SUSD2	68	.	1	Substitution - Missense(1)	prostate(1)	c.G898A						.						28.0	28.0	28.0					22																	24581177		2203	4300	6503	SO:0001583	missense	56241	exon6			GAGCTGGAGGATC	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.898G>A	chr22.hg19:g.24581177G>A	ENSP00000351075:p.Glu300Lys	60.0	1.0		93.0	18.0	NM_019601	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	hg19	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.513687	0.85389	.	.	ENSG00000099994	ENST00000358321	T	0.22539	1.95	4.27	4.27	0.50696	AMOP (3);	0.182147	0.46758	D	0.000261	T	0.36663	0.0975	M	0.77820	2.39	0.39316	D	0.965161	P	0.50819	0.939	P	0.51453	0.67	T	0.42464	-0.9450	10	0.72032	D	0.01	-18.4309	12.6244	0.56622	0.0:0.0:1.0:0.0	.	300	Q9UGT4	SUSD2_HUMAN	K	300	ENSP00000351075:E300K	ENSP00000351075:E300K	E	+	1	0	SUSD2	22911177	1.000000	0.71417	0.911000	0.35937	0.561000	0.35649	7.216000	0.77974	2.102000	0.63906	0.437000	0.28790	GAG	.	.		0.672	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
STS	412	hgsc.bcm.edu	37	X	7252038	7252038	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chrX:7252038G>A	ENST00000217961.4	+	9	1488	c.1268G>A	c.(1267-1269)gGa>gAa	p.G423E		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	423					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	ATCATTGATGGACGTGATCTG	0.488									Ichthyosis																												p.G423E		Atlas-SNP	.											.	STS	64	.	0			c.G1268A						.						124.0	93.0	103.0					X																	7252038		2203	4299	6502	SO:0001583	missense	412	exon9	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TTGATGGACGTGA	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1268G>A	chrX.hg19:g.7252038G>A	ENSP00000217961:p.Gly423Glu	58.0	0.0		75.0	24.0	NM_000351	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	hg19	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	G	19.98	3.926303	0.73327	.	.	ENSG00000101846	ENST00000217961	D	0.99698	-6.44	3.95	3.95	0.45737	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.99869	0.9938	H	0.99783	4.775	0.50467	D	0.999872	D	0.89917	1.0	D	0.97110	1.0	D	0.96309	0.9227	10	0.87932	D	0	.	12.8957	0.58098	0.0:0.0:1.0:0.0	.	423	P08842	STS_HUMAN	E	423	ENSP00000217961:G423E	ENSP00000217961:G423E	G	+	2	0	STS	7262038	1.000000	0.71417	0.012000	0.15200	0.117000	0.20001	7.637000	0.83313	1.586000	0.49944	0.513000	0.50165	GGA	.	.		0.488	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351	
CAPN6	827	hgsc.bcm.edu	37	X	110495540	110495540	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chrX:110495540T>C	ENST00000324068.1	-	5	861	c.694A>G	c.(694-696)Att>Gtt	p.I232V	CAPN6_ENST00000541758.1_Intron	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	232	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						CAAACCTCAATGGAACAGCAG	0.428																																					p.I232V		Atlas-SNP	.											.	CAPN6	120	.	0			c.A694G						.						122.0	94.0	103.0					X																	110495540		2203	4300	6503	SO:0001583	missense	827	exon5			CCTCAATGGAACA	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.694A>G	chrX.hg19:g.110495540T>C	ENSP00000317214:p.Ile232Val	51.0	0.0		51.0	22.0	NM_014289	D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	hg19	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.580529	0.86645	.	.	ENSG00000077274	ENST00000324068	T	0.42900	0.96	5.97	5.97	0.96955	Peptidase C2, calpain, catalytic domain (3);	0.094708	0.64402	D	0.000001	T	0.66436	0.2789	M	0.78344	2.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70659	-0.4811	10	0.72032	D	0.01	.	15.388	0.74718	0.0:0.0:0.0:1.0	.	232	Q9Y6Q1	CAN6_HUMAN	V	232	ENSP00000317214:I232V	ENSP00000317214:I232V	I	-	1	0	CAPN6	110382196	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	4.622000	0.61240	2.018000	0.59344	0.486000	0.48141	ATT	.	.		0.428	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
MT-CO2	4513	hgsc.bcm.edu	37	M	7997	7997	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chrM:7997G>A	ENST00000361739.1	+	1	412	c.412G>A	c.(412-414)Gtt>Att	p.V138I	MT-TG_ENST00000387429.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TA_ENST00000387392.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank			P00403	COX2_HUMAN	mitochondrially encoded cytochrome c oxidase II	138					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|respiratory chain complex IV (GO:0045277)	copper ion binding (GO:0005507)|cytochrome-c oxidase activity (GO:0004129)			endometrium(5)|kidney(8)|lung(2)|pancreas(3)|prostate(1)	19						GACTCCTTGACGTTGACAATC	0.478																																					p.V138I		Atlas-SNP	.											.	.	.	.	0			c.G412A						.																																			SO:0001583	missense	5743	exon1			CTTGACGTTGACA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198712	ENSG00000198712		"""Mitochondrial respiratory chain complex / Complex IV"""	7421	protein-coding gene	gene with protein product		516040	"""cytochrome c oxidase II"""	MTCO2		1712754, 1989603	Standard			Approved	COX2, CO2		P00403		ENST00000361739.1:c.412G>A	chrM.hg19:g.7997G>A	ENSP00000354876:p.Val138Ile	18.0	0.0		64.0	9.0	ENST00000361739	Q37526	Missense_Mutation	SNP	ENST00000361739.1	hg19																																																																																				.	.		0.478	MT-CO2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024029	
MT-CYB	4519	hgsc.bcm.edu	37	M	14846	14846	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chrM:14846G>A	ENST00000361789.2	+	1	100	c.100G>A	c.(100-102)Ggc>Agc	p.G34S	MT-TH_ENST00000387441.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TL2_ENST00000387456.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	34			G -> S (in mitochondrial myopathy; sporadic). {ECO:0000269|PubMed:10502593}.		cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						GATGAAACTTCGGCTCACTCC	0.483																																					p.G34S		Atlas-SNP	.											.	.	.	.	0			c.G100A						.																																			SO:0001583	missense	0	exon1			AACTTCGGCTCAC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.100G>A	chrM.hg19:g.14846G>A	ENSP00000354554:p.Gly34Ser	70.0	0.0		243.0	163.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.483	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
ALB	213	hgsc.bcm.edu	37	4	74285302	74285311	+	Frame_Shift_Del	DEL	TTTTGTAGAG	TTTTGTAGAG	-	rs564649737		TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	TTTTGTAGAG	TTTTGTAGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr4:74285302_74285311delTTTTGTAGAG	ENST00000503124.1	+	11	1488_1497	c.1281_1290delTTTTGTAGAG	c.(1279-1290)gcttttgtagagfs	p.AFVE427fs	ALB_ENST00000295897.4_Frame_Shift_Del_p.AFVE577fs|ALB_ENST00000509063.1_Frame_Shift_Del_p.AFVE577fs|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000401494.3_Frame_Shift_Del_p.AFVE462fs|ALB_ENST00000415165.2_Frame_Shift_Del_p.AFVE385fs			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ATTTCGCAGCTTTTGTAGAGAAGTGCTGCA	0.419																																					p.577_580del		Atlas-INDEL	.											.	ALB	132	.	0			c.1730_1739del						.																																			SO:0001589	frameshift_variant	213	exon13			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1281_1290delTTTTGTAGAG	chr4.hg19:g.74285302_74285311delTTTTGTAGAG	ENSP00000421027:p.Ala427fs	106.0	0.0		99.0	15.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Frame_Shift_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.419	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
FETUB	26998	hgsc.bcm.edu	37	3	186360348	186360349	+	Splice_Site	INS	-	-	T	rs147011769	byFrequency	TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr3:186360348_186360349insT	ENST00000265029.3	+	3	525		c.e3+1		FETUB_ENST00000382134.3_Intron|RP11-134F2.2_ENST00000428501.1_RNA|FETUB_ENST00000539949.1_Intron|FETUB_ENST00000450521.1_Splice_Site|FETUB_ENST00000488561.1_Intron|FETUB_ENST00000382136.3_Splice_Site|RP11-134F2.2_ENST00000455926.1_RNA	NM_014375.2	NP_055190.2	Q9UGM5	FETUB_HUMAN	fetuin B						binding of sperm to zona pellucida (GO:0007339)|negative regulation of endopeptidase activity (GO:0010951)|single fertilization (GO:0007338)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)	20	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		CTTCGCCCAGGTAAGAAATCAC	0.342																																					.		Atlas-INDEL	.											.	FETUB	53	.	0			c.424+1->T						.																																			SO:0001630	splice_region_variant	26998	exon3			.	AJ242928	CCDS3279.1	3q27.3	2008-05-15			ENSG00000090512	ENSG00000090512			3658	protein-coding gene	gene with protein product		605954				10947975	Standard	XM_005247350		Approved		uc003fqn.3	Q9UGM5	OTTHUMG00000156586	ENST00000265029.3:c.424+1->T	chr3.hg19:g.186360349_186360349dupT		125.0	0.0		227.0	52.0	NM_014375	B2RCW6|E9PG06|Q1RMZ0|Q5J876|Q6DK58|Q6GRB6|Q9Y6Z0	Splice_Site	INS	ENST00000265029.3	hg19	CCDS3279.1																																																																																			.	.		0.342	FETUB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344679.1	NM_014375	Intron
TNPO1	3842	hgsc.bcm.edu	37	5	72189057	72189058	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr5:72189057_72189058delCT	ENST00000337273.5	+	16	2306_2307	c.1880_1881delCT	c.(1879-1881)actfs	p.T627fs	TNPO1_ENST00000523768.1_Frame_Shift_Del_p.T577fs|TNPO1_ENST00000454282.1_Frame_Shift_Del_p.T577fs|TNPO1_ENST00000506351.2_Frame_Shift_Del_p.T619fs	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	627					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		GTACAGAAGACTCTTGCACAAG	0.391																																					p.627_627del		Atlas-INDEL	.											.	TNPO1	90	.	0			c.1879_1880del						.																																			SO:0001589	frameshift_variant	3842	exon16			.	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.1880_1881delCT	chr5.hg19:g.72189059_72189060delCT	ENSP00000336712:p.Thr627fs	87.0	0.0		122.0	29.0	NM_002270	B4DVC6|Q92957|Q92975	Frame_Shift_Del	DEL	ENST00000337273.5	hg19	CCDS43329.1																																																																																			.	.		0.391	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
AHNAK2	113146	hgsc.bcm.edu	37	14	105414494	105414495	+	In_Frame_Ins	INS	-	-	TTT			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr14:105414494_105414495insTTT	ENST00000333244.5	-	7	7412_7413	c.7293_7294insAAA	c.(7291-7296)aaaggc>aaaAAAggc	p.2431_2432insK	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2431						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GTCTTGGGGCCTTTCAGGTCCA	0.624																																					p.G2432delinsKG		Atlas-INDEL	.											.	AHNAK2	719	.	0			c.7294_7295insAAA						.																																			SO:0001652	inframe_insertion	113146	exon7			.	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7291_7293dupAAA	chr14.hg19:g.105414495_105414497dupTTT	ENSP00000353114:p.Lys2431_Lys2431dup	140.0	0.0		197.0	42.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	In_Frame_Ins	INS	ENST00000333244.5	hg19	CCDS45177.1																																																																																			.	.		0.624	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
CEMIP	57214	hgsc.bcm.edu	37	15	81224345	81224347	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	AAC	AAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr15:81224345_81224347delAAC	ENST00000394685.3	+	22	3177_3179	c.2758_2760delAAC	c.(2758-2760)aacdel	p.N921del	KIAA1199_ENST00000220244.3_In_Frame_Del_p.N921del|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_In_Frame_Del_p.N921del			Q8WUJ3	CEMIP_HUMAN		921					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CTGCCCCCATAACAACGTGACCG	0.596																																					p.919_920del		Atlas-INDEL	.											.	KIAA1199	118	.	0			c.2757_2759del						.																																			SO:0001651	inframe_deletion	57214	exon21			.																												ENST00000394685.3:c.2758_2760delAAC	chr15.hg19:g.81224348_81224350delAAC	ENSP00000378177:p.Asn921del	43.0	0.0		60.0	18.0	NM_018689	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	In_Frame_Del	DEL	ENST00000394685.3	hg19	CCDS10315.1																																																																																			.	.		0.596	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291389.1		
SLC25A52	147407	hgsc.bcm.edu	37	18	29339948	29339948	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr18:29339948delC	ENST00000579441.2	-	1	676	c.677delG	c.(676-678)ggafs	p.G226fs	SLC25A52_ENST00000269205.5_Frame_Shift_Del_p.G236fs			Q3SY17	S2552_HUMAN	solute carrier family 25, member 52	226					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											ACACAAGAATCCCAACATGGC	0.448																																					p.G236fs		Atlas-INDEL	.											.	.	.	.	0			c.708delA						.						62.0	61.0	61.0					18																	29339948		2203	4300	6503	SO:0001589	frameshift_variant	147407	exon1			.		CCDS32812.1, CCDS32812.2	18q12.1	2013-07-15	2012-03-29	2012-03-29	ENSG00000141437	ENSG00000141437		"""Solute carriers"""	23324	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 2"""	MCART2			Standard	NM_001034172		Approved		uc002kxa.3	Q3SY17	OTTHUMG00000179617	ENST00000579441.2:c.677delG	chr18.hg19:g.29339948delC	ENSP00000462754:p.Gly226fs	346.0	0.0		483.0	122.0	NM_001034172		Frame_Shift_Del	DEL	ENST00000579441.2	hg19																																																																																				.	.		0.448	SLC25A52-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_084000	
DCHS2	54798	hgsc.bcm.edu	37	4	155410671	155410702	+	Frame_Shift_Del	DEL	CGCTTTCGGAATCAATGGCAAAAGATGGTCCA	CGCTTTCGGAATCAATGGCAAAAGATGGTCCA	-	rs371502851	byFrequency	TCGA-DD-AAW0-01A-11D-A40R-10	TCGA-DD-AAW0-10A-01D-A40U-10	CGCTTTCGGAATCAATGGCAAAAGATGGTCCA	CGCTTTCGGAATCAATGGCAAAAGATGGTCCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4fe50376-65f7-435c-aa48-38e821e121b3	16c90d4a-6a13-4147-9135-3e66190c927f	g.chr4:155410671_155410702delCGCTTTCGGAATCAATGGCAAAAGATGGTCCA	ENST00000339452.1	-	1	2166_2197	c.1806_1837delTGGACCATCTTTTGCCATTGATTCCGAAAGCG	c.(1804-1839)tgtggaccatcttttgccattgattccgaaagcggtfs	p.CGPSFAIDSESG602fs	DCHS2_ENST00000443500.1_Frame_Shift_Del_p.CGPSFAIDSESG602fs|DCHS2_ENST00000456341.2_Frame_Shift_Del_p.CGPSFAIDSESG595fs	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1724	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGATCGCACCGCTTTCGGAATCAATGGCAAAAGATGGTCCACACTCTGCGG	0.595																																					p.603_613del		Atlas-INDEL	.											.	DCHS2	594	.	0			c.1807_1838del						.																																			SO:0001589	frameshift_variant	54798	exon1			.	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1806_1837delTGGACCATCTTTTGCCATTGATTCCGAAAGCG	chr4.hg19:g.155410671_155410702delCGCTTTCGGAATCAATGGCAAAAGATGGTCCA	ENSP00000345062:p.Cys602fs	102.0	0.0		108.0	15.0	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Frame_Shift_Del	DEL	ENST00000339452.1	hg19	CCDS47150.1																																																																																			.	.		0.595	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
