#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ASAP3	55616	hgsc.bcm.edu	37	1	23763700	23763700	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:23763700T>A	ENST00000336689.3	-	14	1309	c.1265A>T	c.(1264-1266)cAc>cTc	p.H422L	ASAP3_ENST00000437606.2_Missense_Mutation_p.H413L|ASAP3_ENST00000495646.1_5'Flank	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	422					cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						TGTGAGGTCGTGCGGCTCCCC	0.701																																					p.H422L		Atlas-SNP	.											.	ASAP3	65	.	0			c.A1265T						.						16.0	17.0	17.0					1																	23763700		2200	4300	6500	SO:0001583	missense	55616	exon14			AGGTCGTGCGGCT	AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.1265A>T	chr1.hg19:g.23763700T>A	ENSP00000338769:p.His422Leu	123.0	0.0		197.0	72.0	NM_017707	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	ENST00000336689.3	hg19	CCDS235.1	.	.	.	.	.	.	.	.	.	.	T	11.01	1.514166	0.27123	.	.	ENSG00000088280	ENST00000336689;ENST00000437606	T;T	0.52057	0.68;0.68	4.35	2.07	0.26955	.	0.408591	0.24085	N	0.041695	T	0.26774	0.0655	N	0.14661	0.345	0.36068	D	0.84194	B;B;B	0.14805	0.011;0.0;0.006	B;B;B	0.09377	0.004;0.0;0.002	T	0.14531	-1.0469	10	0.44086	T	0.13	.	7.5042	0.27534	0.0:0.207:0.0:0.793	.	413;291;422	Q8TDY4-3;B4DRP2;Q8TDY4	.;.;ASAP3_HUMAN	L	422;413	ENSP00000338769:H422L;ENSP00000408826:H413L	ENSP00000338769:H422L	H	-	2	0	ASAP3	23636287	1.000000	0.71417	0.983000	0.44433	0.136000	0.21042	1.745000	0.38278	0.807000	0.34208	0.391000	0.25812	CAC	.	.		0.701	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008916.2	NM_017707	
MKNK1	8569	hgsc.bcm.edu	37	1	47048993	47048993	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:47048993T>G	ENST00000371946.4	-	3	206	c.43A>C	c.(43-45)Agt>Cgt	p.S15R	MKNK1_ENST00000371945.4_Missense_Mutation_p.S15R|MKNK1_ENST00000341183.5_Missense_Mutation_p.S15R|MKNK1_ENST00000465783.1_Missense_Mutation_p.S15R|MKNK1_ENST00000545730.1_Missense_Mutation_p.S15R|MKNK1_ENST00000428112.2_Missense_Mutation_p.S15R|MKNK1_ENST00000371944.4_5'UTR|MKNK1_ENST00000525888.1_5'Flank	NM_003684.5	NP_003675.2	Q9BUB5	MKNK1_HUMAN	MAP kinase interacting serine/threonine kinase 1	15					extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fibroblast growth factor receptor signaling pathway (GO:0008543)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of translation (GO:0006417)|response to salt stress (GO:0009651)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	13	Acute lymphoblastic leukemia(166;0.155)					GGTTCGCTACTGCCCATCTCT	0.507																																					p.S15R		Atlas-SNP	.											.	MKNK1	36	.	0			c.A43C						.						60.0	62.0	61.0					1																	47048993		2203	4300	6503	SO:0001583	missense	8569	exon3			CGCTACTGCCCAT	AB000409	CCDS538.1, CCDS30705.1, CCDS44134.1	1p33	2008-02-05			ENSG00000079277	ENSG00000079277			7110	protein-coding gene	gene with protein product		606724				9155018	Standard	NM_003684		Approved	MNK1	uc001cqb.4	Q9BUB5	OTTHUMG00000007983	ENST00000371946.4:c.43A>C	chr1.hg19:g.47048993T>G	ENSP00000361014:p.Ser15Arg	50.0	0.0		49.0	18.0	NM_003684	D3DQ20|D3DQ21|O00312|Q5TC06|Q5TC07|Q6V0N6	Missense_Mutation	SNP	ENST00000371946.4	hg19	CCDS538.1	.	.	.	.	.	.	.	.	.	.	T	15.10	2.734135	0.48939	.	.	ENSG00000079277	ENST00000371946;ENST00000371945;ENST00000341183;ENST00000428112;ENST00000532783;ENST00000496619;ENST00000528237;ENST00000545730;ENST00000529170;ENST00000531769;ENST00000465783;ENST00000532110	T;T;T;T;T;T;T;T;T;T;T;T	0.71341	-0.12;-0.51;-0.56;-0.56;-0.23;-0.22;0.07;-0.16;1.44;1.44;1.39;1.3	5.78	5.78	0.91487	.	0.121240	0.85682	D	0.000000	T	0.58652	0.2137	N	0.25485	0.75	0.50039	D	0.999847	B;B;B;B	0.17268	0.011;0.008;0.019;0.021	B;B;B;B	0.16289	0.013;0.009;0.015;0.013	T	0.54289	-0.8316	10	0.33141	T	0.24	.	14.0601	0.64795	0.0:0.0:0.0:1.0	.	15;15;15;15	B4E1V9;Q9BUB5-3;Q9BUB5-2;Q9BUB5	.;.;.;MKNK1_HUMAN	R	15;15;15;15;3;15;9;15;15;15;15;85	ENSP00000361014:S15R;ENSP00000361013:S15R;ENSP00000339573:S15R;ENSP00000411135:S15R;ENSP00000431837:S3R;ENSP00000436709:S15R;ENSP00000432665:S9R;ENSP00000440974:S15R;ENSP00000435163:S15R;ENSP00000434021:S15R;ENSP00000434834:S15R;ENSP00000431985:S85R	ENSP00000339573:S15R	S	-	1	0	MKNK1	46821580	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.352000	0.66028	2.194000	0.70268	0.533000	0.62120	AGT	.	.		0.507	MKNK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021897.2	NM_003684	
MOB3C	148932	hgsc.bcm.edu	37	1	47075833	47075833	+	Silent	SNP	G	G	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:47075833G>T	ENST00000319928.3	-	3	692	c.462C>A	c.(460-462)atC>atA	p.I154I	MKNK1_ENST00000545730.1_Intron|MOB3C_ENST00000371940.1_Silent_p.I177I|MOB3C_ENST00000271139.8_Silent_p.I206I|MOB3C_ENST00000477318.1_5'UTR	NM_201403.2	NP_958805.1	Q70IA8	MOB3C_HUMAN	MOB kinase activator 3C	154							metal ion binding (GO:0046872)										GGCGGGTCAGGATCTTGGTGC	0.567																																					p.I206I		Atlas-SNP	.											.	MOB3C	1	.	0			c.C618A						.						80.0	75.0	77.0					1																	47075833		2203	4300	6503	SO:0001819	synonymous_variant	148932	exon3			GGTCAGGATCTTG	AK091808	CCDS539.1, CCDS540.1	1p34.1	2011-09-28	2011-09-28	2011-09-28	ENSG00000142961	ENSG00000142961		"""MOB kinase activators"""	29800	protein-coding gene	gene with protein product			"""MOB1, Mps One Binder kinase activator-like 2C (yeast)"""	MOBKL2C		12477932	Standard	NM_145279		Approved	MOB1E	uc001cqe.4	Q70IA8	OTTHUMG00000007989	ENST00000319928.3:c.462C>A	chr1.hg19:g.47075833G>T		67.0	0.0		91.0	40.0	NM_145279	D3DQ22|Q0VA98|Q5TC10|Q5TC11|Q8NAZ2|Q8NF28	Silent	SNP	ENST00000319928.3	hg19	CCDS540.1																																																																																			.	.		0.567	MOB3C-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145279	
TCHH	7062	hgsc.bcm.edu	37	1	152080354	152080354	+	Missense_Mutation	SNP	C	C	A	rs199599922		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:152080354C>A	ENST00000368804.1	-	2	5338	c.5339G>T	c.(5338-5340)cGc>cTc	p.R1780L		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1780	23 X 26 AA approximate tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCTCTCCTGGCGGAGCTGTTC	0.592																																					p.R1780L		Atlas-SNP	.											TCHH,NS,carcinoma,0,1	TCHH	275	.	0			c.G5339T						.						65.0	66.0	66.0					1																	152080354		1903	4116	6019	SO:0001583	missense	7062	exon3			TCCTGGCGGAGCT	L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.5339G>T	chr1.hg19:g.152080354C>A	ENSP00000357794:p.Arg1780Leu	58.0	1.0		123.0	77.0	NM_007113	Q5VUI3	Missense_Mutation	SNP	ENST00000368804.1	hg19	CCDS41396.1	.	.	.	.	.	.	.	.	.	.	C	9.217	1.032365	0.19590	.	.	ENSG00000159450	ENST00000368804	T	0.10099	2.91	4.03	-3.57	0.04612	.	.	.	.	.	T	0.00815	0.0027	N	0.02225	-0.63	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.46303	-0.9201	9	0.30078	T	0.28	.	1.3741	0.02216	0.4511:0.2437:0.1213:0.1839	.	1780	Q07283	TRHY_HUMAN	L	1780	ENSP00000357794:R1780L	ENSP00000357794:R1780L	R	-	2	0	TCHH	150346978	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	-1.302000	0.02746	-1.171000	0.02765	-1.564000	0.00881	CGC	.	C|0.999;A|0.001		0.592	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036671.2	NM_007113	
INTS3	65123	hgsc.bcm.edu	37	1	153740305	153740305	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:153740305T>A	ENST00000318967.2	+	21	2812		c.e21+2		INTS3_ENST00000456435.1_Splice_Site|INTS3_ENST00000476843.1_Splice_Site|INTS3_ENST00000512605.1_Splice_Site|INTS3_ENST00000435409.2_Splice_Site	NM_023015.3	NP_075391.3	Q68E01	INT3_HUMAN	integrator complex subunit 3						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|mitotic cell cycle checkpoint (GO:0007093)|response to ionizing radiation (GO:0010212)|snRNA processing (GO:0016180)	integrator complex (GO:0032039)|nucleus (GO:0005634)|SOSS complex (GO:0070876)				breast(1)|cervix(4)|endometrium(10)|kidney(1)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TACACAGAGGTCAGTGCCTGC	0.582																																					.		Atlas-SNP	.											.	INTS3	83	.	0			c.2244+2T>A						.						75.0	63.0	67.0					1																	153740305		2203	4300	6503	SO:0001630	splice_region_variant	65123	exon21			CAGAGGTCAGTGC	BX640950	CCDS1052.1	1q21.3	2012-03-16	2006-03-15	2006-03-15	ENSG00000143624	ENSG00000143624			26153	protein-coding gene	gene with protein product	"""sensor of single-strand DNA complex subunit A"""	611347	"""chromosome 1 open reading frame 60"""	C1orf60		16239144	Standard	NM_023015		Approved	FLJ21919, INT3, SOSS-A	uc001fct.3	Q68E01	OTTHUMG00000037089	ENST00000318967.2:c.2244+2T>A	chr1.hg19:g.153740305T>A		21.0	0.0		66.0	20.0	NM_023015	A8K1W0|B4DQC8|B4E3U9|D3DV57|Q4G0E5|Q5VUQ5|Q5VUQ6|Q5VUR0|Q5VUR1|Q68DJ1|Q69YR5|Q6AI57|Q6DKG7|Q6MZQ4|Q6MZZ9|Q8NC46|Q8TB23|Q9H6S9	Splice_Site	SNP	ENST00000318967.2	hg19	CCDS1052.1	.	.	.	.	.	.	.	.	.	.	T	15.31	2.794223	0.50102	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5963	0.56472	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	INTS3	152006929	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	7.165000	0.77544	2.234000	0.73211	0.459000	0.35465	.	.	.		0.582	INTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090045.2	NM_023015	Intron
DCST1	149095	hgsc.bcm.edu	37	1	155015937	155015937	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:155015937G>A	ENST00000295542.1	+	10	1220	c.1124G>A	c.(1123-1125)gGg>gAg	p.G375E	DCST1_ENST00000368419.2_Missense_Mutation_p.G375E|RP11-307C12.11_ENST00000452962.1_RNA|DCST1_ENST00000423025.2_Missense_Mutation_p.G350E|DCST1_ENST00000392480.1_Missense_Mutation_p.G375E	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	375						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TGGGCCCTGGGGCTGCTGCAC	0.692																																					p.G375E		Atlas-SNP	.											.	DCST1	69	.	0			c.G1124A						.						51.0	52.0	52.0					1																	155015937		2203	4299	6502	SO:0001583	missense	149095	exon10			CCCTGGGGCTGCT	AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.1124G>A	chr1.hg19:g.155015937G>A	ENSP00000295542:p.Gly375Glu	68.0	0.0		171.0	56.0	NM_152494	B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	ENST00000295542.1	hg19	CCDS1083.1	.	.	.	.	.	.	.	.	.	.	g	15.20	2.761967	0.49468	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.24151	1.89;1.87;1.91;1.87	3.99	2.05	0.26809	.	1.611180	0.04084	N	0.310062	T	0.29588	0.0738	M	0.70595	2.14	0.43259	D	0.995193	D;D;D	0.76494	0.999;0.995;0.999	D;P;D	0.66716	0.946;0.871;0.946	T	0.48514	-0.9029	10	0.23891	T	0.37	-16.1869	5.1654	0.15082	0.1171:0.2121:0.6708:0.0	.	350;400;375	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	E	375;375;350;375	ENSP00000295542:G375E;ENSP00000376271:G375E;ENSP00000387369:G350E;ENSP00000357404:G375E	ENSP00000295542:G375E	G	+	2	0	DCST1	153282561	0.995000	0.38212	0.955000	0.39395	0.721000	0.41392	0.415000	0.21181	0.326000	0.23384	-0.348000	0.07805	GGG	.	.		0.692	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099006.1	NM_152494	
LAMC2	3918	hgsc.bcm.edu	37	1	183190045	183190045	+	Missense_Mutation	SNP	C	C	A	rs184817147	byFrequency	TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:183190045C>A	ENST00000264144.4	+	5	654	c.589C>A	c.(589-591)Cgc>Agc	p.R197S	LAMC2_ENST00000493293.1_Missense_Mutation_p.R197S	NM_005562.2	NP_005553.2	Q13753	LAMC2_HUMAN	laminin, gamma 2	197					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	cell cortex (GO:0005938)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-2 complex (GO:0005607)|laminin-5 complex (GO:0005610)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	heparin binding (GO:0008201)	p.R197C(1)		breast(2)|endometrium(6)|kidney(8)|large_intestine(11)|lung(18)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55						AGCCAGCTGCCGCAGCTCTGC	0.468																																					p.R197S		Atlas-SNP	.											LAMC2,caecum,carcinoma,0,1	LAMC2	113	.	1	Substitution - Missense(1)	large_intestine(1)	c.C589A						.						77.0	79.0	78.0					1																	183190045		2203	4300	6503	SO:0001583	missense	3918	exon5			AGCTGCCGCAGCT	Z15008	CCDS1352.1, CCDS44285.1	1q25-q31	2013-03-01	2002-08-29		ENSG00000058085	ENSG00000058085		"""Laminins"""	6493	protein-coding gene	gene with protein product		150292	"""laminin, gamma 2 (nicein (100kD), kalinin (105kD), BM600 (100kD), Herlitz junctional epidermolysis bullosa))"""	EBR2, LAMB2T, LAMNB2, EBR2A		1383240	Standard	NM_005562		Approved	nicein-100kDa, kalinin-105kDa, BM600-100kDa	uc001gqa.2	Q13753	OTTHUMG00000035520	ENST00000264144.4:c.589C>A	chr1.hg19:g.183190045C>A	ENSP00000264144:p.Arg197Ser	160.0	1.0		323.0	87.0	NM_005562	Q02536|Q02537|Q13752|Q14941|Q14DF7|Q2M1N2|Q5VYE8	Missense_Mutation	SNP	ENST00000264144.4	hg19	CCDS1352.1	.	.	.	.	.	.	.	.	.	.	C	6.301	0.423590	0.11928	.	.	ENSG00000058085	ENST00000493293;ENST00000537180;ENST00000264144	T;T	0.16073	2.52;2.37	5.41	4.42	0.53409	Growth factor, receptor (1);	0.908562	0.09424	N	0.804096	T	0.06188	0.0160	N	0.02539	-0.55	0.22112	N	0.999353	B;B	0.10296	0.001;0.003	B;B	0.06405	0.001;0.002	T	0.31110	-0.9955	10	0.07325	T	0.83	.	7.7479	0.28879	0.4224:0.4614:0.1162:0.0	.	197;197	Q13753;Q13753-2	LAMC2_HUMAN;.	S	197	ENSP00000432063:R197S;ENSP00000264144:R197S	ENSP00000264144:R197S	R	+	1	0	LAMC2	181456668	0.015000	0.18098	0.974000	0.42286	0.991000	0.79684	0.176000	0.16782	2.529000	0.85273	0.655000	0.94253	CGC	.	C|0.998;T|0.002		0.468	LAMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086258.1	NM_005562	
USH2A	7399	hgsc.bcm.edu	37	1	216019200	216019200	+	Silent	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:216019200G>A	ENST00000307340.3	-	45	9407	c.9021C>T	c.(9019-9021)aaC>aaT	p.N3007N	USH2A_ENST00000366943.2_Silent_p.N3007N	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3007	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTCCTGCACTGTTGATGCTGT	0.443										HNSCC(13;0.011)																											p.N3007N		Atlas-SNP	.											USH2A,NS,carcinoma,0,1	USH2A	1168	.	0			c.C9021T						.						95.0	88.0	90.0					1																	216019200		2203	4300	6503	SO:0001819	synonymous_variant	7399	exon45			TGCACTGTTGATG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9021C>T	chr1.hg19:g.216019200G>A		151.0	0.0		254.0	76.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	hg19	CCDS31025.1																																																																																			.	.		0.443	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
TBCE	6905	hgsc.bcm.edu	37	1	235605132	235605132	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:235605132A>G	ENST00000366601.3	+	14	1450	c.1274A>G	c.(1273-1275)tAt>tGt	p.Y425C	TBCE_ENST00000472011.1_3'UTR|TBCE_ENST00000543662.1_Missense_Mutation_p.Y476C|TBCE_ENST00000406207.1_Missense_Mutation_p.Y425C			Q15813	TBCE_HUMAN	tubulin folding cofactor E	425					'de novo' posttranslational protein folding (GO:0051084)|adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|developmental growth (GO:0048589)|microtubule cytoskeleton organization (GO:0000226)|muscle atrophy (GO:0014889)|peripheral nervous system neuron axonogenesis (GO:0048936)|post-chaperonin tubulin folding pathway (GO:0007023)|post-embryonic development (GO:0009791)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	chaperone binding (GO:0051087)			NS(1)|endometrium(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	14	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00192)|Prostate(94;0.0294)|all_epithelial(177;0.155)|Lung SC(1967;0.238)	OV - Ovarian serous cystadenocarcinoma(106;2.56e-05)			TAAACAGAATATGGTGCACCT	0.343																																					p.Y425C		Atlas-SNP	.											.	TBCE	40	.	0			c.A1274G						.						89.0	89.0	89.0					1																	235605132		2203	4300	6503	SO:0001583	missense	6905	exon14			CAGAATATGGTGC	U61232	CCDS1605.1, CCDS73052.1	1q42.3	2014-02-04	2006-11-21		ENSG00000116957	ENSG00000116957			11582	protein-coding gene	gene with protein product		604934	"""tubulin-specific chaperone e"", ""Kenny-Caffey syndrome"", ""hypoparathyroidism, growth and mental retardation, and dysmorphism"""	KCS, HRD		8706133, 9806825, 12389028	Standard	NM_001079515		Approved	KCS1, pac2	uc001hxa.1	Q15813	OTTHUMG00000039987	ENST00000366601.3:c.1274A>G	chr1.hg19:g.235605132A>G	ENSP00000355560:p.Tyr425Cys	100.0	0.0		128.0	39.0	NM_003193	A8K8C2|B7Z3P1	Missense_Mutation	SNP	ENST00000366601.3	hg19	CCDS1605.1	.	.	.	.	.	.	.	.	.	.	A	18.92	3.725600	0.68959	.	.	ENSG00000116957	ENST00000366601;ENST00000406207;ENST00000543662	T;T;T	0.47177	0.85;0.85;0.85	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.72771	0.3502	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	0.993;1.0;0.981	P;D;P	0.79108	0.811;0.992;0.892	T	0.78465	-0.2193	10	0.87932	D	0	-20.0642	15.6593	0.77169	1.0:0.0:0.0:0.0	.	476;425;425	B7Z3P1;A8K8C2;Q15813	.;.;TBCE_HUMAN	C	425;425;476	ENSP00000355560:Y425C;ENSP00000384571:Y425C;ENSP00000439170:Y476C	ENSP00000355560:Y425C	Y	+	2	0	TBCE	233671755	1.000000	0.71417	1.000000	0.80357	0.779000	0.44077	4.364000	0.59479	2.285000	0.76669	0.477000	0.44152	TAT	.	.		0.343	TBCE-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096458.3	NM_003193	
KIF26B	55083	hgsc.bcm.edu	37	1	245851773	245851773	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr1:245851773G>A	ENST00000407071.2	+	12	5928	c.5488G>A	c.(5488-5490)Gag>Aag	p.E1830K	KIF26B_ENST00000366518.4_Missense_Mutation_p.E1449K	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	1830					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			gcccgaggcggaggcgcgcgg	0.796																																					p.E1830K		Atlas-SNP	.											.	KIF26B	343	.	0			c.G5488A						.						1.0	1.0	1.0					1																	245851773		268	741	1009	SO:0001583	missense	55083	exon12			GAGGCGGAGGCGC	AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.5488G>A	chr1.hg19:g.245851773G>A	ENSP00000385545:p.Glu1830Lys	6.0	0.0		32.0	10.0	NM_018012	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	ENST00000407071.2	hg19	CCDS44342.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623293	0.46840	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.78924	-1.22;-1.21	5.12	5.12	0.69794	.	.	.	.	.	T	0.76765	0.4033	L	0.57536	1.79	0.40602	D	0.981596	B;B	0.26318	0.146;0.085	B;B	0.24974	0.057;0.039	T	0.76903	-0.2787	9	0.72032	D	0.01	.	18.5334	0.91000	0.0:0.0:1.0:0.0	.	1449;1830	B7WPD9;Q2KJY2	.;KI26B_HUMAN	K	1830;1449;1446	ENSP00000385545:E1830K;ENSP00000355475:E1449K	ENSP00000355475:E1449K	E	+	1	0	KIF26B	243918396	1.000000	0.71417	0.912000	0.35992	0.103000	0.19146	3.186000	0.50942	2.374000	0.81015	0.407000	0.27541	GAG	.	.		0.796	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381037.1	XM_371354	
DDX1	1653	hgsc.bcm.edu	37	2	15737583	15737583	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:15737583A>C	ENST00000381341.2	+	6	636	c.247A>C	c.(247-249)Act>Cct	p.T83P	DDX1_ENST00000233084.3_Missense_Mutation_p.T83P			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	83	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		AACAATTAAAACTGGTGCTTC	0.313																																					p.T83P		Atlas-SNP	.											.	DDX1	70	.	0			c.A247C						.						59.0	58.0	58.0					2																	15737583		2201	4296	6497	SO:0001583	missense	1653	exon5			ATTAAAACTGGTG	X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.247A>C	chr2.hg19:g.15737583A>C	ENSP00000370745:p.Thr83Pro	182.0	0.0		213.0	80.0	NM_004939	B4DME8|B4DPN6	Missense_Mutation	SNP	ENST00000381341.2	hg19	CCDS1686.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.104768	0.37145	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.41400	1.0;1.0	5.64	5.64	0.86602	Concanavalin A-like lectin/glucanase (1);DEAD-like helicase (1);B30.2/SPRY domain (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	N	0.19112	0.55	0.80722	D	1	D	0.53462	0.96	P	0.51777	0.679	T	0.12268	-1.0554	10	0.20519	T	0.43	-21.2071	15.8545	0.78965	1.0:0.0:0.0:0.0	.	83	Q92499	DDX1_HUMAN	P	83	ENSP00000370745:T83P;ENSP00000233084:T83P	ENSP00000233084:T83P	T	+	1	0	DDX1	15655034	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.806000	0.69150	2.160000	0.67779	0.533000	0.62120	ACT	.	.		0.313	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207141.2	NM_004939	
CRIM1	51232	hgsc.bcm.edu	37	2	36749317	36749317	+	Silent	SNP	A	A	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:36749317A>T	ENST00000280527.2	+	13	2656	c.2289A>T	c.(2287-2289)gcA>gcT	p.A763A		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	763	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.				insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TATTCCTGGCAGCTGAGTCCT	0.448																																					p.A763A		Atlas-SNP	.											.	CRIM1	88	.	0			c.A2289T						.						177.0	161.0	166.0					2																	36749317		2203	4300	6503	SO:0001819	synonymous_variant	51232	exon13			CCTGGCAGCTGAG	AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.2289A>T	chr2.hg19:g.36749317A>T		178.0	0.0		209.0	84.0	NM_016441	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Silent	SNP	ENST00000280527.2	hg19	CCDS1783.1																																																																																			.	.		0.448	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216878.2	NM_016441	
SOS1	6654	hgsc.bcm.edu	37	2	39239378	39239378	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:39239378G>A	ENST00000426016.1	-	15	2365	c.2279C>T	c.(2278-2280)aCa>aTa	p.T760I	SOS1_ENST00000402219.2_Missense_Mutation_p.T760I|SOS1_ENST00000395038.2_Missense_Mutation_p.T760I			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	760					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				CCACTCAACTGTGGGAGGTGA	0.388									Noonan syndrome																												p.T760I		Atlas-SNP	.											.	SOS1	134	.	0			c.C2279T						.						189.0	173.0	178.0					2																	39239378		2203	4300	6503	SO:0001583	missense	6654	exon14	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	TCAACTGTGGGAG	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.2279C>T	chr2.hg19:g.39239378G>A	ENSP00000387784:p.Thr760Ile	105.0	0.0		105.0	8.0	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	hg19	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	G	16.94	3.261711	0.59431	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	T;T;T	0.29655	1.56;1.56;1.56	5.87	4.98	0.66077	Guanine-nucleotide dissociation stimulator CDC25 (1);Ras guanine nucleotide exchange factor, domain (1);	0.280184	0.40385	N	0.001101	T	0.20047	0.0482	N	0.08118	0	0.80722	D	1	B	0.22414	0.069	B	0.18871	0.023	T	0.04281	-1.0963	10	0.72032	D	0.01	.	17.5059	0.87745	0.0:0.1326:0.8674:0.0	.	760	Q07889	SOS1_HUMAN	I	760;760;492;760;760	ENSP00000387784:T760I;ENSP00000384675:T760I;ENSP00000378479:T760I	ENSP00000263879:T760I	T	-	2	0	SOS1	39092882	1.000000	0.71417	0.889000	0.34880	0.985000	0.73830	7.827000	0.86722	1.575000	0.49775	0.655000	0.94253	ACA	.	.		0.388	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
FAM178B	51252	hgsc.bcm.edu	37	2	97637903	97637903	+	Missense_Mutation	SNP	T	T	A	rs573710266	byFrequency	TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:97637903T>A	ENST00000417561.3	-	7	742	c.743A>T	c.(742-744)cAg>cTg	p.Q248L	FAM178B_ENST00000490605.2_Missense_Mutation_p.Q100L|FAM178B_ENST00000327896.3_Missense_Mutation_p.Q68L			Q8IXR5	F178B_HUMAN	family with sequence similarity 178, member B	248										large_intestine(1)|ovary(1)	2						CCCAGGTGCCTGTATCTTGGG	0.697																																					p.Q100L		Atlas-SNP	.											.	FAM178B	35	.	0			c.A299T						.						7.0	9.0	8.0					2																	97637903		690	1584	2274	SO:0001583	missense	51252	exon3			GGTGCCTGTATCT	AF151068, BC039488	CCDS33252.1, CCDS46366.1, CCDS46366.2	2q11.2	2008-08-08			ENSG00000168754	ENSG00000168754			28036	protein-coding gene	gene with protein product						11042152	Standard	NM_001122646		Approved	LOC51252	uc002sxl.4	Q8IXR5	OTTHUMG00000155257	ENST00000417561.3:c.743A>T	chr2.hg19:g.97637903T>A	ENSP00000413245:p.Gln248Leu	252.0	0.0		368.0	153.0	NM_001122646	A8MXN2|E9PD86|Q8IUY0|Q9P0P4	Missense_Mutation	SNP	ENST00000417561.3	hg19		.	.	.	.	.	.	.	.	.	.	T	15.13	2.742564	0.49151	.	.	ENSG00000168754	ENST00000417561;ENST00000327896;ENST00000490605	T;T;T	0.52526	0.66;0.71;0.69	4.22	4.22	0.49857	.	.	.	.	.	T	0.38585	0.1046	N	0.24115	0.695	0.28563	N	0.911001	.	.	.	.	.	.	T	0.28713	-1.0035	7	0.38643	T	0.18	-6.1455	9.9837	0.41828	0.0:0.0:0.0:1.0	.	.	.	.	L	248;68;100	ENSP00000413245:Q248L;ENSP00000333553:Q68L;ENSP00000429896:Q100L	ENSP00000333553:Q68L	Q	-	2	0	FAM178B	97001630	0.980000	0.34600	0.943000	0.38184	0.152000	0.21847	3.093000	0.50217	2.140000	0.66376	0.533000	0.62120	CAG	.	.		0.697	FAM178B-202	KNOWN	basic	protein_coding	protein_coding		NM_016490	
ANAPC1	64682	hgsc.bcm.edu	37	2	112601156	112601156	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:112601156T>C	ENST00000341068.3	-	17	2645	c.1873A>G	c.(1873-1875)Att>Gtt	p.I625V		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	625					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						ATAAACTTAATTGCTTGCAAA	0.373																																					p.I625V		Atlas-SNP	.											.	ANAPC1	116	.	0			c.A1873G						.						60.0	53.0	55.0					2																	112601156		2203	4300	6503	SO:0001583	missense	64682	exon17			ACTTAATTGCTTG	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1873A>G	chr2.hg19:g.112601156T>C	ENSP00000339109:p.Ile625Val	103.0	0.0		140.0	54.0	NM_022662	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	ENST00000341068.3	hg19	CCDS2093.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	10.08|10.08	1.253213|1.253213	0.22965|0.22965	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000341068|ENST00000427997	.|.	.|.	.|.	4.37|4.37	1.57|1.57	0.23409|0.23409	.|.	0.000000|.	0.36482|.	U|.	0.002569|.	T|T	0.23886|0.23886	0.0578|0.0578	N|N	0.04043|0.04043	-0.29|-0.29	0.35272|0.35272	D|D	0.780557|0.780557	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.22800|0.22800	-1.0206|-1.0206	9|5	0.28530|.	T|.	0.3|.	-15.3506|-15.3506	8.6102|8.6102	0.33797|0.33797	0.0:0.2636:0.0:0.7364|0.0:0.2636:0.0:0.7364	.|.	625|.	Q9H1A4|.	APC1_HUMAN|.	V|S	625|159	.|.	ENSP00000339109:I625V|.	I|N	-|-	1|2	0|0	ANAPC1|ANAPC1	112317627|112317627	0.905000|0.905000	0.30787|0.30787	0.999000|0.999000	0.59377|0.59377	0.962000|0.962000	0.63368|0.63368	0.886000|0.886000	0.28241|0.28241	0.548000|0.548000	0.28955|0.28955	0.445000|0.445000	0.29226|0.29226	ATT|AAT	.	.		0.373	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
IFIH1	64135	hgsc.bcm.edu	37	2	163139081	163139081	+	Silent	SNP	C	C	A	rs180798633		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:163139081C>A	ENST00000263642.2	-	6	1496	c.1101G>T	c.(1099-1101)ctG>ctT	p.L367L		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	367	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						GTTCAACTAGCAGTACCTTAA	0.368																																					p.L367L		Atlas-SNP	.											.	IFIH1	102	.	0			c.G1101T						.						34.0	33.0	33.0					2																	163139081		2200	4299	6499	SO:0001819	synonymous_variant	64135	exon6			AACTAGCAGTACC	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.1101G>T	chr2.hg19:g.163139081C>A		77.0	0.0		85.0	37.0	NM_022168	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Silent	SNP	ENST00000263642.2	hg19	CCDS2217.1																																																																																			.	C|1.000;G|0.000		0.368	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168	
DHRS9	10170	hgsc.bcm.edu	37	2	169952088	169952088	+	Silent	SNP	G	G	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:169952088G>T	ENST00000327239.4	+	8	2275	c.771G>T	c.(769-771)gtG>gtT	p.V257V	DHRS9_ENST00000357546.2_Silent_p.V257V|DHRS9_ENST00000602501.1_Silent_p.V257V|DHRS9_ENST00000421653.1_Silent_p.V110V|DHRS9_ENST00000432060.2_Silent_p.V317V|DHRS9_ENST00000428522.1_Silent_p.V257V|DHRS9_ENST00000412271.1_Silent_p.V257V|DHRS9_ENST00000436483.2_Silent_p.V257V	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9	257					9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						AATCCTATGTGAACATGGACC	0.433																																					p.V257V		Atlas-SNP	.											.	DHRS9	29	.	0			c.G771T						.						151.0	149.0	150.0					2																	169952088		2203	4300	6503	SO:0001819	synonymous_variant	10170	exon8			CTATGTGAACATG	AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.771G>T	chr2.hg19:g.169952088G>T		274.0	0.0		328.0	125.0	NM_005771	B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Silent	SNP	ENST00000327239.4	hg19	CCDS2231.1																																																																																			.	.		0.433	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333612.3	NM_005771	
TTN	7273	hgsc.bcm.edu	37	2	179639038	179639038	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:179639038C>T	ENST00000591111.1	-	30	7177	c.6953G>A	c.(6952-6954)cGt>cAt	p.R2318H	TTN_ENST00000359218.5_Missense_Mutation_p.R2272H|TTN-AS1_ENST00000584485.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.R2318H|TTN_ENST00000589042.1_Missense_Mutation_p.R2318H|TTN_ENST00000342992.6_Missense_Mutation_p.R2318H|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R2272H|TTN_ENST00000342175.6_Missense_Mutation_p.R2272H			Q8WZ42	TITIN_HUMAN	titin	12640	Ig-like 12.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGACGTCCACGACGAGATGT	0.403																																					p.R2318H		Atlas-SNP	.											.	TTN	18412	.	0			c.G6953A						.						176.0	161.0	166.0					2																	179639038		2203	4300	6503	SO:0001583	missense	7273	exon30			CGTCCACGACGAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6953G>A	chr2.hg19:g.179639038C>T	ENSP00000465570:p.Arg2318His	88.0	0.0		132.0	67.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.23	3.065125	0.55432	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	5.6	5.6	0.85130	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56171	0.1967	L	0.29908	0.895	0.39107	D	0.961397	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.60885	-0.7174	9	0.87932	D	0	.	19.6137	0.95619	0.0:1.0:0.0:0.0	.	2272;2272;2272;2318;2318	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	H	2318;2272;2272;2272;2272;2318	ENSP00000343764:R2318H;ENSP00000434586:R2272H;ENSP00000340554:R2272H;ENSP00000352154:R2272H;ENSP00000354117:R2318H	ENSP00000340554:R2272H	R	-	2	0	TTN	179347283	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.650000	0.89964	0.557000	0.71058	CGT	.	.		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FAM171B	165215	hgsc.bcm.edu	37	2	187627077	187627077	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:187627077C>T	ENST00000304698.5	+	8	2211	c.2008C>T	c.(2008-2010)Ccc>Tcc	p.P670S		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	670						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						CTCCCCGCATCCCAGAGCCTG	0.483																																					p.P670S		Atlas-SNP	.											.	FAM171B	146	.	0			c.C2008T						.						75.0	83.0	80.0					2																	187627077		2203	4300	6503	SO:0001583	missense	165215	exon8			CCGCATCCCAGAG	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.2008C>T	chr2.hg19:g.187627077C>T	ENSP00000304108:p.Pro670Ser	193.0	0.0		213.0	107.0	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	hg19	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366859	0.82463	.	.	ENSG00000144369	ENST00000304698	T	0.63744	-0.06	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.79191	0.4404	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78974	-0.1992	10	0.87932	D	0	-14.9834	20.547	0.99278	0.0:1.0:0.0:0.0	.	670;671	Q6P995;A8K122	F171B_HUMAN;.	S	670	ENSP00000304108:P670S	ENSP00000304108:P670S	P	+	1	0	FAM171B	187335322	1.000000	0.71417	0.998000	0.56505	0.920000	0.55202	7.460000	0.80816	2.850000	0.98022	0.650000	0.86243	CCC	.	.		0.483	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
UGT1A1	54658	hgsc.bcm.edu	37	2	234669658	234669659	+	Missense_Mutation	DNP	TG	TG	AC			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:234669658_234669659TG>AC	ENST00000608383.1	+	1	725_726	c.725_726TG>AC	c.(724-726)gTG>gAC	p.V242D	UGT1A6_ENST00000373424.1_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A8_ENST00000305208.5_Missense_Mutation_p.V242D|UGT1A9_ENST00000354728.4_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A10_ENST00000373445.1_Intron|UGT1A1_ENST00000360418.3_Missense_Mutation_p.V242D|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A7_ENST00000373426.3_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A5_ENST00000373414.3_Intron			P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	242					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	CAGAGAGAGGTGACTGTCCAGG	0.475																																					p.V242E|p.V242V		Atlas-SNP	.											.	UGT1A1	81	.	0			c.T725A|c.G726C						.																																			SO:0001583	missense	54658	exon1			GAGAGGTGACTGT|AGAGGTGACTGTC	M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	Exception_encountered	chr2.hg19:g.234669658_234669659delinsAC	ENSP00000476741:p.Val242Asp	132.0|133.0	0.0		159.0|162.0	65.0|66.0	NM_000463	A6NJC3|B8K286	Missense_Mutation|Silent	SNP	ENST00000608383.1	hg19	CCDS2510.1																																																																																			.	.		0.475	UGT1A1-203	KNOWN	basic|CCDS	protein_coding	protein_coding			
ACKR3	57007	hgsc.bcm.edu	37	2	237489983	237489983	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:237489983C>T	ENST00000272928.3	+	2	1185	c.875C>T	c.(874-876)gCc>gTc	p.A292V		NM_020311.2	NP_064707.1	P25106	ACKR3_HUMAN	atypical chemokine receptor 3	292					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|receptor internalization (GO:0031623)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell surface (GO:0009986)|coated pit (GO:0005905)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-X-C chemokine binding (GO:0019958)|C-X-C chemokine receptor activity (GO:0016494)|coreceptor activity (GO:0015026)|scavenger receptor activity (GO:0005044)										CTGGAGCACGCCCTCTTCACG	0.592																																					p.A292V		Atlas-SNP	.											.	CXCR7	72	.	0			c.C875T						.						135.0	113.0	121.0					2																	237489983		2203	4300	6503	SO:0001583	missense	57007	exon2			AGCACGCCCTCTT	BC008459	CCDS2516.1	2q37.3	2013-07-17	2013-07-16	2013-07-16	ENSG00000144476	ENSG00000144476		"""CD molecules"", ""GPCR / Class A : Chemokine receptors : Atypical"""	23692	protein-coding gene	gene with protein product		610376	"""chemokine orphan receptor 1"", ""chemokine (C-X-C motif) receptor 7"""	CMKOR1, CXCR7		16107333, 16148	Standard	NM_020311		Approved	RDC1, GPR159	uc002vwd.3	P25106	OTTHUMG00000133295	ENST00000272928.3:c.875C>T	chr2.hg19:g.237489983C>T	ENSP00000272928:p.Ala292Val	41.0	0.0		65.0	24.0	NM_020311	A8K6J4|Q53RV4|Q8NE10|Q92938|Q92986	Missense_Mutation	SNP	ENST00000272928.3	hg19	CCDS2516.1	.	.	.	.	.	.	.	.	.	.	C	5.837	0.338691	0.11069	.	.	ENSG00000144476	ENST00000272928	T	0.70164	-0.46	5.41	2.06	0.26882	GPCR, rhodopsin-like superfamily (1);	0.323007	0.32328	N	0.006246	T	0.40347	0.1113	N	0.12637	0.245	0.26746	N	0.970281	B	0.02656	0.0	B	0.04013	0.001	T	0.15578	-1.0432	9	.	.	.	.	5.2762	0.15651	0.0:0.1236:0.184:0.6923	.	292	P25106	CXCR7_HUMAN	V	292	ENSP00000272928:A292V	.	A	+	2	0	CXCR7	237154722	1.000000	0.71417	0.974000	0.42286	0.881000	0.50899	2.115000	0.41921	0.141000	0.18875	-0.176000	0.13171	GCC	.	.		0.592	ACKR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257079.2	NM_020311	
ITPR1	3708	hgsc.bcm.edu	37	3	4747976	4747976	+	Missense_Mutation	SNP	C	C	A	rs373619512		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr3:4747976C>A	ENST00000443694.2	+	34	4738	c.4738C>A	c.(4738-4740)Cgc>Agc	p.R1580S	ITPR1_ENST00000423119.2_Missense_Mutation_p.R1586S|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.R1595S|ITPR1_ENST00000302640.8_Missense_Mutation_p.R1580S|ITPR1_ENST00000357086.4_Missense_Mutation_p.R1586S|ITPR1_ENST00000456211.2_Missense_Mutation_p.R1571S			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1595				AIAIPVDLDSQVNNLFLKSHSIVQK -> HCHSRGPGQPSQ QPLSQVPQHCAE (in Ref. 6; AAD14386). {ECO:0000305}.	activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	CAATGCCGCACGCAGGGACTC	0.537																																					p.R1586S		Atlas-SNP	.											ITPR1_ENST00000357086,colon,carcinoma,0,3	ITPR1	659	.	0			c.C4756A						.						48.0	51.0	50.0					3																	4747976		2030	4186	6216	SO:0001583	missense	3708	exon37			GCCGCACGCAGGG	D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.4738C>A	chr3.hg19:g.4747976C>A	ENSP00000401671:p.Arg1580Ser	80.0	1.0		99.0	38.0	NM_001099952	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	ENST00000443694.2	hg19	CCDS54551.1	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825180	0.32237	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	T;T;T;T;T;T	0.61627	0.09;0.09;0.09;0.09;0.09;0.09	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.52533	0.1740	L	0.56280	1.765	0.80722	D	1	B;B	0.27679	0.091;0.185	B;B	0.25987	0.033;0.065	T	0.47812	-0.9088	10	0.25751	T	0.34	.	14.9162	0.70798	0.1438:0.8562:0.0:0.0	.	1595;1586	Q14643;G5E9P1	ITPR1_HUMAN;.	S	1595;1580;1595;1586;41;1586;1571;1580	ENSP00000306253:R1580S;ENSP00000346595:R1595S;ENSP00000405934:R1586S;ENSP00000349597:R1586S;ENSP00000397885:R1571S;ENSP00000401671:R1580S	ENSP00000306253:R1580S	R	+	1	0	ITPR1	4722976	0.987000	0.35691	0.570000	0.28473	0.415000	0.31203	2.787000	0.47798	2.609000	0.88269	0.655000	0.94253	CGC	.	.		0.537	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000337982.3	NM_002222	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266124	41266124	+	Missense_Mutation	SNP	A	A	G	rs121913412		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr3:41266124A>G	ENST00000349496.5	+	3	401	c.121A>G	c.(121-123)Acc>Gcc	p.T41A	CTNNB1_ENST00000453024.1_Missense_Mutation_p.T34A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.T41A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.T41A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.T41A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	41			T -> A (in hepatoblastoma and hepatocellular carcinoma; also in a desmoid tumor; strongly reduces phosphorylation and degradation; abolishes phosphorylation on Ser-33 and Ser-37 and enhances transactivation of target genes). {ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10398436, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10655994, ECO:0000269|PubMed:9927029}.|T -> I (in PTR, hepatocellular carcinoma and ovarian cancer). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10391090, ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.T41A(550)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.T41P(6)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T41S(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.S37_G48>C(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.M14_S45del(1)|p.T40_L46del(1)|p.A20_N141del(1)|p.T41_N51del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_T41del(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.A39_T42del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGGTGCCACTACCACAGCTCC	0.507	T41A(CCK81_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.T41A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,1	CTNNB1	4904	.	681	Substitution - Missense(559)|Deletion - In frame(96)|Complex - deletion inframe(17)|Unknown(7)|Deletion - Frameshift(2)	soft_tissue(387)|liver(158)|large_intestine(61)|endometrium(17)|kidney(11)|stomach(8)|biliary_tract(7)|ovary(6)|small_intestine(4)|lung(4)|prostate(4)|adrenal_gland(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|salivary_gland(1)|pituitary(1)|pancreas(1)	c.A121G						.						89.0	77.0	81.0					3																	41266124		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GCCACTACCACAG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.121A>G	chr3.hg19:g.41266124A>G	ENSP00000344456:p.Thr41Ala	133.0	0.0		218.0	127.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.449381	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.63117	0.2484	M	0.79258	2.445	0.80722	D	1	P	0.50943	0.94	P	0.52267	0.694	T	0.68561	-0.5376	10	0.87932	D	0	-8.9189	16.3453	0.83126	1.0:0.0:0.0:0.0	.	41	P35222	CTNB1_HUMAN	A	34;41;41;41;41;34;41;41;41	ENSP00000400508:T34A;ENSP00000385604:T41A;ENSP00000412219:T41A;ENSP00000379486:T41A;ENSP00000344456:T41A;ENSP00000411226:T34A;ENSP00000379488:T41A;ENSP00000409302:T41A;ENSP00000401599:T41A	ENSP00000344456:T41A	T	+	1	0	CTNNB1	41241128	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	9.339000	0.96797	2.261000	0.74972	0.533000	0.62120	ACC	.	.		0.507	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266165	41266165	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr3:41266165A>C	ENST00000349496.5	+	3	442	c.162A>C	c.(160-162)gaA>gaC	p.E54D	CTNNB1_ENST00000453024.1_Missense_Mutation_p.E47D|CTNNB1_ENST00000405570.1_Missense_Mutation_p.E54D|CTNNB1_ENST00000396183.3_Missense_Mutation_p.E54D|CTNNB1_ENST00000396185.3_Missense_Mutation_p.E54D	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	54					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.W25_I140del(3)|p.T3_A126del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.Q28_Q61del(1)|p.M1_A87del(1)|p.A20_N141del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.Y30_A97del(1)|p.S45_D58del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.A5_E54del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.A20_S111del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ATCCTGAGGAAGAGGATGTGG	0.463		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.E54D	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,+2,1	CTNNB1	4904	.	110	Deletion - In frame(88)|Complex - deletion inframe(15)|Unknown(7)	liver(81)|large_intestine(16)|stomach(7)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)	c.A162C						.						73.0	67.0	69.0					3																	41266165		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGAGGAAGAGGAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.162A>C	chr3.hg19:g.41266165A>C	ENSP00000344456:p.Glu54Asp	138.0	0.0		206.0	117.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	3.145	-0.175568	0.06421	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.91	-0.768	0.11013	.	0.272597	0.42548	D	0.000690	T	0.10337	0.0253	N	0.02011	-0.69	0.44745	D	0.997743	B	0.02656	0.0	B	0.04013	0.001	T	0.33420	-0.9869	10	0.02654	T	1	-8.2306	2.7296	0.05223	0.3389:0.1297:0.4044:0.127	.	54	P35222	CTNB1_HUMAN	D	47;54;54;54;54;47;54;54;54	ENSP00000400508:E47D;ENSP00000385604:E54D;ENSP00000412219:E54D;ENSP00000379486:E54D;ENSP00000344456:E54D;ENSP00000411226:E47D;ENSP00000379488:E54D;ENSP00000409302:E54D;ENSP00000401599:E54D	ENSP00000344456:E54D	E	+	3	2	CTNNB1	41241169	0.991000	0.36638	0.991000	0.47740	0.997000	0.91878	0.349000	0.20055	-0.081000	0.12662	0.533000	0.62120	GAA	.	.		0.463	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
LZTFL1	54585	hgsc.bcm.edu	37	3	45872441	45872441	+	Silent	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr3:45872441T>C	ENST00000296135.6	-	7	738	c.564A>G	c.(562-564)gcA>gcG	p.A188A	LZTFL1_ENST00000536047.1_Silent_p.A171A|LZTFL1_ENST00000490463.1_5'UTR|LZTFL1_ENST00000539217.1_Silent_p.A184A	NM_001276378.1|NM_020347.2	NP_001263307.1|NP_065080.1	Q9NQ48	LZTL1_HUMAN	leucine zipper transcription factor-like 1	188	Interaction with BSS9.				establishment of protein localization to organelle (GO:0072594)	BBSome (GO:0034464)|cytoplasm (GO:0005737)	identical protein binding (GO:0042802)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	8				BRCA - Breast invasive adenocarcinoma(193;0.00867)|KIRC - Kidney renal clear cell carcinoma(197;0.0177)|Kidney(197;0.0208)		AATCTTGCAGTGCTTTTTCTA	0.303																																					p.A188A		Atlas-SNP	.											.	LZTFL1	37	.	0			c.A564G						.						153.0	148.0	150.0					3																	45872441		2201	4299	6500	SO:0001819	synonymous_variant	54585	exon7			TTGCAGTGCTTTT	AJ297351	CCDS2731.1, CCDS63608.1, CCDS63609.1	3p21.3	2014-01-28			ENSG00000163818	ENSG00000163818			6741	protein-coding gene	gene with protein product		606568				11352561, 22510444	Standard	NM_020347		Approved	BBS17	uc003cox.2	Q9NQ48	OTTHUMG00000133452	ENST00000296135.6:c.564A>G	chr3.hg19:g.45872441T>C		96.0	0.0		149.0	40.0	NM_020347	B3KSI9|B4E0K7|Q8TC61|Q9NQ56	Silent	SNP	ENST00000296135.6	hg19	CCDS2731.1	.	.	.	.	.	.	.	.	.	.	T	9.809	1.182699	0.21870	.	.	ENSG00000163818	ENST00000440576	.	.	.	5.78	-4.99	0.03010	.	.	.	.	.	T	0.17959	0.0431	.	.	.	0.25986	N	0.982316	.	.	.	.	.	.	T	0.28235	-1.0050	4	.	.	.	-0.4303	2.3522	0.04286	0.0972:0.2346:0.3008:0.3674	.	.	.	.	A	124	.	.	T	-	1	0	LZTFL1	45847445	0.028000	0.19301	0.001000	0.08648	0.991000	0.79684	-0.961000	0.03845	-0.802000	0.04421	0.533000	0.62120	ACT	.	.		0.303	LZTFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257326.3	NM_020347	
TMEM115	11070	hgsc.bcm.edu	37	3	50396097	50396097	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr3:50396097A>C	ENST00000266025.3	-	1	944	c.398T>G	c.(397-399)gTc>gGc	p.V133G	XXcos-LUCA11.5_ENST00000606589.1_Intron	NM_007024.4	NP_008955.1	Q12893	TM115_HUMAN	transmembrane protein 115	133					negative regulation of cell proliferation (GO:0008285)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(1)|lung(1)|prostate(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GTGGATACGGACAGTGAACAG	0.597																																					p.V133G		Atlas-SNP	.											.	TMEM115	20	.	0			c.T398G						.						53.0	58.0	56.0					3																	50396097		2203	4300	6503	SO:0001583	missense	11070	exon1			ATACGGACAGTGA	BC011948	CCDS2828.1	3p21.31	2008-11-04			ENSG00000126062	ENSG00000126062			30055	protein-coding gene	gene with protein product	"""placental protein 6"""	607069				11085536	Standard	NM_007024		Approved	PL6	uc003dan.1	Q12893	OTTHUMG00000044212	ENST00000266025.3:c.398T>G	chr3.hg19:g.50396097A>C	ENSP00000266025:p.Val133Gly	86.0	0.0		227.0	138.0	NM_007024	A2IDB7|O14568|Q6IAY4|Q9UIX3	Missense_Mutation	SNP	ENST00000266025.3	hg19	CCDS2828.1	.	.	.	.	.	.	.	.	.	.	A	15.93	2.978744	0.53720	.	.	ENSG00000126062	ENST00000266025	.	.	.	5.39	5.39	0.77823	.	0.439891	0.23543	N	0.047046	T	0.61739	0.2371	M	0.74881	2.28	0.80722	D	1	B	0.24186	0.099	B	0.30401	0.115	T	0.59731	-0.7399	9	0.32370	T	0.25	-2.2824	9.0046	0.36104	0.9161:0.0:0.0839:0.0	.	133	Q12893	TM115_HUMAN	G	133	.	ENSP00000266025:V133G	V	-	2	0	TMEM115	50371101	0.993000	0.37304	0.824000	0.32777	0.761000	0.43186	7.406000	0.80017	2.038000	0.60285	0.460000	0.39030	GTC	.	.		0.597	TMEM115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102784.3	NM_007024	
GNL3	26354	hgsc.bcm.edu	37	3	52724657	52724657	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr3:52724657A>C	ENST00000418458.1	+	7	764	c.591A>C	c.(589-591)aaA>aaC	p.K197N	SNORD69_ENST00000391150.1_RNA|GNL3_ENST00000394799.2_Missense_Mutation_p.K185N|SNORD19_ENST00000391191.1_RNA|SNORD19_ENST00000410413.1_RNA|SNORD19B_ENST00000516978.1_RNA|SNORD19B_ENST00000459623.1_RNA	NM_014366.4|NM_206826.1	NP_055181.3|NP_996562.1	Q9BVP2	GNL3_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)	197	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				cell proliferation (GO:0008283)|GTP catabolic process (GO:0006184)|regulation of cell proliferation (GO:0042127)|ribosome biogenesis (GO:0042254)	extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(3)|large_intestine(3)|lung(2)	12				BRCA - Breast invasive adenocarcinoma(193;6.75e-05)|Kidney(197;0.000611)|KIRC - Kidney renal clear cell carcinoma(197;0.000773)|OV - Ovarian serous cystadenocarcinoma(275;0.048)		ATTTGAAGAAAGAATTGCCAA	0.408																																					p.K197N		Atlas-SNP	.											.	GNL3	37	.	0			c.A591C						.						183.0	207.0	199.0					3																	52724657		2203	4300	6503	SO:0001583	missense	26354	exon7			GAAGAAAGAATTG	AK027514	CCDS2861.1, CCDS43100.1	3p21.1	2005-01-10			ENSG00000163938	ENSG00000163938			29931	protein-coding gene	gene with protein product		608011				11085516, 12464630	Standard	NM_014366		Approved	C77032, E2IG3, MGC800, NS, nucleostemin	uc003dfd.3	Q9BVP2	OTTHUMG00000158752	ENST00000418458.1:c.591A>C	chr3.hg19:g.52724657A>C	ENSP00000395772:p.Lys197Asn	133.0	0.0		206.0	65.0	NM_014366	B2RDC1|Q5PU80|Q96SV6|Q96SV7|Q9UJY0	Missense_Mutation	SNP	ENST00000418458.1	hg19	CCDS2861.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.912593	0.52439	.	.	ENSG00000163938	ENST00000418458;ENST00000394799	T;T	0.14266	2.52;2.52	6.17	1.41	0.22369	.	0.452214	0.27586	N	0.018704	T	0.11281	0.0275	L	0.57536	1.79	0.43467	D	0.995677	B	0.17268	0.021	B	0.16722	0.016	T	0.17868	-1.0355	10	0.14656	T	0.56	.	6.0675	0.19871	0.6025:0.0:0.2784:0.1192	.	197	Q9BVP2	GNL3_HUMAN	N	197;185	ENSP00000395772:K197N;ENSP00000378278:K185N	ENSP00000378278:K185N	K	+	3	2	GNL3	52699697	0.620000	0.27068	0.985000	0.45067	0.999000	0.98932	-0.231000	0.09069	0.019000	0.15079	0.533000	0.62120	AAA	.	.		0.408	GNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352032.1	NM_014366	
ALDH1L1	10840	hgsc.bcm.edu	37	3	125833489	125833489	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr3:125833489T>A	ENST00000393434.2	-	18	2342	c.1993A>T	c.(1993-1995)Agt>Tgt	p.S665C	ALDH1L1_ENST00000452905.2_Missense_Mutation_p.S564C|ALDH1L1_ENST00000472186.1_Missense_Mutation_p.S665C|ALDH1L1_ENST00000273450.3_Missense_Mutation_p.S675C|ALDH1L1_ENST00000393431.2_Intron	NM_012190.3	NP_036322.2	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	665	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	catalytic activity (GO:0003824)|formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(5)|large_intestine(10)|lung(22)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	52				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	TTCACGTTACTTATGGCACAG	0.617																																					p.S675C		Atlas-SNP	.											.	ALDH1L1	138	.	0			c.A2023T						.						138.0	125.0	129.0					3																	125833489		2203	4300	6503	SO:0001583	missense	10840	exon18			CGTTACTTATGGC	AF052732	CCDS3034.1, CCDS58850.1, CCDS58851.1	3q21.2	2010-07-19		2005-01-27	ENSG00000144908	ENSG00000144908	1.5.1.6	"""Aldehyde dehydrogenases"""	3978	protein-coding gene	gene with protein product	"""cytosolic 10-formyltetrahydrofolate dehydrogenase"""	600249	"""formyltetrahydrofolate dehydrogenase"""	FTHFD			Standard	NM_012190		Approved	10-fTHF	uc031sbp.1	O75891	OTTHUMG00000125551	ENST00000393434.2:c.1993A>T	chr3.hg19:g.125833489T>A	ENSP00000377083:p.Ser665Cys	68.0	0.0		63.0	27.0	NM_001270364	B4DG36|E9PBX3|Q68CS1	Missense_Mutation	SNP	ENST00000393434.2	hg19	CCDS3034.1	.	.	.	.	.	.	.	.	.	.	T	16.48	3.135527	0.56828	.	.	ENSG00000144908	ENST00000273450;ENST00000472186;ENST00000452905;ENST00000393434	T;T;T;T	0.09350	2.99;2.99;2.99;2.99	4.14	4.14	0.48551	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.146153	0.64402	D	0.000012	T	0.40546	0.1121	H	0.96080	3.765	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.79784	0.971;0.993;0.973	T	0.46176	-0.9210	10	0.87932	D	0	.	6.134	0.20221	0.0:0.1142:0.0:0.8858	.	564;200;665	E9PBX3;Q6ZV71;O75891	.;.;AL1L1_HUMAN	C	675;665;564;665	ENSP00000273450:S675C;ENSP00000420293:S665C;ENSP00000395881:S564C;ENSP00000377083:S665C	ENSP00000273450:S675C	S	-	1	0	ALDH1L1	127316179	1.000000	0.71417	0.396000	0.26296	0.705000	0.40729	3.937000	0.56575	1.732000	0.51606	0.402000	0.26972	AGT	.	.		0.617	ALDH1L1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354391.1	NM_012190	
STX18	53407	hgsc.bcm.edu	37	4	4426917	4426917	+	Silent	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:4426917T>C	ENST00000306200.2	-	8	798	c.735A>G	c.(733-735)gaA>gaG	p.E245E	STX18_ENST00000505286.1_Silent_p.E245E	NM_016930.2	NP_058626.1	Q9P2W9	STX18_HUMAN	syntaxin 18	245	t-SNARE coiled-coil homology.				ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5				UCEC - Uterine corpus endometrioid carcinoma (64;0.0534)		AGCTGTTCATTTCACCAATTA	0.413																																					p.E245E		Atlas-SNP	.											.	STX18	16	.	0			c.A735G						.						160.0	132.0	141.0					4																	4426917		2203	4300	6503	SO:0001819	synonymous_variant	53407	exon8			GTTCATTTCACCA	AB028741	CCDS3377.1	4p16.3-p16.2	2013-09-23			ENSG00000168818	ENSG00000168818			15942	protein-coding gene	gene with protein product		606046				10788491	Standard	NM_016930		Approved	Ufe1	uc003gic.3	Q9P2W9	OTTHUMG00000090331	ENST00000306200.2:c.735A>G	chr4.hg19:g.4426917T>C		73.0	0.0		94.0	4.0	NM_016930	Q596L3|Q5TZP5	Silent	SNP	ENST00000306200.2	hg19	CCDS3377.1																																																																																			.	.		0.413	STX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206696.1		
WDR1	9948	hgsc.bcm.edu	37	4	10079384	10079384	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:10079384C>A	ENST00000499869.2	-	13	1755	c.1562G>T	c.(1561-1563)gGc>gTc	p.G521V	WDR1_ENST00000382452.2_Missense_Mutation_p.G521V|WDR1_ENST00000382451.2_Missense_Mutation_p.G381V|WDR1_ENST00000515743.1_5'UTR|WDR1_ENST00000502702.1_Missense_Mutation_p.G381V|MIR3138_ENST00000585238.1_RNA			O75083	WDR1_HUMAN	WD repeat domain 1	521					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		CACCGAGTAGCCGTCAGCAAC	0.667																																					p.G521V		Atlas-SNP	.											.	WDR1	93	.	0			c.G1562T						.						17.0	20.0	19.0					4																	10079384		2149	4224	6373	SO:0001583	missense	9948	exon13			GAGTAGCCGTCAG	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.1562G>T	chr4.hg19:g.10079384C>A	ENSP00000427687:p.Gly521Val	100.0	0.0		165.0	63.0	NM_017491	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Missense_Mutation	SNP	ENST00000499869.2	hg19	CCDS54740.1	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900449	0.33535	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000502702;ENST00000439733	T;T;T;T	0.57436	0.4;0.4;0.59;0.59	5.85	4.12	0.48240	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.200800	0.51477	D	0.000088	T	0.53222	0.1783	M	0.83312	2.635	0.80722	D	1	P;P	0.41947	0.634;0.766	B;B	0.37198	0.165;0.243	T	0.58423	-0.7639	10	0.66056	D	0.02	-21.513	10.2261	0.43227	0.1363:0.7937:0.0:0.07	.	381;521	O75083-3;O75083	.;WDR1_HUMAN	V	521;521;381;381;356	ENSP00000427687:G521V;ENSP00000371890:G521V;ENSP00000371889:G381V;ENSP00000426725:G381V	ENSP00000371889:G381V	G	-	2	0	WDR1	9688482	1.000000	0.71417	0.803000	0.32268	0.598000	0.36846	2.193000	0.42658	0.813000	0.34350	0.655000	0.94253	GGC	.	.		0.667	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		
CCDC149	91050	hgsc.bcm.edu	37	4	24839840	24839840	+	Nonsense_Mutation	SNP	G	G	A	rs377438836		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:24839840G>A	ENST00000389609.4	-	6	570	c.427C>T	c.(427-429)Cga>Tga	p.R143*	CCDC149_ENST00000502801.1_Intron|CCDC149_ENST00000504487.1_Nonsense_Mutation_p.R143*|CCDC149_ENST00000428116.2_Intron	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	88										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				GCAAAGTGTCGCACGCCGATT	0.478																																					p.R143X		Atlas-SNP	.											.	CCDC149	41	.	0			c.C427T						.	G	stop/ARG,stop/ARG	1,4405	2.1+/-5.4	0,1,2202	169.0	152.0	157.0		427,427	5.0	1.0	4		157	0,8600		0,0,4300	no	stop-gained,stop-gained	CCDC149	NM_001130726.2,NM_173463.4	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	143/530,143/530	24839840	1,13005	2203	4300	6503	SO:0001587	stop_gained	91050	exon6			AGTGTCGCACGCC		CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.427C>T	chr4.hg19:g.24839840G>A	ENSP00000374260:p.Arg143*	77.0	0.0		118.0	5.0	NM_173463	A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Nonsense_Mutation	SNP	ENST00000389609.4	hg19	CCDS33967.2	.	.	.	.	.	.	.	.	.	.	G	37	6.215628	0.97385	2.27E-4	0.0	ENSG00000181982	ENST00000504487;ENST00000389609;ENST00000382116;ENST00000503881	.	.	.	5.82	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.7498	15.8605	0.79017	0.0:0.0:0.8594:0.1406	.	.	.	.	X	143;143;67;88	.	ENSP00000371550:R67X	R	-	1	2	CCDC149	24448938	1.000000	0.71417	0.983000	0.44433	0.857000	0.48899	6.535000	0.73838	1.394000	0.46624	0.591000	0.81541	CGA	.	.		0.478	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000360157.1	NM_173463	
PDGFRA	5156	hgsc.bcm.edu	37	4	55139876	55139876	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:55139876G>A	ENST00000257290.5	+	10	1868	c.1537G>A	c.(1537-1539)Gag>Aag	p.E513K	FIP1L1_ENST00000507166.1_Intron	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	513	Ig-like C2-type 5.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TGAGAACCGAGAGCTGAAGCT	0.577			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.E513K	Pancreas(151;208 1913 7310 23853 37092)	Atlas-SNP	.		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	PDGFRA	1583	.	0			c.G1537A						.						57.0	59.0	58.0					4																	55139876		2203	4300	6503	SO:0001583	missense	5156	exon10	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	AACCGAGAGCTGA	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.1537G>A	chr4.hg19:g.55139876G>A	ENSP00000257290:p.Glu513Lys	41.0	0.0		46.0	4.0	NM_006206	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Missense_Mutation	SNP	ENST00000257290.5	hg19	CCDS3495.1	.	.	.	.	.	.	.	.	.	.	G	33	5.229952	0.95173	.	.	ENSG00000134853	ENST00000257290	T	0.75589	-0.95	5.9	5.9	0.94986	Immunoglobulin-like fold (1);	0.000000	0.32273	U	0.006328	D	0.86151	0.5864	M	0.77820	2.39	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.979;0.997	T	0.81057	-0.1105	10	0.15952	T	0.53	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	513;513	P16234-3;P16234	.;PGFRA_HUMAN	K	513	ENSP00000257290:E513K	ENSP00000257290:E513K	E	+	1	0	PDGFRA	54834633	1.000000	0.71417	0.998000	0.56505	0.669000	0.39330	8.662000	0.91130	2.788000	0.95919	0.650000	0.86243	GAG	.	.		0.577	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
ALB	213	hgsc.bcm.edu	37	4	74275115	74275115	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:74275115C>G	ENST00000503124.1	+	3	283	c.76C>G	c.(76-78)Ccg>Gcg	p.P26A	ALB_ENST00000415165.2_Intron|ALB_ENST00000509063.1_Missense_Mutation_p.P176A|ALB_ENST00000401494.3_Missense_Mutation_p.P61A|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000295897.4_Missense_Mutation_p.P176A			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTTTTATGCCCCGGAACTCCT	0.353																																					p.P176A		Atlas-SNP	.											.	ALB	132	.	0			c.C526G						.						69.0	74.0	72.0					4																	74275115		2203	4299	6502	SO:0001583	missense	213	exon5			TATGCCCCGGAAC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.76C>G	chr4.hg19:g.74275115C>G	ENSP00000421027:p.Pro26Ala	203.0	0.0		239.0	104.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.328345|4.328345	0.81690|0.81690	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000441319;ENST00000295897;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202|ENST00000511370	T;T;T;T;T|.	0.73258|.	-0.73;-0.73;-0.73;-0.73;-0.73|.	5.55|5.55	5.55|5.55	0.83447|0.83447	Serum albumin-like (1);Serum albumin, N-terminal (3);|.	0.133283|0.133283	0.52532|0.52532	D|D	0.000066|0.000066	D|D	0.84306|0.84306	0.5443|0.5443	M|M	0.88906|0.88906	2.99|2.99	0.53005|0.53005	D|D	0.999967|0.999967	D;P;P;D|.	0.89917|.	1.0;0.955;0.916;0.986|.	D;P;P;P|.	0.83275|.	0.996;0.57;0.784;0.827|.	D|D	0.85964|0.85964	0.1472|0.1472	10|6	0.87932|.	D|.	0|.	-21.472|-21.472	18.2485|18.2485	0.89995|0.89995	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	61;26;176;176|.	B7WNR0;D6RHD5;A6NBZ8;P02768|.	.;.;.;ALBU_HUMAN|.	A|R	178;176;26;176;61;185|20	ENSP00000392541:P178A;ENSP00000295897:P176A;ENSP00000421027:P26A;ENSP00000422784:P176A;ENSP00000384695:P61A|.	ENSP00000295897:P176A|.	P|P	+|+	1|2	0|0	ALB|ALB	74493979|74493979	0.977000|0.977000	0.34250|0.34250	0.998000|0.998000	0.56505|0.56505	0.916000|0.916000	0.54674|0.54674	3.066000|3.066000	0.50002|0.50002	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CCG|CCC	.	.		0.353	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
MYOZ2	51778	hgsc.bcm.edu	37	4	120079231	120079231	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:120079231T>A	ENST00000307128.5	+	4	514	c.301T>A	c.(301-303)Tcg>Acg	p.S101T		NM_016599.4	NP_057683.1			myozenin 2											endometrium(1)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	16						GGAAGGTGGTTCGCAGCAAGC	0.458																																					p.S101T		Atlas-SNP	.											MYOZ2,NS,malignant_melanoma,0,1	MYOZ2	34	.	0			c.T301A						.						160.0	152.0	155.0					4																	120079231		2203	4300	6503	SO:0001583	missense	51778	exon4			GGTGGTTCGCAGC	AF249873	CCDS3711.1	4q26-q27	2014-09-17	2002-01-07	2002-01-11	ENSG00000172399	ENSG00000172399			1330	protein-coding gene	gene with protein product		605602	"""chromosome 4 open reading frame 5"""	C4orf5		8619474, 9110174	Standard	NM_016599		Approved	CS-1	uc003icp.4	Q9NPC6	OTTHUMG00000132968	ENST00000307128.5:c.301T>A	chr4.hg19:g.120079231T>A	ENSP00000306997:p.Ser101Thr	133.0	1.0		162.0	69.0	NM_016599		Missense_Mutation	SNP	ENST00000307128.5	hg19	CCDS3711.1	.	.	.	.	.	.	.	.	.	.	T	11.17	1.560723	0.27827	.	.	ENSG00000172399	ENST00000307128	T	0.64085	-0.08	5.55	5.55	0.83447	.	0.340145	0.30464	N	0.009561	T	0.46367	0.1389	L	0.38531	1.155	0.09310	N	1	B	0.30563	0.285	B	0.30251	0.113	T	0.32666	-0.9898	10	0.20046	T	0.44	-9.7478	5.9555	0.19271	0.0:0.2042:0.0:0.7958	.	101	Q9NPC6	MYOZ2_HUMAN	T	101	ENSP00000306997:S101T	ENSP00000306997:S101T	S	+	1	0	MYOZ2	120298679	0.216000	0.23585	0.798000	0.32154	0.985000	0.73830	2.064000	0.41432	2.108000	0.64289	0.533000	0.62120	TCG	.	.		0.458	MYOZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256526.2		
FAT1	2195	hgsc.bcm.edu	37	4	187524333	187524333	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:187524333T>G	ENST00000441802.2	-	19	11556	c.11347A>C	c.(11347-11349)Aaa>Caa	p.K3783Q		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3783					actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GCAGTACCTTTGCAGAGACAC	0.483										HNSCC(5;0.00058)																											p.K3783Q	Colon(197;1040 2055 4143 4984 49344)	Atlas-SNP	.											.	FAT1	500	.	0			c.A11347C						.						51.0	50.0	51.0					4																	187524333		2036	4187	6223	SO:0001583	missense	2195	exon19			TACCTTTGCAGAG	X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.11347A>C	chr4.hg19:g.187524333T>G	ENSP00000406229:p.Lys3783Gln	83.0	0.0		139.0	55.0	NM_005245		Missense_Mutation	SNP	ENST00000441802.2	hg19	CCDS47177.1	.	.	.	.	.	.	.	.	.	.	T	9.519	1.107704	0.20714	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.42513	0.97	4.41	0.312	0.15837	.	0.413094	0.28052	N	0.016800	T	0.29684	0.0741	L	0.41573	1.285	0.37503	D	0.916859	B	0.02656	0.0	B	0.12156	0.007	T	0.21177	-1.0253	10	0.13853	T	0.58	.	12.3299	0.55033	0.0:0.0:0.4089:0.5911	.	3783	Q14517	FAT1_HUMAN	Q	3783;3785	ENSP00000406229:K3783Q	ENSP00000260147:K3785Q	K	-	1	0	FAT1	187761327	0.993000	0.37304	0.983000	0.44433	0.660000	0.38997	0.511000	0.22739	-0.005000	0.14395	-0.429000	0.05907	AAA	.	.		0.483	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360209.3	NM_005245	
NAIP	4671	hgsc.bcm.edu	37	5	70308645	70308645	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr5:70308645T>A	ENST00000517649.1	-	4	388	c.98A>T	c.(97-99)cAg>cTg	p.Q33L	NAIP_ENST00000523981.1_Intron|NAIP_ENST00000503719.2_Intron|NAIP_ENST00000194097.4_Missense_Mutation_p.Q33L|NAIP_ENST00000508426.2_Missense_Mutation_p.Q33L	NM_004536.2	NP_004527.2	Q13075	BIRC1_HUMAN	NLR family, apoptosis inhibitory protein	33					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|nervous system development (GO:0007399)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|metal ion binding (GO:0046872)			central_nervous_system(1)	1		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		CTTTGCCAACTGAACTGCATC	0.478																																					p.Q33L		Atlas-SNP	.											.	NAIP	38	.	0			c.A98T						.						122.0	112.0	115.0					5																	70308645		2202	4296	6498	SO:0001583	missense	4671	exon4			GCCAACTGAACTG	U19251	CCDS4009.1, CCDS43327.1	5q13.2	2010-06-16	2006-12-08	2006-12-08	ENSG00000249437	ENSG00000249437		"""Baculoviral IAP repeat containing"", ""Nucleotide-binding domain and leucine rich repeat containing"""	7634	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and BIR domain containing 1"", ""NLR family, BIR domain containing 1"""	600355	"""baculoviral IAP repeat-containing 1"""	BIRC1		7813013	Standard	NM_022892		Approved	NLRB1	uc003jyj.1	Q13075	OTTHUMG00000163318	ENST00000517649.1:c.98A>T	chr5.hg19:g.70308645T>A	ENSP00000428657:p.Gln33Leu	89.0	0.0		147.0	89.0	NM_004536	B9EG72|E9PHD1|O75857|Q13730|Q59GI6|Q8TDZ4|Q99796	Missense_Mutation	SNP	ENST00000517649.1	hg19	CCDS4009.1	.	.	.	.	.	.	.	.	.	.	t	9.817	1.184803	0.21870	.	.	ENSG00000249437	ENST00000517649;ENST00000194097;ENST00000508426	T;T;T	0.76060	-0.99;-0.99;-0.99	3.25	0.72	0.18214	.	2.505560	0.02342	U	0.075009	T	0.59702	0.2213	L	0.29908	0.895	0.09310	N	1	B;P	0.34462	0.255;0.454	B;B	0.26614	0.071;0.057	T	0.52533	-0.8563	10	0.72032	D	0.01	.	3.0408	0.06138	0.0:0.247:0.2274:0.5256	.	33;33	E7EQW0;Q13075	.;BIRC1_HUMAN	L	33	ENSP00000428657:Q33L;ENSP00000443944:Q33L;ENSP00000429545:Q33L	ENSP00000443944:Q33L	Q	-	2	0	NAIP	70344401	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.010000	0.12743	0.146000	0.19002	-0.495000	0.04643	CAG	.	.		0.478	NAIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372649.6	NM_004536	
TRPC7	57113	hgsc.bcm.edu	37	5	135651445	135651445	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr5:135651445A>C	ENST00000513104.1	-	3	1085	c.803T>G	c.(802-804)aTg>aGg	p.M268R	TRPC7-AS2_ENST00000513958.1_RNA|TRPC7_ENST00000426057.2_Intron|TRPC7_ENST00000355180.3_Intron	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	268					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTGCATTGCATAGATAACTT	0.483																																					p.M268R		Atlas-SNP	.											.	TRPC7	126	.	0			c.T803G						.						68.0	70.0	69.0					5																	135651445		2073	4232	6305	SO:0001583	missense	57113	exon3			CATTGCATAGATA	AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.803T>G	chr5.hg19:g.135651445A>C	ENSP00000426070:p.Met268Arg	100.0	0.0		181.0	14.0	NM_020389	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	ENST00000513104.1	hg19	CCDS47267.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.60|16.60	3.167790|3.167790	0.57476|0.57476	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000513104;ENST00000265193|ENST00000502753	T|.	0.61392|.	0.11|.	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.56171|.	0.1967|.	L|L	0.28740|0.28740	0.885|0.885	0.80722|0.80722	D|D	1|1	B;B|.	0.33883|.	0.43;0.006|.	B;B|.	0.33846|.	0.171;0.01|.	T|.	0.52064|.	-0.8625|.	10|.	0.02654|.	T|.	1|.	-34.974|-34.974	16.0238|16.0238	0.80522|0.80522	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	268;268|.	Q70T25;Q9HCX4|.	.;TRPC7_HUMAN|.	R|X	268|267	ENSP00000426070:M268R|.	ENSP00000265193:M268R|.	M|Y	-|-	2|3	0|2	TRPC7|TRPC7	135679344|135679344	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.072000|5.072000	0.64389|0.64389	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	ATG|TAT	.	.		0.483	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366975.1	NM_020389	
PCDHB3	56132	hgsc.bcm.edu	37	5	140480412	140480412	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr5:140480412C>T	ENST00000231130.2	+	1	179	c.179C>T	c.(178-180)gCc>gTc	p.A60V	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	60	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGGAACTGGCCGCGAGGGGG	0.507																																					p.A60V		Atlas-SNP	.											.	PCDHB3	208	.	0			c.C179T						.						59.0	70.0	67.0					5																	140480412		2203	4300	6503	SO:0001583	missense	56132	exon1			AACTGGCCGCGAG	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.179C>T	chr5.hg19:g.140480412C>T	ENSP00000231130:p.Ala60Val	125.0	0.0		255.0	62.0	NM_018937	B2R8P2	Missense_Mutation	SNP	ENST00000231130.2	hg19	CCDS4245.1	.	.	.	.	.	.	.	.	.	.	C	10.58	1.391001	0.25118	.	.	ENSG00000113205	ENST00000231130	T	0.41065	1.01	4.61	2.77	0.32553	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.42630	0.1211	L	0.58302	1.8	0.09310	N	1	B	0.18610	0.029	B	0.30251	0.113	T	0.44772	-0.9306	9	0.59425	D	0.04	.	10.5778	0.45238	0.0:0.7718:0.0:0.2282	.	60	Q9Y5E6	PCDB3_HUMAN	V	60	ENSP00000231130:A60V	ENSP00000231130:A60V	A	+	2	0	PCDHB3	140460596	0.000000	0.05858	0.142000	0.22268	0.832000	0.47134	0.295000	0.19065	1.046000	0.40249	0.655000	0.94253	GCC	.	.		0.507	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
NKX2-5	1482	hgsc.bcm.edu	37	5	172661932	172661932	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr5:172661932T>A	ENST00000329198.4	-	1	428	c.155A>T	c.(154-156)aAg>aTg	p.K52M	NKX2-5_ENST00000424406.2_Missense_Mutation_p.K52M|NKX2-5_ENST00000521848.1_Missense_Mutation_p.K52M	NM_001166175.1|NM_001166176.1|NM_004387.3	NP_001159647.1|NP_001159648.1|NP_004378.1	P52952	NKX25_HUMAN	NK2 homeobox 5	52	Ala/Pro-rich.				adult heart development (GO:0007512)|apoptotic process involved in heart morphogenesis (GO:0003278)|atrial cardiac muscle cell development (GO:0055014)|atrial septum morphogenesis (GO:0060413)|atrioventricular node cell development (GO:0060928)|atrioventricular node cell fate commitment (GO:0060929)|BMP signaling pathway (GO:0030509)|bundle of His development (GO:0003166)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle contraction (GO:0060048)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac ventricle formation (GO:0003211)|cell differentiation (GO:0030154)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|heart trabecula formation (GO:0060347)|hemopoiesis (GO:0030097)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|pharyngeal system development (GO:0060037)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart contraction (GO:0045823)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription via serum response element binding (GO:0010735)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|proepicardium development (GO:0003342)|pulmonary myocardium development (GO:0003350)|Purkinje myocyte differentiation (GO:0003168)|regulation of cardiac muscle cell proliferation (GO:0060043)|regulation of cardiac muscle contraction (GO:0055117)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|sarcomere organization (GO:0045214)|septum secundum development (GO:0003285)|spleen development (GO:0048536)|thyroid gland development (GO:0030878)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|serum response element binding (GO:0010736)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)	12	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGCCTCTGGCTTGAAGGCGGC	0.736																																					p.K52M	Esophageal Squamous(72;810 1219 2387 13420 44943)	Atlas-SNP	.											.	NKX2-5	42	.	0			c.A155T						.						8.0	12.0	11.0					5																	172661932		2088	4175	6263	SO:0001583	missense	1482	exon1			TCTGGCTTGAAGG	AB021133	CCDS4387.1, CCDS54949.1, CCDS54950.1	5q34	2014-09-17	2011-06-01	2002-10-04	ENSG00000183072	ENSG00000183072		"""Homeoboxes / ANTP class : NKL subclass"""	2488	protein-coding gene	gene with protein product	"""tinman paralog (Drosophila)"""	600584	"""cardiac-specific homeo box"", ""NK2 transcription factor related, locus 5 (Drosophila)"""	CSX, NKX2E		7665173, 8900537	Standard	NM_004387		Approved	CSX1, NKX2.5, NKX4-1	uc003mcm.2	P52952	OTTHUMG00000130522	ENST00000329198.4:c.155A>T	chr5.hg19:g.172661932T>A	ENSP00000327758:p.Lys52Met	100.0	0.0		212.0	128.0	NM_004387	A8K3K0|B4DNB6|E9PBU6	Missense_Mutation	SNP	ENST00000329198.4	hg19	CCDS4387.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.150426	0.78001	.	.	ENSG00000183072	ENST00000329198;ENST00000424406;ENST00000521848;ENST00000517440	D;D;D;D	0.91945	-2.76;-2.84;-2.94;-2.89	5.01	3.82	0.43975	.	0.397263	0.18720	N	0.133025	D	0.92896	0.7740	L	0.59436	1.845	0.51233	D	0.999912	D;D;B	0.61697	0.99;0.98;0.441	P;P;B	0.57152	0.814;0.58;0.087	D	0.90168	0.4233	10	0.33141	T	0.24	.	11.309	0.49353	0.1366:0.0:0.0:0.8634	.	52;52;52	B4DNB6;E5RH49;P52952	.;.;NKX25_HUMAN	M	52	ENSP00000327758:K52M;ENSP00000395378:K52M;ENSP00000427906:K52M;ENSP00000429905:K52M	ENSP00000327758:K52M	K	-	2	0	NKX2-5	172594538	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.697000	0.68295	0.821000	0.34540	0.379000	0.24179	AAG	.	.		0.736	NKX2-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252942.2		
FOXF2	2295	hgsc.bcm.edu	37	6	1391085	1391085	+	Silent	SNP	G	G	C	rs58230522|rs147426137|rs111257067|rs397731476	byFrequency	TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr6:1391085G>C	ENST00000259806.1	+	1	1017	c.903G>C	c.(901-903)ggG>ggC	p.G301G		NM_001452.1	NP_001443.1	Q12947	FOXF2_HUMAN	forkhead box F2	301	Poly-Gly.				embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digestive tract development (GO:0048566)|epithelial to mesenchymal transition (GO:0001837)|establishment of planar polarity of embryonic epithelium (GO:0042249)|extracellular matrix organization (GO:0030198)|genitalia development (GO:0048806)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			large_intestine(2)|lung(5)|prostate(1)	8	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		gtgcggccgggggcggcggcg	0.746																																					p.G301G		Atlas-SNP	.											.	FOXF2	28	.	0			c.G903C						.						1.0	2.0	1.0					6																	1391085		586	1494	2080	SO:0001819	synonymous_variant	2295	exon1			GGCCGGGGGCGGC	U13220	CCDS4472.1	6p25.3	2008-04-10			ENSG00000137273	ENSG00000137273		"""Forkhead boxes"""	3810	protein-coding gene	gene with protein product		603250		FKHL6		9799607, 7957066	Standard	NM_001452		Approved	FREAC2	uc003mtm.3	Q12947	OTTHUMG00000016243	ENST00000259806.1:c.903G>C	chr6.hg19:g.1391085G>C		22.0	0.0		80.0	14.0	NM_001452	Q5TGJ1|Q9UQ85	Silent	SNP	ENST00000259806.1	hg19	CCDS4472.1																																																																																			.	.		0.746	FOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043558.1		
FOXC1	2296	hgsc.bcm.edu	37	6	1612042	1612042	+	Silent	SNP	G	G	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr6:1612042G>C	ENST00000380874.2	+	1	1362	c.1362G>C	c.(1360-1362)ggG>ggC	p.G454G		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	454	Poly-Gly.				artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		gcggcggcggGGGAGGCCAGG	0.751																																					p.G454G	Pancreas(133;719 1821 3197 26645 35015)	Atlas-SNP	.											.	FOXC1	19	.	0			c.G1362C						.						1.0	1.0	1.0					6																	1612042		591	1329	1920	SO:0001819	synonymous_variant	2296	exon1			CGGCGGGGGAGGC	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.1362G>C	chr6.hg19:g.1612042G>C		132.0	0.0		512.0	24.0	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Silent	SNP	ENST00000380874.2	hg19	CCDS4473.1																																																																																			.	.		0.751	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
LYRM4	57128	hgsc.bcm.edu	37	6	5109701	5109701	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr6:5109701T>C	ENST00000330636.4	-	3	437	c.232A>G	c.(232-234)Act>Gct	p.T78A	LYRM4_ENST00000464010.1_3'UTR|LYRM4_ENST00000606472.1_5'Flank|LYRM4_ENST00000468929.1_Silent_p.Q37Q	NM_020408.4	NP_065141.3	Q9HD34	LYRM4_HUMAN	LYR motif containing 4	78					small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)				endometrium(1)	1	Ovarian(93;0.11)	all_hematologic(90;0.0901)				AGCTTGTCAGTTGAATACAGT	0.562																																					p.T78A	NSCLC(130;1006 2426 17608 36797)	Atlas-SNP	.											.	LYRM4	5	.	0			c.A232G						.						136.0	125.0	129.0					6																	5109701		2203	4300	6503	SO:0001583	missense	57128	exon3			TGTCAGTTGAATA	AF258559	CCDS4493.1, CCDS54961.1	6p25.1	2008-02-05	2006-09-19	2006-09-19	ENSG00000214113	ENSG00000214113		"""LYR motif containing"""	21365	protein-coding gene	gene with protein product		613311	"""chromosome 6 open reading frame 149"""	C6orf149			Standard	XM_005249239		Approved	CGI-203, ISD11	uc021ykw.1	Q9HD34	OTTHUMG00000014173	ENST00000330636.4:c.232A>G	chr6.hg19:g.5109701T>C	ENSP00000418787:p.Thr78Ala	134.0	0.0		406.0	55.0	NM_020408	A8K543|Q5XKP1	Missense_Mutation	SNP	ENST00000330636.4	hg19	CCDS4493.1	.	.	.	.	.	.	.	.	.	.	T	7.176	0.588654	0.13812	.	.	ENSG00000214113	ENST00000330636	T	0.41400	1.0	5.42	3.01	0.34805	.	0.973282	0.08253	U	0.974336	T	0.05777	0.0151	.	.	.	0.19300	N	0.999977	B	0.18166	0.026	B	0.12156	0.007	T	0.36407	-0.9749	9	0.06099	T	0.92	.	7.1482	0.25595	0.0:0.1836:0.0:0.8164	.	78	Q9HD34	LYRM4_HUMAN	A	78	ENSP00000418787:T78A	ENSP00000418787:T78A	T	-	1	0	LYRM4	5054700	0.812000	0.29077	0.023000	0.16930	0.977000	0.68977	1.331000	0.33793	0.908000	0.36671	0.533000	0.62120	ACT	.	.		0.562	LYRM4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353461.3	NM_020408	
HIST1H2AE	3012	hgsc.bcm.edu	37	6	26217396	26217396	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr6:26217396A>T	ENST00000303910.2	+	1	232	c.194A>T	c.(193-195)gAg>gTg	p.E65V	HIST1H2BG_ENST00000244601.3_5'Flank	NM_021052.2	NP_066390.1	P04908	H2A1B_HUMAN	histone cluster 1, H2ae	65						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	10		all_hematologic(11;0.196)				GAGATCTTAGAGCTAGCTGGC	0.602																																					p.E65V		Atlas-SNP	.											.	HIST1H2AE	25	.	0			c.A194T						.						56.0	57.0	56.0					6																	26217396		2203	4300	6503	SO:0001583	missense	3012	exon1			TCTTAGAGCTAGC	M60752	CCDS4595.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000168274	ENSG00000277075		"""Histones / Replication-dependent"""	4724	protein-coding gene	gene with protein product		602786	"""H2A histone family, member A"", ""histone 1, H2ae"""	H2AFA		9119399, 1916825, 12408966	Standard	NM_021052		Approved	H2A/a, H2A.1	uc003nha.1	P04908	OTTHUMG00000014440	ENST00000303910.2:c.194A>T	chr6.hg19:g.26217396A>T	ENSP00000303373:p.Glu65Val	114.0	0.0		394.0	301.0	NM_021052	P28001|Q76P63	Missense_Mutation	SNP	ENST00000303910.2	hg19	CCDS4595.1	.	.	.	.	.	.	.	.	.	.	.	12.37	1.918180	0.33815	.	.	ENSG00000168274	ENST00000303910	T	0.72505	-0.66	4.07	4.07	0.47477	.	0.000000	0.34314	U	0.004071	D	0.90625	0.7060	H	0.99958	5.055	0.50632	D	0.999888	.	.	.	.	.	.	D	0.93878	0.7168	8	0.87932	D	0	.	12.6507	0.56759	1.0:0.0:0.0:0.0	.	.	.	.	V	65	ENSP00000303373:E65V	ENSP00000303373:E65V	E	+	2	0	HIST1H2AE	26325375	1.000000	0.71417	1.000000	0.80357	0.019000	0.09904	8.908000	0.92640	1.834000	0.53371	0.528000	0.53228	GAG	.	.		0.602	HIST1H2AE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040103.1	NM_021052	
TTBK1	84630	hgsc.bcm.edu	37	6	43222808	43222808	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr6:43222808C>T	ENST00000259750.4	+	7	681	c.598C>T	c.(598-600)Cga>Tga	p.R200*	TTBK1_ENST00000304139.5_Nonsense_Mutation_p.R149*	NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	200	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			GGCCGGGTTTCGAGGAACGGT	0.607																																					p.R200X		Atlas-SNP	.											.	TTBK1	124	.	0			c.C598T						.						146.0	110.0	122.0					6																	43222808		2203	4300	6503	SO:0001587	stop_gained	84630	exon7			GGGTTTCGAGGAA	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.598C>T	chr6.hg19:g.43222808C>T	ENSP00000259750:p.Arg200*	91.0	0.0		332.0	55.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Nonsense_Mutation	SNP	ENST00000259750.4	hg19	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	C	37	6.600649	0.97697	.	.	ENSG00000146216	ENST00000393984;ENST00000259750;ENST00000304139	.	.	.	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.6948	0.85332	0.0:1.0:0.0:0.0	.	.	.	.	X	149;200;149	.	ENSP00000259750:R200X	R	+	1	2	TTBK1	43330786	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.543000	0.60684	2.242000	0.73789	0.655000	0.94253	CGA	.	.		0.607	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		
DOPEY1	23033	hgsc.bcm.edu	37	6	83819950	83819950	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr6:83819950A>G	ENST00000349129.2	+	6	858	c.598A>G	c.(598-600)Atc>Gtc	p.I200V	DOPEY1_ENST00000369739.3_Missense_Mutation_p.I200V|DOPEY1_ENST00000237163.5_Missense_Mutation_p.I200V|DOPEY1_ENST00000536812.1_Missense_Mutation_p.I200V	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	200					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		TTTACCTGGAATCACGTATGT	0.428																																					p.I200V		Atlas-SNP	.											.	DOPEY1	190	.	0			c.A598G						.						191.0	170.0	177.0					6																	83819950		2203	4300	6503	SO:0001583	missense	23033	exon6			CCTGGAATCACGT	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.598A>G	chr6.hg19:g.83819950A>G	ENSP00000195654:p.Ile200Val	137.0	1.0		86.0	64.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	hg19	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	A	11.56	1.675843	0.29783	.	.	ENSG00000083097	ENST00000349129;ENST00000237163;ENST00000536812;ENST00000369739	T;T;T	0.23754	1.9;1.9;1.89	5.73	5.73	0.89815	Dopey, N-terminal (1);	0.059716	0.64402	D	0.000001	T	0.13500	0.0327	L	0.41027	1.25	0.46167	D	0.998901	B;B;B	0.14438	0.007;0.01;0.01	B;B;B	0.17098	0.012;0.017;0.017	T	0.02639	-1.1130	10	0.41790	T	0.15	.	16.3123	0.82883	1.0:0.0:0.0:0.0	.	200;200;200	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	V	200	ENSP00000195654:I200V;ENSP00000237163:I200V;ENSP00000358754:I200V	ENSP00000237163:I200V	I	+	1	0	DOPEY1	83876669	1.000000	0.71417	1.000000	0.80357	0.679000	0.39708	6.862000	0.75484	2.308000	0.77769	0.533000	0.62120	ATC	.	.		0.428	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
RAPGEF5	9771	hgsc.bcm.edu	37	7	22179655	22179655	+	Silent	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr7:22179655C>T	ENST00000401957.2	-	11	1603	c.1356G>A	c.(1354-1356)tcG>tcA	p.S452S	RAPGEF5_ENST00000344041.6_Silent_p.S602S			Q92565	RPGF5_HUMAN	Rap guanine nucleotide exchange factor (GEF) 5	452	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				nervous system development (GO:0007399)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	nucleus (GO:0005634)	GTP-dependent protein binding (GO:0030742)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|ovary(1)	6						CCCAGGTCTGCGACAGTCGAC	0.413																																					p.S602S		Atlas-SNP	.											.	RAPGEF5	96	.	0			c.G1806A						.						31.0	32.0	31.0					7																	22179655		1892	4117	6009	SO:0001819	synonymous_variant	9771	exon21			GGTCTGCGACAGT	D87467	CCDS55093.1	7p15.3	2004-03-01			ENSG00000136237	ENSG00000136237			16862	protein-coding gene	gene with protein product	"""M-Ras-regulated GEF"""	609527				9039502, 10486569	Standard	NM_012294		Approved	KIAA0277, GFR, MR-GEF	uc003svg.3	Q92565	OTTHUMG00000152525	ENST00000401957.2:c.1356G>A	chr7.hg19:g.22179655C>T		271.0	0.0		440.0	118.0	NM_012294	A4D140|Q8IXU5	Silent	SNP	ENST00000401957.2	hg19																																																																																				.	.		0.413	RAPGEF5-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000326590.2	NM_012294	
CDK13	8621	hgsc.bcm.edu	37	7	40133994	40133994	+	Silent	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr7:40133994A>G	ENST00000181839.4	+	14	4559	c.3954A>G	c.(3952-3954)gaA>gaG	p.E1318E	CDK13_ENST00000340829.5_Silent_p.E1258E	NM_003718.4|NM_031267.3	NP_003709.3|NP_112557.2	Q14004	CDK13_HUMAN	cyclin-dependent kinase 13	1318					alternative mRNA splicing, via spliceosome (GO:0000380)|hemopoiesis (GO:0030097)|multicellular organismal development (GO:0007275)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|positive regulation of cell proliferation (GO:0008284)|regulation of mitosis (GO:0007088)|viral process (GO:0016032)	cyclin K-CDK13 complex (GO:0002945)|extracellular space (GO:0005615)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(2)|prostate(2)|skin(5)|stomach(2)|urinary_tract(1)	49						CCAAAAGAGAAGGTGGGATTG	0.493																																					p.E1318E		Atlas-SNP	.											.	CDK13	114	.	0			c.A3954G						.						130.0	126.0	128.0					7																	40133994		2203	4300	6503	SO:0001819	synonymous_variant	8621	exon14			AAGAGAAGGTGGG	M80629	CCDS5461.1, CCDS5462.1	7p14.1	2011-11-08	2009-12-16	2009-12-16	ENSG00000065883	ENSG00000065883		"""Cyclin-dependent kinases"""	1733	protein-coding gene	gene with protein product	"""cholinesterase-related cell division controller"""	603309	"""cell division cycle 2-like 5 (cholinesterase-related cell division controller)"""	CDC2L5		1731328, 19884882	Standard	NM_003718		Approved	CHED, CDC2L, KIAA1791	uc003thh.4	Q14004	OTTHUMG00000023726	ENST00000181839.4:c.3954A>G	chr7.hg19:g.40133994A>G		63.0	0.0		147.0	39.0	NM_003718	Q53G78|Q6DKQ9|Q75MH4|Q75MH5|Q96JN4|Q9H4A0|Q9H4A1|Q9UDR4	Silent	SNP	ENST00000181839.4	hg19	CCDS5461.1																																																																																			.	.		0.493	CDK13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250726.2	NM_003718	
COBL	23242	hgsc.bcm.edu	37	7	51095425	51095425	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr7:51095425T>C	ENST00000265136.7	-	10	3533	c.3368A>G	c.(3367-3369)aAg>aGg	p.K1123R	COBL_ENST00000395542.2_Missense_Mutation_p.K1205R	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	1123	WH2 1. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					TAGTCTGTCCTTCCCTCCCGC	0.567																																					p.K1123R	NSCLC(189;2119 2138 12223 30818 34679)	Atlas-SNP	.											.	COBL	167	.	0			c.A3368G						.						106.0	92.0	96.0					7																	51095425		2203	4300	6503	SO:0001583	missense	23242	exon10			CTGTCCTTCCCTC	AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.3368A>G	chr7.hg19:g.51095425T>C	ENSP00000265136:p.Lys1123Arg	82.0	0.0		156.0	30.0	NM_015198	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Missense_Mutation	SNP	ENST00000265136.7	hg19	CCDS34637.1	.	.	.	.	.	.	.	.	.	.	T	7.010	0.556676	0.13436	.	.	ENSG00000106078	ENST00000265136;ENST00000445054;ENST00000431948;ENST00000395542	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	5.27	0.0736	0.14391	Actin-binding WH2 (3);	0.325435	0.22233	N	0.062783	T	0.30572	0.0769	N	0.12182	0.205	0.22199	N	0.999296	B;B;B;B;B	0.27997	0.082;0.082;0.1;0.197;0.122	B;B;B;B;B	0.28916	0.058;0.058;0.096;0.062;0.056	T	0.17018	-1.0383	10	0.18276	T	0.48	.	5.1978	0.15246	0.0:0.2352:0.1416:0.6232	.	1123;1180;1123;1205;665	O75128-3;O75128-7;O75128;O75128-2;O75128-6	.;.;COBL_HUMAN;.;.	R	1123;1015;1008;1205	ENSP00000265136:K1123R;ENSP00000401204:K1015R;ENSP00000413498:K1008R;ENSP00000378912:K1205R	ENSP00000265136:K1123R	K	-	2	0	COBL	51062919	0.994000	0.37717	0.170000	0.22879	0.412000	0.31113	1.401000	0.34589	-0.224000	0.09928	0.460000	0.39030	AAG	.	.		0.567	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000342682.1	NM_015198	
SAMD9	54809	hgsc.bcm.edu	37	7	92734707	92734707	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr7:92734707A>G	ENST00000379958.2	-	3	973	c.704T>C	c.(703-705)aTt>aCt	p.I235T		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	235						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TCCAAAATGAATAGTGCCATT	0.393																																					p.I235T		Atlas-SNP	.											.	SAMD9	239	.	0			c.T704C						.						134.0	128.0	130.0					7																	92734707		2203	4300	6503	SO:0001583	missense	54809	exon2			AAATGAATAGTGC	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.704T>C	chr7.hg19:g.92734707A>G	ENSP00000369292:p.Ile235Thr	88.0	0.0		172.0	46.0	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	hg19	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	A	19.94	3.919098	0.73098	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.16324	2.35;2.35	4.39	4.39	0.52855	.	0.000000	0.64402	D	0.000008	T	0.37892	0.1020	M	0.61703	1.905	0.40974	D	0.98472	D	0.89917	1.0	D	0.83275	0.996	T	0.27640	-1.0068	10	0.87932	D	0	.	12.837	0.57780	1.0:0.0:0.0:0.0	.	235	Q5K651	SAMD9_HUMAN	T	235	ENSP00000369292:I235T;ENSP00000414529:I235T	ENSP00000369292:I235T	I	-	2	0	SAMD9	92572643	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.733000	0.91539	1.976000	0.57569	0.491000	0.48974	ATT	.	.		0.393	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
NOS3	4846	hgsc.bcm.edu	37	7	150695672	150695672	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr7:150695672C>A	ENST00000484524.1	+	6	720	c.720C>A	c.(718-720)gaC>gaA	p.D240E	NOS3_ENST00000297494.3_Missense_Mutation_p.D240E|NOS3_ENST00000461406.1_Missense_Mutation_p.D34E|NOS3_ENST00000467517.1_Missense_Mutation_p.D240E	NM_001160111.1	NP_001153583.1	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	3					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCCGAGGAGACTTCCGAATCT	0.667																																					p.D240E		Atlas-SNP	.											.	NOS3	131	.	0			c.C720A						.						21.0	19.0	20.0					7																	150695672		2178	4278	6456	SO:0001583	missense	4846	exon6			AGGAGACTTCCGA		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000484524.1:c.720C>A	chr7.hg19:g.150695672C>A	ENSP00000420215:p.Asp240Glu	75.0	0.0		137.0	44.0	NM_001160111	Q495E5	Missense_Mutation	SNP	ENST00000484524.1	hg19	CCDS55182.1	.	.	.	.	.	.	.	.	.	.	c	20.6	4.025959	0.75390	.	.	ENSG00000164867	ENST00000297494;ENST00000461406;ENST00000484524;ENST00000467517	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	4.9	3.06	0.35304	Nitric oxide synthase, oxygenase domain (3);	0.000000	0.64402	D	0.000011	T	0.48874	0.1524	L	0.56124	1.755	0.39030	D	0.95992	B;B;D;D;B	0.65815	0.006;0.006;0.993;0.995;0.153	B;B;D;D;B	0.79784	0.039;0.039;0.993;0.982;0.132	T	0.51212	-0.8734	10	0.66056	D	0.02	-11.1048	6.5113	0.22224	0.0:0.7143:0.0:0.2857	.	240;240;240;34;240	A0S0A6;E9PFR2;A0S0A8;E7ESA7;P29474	.;.;.;.;NOS3_HUMAN	E	240;34;240;240	ENSP00000297494:D240E;ENSP00000417143:D34E;ENSP00000420215:D240E;ENSP00000420551:D240E	ENSP00000297494:D240E	D	+	3	2	NOS3	150326605	0.967000	0.33354	0.999000	0.59377	0.824000	0.46624	0.201000	0.17276	1.192000	0.43071	0.471000	0.43371	GAC	.	.		0.667	NOS3-004	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351550.1	NM_000603	
WDR60	55112	hgsc.bcm.edu	37	7	158718939	158718939	+	Silent	SNP	G	G	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr7:158718939G>T	ENST00000407559.3	+	18	2477	c.2319G>T	c.(2317-2319)acG>acT	p.T773T		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	773					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		CTATCTCAACGTCCGTCCACA	0.433																																					p.T773T		Atlas-SNP	.											.	WDR60	94	.	0			c.G2319T						.						85.0	80.0	82.0					7																	158718939		1904	4123	6027	SO:0001819	synonymous_variant	55112	exon18			CTCAACGTCCGTC		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.2319G>T	chr7.hg19:g.158718939G>T		163.0	0.0		251.0	76.0	NM_018051	Q9NW58	Silent	SNP	ENST00000407559.3	hg19	CCDS47757.1																																																																																			.	.		0.433	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
FRMPD1	22844	hgsc.bcm.edu	37	9	37708463	37708463	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr9:37708463A>C	ENST00000539465.1	+	4	920	c.327A>C	c.(325-327)gaA>gaC	p.E109D	RP11-613M10.9_ENST00000540557.1_Intron|FRMPD1_ENST00000377765.3_Missense_Mutation_p.E109D			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	109	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AGCCTGCTGAAGACCTTTCCT	0.443																																					p.E109D		Atlas-SNP	.											.	FRMPD1	237	.	0			c.A327C						.						127.0	116.0	120.0					9																	37708463		2203	4300	6503	SO:0001583	missense	22844	exon4			TGCTGAAGACCTT	AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.327A>C	chr9.hg19:g.37708463A>C	ENSP00000444411:p.Glu109Asp	56.0	0.0		85.0	34.0	NM_014907	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Missense_Mutation	SNP	ENST00000539465.1	hg19	CCDS6612.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.660429	0.47572	.	.	ENSG00000070601	ENST00000377765;ENST00000539465	T;T	0.30182	1.54;1.54	5.91	5.91	0.95273	PDZ/DHR/GLGF (4);	0.314836	0.36303	N	0.002664	T	0.26521	0.0648	L	0.37630	1.12	0.80722	D	1	B	0.28605	0.217	B	0.30855	0.121	T	0.05338	-1.0891	10	0.33141	T	0.24	-7.7796	12.7269	0.57176	1.0:0.0:0.0:0.0	.	109	Q5SYB0	FRPD1_HUMAN	D	109	ENSP00000366995:E109D;ENSP00000444411:E109D	ENSP00000366995:E109D	E	+	3	2	FRMPD1	37698463	1.000000	0.71417	0.997000	0.53966	0.676000	0.39594	1.665000	0.37449	2.262000	0.75019	0.528000	0.53228	GAA	.	.		0.443	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402969.1	NM_014907	
FBP1	2203	hgsc.bcm.edu	37	9	97367847	97367847	+	Silent	SNP	A	A	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr9:97367847A>T	ENST00000375326.4	-	6	913	c.717T>A	c.(715-717)gcT>gcA	p.A239A	FBP1_ENST00000415431.1_Silent_p.A239A	NM_000507.3	NP_000498.2	P09467	F16P1_HUMAN	fructose-1,6-bisphosphatase 1	239					carbohydrate metabolic process (GO:0005975)|cellular response to drug (GO:0035690)|cellular response to magnesium ion (GO:0071286)|dephosphorylation (GO:0016311)|fructose 6-phosphate metabolic process (GO:0006002)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|negative regulation of cell growth (GO:0030308)|negative regulation of glycolytic process (GO:0045820)|negative regulation of Ras protein signal transduction (GO:0046580)|protein homotetramerization (GO:0051289)|regulation of gluconeogenesis (GO:0006111)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	AMP binding (GO:0016208)|fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|monosaccharide binding (GO:0048029)			kidney(1)|liver(1)|lung(1)	3		Acute lymphoblastic leukemia(62;0.136)			Adenosine monophosphate(DB00131)	CCCCATAAGGAGCTGAATTAT	0.463																																					p.A239A	Ovarian(142;590 2466 25593 44496)	Atlas-SNP	.											.	FBP1	13	.	0			c.T717A						.						44.0	42.0	43.0					9																	97367847		2203	4300	6503	SO:0001819	synonymous_variant	2203	exon6			ATAAGGAGCTGAA	M19922	CCDS6712.1	9q22.3	2012-08-13			ENSG00000165140	ENSG00000165140	3.1.3.11		3606	protein-coding gene	gene with protein product		611570		FBP		8387495	Standard	NM_000507		Approved		uc004auw.4	P09467	OTTHUMG00000020268	ENST00000375326.4:c.717T>A	chr9.hg19:g.97367847A>T		61.0	0.0		84.0	28.0	NM_000507	O75571|Q53F94|Q96E46	Silent	SNP	ENST00000375326.4	hg19	CCDS6712.1																																																																																			.	.		0.463	FBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053187.1	NM_000507	
CACNA1B	774	hgsc.bcm.edu	37	9	141008886	141008886	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr9:141008886A>G	ENST00000371372.1	+	41	5738	c.5593A>G	c.(5593-5595)Aag>Gag	p.K1865E	CACNA1B_ENST00000371363.1_Missense_Mutation_p.K1863E|CACNA1B_ENST00000371355.4_Missense_Mutation_p.K1866E|CACNA1B_ENST00000371357.1_Missense_Mutation_p.K1864E|CACNA1B_ENST00000277551.2_Missense_Mutation_p.K1865E|CACNA1B_ENST00000277549.5_Missense_Mutation_p.K1059E	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1865					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CGACTTCTACAAGCAGAACAA	0.527																																					p.K1865E		Atlas-SNP	.											.	CACNA1B	266	.	0			c.A5593G						.						52.0	48.0	49.0					9																	141008886		1922	4130	6052	SO:0001583	missense	774	exon40			TTCTACAAGCAGA	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5593A>G	chr9.hg19:g.141008886A>G	ENSP00000360423:p.Lys1865Glu	72.0	0.0		111.0	51.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	A	31	5.067602	0.93898	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	T;T;T;T;T;T	0.71817	-0.6;-0.6;-0.6;-0.6;-0.6;-0.6	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.82337	0.5015	M	0.63843	1.955	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.76071	0.987;0.987	D	0.84226	0.0464	10	0.87932	D	0	.	15.9983	0.80268	1.0:0.0:0.0:0.0	.	1864;1863	B1AQK7;B1AQK6	.;.	E	1865;1865;1059;1863;1864;1866	ENSP00000360423:K1865E;ENSP00000277551:K1865E;ENSP00000277549:K1059E;ENSP00000360414:K1863E;ENSP00000360408:K1864E;ENSP00000360406:K1866E	ENSP00000277549:K1059E	K	+	1	0	CACNA1B	140128707	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.910000	0.69931	2.171000	0.68590	0.533000	0.62120	AAG	.	.		0.527	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
MMS19	64210	hgsc.bcm.edu	37	10	99219816	99219816	+	Silent	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr10:99219816A>G	ENST00000438925.2	-	26	2978	c.2643T>C	c.(2641-2643)caT>caC	p.H881H	MMS19_ENST00000327238.10_Silent_p.H783H|MMS19_ENST00000370782.2_Silent_p.H881H|MMS19_ENST00000327277.7_3'UTR|MMS19_ENST00000355839.6_Silent_p.H838H	NM_022362.4	NP_071757.4	Q96T76	MMS19_HUMAN	MMS19 nucleotide excision repair homolog (S. cerevisiae)	881					cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|iron-sulfur cluster assembly (GO:0016226)|nucleotide-excision repair (GO:0006289)|phosphorelay signal transduction system (GO:0000160)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|membrane (GO:0016020)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)	estrogen receptor binding (GO:0030331)|protein binding, bridging (GO:0030674)|receptor signaling complex scaffold activity (GO:0030159)|transcription coactivator activity (GO:0003713)			endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|stomach(1)	16		Colorectal(252;0.0846)		Epithelial(162;3.33e-10)|all cancers(201;2.74e-08)		GGGGAGCAGCATGGAAGCCCT	0.537								Direct reversal of damage																													p.H881H		Atlas-SNP	.											.	MMS19	36	.	0			c.T2643C						.						96.0	92.0	94.0					10																	99219816		2203	4300	6503	SO:0001819	synonymous_variant	64210	exon26			AGCAGCATGGAAG	AF007151	CCDS7464.1, CCDS73177.1	10q24-q25	2007-08-15	2007-08-15	2007-08-15	ENSG00000155229	ENSG00000155229			13824	protein-coding gene	gene with protein product	"""MET18 homolog (S. cerevisiae)"""	614777		MMS19L		11071939	Standard	NM_022362		Approved	MET18, hMMS19	uc001kns.4	Q96T76	OTTHUMG00000018857	ENST00000438925.2:c.2643T>C	chr10.hg19:g.99219816A>G		136.0	0.0		143.0	55.0	NM_022362	B0QZ75|B3KPE5|B4DQX2|B4E2I3|D3DR55|F8W9Y2|Q17RZ8|Q5T455|Q66K82|Q7L4W8|Q969Z1|Q96DF1|Q96MR1|Q96RK5|Q96SK1|Q9BUE2|Q9BYS9	Silent	SNP	ENST00000438925.2	hg19	CCDS7464.1	.	.	.	.	.	.	.	.	.	.	A	7.438	0.640150	0.14386	.	.	ENSG00000155229	ENST00000434538	.	.	.	5.65	2.03	0.26663	.	.	.	.	.	T	0.57315	0.2045	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50329	-0.8841	4	.	.	.	.	8.4545	0.32890	0.6422:0.0:0.3578:0.0	.	.	.	.	T	456	.	.	M	-	2	0	MMS19	99209806	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.364000	0.34171	0.437000	0.26423	0.482000	0.46254	ATG	.	.		0.537	MMS19-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049706.2		
MMP21	118856	hgsc.bcm.edu	37	10	127456123	127456123	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr10:127456123A>G	ENST00000368808.3	-	6	1387	c.1388T>C	c.(1387-1389)aTt>aCt	p.I463T		NM_147191.1	NP_671724.1	Q8N119	MMP21_HUMAN	matrix metallopeptidase 21	463					hematopoietic progenitor cell differentiation (GO:0002244)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	16		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)			Marimastat(DB00786)	GAAGAAGTAAATTAACTTCTG	0.418																																					p.I463T		Atlas-SNP	.											.	MMP21	46	.	0			c.T1388C						.						109.0	107.0	107.0					10																	127456123		2203	4300	6503	SO:0001583	missense	118856	exon6			AAGTAAATTAACT	AF331526	CCDS7647.1	10q26.3	2008-07-28	2005-08-08		ENSG00000154485	ENSG00000154485			14357	protein-coding gene	gene with protein product		608416	"""matrix metalloproteinase 21"""			11255011	Standard	NM_147191		Approved		uc001liu.3	Q8N119	OTTHUMG00000019235	ENST00000368808.3:c.1388T>C	chr10.hg19:g.127456123A>G	ENSP00000357798:p.Ile463Thr	85.0	0.0		121.0	46.0	NM_147191	Q5VZP9|Q8NG02	Missense_Mutation	SNP	ENST00000368808.3	hg19	CCDS7647.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.912747	0.52439	.	.	ENSG00000154485	ENST00000368808	T	0.02121	4.44	5.75	5.75	0.90469	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.03915	0.0110	L	0.37561	1.115	0.53688	D	0.99997	D	0.53312	0.959	P	0.53313	0.723	T	0.47086	-0.9144	10	0.02654	T	1	-19.6822	14.0066	0.64468	1.0:0.0:0.0:0.0	.	463	Q8N119	MMP21_HUMAN	T	463	ENSP00000357798:I463T	ENSP00000357798:I463T	I	-	2	0	MMP21	127446113	1.000000	0.71417	0.977000	0.42913	0.533000	0.34776	5.951000	0.70273	2.195000	0.70347	0.533000	0.62120	ATT	.	.		0.418	MMP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050928.1		
DOCK1	1793	hgsc.bcm.edu	37	10	128835982	128835982	+	Splice_Site	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr10:128835982G>A	ENST00000280333.6	+	19	1958		c.e19-1			NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TCTGTTTCCAGTGGACCTTCT	0.443																																					.		Atlas-SNP	.											.	DOCK1	188	.	0			c.1850-1G>A						.						57.0	51.0	53.0					10																	128835982		1873	4103	5976	SO:0001630	splice_region_variant	1793	exon19			TTTCCAGTGGACC	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.1850-1G>A	chr10.hg19:g.128835982G>A		60.0	0.0		89.0	37.0	NM_001380	A9Z1Z5	Splice_Site	SNP	ENST00000280333.6	hg19		.	.	.	.	.	.	.	.	.	.	G	22.2	4.256376	0.80246	.	.	ENSG00000150760	ENST00000280333	.	.	.	4.73	4.73	0.59995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9241	0.88977	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK1	128725972	1.000000	0.71417	0.998000	0.56505	0.856000	0.48823	9.339000	0.96797	2.456000	0.83038	0.462000	0.41574	.	.	.		0.443	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	Intron
MKI67	4288	hgsc.bcm.edu	37	10	129914021	129914021	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr10:129914021T>A	ENST00000368654.3	-	7	1026	c.651A>T	c.(649-651)gaA>gaT	p.E217D	MKI67_ENST00000368653.3_Intron	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	217					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CAGACTTCAATTCTCCATAAC	0.393																																					p.E217D		Atlas-SNP	.											.	MKI67	363	.	0			c.A651T						.						91.0	90.0	90.0					10																	129914021		2203	4300	6503	SO:0001583	missense	4288	exon7			CTTCAATTCTCCA	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.651A>T	chr10.hg19:g.129914021T>A	ENSP00000357643:p.Glu217Asp	49.0	0.0		61.0	31.0	NM_002417	Q5VWH2	Missense_Mutation	SNP	ENST00000368654.3	hg19	CCDS7659.1	.	.	.	.	.	.	.	.	.	.	T	12.90	2.077529	0.36662	.	.	ENSG00000148773	ENST00000368654;ENST00000537609	T	0.22945	1.93	3.69	-1.77	0.07982	.	1.628700	0.03650	N	0.240821	T	0.14743	0.0356	N	0.17082	0.46	0.09310	N	1	B	0.24618	0.107	B	0.19946	0.027	T	0.20306	-1.0279	9	.	.	.	.	6.5656	0.22511	0.0:0.0917:0.4518:0.4565	.	217	P46013	KI67_HUMAN	D	217	ENSP00000357643:E217D	.	E	-	3	2	MKI67	129804011	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.305000	0.19254	-0.318000	0.08665	0.533000	0.62120	GAA	.	.		0.393	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
EPS8L2	64787	hgsc.bcm.edu	37	11	721563	721563	+	Splice_Site	SNP	A	A	T	rs111293076		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:721563A>T	ENST00000533256.1	+	11	1143		c.e11-1		EPS8L2_ENST00000318562.8_Splice_Site|EPS8L2_ENST00000530636.1_Splice_Site|EPS8L2_ENST00000526198.1_Splice_Site|AP006621.9_ENST00000527021.2_RNA			Q9H6S3	ES8L2_HUMAN	EPS8-like 2						positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of ruffle assembly (GO:1900029)|regulation of Rho protein signal transduction (GO:0035023)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|vesicle (GO:0031982)	actin binding (GO:0003779)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|pancreas(1)|prostate(2)|soft_tissue(1)|urinary_tract(1)	13		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.37e-27)|Epithelial(43;2.81e-26)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-20)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTCTGACCCCAGCAAATCCTC	0.652																																					.		Atlas-SNP	.											.	EPS8L2	42	.	0			c.769-2A>T						.						20.0	25.0	23.0					11																	721563		2184	4276	6460	SO:0001630	splice_region_variant	64787	exon10			GACCCCAGCAAAT	AF318331	CCDS31328.1	11p15.5	2008-02-05				ENSG00000177106			21296	protein-coding gene	gene with protein product		614988				12620401	Standard	NM_022772		Approved	FLJ21935, FLJ22171, MGC3088	uc001lqt.3	Q9H6S3		ENST00000533256.1:c.769-1A>T	chr11.hg19:g.721563A>T		154.0	0.0		247.0	118.0	NM_022772	B3KSX1|B7ZKL3|Q53GM8|Q8WYW7|Q96K06|Q9H6K9	Splice_Site	SNP	ENST00000533256.1	hg19	CCDS31328.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.842242	0.51057	.	.	ENSG00000177106	ENST00000318562;ENST00000533256;ENST00000530636;ENST00000526198	.	.	.	3.57	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.404	0.26981	0.8055:0.0:0.0:0.1945	.	.	.	.	.	-1	.	.	.	+	.	.	EPS8L2	711563	1.000000	0.71417	0.928000	0.36995	0.749000	0.42624	6.698000	0.74608	1.628000	0.50416	0.451000	0.29950	.	.	T|1.000		0.652	EPS8L2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382344.1	NM_022772	Intron
SMPD1	6609	hgsc.bcm.edu	37	11	6411942	6411942	+	Silent	SNP	G	G	C	rs550365194|rs550067660	byFrequency	TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:6411942G>C	ENST00000342245.4	+	1	282	c.114G>C	c.(112-114)gcG>gcC	p.A38A	SMPD1_ENST00000527275.1_Silent_p.A38A|SMPD1_ENST00000299397.3_Silent_p.A38A|SMPD1_ENST00000356761.2_Silent_p.A38A|SMPD1_ENST00000533196.1_3'UTR	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	38					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	tggtgctggcgctggcgctgg	0.706																																					p.A38A		Atlas-SNP	.											.	SMPD1	108	.	0			c.G114C						.						13.0	17.0	16.0					11																	6411942		2189	4262	6451	SO:0001819	synonymous_variant	6609	exon1			GCTGGCGCTGGCG	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.114G>C	chr11.hg19:g.6411942G>C		32.0	0.0		83.0	7.0	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Silent	SNP	ENST00000342245.4	hg19	CCDS44531.1																																																																																			.	.		0.706	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
OR5M11	219487	hgsc.bcm.edu	37	11	56310580	56310580	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:56310580C>T	ENST00000528616.2	-	1	177	c.154G>A	c.(154-156)Gac>Aac	p.D52N		NM_001005245.1	NP_001005245.1	Q96RB7	OR5MB_HUMAN	olfactory receptor, family 5, subfamily M, member 11	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D52Y(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(14)	18						AGGCGAGAGTCCAGTCTCATT	0.468																																					p.D52N		Atlas-SNP	.											OR5M11,NS,carcinoma,0,1	OR5M11	60	.	1	Substitution - Missense(1)	lung(1)	c.G154A						.						154.0	154.0	154.0					11																	56310580		2168	4280	6448	SO:0001583	missense	219487	exon1			GAGAGTCCAGTCT	AP002517	CCDS53629.1	11q11	2012-08-09				ENSG00000255223		"""GPCR / Class A : Olfactory receptors"""	15291	protein-coding gene	gene with protein product							Standard	NM_001005245		Approved	OR11-199	uc010rjl.2	Q96RB7		ENST00000528616.2:c.154G>A	chr11.hg19:g.56310580C>T	ENSP00000432417:p.Asp52Asn	92.0	0.0		140.0	69.0	NM_001005245	B2RNL5|B2RNL7	Missense_Mutation	SNP	ENST00000528616.2	hg19	CCDS53629.1	.	.	.	.	.	.	.	.	.	.	C	4.361	0.066493	0.08388	.	.	ENSG00000255223	ENST00000528616	T	0.02837	4.14	5.1	2.26	0.28386	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.04588	0.0125	M	0.73319	2.225	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.36016	-0.9765	9	0.30078	T	0.28	.	7.739	0.28831	0.0:0.6718:0.0:0.3282	.	52	Q96RB7	OR5MB_HUMAN	N	52	ENSP00000432417:D52N	ENSP00000432417:D52N	D	-	1	0	OR5M11	56067156	0.000000	0.05858	0.695000	0.30226	0.061000	0.15899	-0.087000	0.11215	0.362000	0.24319	-0.162000	0.13425	GAC	.	.		0.468	OR5M11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391608.1	NM_001005245	
OR9G1	390174	hgsc.bcm.edu	37	11	56468039	56468039	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:56468039A>G	ENST00000312153.1	+	1	176	c.176A>G	c.(175-177)tAt>tGt	p.Y59C		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	59						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						ACACCCATGTATTTTTTCACT	0.473																																					p.Y59C		Atlas-SNP	.											.	.	.	.	0			c.A176G						.						116.0	102.0	107.0					11																	56468039		2201	4296	6497	SO:0001583	missense	504191	exon1			CCATGTATTTTTT	AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.176A>G	chr11.hg19:g.56468039A>G	ENSP00000309012:p.Tyr59Cys	77.0	0.0		68.0	16.0	NM_001013358	Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	ENST00000312153.1	hg19	CCDS31536.1	.	.	.	.	.	.	.	.	.	.	A	15.73	2.918447	0.52546	.	.	ENSG00000174914	ENST00000312153	T	0.15718	2.4	4.54	4.54	0.55810	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000208	T	0.52403	0.1732	H	0.94964	3.605	0.48135	D	0.999595	D	0.89917	1.0	D	0.76071	0.987	T	0.67268	-0.5713	10	0.87932	D	0	-26.0348	13.988	0.64348	1.0:0.0:0.0:0.0	.	59	Q8NH87	OR9G1_HUMAN	C	59	ENSP00000309012:Y59C	ENSP00000309012:Y59C	Y	+	2	0	OR9G1	56224615	1.000000	0.71417	1.000000	0.80357	0.406000	0.30931	5.099000	0.64554	2.013000	0.59113	0.477000	0.44152	TAT	.	.		0.473	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393253.1	NM_001005213	
HRASLS5	117245	hgsc.bcm.edu	37	11	63257813	63257813	+	Silent	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:63257813A>G	ENST00000301790.4	-	2	330	c.171T>C	c.(169-171)ctT>ctC	p.L57L	HRASLS5_ENST00000540857.1_Intron|HRASLS5_ENST00000539221.1_Silent_p.L57L			Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	57							transferase activity, transferring acyl groups (GO:0016746)			endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	14						CTTCTAATTCAAGGGGGGAAA	0.557																																					p.L57L		Atlas-SNP	.											.	HRASLS5	28	.	0			c.T171C						.						145.0	159.0	154.0					11																	63257813		2201	4298	6499	SO:0001819	synonymous_variant	117245	exon2			TAATTCAAGGGGG	AJ416558	CCDS8044.1, CCDS53646.1, CCDS53647.1	11q13.2	2006-08-16			ENSG00000168004	ENSG00000168004			24978	protein-coding gene	gene with protein product		611474					Standard	NM_001146729		Approved	HRLP5	uc001nwy.2	Q96KN8	OTTHUMG00000167806	ENST00000301790.4:c.171T>C	chr11.hg19:g.63257813A>G		32.0	0.0		59.0	21.0	NM_001146728	B7X6T1|F5GZ87|F5H4Y9	Silent	SNP	ENST00000301790.4	hg19	CCDS8044.1																																																																																			.	.		0.557	HRASLS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396375.1	NM_054108	
CATSPER1	117144	hgsc.bcm.edu	37	11	65790380	65790380	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:65790380C>A	ENST00000312106.5	-	2	1506	c.1369G>T	c.(1369-1371)Gtc>Ttc	p.V457F		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	457					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						TTGAGGCAGACAACGAAGAAG	0.557											OREG0021092	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V457F		Atlas-SNP	.											.	CATSPER1	101	.	0			c.G1369T						.						104.0	99.0	101.0					11																	65790380		2201	4296	6497	SO:0001583	missense	117144	exon2			GGCAGACAACGAA	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.1369G>T	chr11.hg19:g.65790380C>A	ENSP00000309052:p.Val457Phe	94.0	0.0	1086	88.0	37.0	NM_053054	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	hg19	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033169	0.75504	.	.	ENSG00000175294	ENST00000312106	D	0.97831	-4.56	5.62	-2.72	0.05968	.	0.613850	0.12427	N	0.469938	D	0.97272	0.9108	L	0.46157	1.445	0.21355	N	0.999717	D	0.63880	0.993	D	0.67900	0.954	D	0.93655	0.6976	10	0.87932	D	0	-18.652	10.8032	0.46502	0.0:0.3494:0.0:0.6506	.	457	Q8NEC5	CTSR1_HUMAN	F	457	ENSP00000309052:V457F	ENSP00000309052:V457F	V	-	1	0	CATSPER1	65546956	0.309000	0.24518	0.003000	0.11579	0.114000	0.19823	0.411000	0.21115	-0.904000	0.03876	-0.471000	0.05019	GTC	.	.		0.557	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
PICALM	8301	hgsc.bcm.edu	37	11	85722082	85722082	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:85722082T>G	ENST00000393346.3	-	7	904	c.756A>C	c.(754-756)aaA>aaC	p.K252N	PICALM_ENST00000532317.1_Missense_Mutation_p.K252N|PICALM_ENST00000526033.1_Missense_Mutation_p.K252N|PICALM_ENST00000528398.1_Missense_Mutation_p.K201N|PICALM_ENST00000356360.5_Missense_Mutation_p.K252N			Q13492	PICAL_HUMAN	phosphatidylinositol binding clathrin assembly protein	252	Interaction with FAM64A.				axonogenesis (GO:0007409)|cargo loading into vesicle (GO:0035459)|cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|hemopoiesis (GO:0030097)|iron ion homeostasis (GO:0055072)|iron ion import into cell (GO:0097459)|negative regulation of gene expression (GO:0010629)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of receptor-mediated endocytosis (GO:0048261)|positive regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902961)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of neuron death (GO:1901216)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902959)|regulation of endocytosis (GO:0030100)|regulation of protein localization (GO:0032880)|synaptic vesicle maturation (GO:0016188)|vesicle-mediated transport (GO:0016192)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neurofibrillary tangle (GO:0097418)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|vesicle (GO:0031982)	1-phosphatidylinositol binding (GO:0005545)|clathrin adaptor activity (GO:0035615)|clathrin binding (GO:0030276)|clathrin heavy chain binding (GO:0032050)			endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	19		Acute lymphoblastic leukemia(157;7.42e-07)|all_hematologic(158;0.00092)				CCTCTGCAACTTTGAGGAACT	0.338			T	"""MLLT10, MLL"""	"""TALL, AML, """																																p.K252N		Atlas-SNP	.		Dom	yes		11	11q14	8301	phosphatidylinositol binding clathrin assembly protein (CALM)		L	.	PICALM	82	.	0			c.A756C						.						126.0	110.0	115.0					11																	85722082		2202	4298	6500	SO:0001583	missense	8301	exon7			TGCAACTTTGAGG	BC048259	CCDS8272.1, CCDS31653.1, CCDS55783.1, CCDS55784.1	11q14	2008-02-01			ENSG00000073921	ENSG00000073921			15514	protein-coding gene	gene with protein product		603025				8643484	Standard	NM_001206947		Approved	CALM, CLTH	uc001pbm.3	Q13492	OTTHUMG00000166981	ENST00000393346.3:c.756A>C	chr11.hg19:g.85722082T>G	ENSP00000377015:p.Lys252Asn	92.0	0.0		93.0	39.0	NM_007166	B4DTM3|E9PN05|F8VPG7|O60700|Q4LE54|Q6GMQ6|Q86XZ9	Missense_Mutation	SNP	ENST00000393346.3	hg19	CCDS8272.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.387462	0.82902	.	.	ENSG00000073921	ENST00000532317;ENST00000526033;ENST00000447890;ENST00000393346;ENST00000528398;ENST00000356360	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.48	4.34	0.51931	ANTH (1);Clathrin adaptor, phosphoinositide-binding, GAT-like (1);	0.000000	0.85682	D	0.000000	T	0.64918	0.2642	M	0.83692	2.655	0.80722	D	1	D;D;P;D	0.89917	1.0;0.99;0.551;0.996	D;D;P;D	0.87578	0.998;0.951;0.51;0.971	T	0.68792	-0.5315	9	.	.	.	-21.1179	11.9695	0.53055	0.0:0.0713:0.0:0.9287	.	201;252;252;252	E9PN05;F8VPG7;Q13492;Q13492-3	.;.;PICAL_HUMAN;.	N	252;252;252;252;201;252	ENSP00000436958:K252N;ENSP00000433846:K252N;ENSP00000377015:K252N;ENSP00000434884:K201N;ENSP00000348718:K252N	.	K	-	3	2	PICALM	85399730	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.539000	0.53604	2.197000	0.70478	0.533000	0.62120	AAA	.	.		0.338	PICALM-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392224.1	NM_007166	
DYNC2H1	79659	hgsc.bcm.edu	37	11	103156996	103156996	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:103156996A>G	ENST00000375735.2	+	74	11047	c.10903A>G	c.(10903-10905)Agt>Ggt	p.S3635G	DYNC2H1_ENST00000398093.3_Missense_Mutation_p.S3642G|DYNC2H1_ENST00000334267.7_Intron	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3635					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TGCTCTCCCCAGTCTTTATCA	0.338																																					p.S3642G		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.A10924G						.						200.0	203.0	202.0					11																	103156996		1865	4114	5979	SO:0001583	missense	79659	exon75			CTCCCCAGTCTTT	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.10903A>G	chr11.hg19:g.103156996A>G	ENSP00000364887:p.Ser3635Gly	53.0	0.0		70.0	27.0	NM_001080463	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.301971	0.23736	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.07800	3.16;3.16	5.41	-0.903	0.10534	Dynein heavy chain (1);	0.787654	0.10472	U	0.670691	T	0.06280	0.0162	L	0.36672	1.1	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41610	-0.9499	10	0.26408	T	0.33	.	6.6822	0.23127	0.3711:0.0:0.494:0.1349	.	3635;3642	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	G	3635;3642	ENSP00000364887:S3635G;ENSP00000381167:S3642G	ENSP00000364887:S3635G	S	+	1	0	DYNC2H1	102662206	0.003000	0.15002	0.203000	0.23512	0.953000	0.61014	-0.019000	0.12546	0.032000	0.15435	0.533000	0.62120	AGT	.	.		0.338	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
NCAM1	4684	hgsc.bcm.edu	37	11	113142501	113142501	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr11:113142501C>A	ENST00000316851.7	+	17	2329	c.2329C>A	c.(2329-2331)Ccc>Acc	p.P777T	NCAM1-AS1_ENST00000526229.1_RNA|NCAM1-AS1_ENST00000533638.1_RNA|NCAM1_ENST00000397957.4_3'UTR	NM_001242607.1|NM_181351.4	NP_001229536.1|NP_851996.2	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	787					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GTCCAAGGAGCCCATCGTGGA	0.592																																					p.P813T		Atlas-SNP	.											.	NCAM1	372	.	0			c.C2437A						.						69.0	79.0	76.0					11																	113142501		2058	4160	6218	SO:0001583	missense	4684	exon20			AAGGAGCCCATCG		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000316851.7:c.2329C>A	chr11.hg19:g.113142501C>A	ENSP00000318472:p.Pro777Thr	68.0	0.0		69.0	34.0	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000316851.7	hg19		.	.	.	.	.	.	.	.	.	.	C	25.9	4.682760	0.88542	.	.	ENSG00000149294	ENST00000531044;ENST00000316851;ENST00000433634	T	0.48201	0.82	5.83	5.83	0.93111	.	0.000000	0.85682	U	0.000000	T	0.72882	0.3516	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;0.988;0.995	D;P;P	0.87578	0.998;0.799;0.728	T	0.74870	-0.3517	9	0.72032	D	0.01	-24.8787	20.1152	0.97926	0.0:1.0:0.0:0.0	.	659;777;787	E9PLH7;P13591-1;P13591	.;.;NCAM1_HUMAN	T	659;777;242	ENSP00000318472:P777T	ENSP00000318472:P777T	P	+	1	0	NCAM1	112647711	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	6.070000	0.71220	2.750000	0.94351	0.655000	0.94253	CCC	.	.		0.592	NCAM1-201	KNOWN	basic	protein_coding	protein_coding		NM_000615	
WNT5B	81029	hgsc.bcm.edu	37	12	1755095	1755095	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:1755095G>C	ENST00000397196.2	+	5	989	c.757G>C	c.(757-759)Gcc>Ccc	p.A253P	WNT5B_ENST00000537031.1_Missense_Mutation_p.A253P|WNT5B_ENST00000542408.1_3'UTR|WNT5B_ENST00000310594.3_Missense_Mutation_p.A253P|WNT5B_ENST00000545747.1_3'UTR	NM_032642.2	NP_116031.1	Q9H1J7	WNT5B_HUMAN	wingless-type MMTV integration site family, member 5B	253					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fat cell differentiation (GO:0045444)|lens fiber cell development (GO:0070307)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuron differentiation (GO:0030182)|positive regulation of cell migration (GO:0030335)|positive regulation of fat cell differentiation (GO:0045600)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor binding (GO:0005102)			skin(1)	1	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00109)			CGACAGCGCGGCCGCCATGCG	0.697																																					p.A253P		Atlas-SNP	.											.	WNT5B	27	.	0			c.G757C						.						26.0	29.0	28.0					12																	1755095		2202	4299	6501	SO:0001583	missense	81029	exon5			AGCGCGGCCGCCA	AB060966	CCDS8510.1	12p13.3	2008-07-07			ENSG00000111186	ENSG00000111186		"""Wingless-type MMTV integration sites"""	16265	protein-coding gene	gene with protein product		606361				11445850	Standard	NM_030775		Approved		uc001qjk.3	Q9H1J7	OTTHUMG00000090375	ENST00000397196.2:c.757G>C	chr12.hg19:g.1755095G>C	ENSP00000380379:p.Ala253Pro	32.0	0.0		44.0	14.0	NM_032642	A8K315|D3DUP9|Q96S49|Q9BV04	Missense_Mutation	SNP	ENST00000397196.2	hg19	CCDS8510.1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.862399	0.71949	.	.	ENSG00000111186	ENST00000537031;ENST00000310594;ENST00000397196;ENST00000543071	T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03	5.14	5.14	0.70334	.	0.048696	0.85682	D	0.000000	D	0.86628	0.5978	M	0.69358	2.11	0.80722	D	1	D	0.60160	0.987	D	0.65573	0.936	D	0.86836	0.2014	10	0.54805	T	0.06	.	18.8	0.92013	0.0:0.0:1.0:0.0	.	253	Q9H1J7	WNT5B_HUMAN	P	253	ENSP00000439312:A253P;ENSP00000308887:A253P;ENSP00000380379:A253P;ENSP00000442348:A253P	ENSP00000308887:A253P	A	+	1	0	WNT5B	1625356	1.000000	0.71417	0.463000	0.27130	0.531000	0.34715	7.652000	0.83633	2.668000	0.90789	0.650000	0.86243	GCC	.	.		0.697	WNT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206747.2		
MLF2	8079	hgsc.bcm.edu	37	12	6859471	6859472	+	Splice_Site	DNP	CC	CC	AG			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:6859471_6859472CC>AG	ENST00000203630.5	-	6	915	c.271_271GG>CT	c.(271-273)GGga>CTgga	p.G91L	MLF2_ENST00000539187.1_Splice_Site_p.G91L|MLF2_ENST00000435120.1_Splice_Site_p.G91L|MLF2_ENST00000564181.1_5'Flank|MLF2_ENST00000542154.1_Splice_Site_p.G91L			Q15773	MLF2_HUMAN	myeloid leukemia factor 2	91					defense response (GO:0006952)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				kidney(2)|large_intestine(3)|lung(4)	9						GTCATGTGTTCCTGAGGACAGG	0.545																																					p.E91X|.		Atlas-SNP	.											.	MLF2	26	.	0			c.G271T|c.271-1G>C						.																																			SO:0001630	splice_region_variant	8079	exon6|exon7			TGTGTTCCTGAGG|GTGTTCCTGAGGA	U57342	CCDS8559.1	12p13.31	2014-09-11			ENSG00000089693	ENSG00000089693			7126	protein-coding gene	gene with protein product		601401				8661158	Standard	NM_005439		Approved	NTN4	uc010sfi.2	Q15773	OTTHUMG00000168717	ENST00000203630.5:c.271_271delinsAG	chr12.hg19:g.6859471_6859472delinsAG		48.0	0.0		51.0	23.0|22.0	NM_005439		Nonsense_Mutation|Splice_Site	SNP	ENST00000203630.5	hg19	CCDS8559.1																																																																																			.	.		0.545	MLF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400733.2		Missense_Mutation
A2ML1	144568	hgsc.bcm.edu	37	12	9004828	9004828	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:9004828C>T	ENST00000299698.7	+	20	2666	c.2486C>T	c.(2485-2487)tCg>tTg	p.S829L	A2ML1_ENST00000539547.1_Missense_Mutation_p.S338L	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						CTGGCTAAATCGCATGAGTAC	0.498																																					p.S829L		Atlas-SNP	.											.	A2ML1	199	.	0			c.C2486T						.						248.0	234.0	239.0					12																	9004828		1939	4164	6103	SO:0001583	missense	144568	exon20			CTAAATCGCATGA	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.2486C>T	chr12.hg19:g.9004828C>T	ENSP00000299698:p.Ser829Leu	92.0	0.0		97.0	8.0	NM_144670		Missense_Mutation	SNP	ENST00000299698.7	hg19	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	C	16.43	3.122517	0.56613	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547	T;T;T	0.16597	2.33;2.33;2.33	3.08	3.08	0.35506	.	0.652197	0.12736	N	0.443418	T	0.41558	0.1164	M	0.91612	3.225	0.09310	N	1	D	0.64830	0.994	P	0.53062	0.717	T	0.38607	-0.9653	10	0.54805	T	0.06	.	13.9246	0.63955	0.0:1.0:0.0:0.0	.	829	A8K2U0	A2ML1_HUMAN	L	829;829;379;338	ENSP00000299698:S829L;ENSP00000443174:S379L;ENSP00000438292:S338L	ENSP00000299698:S829L	S	+	2	0	A2ML1	8896095	0.005000	0.15991	0.009000	0.14445	0.001000	0.01503	0.951000	0.29135	2.025000	0.59659	0.442000	0.29010	TCG	.	.		0.498	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	
PDE1B	5153	hgsc.bcm.edu	37	12	54969802	54969802	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:54969802A>T	ENST00000243052.3	+	13	1730	c.1294A>T	c.(1294-1296)Aca>Tca	p.T432S	PDE1B_ENST00000394277.3_3'UTR|PPP1R1A_ENST00000547431.1_3'UTR|PDE1B_ENST00000550620.1_Missense_Mutation_p.T412S|PDE1B_ENST00000538346.1_Missense_Mutation_p.T391S	NM_000924.3	NP_000915.1	Q01064	PDE1B_HUMAN	phosphodiesterase 1B, calmodulin-dependent	432	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cGMP catabolic process (GO:0046069)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|monocyte differentiation (GO:0030224)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of dopamine metabolic process (GO:0042053)|regulation of neurotransmitter levels (GO:0001505)|response to amphetamine (GO:0001975)|serotonin metabolic process (GO:0042428)|signal transduction (GO:0007165)|visual learning (GO:0008542)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|calcium- and calmodulin-regulated 3',5'-cyclic-GMP phosphodiesterase activity (GO:0048101)|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			endometrium(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(4)	31					Bepridil(DB01244)|Caffeine(DB00201)|Felodipine(DB01023)|Nicardipine(DB00622)	TGTGGAGCCCACATTCTCTGT	0.547																																					p.T432S		Atlas-SNP	.											.	PDE1B	76	.	0			c.A1294T						.						146.0	142.0	144.0					12																	54969802		2203	4300	6503	SO:0001583	missense	5153	exon13			GAGCCCACATTCT	U56976	CCDS8882.1, CCDS53800.1, CCDS73477.1	12q13	2008-03-18				ENSG00000123360	3.1.4.17	"""Phosphodiesterases"""	8775	protein-coding gene	gene with protein product		171891		PDES1B		8855339, 9419816	Standard	NM_000924		Approved		uc001sgd.2	Q01064	OTTHUMG00000169844	ENST00000243052.3:c.1294A>T	chr12.hg19:g.54969802A>T	ENSP00000243052:p.Thr432Ser	72.0	0.0		59.0	23.0	NM_000924	Q92825|Q96KP3	Missense_Mutation	SNP	ENST00000243052.3	hg19	CCDS8882.1	.	.	.	.	.	.	.	.	.	.	A	16.37	3.104221	0.56291	.	.	ENSG00000123360	ENST00000243052;ENST00000538346;ENST00000550620	D;D;D	0.81821	-1.54;-1.54;-1.54	4.95	4.95	0.65309	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.74336	0.3703	N	0.13198	0.31	0.80722	D	1	P;B	0.38110	0.618;0.443	P;P	0.50378	0.584;0.639	T	0.69822	-0.5041	10	0.14252	T	0.57	.	12.8837	0.58032	1.0:0.0:0.0:0.0	.	412;432	Q01064-2;Q01064	.;PDE1B_HUMAN	S	432;391;412	ENSP00000243052:T432S;ENSP00000442559:T391S;ENSP00000448519:T412S	ENSP00000243052:T432S	T	+	1	0	PDE1B	53256069	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	9.115000	0.94336	1.984000	0.57885	0.533000	0.62120	ACA	.	.		0.547	PDE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406203.1		
PAN2	9924	hgsc.bcm.edu	37	12	56720131	56720131	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:56720131T>A	ENST00000425394.2	-	8	1701	c.1325A>T	c.(1324-1326)tAt>tTt	p.Y442F	PAN2_ENST00000257931.5_Missense_Mutation_p.Y442F|PAN2_ENST00000440411.3_Missense_Mutation_p.Y442F|PAN2_ENST00000548043.1_Missense_Mutation_p.Y442F	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	ATTGGGCGCATAGCCAATGAA	0.547																																					p.Y442F		Atlas-SNP	.											.	PAN2	107	.	0			c.A1325T						.						50.0	43.0	45.0					12																	56720131		2203	4300	6503	SO:0001583	missense	9924	exon8			GGCGCATAGCCAA	AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1325A>T	chr12.hg19:g.56720131T>A	ENSP00000401721:p.Tyr442Phe	74.0	0.0		120.0	48.0	NM_014871		Missense_Mutation	SNP	ENST00000425394.2	hg19	CCDS44922.1	.	.	.	.	.	.	.	.	.	.	t	34	5.303289	0.95601	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.33438	1.43;1.44;1.41;1.43	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.53384	0.1793	M	0.69358	2.11	0.58432	D	0.999999	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.955;0.997	T	0.55592	-0.8117	10	0.56958	D	0.05	-13.1945	14.2558	0.66051	0.0:0.0:0.0:1.0	.	442;442;442	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	F	442	ENSP00000401721:Y442F;ENSP00000388231:Y442F;ENSP00000257931:Y442F;ENSP00000449861:Y442F	ENSP00000257931:Y442F	Y	-	2	0	PAN2	55006398	1.000000	0.71417	0.980000	0.43619	0.939000	0.58152	7.873000	0.87193	2.071000	0.62044	0.473000	0.43528	TAT	.	.		0.547	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409024.1	NM_014871	
LRIG3	121227	hgsc.bcm.edu	37	12	59307787	59307787	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:59307787G>A	ENST00000320743.3	-	3	645	c.359C>T	c.(358-360)tCg>tTg	p.S120L	LRIG3_ENST00000379141.4_Missense_Mutation_p.S60L	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	120					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			AATATTTGCCGAGACTGGTCC	0.388			T	ROS1	NSCLC																																p.S120L		Atlas-SNP	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.C359T						.						107.0	108.0	108.0					12																	59307787		2203	4300	6503	SO:0001583	missense	121227	exon3			TTTGCCGAGACTG	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.359C>T	chr12.hg19:g.59307787G>A	ENSP00000326759:p.Ser120Leu	51.0	0.0		68.0	22.0	NM_153377	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	hg19	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	G	13.76	2.334663	0.41297	.	.	ENSG00000139263	ENST00000379141;ENST00000320743;ENST00000552267	T;T;T	0.40756	2.06;2.12;1.02	5.85	5.85	0.93711	.	0.260402	0.20444	N	0.092226	T	0.44201	0.1282	M	0.66939	2.045	0.43698	D	0.996155	B;B	0.32781	0.001;0.384	B;B	0.24974	0.007;0.057	T	0.32771	-0.9894	9	.	.	.	.	20.1731	0.98165	0.0:0.0:1.0:0.0	.	60;120	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	L	60;120;27	ENSP00000368436:S60L;ENSP00000326759:S120L;ENSP00000449109:S27L	.	S	-	2	0	LRIG3	57594054	1.000000	0.71417	0.446000	0.26920	0.093000	0.18481	7.552000	0.82192	2.768000	0.95171	0.655000	0.94253	TCG	.	.		0.388	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
C12orf43	64897	hgsc.bcm.edu	37	12	121448715	121448715	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:121448715T>A	ENST00000288757.3	-	3	225	c.203A>T	c.(202-204)gAg>gTg	p.E68V	C12orf43_ENST00000537817.1_Missense_Mutation_p.E69V|C12orf43_ENST00000366211.2_Missense_Mutation_p.E26V|C12orf43_ENST00000536407.2_Missense_Mutation_p.E68V|C12orf43_ENST00000539736.1_Missense_Mutation_p.E68V|C12orf43_ENST00000445832.3_Missense_Mutation_p.E38V	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43	68										cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TTGTTCATGCTCATTCACCTT	0.542																																					p.E68V		Atlas-SNP	.											.	C12orf43	30	.	0			c.A203T						.						220.0	186.0	197.0					12																	121448715		2203	4300	6503	SO:0001583	missense	64897	exon3			TCATGCTCATTCA	AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150	ENST00000288757.3:c.203A>T	chr12.hg19:g.121448715T>A	ENSP00000288757:p.Glu68Val	118.0	0.0		147.0	56.0	NM_022895	Q53HF0|Q9H9Z7	Missense_Mutation	SNP	ENST00000288757.3	hg19	CCDS9210.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	17.23|17.23|17.23	3.336842|3.336842|3.336842	0.60963|0.60963|0.60963	.|.|.	.|.|.	ENSG00000157895|ENSG00000157895|ENSG00000157895	ENST00000445832;ENST00000288757;ENST00000537817;ENST00000366211;ENST00000539736;ENST00000535367|ENST00000546272|ENST00000536407	T;T;T;T|.|.	0.47177|.|.	0.85;0.85;0.85;0.85|.|.	5.53|5.53|5.53	5.53|5.53|5.53	0.82687|0.82687|0.82687	.|.|.	0.595405|.|.	0.19292|.|.	N|.|.	0.117871|.|.	T|T|.	0.47801|0.47801|.	0.1465|0.1465|.	M|M|M	0.64997|0.64997|0.64997	1.995|1.995|1.995	0.26468|0.26468|0.26468	N|N|N	0.975334|0.975334|0.975334	D;D;D;D;D|.|.	0.67145|.|.	0.996;0.996;0.996;0.996;0.996|.|.	P;P;P;P;P|.|.	0.62298|.|.	0.857;0.857;0.9;0.773;0.9|.|.	T|T|.	0.47459|0.47459|.	-0.9116|-0.9116|.	10|5|.	0.72032|.|.	D|.|.	0.01|.|.	-16.1759|-16.1759|-16.1759	8.2172|8.2172|8.2172	0.31519|0.31519|0.31519	0.0:0.153:0.0:0.847|0.0:0.153:0.0:0.847|0.0:0.153:0.0:0.847	.|.|.	68;26;69;68;68|.|.	G5EA44;F6TFQ5;F5H7W8;B4DWJ9;Q96C57|.|.	.;.;.;.;CL043_HUMAN|.|.	V|C|C	38;68;69;26;68;22|21|72	ENSP00000409788:E38V;ENSP00000288757:E68V;ENSP00000442224:E69V;ENSP00000437803:E68V|.|.	ENSP00000288757:E68V|.|.	E|S|X	-|-|-	2|1|3	0|0|0	C12orf43|C12orf43|C12orf43	119933098|119933098|119933098	0.970000|0.970000|0.970000	0.33590|0.33590|0.33590	0.807000|0.807000|0.807000	0.32361|0.32361|0.32361	0.710000|0.710000|0.710000	0.40934|0.40934|0.40934	2.059000|2.059000|2.059000	0.41384|0.41384|0.41384	2.112000|2.112000|2.112000	0.64535|0.64535|0.64535	0.460000|0.460000|0.460000	0.39030|0.39030|0.39030	GAG|AGC|TGA	.	.		0.542	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022895	
SCARB1	949	hgsc.bcm.edu	37	12	125299561	125299561	+	Silent	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:125299561G>A	ENST00000415380.2	-	3	509	c.384C>T	c.(382-384)ggC>ggT	p.G128G	SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000339570.5_Silent_p.G128G|SCARB1_ENST00000544327.1_Silent_p.G74G|SCARB1_ENST00000376788.1_Intron|SCARB1_ENST00000540495.1_Silent_p.G91G|SCARB1_ENST00000261693.6_Silent_p.G128G|SCARB1_ENST00000546215.1_Silent_p.G128G|SCARB1_ENST00000541205.1_Silent_p.G87G			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	128					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	CGCTCTCCGAGCCGTGGGACT	0.607																																					p.G128G		Atlas-SNP	.											.	SCARB1	40	.	0			c.C384T						.						295.0	216.0	243.0					12																	125299561		2203	4300	6503	SO:0001819	synonymous_variant	949	exon3			CTCCGAGCCGTGG	Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.384C>T	chr12.hg19:g.125299561G>A		82.0	0.0		123.0	5.0	NM_005505	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Silent	SNP	ENST00000415380.2	hg19																																																																																				.	.		0.607	SCARB1-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000400165.1	NM_005505	
ATP12A	479	hgsc.bcm.edu	37	13	25255721	25255721	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr13:25255721G>A	ENST00000381946.3	+	2	198	c.31G>A	c.(31-33)Gtg>Atg	p.V11M	ATP12A_ENST00000218548.6_Missense_Mutation_p.V11M			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	11					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AATTTACTCCGTGGAGCTCAG	0.517																																					p.V11M	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.G31A						.						64.0	66.0	66.0					13																	25255721		2203	4300	6503	SO:0001583	missense	479	exon2			TACTCCGTGGAGC	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.31G>A	chr13.hg19:g.25255721G>A	ENSP00000371372:p.Val11Met	225.0	0.0		261.0	14.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	hg19	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	G	15.07	2.723645	0.48728	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.93659	-3.26;-3.26	5.21	4.29	0.51040	.	4.421500	0.00604	N	0.000384	D	0.92241	0.7539	N	0.08118	0	0.38326	D	0.943652	D;D	0.64830	0.994;0.977	P;P	0.58928	0.848;0.483	D	0.85080	0.0945	10	0.66056	D	0.02	.	10.5599	0.45140	0.1008:0.0:0.8992:0.0	.	11;11	P54707-2;P54707	.;AT12A_HUMAN	M	11	ENSP00000218548:V11M;ENSP00000371372:V11M	ENSP00000218548:V11M	V	+	1	0	ATP12A	24153721	0.983000	0.35010	0.996000	0.52242	0.264000	0.26372	1.860000	0.39428	2.716000	0.92895	0.650000	0.86243	GTG	.	.		0.517	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
KLHL1	57626	hgsc.bcm.edu	37	13	70314528	70314528	+	Silent	SNP	G	G	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr13:70314528G>T	ENST00000377844.4	-	8	2559	c.1800C>A	c.(1798-1800)ggC>ggA	p.G600G	KLHL1_ENST00000545028.1_Silent_p.G407G	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	600					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		TTACTTACTTGCCATTCAATG	0.313																																					p.G600G		Atlas-SNP	.											.	KLHL1	164	.	0			c.C1800A						.						57.0	51.0	53.0					13																	70314528		2203	4299	6502	SO:0001819	synonymous_variant	57626	exon8			TTACTTGCCATTC	AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1800C>A	chr13.hg19:g.70314528G>T		56.0	0.0		51.0	34.0	NM_020866	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Silent	SNP	ENST00000377844.4	hg19	CCDS9445.1																																																																																			.	.		0.313	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045231.3	NM_020866	
RTN1	6252	hgsc.bcm.edu	37	14	60212848	60212848	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr14:60212848T>A	ENST00000267484.5	-	2	928	c.593A>T	c.(592-594)gAc>gTc	p.D198V		NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	198					neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)		p.D198G(1)		central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		TCTGGTTATGTCAATGTATTT	0.448																																					p.D198V		Atlas-SNP	.											RTN1,NS,carcinoma,0,1	RTN1	139	.	1	Substitution - Missense(1)	kidney(1)	c.A593T						.						230.0	225.0	227.0					14																	60212848		2203	4300	6503	SO:0001583	missense	6252	exon2			GTTATGTCAATGT	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.593A>T	chr14.hg19:g.60212848T>A	ENSP00000267484:p.Asp198Val	108.0	0.0		107.0	26.0	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	hg19	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	T	19.92	3.917192	0.73098	.	.	ENSG00000139970	ENST00000267484;ENST00000433623	T	0.39592	1.07	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.66557	0.2801	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71111	-0.4687	10	0.87932	D	0	.	15.9506	0.79830	0.0:0.0:0.0:1.0	.	198	Q16799	RTN1_HUMAN	V	198;124	ENSP00000267484:D198V	ENSP00000267484:D198V	D	-	2	0	RTN1	59282601	1.000000	0.71417	0.992000	0.48379	0.839000	0.47603	5.887000	0.69751	2.171000	0.68590	0.455000	0.32223	GAC	.	.		0.448	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		
OR4M2	390538	hgsc.bcm.edu	37	15	22368845	22368845	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr15:22368845G>C	ENST00000332663.2	+	1	368	c.270G>C	c.(268-270)aaG>aaC	p.K90N	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		TGGAGAGGAAGATAATTTCTT	0.438																																					p.K90N		Atlas-SNP	.											.	OR4M2	140	.	0			c.G270C						.						344.0	292.0	309.0					15																	22368845		2203	4300	6503	SO:0001583	missense	390538	exon1			GAGGAAGATAATT	AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.270G>C	chr15.hg19:g.22368845G>C	ENSP00000329467:p.Lys90Asn	180.0	0.0		175.0	55.0	NM_001004719	B9EH16|Q6IEY2	Missense_Mutation	SNP	ENST00000332663.2	hg19	CCDS32172.1	.	.	.	.	.	.	.	.	.	.	.	13.71	2.317630	0.40996	.	.	ENSG00000182974	ENST00000332663	T	0.38240	1.15	2.5	2.5	0.30297	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000142	T	0.55784	0.1942	M	0.76170	2.325	0.09310	N	1	D	0.89917	1.0	D	0.76071	0.987	T	0.43686	-0.9376	10	0.66056	D	0.02	-11.6614	10.8078	0.46529	0.0:0.0:1.0:0.0	.	90	Q8NGB6	OR4M2_HUMAN	N	90	ENSP00000329467:K90N	ENSP00000329467:K90N	K	+	3	2	OR4M2	19870209	0.004000	0.15560	0.953000	0.39169	0.939000	0.58152	-0.116000	0.10724	1.422000	0.47177	0.448000	0.29417	AAG	.	.		0.438	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414921.1		
APBA2	321	hgsc.bcm.edu	37	15	29346270	29346270	+	Silent	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr15:29346270G>A	ENST00000558402.1	+	5	782	c.183G>A	c.(181-183)caG>caA	p.Q61Q	APBA2_ENST00000558330.1_Silent_p.Q61Q|APBA2_ENST00000558259.1_Silent_p.Q61Q|APBA2_ENST00000561069.1_Silent_p.Q61Q|APBA2_ENST00000411764.1_Silent_p.Q61Q			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	61					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CAGAGGAACAGGAGTGCCACA	0.657																																					p.Q61Q		Atlas-SNP	.											.	APBA2	132	.	0			c.G183A						.						71.0	82.0	78.0					15																	29346270		2203	4300	6503	SO:0001819	synonymous_variant	321	exon3			GGAACAGGAGTGC	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.183G>A	chr15.hg19:g.29346270G>A		129.0	0.0		221.0	110.0	NM_005503	E9PGI4|O60571|Q5XKC0	Silent	SNP	ENST00000558402.1	hg19	CCDS10022.1																																																																																			.	.		0.657	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
KNSTRN	90417	hgsc.bcm.edu	37	15	40675151	40675151	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr15:40675151C>T	ENST00000249776.8	+	1	230	c.115C>T	c.(115-117)Cag>Tag	p.Q39*	KNSTRN_ENST00000416151.2_Nonsense_Mutation_p.Q39*|KNSTRN_ENST00000608100.1_5'UTR|KNSTRN_ENST00000448395.2_Nonsense_Mutation_p.Q39*	NM_033286.3	NP_150628.3			kinetochore-localized astrin/SPAG5 binding protein																		ATTTGAAACCCAGGCGGCCGA	0.592																																					p.Q39X		Atlas-SNP	.											.	.	.	.	0			c.C115T						.						53.0	59.0	57.0					15																	40675151		1852	4094	5946	SO:0001587	stop_gained	90417	exon1			GAAACCCAGGCGG	AK027408	CCDS42021.1, CCDS45226.1, CCDS45227.1	15q15.1	2013-01-17	2012-12-04	2012-12-04	ENSG00000128944	ENSG00000128944			30767	protein-coding gene	gene with protein product	"""small kinetochore-associated protein"", ""kinetochore-localized astrin-binding protein"", ""TRAF4 associated factor 1"""	614718	"""chromosome 15 open reading frame 23"""	C15orf23		12477932	Standard	NM_033286		Approved	FLJ14502, SKAP, kinastrin, TRAF4AF1	uc001zll.3	Q9Y448	OTTHUMG00000172454	ENST00000249776.8:c.115C>T	chr15.hg19:g.40675151C>T	ENSP00000249776:p.Gln39*	63.0	0.0		105.0	42.0	NM_033286		Nonsense_Mutation	SNP	ENST00000249776.8	hg19	CCDS42021.1	.	.	.	.	.	.	.	.	.	.	C	16.16	3.043118	0.55003	.	.	ENSG00000128944	ENST00000249776;ENST00000416151;ENST00000448395	.	.	.	4.77	0.634	0.17718	.	1.943820	0.02223	N	0.064168	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	-1.5582	14.7288	0.69365	0.0:0.4704:0.5296:0.0	.	.	.	.	X	39	.	ENSP00000249776:Q39X	Q	+	1	0	C15orf23	38462443	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.133000	0.10451	0.036000	0.15547	-0.128000	0.14901	CAG	.	.		0.592	KNSTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418636.1	NM_001142761	
SPG11	80208	hgsc.bcm.edu	37	15	44876651	44876651	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr15:44876651T>C	ENST00000261866.7	-	30	5243	c.5227A>G	c.(5227-5229)Att>Gtt	p.I1743V	SPG11_ENST00000535302.2_Missense_Mutation_p.I1743V|SPG11_ENST00000558319.1_Missense_Mutation_p.I1743V|SPG11_ENST00000427534.2_Missense_Mutation_p.I1743V|SPG11_ENST00000558253.1_5'Flank	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	1743					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		TTGCTTGAAATTGAATTTTTC	0.438																																					p.I1743V		Atlas-SNP	.											.	SPG11	207	.	0			c.A5227G						.						49.0	55.0	53.0					15																	44876651		2198	4298	6496	SO:0001583	missense	80208	exon30			TTGAAATTGAATT		CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.5227A>G	chr15.hg19:g.44876651T>C	ENSP00000261866:p.Ile1743Val	103.0	0.0		92.0	50.0	NM_025137	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	ENST00000261866.7	hg19	CCDS10112.1	.	.	.	.	.	.	.	.	.	.	T	1.527	-0.545263	0.04024	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.74106	-0.81;-0.55;-0.55	5.74	-1.91	0.07641	.	0.538736	0.20039	N	0.100560	T	0.52709	0.1751	N	0.26130	0.795	0.80722	D	1	B;B;B;B	0.10296	0.003;0.002;0.003;0.003	B;B;B;B	0.09377	0.003;0.004;0.003;0.003	T	0.47711	-0.9096	10	0.05620	T	0.96	.	11.9132	0.52751	0.0:0.5039:0.0:0.4961	.	1743;1743;1743;1743	C4B7M2;F5H3N6;C4B7M4;Q96JI7	.;.;.;SPTCS_HUMAN	V	1743	ENSP00000261866:I1743V;ENSP00000445278:I1743V;ENSP00000396110:I1743V	ENSP00000261866:I1743V	I	-	1	0	SPG11	42663943	0.528000	0.26314	0.969000	0.41365	0.310000	0.27922	0.030000	0.13688	-0.360000	0.08138	0.455000	0.32223	ATT	.	.		0.438	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253927.1		
DUOX2	50506	hgsc.bcm.edu	37	15	45404147	45404147	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr15:45404147T>C	ENST00000603300.1	-	5	534	c.332A>G	c.(331-333)cAt>cGt	p.H111R	DUOXA2_ENST00000323030.5_5'Flank|DUOX2_ENST00000389039.6_Missense_Mutation_p.H111R	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	111	Peroxidase-like; mediates peroxidase activity. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GGAAAGAACATGGTAGCCTGC	0.642																																					p.H111R		Atlas-SNP	.											.	DUOX2	137	.	0			c.A332G						.						27.0	27.0	27.0					15																	45404147		2198	4298	6496	SO:0001583	missense	50506	exon5			AGAACATGGTAGC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.332A>G	chr15.hg19:g.45404147T>C	ENSP00000475084:p.His111Arg	156.0	0.0		191.0	90.0	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	hg19	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294574	0.81025	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.22	4.06	0.47325	.	0.000000	0.85682	D	0.000000	T	0.78991	0.4371	M	0.87038	2.855	0.80722	D	1	D	0.58970	0.984	D	0.65684	0.937	T	0.80334	-0.1426	9	0.56958	D	0.05	-27.9211	11.3871	0.49791	0.0:0.0:0.1517:0.8483	.	111	Q9NRD8	DUOX2_HUMAN	R	111	.	ENSP00000373691:H111R	H	-	2	0	DUOX2	43191439	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.980000	0.88113	0.800000	0.34041	0.459000	0.35465	CAT	.	.		0.642	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
CRTC3	64784	hgsc.bcm.edu	37	15	91181991	91181991	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr15:91181991C>T	ENST00000268184.6	+	13	1496	c.1492C>T	c.(1492-1494)Cca>Tca	p.P498S	CRTC3_ENST00000420329.2_Missense_Mutation_p.P498S|RP11-387D10.2_ENST00000559531.1_RNA			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	498					energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			CAACTTCTTCCCAGATGTGGG	0.522			T	MAML2	salivary gland mucoepidermoid																																p.P498S		Atlas-SNP	.		Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	.	CRTC3	47	.	0			c.C1492T						.						126.0	114.0	118.0					15																	91181991		2198	4298	6496	SO:0001583	missense	64784	exon13			TTCTTCCCAGATG		CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.1492C>T	chr15.hg19:g.91181991C>T	ENSP00000268184:p.Pro498Ser	87.0	0.0		93.0	40.0	NM_022769	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Missense_Mutation	SNP	ENST00000268184.6	hg19	CCDS32331.1	.	.	.	.	.	.	.	.	.	.	C	8.575	0.880977	0.17467	.	.	ENSG00000140577	ENST00000437186;ENST00000268184;ENST00000420329	T;T	0.11277	2.8;2.79	5.46	4.54	0.55810	.	0.763029	0.13278	N	0.399945	T	0.08088	0.0202	L	0.35414	1.06	0.28992	N	0.888007	B;B	0.09022	0.001;0.002	B;B	0.10450	0.002;0.005	T	0.31110	-0.9955	10	0.06625	T	0.88	-4.4159	10.3229	0.43777	0.0:0.9111:0.0:0.0889	.	498;498	Q6UUV7;Q6UUV7-3	CRTC3_HUMAN;.	S	462;498;498	ENSP00000268184:P498S;ENSP00000416573:P498S	ENSP00000268184:P498S	P	+	1	0	CRTC3	88982995	0.902000	0.30710	0.940000	0.37924	0.788000	0.44548	1.938000	0.40203	1.545000	0.49373	0.591000	0.81541	CCA	.	.		0.522	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417716.2	NM_022769	
SLX4	84464	hgsc.bcm.edu	37	16	3647563	3647563	+	Silent	SNP	C	C	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr16:3647563C>A	ENST00000294008.3	-	7	2140	c.1500G>T	c.(1498-1500)acG>acT	p.T500T		NM_032444.2	NP_115820.2	Q8IY92	SLX4_HUMAN	SLX4 structure-specific endonuclease subunit	500	Interaction with SLX4IP, ERCC4 and MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|positive regulation of catalytic activity (GO:0043085)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|Slx1-Slx4 complex (GO:0033557)	5'-flap endonuclease activity (GO:0017108)|enzyme activator activity (GO:0008047)			breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	76						GAAGTGGTGGCGTGCTAGACA	0.572								Direct reversal of damage																													p.T500T		Atlas-SNP	.											.	SLX4	173	.	0			c.G1500T						.						78.0	76.0	77.0					16																	3647563		2197	4300	6497	SO:0001819	synonymous_variant	84464	exon7			TGGTGGCGTGCTA	AB058687	CCDS10506.2	16p13.3	2014-09-17	2013-06-05	2010-09-13	ENSG00000188827	ENSG00000188827		"""Fanconi anemia, complementation groups"", ""BTB/POZ domain containing"""	23845	protein-coding gene	gene with protein product	"""Fanconi anemia, complementation group P"""	613278	"""BTB (POZ) domain containing 12"", ""SLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)"""	BTBD12		11347906, 19595721	Standard	NM_032444		Approved	KIAA1784, KIAA1987, FANCP	uc002cvp.2	Q8IY92	OTTHUMG00000074089	ENST00000294008.3:c.1500G>T	chr16.hg19:g.3647563C>A		92.0	0.0		111.0	53.0	NM_032444	Q69YT8|Q8TF15|Q96JP1	Silent	SNP	ENST00000294008.3	hg19	CCDS10506.2																																																																																			.	.		0.572	SLX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157301.3	NM_032444	
SPNS1	83985	hgsc.bcm.edu	37	16	28986482	28986482	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr16:28986482T>C	ENST00000311008.11	+	1	387	c.10T>C	c.(10-12)Tcc>Ccc	p.S4P	RP11-264B17.3_ENST00000569969.1_RNA|SPNS1_ENST00000334536.8_Missense_Mutation_p.S4P|SPNS1_ENST00000352260.7_Missense_Mutation_p.S4P|SPNS1_ENST00000565975.1_Missense_Mutation_p.S49P|RP11-264B17.4_ENST00000567209.1_RNA|SPNS1_ENST00000323081.8_Intron	NM_032038.2	NP_114427.1	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 (Drosophila)	4					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrial inner membrane (GO:0005743)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)|urinary_tract(1)	21						CATGGCCGGGTCCGACACCGC	0.736																																					p.S4P		Atlas-SNP	.											.	SPNS1	47	.	0			c.T10C						.						2.0	3.0	3.0					16																	28986482		1626	3333	4959	SO:0001583	missense	83985	exon1			GCCGGGTCCGACA	BC006156	CCDS10646.1, CCDS45452.1, CCDS45453.1, CCDS45454.1	16p11.2	2007-04-12			ENSG00000169682	ENSG00000169682			30621	protein-coding gene	gene with protein product		612583				11340170, 12815463	Standard	NM_032038		Approved	HSpin1, nrs, SPINL, PP2030, SPIN1, LAT	uc010vdi.1	Q9H2V7	OTTHUMG00000131762	ENST00000311008.11:c.10T>C	chr16.hg19:g.28986482T>C	ENSP00000309945:p.Ser4Pro	42.0	0.0		39.0	17.0	NM_001142451	B5MDM9|Q6P182|Q71RB5|Q7L541|Q86VU7|Q8N953|Q8TCS5|Q9BRN5	Missense_Mutation	SNP	ENST00000311008.11	hg19	CCDS10646.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.451786	0.84209	.	.	ENSG00000169682	ENST00000311008;ENST00000334536;ENST00000352260	T;T;T	0.33865	1.8;1.41;1.39	4.27	1.94	0.25998	.	0.265993	0.31709	N	0.007195	T	0.30510	0.0767	N	0.08118	0	0.29604	N	0.847475	B;D;D;B	0.57899	0.001;0.967;0.981;0.0	B;D;D;B	0.68621	0.002;0.91;0.959;0.002	T	0.08994	-1.0695	10	0.62326	D	0.03	.	3.7767	0.08663	0.0:0.1159:0.2247:0.6594	.	4;4;4;4	Q9H2V7-3;Q9H2V7;Q9H2V7-2;Q9H2V7-5	.;SPNS1_HUMAN;.;.	P	4	ENSP00000309945:S4P;ENSP00000335494:S4P;ENSP00000306050:S4P	ENSP00000309945:S4P	S	+	1	0	SPNS1	28893983	0.999000	0.42202	1.000000	0.80357	0.932000	0.56968	0.608000	0.24223	0.734000	0.32515	0.459000	0.35465	TCC	.	.		0.736	SPNS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254690.2	NM_032038	
TANGO6	79613	hgsc.bcm.edu	37	16	68894026	68894026	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr16:68894026C>T	ENST00000261778.1	+	2	346	c.334C>T	c.(334-336)Ctt>Ttt	p.L112F		NM_024562.1	NP_078838.1	Q9C0B7	TNG6_HUMAN	transport and golgi organization 6 homolog (Drosophila)	112						integral component of membrane (GO:0016021)											CATGATCCGCCTTGCAGCTAA	0.473																																					p.L112F		Atlas-SNP	.											.	.	.	.	0			c.C334T						.						191.0	184.0	187.0					16																	68894026		1954	4154	6108	SO:0001583	missense	79613	exon2			ATCCGCCTTGCAG		CCDS45516.1	16q22.1	2012-12-13	2012-12-13	2012-12-13	ENSG00000103047	ENSG00000103047			25749	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 7"""	TMCO7		11214970	Standard	NM_024562		Approved	FLJ12688, KIAA1746	uc002ewi.4	Q9C0B7	OTTHUMG00000176743	ENST00000261778.1:c.334C>T	chr16.hg19:g.68894026C>T	ENSP00000261778:p.Leu112Phe	114.0	0.0		114.0	47.0	NM_024562	Q569F9|Q9H9K1	Missense_Mutation	SNP	ENST00000261778.1	hg19	CCDS45516.1	.	.	.	.	.	.	.	.	.	.	C	13.95	2.390203	0.42410	.	.	ENSG00000103047	ENST00000261778	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	T	0.76169	0.3950	M	0.72118	2.19	0.41450	D	0.987974	D	0.76494	0.999	D	0.85130	0.997	T	0.77373	-0.2612	8	0.52906	T	0.07	-5.1723	11.475	0.50293	0.0:0.9166:0.0:0.0834	.	112	Q9C0B7	TMCO7_HUMAN	F	112	.	ENSP00000261778:L112F	L	+	1	0	TMCO7	67451527	0.813000	0.29090	0.729000	0.30791	0.213000	0.24496	1.496000	0.35638	2.548000	0.85928	0.561000	0.74099	CTT	.	.		0.473	TANGO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433471.2	XM_928235.2	
NQO1	1728	hgsc.bcm.edu	37	16	69752318	69752318	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr16:69752318A>C	ENST00000320623.5	-	2	638	c.127T>G	c.(127-129)Tat>Gat	p.Y43D	NQO1_ENST00000379047.3_Missense_Mutation_p.Y43D|NQO1_ENST00000561500.1_Missense_Mutation_p.Y43D|NQO1_ENST00000379046.2_Missense_Mutation_p.Y43D|NQO1_ENST00000439109.2_Missense_Mutation_p.Y43D|NQO1_ENST00000564043.1_Missense_Mutation_p.Y22D	NM_000903.2	NP_000894.1	P15559	NQO1_HUMAN	NAD(P)H dehydrogenase, quinone 1	43					aging (GO:0007568)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cellular amino acid metabolic process (GO:0006521)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|synaptic transmission, cholinergic (GO:0007271)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|NAD(P)H dehydrogenase (quinone) activity (GO:0003955)|poly(A) RNA binding (GO:0044822)|superoxide dismutase activity (GO:0004784)			autonomic_ganglia(1)|large_intestine(2)|lung(5)|prostate(1)|stomach(1)	10					Carboplatin(DB00958)|Cisplatin(DB00515)|Dicoumarol(DB00266)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|Menadione(DB00170)|Oxaliplatin(DB00526)|Vitamin E(DB00163)	TTCATGGCATAGAGGTCCGAC	0.507																																					p.Y43D		Atlas-SNP	.											.	NQO1	21	.	0			c.T127G						.						124.0	115.0	118.0					16																	69752318		2198	4300	6498	SO:0001583	missense	1728	exon2			TGGCATAGAGGTC	M81600	CCDS10883.1, CCDS32471.1, CCDS32472.1, CCDS67067.1	16q12-q22	2012-10-02	2001-11-30	2001-12-07	ENSG00000181019	ENSG00000181019	1.6.5.2		2874	protein-coding gene	gene with protein product		125860	"""diaphorase (NADH/NADPH) (cytochrome b-5 reductase)"""	NMOR1, DIA4		2843525	Standard	NM_001286137		Approved	DHQU, QR1, DTD	uc002exp.3	P15559	OTTHUMG00000137575	ENST00000320623.5:c.127T>G	chr16.hg19:g.69752318A>C	ENSP00000319788:p.Tyr43Asp	85.0	0.0		97.0	46.0	NM_000903	B2R5Y9|B4DNM7|B7ZAD1|Q86UK1	Missense_Mutation	SNP	ENST00000320623.5	hg19	CCDS10883.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.447327	0.84101	.	.	ENSG00000181019	ENST00000320623;ENST00000379047;ENST00000379046;ENST00000439109	T;T;T;T	0.10192	2.9;2.9;2.9;2.9	6.02	4.92	0.64577	Flavodoxin-like fold (1);	0.053569	0.85682	D	0.000000	T	0.39384	0.1076	M	0.90705	3.14	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;0.999;1.0	T	0.43278	-0.9401	9	.	.	.	-6.4844	12.3394	0.55085	0.8732:0.0:0.0:0.1268	.	43;43;43;43	B4DLR8;B4DNM7;B7ZAD1;P15559	.;.;.;NQO1_HUMAN	D	43	ENSP00000319788:Y43D;ENSP00000368335:Y43D;ENSP00000368334:Y43D;ENSP00000398330:Y43D	.	Y	-	1	0	NQO1	68309819	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.624000	0.90961	1.071000	0.40834	0.533000	0.62120	TAT	.	.		0.507	NQO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268956.2		
FA2H	79152	hgsc.bcm.edu	37	16	74752917	74752917	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr16:74752917A>T	ENST00000219368.3	-	5	824	c.755T>A	c.(754-756)cTg>cAg	p.L252Q	FA2H_ENST00000544337.1_Missense_Mutation_p.L39Q	NM_024306.4	NP_077282.3	Q7L5A8	FA2H_HUMAN	fatty acid 2-hydroxylase	252					cell death (GO:0008219)|central nervous system myelin maintenance (GO:0032286)|fatty acid biosynthetic process (GO:0006633)|lipid modification (GO:0030258)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of cell proliferation (GO:0042127)|regulation of hair cycle (GO:0042634)|sebaceous gland cell differentiation (GO:0001949)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	fatty acid alpha-hydroxylase activity (GO:0080132)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						GACGAAGTGCAGCATGATGAG	0.632																																					p.L252Q		Atlas-SNP	.											.	FA2H	21	.	0			c.T755A						.						65.0	61.0	62.0					16																	74752917		2198	4300	6498	SO:0001583	missense	79152	exon5			AAGTGCAGCATGA	BC002679	CCDS10911.1	16q23	2013-03-04	2003-10-29	2003-10-31	ENSG00000103089	ENSG00000103089		"""Fatty acid hydroxylase domain containing"""	21197	protein-coding gene	gene with protein product	"""fatty acid hydroxylase"""	611026	"""fatty acid hydroxylase domain containing 1"", ""spastic paraplegia 35 (autosomal recessive)"""	FAXDC1, SPG35		20104589	Standard	NM_024306		Approved	FAAH, FLJ25287	uc002fde.2	Q7L5A8	OTTHUMG00000137603	ENST00000219368.3:c.755T>A	chr16.hg19:g.74752917A>T	ENSP00000219368:p.Leu252Gln	66.0	0.0		81.0	32.0	NM_024306	B7Z8T6|O75213|Q96DK1|Q9H1A5	Missense_Mutation	SNP	ENST00000219368.3	hg19	CCDS10911.1	.	.	.	.	.	.	.	.	.	.	A	29.6	5.023649	0.93462	.	.	ENSG00000103089	ENST00000219368;ENST00000544337	D;D	0.85556	-2.0;-2.0	5.36	5.36	0.76844	Fatty acid hydroxylase (1);	0.201690	0.43919	D	0.000507	D	0.94102	0.8109	M	0.94021	3.485	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.95546	0.8616	10	0.87932	D	0	-6.0E-4	15.3568	0.74434	1.0:0.0:0.0:0.0	.	252	Q7L5A8	FA2H_HUMAN	Q	252;39	ENSP00000219368:L252Q;ENSP00000442334:L39Q	ENSP00000219368:L252Q	L	-	2	0	FA2H	73310418	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.297000	0.96120	2.030000	0.59900	0.459000	0.35465	CTG	.	.		0.632	FA2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269015.2	NM_024306	
SPEM1	374768	hgsc.bcm.edu	37	17	7324364	7324364	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr17:7324364T>A	ENST00000323675.3	+	3	395	c.370T>A	c.(370-372)Tgc>Agc	p.C124S	RP11-104H15.7_ENST00000575310.1_RNA	NM_199339.2	NP_955371.2	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	124					sperm individualization (GO:0007291)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	12		Prostate(122;0.173)				CTGTGCTCACTGCCCAGTAGC	0.607																																					p.C124S		Atlas-SNP	.											.	SPEM1	41	.	0			c.T370A						.						64.0	69.0	67.0					17																	7324364		2136	4240	6376	SO:0001583	missense	374768	exon3			GCTCACTGCCCAG	AK097400	CCDS42254.1	17p13.1	2011-12-12	2008-02-04	2008-02-04	ENSG00000181323	ENSG00000181323			32429	protein-coding gene	gene with protein product		615116	"""chromosome 17 open reading frame 83"""	C17orf83		17426145, 20558241, 21184802	Standard	NM_199339		Approved	FLJ40081	uc002ggv.3	Q8N4L4		ENST00000323675.3:c.370T>A	chr17.hg19:g.7324364T>A	ENSP00000315554:p.Cys124Ser	69.0	0.0		106.0	53.0	NM_199339		Missense_Mutation	SNP	ENST00000323675.3	hg19	CCDS42254.1	.	.	.	.	.	.	.	.	.	.	T	12.58	1.981441	0.34942	.	.	ENSG00000181323	ENST00000323383;ENST00000323675	.	.	.	5.55	-4.19	0.03835	.	1.737370	0.02984	N	0.145997	T	0.17916	0.0430	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.09122	-1.0689	9	0.17369	T	0.5	0.2299	0.966	0.01406	0.232:0.3529:0.1139:0.3012	.	124	Q8N4L4	SPEM1_HUMAN	S	73;124	.	ENSP00000315511:C73S	C	+	1	0	SPEM1	7265088	0.000000	0.05858	0.002000	0.10522	0.148000	0.21650	-0.095000	0.11077	-0.226000	0.09899	-0.177000	0.13119	TGC	.	.		0.607	SPEM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440932.1	NM_199339	
EME1	146956	hgsc.bcm.edu	37	17	48457826	48457826	+	Silent	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr17:48457826T>C	ENST00000338165.4	+	8	1582	c.1500T>C	c.(1498-1500)gtT>gtC	p.V500V	EME1_ENST00000511648.2_Silent_p.V513V|EME1_ENST00000393271.2_Silent_p.V513V	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	500					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			CCAGTGCAGTTGTGAATGCCT	0.607								Direct reversal of damage;Homologous recombination																													p.V513V		Atlas-SNP	.											.	EME1	39	.	0			c.T1539C						.						93.0	75.0	81.0					17																	48457826		2203	4300	6503	SO:0001819	synonymous_variant	146956	exon8			TGCAGTTGTGAAT	BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.1500T>C	chr17.hg19:g.48457826T>C		67.0	0.0		84.0	34.0	NM_001166131	Q96N62	Silent	SNP	ENST00000338165.4	hg19	CCDS11565.1	.	.	.	.	.	.	.	.	.	.	T	7.818	0.717179	0.15372	.	.	ENSG00000154920	ENST00000510246	.	.	.	6.06	2.61	0.31194	.	.	.	.	.	T	0.53465	0.1798	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40869	-0.9540	4	.	.	.	-26.1322	5.4971	0.16809	0.0:0.1978:0.2484:0.5539	.	.	.	.	R	312	.	.	C	+	1	0	EME1	45812825	0.981000	0.34729	0.863000	0.33907	0.694000	0.40290	0.119000	0.15626	0.167000	0.19631	0.533000	0.62120	TGT	.	.		0.607	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367118.3	NM_152463	
GRIN2C	2905	hgsc.bcm.edu	37	17	72838940	72838940	+	Silent	SNP	C	C	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr17:72838940C>G	ENST00000293190.5	-	13	3482	c.3336G>C	c.(3334-3336)tcG>tcC	p.S1112S		NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	1112					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCCTGCAGGCCGAGTGGCCGT	0.761																																					p.S1112S		Atlas-SNP	.											.	GRIN2C	144	.	0			c.G3336C						.						1.0	2.0	2.0					17																	72838940		752	1936	2688	SO:0001819	synonymous_variant	2905	exon13			GCAGGCCGAGTGG		CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.3336G>C	chr17.hg19:g.72838940C>G		19.0	0.0		51.0	23.0	NM_000835	B2RTT1	Silent	SNP	ENST00000293190.5	hg19	CCDS32724.1																																																																																			.	.		0.761	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103824.1		
FOXK2	3607	hgsc.bcm.edu	37	17	80529707	80529707	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr17:80529707A>C	ENST00000335255.5	+	4	1044	c.870A>C	c.(868-870)aaA>aaC	p.K290N		NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	290					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			ACATCACTAAAAATTATCCCT	0.488																																					p.K290N		Atlas-SNP	.											.	FOXK2	46	.	0			c.A870C						.						67.0	59.0	62.0					17																	80529707		2203	4300	6503	SO:0001583	missense	3607	exon4			CACTAAAAATTAT	U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.870A>C	chr17.hg19:g.80529707A>C	ENSP00000335677:p.Lys290Asn	128.0	0.0		148.0	52.0	NM_004514	A6NEP5|Q13622|Q13623|Q13624	Missense_Mutation	SNP	ENST00000335255.5	hg19	CCDS11813.1	.	.	.	.	.	.	.	.	.	.	A	19.58	3.853657	0.71719	.	.	ENSG00000141568	ENST00000535184;ENST00000335255;ENST00000335241;ENST00000531030;ENST00000526383	D;D;D	0.95518	-3.73;-3.73;-3.73	5.64	-3.3	0.05003	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.94594	0.8258	L	0.31065	0.9	0.58432	D	0.999991	D;D;D	0.89917	1.0;0.968;0.96	D;D;P	0.85130	0.997;0.943;0.905	D	0.91623	0.5312	10	0.72032	D	0.01	.	12.4947	0.55921	0.5508:0.0:0.4492:0.0	.	290;290;290	Q01167-3;Q01167;Q01167-2	.;FOXK2_HUMAN;.	N	286;290;290;101;170	ENSP00000335677:K290N;ENSP00000433167:K101N;ENSP00000432663:K170N	ENSP00000334321:K290N	K	+	3	2	FOXK2	78122996	1.000000	0.71417	0.036000	0.18154	0.713000	0.41058	0.969000	0.29370	-0.744000	0.04778	0.528000	0.53228	AAA	.	.		0.488	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277099.2	NM_181430	
TXNDC2	84203	hgsc.bcm.edu	37	18	9886755	9886755	+	Silent	SNP	A	A	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr18:9886755A>C	ENST00000306084.6	+	2	478	c.279A>C	c.(277-279)tcA>tcC	p.S93S	TXNDC2_ENST00000357775.5_Silent_p.S26S|TXNDC2_ENST00000536353.2_Silent_p.S26S|TXNDC2_ENST00000426718.3_3'UTR	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	93					cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CCAAGTCCTCAGCAAACACCA	0.572																																					p.S93S		Atlas-SNP	.											.	TXNDC2	168	.	0			c.A279C						.						169.0	108.0	129.0					18																	9886755		2203	4300	6503	SO:0001819	synonymous_variant	84203	exon2			GTCCTCAGCAAAC	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.279A>C	chr18.hg19:g.9886755A>C		128.0	0.0		164.0	12.0	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	ENST00000306084.6	hg19	CCDS42414.1																																																																																			.	.		0.572	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
RIOK3	8780	hgsc.bcm.edu	37	18	21053404	21053404	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr18:21053404A>G	ENST00000339486.3	+	8	1444	c.827A>G	c.(826-828)gAa>gGa	p.E276G	RIOK3_ENST00000577501.1_Missense_Mutation_p.E276G|RIOK3_ENST00000581585.1_Missense_Mutation_p.E260G	NM_003831.3	NP_003822.2	O14730	RIOK3_HUMAN	RIO kinase 3	276	Protein kinase.				chromosome segregation (GO:0007059)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(2)	10	all_cancers(21;0.000106)|all_epithelial(16;6.74e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ATGGAGGATGAAAAGGAAGAT	0.303																																					p.E276G		Atlas-SNP	.											.	RIOK3	42	.	0			c.A827G						.						39.0	38.0	38.0					18																	21053404		2203	4298	6501	SO:0001583	missense	8780	exon8			AGGATGAAAAGGA	AF013591	CCDS11877.1	18q11.2	2012-12-10	2012-12-10	2003-06-25	ENSG00000101782	ENSG00000101782			11451	protein-coding gene	gene with protein product		603579	"""sudD (suppressor of bimD6, Aspergillus nidulans) homolog"", ""RIO kinase 3 (yeast)"""	SUDD		9602165	Standard	NM_003831		Approved		uc002kui.4	O14730	OTTHUMG00000131813	ENST00000339486.3:c.827A>G	chr18.hg19:g.21053404A>G	ENSP00000341874:p.Glu276Gly	249.0	0.0		297.0	133.0	NM_003831	Q8IXN9	Missense_Mutation	SNP	ENST00000339486.3	hg19	CCDS11877.1	.	.	.	.	.	.	.	.	.	.	A	10.65	1.410784	0.25465	.	.	ENSG00000101782	ENST00000339486	T	0.07908	3.15	4.86	-0.302	0.12796	RIO kinase (1);Protein kinase-like domain (1);RIO-like kinase (1);	0.388002	0.28171	N	0.016336	T	0.04227	0.0117	L	0.29908	0.895	0.28808	N	0.898395	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33599	-0.9862	10	0.21014	T	0.42	-11.1858	1.5643	0.02601	0.3836:0.2586:0.2433:0.1146	.	260;276;276	B4E1Q4;O14730-2;O14730	.;.;RIOK3_HUMAN	G	276	ENSP00000341874:E276G	ENSP00000341874:E276G	E	+	2	0	RIOK3	19307402	0.994000	0.37717	0.999000	0.59377	0.985000	0.73830	0.431000	0.21444	0.050000	0.15949	0.477000	0.44152	GAA	.	.		0.303	RIOK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254756.1	NM_003831	
DTNA	1837	hgsc.bcm.edu	37	18	32418754	32418754	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr18:32418754T>G	ENST00000399113.3	+	12	1218	c.1218T>G	c.(1216-1218)caT>caG	p.H406Q	DTNA_ENST00000599844.1_Intron|DTNA_ENST00000556414.3_Intron|DTNA_ENST00000597674.1_Intron|DTNA_ENST00000399121.5_Intron|DTNA_ENST00000601125.1_Intron|DTNA_ENST00000444659.1_Missense_Mutation_p.H406Q|DTNA_ENST00000283365.9_Intron|DTNA_ENST00000348997.5_Missense_Mutation_p.H403Q|DTNA_ENST00000598142.1_Intron|DTNA_ENST00000399097.3_Intron|DTNA_ENST00000269192.7_Missense_Mutation_p.H115Q|DTNA_ENST00000595022.1_Intron|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000269191.6_Missense_Mutation_p.H406Q|DTNA_ENST00000598774.1_Intron|DTNA_ENST00000598334.1_Intron|DTNA_ENST00000597599.1_Intron|DTNA_ENST00000591182.1_Intron|DTNA_ENST00000269190.7_Missense_Mutation_p.H407Q			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	406	Syntrophin-binding region.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						CTGATGAACATGTTCTCATCG	0.493																																					p.H406Q		Atlas-SNP	.											.	DTNA	321	.	0			c.T1218G						.						177.0	135.0	149.0					18																	32418754		2203	4300	6503	SO:0001583	missense	1837	exon12			TGAACATGTTCTC	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1218T>G	chr18.hg19:g.32418754T>G	ENSP00000382064:p.His406Gln	128.0	0.0		139.0	56.0	NM_001390	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	ENST00000399113.3	hg19	CCDS59311.1	.	.	.	.	.	.	.	.	.	.	T	18.31	3.595096	0.66219	.	.	ENSG00000134769	ENST00000269190;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113;ENST00000269192	T;T;T;T;T	0.27256	1.68;1.88;1.69;1.85;1.69	5.95	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.46425	0.1392	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.71674	0.991;0.998;0.991;0.997	D;D;P;D	0.78314	0.958;0.986;0.849;0.991	T	0.45338	-0.9268	10	0.66056	D	0.02	-16.978	9.0993	0.36658	0.0:0.138:0.0:0.862	.	115;406;406;403	B4DIR0;Q9Y4J8;Q9Y4J8-3;Q9Y4J8-4	.;DTNA_HUMAN;.;.	Q	407;403;406;406;406;406;115	ENSP00000269190:H407Q;ENSP00000336682:H403Q;ENSP00000405819:H406Q;ENSP00000269191:H406Q;ENSP00000382064:H406Q	ENSP00000269190:H407Q	H	+	3	2	DTNA	30672752	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.898000	0.48672	2.272000	0.75746	0.460000	0.39030	CAT	.	.		0.493	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
ZSCAN30	100101467	hgsc.bcm.edu	37	18	32834231	32834231	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr18:32834231C>A	ENST00000420878.3	-	5	1123	c.668G>T	c.(667-669)cGg>cTg	p.R223L	ZSCAN30_ENST00000333206.5_Missense_Mutation_p.R223L|ZNF397_ENST00000592264.1_Intron|ZNF397_ENST00000261333.6_Missense_Mutation_p.R228S|ZNF397_ENST00000355632.4_Missense_Mutation_p.R198S|ZNF397_ENST00000589420.1_3'UTR	NM_001166012.1	NP_001159484.1	Q86W11	ZSC30_HUMAN	zinc finger and SCAN domain containing 30	223					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R228S(1)|p.R223L(1)		large_intestine(5)|lung(3)|urinary_tract(1)	9						TTCAGCTATCCGTTGGGAATG	0.468																																					p.R228S		Atlas-SNP	.											ZSCAN30,colon,carcinoma,0,2	ZNF397	51	.	2	Substitution - Missense(2)	lung(2)	c.C682A						.						159.0	150.0	153.0					18																	32834231		2203	4300	6503	SO:0001583	missense	84307	exon5			GCTATCCGTTGGG	AY234408	CCDS42427.1, CCDS74207.1	18q12.2	2013-01-08	2010-07-23	2010-07-23	ENSG00000186814	ENSG00000186814		"""-"", ""Zinc fingers, C2H2-type"""	33517	protein-coding gene	gene with protein product			"""zinc finger protein 397 opposite strand"", ""ZNF397 opposite strand"""	ZNF397OS		12801647	Standard	NM_001166012		Approved	ZNF917	uc002kym.3	Q86W11		ENST00000420878.3:c.668G>T	chr18.hg19:g.32834231C>A	ENSP00000392371:p.Arg223Leu	109.0	1.0		117.0	48.0	NM_032347	B4E0N0|Q6ZNB3|Q96PN3	Missense_Mutation	SNP	ENST00000420878.3	hg19	CCDS42427.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.880|8.880	0.951460|0.951460	0.18431|0.18431	.|.	.|.	ENSG00000186814|ENSG00000186812	ENST00000420878;ENST00000333206;ENST00000360932|ENST00000261333;ENST00000355632	T;T|T;T	0.06768|0.02944	3.26;3.26|4.23;4.1	4.21|4.21	4.21|4.21	0.49690|0.49690	.|.	0.529775|0.529775	0.14290|0.14290	N|N	0.328959|0.328959	T|T	0.02047|0.02047	0.0064|0.0064	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|B;B	0.06786|0.02656	0.001|0.0;0.0	B|B;B	0.01281|0.01281	0.0|0.0;0.0	T|T	0.47209|0.47209	-0.9135|-0.9135	9|9	0.27785|0.12103	T|T	0.31|0.63	.|.	8.1344|8.1344	0.31046|0.31046	0.0:0.0984:0.0:0.9016|0.0:0.0984:0.0:0.9016	.|.	223|198;228	Q86W11|Q96K65;Q8NF99-2	ZSC30_HUMAN|.;.	L|S	223;223;158|228;198	ENSP00000392371:R223L;ENSP00000329738:R223L|ENSP00000261333:R228S;ENSP00000347850:R198S	ENSP00000329738:R223L|ENSP00000261333:R228S	R|R	-|+	2|1	0|0	ZSCAN30|ZNF397	31088229|31088229	0.017000|0.017000	0.18338|0.18338	0.141000|0.141000	0.22245|0.22245	0.070000|0.070000	0.16714|0.16714	0.926000|0.926000	0.28804|0.28804	0.766000|0.766000	0.33244|0.33244	-0.268000|-0.268000	0.10319|0.10319	CGG|CGT	.	.		0.468	ZSCAN30-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442510.1	NM_001112734	
ZNRF4	148066	hgsc.bcm.edu	37	19	5456638	5456638	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr19:5456638A>T	ENST00000222033.4	+	1	1213	c.1136A>T	c.(1135-1137)cAc>cTc	p.H379L		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	379						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		CTACCGGGCCACCGGCCCCCC	0.677																																					p.H379L		Atlas-SNP	.											.	ZNRF4	59	.	0			c.A1136T						.						44.0	52.0	50.0					19																	5456638		1977	4151	6128	SO:0001583	missense	148066	exon1			CGGGCCACCGGCC	AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.1136A>T	chr19.hg19:g.5456638A>T	ENSP00000222033:p.His379Leu	58.0	0.0		107.0	45.0	NM_181710	A8K886|O75866	Missense_Mutation	SNP	ENST00000222033.4	hg19	CCDS42475.1	.	.	.	.	.	.	.	.	.	.	A	5.548	0.286016	0.10513	.	.	ENSG00000105428	ENST00000222033	T	0.04234	3.67	3.47	-0.104	0.13605	.	0.295799	0.32134	U	0.006522	T	0.03434	0.0099	L	0.27053	0.805	0.28196	N	0.927536	P	0.50943	0.94	P	0.44732	0.459	T	0.45469	-0.9259	10	0.17832	T	0.49	-14.1544	6.5764	0.22569	0.6462:0.0:0.3538:0.0	.	379	Q8WWF5	ZNRF4_HUMAN	L	379	ENSP00000222033:H379L	ENSP00000222033:H379L	H	+	2	0	ZNRF4	5407638	0.000000	0.05858	0.183000	0.23137	0.058000	0.15608	-0.458000	0.06737	-0.235000	0.09767	0.459000	0.35465	CAC	.	.		0.677	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450924.1	NM_181710	
MLLT1	4298	hgsc.bcm.edu	37	19	6213406	6213406	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr19:6213406T>C	ENST00000252674.7	-	11	1656	c.1493A>G	c.(1492-1494)gAg>gGg	p.E498G	MLLT1_ENST00000585588.1_5'UTR|CTC-503J8.6_ENST00000586154.1_lincRNA	NM_005934.3	NP_005925.2	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1	498					negative regulation of protein kinase activity (GO:0006469)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)			endometrium(3)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|skin(2)	17						CTCCACCAGCTCATCCGTGTA	0.701			T	MLL	AL																																p.E498G		Atlas-SNP	.		Dom	yes		19	19p13.3	4298	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 1 (ENL)"""		L	.	MLLT1	47	.	0			c.A1493G						.						42.0	50.0	47.0					19																	6213406		2200	4287	6487	SO:0001583	missense	4298	exon11			ACCAGCTCATCCG		CCDS12160.1	19p13.3	2012-10-04	2001-11-28		ENSG00000130382	ENSG00000130382			7134	protein-coding gene	gene with protein product		159556	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 1"""				Standard	XM_005259561		Approved	ENL, LTG19, YEATS1	uc002mek.3	Q03111	OTTHUMG00000180757	ENST00000252674.7:c.1493A>G	chr19.hg19:g.6213406T>C	ENSP00000252674:p.Glu498Gly	49.0	0.0		72.0	29.0	NM_005934	Q14768	Missense_Mutation	SNP	ENST00000252674.7	hg19	CCDS12160.1	.	.	.	.	.	.	.	.	.	.	t	15.57	2.873518	0.51695	.	.	ENSG00000130382	ENST00000252674	.	.	.	4.16	4.16	0.48862	.	0.124124	0.51477	N	0.000082	T	0.63177	0.2489	M	0.78049	2.395	0.49213	D	0.999765	P	0.52316	0.952	P	0.49140	0.601	T	0.68006	-0.5523	9	0.87932	D	0	-14.3704	8.3814	0.32474	0.1755:0.0:0.0:0.8245	.	498	Q03111	ENL_HUMAN	G	498	.	ENSP00000252674:E498G	E	-	2	0	MLLT1	6164406	1.000000	0.71417	0.508000	0.27688	0.677000	0.39632	5.933000	0.70130	1.514000	0.48869	0.478000	0.44815	GAG	.	.		0.701	MLLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452909.1	NM_005934	
MUC16	94025	hgsc.bcm.edu	37	19	9083038	9083038	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr19:9083038G>A	ENST00000397910.4	-	1	8980	c.8777C>T	c.(8776-8778)tCt>tTt	p.S2926F		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2927	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGTGAGGAAGATGCTGTGCT	0.458																																					p.S2926F		Atlas-SNP	.											.	MUC16	4315	.	0			c.C8777T						.						105.0	96.0	99.0					19																	9083038		1933	4136	6069	SO:0001583	missense	94025	exon1			GAGGAAGATGCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8777C>T	chr19.hg19:g.9083038G>A	ENSP00000381008:p.Ser2926Phe	143.0	0.0		203.0	93.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	6.177	0.400786	0.11696	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.773	0.773	0.18516	.	.	.	.	.	T	0.03095	0.0091	N	0.08118	0	.	.	.	D	0.58268	0.982	P	0.56700	0.804	T	0.44937	-0.9295	8	0.87932	D	0	.	4.823	0.13400	0.0:0.0:1.0:0.0	.	2926	B5ME49	.	F	2926	ENSP00000381008:S2926F	ENSP00000381008:S2926F	S	-	2	0	MUC16	8944038	0.017000	0.18338	0.005000	0.12908	0.629000	0.37895	0.337000	0.19841	0.680000	0.31366	0.313000	0.20887	TCT	.	.		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF181	339318	hgsc.bcm.edu	37	19	35231867	35231867	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr19:35231867A>G	ENST00000492450.1	+	4	670	c.581A>G	c.(580-582)aAa>aGa	p.K194R	ZNF181_ENST00000392232.3_Missense_Mutation_p.K238R|ZNF181_ENST00000459757.2_Missense_Mutation_p.K193R			Q2M3W8	ZN181_HUMAN	zinc finger protein 181	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(6)|kidney(2)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(1)	22	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			AACTTACCAAAAAAGTCAGTT	0.343																																					p.K194R		Atlas-SNP	.											.	ZNF181	65	.	0			c.A581G						.						43.0	50.0	48.0					19																	35231867		2191	4292	6483	SO:0001583	missense	339318	exon4			TACCAAAAAAGTC	BC104759, H54888	CCDS32990.2, CCDS46043.1	19q13.13	2013-01-08	2006-04-27		ENSG00000197841	ENSG00000197841		"""Zinc fingers, C2H2-type"", ""-"""	12971	protein-coding gene	gene with protein product		606741	"""zinc finger protein 181 (HHZ181)"""				Standard	NM_001029997		Approved	HHZ181, MGC44316	uc002nvu.3	Q2M3W8	OTTHUMG00000157508	ENST00000492450.1:c.581A>G	chr19.hg19:g.35231867A>G	ENSP00000420727:p.Lys194Arg	343.0	1.0		420.0	195.0	NM_001029997	B7ZKX3|Q49A75	Missense_Mutation	SNP	ENST00000492450.1	hg19	CCDS32990.2	.	.	.	.	.	.	.	.	.	.	A	0.114	-1.134773	0.01742	.	.	ENSG00000197841	ENST00000392232;ENST00000425140;ENST00000492450;ENST00000459757	T;T;T	0.06687	3.27;3.37;3.33	2.89	0.667	0.17907	.	.	.	.	.	T	0.13114	0.0318	L	0.40543	1.245	0.09310	N	1	B;P	0.52842	0.089;0.956	B;D	0.65010	0.051;0.931	T	0.26189	-1.0110	9	0.19590	T	0.45	.	4.4584	0.11654	0.6002:0.2189:0.0:0.1809	.	193;194	B7ZKX3;Q2M3W8	.;ZN181_HUMAN	R	238;193;194;193	ENSP00000376065:K238R;ENSP00000420727:K194R;ENSP00000419435:K193R	ENSP00000376065:K238R	K	+	2	0	ZNF181	39923707	0.000000	0.05858	0.001000	0.08648	0.050000	0.14768	-0.078000	0.11375	0.077000	0.16863	0.402000	0.26972	AAA	.	.		0.343	ZNF181-002	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349005.3	NM_001029997	
PTH2	113091	hgsc.bcm.edu	37	19	49926536	49926536	+	Missense_Mutation	SNP	G	G	C	rs371950649		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr19:49926536G>C	ENST00000270631.1	-	1	162	c.61C>G	c.(61-63)Ctg>Gtg	p.L21V	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	21					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		ACCACcagcagcagcagcagc	0.687																																					p.L21V		Atlas-SNP	.											.	PTH2	20	.	0			c.C61G						.						11.0	15.0	14.0					19																	49926536		2186	4273	6459	SO:0001583	missense	113091	exon1			CCAGCAGCAGCAG	AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.61C>G	chr19.hg19:g.49926536G>C	ENSP00000270631:p.Leu21Val	51.0	0.0		129.0	12.0	NM_178449	Q96DJ4	Missense_Mutation	SNP	ENST00000270631.1	hg19	CCDS12763.1	.	.	.	.	.	.	.	.	.	.	g	1.896	-0.454359	0.04540	.	.	ENSG00000142538	ENST00000270631	.	.	.	4.24	2.06	0.26882	.	0.116151	0.35436	U	0.003207	T	0.46580	0.1400	L	0.27053	0.805	0.09310	N	1	D	0.71674	0.998	D	0.73708	0.981	T	0.36237	-0.9756	9	0.87932	D	0	-4.0206	9.5665	0.39402	0.1978:0.0:0.8022:0.0	.	21	Q96A98	TIP39_HUMAN	V	21	.	ENSP00000270631:L21V	L	-	1	2	PTH2	54618348	0.089000	0.21612	0.003000	0.11579	0.024000	0.10985	0.799000	0.27028	0.056000	0.16144	-1.634000	0.00779	CTG	.	.		0.687	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465366.1	NM_178449	
PTH2	113091	hgsc.bcm.edu	37	19	49926539	49926539	+	Missense_Mutation	SNP	G	G	C	rs371950649		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr19:49926539G>C	ENST00000270631.1	-	1	159	c.58C>G	c.(58-60)Ctg>Gtg	p.L20V	CTD-3148I10.1_ENST00000576655.1_5'Flank	NM_178449.3	NP_848544.1	Q96A98	TIP39_HUMAN	parathyroid hormone 2	20					neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(262;0.0015)|GBM - Glioblastoma multiforme(486;0.044)|Lung(386;0.0785)|LUSC - Lung squamous cell carcinoma(496;0.0836)		ACcagcagcagcagcagcagc	0.687																																					p.L20V		Atlas-SNP	.											.	PTH2	20	.	0			c.C58G						.						11.0	14.0	13.0					19																	49926539		2184	4260	6444	SO:0001583	missense	113091	exon1			GCAGCAGCAGCAG	AY037555	CCDS12763.1	19q13.33	2013-02-28				ENSG00000142538		"""Endogenous ligands"""	30828	protein-coding gene	gene with protein product	"""tuberoinfundibular 39 residues"""	608386				11861531	Standard	NM_178449		Approved	TIP39	uc002pnn.1	Q96A98		ENST00000270631.1:c.58C>G	chr19.hg19:g.49926539G>C	ENSP00000270631:p.Leu20Val	48.0	0.0		123.0	14.0	NM_178449	Q96DJ4	Missense_Mutation	SNP	ENST00000270631.1	hg19	CCDS12763.1	.	.	.	.	.	.	.	.	.	.	g	12.98	2.101872	0.37048	.	.	ENSG00000142538	ENST00000270631	.	.	.	3.93	3.93	0.45458	.	0.148013	0.39544	U	0.001330	T	0.48660	0.1512	L	0.27053	0.805	0.24833	N	0.992511	D	0.71674	0.998	D	0.73708	0.981	T	0.36359	-0.9751	9	0.87932	D	0	.	11.8501	0.52407	0.0:0.0:1.0:0.0	.	20	Q96A98	TIP39_HUMAN	V	20	.	ENSP00000270631:L20V	L	-	1	2	PTH2	54618351	0.064000	0.20934	0.867000	0.34043	0.174000	0.22865	1.881000	0.39638	1.921000	0.55644	0.457000	0.33378	CTG	.	.		0.687	PTH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465366.1	NM_178449	
LILRA5	353514	hgsc.bcm.edu	37	19	54822602	54822602	+	Intron	SNP	C	C	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr19:54822602C>G	ENST00000301219.3	-	5	832				LILRA5_ENST00000346508.3_Intron|LILRA5_ENST00000446712.3_Missense_Mutation_p.C253S|LILRA5_ENST00000432233.3_Missense_Mutation_p.C265S|AC008984.2_ENST00000507363.1_RNA	NM_021250.2	NP_067073.1	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5						innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCTTTCTTAGCAGGGGCTGCC	0.517																																					p.C265S		Atlas-SNP	.											.	LILRA5	49	.	0			c.G794C						.						33.0	35.0	34.0					19																	54822602		1327	2308	3635	SO:0001627	intron_variant	353514	exon5			TCTTAGCAGGGGC	AF212842	CCDS12888.1, CCDS12889.1	19q13.4	2013-01-11	2005-05-13	2005-05-13	ENSG00000187116	ENSG00000187116		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16309	protein-coding gene	gene with protein product		606047		LILRB7		10941842	Standard	NM_181986		Approved	ILT11, LIR9, CD85, CD85f	uc002qfe.3	A6NI73	OTTHUMG00000065357	ENST00000301219.3:c.712+81G>C	chr19.hg19:g.54822602C>G		68.0	0.0		91.0	10.0	NM_181879	A6NHI3	Missense_Mutation	SNP	ENST00000301219.3	hg19	CCDS12888.1	.	.	.	.	.	.	.	.	.	.	C	4.309	0.056564	0.08291	.	.	ENSG00000187116	ENST00000446712;ENST00000432233	T;T	0.00520	6.85;6.94	1.27	-0.71	0.11234	.	.	.	.	.	T	0.00356	0.0011	.	.	.	0.09310	N	1	B;B	0.17038	0.02;0.019	B;B	0.12156	0.007;0.003	T	0.41413	-0.9510	8	0.87932	D	0	.	5.512	0.16886	0.0:0.4866:0.5134:0.0	.	253;265	A6NI73-4;A6NI73-3	.;.	S	253;265	ENSP00000389499:C253S;ENSP00000404236:C265S	ENSP00000404236:C265S	C	-	2	0	LILRA5	59514414	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	-2.074000	0.01375	-0.056000	0.13221	0.430000	0.28490	TGC	.	.		0.517	LILRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140231.1	NM_181985	
NOP56	10528	hgsc.bcm.edu	37	20	2635441	2635441	+	Silent	SNP	G	G	A	rs140571524		TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr20:2635441G>A	ENST00000329276.5	+	5	933	c.417G>A	c.(415-417)ctG>ctA	p.L139L	SNORA51_ENST00000606420.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD110_ENST00000408189.1_RNA|SNORD86_ENST00000391196.1_RNA|SNORD56_ENST00000413522.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	139					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TGACCGATCTGTCAGCTTGTA	0.517																																					p.L139L		Atlas-SNP	.											.	NOP56	73	.	0			c.G417A						.						170.0	167.0	168.0					20																	2635441		2203	4300	6503	SO:0001819	synonymous_variant	10528	exon5			CGATCTGTCAGCT	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.417G>A	chr20.hg19:g.2635441G>A		55.0	0.0		72.0	28.0	NM_006392	Q2M3T6|Q9NQ05	Silent	SNP	ENST00000329276.5	hg19	CCDS13030.1																																																																																			.	G|1.000;T|0.000		0.517	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
RRP1B	23076	hgsc.bcm.edu	37	21	45107430	45107430	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr21:45107430G>A	ENST00000340648.4	+	13	1292	c.1175G>A	c.(1174-1176)aGt>aAt	p.S392N		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	392					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		GAAGAGGACAGTGAAAGCAGT	0.522																																					p.S392N		Atlas-SNP	.											.	RRP1B	51	.	0			c.G1175A						.						66.0	78.0	74.0					21																	45107430		2122	4177	6299	SO:0001583	missense	23076	exon13			AGGACAGTGAAAG	AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.1175G>A	chr21.hg19:g.45107430G>A	ENSP00000339145:p.Ser392Asn	22.0	0.0		29.0	16.0	NM_015056	Q8TBZ4	Missense_Mutation	SNP	ENST00000340648.4	hg19	CCDS33577.1	.	.	.	.	.	.	.	.	.	.	G	9.516	1.107103	0.20714	.	.	ENSG00000160208	ENST00000340648	T	0.02032	4.49	4.17	0.876	0.19138	.	0.809018	0.11744	N	0.533722	T	0.02342	0.0072	L	0.43152	1.355	0.09310	N	1	B	0.19331	0.035	B	0.17098	0.017	T	0.43861	-0.9365	10	0.87932	D	0	-0.0476	3.3812	0.07255	0.3914:0.2042:0.4044:0.0	.	392	Q14684	RRP1B_HUMAN	N	392	ENSP00000339145:S392N	ENSP00000339145:S392N	S	+	2	0	RRP1B	43931858	0.000000	0.05858	0.000000	0.03702	0.114000	0.19823	0.346000	0.19997	0.439000	0.26476	0.561000	0.74099	AGT	.	.		0.522	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195651.1	NM_015056	
AIRE	326	hgsc.bcm.edu	37	21	45707002	45707002	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr21:45707002G>T	ENST00000291582.5	+	3	576	c.449G>T	c.(448-450)gGc>gTc	p.G150V		NM_000383.3	NP_000374.1	O43918	AIRE_HUMAN	autoimmune regulator	150					humoral immune response (GO:0006959)|immune response (GO:0006955)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|transcription regulatory region DNA binding (GO:0044212)|translation regulator activity (GO:0045182)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|skin(2)|urinary_tract(1)	14				Colorectal(79;0.0806)		ACTCCAAGGGGCACCGCCAGC	0.711									Autoimmune PolyEndocrinopathy Candidiasis Ectodermal Dystrophy																												p.G150V		Atlas-SNP	.											.	AIRE	61	.	0			c.G449T						.						16.0	22.0	20.0					21																	45707002		2155	4222	6377	SO:0001583	missense	326	exon3	Familial Cancer Database	APECED	CAAGGGGCACCGC	AB006684	CCDS13706.1	21q22.3	2014-09-17	2007-06-20		ENSG00000160224	ENSG00000160224		"""Zinc fingers, PHD-type"""	360	protein-coding gene	gene with protein product	"""autoimmune polyendocrinopathy candidiasis ectodermal dystrophy"""	607358	"""autoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)"""	APECED		9398840	Standard	NM_000383		Approved	PGA1, APS1	uc002zei.3	O43918	OTTHUMG00000086921	ENST00000291582.5:c.449G>T	chr21.hg19:g.45707002G>T	ENSP00000291582:p.Gly150Val	102.0	0.0		150.0	40.0	NM_000383	B2RP50|O43922|O43932|O75745	Missense_Mutation	SNP	ENST00000291582.5	hg19	CCDS13706.1	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.435265	0.01108	.	.	ENSG00000160224	ENST00000291582	D	0.94613	-3.47	3.8	1.82	0.25136	.	0.759894	0.11472	N	0.560676	D	0.87573	0.6211	N	0.22421	0.69	0.23879	N	0.996583	B	0.18461	0.028	B	0.12837	0.008	T	0.75039	-0.3458	10	0.26408	T	0.33	-28.9906	6.7098	0.23270	0.0:0.1974:0.5991:0.2035	.	150	O43918	AIRE_HUMAN	V	150	ENSP00000291582:G150V	ENSP00000291582:G150V	G	+	2	0	AIRE	44531430	0.000000	0.05858	0.292000	0.24919	0.018000	0.09664	0.144000	0.16135	0.295000	0.22570	0.543000	0.68304	GGC	.	.		0.711	AIRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195842.2		
PIWIL3	440822	hgsc.bcm.edu	37	22	25155853	25155853	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr22:25155853C>T	ENST00000332271.5	-	3	622	c.206G>A	c.(205-207)gGa>gAa	p.G69E	PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_5'UTR|PIWIL3_ENST00000527701.1_5'UTR	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	69					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CTGTGCTCCTCCTCCTGCTCC	0.582																																					p.G69E		Atlas-SNP	.											.	PIWIL3	115	.	0			c.G206A						.						431.0	420.0	424.0					22																	25155853		2203	4300	6503	SO:0001583	missense	440822	exon3			GCTCCTCCTCCTG	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.206G>A	chr22.hg19:g.25155853C>T	ENSP00000330031:p.Gly69Glu	39.0	0.0		70.0	35.0	NM_001008496		Missense_Mutation	SNP	ENST00000332271.5	hg19	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	C	6.241	0.412595	0.11812	.	.	ENSG00000184571	ENST00000332271	T	0.03982	3.74	2.32	0.113	0.14631	.	251.269000	0.02277	U	0.068982	T	0.02267	0.0070	N	0.08118	0	0.09310	N	0.999999	B;P	0.40731	0.141;0.728	B;B	0.37601	0.021;0.254	T	0.35943	-0.9768	10	0.02654	T	1	-0.842	3.4604	0.07531	0.0:0.5657:0.2712:0.1631	.	69;69	B4DYF7;Q7Z3Z3	.;PIWL3_HUMAN	E	69	ENSP00000330031:G69E	ENSP00000330031:G69E	G	-	2	0	PIWIL3	23485853	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	0.171000	0.16685	0.102000	0.17638	0.385000	0.25706	GGA	.	.		0.582	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
TAB1	10454	hgsc.bcm.edu	37	22	39817945	39817945	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr22:39817945A>T	ENST00000216160.6	+	8	952	c.890A>T	c.(889-891)gAg>gTg	p.E297V	TAB1_ENST00000331454.3_Missense_Mutation_p.E297V	NM_006116.2	NP_006107.1	Q15750	TAB1_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 1	297	PP2C-like.				activation of MAPK activity (GO:0000187)|activation of MAPKKK activity (GO:0000185)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart morphogenesis (GO:0003007)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lung development (GO:0030324)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|protein complex (GO:0043234)	catalytic activity (GO:0003824)|enzyme activator activity (GO:0008047)|kinase activator activity (GO:0019209)			breast(1)|endometrium(2)|large_intestine(2)|lung(8)|urinary_tract(1)	14						AAGGCCCTAGAGGCAGCCCAT	0.637																																					p.E297V		Atlas-SNP	.											.	TAB1	36	.	0			c.A890T						.						59.0	56.0	57.0					22																	39817945		2203	4300	6503	SO:0001583	missense	10454	exon8			CCCTAGAGGCAGC	U49928	CCDS13992.1, CCDS13993.1	22q13.1	2010-02-05	2010-02-05	2010-02-05	ENSG00000100324	ENSG00000100324			18157	protein-coding gene	gene with protein product	"""TAK1-binding protein 1"", ""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	602615	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 1"""	MAP3K7IP1		8638164, 10187861	Standard	NM_153497		Approved		uc003axt.3	Q15750	OTTHUMG00000151102	ENST00000216160.6:c.890A>T	chr22.hg19:g.39817945A>T	ENSP00000216160:p.Glu297Val	101.0	0.0		118.0	51.0	NM_153497	Q2PP09|Q8IZW2	Missense_Mutation	SNP	ENST00000216160.6	hg19	CCDS13993.1	.	.	.	.	.	.	.	.	.	.	A	24.4	4.527637	0.85706	.	.	ENSG00000100324	ENST00000216160;ENST00000331454	T;T	0.10099	2.91;2.91	5.26	5.26	0.73747	Protein phosphatase 2C-like (4);	0.000000	0.85682	D	0.000000	T	0.32763	0.0840	M	0.70595	2.14	0.80722	D	1	D;D;D	0.89917	0.996;1.0;1.0	P;D;D	0.91635	0.892;0.999;0.998	T	0.02877	-1.1099	10	0.52906	T	0.07	-12.6493	15.4812	0.75528	1.0:0.0:0.0:0.0	.	297;297;441	Q15750-2;Q15750;Q59FT7	.;TAB1_HUMAN;.	V	297	ENSP00000216160:E297V;ENSP00000333049:E297V	ENSP00000216160:E297V	E	+	2	0	TAB1	38147891	1.000000	0.71417	1.000000	0.80357	0.811000	0.45836	8.525000	0.90583	2.118000	0.64928	0.533000	0.62120	GAG	.	.		0.637	TAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321313.1	NM_153497	
ACE2	59272	hgsc.bcm.edu	37	X	15609834	15609834	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chrX:15609834A>G	ENST00000252519.3	-	4	686		c.e4+1		ACE2_ENST00000427411.1_Splice_Site			Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2						angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|angiotensin-mediated drinking behavior (GO:0003051)|cellular protein metabolic process (GO:0044267)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|receptor biosynthetic process (GO:0032800)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell proliferation (GO:0042127)|regulation of cytokine production (GO:0001817)|regulation of inflammatory response (GO:0050727)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|response to virus (GO:0009615)|viral entry into host cell (GO:0046718)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|endopeptidase activity (GO:0004175)|glycoprotein binding (GO:0001948)|peptide hormone binding (GO:0017046)|virus receptor activity (GO:0001618)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	32	Hepatocellular(33;0.183)				Lisinopril(DB00722)|Moexipril(DB00691)	CAGCAAACTTACGATTTGCTC	0.493																																					.		Atlas-SNP	.											.	ACE2	87	.	0			c.583+2T>C						.						234.0	220.0	225.0					X																	15609834		2203	4300	6503	SO:0001630	splice_region_variant	59272	exon6			AAACTTACGATTT	AF291820	CCDS14169.1	Xp22	2013-06-12	2013-06-12		ENSG00000130234	ENSG00000130234	3.4.17.23		13557	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	300335	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 2"""			10969042	Standard	NM_021804		Approved		uc004cxb.2	Q9BYF1	OTTHUMG00000021177	ENST00000252519.3:c.583+1T>C	chrX.hg19:g.15609834A>G		53.0	0.0		121.0	110.0	NM_021804	C7ECU1|Q6UWP0|Q86WT0|Q9NRA7|Q9UFZ6	Splice_Site	SNP	ENST00000252519.3	hg19	CCDS14169.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.109965	0.37242	.	.	ENSG00000130234	ENST00000252519;ENST00000427411	.	.	.	5.84	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5295	0.50599	0.8638:0.0:0.0:0.1362	.	.	.	.	.	-1	.	.	.	-	.	.	ACE2	15519755	1.000000	0.71417	0.099000	0.21106	0.386000	0.30323	8.220000	0.89772	0.874000	0.35823	0.483000	0.47432	.	.	.		0.493	ACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055867.1		Intron
KDM5C	8242	hgsc.bcm.edu	37	X	53230776	53230776	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chrX:53230776T>C	ENST00000375401.3	-	14	2549	c.2017A>G	c.(2017-2019)Atg>Gtg	p.M673V	KDM5C_ENST00000404049.3_Missense_Mutation_p.M672V|KDM5C_ENST00000375383.3_Missense_Mutation_p.M632V|KDM5C_ENST00000465402.1_5'UTR|KDM5C_ENST00000452825.3_Missense_Mutation_p.M606V|KDM5C_ENST00000375379.3_Missense_Mutation_p.M673V	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	673					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						TCTTGCACCATGATGAACATC	0.567			"""N, F, S"""		clear cell renal carcinoma																																p.M673V		Atlas-SNP	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C	385	.	0			c.A2017G						.						90.0	83.0	85.0					X																	53230776		2203	4300	6503	SO:0001583	missense	8242	exon14			GCACCATGATGAA	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2017A>G	chrX.hg19:g.53230776T>C	ENSP00000364550:p.Met673Val	77.0	0.0		142.0	6.0	NM_004187	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	hg19	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.565255	0.45694	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.86769	-2.17;-1.88;-1.88;-1.88;-2.02	5.58	5.58	0.84498	.	0.091914	0.85682	D	0.000000	D	0.82981	0.5155	L	0.54965	1.715	0.37150	D	0.902132	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.002	T	0.81709	-0.0809	10	0.72032	D	0.01	-19.3333	8.1293	0.31018	0.1817:0.0:0.0:0.8183	.	606;672;673	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	V	606;673;672;673;632	ENSP00000445176:M606V;ENSP00000364550:M673V;ENSP00000385394:M672V;ENSP00000364528:M673V;ENSP00000364532:M632V	ENSP00000364528:M673V	M	-	1	0	KDM5C	53247501	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.675000	0.25232	1.864000	0.54056	0.486000	0.48141	ATG	.	.		0.567	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
MT-ND5	4540	hgsc.bcm.edu	37	M	12345	12345	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chrM:12345G>A	ENST00000361567.2	+	1	9	c.9G>A	c.(7-9)atG>atA	p.M3I	MT-TR_ENST00000387439.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	0					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GTAATAACCATGCACACTACT	0.403																																					p.M3M		Atlas-SNP	.											.	.	.	.	0			c.G9A						.																																			SO:0001583	missense	0	exon1			AACCATGCACACT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.9G>A	chrM.hg19:g.12345G>A	ENSP00000354813:p.Met3Ile	12.0	0.0		80.0	76.0	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
USP37	57695	hgsc.bcm.edu	37	2	219330793	219330794	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr2:219330793_219330794insA	ENST00000258399.3	-	21	2817_2818	c.2405_2406insT	c.(2404-2406)atgfs	p.M802fs	USP37_ENST00000415516.1_Frame_Shift_Ins_p.M708fs|USP37_ENST00000454775.1_Frame_Shift_Ins_p.M802fs|USP37_ENST00000418019.1_Frame_Shift_Ins_p.M802fs	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	802	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		TTTCACGCTCCATATCATACTG	0.421																																					p.M802fs		Atlas-INDEL	.											.	USP37	76	.	0			c.2406_2407insT						.																																			SO:0001589	frameshift_variant	57695	exon21			.	AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.2406dupT	chr2.hg19:g.219330794_219330794dupA	ENSP00000258399:p.Met802fs	43.0	0.0		60.0	23.0	NM_020935	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Frame_Shift_Ins	INS	ENST00000258399.3	hg19	CCDS2418.1																																																																																			.	.		0.421	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256779.3	NM_020935	
FBXL18	80028	hgsc.bcm.edu	37	7	5540596	5540605	+	Frame_Shift_Del	DEL	GCGCGGTCGG	GCGCGGTCGG	-			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	GCGCGGTCGG	GCGCGGTCGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr7:5540596_5540605delGCGCGGTCGG	ENST00000382368.3	-	3	1418_1427	c.1295_1304delCCGACCGCGC	c.(1294-1305)gccgaccgcgcgfs	p.ADRA432fs	FBXL18_ENST00000453700.3_Frame_Shift_Del_p.ADRA432fs	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	432									FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		ctgggcgggcgcgcggtcggcgcgcggcgc	0.743																																					p.432_435del		Atlas-INDEL	.											.	FBXL18	99	.	0			c.1296_1305del						.																																			SO:0001589	frameshift_variant	80028	exon3			.	AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.1295_1304delCCGACCGCGC	chr7.hg19:g.5540596_5540605delGCGCGGTCGG	ENSP00000371805:p.Ala432fs	37.0	0.0		73.0	24.0	NM_024963	Q9BR90|Q9BTC7|Q9HAK7	Frame_Shift_Del	DEL	ENST00000382368.3	hg19	CCDS43546.1																																																																																			.	.		0.743	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1	NM_024963	
MYO16	23026	hgsc.bcm.edu	37	13	109644729	109644729	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr13:109644729delA	ENST00000357550.2	+	20	2350	c.2309delA	c.(2308-2310)cagfs	p.Q770fs	MYO16_ENST00000251041.5_Frame_Shift_Del_p.Q770fs|MYO16_ENST00000457511.2_Frame_Shift_Del_p.Q282fs|MYO16_ENST00000356711.2_Frame_Shift_Del_p.Q770fs	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TTCAGCATGCAGACATTGGAT	0.338																																					p.Q792fs		Atlas-INDEL	.											.	MYO16	285	.	0			c.2374delC						.						177.0	166.0	170.0					13																	109644729		2202	4299	6501	SO:0001589	frameshift_variant	23026	exon21			.		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.2309delA	chr13.hg19:g.109644729delA	ENSP00000350160:p.Gln770fs	79.0	0.0		85.0	37.0	NM_001198950		Frame_Shift_Del	DEL	ENST00000357550.2	hg19	CCDS32008.1																																																																																			.	.		0.338	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
NCKAP1L	3071	hgsc.bcm.edu	37	12	54917217	54917223	+	Frame_Shift_Del	DEL	AAGAACA	AAGAACA	-	rs146187661	byFrequency	TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	AAGAACA	AAGAACA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr12:54917217_54917223delAAGAACA	ENST00000293373.6	+	19	1997_2003	c.1918_1924delAAGAACA	c.(1918-1926)aagaacaagfs	p.KNK640fs	NCKAP1L_ENST00000545638.2_Frame_Shift_Del_p.KNK590fs	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	640					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						CAGCAAAGCCAAGAACAAGAAAACCAG	0.498																																					p.639_641del		Atlas-INDEL	.											.	NCKAP1L	180	.	0			c.1917_1923del						.																																			SO:0001589	frameshift_variant	3071	exon19			.	AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.1918_1924delAAGAACA	chr12.hg19:g.54917217_54917223delAAGAACA	ENSP00000293373:p.Lys640fs	182.0	0.0		210.0	64.0	NM_005337	B4DUT5|Q52LW0	Frame_Shift_Del	DEL	ENST00000293373.6	hg19	CCDS31813.1																																																																																			.	.		0.498	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406195.1	NM_005337	
DDX60L	91351	hgsc.bcm.edu	37	4	169369922	169369922	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAW2-01A-11D-A40P-10	TCGA-DD-AAW2-10A-01D-A40P-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	91d7e3b8-5b43-4687-82e3-fd0f5f872589	8038b7be-ceb3-48e7-a9a2-b55e0e60721f	g.chr4:169369922delC	ENST00000511577.1	-	9	1252	c.1005delG	c.(1003-1005)tggfs	p.W335fs	DDX60L_ENST00000505890.1_Frame_Shift_Del_p.W335fs|DDX60L_ENST00000260184.7_Frame_Shift_Del_p.W335fs			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	335							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		AATATTCACACCACTTGTTCT	0.328																																					p.C336fs		Atlas-INDEL	.											.	DDX60L	116	.	0			c.1006delT						.						43.0	40.0	41.0					4																	169369922		1814	4062	5876	SO:0001589	frameshift_variant	91351	exon9			.	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.1005delG	chr4.hg19:g.169369922delC	ENSP00000422423:p.Trp335fs	377.0	0.0		376.0	176.0	NM_001012967	Q96ND6	Frame_Shift_Del	DEL	ENST00000511577.1	hg19																																																																																				.	.		0.328	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
