#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
AGMAT	79814	hgsc.bcm.edu	37	1	15909713	15909713	+	Silent	SNP	T	T	G			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr1:15909713T>G	ENST00000375826.3	-	2	592	c.450A>C	c.(448-450)gcA>gcC	p.A150A	RP4-680D5.2_ENST00000428945.1_RNA|DNAJC16_ENST00000483270.1_Intron	NM_024758.4	NP_079034.3	Q9BSE5	SPEB_HUMAN	agmatine ureohydrolase (agmatinase)	150					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|polyamine metabolic process (GO:0006595)|putrescine biosynthetic process from arginine (GO:0033388)|small molecule metabolic process (GO:0044281)|spermidine biosynthetic process (GO:0008295)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	agmatinase activity (GO:0008783)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(6)|lung(2)|skin(1)	12		Breast(348;0.000207)|Colorectal(325;0.000258)|Lung NSC(340;0.000359)|all_lung(284;0.000486)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.93e-07)|COAD - Colon adenocarcinoma(227;3.91e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000121)|KIRC - Kidney renal clear cell carcinoma(229;0.00257)|STAD - Stomach adenocarcinoma(313;0.00734)|READ - Rectum adenocarcinoma(331;0.0649)		TACAGCCAGCTGCTACAATTT	0.493																																					p.A150A	NSCLC(126;1678 1780 25805 43508 49531)	Atlas-SNP	.											.	AGMAT	25	.	0			c.A450C						.						59.0	60.0	60.0					1																	15909713		2203	4300	6503	SO:0001819	synonymous_variant	79814	exon2			GCCAGCTGCTACA	AY057097	CCDS160.1	1p36.13	2009-01-05			ENSG00000116771	ENSG00000116771			18407	protein-coding gene	gene with protein product						11804860, 14648699, 11914032	Standard	NM_024758		Approved	FLJ23384	uc001awv.2	Q9BSE5	OTTHUMG00000002357	ENST00000375826.3:c.450A>C	chr1.hg19:g.15909713T>G		53.0	0.0		64.0	10.0	NM_024758	Q5TDH1|Q9H5J3	Silent	SNP	ENST00000375826.3	hg19	CCDS160.1																																																																																			.	.		0.493	AGMAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006763.1	NM_024758	
LRRIQ3	127255	hgsc.bcm.edu	37	1	74507289	74507289	+	Silent	SNP	A	A	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr1:74507289A>T	ENST00000395089.1	-	6	1325	c.1326T>A	c.(1324-1326)gtT>gtA	p.V442V	LRRIQ3_ENST00000354431.4_Silent_p.V442V			A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	442										NS(2)|breast(1)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(13)|liver(1)|lung(27)|ovary(3)|prostate(1)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(5)	73						CCATGGCTACAACTCTTACTT	0.333																																					p.V442V		Atlas-SNP	.											.	LRRIQ3	146	.	0			c.T1326A						.						208.0	191.0	197.0					1																	74507289		1843	4095	5938	SO:0001819	synonymous_variant	127255	exon7			GGCTACAACTCTT	BX647210	CCDS41350.1	1p31.1	2008-06-12	2008-06-12	2008-06-12	ENSG00000162620	ENSG00000162620			28318	protein-coding gene	gene with protein product			"""leucine rich repeat containing 44"""	LRRC44		12477932	Standard	NM_001105659		Approved	MGC22773	uc001dfy.4	A6PVS8	OTTHUMG00000009508	ENST00000395089.1:c.1326T>A	chr1.hg19:g.74507289A>T		44.0	0.0		42.0	4.0	NM_001105659	A6PVS9|Q6P5P7|Q6ZMV4|Q8WUE0	Silent	SNP	ENST00000395089.1	hg19	CCDS41350.1																																																																																			.	.		0.333	LRRIQ3-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316539.1	NM_145258	
CNTN2	6900	hgsc.bcm.edu	37	1	205041630	205041630	+	Silent	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr1:205041630C>A	ENST00000331830.4	+	21	3035	c.2751C>A	c.(2749-2751)ggC>ggA	p.G917G		NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	917	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GACCTCCTGGCAACATCTCCT	0.552																																					p.G917G	Melanoma(183;2548 2817 37099 41192)	Atlas-SNP	.											.	CNTN2	116	.	0			c.C2751A						.						72.0	71.0	71.0					1																	205041630		2203	4300	6503	SO:0001819	synonymous_variant	6900	exon21			TCCTGGCAACATC	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.2751C>A	chr1.hg19:g.205041630C>A		72.0	0.0		80.0	8.0	NM_005076	P78432|Q5T054	Silent	SNP	ENST00000331830.4	hg19	CCDS1449.1																																																																																			.	.		0.552	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
ADCY2	108	hgsc.bcm.edu	37	5	7396525	7396525	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr5:7396525G>A	ENST00000338316.4	+	1	205	c.116G>A	c.(115-117)tGc>tAc	p.C39Y		NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	39					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						TCCTACTACTGCATGAGCCAG	0.701																																					p.C39Y		Atlas-SNP	.											.	ADCY2	337	.	0			c.G116A						.						44.0	36.0	39.0					5																	7396525		2203	4300	6503	SO:0001583	missense	108	exon1			ACTACTGCATGAG	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.116G>A	chr5.hg19:g.7396525G>A	ENSP00000342952:p.Cys39Tyr	94.0	0.0		63.0	4.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	hg19	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	G	1.084	-0.665988	0.03428	.	.	ENSG00000078295	ENST00000338316	T	0.76060	-0.99	3.51	3.51	0.40186	.	0.209765	0.40064	U	0.001190	T	0.56804	0.2010	L	0.29908	0.895	0.80722	D	1	B	0.12630	0.006	B	0.09377	0.004	T	0.50996	-0.8761	10	0.05436	T	0.98	.	12.1741	0.54176	0.0:0.0:1.0:0.0	.	39	Q08462	ADCY2_HUMAN	Y	39	ENSP00000342952:C39Y	ENSP00000342952:C39Y	C	+	2	0	ADCY2	7449525	1.000000	0.71417	0.979000	0.43373	0.352000	0.29268	7.804000	0.85993	1.475000	0.48197	0.305000	0.20034	TGC	.	.		0.701	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33891885	33891885	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr5:33891885T>C	ENST00000504830.1	-	1	412	c.77A>G	c.(76-78)tAt>tGt	p.Y26C	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.Y26C|ADAMTS12_ENST00000515401.1_Missense_Mutation_p.Y26C	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	26					cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						CTGTCTCCCATAGCAAAGCGC	0.512										HNSCC(64;0.19)																											p.Y26C		Atlas-SNP	.											.	ADAMTS12	464	.	0			c.A77G						.						107.0	115.0	112.0					5																	33891885		2203	4300	6503	SO:0001583	missense	81792	exon1			CTCCCATAGCAAA	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.77A>G	chr5.hg19:g.33891885T>C	ENSP00000422554:p.Tyr26Cys	353.0	0.0		361.0	22.0	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	hg19	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	T	9.105	1.005063	0.19199	.	.	ENSG00000151388	ENST00000504830;ENST00000352040;ENST00000515401	T;T;T	0.58940	0.3;0.3;2.87	5.61	0.551	0.17225	.	1.661270	0.02918	N	0.137613	T	0.36082	0.0954	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.19647	-1.0299	10	0.40728	T	0.16	.	3.8638	0.09007	0.1494:0.248:0.0:0.6026	.	26;26;26	P58397-3;D6REX0;P58397	.;.;ATS12_HUMAN	C	26	ENSP00000422554:Y26C;ENSP00000344847:Y26C;ENSP00000421638:Y26C	ENSP00000344847:Y26C	Y	-	2	0	ADAMTS12	33927642	0.021000	0.18746	0.005000	0.12908	0.703000	0.40648	0.365000	0.20348	0.077000	0.16863	0.477000	0.44152	TAT	.	.		0.512	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
OR11A1	26531	hgsc.bcm.edu	37	6	29395394	29395394	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr6:29395394C>T	ENST00000377149.1	-	5	497	c.25G>A	c.(25-27)Gaa>Aaa	p.E9K	OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377147.2_Missense_Mutation_p.E9K|OR11A1_ENST00000377148.1_Missense_Mutation_p.E9K			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						GTAATAGTTTCGTTTCCTGTG	0.393																																					p.E9K		Atlas-SNP	.											.	OR11A1	30	.	0			c.G25A						.						60.0	58.0	59.0					6																	29395394		1509	2709	4218	SO:0001583	missense	26531	exon1			TAGTTTCGTTTCC		CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.25G>A	chr6.hg19:g.29395394C>T	ENSP00000366354:p.Glu9Lys	68.0	0.0		89.0	6.0	NM_013937	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Missense_Mutation	SNP	ENST00000377149.1	hg19	CCDS34363.1	.	.	.	.	.	.	.	.	.	.	c	6.981	0.551005	0.13374	.	.	ENSG00000204694	ENST00000377148;ENST00000377149;ENST00000377147	T;T;T	0.00333	8.07;8.07;8.07	3.66	-0.976	0.10286	.	.	.	.	.	T	0.00039	0.0001	N	0.17248	0.465	0.09310	N	1	B	0.17038	0.02	B	0.06405	0.002	T	0.04537	-1.0944	9	0.38643	T	0.18	0.5553	10.4396	0.44457	0.0:0.5807:0.2074:0.212	.	9	Q9GZK7	O11A1_HUMAN	K	9	ENSP00000366353:E9K;ENSP00000366354:E9K;ENSP00000366352:E9K	ENSP00000366352:E9K	E	-	1	0	OR11A1	29503373	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.993000	0.03720	-1.263000	0.02455	-2.938000	0.00087	GAA	.	.		0.393	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000193778.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152536122	152536122	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr6:152536122A>T	ENST00000367255.5	-	122	22866	c.22265T>A	c.(22264-22266)tTg>tAg	p.L7422*	SYNE1_ENST00000448038.1_Nonsense_Mutation_p.L7351*|SYNE1_ENST00000341594.5_Nonsense_Mutation_p.L7034*|SYNE1_ENST00000265368.4_Nonsense_Mutation_p.L7422*|SYNE1_ENST00000356820.4_Nonsense_Mutation_p.L1946*|SYNE1_ENST00000423061.1_Nonsense_Mutation_p.L7351*	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7422					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTATCATTCAAGGGTAACCT	0.393										HNSCC(10;0.0054)																											p.L7422X		Atlas-SNP	.											.	SYNE1	3227	.	0			c.T22265A						.						157.0	148.0	151.0					6																	152536122		2203	4300	6503	SO:0001587	stop_gained	23345	exon122			TCATTCAAGGGTA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.22265T>A	chr6.hg19:g.152536122A>T	ENSP00000356224:p.Leu7422*	81.0	0.0		75.0	4.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Nonsense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	A	49	15.221097	0.99826	.	.	ENSG00000131018	ENST00000367255;ENST00000367257;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	.	.	.	5.97	5.97	0.96955	.	0.000000	0.47455	D	0.000231	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4461	0.83932	1.0:0.0:0.0:0.0	.	.	.	.	X	7422;68;7351;7422;7351;7034;1946;344	.	ENSP00000265368:L7422X	L	-	2	0	SYNE1	152577815	1.000000	0.71417	0.976000	0.42696	0.944000	0.59088	9.276000	0.95745	2.285000	0.76669	0.528000	0.53228	TTG	.	.		0.393	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
RHBDD2	57414	hgsc.bcm.edu	37	7	75511359	75511359	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr7:75511359G>T	ENST00000006777.6	+	2	526	c.391G>T	c.(391-393)Gat>Tat	p.D131Y	RHBDD2_ENST00000428119.1_5'Flank|RHBDD2_ENST00000318622.4_5'UTR|RHBDD2_ENST00000468304.1_Intron	NM_001040456.1	NP_001035546.1	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2	131						Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|lung(4)|prostate(1)	6						GGAAGTGGAGGATGCCAGAGG	0.582																																					p.D131Y		Atlas-SNP	.											.	RHBDD2	49	.	0			c.G391T						.						121.0	129.0	127.0					7																	75511359		2149	4253	6402	SO:0001583	missense	57414	exon2			GTGGAGGATGCCA	AF226732	CCDS43602.1, CCDS43603.1	7q11	2008-09-04	2006-02-22	2006-02-22	ENSG00000005486	ENSG00000005486			23082	protein-coding gene	gene with protein product		615203	"""rhomboid, veinlet-like 7 (Drosophila)"""	RHBDL7		12838346	Standard	XM_005250511		Approved	NPD007	uc003udw.1	Q6NTF9	OTTHUMG00000156435	ENST00000006777.6:c.391G>T	chr7.hg19:g.75511359G>T	ENSP00000006777:p.Asp131Tyr	225.0	0.0		258.0	21.0	NM_001040456	Q7L534|Q9H5W6|Q9HBK7|Q9UDT2	Missense_Mutation	SNP	ENST00000006777.6	hg19	CCDS43602.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459677	0.63401	.	.	ENSG00000005486	ENST00000006777;ENST00000413229	T	0.13657	2.57	5.1	5.1	0.69264	Peptidase S54, rhomboid domain (1);	0.497273	0.21411	N	0.074974	T	0.20455	0.0492	N	0.22421	0.69	0.80722	D	1	D	0.56287	0.975	P	0.59948	0.866	T	0.00759	-1.1578	10	0.49607	T	0.09	-8.2077	13.43	0.61049	0.0:0.1572:0.8428:0.0	.	131	Q6NTF9	RHBD2_HUMAN	Y	131;176	ENSP00000006777:D131Y	ENSP00000006777:D131Y	D	+	1	0	RHBDD2	75349295	1.000000	0.71417	0.999000	0.59377	0.832000	0.47134	3.425000	0.52771	2.652000	0.90054	0.655000	0.94253	GAT	.	.		0.582	RHBDD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344176.1	NM_020684	
ZNF862	643641	hgsc.bcm.edu	37	7	149558968	149558968	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr7:149558968T>A	ENST00000223210.4	+	7	2964	c.2719T>A	c.(2719-2721)Ttg>Atg	p.L907M	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	907					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						CGGCATCTGCTTGGACAAACT	0.612																																					p.L907M		Atlas-SNP	.											.	ZNF862	97	.	0			c.T2719A						.						60.0	64.0	63.0					7																	149558968		2036	4204	6240	SO:0001583	missense	643641	exon7			ATCTGCTTGGACA	AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.2719T>A	chr7.hg19:g.149558968T>A	ENSP00000223210:p.Leu907Met	103.0	0.0		101.0	5.0	NM_001099220	A0AUL8	Missense_Mutation	SNP	ENST00000223210.4	hg19	CCDS47741.1	.	.	.	.	.	.	.	.	.	.	T	10.86	1.470352	0.26423	.	.	ENSG00000106479	ENST00000223210	T	0.01159	5.25	5.39	-5.56	0.02529	.	0.000000	0.42172	D	0.000754	T	0.02571	0.0078	N	0.20986	0.625	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.00891	-1.1525	10	0.42905	T	0.14	-18.9508	19.4009	0.94629	0.0:0.8501:0.0:0.1499	.	907	O60290	ZN862_HUMAN	M	907	ENSP00000223210:L907M	ENSP00000223210:L907M	L	+	1	2	ZNF862	149189901	0.001000	0.12720	0.002000	0.10522	0.363000	0.29612	-1.068000	0.03447	-1.143000	0.02866	-0.264000	0.10439	TTG	.	.		0.612	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350165.1	NM_001099220	
CSMD1	64478	hgsc.bcm.edu	37	8	2949136	2949136	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr8:2949136G>A	ENST00000520002.1	-	49	7745	c.7190C>T	c.(7189-7191)aCt>aTt	p.T2397I	CSMD1_ENST00000602557.1_Missense_Mutation_p.T2397I|CSMD1_ENST00000537824.1_Missense_Mutation_p.T2396I|CSMD1_ENST00000602723.1_Missense_Mutation_p.T2397I|CSMD1_ENST00000400186.3_Missense_Mutation_p.T2397I|CSMD1_ENST00000542608.1_Missense_Mutation_p.T2396I			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	2397	CUB 14. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGATTGTTCAGTATGATTCCC	0.413																																					p.T2396I		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C7187T						.						101.0	94.0	96.0					8																	2949136		1847	4085	5932	SO:0001583	missense	64478	exon48			TGTTCAGTATGAT			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.7190C>T	chr8.hg19:g.2949136G>A	ENSP00000430733:p.Thr2397Ile	29.0	0.0		32.0	4.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	G	11.39	1.625372	0.28889	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	5.8	4.91	0.64330	CUB (5);	0.073354	0.56097	D	0.000027	T	0.29256	0.0728	L	0.50919	1.6	0.80722	D	1	B;B;P	0.48911	0.317;0.14;0.917	B;B;P	0.52386	0.376;0.311;0.697	T	0.01557	-1.1325	10	0.48119	T	0.1	.	16.7039	0.85366	0.0:0.1297:0.8703:0.0	.	2397;2397;2396	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	I	2397;2397;2258;2396;2396	ENSP00000383047:T2397I;ENSP00000430733:T2397I;ENSP00000441462:T2396I;ENSP00000446243:T2396I	ENSP00000320445:T2258I	T	-	2	0	CSMD1	2936543	1.000000	0.71417	0.715000	0.30552	0.032000	0.12392	6.321000	0.72881	1.407000	0.46875	0.555000	0.69702	ACT	.	.		0.413	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
ODF1	4956	hgsc.bcm.edu	37	8	103572783	103572783	+	Silent	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr8:103572783C>A	ENST00000285402.3	+	2	580	c.424C>A	c.(424-426)Cga>Aga	p.R142R	ODF1_ENST00000518835.1_5'UTR	NM_024410.3	NP_077721.2	Q14990	ODFP1_HUMAN	outer dense fiber of sperm tails 1	142					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|outer dense fiber (GO:0001520)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(14;2.76e-05)|all_epithelial(15;4.54e-08)|Lung NSC(17;4.08e-05)|all_lung(17;9.15e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000125)|STAD - Stomach adenocarcinoma(118;0.0826)			AGTCAAAGTTCGAGTGAAGGA	0.448																																					p.R142R		Atlas-SNP	.											.	ODF1	55	.	0			c.C424A						.						170.0	150.0	157.0					8																	103572783		2203	4300	6503	SO:0001819	synonymous_variant	4956	exon2			AAAGTTCGAGTGA	M93131	CCDS6293.1	8q22	2011-09-05	2002-10-21		ENSG00000155087	ENSG00000155087		"""Heat shock proteins / HSPB"""	8113	protein-coding gene	gene with protein product	"""cancer/testis antigen 133"""	182878	"""outer dense fibre of sperm tails 1"""			8305202	Standard	NM_024410		Approved	ODFPG, ODF27, RT7, HSPB10, CT133	uc003ykt.2	Q14990	OTTHUMG00000164719	ENST00000285402.3:c.424C>A	chr8.hg19:g.103572783C>A		192.0	0.0		245.0	13.0	NM_024410	Q3SX72	Silent	SNP	ENST00000285402.3	hg19	CCDS6293.1																																																																																			.	.		0.448	ODF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379884.1		
TMOD1	7111	hgsc.bcm.edu	37	9	100325046	100325046	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr9:100325046C>T	ENST00000259365.4	+	5	643	c.430C>T	c.(430-432)Cag>Tag	p.Q144*	TMOD1_ENST00000375175.1_Nonsense_Mutation_p.Q17*|TMOD1_ENST00000395211.2_Nonsense_Mutation_p.Q144*	NM_003275.3	NP_003266.1	P28289	TMOD1_HUMAN	tropomodulin 1	144					adult locomotory behavior (GO:0008344)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)	cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|membrane (GO:0016020)|myofibril (GO:0030016)				breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(2)|urinary_tract(1)	11		Acute lymphoblastic leukemia(62;0.154)		STAD - Stomach adenocarcinoma(157;0.105)		CATGAGTAACCAGCAGTACTA	0.592																																					p.Q144X		Atlas-SNP	.											.	TMOD1	29	.	0			c.C430T						.						164.0	145.0	152.0					9																	100325046		2203	4300	6503	SO:0001587	stop_gained	7111	exon5			AGTAACCAGCAGT		CCDS6726.1	9q22	2008-07-21		2003-03-21	ENSG00000136842	ENSG00000136842			11871	protein-coding gene	gene with protein product		190930		D9S57E, TMOD		1370827, 8661028	Standard	NM_003275		Approved	ETMOD	uc004axl.2	P28289	OTTHUMG00000020325	ENST00000259365.4:c.430C>T	chr9.hg19:g.100325046C>T	ENSP00000259365:p.Gln144*	106.0	0.0		113.0	6.0	NM_001166116	B2RB77|Q5T7W3|Q9BUF1	Nonsense_Mutation	SNP	ENST00000259365.4	hg19	CCDS6726.1	.	.	.	.	.	.	.	.	.	.	C	38	6.960216	0.97964	.	.	ENSG00000136842	ENST00000395211;ENST00000259365;ENST00000375175	.	.	.	4.72	4.72	0.59763	.	0.155442	0.44285	D	0.000464	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.9597	18.1729	0.89752	0.0:1.0:0.0:0.0	.	.	.	.	X	144;144;17	.	ENSP00000259365:Q144X	Q	+	1	0	TMOD1	99364867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.293000	0.43558	2.580000	0.87095	0.655000	0.94253	CAG	.	.		0.592	TMOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053320.2	NM_003275	
OR51A4	401666	hgsc.bcm.edu	37	11	4967860	4967860	+	Silent	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr11:4967860C>A	ENST00000380373.2	-	1	496	c.471G>T	c.(469-471)ctG>ctT	p.L157L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001005329.1	NP_001005329.1	Q8NGJ6	O51A4_HUMAN	olfactory receptor, family 51, subfamily A, member 4	157						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L157L(1)		large_intestine(3)|lung(15)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	29		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AGGGAAGAACCAGGAGCATGC	0.438																																					p.L157L		Atlas-SNP	.											OR51A4,NS,carcinoma,-2,1	OR51A4	73	.	1	Substitution - coding silent(1)	lung(1)	c.G471T						.						181.0	176.0	177.0					11																	4967860		2191	4266	6457	SO:0001819	synonymous_variant	401666	exon1			AAGAACCAGGAGC	AB065798	CCDS31367.1	11p15.4	2012-08-09			ENSG00000205497	ENSG00000205497		"""GPCR / Class A : Olfactory receptors"""	14795	protein-coding gene	gene with protein product							Standard	NM_001005329		Approved		uc010qys.2	Q8NGJ6	OTTHUMG00000066614	ENST00000380373.2:c.471G>T	chr11.hg19:g.4967860C>A		206.0	0.0		237.0	13.0	NM_001005329		Silent	SNP	ENST00000380373.2	hg19	CCDS31367.1																																																																																			.	.		0.438	OR51A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142821.1	NM_001005329	
OR8B4	283162	hgsc.bcm.edu	37	11	124294075	124294075	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr11:124294075C>T	ENST00000356130.3	-	1	714	c.693G>A	c.(691-693)gaG>gaA	p.E231E		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGGATCTGCCCTCTGCAGAAG	0.438																																					p.E231E		Atlas-SNP	.											.	OR8B4	60	.	0			c.G693A						.						76.0	72.0	74.0					11																	124294075		2201	4299	6500	SO:0001819	synonymous_variant	283162	exon1			TCTGCCCTCTGCA	AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.693G>A	chr11.hg19:g.124294075C>T		92.0	0.0		98.0	4.0	NM_001005196	B2RNF8|Q6IFQ7	Silent	SNP	ENST00000356130.3	hg19	CCDS31710.1																																																																																			.	.		0.438	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387055.1	NM_001005196	
HEATR3	55027	hgsc.bcm.edu	37	16	50106573	50106573	+	Silent	SNP	G	G	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr16:50106573G>T	ENST00000299192.7	+	5	761	c.570G>T	c.(568-570)gtG>gtT	p.V190V	HEATR3_ENST00000285767.4_Silent_p.V104V	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	190										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TGGAGATTGTGTTAAAGTATT	0.338																																					p.V190V		Atlas-SNP	.											.	HEATR3	59	.	0			c.G570T						.						205.0	192.0	197.0					16																	50106573		2198	4300	6498	SO:0001819	synonymous_variant	55027	exon5			GATTGTGTTAAAG	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.570G>T	chr16.hg19:g.50106573G>T		130.0	0.0		82.0	5.0	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Silent	SNP	ENST00000299192.7	hg19	CCDS10739.1																																																																																			.	.		0.338	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
ASIC2	40	hgsc.bcm.edu	37	17	32483120	32483120	+	Silent	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr17:32483120C>T	ENST00000359872.6	-	1	1193	c.432G>A	c.(430-432)aaG>aaA	p.K144K		NM_001094.4	NP_001085.2	Q16515	ASIC2_HUMAN	acid-sensing (proton-gated) ion channel 2	144					central nervous system development (GO:0007417)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|ion transmembrane transport (GO:0034220)|monovalent inorganic cation transport (GO:0015672)|negative regulation of apoptotic process (GO:0043066)|peripheral nervous system development (GO:0007422)|phototransduction (GO:0007602)|positive regulation of synapse assembly (GO:0051965)|protein localization to synapse (GO:0035418)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of membrane potential (GO:0042391)|regulation of systemic arterial blood pressure by aortic arch baroreceptor feedback (GO:0003026)|regulation of vasoconstriction (GO:0019229)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|sensory perception of sound (GO:0007605)|sensory perception of sour taste (GO:0050915)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ion gated channel activity (GO:0022839)|ligand-gated sodium channel activity (GO:0015280)|voltage-gated sodium channel activity (GO:0005248)									Amiloride(DB00594)	GTTTGTAGTGCTTGAAGTTGG	0.592																																					p.K144K		Atlas-SNP	.											.	.	.	.	0			c.G432A						.						97.0	105.0	103.0					17																	32483120		2136	4256	6392	SO:0001819	synonymous_variant	40	exon1			GTAGTGCTTGAAG	AL834182	CCDS11276.1, CCDS42296.1	17q11.2-q12	2012-02-23	2012-02-22	2012-02-22	ENSG00000108684	ENSG00000108684		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	99	protein-coding gene	gene with protein product	"""degenerin"""	601784	"""amiloride-sensitive cation channel 1, neuronal"""	ACCN, ACCN1		8921408	Standard	NM_183377		Approved	ASIC2a, BNC1, BNaC1, hBNaC1, MDEG	uc002hhu.3	Q16515	OTTHUMG00000132885	ENST00000359872.6:c.432G>A	chr17.hg19:g.32483120C>T		135.0	0.0		180.0	14.0	NM_001094	E9PBX2|Q13553|Q6DJU1|Q8N3E2	Silent	SNP	ENST00000359872.6	hg19	CCDS42296.1																																																																																			.	.		0.592	ASIC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447552.1	NM_183377, NM_001094	
CA4	762	hgsc.bcm.edu	37	17	58235740	58235740	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr17:58235740C>T	ENST00000300900.4	+	7	776	c.677C>T	c.(676-678)aCa>aTa	p.T226I		NM_000717.3	NP_000708.1	P22748	CAH4_HUMAN	carbonic anhydrase IV	226	Substrate binding. {ECO:0000305}.				bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|organ development (GO:0048513)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)|transport vesicle membrane (GO:0030658)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(2)|lung(5)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.83e-12)|all cancers(12;6.83e-11)		Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diclofenamide(DB01144)|Dorzolamide(DB00869)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methazolamide(DB00703)|Methyclothiazide(DB00232)|Topiramate(DB00273)|Trichlormethiazide(DB01021)|Zonisamide(DB00909)	TCACTCACCACACCGACCTGC	0.602																																					p.T226I		Atlas-SNP	.											.	CA4	20	.	0			c.C677T						.						110.0	83.0	92.0					17																	58235740		2203	4300	6503	SO:0001583	missense	762	exon7			TCACCACACCGAC	L10955	CCDS11624.1	17q23.1	2012-08-21			ENSG00000167434	ENSG00000167434	4.2.1.1	"""Carbonic anhydrases"""	1375	protein-coding gene	gene with protein product		114760	"""retinitis pigmentosa 17 (autosomal dominant)"""	RP17		8325641	Standard	NM_000717		Approved	CAIV, Car4	uc002iym.4	P22748		ENST00000300900.4:c.677C>T	chr17.hg19:g.58235740C>T	ENSP00000300900:p.Thr226Ile	103.0	0.0		130.0	8.0	NM_000717	B4DQA4|Q6FHI7	Missense_Mutation	SNP	ENST00000300900.4	hg19	CCDS11624.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996852	0.74818	.	.	ENSG00000167434	ENST00000300900	T	0.77229	-1.08	5.54	5.54	0.83059	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.85682	D	0.000000	D	0.89570	0.6753	H	0.95679	3.705	0.80722	D	1	D	0.67145	0.996	P	0.56514	0.8	D	0.92413	0.5939	10	0.87932	D	0	.	14.9783	0.71293	0.0:1.0:0.0:0.0	.	226	P22748	CAH4_HUMAN	I	226	ENSP00000300900:T226I	ENSP00000300900:T226I	T	+	2	0	CA4	55590522	0.998000	0.40836	0.957000	0.39632	0.626000	0.37791	4.321000	0.59209	2.589000	0.87451	0.491000	0.48974	ACA	.	.		0.602	CA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449189.1	NM_000717	
DNAH17	8632	hgsc.bcm.edu	37	17	76451796	76451796	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr17:76451796C>T	ENST00000585328.1	-	63	10209	c.10085G>A	c.(10084-10086)gGc>gAc	p.G3362D	DNAH17_ENST00000586052.1_Intron|DNAH17_ENST00000389840.5_Missense_Mutation_p.G3353D	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3353					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GGTGAAGTAGCCCACGTAGGA	0.537																																					p.G3367D		Atlas-SNP	.											.	DNAH17	347	.	0			c.G10100A						.						79.0	62.0	68.0					17																	76451796		2203	4299	6502	SO:0001583	missense	8632	exon63			AAGTAGCCCACGT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.10085G>A	chr17.hg19:g.76451796C>T	ENSP00000465516:p.Gly3362Asp	198.0	0.0		187.0	8.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	C	34	5.354418	0.95830	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	D	0.83075	-1.68	5.06	5.06	0.68205	.	0.093775	0.46758	D	0.000264	D	0.95294	0.8473	H	0.99169	4.455	0.58432	D	0.999997	D	0.67145	0.996	D	0.73708	0.981	D	0.97710	1.0190	10	0.87932	D	0	.	18.4429	0.90673	0.0:1.0:0.0:0.0	.	3362	E7EUM8	.	D	3362;3353	ENSP00000374490:G3353D	ENSP00000300671:G3362D	G	-	2	0	DNAH17	73963391	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.611000	0.82962	2.334000	0.79466	0.655000	0.94253	GGC	.	.		0.537	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
L3MBTL4	91133	hgsc.bcm.edu	37	18	6243330	6243330	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr18:6243330C>T	ENST00000284898.6	-	7	623	c.423G>A	c.(421-423)tgG>tgA	p.W141*	L3MBTL4_ENST00000400105.2_Nonsense_Mutation_p.W141*|L3MBTL4_ENST00000400104.3_Nonsense_Mutation_p.W141*|L3MBTL4_ENST00000535782.1_5'Flank|L3MBTL4_ENST00000317931.7_Nonsense_Mutation_p.W141*	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	141					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				TCTTTTCACACCATCCTACTG	0.383																																					p.W141X	Esophageal Squamous(41;748 902 17366 28959 43175)	Atlas-SNP	.											.	L3MBTL4	87	.	0			c.G423A						.						175.0	157.0	163.0					18																	6243330		2203	4300	6503	SO:0001587	stop_gained	91133	exon7			TTCACACCATCCT	BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.423G>A	chr18.hg19:g.6243330C>T	ENSP00000284898:p.Trp141*	109.0	0.0		118.0	5.0	NM_173464	A8MTL8|Q8IXS3	Nonsense_Mutation	SNP	ENST00000284898.6	hg19	CCDS11839.2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.046465	0.93740	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000400104	.	.	.	4.21	4.21	0.49690	.	0.000000	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4228	0.67196	0.0:1.0:0.0:0.0	.	.	.	.	X	141	.	ENSP00000284898:W141X	W	-	3	0	L3MBTL4	6233330	1.000000	0.71417	0.999000	0.59377	0.848000	0.48234	5.015000	0.64035	2.338000	0.79540	0.491000	0.48974	TGG	.	.		0.383	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254448.2	NM_173464	
MTCL1	23255	hgsc.bcm.edu	37	18	8824928	8824928	+	Silent	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr18:8824928G>A	ENST00000306329.11	+	13	4377	c.4377G>A	c.(4375-4377)cgG>cgA	p.R1459R	SOGA2_ENST00000518815.1_Silent_p.R465R|SOGA2_ENST00000306285.7_Silent_p.R465R|SOGA2_ENST00000400050.3_Silent_p.R1099R|SOGA2_ENST00000359865.3_Silent_p.R1140R|SOGA2_ENST00000517570.1_Silent_p.R1099R																							AGGTGGGGCGGGCAGGGCACG	0.617																																					p.R1140R		Atlas-SNP	.											.	.	.	.	0			c.G3420A						.						73.0	61.0	65.0					18																	8824928		2203	4300	6503	SO:0001819	synonymous_variant	23255	exon15			GGGGCGGGCAGGG																												ENST00000306329.11:c.4377G>A	chr18.hg19:g.8824928G>A		76.0	0.0		63.0	4.0	NM_015210		Silent	SNP	ENST00000306329.11	hg19																																																																																				.	.		0.617	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
MYO5B	4645	hgsc.bcm.edu	37	18	47390748	47390748	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr18:47390748C>A	ENST00000285039.7	-	28	3905	c.3606G>T	c.(3604-3606)agG>agT	p.R1202S	MYO5B_ENST00000587895.1_5'UTR|MYO5B_ENST00000324581.6_Missense_Mutation_p.R343S	NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	1202					endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CCAGCTCTTGCCTCTGGAAGA	0.577																																					p.R1202S		Atlas-SNP	.											.	MYO5B	178	.	0			c.G3606T						.						97.0	108.0	105.0					18																	47390748		1979	4148	6127	SO:0001583	missense	4645	exon28			CTCTTGCCTCTGG	AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.3606G>T	chr18.hg19:g.47390748C>A	ENSP00000285039:p.Arg1202Ser	47.0	0.0		47.0	4.0	NM_001080467	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	ENST00000285039.7	hg19	CCDS42436.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478980	0.63849	.	.	ENSG00000167306	ENST00000285039;ENST00000324581	T;T	0.05649	3.41;3.41	5.5	1.14	0.20703	.	0.000000	0.85682	D	0.000000	T	0.19565	0.0470	M	0.80183	2.485	0.53688	D	0.999973	P;D	0.89917	0.882;1.0	P;D	0.83275	0.521;0.996	T	0.16335	-1.0406	10	0.13853	T	0.58	.	10.3118	0.43712	0.0:0.6334:0.0:0.3666	.	1202;343	Q9ULV0;Q9H6Y6	MYO5B_HUMAN;.	S	1202;343	ENSP00000285039:R1202S;ENSP00000315531:R343S	ENSP00000285039:R1202S	R	-	3	2	MYO5B	45644746	0.766000	0.28496	0.998000	0.56505	0.902000	0.53008	-0.042000	0.12063	0.294000	0.22547	-0.224000	0.12420	AGG	.	.		0.577	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448515.2		
IRGC	56269	hgsc.bcm.edu	37	19	44223141	44223141	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr19:44223141G>A	ENST00000244314.5	+	2	630	c.431G>A	c.(430-432)cGc>cAc	p.R144H		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	144	IRG-type G.					membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				TCCCCCCGCCGCTGCGGGGCC	0.652																																					p.R144H	Colon(189;350 2037 11447 13433 38914)	Atlas-SNP	.											.	IRGC	67	.	0			c.G431A						.						12.0	12.0	12.0					19																	44223141		2114	4167	6281	SO:0001583	missense	56269	exon2			CCCGCCGCTGCGG	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.431G>A	chr19.hg19:g.44223141G>A	ENSP00000244314:p.Arg144His	42.0	0.0		18.0	9.0	NM_019612	Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	hg19	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.415973	0.62511	.	.	ENSG00000124449	ENST00000244314	T	0.27720	1.65	5.71	4.65	0.58169	.	0.000000	0.64402	D	0.000001	T	0.56232	0.1971	M	0.77406	2.37	0.46927	D	0.99925	D	0.89917	1.0	D	0.81914	0.995	T	0.61392	-0.7072	10	0.59425	D	0.04	.	14.4208	0.67183	0.0:0.1485:0.8515:0.0	.	144	Q6NXR0	IIGP5_HUMAN	H	144	ENSP00000244314:R144H	ENSP00000244314:R144H	R	+	2	0	IRGC	48914981	1.000000	0.71417	0.033000	0.17914	0.509000	0.34042	5.579000	0.67457	1.380000	0.46344	0.555000	0.69702	CGC	.	.		0.652	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612	
ZNF83	55769	hgsc.bcm.edu	37	19	53116801	53116801	+	Silent	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr19:53116801G>A	ENST00000597597.1	-	2	3270	c.1017C>T	c.(1015-1017)caC>caT	p.H339H	ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000544146.1_Silent_p.H339H|ZNF83_ENST00000391789.4_Silent_p.H311H|ZNF83_ENST00000536937.1_Silent_p.H339H|ZNF83_ENST00000545872.1_Silent_p.H339H|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000301096.3_Silent_p.H339H|ZNF83_ENST00000541777.2_Silent_p.H339H			P51522	ZNF83_HUMAN	zinc finger protein 83	339					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TCTCTCCAGTGTGGATTCTCC	0.418																																					p.H339H		Atlas-SNP	.											ZNF83,NS,carcinoma,0,2	ZNF83	73	.	0			c.C1017T						.						118.0	120.0	120.0					19																	53116801		2203	4300	6503	SO:0001819	synonymous_variant	55769	exon3			TCCAGTGTGGATT	M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.1017C>T	chr19.hg19:g.53116801G>A		92.0	2.0		99.0	9.0	NM_018300	A8MT75|Q3ZCX0|Q6PI08	Silent	SNP	ENST00000597597.1	hg19	CCDS12854.1																																																																																			.	.		0.418	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463700.1	NM_018300	
SRC	6714	hgsc.bcm.edu	37	20	36031248	36031248	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr20:36031248C>G	ENST00000373578.2	+	13	1716	c.1367C>G	c.(1366-1368)aCt>aGt	p.T456S	SRC_ENST00000373567.2_Missense_Mutation_p.T456S|SRC_ENST00000358208.4_Missense_Mutation_p.T456S|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000373558.2_Missense_Mutation_p.T462S|SRC_ENST00000360723.4_Missense_Mutation_p.T462S|SRC_ENST00000445403.1_Missense_Mutation_p.T456S	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase	456	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	ATCCTGCTGACTGAGCTCACC	0.602																																					p.T456S		Atlas-SNP	.											.	SRC	52	.	0			c.C1367G						.						111.0	98.0	102.0					20																	36031248		2203	4300	6503	SO:0001583	missense	6714	exon13			TGCTGACTGAGCT	AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.1367C>G	chr20.hg19:g.36031248C>G	ENSP00000362680:p.Thr456Ser	124.0	0.0		138.0	12.0	NM_005417	E1P5V4|Q76P87|Q86VB9|Q9H5A8	Missense_Mutation	SNP	ENST00000373578.2	hg19	CCDS13294.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.047008	0.75846	.	.	ENSG00000197122	ENST00000445403;ENST00000373578;ENST00000360723;ENST00000358208;ENST00000373567;ENST00000373558	D;D;D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63;-1.63;-1.63	4.63	4.63	0.57726	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75376	0.3841	N	0.11064	0.09	0.80722	D	1	P	0.51240	0.943	P	0.48552	0.581	T	0.80968	-0.1145	10	0.72032	D	0.01	.	15.3531	0.74405	0.0:1.0:0.0:0.0	.	456	P12931	SRC_HUMAN	S	456;456;462;456;456;462	ENSP00000408503:T456S;ENSP00000362680:T456S;ENSP00000353950:T462S;ENSP00000350941:T456S;ENSP00000362668:T456S;ENSP00000362659:T462S	ENSP00000350941:T456S	T	+	2	0	SRC	35464662	1.000000	0.71417	0.974000	0.42286	0.980000	0.70556	5.873000	0.69644	2.550000	0.86006	0.561000	0.74099	ACT	.	.		0.602	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268142.1	NM_005417	
KIAA0930	23313	hgsc.bcm.edu	37	22	45595761	45595761	+	Silent	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chr22:45595761G>A	ENST00000336156.5	-	8	1073	c.1008C>T	c.(1006-1008)gaC>gaT	p.D336D	KIAA0930_ENST00000474515.1_5'UTR|KIAA0930_ENST00000391627.2_Silent_p.D302D|KIAA0930_ENST00000251993.7_Silent_p.D341D|KIAA0930_ENST00000443310.3_Silent_p.D318D|MIR1249_ENST00000408671.1_RNA	NM_001009880.1	NP_001009880.1	Q6ICG6	K0930_HUMAN	KIAA0930	336										endometrium(1)|kidney(4)|large_intestine(2)|lung(7)|urinary_tract(1)	15						CACCTCCACCGTCGTCCTCCC	0.562																																					p.D341D		Atlas-SNP	.											.	KIAA0930	43	.	0			c.C1023T						.						98.0	94.0	96.0					22																	45595761		2203	4300	6503	SO:0001819	synonymous_variant	23313	exon8			TCCACCGTCGTCC	AK025608	CCDS33665.1, CCDS33666.1	22q13.31	2011-02-23	2011-02-23	2011-02-23	ENSG00000100364	ENSG00000100364			1314	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 9"""	C22orf9		10231032	Standard	NM_015264		Approved	bK268H5.C22.1	uc003bfw.1	Q6ICG6	OTTHUMG00000151263	ENST00000336156.5:c.1008C>T	chr22.hg19:g.45595761G>A		69.0	0.0		74.0	4.0	NM_015264	B0QY17|B0QY19|B3KT48|Q6ZVE5|Q7Z6K9|Q8IZ76|Q9Y2E2	Silent	SNP	ENST00000336156.5	hg19	CCDS33665.1																																																																																			.	.		0.562	KIAA0930-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321975.2	NM_001009880	
CXorf58	254158	hgsc.bcm.edu	37	X	23934445	23934445	+	Splice_Site	SNP	G	G	A			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chrX:23934445G>A	ENST00000379211.3	+	5	972	c.423G>A	c.(421-423)aaG>aaA	p.K141K		NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	141										breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						CGTCAAGTAAGGTGACGTTTC	0.299																																					p.K141K		Atlas-SNP	.											.	CXorf58	53	.	0			c.G423A						.						106.0	93.0	97.0					X																	23934445		2202	4298	6500	SO:0001630	splice_region_variant	254158	exon5			AAGTAAGGTGACG	AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.423+1G>A	chrX.hg19:g.23934445G>A		143.0	0.0		152.0	9.0	NM_152761		Silent	SNP	ENST00000379211.3	hg19	CCDS14209.1	.	.	.	.	.	.	.	.	.	.	g	8.504	0.864873	0.17250	.	.	ENSG00000165182	ENST00000435707	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	T	0.70272	0.3205	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69914	-0.5016	4	.	.	.	-1.6058	14.2859	0.66245	0.0:0.0:1.0:0.0	.	.	.	.	S	115	.	.	G	+	1	0	CXorf58	23844366	1.000000	0.71417	0.869000	0.34112	0.261000	0.26267	5.194000	0.65125	2.064000	0.61679	0.411000	0.27672	GGT	.	.		0.299	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	Silent
DMD	1756	hgsc.bcm.edu	37	X	31525469	31525469	+	Silent	SNP	G	G	T			TCGA-ED-A5KG-01A-11D-A27I-10	TCGA-ED-A5KG-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9c986f8b-3eb9-493f-89a4-c408397dd414	f9ce62ee-6802-40bc-8021-23159fb6d4eb	g.chrX:31525469G>T	ENST00000357033.4	-	56	8525	c.8319C>A	c.(8317-8319)gtC>gtA	p.V2773V	DMD_ENST00000445312.1_5'UTR|DMD_ENST00000359836.1_Silent_p.V313V|DMD_ENST00000541735.1_Silent_p.V313V|DMD_ENST00000474231.1_Silent_p.V313V|DMD_ENST00000378707.3_Silent_p.V313V|DMD_ENST00000343523.2_Silent_p.V313V|DMD_ENST00000378677.2_Silent_p.V2769V	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2773					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTTGTAACAGGACTGCATCAT	0.423																																					p.V2773V		Atlas-SNP	.											.	DMD	2127	.	0			c.C8319A						.						181.0	146.0	158.0					X																	31525469		2202	4300	6502	SO:0001819	synonymous_variant	1756	exon56			TAACAGGACTGCA	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8319C>A	chrX.hg19:g.31525469G>T		133.0	0.0		166.0	8.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	G	4.269	0.049096	0.08243	.	.	ENSG00000198947	ENST00000465285	.	.	.	5.68	3.89	0.44902	.	.	.	.	.	T	0.45094	0.1325	.	.	.	0.30887	N	0.730797	.	.	.	.	.	.	T	0.47812	-0.9088	4	.	.	.	.	9.5377	0.39233	0.0754:0.0:0.781:0.1437	.	.	.	.	T	502	.	.	P	-	1	0	DMD	31435390	0.440000	0.25618	0.289000	0.24876	0.988000	0.76386	0.952000	0.29149	1.131000	0.42111	0.594000	0.82650	CCT	.	.		0.423	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
