#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HSPG2	3339	hgsc.bcm.edu	37	1	22180823	22180823	+	Missense_Mutation	SNP	C	C	T	rs369444110	byFrequency	TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:22180823C>T	ENST00000374695.3	-	50	6381	c.6302G>A	c.(6301-6303)cGt>cAt	p.R2101H	HSPG2_ENST00000430507.1_Missense_Mutation_p.R51H	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2101	Ig-like C2-type 6.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	GAGCCGCAGACGGGAGCCGTG	0.597													C|||	2	0.000399361	0.0	0.0014	5008	,	,		18063	0.0		0.0	False		,,,				2504	0.001				p.R2101H		Atlas-SNP	.											.	HSPG2	311	.	0			c.G6302A						.	C	HIS/ARG	0,4382		0,0,2191	16.0	14.0	15.0		6302	4.6	1.0	1		15	1,8567		0,1,4283	no	missense	HSPG2	NM_005529.5	29	0,1,6474	TT,TC,CC		0.0117,0.0,0.0077	probably-damaging	2101/4392	22180823	1,12949	2191	4284	6475	SO:0001583	missense	3339	exon50			CGCAGACGGGAGC	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6302G>A	chr1.hg19:g.22180823C>T	ENSP00000363827:p.Arg2101His	113.0	0.0		40.0	31.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	C	15.90	2.968677	0.53614	0.0	1.17E-4	ENSG00000142798	ENST00000374695;ENST00000430507	T;T	0.67865	-0.29;-0.29	5.56	4.64	0.57946	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.35096	N	0.003443	T	0.69922	0.3165	L	0.37507	1.11	0.40471	D	0.980346	D;D	0.89917	0.999;1.0	D;D	0.74348	0.97;0.983	T	0.67511	-0.5652	10	0.34782	T	0.22	.	9.099	0.36656	0.0:0.8332:0.0:0.1668	.	41;2101	Q59EG0;P98160	.;PGBM_HUMAN	H	2101;51	ENSP00000363827:R2101H;ENSP00000416385:R51H	ENSP00000363827:R2101H	R	-	2	0	HSPG2	22053410	0.700000	0.27796	1.000000	0.80357	0.885000	0.51271	0.698000	0.25571	2.629000	0.89072	0.655000	0.94253	CGT	.	.		0.597	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
CEP85	64793	hgsc.bcm.edu	37	1	26601548	26601548	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:26601548A>G	ENST00000252992.4	+	12	2019	c.1888A>G	c.(1888-1890)Aca>Gca	p.T630A	CEP85_ENST00000451429.2_Missense_Mutation_p.T579A|CEP85_ENST00000469609.1_3'UTR	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa	630						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						GCAGCTGCGCACAGCCGTGAA	0.547																																					p.T630A		Atlas-SNP	.											.	CEP85	61	.	0			c.A1888G						.						47.0	43.0	44.0					1																	26601548		2195	4282	6477	SO:0001583	missense	64793	exon12			CTGCGCACAGCCG	AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.1888A>G	chr1.hg19:g.26601548A>G	ENSP00000252992:p.Thr630Ala	132.0	0.0		59.0	39.0	NM_022778	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	Missense_Mutation	SNP	ENST00000252992.4	hg19	CCDS277.1	.	.	.	.	.	.	.	.	.	.	A	11.29	1.593707	0.28445	.	.	ENSG00000130695	ENST00000451429;ENST00000252992	T;T	0.11930	2.73;2.73	5.57	2.94	0.34122	.	0.533866	0.22326	N	0.061523	T	0.08447	0.0210	L	0.35723	1.085	0.23735	N	0.996984	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.10450	0.004;0.005;0.002	T	0.38436	-0.9661	10	0.09843	T	0.71	-3.029	5.2166	0.15346	0.6046:0.0:0.2597:0.1357	.	579;630;630	F8W7K4;Q6P2H3;Q6P2H3-2	.;CEP85_HUMAN;.	A	579;630	ENSP00000417002:T579A;ENSP00000252992:T630A	ENSP00000252992:T630A	T	+	1	0	CEP85	26474135	0.980000	0.34600	1.000000	0.80357	0.978000	0.69477	0.935000	0.28924	0.933000	0.37291	0.459000	0.35465	ACA	.	.		0.547	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009492.2	NM_022778	
OSBPL9	114883	hgsc.bcm.edu	37	1	52238325	52238325	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:52238325C>T	ENST00000428468.1	+	14	1102	c.1100C>T	c.(1099-1101)tCt>tTt	p.S367F	OSBPL9_ENST00000435686.2_Missense_Mutation_p.S202F|OSBPL9_ENST00000361556.5_Missense_Mutation_p.S257F|OSBPL9_ENST00000453295.1_Missense_Mutation_p.S350F|OSBPL9_ENST00000371710.3_Missense_Mutation_p.S385F|OSBPL9_ENST00000337809.4_Missense_Mutation_p.S372F|OSBPL9_ENST00000371714.1_Missense_Mutation_p.S354F|OSBPL9_ENST00000462759.1_Missense_Mutation_p.S189F|OSBPL9_ENST00000530544.1_Missense_Mutation_p.S286F|OSBPL9_ENST00000486942.1_Missense_Mutation_p.S189F|OSBPL9_ENST00000447887.1_Missense_Mutation_p.S377F|OSBPL9_ENST00000531828.1_Missense_Mutation_p.S202F			Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9	367					lipid transport (GO:0006869)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|pancreas(1)|prostate(3)|skin(1)	18						GAGGCAGGGTCTGTGGAGGAG	0.433																																					p.S377F		Atlas-SNP	.											.	OSBPL9	192	.	0			c.C1130T						.						245.0	216.0	226.0					1																	52238325		2203	4300	6503	SO:0001583	missense	114883	exon14			CAGGGTCTGTGGA	AF392445	CCDS558.1, CCDS41332.1, CCDS41333.1, CCDS41334.1, CCDS41332.2, CCDS41332.3, CCDS41333.2, CCDS44145.1, CCDS55598.1	1p32.3	2013-01-10			ENSG00000117859	ENSG00000117859		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16386	protein-coding gene	gene with protein product		606737					Standard	NM_148904		Approved		uc001csu.3	Q96SU4	OTTHUMG00000008234	ENST00000428468.1:c.1100C>T	chr1.hg19:g.52238325C>T	ENSP00000407168:p.Ser367Phe	97.0	0.0		39.0	27.0	NM_148909	B1AKJ8|B3KPQ4|D3DQ31|Q5TFC0|Q6IA67|Q86YQ3|Q8NB17|Q8TAS8|Q96SK4|Q9H9X2	Missense_Mutation	SNP	ENST00000428468.1	hg19	CCDS41332.3	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620945	0.66787	.	.	ENSG00000117859	ENST00000371714;ENST00000371710;ENST00000337809;ENST00000447887;ENST00000435686;ENST00000428468;ENST00000453295;ENST00000530544;ENST00000531828;ENST00000361556;ENST00000462759;ENST00000486942	T;T;T;T;T	0.16196	2.39;2.6;2.6;2.36;2.4	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.44414	0.1292	M	0.76838	2.35	0.80722	D	1	D;D;D;D;D	0.76494	0.996;0.999;0.999;0.998;0.998	P;D;D;D;D	0.69654	0.862;0.965;0.949;0.923;0.923	T	0.45833	-0.9234	10	0.72032	D	0.01	-5.4603	18.3308	0.90268	0.0:1.0:0.0:0.0	.	350;257;383;367;372	Q86YQ3;Q96SU4-3;B1AKJ7;Q96SU4;B1AKJ6	.;.;.;OSBL9_HUMAN;.	F	354;385;372;377;202;367;350;286;202;257;189;189	ENSP00000360779:S354F;ENSP00000360775:S385F;ENSP00000337265:S372F;ENSP00000412733:S377F;ENSP00000407168:S367F	ENSP00000337265:S372F	S	+	2	0	OSBPL9	52010913	1.000000	0.71417	0.810000	0.32431	0.276000	0.26787	7.288000	0.78691	2.563000	0.86464	0.650000	0.86243	TCT	.	.		0.433	OSBPL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022584.4		
NOTCH2	4853	hgsc.bcm.edu	37	1	120462183	120462183	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:120462183T>G	ENST00000256646.2	-	31	5752	c.5533A>C	c.(5533-5535)Agt>Cgt	p.S1845R	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1845					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTTCATCACTCAAATCTGAG	0.502			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.S1845R		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.A5533C						.						54.0	46.0	49.0					1																	120462183		2203	4300	6503	SO:0001583	missense	4853	exon31	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	CATCACTCAAATC	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5533A>C	chr1.hg19:g.120462183T>G	ENSP00000256646:p.Ser1845Arg	140.0	0.0		164.0	49.0	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	hg19	CCDS908.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.856220	0.51376	.	.	ENSG00000134250	ENST00000256646	D	0.82167	-1.58	5.84	5.84	0.93424	Ankyrin repeat-containing domain (3);	0.000000	0.44285	U	0.000479	T	0.65228	0.2671	L	0.51422	1.61	0.37247	D	0.906371	P	0.51933	0.949	B	0.36666	0.23	T	0.71813	-0.4479	10	0.42905	T	0.14	.	9.8179	0.40865	0.0:0.0758:0.0:0.9242	.	1845	Q04721	NOTC2_HUMAN	R	1845	ENSP00000256646:S1845R	ENSP00000256646:S1845R	S	-	1	0	NOTCH2	120263706	0.002000	0.14202	0.997000	0.53966	0.910000	0.53928	1.521000	0.35910	2.243000	0.73865	0.533000	0.62120	AGT	.	.		0.502	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144886225	144886225	+	Silent	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:144886225C>T	ENST00000369354.3	-	23	3198	c.3009G>A	c.(3007-3009)caG>caA	p.Q1003Q	PDE4DIP_ENST00000313382.9_Silent_p.Q1069Q|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000369359.4_Silent_p.Q1140Q|PDE4DIP_ENST00000530740.1_Silent_p.Q1140Q|PDE4DIP_ENST00000369356.4_Silent_p.Q1003Q			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1003					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		GCATTTCTTCCTGAAGACACC	0.507			T	PDGFRB	MPD																																p.Q1069Q		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.G3207A						.						215.0	215.0	215.0					1																	144886225		2203	4296	6499	SO:0001819	synonymous_variant	9659	exon26			TTCTTCCTGAAGA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.3009G>A	chr1.hg19:g.144886225C>T		198.0	0.0		241.0	29.0	NM_001198832	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	hg19	CCDS30824.1																																																																																			.	.		0.507	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
FLG	2312	hgsc.bcm.edu	37	1	152286383	152286384	+	Nonsense_Mutation	DNP	CC	CC	AT	rs369816027		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:152286383_152286384CC>AT	ENST00000368799.1	-	3	1013_1014	c.978_979GG>AT	c.(976-981)tgGGag>tgATag	p.326_327WE>**	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	326	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTGACTGCTCCCACGCAGATC	0.569									Ichthyosis																												p.E327X|p.W326X		Atlas-SNP	.											.	FLG	900	.	0			c.G979T|c.G978A						.																																			SO:0001587	stop_gained	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACTGCTCCCACGC|CTGCTCCCACGCA	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.978_979delinsAT	chr1.hg19:g.152286383_152286384delinsAT	ENSP00000357789:p.W326_E327delins**	178.0|177.0	0.0		205.0|203.0	69.0	NM_002016	Q01720|Q5T583|Q9UC71	Nonsense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1																																																																																			.	.		0.569	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
LOR	4014	hgsc.bcm.edu	37	1	153234342	153234342	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:153234342C>T	ENST00000368742.3	+	2	974	c.917C>T	c.(916-918)gCg>gTg	p.A306V		NM_000427.2	NP_000418.2	P23490	LORI_HUMAN	loricrin	306					keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein binding, bridging (GO:0030674)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			lung(2)	2	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAGAAGCAGGCGCCTACCTGG	0.657																																					p.A306V		Atlas-SNP	.											.	LOR	19	.	0			c.C917T						.						8.0	9.0	9.0					1																	153234342		1757	3712	5469	SO:0001583	missense	4014	exon2			AGCAGGCGCCTAC	M61120	CCDS30870.1	1q21	2008-02-05			ENSG00000203782	ENSG00000203782			6663	protein-coding gene	gene with protein product		152445				2007607, 1355480	Standard	NM_000427		Approved		uc001fbm.3	P23490	OTTHUMG00000013938	ENST00000368742.3:c.917C>T	chr1.hg19:g.153234342C>T	ENSP00000357731:p.Ala306Val	178.0	0.0		214.0	51.0	NM_000427	Q5T869|Q5XKF8	Missense_Mutation	SNP	ENST00000368742.3	hg19	CCDS30870.1	.	.	.	.	.	.	.	.	.	.	C	12.91	2.080607	0.36758	.	.	ENSG00000203782	ENST00000368742	T	0.39406	1.08	4.56	2.59	0.31030	.	0.000000	0.32785	N	0.005650	T	0.07593	0.0191	N	0.14661	0.345	0.23063	N	0.998357	P	0.46952	0.887	B	0.32211	0.142	T	0.12344	-1.0551	10	0.87932	D	0	-4.9869	5.5387	0.17026	0.1946:0.7019:0.0:0.1035	.	306	P23490	LORI_HUMAN	V	306	ENSP00000357731:A306V	ENSP00000357731:A306V	A	+	2	0	LOR	151500966	0.993000	0.37304	0.999000	0.59377	0.972000	0.66771	0.806000	0.27126	1.133000	0.42147	0.563000	0.77884	GCG	.	.		0.657	LOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039107.1	NM_000427	
CCT3	7203	hgsc.bcm.edu	37	1	156287032	156287032	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:156287032G>T	ENST00000295688.3	-	10	1179	c.899C>A	c.(898-900)gCt>gAt	p.A300D	CCT3_ENST00000368259.2_Missense_Mutation_p.A262D|CCT3_ENST00000472765.2_Missense_Mutation_p.A255D|CCT3_ENST00000368261.3_Missense_Mutation_p.A255D	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	300					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					GTAGTGCTGAGCTAAATCTAC	0.443																																					p.A300D		Atlas-SNP	.											.	CCT3	61	.	0			c.C899A						.						150.0	144.0	146.0					1																	156287032		2203	4300	6503	SO:0001583	missense	7203	exon10			TGCTGAGCTAAAT	BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.899C>A	chr1.hg19:g.156287032G>T	ENSP00000295688:p.Ala300Asp	203.0	0.0		240.0	71.0	NM_005998	A6NE14|Q5SZY1|Q9BR64	Missense_Mutation	SNP	ENST00000295688.3	hg19	CCDS1140.2	.	.	.	.	.	.	.	.	.	.	G	34	5.385318	0.95967	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765	D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64	6.14	6.14	0.99180	.	0.051911	0.85682	D	0.000000	D	0.95516	0.8543	H	0.99498	4.595	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.83275	0.991;0.991;0.996	D	0.96895	0.9656	10	0.87932	D	0	-9.2883	18.3129	0.90207	0.0:0.0:1.0:0.0	.	262;299;300	P49368-2;E9PAQ6;P49368	.;.;TCPG_HUMAN	D	300;262;255;255	ENSP00000295688:A300D;ENSP00000357242:A262D;ENSP00000357244:A255D;ENSP00000431543:A255D	ENSP00000295688:A300D	A	-	2	0	CCT3	154553656	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.577000	0.98196	2.927000	0.99377	0.637000	0.83480	GCT	.	.		0.443	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060602.3	NM_005998	
POU2F1	5451	hgsc.bcm.edu	37	1	167343488	167343488	+	Silent	SNP	G	G	A	rs532966862	byFrequency	TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:167343488G>A	ENST00000541643.3	+	7	639	c.477G>A	c.(475-477)acG>acA	p.T159T	POU2F1_ENST00000420254.3_Silent_p.T159T|POU2F1_ENST00000429375.2_Intron|POU2F1_ENST00000367862.5_Silent_p.T171T|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000367866.2_Silent_p.T182T|POU2F1_ENST00000452019.1_Silent_p.T159T			P14859	PO2F1_HUMAN	POU class 2 homeobox 1	159					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						CTGCTGCCACGCCCATGACGC	0.612													G|||	2	0.000399361	0.0	0.0	5008	,	,		17355	0.001		0.0	False		,,,				2504	0.001				p.T182T		Atlas-SNP	.											.	POU2F1	120	.	0			c.G546A						.						26.0	26.0	26.0					1																	167343488		2203	4299	6502	SO:0001819	synonymous_variant	5451	exon6			TGCCACGCCCATG	BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.477G>A	chr1.hg19:g.167343488G>A		322.0	0.0		367.0	112.0	NM_002697	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Silent	SNP	ENST00000541643.3	hg19																																																																																				.	.		0.612	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_002697	
PRRC2C	23215	hgsc.bcm.edu	37	1	171511282	171511282	+	Silent	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:171511282C>T	ENST00000338920.4	+	16	4908	c.4671C>T	c.(4669-4671)aaC>aaT	p.N1557N	PRRC2C_ENST00000367742.3_Silent_p.N1559N|PRRC2C_ENST00000426496.2_Silent_p.N1557N|PRRC2C_ENST00000392078.3_Silent_p.N1559N	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1557					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GACGTGGCAACAATGGTCCAC	0.438																																					p.N1557N		Atlas-SNP	.											.	.	.	.	0			c.C4671T						.						45.0	45.0	45.0					1																	171511282		2203	4300	6503	SO:0001819	synonymous_variant	23215	exon16			TGGCAACAATGGT	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.4671C>T	chr1.hg19:g.171511282C>T		233.0	0.0		323.0	110.0	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Silent	SNP	ENST00000338920.4	hg19	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	C	4.247	0.044749	0.08196	.	.	ENSG00000117523	ENST00000495585	.	.	.	5.87	4.96	0.65561	.	.	.	.	.	T	0.47820	0.1466	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50709	-0.8796	4	.	.	.	.	9.4353	0.38635	0.0:0.7889:0.0:0.2111	.	.	.	.	I	105	.	.	T	+	2	0	PRRC2C	169777906	1.000000	0.71417	0.978000	0.43139	0.998000	0.95712	1.987000	0.40687	1.494000	0.48533	0.650000	0.86243	ACA	.	.		0.438	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
MYOC	4653	hgsc.bcm.edu	37	1	171621369	171621369	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:171621369C>T	ENST00000037502.6	-	1	454	c.383G>A	c.(382-384)cGg>cAg	p.R128Q		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	128					bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CAGCTGGTCCCGCTCCCGCCT	0.612																																					p.R128Q		Atlas-SNP	.											.	MYOC	69	.	0			c.G383A						.						69.0	75.0	73.0					1																	171621369		2203	4300	6503	SO:0001583	missense	4653	exon1			TGGTCCCGCTCCC	BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.383G>A	chr1.hg19:g.171621369C>T	ENSP00000037502:p.Arg128Gln	130.0	0.0		133.0	37.0	NM_000261	B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	ENST00000037502.6	hg19	CCDS1297.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.242089	0.39598	.	.	ENSG00000034971	ENST00000037502;ENST00000536591;ENST00000537133	T	0.58506	0.33	5.4	2.19	0.27852	.	0.498628	0.19991	N	0.101572	T	0.26304	0.0642	M	0.68317	2.08	0.24858	N	0.992366	B	0.31837	0.342	B	0.11329	0.006	T	0.06661	-1.0814	10	0.32370	T	0.25	.	5.8767	0.18832	0.0:0.6517:0.0:0.3483	.	128	Q99972	MYOC_HUMAN	Q	128;61;128	ENSP00000037502:R128Q	ENSP00000037502:R128Q	R	-	2	0	MYOC	169887992	0.002000	0.14202	0.965000	0.40720	0.568000	0.35870	0.413000	0.21148	0.763000	0.33175	0.655000	0.94253	CGG	.	.		0.612	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084178.2	NM_000261	
CACNA1E	777	hgsc.bcm.edu	37	1	181765841	181765841	+	Silent	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:181765841G>A	ENST00000367573.2	+	47	6246	c.6246G>A	c.(6244-6246)gaG>gaA	p.E2082E	CACNA1E_ENST00000367570.1_Silent_p.E2039E|CACNA1E_ENST00000360108.3_Silent_p.E2063E|CACNA1E_ENST00000526775.1_Silent_p.E2020E|CACNA1E_ENST00000358338.5_Silent_p.E1971E|CACNA1E_ENST00000357570.5_Silent_p.E2033E|CACNA1E_ENST00000367567.4_Silent_p.E1646E	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2082					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GGGGCAGGGAGCGGGGACGAT	0.552																																					p.E2082E		Atlas-SNP	.											.	CACNA1E	778	.	0			c.G6246A						.						49.0	51.0	50.0					1																	181765841		1969	4161	6130	SO:0001819	synonymous_variant	777	exon47			CAGGGAGCGGGGA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6246G>A	chr1.hg19:g.181765841G>A		153.0	0.0		162.0	51.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	ENST00000367573.2	hg19	CCDS55664.1																																																																																			.	.		0.552	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
BRINP3	339479	hgsc.bcm.edu	37	1	190423953	190423953	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:190423953A>T	ENST00000367462.3	-	2	299	c.68T>A	c.(67-69)cTg>cAg	p.L23Q	BRINP3_ENST00000534846.1_5'UTR	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	23					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											ATGAAGACTCAGTGCTATCCA	0.517																																					p.L23Q		Atlas-SNP	.											.	FAM5C	343	.	0			c.T68A						.						82.0	80.0	81.0					1																	190423953		2203	4300	6503	SO:0001583	missense	339479	exon2			AGACTCAGTGCTA	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.68T>A	chr1.hg19:g.190423953A>T	ENSP00000356432:p.Leu23Gln	167.0	0.0		227.0	74.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	hg19	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.316959	0.81469	.	.	ENSG00000162670	ENST00000367462;ENST00000445957	T;T	0.56941	2.22;0.43	5.57	5.57	0.84162	.	0.084811	0.49916	D	0.000131	T	0.67335	0.2882	L	0.55481	1.735	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.70274	-0.4917	10	0.87932	D	0	.	13.6909	0.62544	1.0:0.0:0.0:0.0	.	23	Q76B58	FAM5C_HUMAN	Q	23	ENSP00000356432:L23Q;ENSP00000393441:L23Q	ENSP00000356432:L23Q	L	-	2	0	FAM5C	188690576	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.932000	0.92897	2.119000	0.64992	0.533000	0.62120	CTG	.	.		0.517	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
DENND1B	163486	hgsc.bcm.edu	37	1	197509163	197509163	+	IGR	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:197509163T>C								CRB1 (61578 upstream) : DENND1B (12221 downstream)																							GTGTATATTGTACAGAACTAG	0.343																																					p.V482V		Atlas-SNP	.											.	DENND1B	108	.	0			c.A1446G						.						161.0	153.0	155.0					1																	197509163		2201	4300	6501	SO:0001628	intergenic_variant	163486	exon20			ATATTGTACAGAA																													chr1.hg19:g.197509163T>C		126.0	0.0		157.0	43.0	NM_001195215		Silent	SNP		hg19																																																																																				.	.	0	0.343								
DEGS1	8560	hgsc.bcm.edu	37	1	224380171	224380171	+	Silent	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:224380171G>A	ENST00000323699.4	+	3	1129	c.963G>A	c.(961-963)gtG>gtA	p.V321V	DEGS1_ENST00000391877.3_Silent_p.V321V	NM_003676.3	NP_003667.1	O15121	DEGS1_HUMAN	delta(4)-desaturase, sphingolipid 1	321					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|kidney(3)|large_intestine(2)|lung(4)	10	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		GAGAGATGGTGCTGGAGTAAA	0.363																																					p.V321V		Atlas-SNP	.											.	DEGS1	24	.	0			c.G963A						.						56.0	52.0	53.0					1																	224380171		2203	4300	6503	SO:0001819	synonymous_variant	8560	exon3			GATGGTGCTGGAG	AF002668	CCDS1540.1	1q42.11	2013-09-02	2011-12-09	2004-12-14	ENSG00000143753	ENSG00000143753		"""Fatty acid desaturases"""	13709	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 1"", ""dihydroceramide desaturase 1"""	615843	"""degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)"""			9188692, 20105137	Standard	NM_003676		Approved	MLD, Des-1, DES1, FADS7, DEGS-1	uc001hoj.3	O15121	OTTHUMG00000037496	ENST00000323699.4:c.963G>A	chr1.hg19:g.224380171G>A		127.0	0.0		148.0	35.0	NM_003676		Silent	SNP	ENST00000323699.4	hg19	CCDS1540.1																																																																																			.	.		0.363	DEGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091285.2		
OR11L1	391189	hgsc.bcm.edu	37	1	248004283	248004283	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr1:248004283T>A	ENST00000355784.2	-	1	971	c.916A>T	c.(916-918)Aga>Tga	p.R306*		NM_001001959.1	NP_001001959.1	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L, member 1	306						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CATTTCCTTCTCATGACCTTT	0.383																																					p.R306X		Atlas-SNP	.											.	OR11L1	108	.	0			c.A916T						.						90.0	86.0	88.0					1																	248004283		2203	4300	6503	SO:0001587	stop_gained	391189	exon1			TCCTTCTCATGAC	AB065646	CCDS31098.1	1q44	2013-09-24			ENSG00000197591	ENSG00000197591		"""GPCR / Class A : Olfactory receptors"""	14998	protein-coding gene	gene with protein product							Standard	NM_001001959		Approved		uc001idn.1	Q8NGX0	OTTHUMG00000040193	ENST00000355784.2:c.916A>T	chr1.hg19:g.248004283T>A	ENSP00000348033:p.Arg306*	209.0	0.0		210.0	54.0	NM_001001959		Nonsense_Mutation	SNP	ENST00000355784.2	hg19	CCDS31098.1	.	.	.	.	.	.	.	.	.	.	T	16.55	3.154155	0.57259	.	.	ENSG00000197591	ENST00000355784	.	.	.	3.78	0.107	0.14544	.	0.882556	0.09169	U	0.839093	.	.	.	.	.	.	0.33847	D	0.632136	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	.	4.6121	0.12408	0.0:0.2885:0.1604:0.5511	.	.	.	.	X	306	.	ENSP00000348033:R306X	R	-	1	2	OR11L1	246070906	0.000000	0.05858	0.000000	0.03702	0.661000	0.39034	0.420000	0.21263	-0.074000	0.12820	0.438000	0.28831	AGA	.	.		0.383	OR11L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096850.1	NM_001001959	
DNMT3A	1788	hgsc.bcm.edu	37	2	25466768	25466768	+	Splice_Site	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:25466768T>A	ENST00000264709.3	-	16	2272	c.1935A>T	c.(1933-1935)acA>acT	p.T645T	DNMT3A_ENST00000380746.4_Splice_Site_p.T456T|DNMT3A_ENST00000402667.1_Splice_Site_p.T422T|DNMT3A_ENST00000474887.1_5'UTR|DNMT3A_ENST00000321117.5_Splice_Site_p.T645T	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	645	S-adenosyl-L-methionine binding. {ECO:0000305}.|SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCCCTCACCTGTAGCGATTC	0.572			"""Mis, F, N, S"""		AML																																p.T645T		Atlas-SNP	.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A	1807	.	0			c.A1935T						.						47.0	42.0	44.0					2																	25466768		2079	4055	6134	SO:0001630	splice_region_variant	1788	exon16			CTCACCTGTAGCG		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1936+1A>T	chr2.hg19:g.25466768T>A		81.0	0.0		43.0	15.0	NM_175629	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Silent	SNP	ENST00000264709.3	hg19	CCDS33157.1																																																																																			.	.		0.572	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	Silent
FAM179A	165186	hgsc.bcm.edu	37	2	29268229	29268229	+	Missense_Mutation	SNP	G	G	A	rs371609539		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:29268229G>A	ENST00000379558.4	+	19	3026	c.2675G>A	c.(2674-2676)cGt>cAt	p.R892H	FAM179A_ENST00000403861.2_Missense_Mutation_p.R837H|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	892										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGGCGAGTGCGTTTCCTGAGT	0.612																																					p.R892H		Atlas-SNP	.											.	FAM179A	106	.	0			c.G2675A						.	G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	107.0	106.0	106.0		2675	4.4	1.0	2		106	0,8600		0,0,4300	no	missense	FAM179A	NM_199280.2	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	892/1020	29268229	1,13005	2203	4300	6503	SO:0001583	missense	165186	exon19			GAGTGCGTTTCCT	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2675G>A	chr2.hg19:g.29268229G>A	ENSP00000368876:p.Arg892His	41.0	0.0		37.0	18.0	NM_199280	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	hg19	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	G	19.88	3.908492	0.72868	2.27E-4	0.0	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.14144	2.53;2.53	5.33	4.45	0.53987	Armadillo-type fold (1);	0.087928	0.49916	D	0.000123	T	0.31949	0.0813	M	0.64997	1.995	0.34235	D	0.67698	D;D;D	0.89917	0.999;0.997;1.0	P;P;D	0.66196	0.8;0.745;0.942	T	0.48163	-0.9059	10	0.51188	T	0.08	.	13.8719	0.63624	0.0737:0.0:0.9263:0.0	.	837;892;190	F8W8E4;Q6ZUX3;Q6ZUX3-3	.;F179A_HUMAN;.	H	892;837	ENSP00000368876:R892H;ENSP00000384699:R837H	ENSP00000368876:R892H	R	+	2	0	FAM179A	29121733	0.995000	0.38212	0.989000	0.46669	0.542000	0.35054	2.214000	0.42853	1.479000	0.48272	0.561000	0.74099	CGT	.	.		0.612	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
XIRP2	129446	hgsc.bcm.edu	37	2	167992505	167992505	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:167992505C>A	ENST00000409728.1	+	3	584	c.495C>A	c.(493-495)gaC>gaA	p.D165E	XIRP2_ENST00000409043.1_Missense_Mutation_p.D165E|XIRP2_ENST00000295237.9_Missense_Mutation_p.D165E|XIRP2_ENST00000409756.2_Missense_Mutation_p.D165E|XIRP2_ENST00000420519.1_Missense_Mutation_p.D165E|XIRP2-AS1_ENST00000525330.1_RNA|XIRP2_ENST00000409195.1_Missense_Mutation_p.D165E	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAGATTCAGACAAGAAAGGCA	0.433																																					p.D165E		Atlas-SNP	.											.	XIRP2	914	.	0			c.C495A						.						96.0	96.0	96.0					2																	167992505		1904	4128	6032	SO:0001583	missense	129446	exon3			TTCAGACAAGAAA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.495C>A	chr2.hg19:g.167992505C>A	ENSP00000386619:p.Asp165Glu	96.0	0.0		74.0	33.0	NM_001199143	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409728.1	hg19	CCDS56143.1	.	.	.	.	.	.	.	.	.	.	C	12.32	1.903459	0.33628	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	D;D;T;D;D;T	0.85339	-1.53;-1.97;3.85;-1.53;-1.97;3.85	5.51	3.67	0.42095	.	.	.	.	.	T	0.74688	0.3749	.	.	.	0.20307	N	0.999914	B;B	0.14438	0.01;0.01	B;B	0.15484	0.013;0.013	T	0.60622	-0.7227	8	0.33940	T	0.23	-7.4776	5.804	0.18430	0.2713:0.5813:0.0:0.1474	.	165;165	A4UGR9-4;A4UGR9-6	.;.	E	165	ENSP00000386454:D165E;ENSP00000386619:D165E;ENSP00000386840:D165E;ENSP00000386724:D165E;ENSP00000415541:D165E;ENSP00000295237:D165E	ENSP00000295237:D165E	D	+	3	2	XIRP2	167700751	0.511000	0.26179	0.995000	0.50966	0.752000	0.42762	0.015000	0.13355	0.656000	0.30886	-0.216000	0.12614	GAC	.	.		0.433	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333552.1	NM_152381	
KLHL41	10324	hgsc.bcm.edu	37	2	170377511	170377511	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:170377511T>C	ENST00000284669.1	+	5	1780	c.1703T>C	c.(1702-1704)aTa>aCa	p.I568T	RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.I506T|KLHL41_ENST00000463400.1_3'UTR|BBS5_ENST00000554017.1_Missense_Mutation_p.I506T	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	568					myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											GTCAATGACATATGGAAGTAA	0.363																																					p.I568T		Atlas-SNP	.											.	.	.	.	0			c.T1703C						.						136.0	123.0	127.0					2																	170377511		2203	4300	6503	SO:0001583	missense	10324	exon5			ATGACATATGGAA	AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.1703T>C	chr2.hg19:g.170377511T>C	ENSP00000284669:p.Ile568Thr	120.0	0.0		93.0	25.0	NM_006063	Q53R42	Missense_Mutation	SNP	ENST00000284669.1	hg19	CCDS2234.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.543127	0.86022	.	.	ENSG00000163093;ENSG00000251569;ENSG00000239474	ENST00000554017;ENST00000513963;ENST00000284669	T;T;T	0.68903	-0.36;-0.36;-0.36	5.29	5.29	0.74685	Kelch-type beta propeller (1);	0.096814	0.64402	D	0.000001	T	0.77651	0.4162	L	0.52011	1.625	0.53688	D	0.99997	P;D	0.57571	0.776;0.98	P;D	0.74348	0.729;0.983	T	0.79992	-0.1569	10	0.87932	D	0	.	15.5036	0.75719	0.0:0.0:0.0:1.0	.	506;568	E9PBE3;O60662	.;KBTBA_HUMAN	T	506;506;568	ENSP00000452313:I506T;ENSP00000424363:I506T;ENSP00000284669:I568T	ENSP00000284669:I568T	I	+	2	0	BBS5;RP11-724O16.1;KBTBD10	170085757	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.623000	0.83113	2.128000	0.65567	0.482000	0.46254	ATA	.	.		0.363	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255263.1	NM_006063	
MYO3B	140469	hgsc.bcm.edu	37	2	171323102	171323102	+	Silent	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:171323102C>A	ENST00000408978.4	+	25	3038	c.2895C>A	c.(2893-2895)gcC>gcA	p.A965A	MYO3B_ENST00000409044.3_Silent_p.A965A|MYO3B_ENST00000602629.1_Intron|MYO3B_ENST00000334231.6_Silent_p.A974A	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	965	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						ACCGAGAGGCCCTGCAGTTCT	0.567																																					p.A965A		Atlas-SNP	.											.	MYO3B	320	.	0			c.C2895A						.						91.0	94.0	93.0					2																	171323102		1938	4138	6076	SO:0001819	synonymous_variant	140469	exon25			AGAGGCCCTGCAG		CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2895C>A	chr2.hg19:g.171323102C>A		104.0	0.0		85.0	29.0	NM_001083615	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Silent	SNP	ENST00000408978.4	hg19	CCDS42773.1																																																																																			.	.		0.567	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333410.1		
TTN	7273	hgsc.bcm.edu	37	2	179639715	179639715	+	Silent	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:179639715A>T	ENST00000591111.1	-	29	6947	c.6723T>A	c.(6721-6723)gcT>gcA	p.A2241A	TTN_ENST00000342992.6_Silent_p.A2241A|TTN_ENST00000589042.1_Silent_p.A2241A|TTN_ENST00000359218.5_Silent_p.A2195A|TTN_ENST00000460472.2_Silent_p.A2195A|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000360870.5_Silent_p.A2241A|TTN_ENST00000342175.6_Silent_p.A2195A|RP11-88L24.4_ENST00000582038.2_RNA|TTN-AS1_ENST00000610005.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12565	Ig-like 11.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTAATCTTCAGCATCAGACG	0.388																																					p.A2241A		Atlas-SNP	.											.	TTN	18412	.	0			c.T6723A						.						157.0	145.0	149.0					2																	179639715		2203	4300	6503	SO:0001819	synonymous_variant	7273	exon29			ATCTTCAGCATCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6723T>A	chr2.hg19:g.179639715A>T		126.0	0.0		125.0	65.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.388	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	hgsc.bcm.edu	37	2	196822068	196822068	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:196822068T>C	ENST00000312428.6	-	19	3095	c.2995A>G	c.(2995-2997)Att>Gtt	p.I999V		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	999	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TGAGACATAATGTCTGGAGAG	0.468																																					p.I999V		Atlas-SNP	.											.	DNAH7	512	.	0			c.A2995G						.						93.0	86.0	88.0					2																	196822068		1886	4116	6002	SO:0001583	missense	56171	exon19			ACATAATGTCTGG	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2995A>G	chr2.hg19:g.196822068T>C	ENSP00000311273:p.Ile999Val	386.0	1.0		315.0	130.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	T	19.13	3.767322	0.69878	.	.	ENSG00000118997	ENST00000312428	T	0.68903	-0.36	5.57	5.57	0.84162	Dynein heavy chain, domain-2 (1);	0.000000	0.85682	D	0.000000	D	0.86727	0.6002	H	0.94423	3.535	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.90440	0.4431	10	0.87932	D	0	.	15.6854	0.77405	0.0:0.0:0.0:1.0	.	999	Q8WXX0	DYH7_HUMAN	V	999	ENSP00000311273:I999V	ENSP00000311273:I999V	I	-	1	0	DNAH7	196530313	1.000000	0.71417	0.998000	0.56505	0.372000	0.29890	7.950000	0.87804	2.248000	0.74166	0.533000	0.62120	ATT	.	.		0.468	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
EPHA4	2043	hgsc.bcm.edu	37	2	222301170	222301170	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:222301170A>T	ENST00000281821.2	-	13	2336	c.2295T>A	c.(2293-2295)ttT>ttA	p.F765L	EPHA4_ENST00000392071.4_Missense_Mutation_p.F714L|EPHA4_ENST00000409854.1_Missense_Mutation_p.F765L|EPHA4_ENST00000409938.1_Missense_Mutation_p.F765L	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4	765	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		GGGACATGCCAAAATCAGACA	0.493																																					p.F765L		Atlas-SNP	.											.	EPHA4	263	.	0			c.T2295A						.						110.0	92.0	98.0					2																	222301170		2203	4300	6503	SO:0001583	missense	2043	exon13			CATGCCAAAATCA	L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.2295T>A	chr2.hg19:g.222301170A>T	ENSP00000281821:p.Phe765Leu	91.0	0.0		78.0	33.0	NM_004438	A8K2P1|B2R601|B7Z6Q8|Q2M380	Missense_Mutation	SNP	ENST00000281821.2	hg19	CCDS2447.1	.	.	.	.	.	.	.	.	.	.	A	17.24	3.338764	0.60963	.	.	ENSG00000116106	ENST00000281821;ENST00000409854;ENST00000409938;ENST00000392071	T;T;T;T	0.81247	-1.47;-1.47;-1.47;-1.47	6.04	-3.94	0.04130	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80534	0.4641	M	0.86573	2.825	0.58432	D	0.999999	B	0.22683	0.073	B	0.22386	0.039	T	0.69191	-0.5210	10	0.87932	D	0	.	15.0631	0.71970	0.4713:0.0:0.5287:0.0	.	765	P54764	EPHA4_HUMAN	L	765;765;765;714	ENSP00000281821:F765L;ENSP00000386276:F765L;ENSP00000386829:F765L;ENSP00000375923:F714L	ENSP00000281821:F765L	F	-	3	2	EPHA4	222009414	0.176000	0.23096	0.924000	0.36721	0.997000	0.91878	-0.240000	0.08952	-0.989000	0.03485	0.460000	0.39030	TTT	.	.		0.493	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256836.3		
ANKMY1	51281	hgsc.bcm.edu	37	2	241463346	241463346	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr2:241463346G>T	ENST00000272972.3	-	7	1735	c.1521C>A	c.(1519-1521)agC>agA	p.S507R	ANKMY1_ENST00000405002.1_Missense_Mutation_p.S277R|ANKMY1_ENST00000403283.1_Missense_Mutation_p.S445R|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000401804.1_Missense_Mutation_p.S596R|ANKMY1_ENST00000406958.1_Missense_Mutation_p.S268R|ANKMY1_ENST00000391987.1_Missense_Mutation_p.S507R|ANKMY1_ENST00000373320.4_Missense_Mutation_p.S277R|ANKMY1_ENST00000405523.3_Missense_Mutation_p.S366R|ANKMY1_ENST00000536462.1_Missense_Mutation_p.S319R|ANKMY1_ENST00000361678.4_Missense_Mutation_p.S366R|ANKMY1_ENST00000373318.2_Missense_Mutation_p.S366R	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	507							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		CTTTGTCGAAGCTGCTGGTGC	0.622																																					p.S507R		Atlas-SNP	.											.	ANKMY1	112	.	0			c.C1521A						.						64.0	61.0	62.0					2																	241463346		2203	4300	6503	SO:0001583	missense	51281	exon7			GTCGAAGCTGCTG	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1521C>A	chr2.hg19:g.241463346G>T	ENSP00000272972:p.Ser507Arg	56.0	0.0		49.0	24.0	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	hg19	CCDS2536.1	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067578	0.36470	.	.	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T;T	0.56776	2.87;3.6;0.46;2.19;0.46;4.33;2.43;0.44;2.19;2.16;2.47	4.06	3.17	0.36434	Ankyrin repeat-containing domain (1);	2.870430	0.01215	N	0.007942	T	0.49115	0.1538	N	0.24115	0.695	0.09310	N	1	B;D;P;P;B;D;B	0.59767	0.196;0.972;0.753;0.952;0.233;0.986;0.196	B;P;B;B;B;P;B	0.50754	0.024;0.6;0.173;0.396;0.024;0.649;0.024	T	0.43491	-0.9388	10	0.18710	T	0.47	-49.9723	8.2266	0.31572	0.1193:0.0:0.8807:0.0	.	507;319;277;366;268;366;507	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;B5MBY4;Q9P2S6-2;Q9P2S6	.;.;.;.;.;.;ANKY1_HUMAN	R	366;268;507;366;507;277;445;596;319;366;277	ENSP00000362415:S366R;ENSP00000384555:S268R;ENSP00000272972:S507R;ENSP00000355097:S366R;ENSP00000375847:S507R;ENSP00000362417:S277R;ENSP00000383968:S445R;ENSP00000385887:S596R;ENSP00000444707:S319R;ENSP00000385635:S366R;ENSP00000385145:S277R	ENSP00000272972:S507R	S	-	3	2	ANKMY1	241112019	0.000000	0.05858	0.002000	0.10522	0.034000	0.12701	0.393000	0.20817	0.994000	0.38892	0.491000	0.48974	AGC	.	.		0.622	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
COL6A6	131873	hgsc.bcm.edu	37	3	130290002	130290002	+	Silent	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr3:130290002C>T	ENST00000358511.6	+	6	2773	c.2742C>T	c.(2740-2742)gtC>gtT	p.V914V	COL6A6_ENST00000453409.2_Silent_p.V914V	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	914	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCCCCCAAGTCCTCATTGTGA	0.567																																					p.V914V		Atlas-SNP	.											.	COL6A6	497	.	0			c.C2742T						.						50.0	51.0	51.0					3																	130290002		1904	4115	6019	SO:0001819	synonymous_variant	131873	exon6			CCAAGTCCTCATT	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2742C>T	chr3.hg19:g.130290002C>T		128.0	0.0		98.0	52.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	ENST00000358511.6	hg19	CCDS46911.1																																																																																			.	.		0.567	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
CPA3	1359	hgsc.bcm.edu	37	3	148596536	148596536	+	Splice_Site	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr3:148596536G>A	ENST00000296046.3	+	5	526		c.e5+1		RP11-680B3.2_ENST00000488190.1_RNA	NM_001870.2	NP_001861.2	P15088	CBPA3_HUMAN	carboxypeptidase A3 (mast cell)						angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.?(1)		NS(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TGTTCTGAAGGTAAAAATAAC	0.308																																					.		Atlas-SNP	.											CPA3,NS,carcinoma,0,1	CPA3	75	.	1	Unknown(1)	lung(1)	c.474+1G>A						.						48.0	55.0	52.0					3																	148596536		2199	4292	6491	SO:0001630	splice_region_variant	1359	exon5			CTGAAGGTAAAAA		CCDS3138.1	3q24	2012-02-10			ENSG00000163751	ENSG00000163751	3.4.17.1		2298	protein-coding gene	gene with protein product	"""mast cell carboxypeptidase A"", ""tissue carboxypeptidase A"""	114851					Standard	NM_001870		Approved		uc003ewm.3	P15088	OTTHUMG00000159526	ENST00000296046.3:c.474+1G>A	chr3.hg19:g.148596536G>A		142.0	0.0		121.0	58.0	NM_001870	Q96E94	Splice_Site	SNP	ENST00000296046.3	hg19	CCDS3138.1	.	.	.	.	.	.	.	.	.	.	G	13.63	2.294177	0.40594	.	.	ENSG00000163751	ENST00000296046	.	.	.	5.19	5.19	0.71726	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0074	0.89213	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CPA3	150079226	1.000000	0.71417	1.000000	0.80357	0.338000	0.28826	7.163000	0.77524	2.857000	0.98124	0.650000	0.86243	.	.	.		0.308	CPA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355974.1	NM_001870	Intron
Unknown	0	hgsc.bcm.edu	37	4	8951938	8951938	+	IGR	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:8951938T>A								HMX1 (78395 upstream) : AC073648.1 (73120 downstream)																							TTCTCAAACTTGCCTGTTCTG	0.368																																					p.L154L		Atlas-SNP	.											.	.	.	.	0			c.T462A						.						82.0	69.0	73.0					4																	8951938		692	1591	2283	SO:0001628	intergenic_variant	0	exon1			CAAACTTGCCTGT																													chr4.hg19:g.8951938T>A		35.0	0.0		40.0	11.0	NM_001040071		Silent	SNP		hg19																																																																																				.	.	0	0.368								
PROM1	8842	hgsc.bcm.edu	37	4	16077499	16077499	+	Silent	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:16077499G>A	ENST00000510224.1	-	2	279	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L	PROM1_ENST00000505450.1_Silent_p.L11L|PROM1_ENST00000508167.1_Silent_p.L11L|PROM1_ENST00000539194.1_Silent_p.L11L|PROM1_ENST00000540805.1_Silent_p.L11L|PROM1_ENST00000447510.2_Silent_p.L11L|PROM1_ENST00000543373.1_Silent_p.L11L			O43490	PROM1_HUMAN	prominin 1	11					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						CACAGCCCCAGCAGCAACAGG	0.532																																					p.L11L		Atlas-SNP	.											.	PROM1	91	.	0			c.C31T						.						34.0	35.0	35.0					4																	16077499		2034	4193	6227	SO:0001819	synonymous_variant	8842	exon2			GCCCCAGCAGCAA	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.31C>T	chr4.hg19:g.16077499G>A		136.0	0.0		149.0	55.0	NM_001145847	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Silent	SNP	ENST00000510224.1	hg19	CCDS47029.1																																																																																			.	.		0.532	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	
PPARGC1A	10891	hgsc.bcm.edu	37	4	23803848	23803848	+	Splice_Site	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:23803848C>A	ENST00000264867.2	-	11	2259	c.2140G>T	c.(2140-2142)Gga>Tga	p.G714*	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	714	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.|RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				GATTCTCACCCATCATCCCGC	0.408																																					p.G714X	Esophageal Squamous(29;694 744 13796 34866 44181)	Atlas-SNP	.											.	PPARGC1A	129	.	0			c.G2140T						.						132.0	122.0	126.0					4																	23803848		2203	4300	6503	SO:0001630	splice_region_variant	10891	exon11			CTCACCCATCATC	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.2141+1G>T	chr4.hg19:g.23803848C>A		133.0	0.0		160.0	39.0	NM_013261	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Nonsense_Mutation	SNP	ENST00000264867.2	hg19	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	c	39	7.767552	0.98477	.	.	ENSG00000109819	ENST00000264867	.	.	.	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	-7.0564	19.547	0.95302	0.0:1.0:0.0:0.0	.	.	.	.	X	714	.	ENSP00000264867:G714X	G	-	1	0	PPARGC1A	23412946	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.443000	0.80521	2.697000	0.92050	0.457000	0.33378	GGA	.	.		0.408	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	Nonsense_Mutation
CWH43	80157	hgsc.bcm.edu	37	4	48990664	48990664	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:48990664C>A	ENST00000226432.4	+	2	397	c.214C>A	c.(214-216)Ctg>Atg	p.L72M	CWH43_ENST00000513409.1_Missense_Mutation_p.L45M	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	72					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GATGCTAACCCTGCTGAGGAT	0.318																																					p.L72M		Atlas-SNP	.											.	CWH43	101	.	0			c.C214A						.						62.0	59.0	60.0					4																	48990664		2203	4300	6503	SO:0001583	missense	80157	exon2			CTAACCCTGCTGA		CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.214C>A	chr4.hg19:g.48990664C>A	ENSP00000226432:p.Leu72Met	144.0	0.0		146.0	39.0	NM_025087	B2RPD7	Missense_Mutation	SNP	ENST00000226432.4	hg19	CCDS3486.1	.	.	.	.	.	.	.	.	.	.	C	10.06	1.247710	0.22880	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.49720	1.35;0.77	5.04	0.904	0.19302	.	0.000000	0.46145	D	0.000320	T	0.53578	0.1805	M	0.65975	2.015	0.21355	N	0.999719	D	0.57571	0.98	P	0.54312	0.748	T	0.48703	-0.9012	9	.	.	.	.	9.4725	0.38851	0.0:0.4969:0.0:0.5031	.	72	Q9H720	PG2IP_HUMAN	M	72;45	ENSP00000226432:L72M;ENSP00000422802:L45M	.	L	+	1	2	CWH43	48685421	0.085000	0.21516	0.044000	0.18714	0.147000	0.21601	0.258000	0.18387	0.013000	0.14918	0.563000	0.77884	CTG	.	.		0.318	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250496.2	NM_025087	
DMP1	1758	hgsc.bcm.edu	37	4	88583327	88583327	+	Nonsense_Mutation	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:88583327A>T	ENST00000339673.6	+	6	496	c.397A>T	c.(397-399)Aga>Tga	p.R133*	DMP1_ENST00000282479.7_Nonsense_Mutation_p.R117*|RP11-742B18.1_ENST00000507894.1_RNA|RP11-742B18.1_ENST00000506814.1_RNA|RP11-742B18.1_ENST00000506480.1_RNA	NM_004407.3	NP_004398.1	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1	133					biomineral tissue development (GO:0031214)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|positive regulation of cell-substrate adhesion (GO:0010811)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(1)|stomach(1)	32		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)		AGGAAACTCCAGACTGGGAAG	0.512																																					p.R133X		Atlas-SNP	.											.	DMP1	72	.	0			c.A397T						.						89.0	81.0	83.0					4																	88583327		2203	4300	6503	SO:0001587	stop_gained	1758	exon6			AACTCCAGACTGG	U34037	CCDS3623.1, CCDS43249.1	4q21	2008-08-29	2008-08-29		ENSG00000152592	ENSG00000152592			2932	protein-coding gene	gene with protein product		600980	"""dentin matrix acidic phosphoprotein"""			8586437, 9177774	Standard	NM_001079911		Approved		uc003hqv.3	Q13316	OTTHUMG00000130598	ENST00000339673.6:c.397A>T	chr4.hg19:g.88583327A>T	ENSP00000340935:p.Arg133*	171.0	0.0		96.0	70.0	NM_004407	A1L4L3|O43265	Nonsense_Mutation	SNP	ENST00000339673.6	hg19	CCDS3623.1	.	.	.	.	.	.	.	.	.	.	A	13.21	2.170122	0.38315	.	.	ENSG00000152592	ENST00000339673;ENST00000282479	.	.	.	5.37	1.35	0.21983	.	1.159810	0.06226	N	0.687666	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.516	5.9697	0.19344	0.669:0.1509:0.1801:0.0	.	.	.	.	X	133;117	.	ENSP00000282479:R117X	R	+	1	2	DMP1	88802351	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.523000	0.22925	0.365000	0.24400	0.454000	0.30748	AGA	.	.		0.512	DMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253047.1		
INTS12	57117	hgsc.bcm.edu	37	4	106614468	106614468	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:106614468C>T	ENST00000451321.2	-	4	964	c.485G>A	c.(484-486)tGc>tAc	p.C162Y	INTS12_ENST00000394735.1_Missense_Mutation_p.C162Y|INTS12_ENST00000340139.5_Missense_Mutation_p.C162Y	NM_001142471.1	NP_001135943.1	Q96CB8	INT12_HUMAN	integrator complex subunit 12	162					snRNA processing (GO:0016180)	integrator complex (GO:0032039)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(123;5.12e-07)		ACAAACAACGCAGGCCAATCC	0.428																																					p.C162Y		Atlas-SNP	.											.	INTS12	35	.	0			c.G485A						.						139.0	131.0	134.0					4																	106614468		2203	4300	6503	SO:0001583	missense	57117	exon5			ACAACGCAGGCCA		CCDS3671.1	4q24	2013-01-28	2006-03-15	2006-03-15	ENSG00000138785	ENSG00000138785		"""Zinc fingers, PHD-type"""	25067	protein-coding gene	gene with protein product	"""hypothetical nuclear factor SBBI22"""	611355	"""PHD finger protein 22"""	PHF22		16239144	Standard	NM_020395		Approved	SBBI22, INT12	uc010ilr.3	Q96CB8	OTTHUMG00000131215	ENST00000451321.2:c.485G>A	chr4.hg19:g.106614468C>T	ENSP00000415433:p.Cys162Tyr	210.0	0.0		75.0	55.0	NM_020395	B2RC48|Q3B6Z3|Q9HD71	Missense_Mutation	SNP	ENST00000451321.2	hg19	CCDS3671.1	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838145	0.91117	.	.	ENSG00000138785	ENST00000394735;ENST00000340139;ENST00000451321	D;D;D	0.99252	-5.63;-5.63;-5.63	5.71	5.71	0.89125	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.99548	0.9838	M	0.90198	3.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98483	1.0606	10	0.87932	D	0	-10.2296	19.8633	0.96793	0.0:1.0:0.0:0.0	.	162	Q96CB8	INT12_HUMAN	Y	162	ENSP00000378221:C162Y;ENSP00000340737:C162Y;ENSP00000415433:C162Y	ENSP00000340737:C162Y	C	-	2	0	INTS12	106833917	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.340000	0.79292	2.697000	0.92050	0.591000	0.81541	TGC	.	.		0.428	INTS12-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318624.1	NM_020395	
EGF	1950	hgsc.bcm.edu	37	4	110885652	110885652	+	Missense_Mutation	SNP	G	G	A	rs529423872		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:110885652G>A	ENST00000265171.5	+	10	1979	c.1534G>A	c.(1534-1536)Gga>Aga	p.G512R	EGF_ENST00000503392.1_Missense_Mutation_p.G512R|EGF_ENST00000509793.1_Missense_Mutation_p.G470R	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	512					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	CCAGCAGATGGGAATGGTTTA	0.413													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22473	0.0		0.0	False		,,,				2504	0.0				p.G512R		Atlas-SNP	.											.	EGF	113	.	0			c.G1534A						.						274.0	256.0	262.0					4																	110885652		2203	4300	6503	SO:0001583	missense	1950	exon10			CAGATGGGAATGG	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1534G>A	chr4.hg19:g.110885652G>A	ENSP00000265171:p.Gly512Arg	229.0	0.0		104.0	80.0	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	hg19	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.358316	0.82243	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.91631	-2.88;-2.88;-2.88	5.05	5.05	0.67936	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.92701	0.7680	N	0.24115	0.695	0.80722	D	1	D;P;D	0.89917	0.997;0.941;1.0	D;P;D	0.97110	0.973;0.891;1.0	D	0.91325	0.5085	10	0.24483	T	0.36	.	18.434	0.90638	0.0:0.0:1.0:0.0	.	512;470;512	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	R	470;512;512	ENSP00000424316:G470R;ENSP00000265171:G512R;ENSP00000421384:G512R	ENSP00000265171:G512R	G	+	1	0	EGF	111105101	1.000000	0.71417	0.996000	0.52242	0.992000	0.81027	8.427000	0.90275	2.328000	0.79073	0.561000	0.74099	GGA	.	.		0.413	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
ALPK1	80216	hgsc.bcm.edu	37	4	113332992	113332992	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr4:113332992A>T	ENST00000458497.1	+	5	565	c.286A>T	c.(286-288)Agg>Tgg	p.R96W	ALPK1_ENST00000505912.1_3'UTR|ALPK1_ENST00000504176.2_Missense_Mutation_p.R18W|ALPK1_ENST00000177648.9_Missense_Mutation_p.R96W	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	96							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		GGCGTCCCTGAGGGCCTCCAT	0.597																																					p.R96W		Atlas-SNP	.											.	ALPK1	125	.	0			c.A286T						.						37.0	35.0	35.0					4																	113332992		2203	4300	6503	SO:0001583	missense	80216	exon5			TCCCTGAGGGCCT	AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.286A>T	chr4.hg19:g.113332992A>T	ENSP00000398048:p.Arg96Trp	72.0	0.0		45.0	33.0	NM_001102406	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	ENST00000458497.1	hg19	CCDS3697.1	.	.	.	.	.	.	.	.	.	.	A	8.734	0.917257	0.17982	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000309610;ENST00000504176	T;T;T	0.23348	1.91;1.91;1.91	5.48	3.31	0.37934	.	0.163853	0.52532	D	0.000078	T	0.38825	0.1055	L	0.40543	1.245	0.41177	D	0.986205	D;D;D;D	0.67145	0.996;0.996;0.988;0.991	P;D;P;P	0.64687	0.898;0.928;0.898;0.777	T	0.18053	-1.0349	10	0.87932	D	0	-6.3369	13.3895	0.60816	0.8163:0.1837:0.0:0.0	.	18;71;71;96	F5H138;Q9H623;E7EX13;Q96QP1	.;.;.;ALPK1_HUMAN	W	96;96;71;18	ENSP00000398048:R96W;ENSP00000177648:R96W;ENSP00000426044:R18W	ENSP00000177648:R96W	R	+	1	2	ALPK1	113552441	1.000000	0.71417	0.649000	0.29536	0.212000	0.24457	3.401000	0.52601	0.493000	0.27837	-0.445000	0.05633	AGG	.	.		0.597	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256421.2	NM_025144	
CDH18	1016	hgsc.bcm.edu	37	5	19473795	19473796	+	Missense_Mutation	DNP	CG	CG	AA	rs565236156		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C|G	C|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr5:19473795_19473796CG>AA	ENST00000507958.1	-	15	2902_2903	c.1912_1913CG>TT	c.(1912-1914)CGc>TTc	p.R638F	CDH18_ENST00000510297.1_5'UTR|CDH18_ENST00000274170.4_Missense_Mutation_p.R638F|CDH18_ENST00000502796.1_3'UTR|CDH18_ENST00000382275.1_Missense_Mutation_p.R638F|CDH18_ENST00000506372.1_3'UTR			Q13634	CAD18_HUMAN	cadherin 18, type 2	638					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R638H(2)		breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TTTTTTGCTGCGCCTCAGGGTG	0.431																																					p.R638L|p.R638C		Atlas-SNP	.											CDH18_ENST00000507958,NS,adenocarcinoma,-1,2|CDH18_ENST00000507958,NS,adenocarcinoma,0,4	CDH18	561	.	2	Substitution - Missense(2)	endometrium(2)	c.G1913T|c.C1912T						.																																			SO:0001583	missense	1016	exon13			TTGCTGCGCCTCA|TGCTGCGCCTCAG	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.1912_1913delinsAA	chr5.hg19:g.19473795_19473796delinsAA	ENSP00000425093:p.Arg638Phe	38.0	0.0		33.0	10.0	NM_004934	A8K0I2|B4DHG6|Q8N5Z2	Missense_Mutation	SNP	ENST00000507958.1	hg19	CCDS3889.1																																																																																			.	.		0.431	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
CDH9	1007	hgsc.bcm.edu	37	5	26902662	26902662	+	Silent	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr5:26902662T>A	ENST00000231021.4	-	7	1348	c.1176A>T	c.(1174-1176)gtA>gtT	p.V392V		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	392	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						CATCTTCATCTACTTCTATCA	0.378																																					p.V392V	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.A1176T						.						129.0	122.0	124.0					5																	26902662		2203	4300	6503	SO:0001819	synonymous_variant	1007	exon7			TTCATCTACTTCT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1176A>T	chr5.hg19:g.26902662T>A		66.0	0.0		71.0	35.0	NM_016279	Q3B7I5	Silent	SNP	ENST00000231021.4	hg19	CCDS3893.1																																																																																			.	.		0.378	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
CAST	831	hgsc.bcm.edu	37	5	96031603	96031603	+	5'UTR	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr5:96031603G>A	ENST00000341926.3	+	0	115				CAST_ENST00000395813.1_Missense_Mutation_p.A68T|CAST_ENST00000508608.1_Missense_Mutation_p.A53T|AC020900.2_ENST00000580431.1_RNA|CAST_ENST00000338252.3_5'UTR|CAST_ENST00000325674.7_Missense_Mutation_p.A68T|CAST_ENST00000395812.2_Missense_Mutation_p.A68T|CAST_ENST00000508830.1_Missense_Mutation_p.A68T|CAST_ENST00000359176.4_Missense_Mutation_p.A68T|CAST_ENST00000510756.1_Missense_Mutation_p.A68T			P20810	ICAL_HUMAN	calpastatin						negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		AACAGCCTCGGCCACCAAGGT	0.468																																					p.A68T		Atlas-SNP	.											.	CAST	58	.	0			c.G202A						.						36.0	34.0	35.0					5																	96031603		1869	4096	5965	SO:0001623	5_prime_UTR_variant	831	exon3			GCCTCGGCCACCA	AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.-48G>A	chr5.hg19:g.96031603G>A		419.0	0.0		326.0	148.0	NM_001042440	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	ENST00000341926.3	hg19		.	.	.	.	.	.	.	.	.	.	G	7.871	0.728048	0.15507	.	.	ENSG00000153113	ENST00000505143;ENST00000508830;ENST00000511097;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000421689;ENST00000510756;ENST00000514845;ENST00000506811;ENST00000514055;ENST00000508608	T;T;T;T;T;T;T;T;T;T	0.56611	0.45;1.87;4.25;1.87;2.11;1.99;2.08;0.5;2.17;2.18	4.65	0.712	0.18167	.	.	.	.	.	T	0.35941	0.0949	L	0.43152	1.355	0.09310	N	1	B;P;B;P;B;B	0.41848	0.001;0.728;0.004;0.763;0.004;0.041	B;B;B;B;B;B	0.33960	0.001;0.168;0.005;0.173;0.005;0.022	T	0.27606	-1.0069	9	0.87932	D	0	2.5497	3.7993	0.08751	0.2616:0.0:0.5645:0.1739	.	53;68;68;68;68;68	B7Z468;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6	.;.;.;.;.;.	T	63;68;68;68;68;68;68;68;68;53;53;53;53	ENSP00000422957:A63T;ENSP00000425721:A68T;ENSP00000422951:A68T;ENSP00000379158:A68T;ENSP00000352098:A68T;ENSP00000320319:A68T;ENSP00000379157:A68T;ENSP00000396558:A68T;ENSP00000422176:A68T;ENSP00000422677:A53T	ENSP00000320319:A68T	A	+	1	0	CAST	96057359	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.018000	0.12568	0.113000	0.18004	-0.258000	0.10820	GCC	.	.		0.468	CAST-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000250199.2	NM_173062	
ST8SIA4	7903	hgsc.bcm.edu	37	5	100222044	100222044	+	Intron	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr5:100222044C>A	ENST00000231461.5	-	3	814				ST8SIA4_ENST00000507360.2_5'Flank|ST8SIA4_ENST00000451528.2_Nonstop_Mutation_p.*169L	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4						axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		GAAGAAAGCTCACCTTATTAC	0.343																																					p.X169L		Atlas-SNP	.											.	ST8SIA4	77	.	0			c.G506T						.						55.0	58.0	57.0					5																	100222044		2203	4300	6503	SO:0001627	intron_variant	7903	exon3			AAAGCTCACCTTA	L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.503+2G>T	chr5.hg19:g.100222044C>A		150.0	0.0		114.0	47.0	NM_175052	A8KA07|G3V104|Q8N1F4|Q92693	Missense_Mutation	SNP	ENST00000231461.5	hg19	CCDS4091.1	.	.	.	.	.	.	.	.	.	.	C	14.23	2.472384	0.43942	.	.	ENSG00000113532	ENST00000451528	.	.	.	5.82	2.77	0.32553	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6635	0.34108	0.0:0.581:0.0:0.419	.	.	.	.	L	169	.	.	X	-	2	2	ST8SIA4	100249943	1.000000	0.71417	0.994000	0.49952	0.734000	0.41952	0.775000	0.26689	0.243000	0.21327	0.557000	0.71058	TGA	.	.		0.343	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250632.3	NM_005668	
APC	324	hgsc.bcm.edu	37	5	112179352	112179352	+	Silent	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr5:112179352A>T	ENST00000457016.1	+	16	8441	c.8061A>T	c.(8059-8061)tcA>tcT	p.S2687S	APC_ENST00000257430.4_Silent_p.S2687S|CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Silent_p.S2687S			P25054	APC_HUMAN	adenomatous polyposis coli	2687	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		ACAGTGTTTCAGAAAAGGCAA	0.428		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											p.S2687S	NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	Atlas-SNP	.	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	.	APC	4158	.	1	Unknown(1)	skin(1)	c.A8061T						.						85.0	88.0	87.0					5																	112179352		2202	4300	6502	SO:0001819	synonymous_variant	324	exon17	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	TGTTTCAGAAAAG	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.8061A>T	chr5.hg19:g.112179352A>T		164.0	0.0		125.0	63.0	NM_001127510	D3DT03|Q15162|Q15163|Q93042	Silent	SNP	ENST00000457016.1	hg19	CCDS4107.1																																																																																			.	.		0.428	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250738.2	NM_000038	
PROB1	389333	hgsc.bcm.edu	37	5	138728542	138728542	+	Silent	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr5:138728542G>A	ENST00000434752.2	-	1	2343	c.2229C>T	c.(2227-2229)cgC>cgT	p.R743R	MZB1_ENST00000457570.2_5'Flank|MZB1_ENST00000302125.8_5'Flank|MZB1_ENST00000412103.2_5'Flank	NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	743	Pro-rich.																CCTCGGGCCGGCGACCCAAGG	0.711																																					p.R743R		Atlas-SNP	.											.	.	.	.	0			c.C2229T						.						7.0	14.0	12.0					5																	138728542		682	1564	2246	SO:0001819	synonymous_variant	389333	exon1			GGGCCGGCGACCC	AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.2229C>T	chr5.hg19:g.138728542G>A		101.0	0.0		80.0	6.0	NM_001161546	B4E007	Silent	SNP	ENST00000434752.2	hg19	CCDS54909.1																																																																																			.	.		0.711	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470735.1	NM_001161546	
GM2A	2760	hgsc.bcm.edu	37	5	150646346	150646346	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr5:150646346A>G	ENST00000357164.3	+	3	623	c.298A>G	c.(298-300)Aca>Gca	p.T100A		NM_000405.4|NM_001167607.1	NP_000396.2|NP_001161079.1	P17900	SAP3_HUMAN	GM2 ganglioside activator	100					ganglioside catabolic process (GO:0006689)|glycosphingolipid metabolic process (GO:0006687)|learning or memory (GO:0007611)|lipid storage (GO:0019915)|neuromuscular process controlling balance (GO:0050885)|oligosaccharide catabolic process (GO:0009313)|positive regulation of hydrolase activity (GO:0051345)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	apical cortex (GO:0045179)|cytoplasmic side of plasma membrane (GO:0009898)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|mitochondrion (GO:0005739)	beta-N-acetylhexosaminidase activity (GO:0004563)|lipid transporter activity (GO:0005319)|phospholipase activator activity (GO:0016004)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|upper_aerodigestive_tract(2)	8		Medulloblastoma(196;0.091)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GATCCCATGCACAGACTACAT	0.453																																					p.T100A		Atlas-SNP	.											.	GM2A	24	.	0			c.A298G						.						100.0	96.0	98.0					5																	150646346		2203	4300	6503	SO:0001583	missense	2760	exon3			CCATGCACAGACT		CCDS4313.1	5q33.1	2010-03-17	2004-05-20		ENSG00000196743	ENSG00000196743			4367	protein-coding gene	gene with protein product	"""cerebroside sulfate activator protein"", ""sphingolipid activator protein 3"""	613109	"""GM2 ganglioside activator protein"""			115863, 1915857	Standard	NM_000405		Approved	SAP-3	uc003ltr.4	P17900	OTTHUMG00000130124	ENST00000357164.3:c.298A>G	chr5.hg19:g.150646346A>G	ENSP00000349687:p.Thr100Ala	65.0	0.0		47.0	16.0	NM_001167607	B2R699|D3DQH6|Q14426|Q14428|Q6LBL5	Missense_Mutation	SNP	ENST00000357164.3	hg19	CCDS4313.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.719|5.719	0.317077|0.317077	0.10845|0.10845	.|.	.|.	ENSG00000196743|ENSG00000196743	ENST00000523004|ENST00000523466;ENST00000357164	.|T;T	.|0.68181	.|-0.31;-0.31	5.17|5.17	0.0696|0.0696	0.14375|0.14375	.|MD-2-related lipid-recognition (1);	.|0.638868	.|0.16196	.|N	.|0.225157	T|T	0.40473|0.40473	0.1118|0.1118	N|N	0.14661|0.14661	0.345|0.345	0.18873|0.18873	N|N	0.999986|0.999986	.|B;B;B	.|0.13145	.|0.007;0.001;0.003	.|B;B;B	.|0.14023	.|0.01;0.001;0.002	T|T	0.21793|0.21793	-1.0235|-1.0235	5|10	.|0.52906	.|T	.|0.07	-24.5435|-24.5435	1.2428|1.2428	0.01967|0.01967	0.2393:0.1217:0.4016:0.2374|0.2393:0.1217:0.4016:0.2374	.|.	.|100;58;100	.|B4DQM5;Q14427;P17900	.|.;.;SAP3_HUMAN	R|A	58|115;100	.|ENSP00000429100:T115A;ENSP00000349687:T100A	.|ENSP00000349687:T100A	H|T	+|+	2|1	0|0	GM2A|GM2A	150626539|150626539	0.001000|0.001000	0.12720|0.12720	0.196000|0.196000	0.23383|0.23383	0.047000|0.047000	0.14425|0.14425	-1.067000|-1.067000	0.03451|0.03451	0.328000|0.328000	0.23435|0.23435	-0.242000|-0.242000	0.12053|0.12053	CAC|ACA	.	.		0.453	GM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252432.1	NM_000405	
SYCP2L	221711	hgsc.bcm.edu	37	6	10924796	10924796	+	Silent	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr6:10924796C>A	ENST00000283141.6	+	15	1436	c.1140C>A	c.(1138-1140)gtC>gtA	p.V380V	SYCP2L_ENST00000543878.1_Silent_p.V221V|RP11-637O19.3_ENST00000480294.1_3'UTR	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	380						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			ACAAAGAAGTCATGAAAATAG	0.338																																					p.V380V		Atlas-SNP	.											.	SYCP2L	101	.	0			c.C1140A						.						87.0	81.0	83.0					6																	10924796		1822	4081	5903	SO:0001819	synonymous_variant	221711	exon15			AGAAGTCATGAAA	AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.1140C>A	chr6.hg19:g.10924796C>A		85.0	0.0		147.0	28.0	NM_001040274	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Silent	SNP	ENST00000283141.6	hg19	CCDS43423.1																																																																																			.	.		0.338	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039845.3	NM_194299	
MLN	4295	hgsc.bcm.edu	37	6	33766966	33766966	+	Silent	SNP	G	G	T	rs188344611		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr6:33766966G>T	ENST00000430124.2	-	3	215	c.150C>A	c.(148-150)tcC>tcA	p.S50S	MLN_ENST00000507738.1_Silent_p.S50S|MLN_ENST00000266003.5_Silent_p.S50S	NM_001040109.1|NM_001184698.1|NM_002418.2	NP_001035198.1|NP_001171627.1|NP_002409.1	P12872	MOTI_HUMAN	motilin	50					cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)	extracellular region (GO:0005576)	receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|skin(1)	6						ATACACTCAGGGATTTCTTTT	0.527																																					p.S50S		Atlas-SNP	.											.	MLN	16	.	0			c.C150A						.						169.0	141.0	150.0					6																	33766966		2203	4300	6503	SO:0001819	synonymous_variant	4295	exon3			ACTCAGGGATTTC		CCDS4786.1, CCDS47412.1, CCDS54993.1	6p21.31	2014-01-30			ENSG00000096395	ENSG00000096395		"""Endogenous ligands"""	7141	protein-coding gene	gene with protein product	"""prepromotilin"""	158270					Standard	NM_001184698		Approved		uc003off.1	P12872	OTTHUMG00000014536	ENST00000430124.2:c.150C>A	chr6.hg19:g.33766966G>T		127.0	0.0		190.0	40.0	NM_002418	B7ZLR7|E9PDN2|J3KN51|Q2M1L2|Q5T975|Q6NSY7	Silent	SNP	ENST00000430124.2	hg19	CCDS4786.1																																																																																			.	G|1.000;A|0.000		0.527	MLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040211.4		
STK38	11329	hgsc.bcm.edu	37	6	36485547	36485547	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr6:36485547T>C	ENST00000229812.7	-	6	746	c.461A>G	c.(460-462)tAt>tGt	p.Y154C		NM_007271.2	NP_009202.1			serine/threonine kinase 38											NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTGAAAACTATAGAACATTTT	0.413																																					p.Y154C	Colon(180;997 3561 16158)	Atlas-SNP	.											.	STK38	54	.	0			c.A461G						.						124.0	114.0	117.0					6																	36485547		2203	4300	6503	SO:0001583	missense	11329	exon6			AAACTATAGAACA		CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.461A>G	chr6.hg19:g.36485547T>C	ENSP00000229812:p.Tyr154Cys	103.0	0.0		212.0	50.0	NM_007271		Missense_Mutation	SNP	ENST00000229812.7	hg19	CCDS4822.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.940122	0.73557	.	.	ENSG00000112079	ENST00000229812	T	0.39592	1.07	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.45013	0.1321	L	0.33792	1.035	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.40251	-0.9573	10	0.40728	T	0.16	.	16.2669	0.82588	0.0:0.0:0.0:1.0	.	154	Q15208	STK38_HUMAN	C	154	ENSP00000229812:Y154C	ENSP00000229812:Y154C	Y	-	2	0	STK38	36593525	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.240000	0.73641	0.533000	0.62120	TAT	.	.		0.413	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040346.1	NM_007271	
TREML4	285852	hgsc.bcm.edu	37	6	41196780	41196780	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr6:41196780C>A	ENST00000341495.2	+	2	496	c.392C>A	c.(391-393)cCa>cAa	p.P131Q	TREML4_ENST00000448827.2_Missense_Mutation_p.P131Q	NM_198153.2	NP_937796.1	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid cells-like 4	131						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.196)					GTGGTGTCTCCAGGTGAGCTC	0.507																																					p.P131Q		Atlas-SNP	.											.	TREML4	25	.	0			c.C392A						.						53.0	54.0	54.0					6																	41196780		2203	4300	6503	SO:0001583	missense	285852	exon2			TGTCTCCAGGTGA	AF534826	CCDS34446.1	6p21.1	2013-01-11			ENSG00000188056	ENSG00000188056		"""Immunoglobulin superfamily / V-set domain containing"""	30807	protein-coding gene	gene with protein product	"""TREM like transcript 4"""	614664				12645956	Standard	NM_198153		Approved	TLT4	uc003oqc.3	Q6UXN2	OTTHUMG00000016408	ENST00000341495.2:c.392C>A	chr6.hg19:g.41196780C>A	ENSP00000342570:p.Pro131Gln	53.0	0.0		120.0	16.0	NM_198153	B7ZL92	Missense_Mutation	SNP	ENST00000341495.2	hg19	CCDS34446.1	.	.	.	.	.	.	.	.	.	.	.	16.15	3.041096	0.55003	.	.	ENSG00000188056	ENST00000341495;ENST00000445267;ENST00000448827	T;T	0.04551	3.6;3.6	4.39	2.53	0.30540	Immunoglobulin-like fold (1);	.	.	.	.	T	0.03651	0.0104	L	0.27053	0.805	0.09310	N	1	D	0.89917	1.0	D	0.74348	0.983	T	0.38714	-0.9648	9	0.54805	T	0.06	-2.7064	5.1176	0.14843	0.2034:0.6884:0.0:0.1082	.	131	Q6UXN2	TRML4_HUMAN	Q	131	ENSP00000342570:P131Q;ENSP00000418078:P131Q	ENSP00000342570:P131Q	P	+	2	0	TREML4	41304758	0.369000	0.25039	0.050000	0.19076	0.332000	0.28634	0.981000	0.29526	0.431000	0.26258	0.591000	0.81541	CCA	.	.		0.507	TREML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043873.2		
ABCC10	89845	hgsc.bcm.edu	37	6	43417802	43417802	+	Silent	SNP	A	A	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr6:43417802A>C	ENST00000372530.4	+	22	4667	c.4452A>C	c.(4450-4452)ggA>ggC	p.G1484G	ABCC10_ENST00000244533.3_Silent_p.G1456G	NM_001198934.1	NP_001185863.1	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 10	1484					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(8)|lung(21)|ovary(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)		Cyclosporine(DB00091)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Estradiol(DB00783)|Etoposide(DB00773)|Gemcitabine(DB00441)|Methotrexate(DB00563)|Paclitaxel(DB01229)|Sildenafil(DB00203)|Tenofovir(DB00300)|Verapamil(DB00661)|Vincristine(DB00541)	GCCAGCAGGGAGTCCCTGCCT	0.652																																					p.G1484G		Atlas-SNP	.											.	ABCC10	118	.	0			c.A4452C						.						56.0	63.0	61.0					6																	43417802		2203	4300	6503	SO:0001819	synonymous_variant	89845	exon22			GCAGGGAGTCCCT	U66684	CCDS4896.1, CCDS56430.1	6p12.3	2012-03-14			ENSG00000124574	ENSG00000124574		"""ATP binding cassette transporters / subfamily C"""	52	protein-coding gene	gene with protein product		612509				8894702	Standard	NM_033450		Approved	EST182763, MRP7, SIMRP7	uc003ouy.1	Q5T3U5	OTTHUMG00000014733	ENST00000372530.4:c.4452A>C	chr6.hg19:g.43417802A>C		185.0	0.0		288.0	58.0	NM_001198934	Q8NHX7|Q9H7N2|Q9NXY3|Q9UF48	Silent	SNP	ENST00000372530.4	hg19	CCDS56430.1																																																																																			.	.		0.652	ABCC10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040603.2	NM_033450	
AMPH	273	hgsc.bcm.edu	37	7	38505102	38505102	+	Missense_Mutation	SNP	G	G	C	rs146457438	byFrequency	TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr7:38505102G>C	ENST00000356264.2	-	9	929	c.714C>G	c.(712-714)caC>caG	p.H238Q	AMPH_ENST00000325590.5_Missense_Mutation_p.H238Q|AMPH_ENST00000428293.2_Missense_Mutation_p.H238Q	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	238	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)	p.H238H(1)|p.H238Q(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CCTTGTCGGCGTGCTGGTCAC	0.502																																					p.H238Q		Atlas-SNP	.											AMPH,colon,carcinoma,0,2	AMPH	157	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)	c.C714G						.						75.0	59.0	64.0					7																	38505102		2203	4298	6501	SO:0001583	missense	273	exon9			GTCGGCGTGCTGG		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.714C>G	chr7.hg19:g.38505102G>C	ENSP00000348602:p.His238Gln	124.0	0.0		100.0	48.0	NM_139316	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	hg19	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490918	0.44249	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000544070	T;T;T	0.41065	1.01;1.01;1.01	5.87	-11.7	0.00046	BAR (1);	0.107286	0.64402	D	0.000002	T	0.44829	0.1312	L	0.38531	1.155	0.30126	N	0.805235	D;D	0.71674	0.998;0.998	D;P	0.64877	0.93;0.899	T	0.79482	-0.1785	10	0.49607	T	0.09	-26.1083	20.1993	0.98256	0.4304:0.0:0.5696:0.0	.	238;238	P49418-2;P49418	.;AMPH_HUMAN	Q	238;238;238;8;238	ENSP00000317441:H238Q;ENSP00000348602:H238Q;ENSP00000390734:H238Q	ENSP00000317441:H238Q	H	-	3	2	AMPH	38471627	0.001000	0.12720	0.045000	0.18777	0.933000	0.57130	-1.559000	0.02162	-3.327000	0.00186	-2.154000	0.00331	CAC	.	G|0.999;A|0.001		0.502	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
RFC2	5982	hgsc.bcm.edu	37	7	73657534	73657534	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr7:73657534T>G	ENST00000055077.3	-	6	537	c.477A>C	c.(475-477)gaA>gaC	p.E159D	RFC2_ENST00000352131.3_Missense_Mutation_p.E125D	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	159					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						TAGAGTAGATTTCCATGGTTC	0.522																																					p.E159D		Atlas-SNP	.											.	RFC2	27	.	0			c.A477C						.						216.0	182.0	193.0					7																	73657534		2203	4300	6503	SO:0001583	missense	5982	exon6			GTAGATTTCCATG		CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.477A>C	chr7.hg19:g.73657534T>G	ENSP00000055077:p.Glu159Asp	107.0	0.0		86.0	43.0	NM_181471	B5BU07|D3DXG3|P32846|Q9BU93	Missense_Mutation	SNP	ENST00000055077.3	hg19	CCDS5568.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.169854	0.78452	.	.	ENSG00000049541	ENST00000352131;ENST00000055077	T;D	0.91577	0.79;-2.87	4.99	-1.63	0.08345	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.93216	0.7839	M	0.76002	2.32	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90836	0.4720	10	0.87932	D	0	.	9.7016	0.40189	0.0:0.3544:0.0:0.6456	.	125;125;159	P35250-2;Q75MT5;P35250	.;.;RFC2_HUMAN	D	125;159	ENSP00000275627:E125D;ENSP00000055077:E159D	ENSP00000055077:E159D	E	-	3	2	RFC2	73295470	0.938000	0.31826	0.989000	0.46669	0.936000	0.57629	0.036000	0.13819	-0.471000	0.06891	-0.263000	0.10527	GAA	.	.		0.522	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252459.2	NM_181471	
SEMA3E	9723	hgsc.bcm.edu	37	7	82996922	82996922	+	Missense_Mutation	SNP	T	T	A	rs368305214		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr7:82996922T>A	ENST00000307792.3	-	17	2775	c.2308A>T	c.(2308-2310)Agg>Tgg	p.R770W	SEMA3E_ENST00000427262.1_Missense_Mutation_p.R710W	NM_012431.2	NP_036563.1	O15041	SEM3E_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3E	770	Arg/Lys-rich (basic).				axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell-matrix adhesion (GO:0001953)|patterning of blood vessels (GO:0001569)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of cell shape (GO:0008360)|semaphorin-plexin signaling pathway (GO:0071526)|sprouting angiogenesis (GO:0002040)|synapse organization (GO:0050808)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(19)|ovary(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	51		Medulloblastoma(109;0.109)				AGCGTGTGCCTGGGCAGGCGG	0.413																																					p.R770W		Atlas-SNP	.											.	SEMA3E	125	.	0			c.A2308T						.						167.0	167.0	167.0					7																	82996922		2203	4300	6503	SO:0001583	missense	9723	exon17			TGTGCCTGGGCAG	AB002329	CCDS34674.1, CCDS55121.1	7q21.11	2013-01-11			ENSG00000170381	ENSG00000170381		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10727	protein-coding gene	gene with protein product	"""M-sema H"""	608166		SEMAH		9205841, 9515811	Standard	NM_012431		Approved	M-SemaK, KIAA0331, coll-5	uc003uhy.2	O15041	OTTHUMG00000154693	ENST00000307792.3:c.2308A>T	chr7.hg19:g.82996922T>A	ENSP00000303212:p.Arg770Trp	267.0	0.0		189.0	69.0	NM_012431	B4E1P1|Q75M94|Q75M97	Missense_Mutation	SNP	ENST00000307792.3	hg19	CCDS34674.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.289631	0.80914	.	.	ENSG00000170381	ENST00000307792;ENST00000427262;ENST00000541514	T;T	0.37915	1.2;1.17	5.64	4.47	0.54385	.	0.049694	0.85682	D	0.000000	T	0.61311	0.2337	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65829	-0.6073	10	0.87932	D	0	.	12.9892	0.58608	0.0:0.0:0.1347:0.8653	.	770	O15041	SEM3E_HUMAN	W	770;710;761	ENSP00000303212:R770W;ENSP00000405052:R710W	ENSP00000303212:R770W	R	-	1	2	SEMA3E	82834858	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	2.069000	0.41481	0.933000	0.37291	0.477000	0.44152	AGG	.	.		0.413	SEMA3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336606.1	NM_012431	
RELN	5649	hgsc.bcm.edu	37	7	103191647	103191647	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr7:103191647G>T	ENST00000428762.1	-	41	6328	c.6169C>A	c.(6169-6171)Ctc>Atc	p.L2057I	RELN_ENST00000424685.2_Missense_Mutation_p.L2057I|RELN_ENST00000343529.5_Missense_Mutation_p.L2057I	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2057					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TGGTAGCAGAGGGGCAGCAGA	0.587																																					p.L2057I	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.C6169A						.						71.0	54.0	60.0					7																	103191647		2203	4300	6503	SO:0001583	missense	5649	exon41			AGCAGAGGGGCAG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6169C>A	chr7.hg19:g.103191647G>T	ENSP00000392423:p.Leu2057Ile	68.0	0.0		55.0	24.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	ENST00000428762.1	hg19	CCDS47680.1	.	.	.	.	.	.	.	.	.	.	G	18.10	3.547620	0.65311	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21361	2.01;2.01;2.01	5.7	3.54	0.40534	Neuraminidase (1);	0.066024	0.64402	D	0.000011	T	0.32285	0.0824	L	0.50333	1.59	0.40919	D	0.984298	D;D	0.56968	0.977;0.978	D;D	0.70935	0.971;0.95	T	0.09574	-1.0668	10	0.42905	T	0.14	.	4.6682	0.12676	0.2076:0.217:0.5754:0.0	.	2057;2057	P78509-2;P78509	.;RELN_HUMAN	I	2057	ENSP00000392423:L2057I;ENSP00000345694:L2057I;ENSP00000388446:L2057I	ENSP00000345694:L2057I	L	-	1	0	RELN	102978883	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	1.901000	0.39838	1.384000	0.46424	0.650000	0.86243	CTC	.	.		0.587	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
PRKAR2B	5577	hgsc.bcm.edu	37	7	106781380	106781380	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr7:106781380A>G	ENST00000265717.4	+	5	828	c.569A>G	c.(568-570)aAc>aGc	p.N190S	PRKAR2B_ENST00000393613.2_3'UTR	NM_002736.2	NP_002727.2	P31323	KAP3_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, beta	190					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fatty acid metabolic process (GO:0006631)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|mitotic cell cycle (GO:0000278)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|ciliary base (GO:0097546)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	14						GATGGTGACAACTTTTATGTA	0.348																																					p.N190S		Atlas-SNP	.											.	PRKAR2B	34	.	0			c.A569G						.						161.0	155.0	157.0					7																	106781380		2203	4300	6503	SO:0001583	missense	5577	exon5			GTGACAACTTTTA		CCDS5740.1	7q22.3	2010-04-22			ENSG00000005249	ENSG00000005249	2.7.11.1		9392	protein-coding gene	gene with protein product		176912		PRKAR2		1358799	Standard	NM_002736		Approved		uc003vdx.3	P31323	OTTHUMG00000137418	ENST00000265717.4:c.569A>G	chr7.hg19:g.106781380A>G	ENSP00000265717:p.Asn190Ser	193.0	0.0		144.0	54.0	NM_002736	A4D0R9	Missense_Mutation	SNP	ENST00000265717.4	hg19	CCDS5740.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.574225	0.86542	.	.	ENSG00000005249	ENST00000265717;ENST00000543645;ENST00000539794	D	0.91577	-2.87	5.25	5.25	0.73442	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.85682	D	0.000000	D	0.93858	0.8035	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94458	0.7673	10	0.72032	D	0.01	-5.7271	15.4527	0.75285	1.0:0.0:0.0:0.0	.	190	P31323	KAP3_HUMAN	S	190;190;177	ENSP00000265717:N190S	ENSP00000265717:N190S	N	+	2	0	PRKAR2B	106568616	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.259000	0.95561	2.121000	0.65114	0.460000	0.39030	AAC	.	.		0.348	PRKAR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268386.1		
GRM8	2918	hgsc.bcm.edu	37	7	126542720	126542720	+	Nonsense_Mutation	SNP	G	G	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr7:126542720G>C	ENST00000339582.2	-	6	1840	c.1032C>G	c.(1030-1032)taC>taG	p.Y344*	GRM8_ENST00000444921.2_Nonsense_Mutation_p.Y344*|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000405249.1_Nonsense_Mutation_p.Y344*|GRM8_ENST00000358373.3_Nonsense_Mutation_p.Y344*			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	344					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GGCTTCTAAAGTATCGATCAA	0.343										HNSCC(24;0.065)																											p.Y344X		Atlas-SNP	.											.	GRM8	377	.	0			c.C1032G						.						67.0	67.0	67.0					7																	126542720		2202	4300	6502	SO:0001587	stop_gained	2918	exon5			TCTAAAGTATCGA		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1032C>G	chr7.hg19:g.126542720G>C	ENSP00000344173:p.Tyr344*	103.0	0.0		95.0	50.0	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Nonsense_Mutation	SNP	ENST00000339582.2	hg19	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943803	0.92593	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	.	.	.	4.88	-1.71	0.08133	.	0.068522	0.64402	D	0.000011	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4321	0.44413	0.6443:0.0:0.3557:0.0	.	.	.	.	X	344	.	ENSP00000344173:Y344X	Y	-	3	2	GRM8	126329956	0.997000	0.39634	0.995000	0.50966	0.962000	0.63368	0.523000	0.22925	-0.251000	0.09542	-0.350000	0.07774	TAC	.	.		0.343	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
CHMP7	91782	hgsc.bcm.edu	37	8	23104313	23104313	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr8:23104313C>G	ENST00000397677.1	+	2	753	c.105C>G	c.(103-105)ttC>ttG	p.F35L	CHMP7_ENST00000313219.7_Missense_Mutation_p.F35L	NM_152272.3	NP_689485.1	Q8WUX9	CHMP7_HUMAN	charged multivesicular body protein 7	35					endosomal transport (GO:0016197)|late endosome to vacuole transport (GO:0045324)|membrane organization (GO:0061024)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytosol (GO:0005829)|ESCRT III complex (GO:0000815)	protein transporter activity (GO:0008565)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11		Prostate(55;0.0513)		Colorectal(74;0.0155)|COAD - Colon adenocarcinoma(73;0.0632)		CCTTCCTGTTCTCCGCTTTCA	0.706											OREG0018633	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.F35L		Atlas-SNP	.											.	CHMP7	34	.	0			c.C105G						.						15.0	14.0	14.0					8																	23104313		2202	4298	6500	SO:0001583	missense	91782	exon2			CCTGTTCTCCGCT	BC019110	CCDS6040.1	8p21.2	2011-09-21	2011-09-21		ENSG00000147457	ENSG00000147457		"""Charged multivesicular body proteins"""	28439	protein-coding gene	gene with protein product		611130	"""CHMP family, member 7"""			16856878	Standard	NM_152272		Approved	MGC29816	uc003xdc.2	Q8WUX9	OTTHUMG00000131785	ENST00000397677.1:c.105C>G	chr8.hg19:g.23104313C>G	ENSP00000380794:p.Phe35Leu	172.0	0.0	761	168.0	62.0	NM_152272	B2RDT3|B4DKJ6|D3DSS1|Q8NDM1|Q9BT50	Missense_Mutation	SNP	ENST00000397677.1	hg19	CCDS6040.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512875	0.44660	.	.	ENSG00000147457	ENST00000397677;ENST00000313219;ENST00000519984	T;T	0.62498	0.02;0.02	5.8	2.97	0.34412	.	0.000000	0.85682	D	0.000000	T	0.70605	0.3243	M	0.77313	2.365	0.46317	D	0.998982	D	0.58620	0.983	P	0.56278	0.795	T	0.69476	-0.5135	10	0.72032	D	0.01	-13.7121	6.9878	0.24737	0.0:0.6275:0.0:0.3725	.	35	Q8WUX9	CHMP7_HUMAN	L	35	ENSP00000380794:F35L;ENSP00000324491:F35L	ENSP00000324491:F35L	F	+	3	2	CHMP7	23160258	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.590000	0.36654	0.331000	0.23511	0.655000	0.94253	TTC	.	.		0.706	CHMP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254717.1	NM_152272	
FOXD4	2298	hgsc.bcm.edu	37	9	116958	116958	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr9:116958G>A	ENST00000382500.2	-	1	1459	c.1162C>T	c.(1162-1164)Cac>Tac	p.H388Y		NM_207305.4	NP_997188.2	Q12950	FOXD4_HUMAN	forkhead box D4	388					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|large_intestine(2)|lung(3)|prostate(1)|skin(3)	14	all_lung(41;0.218)	all_cancers(5;0.0395)|Acute lymphoblastic leukemia(5;1.91e-07)|all_hematologic(5;1.95e-06)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		GCCGACAGGTGCCCGCCCAGC	0.697																																					p.H388Y		Atlas-SNP	.											.	FOXD4	75	.	0			c.C1162T						.						18.0	27.0	24.0					9																	116958		2108	4192	6300	SO:0001583	missense	2298	exon1			ACAGGTGCCCGCC	U13223	CCDS34975.1	9p24.3	2014-09-17			ENSG00000170122	ENSG00000170122		"""Forkhead boxes"""	3805	protein-coding gene	gene with protein product		601092		FKHL9		7957066, 8825632, 12234674	Standard	NM_207305		Approved	FREAC5, FOXD4a	uc003zfz.4	Q12950	OTTHUMG00000021015	ENST00000382500.2:c.1162C>T	chr9.hg19:g.116958G>A	ENSP00000371940:p.His388Tyr	543.0	1.0		487.0	109.0	NM_207305	B2RN05|B9EGL7|Q5VVK1|Q8WXT6	Missense_Mutation	SNP	ENST00000382500.2	hg19	CCDS34975.1	.	.	.	.	.	.	.	.	.	.	.	4.485	0.090001	0.08632	.	.	ENSG00000170122	ENST00000382500	D	0.98012	-4.66	2.41	1.47	0.22746	.	0.891956	0.08992	U	0.864260	D	0.92632	0.7659	N	0.19112	0.55	0.09310	N	0.99999	B	0.26400	0.148	B	0.22152	0.038	D	0.86277	0.1665	10	0.48119	T	0.1	.	3.1137	0.06367	0.153:0.0:0.5801:0.2669	.	388	Q12950	FOXD4_HUMAN	Y	388	ENSP00000371940:H388Y	ENSP00000371940:H388Y	H	-	1	0	FOXD4	106958	0.841000	0.29509	0.235000	0.24058	0.009000	0.06853	1.705000	0.37867	0.333000	0.23563	-0.513000	0.04457	CAC	.	.		0.697	FOXD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055433.1	NM_207305	
INSL4	3641	hgsc.bcm.edu	37	9	5233727	5233727	+	Silent	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr9:5233727A>G	ENST00000239316.4	+	2	375	c.270A>G	c.(268-270)tcA>tcG	p.S90S		NM_002195.1	NP_002186.1	Q14641	INSL4_HUMAN	insulin-like 4 (placenta)	90					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	insulin-like growth factor receptor binding (GO:0005159)|receptor binding (GO:0005102)			endometrium(2)|lung(2)|skin(1)|urinary_tract(1)	6	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.14)		CTAATTTGTCACCAGAGCTGA	0.408																																					p.S90S		Atlas-SNP	.											.	INSL4	20	.	0			c.A270G						.						81.0	74.0	76.0					9																	5233727		2203	4300	6503	SO:0001819	synonymous_variant	3641	exon2			TTTGTCACCAGAG		CCDS6459.1	9p24	2008-02-05			ENSG00000120211	ENSG00000120211			6087	protein-coding gene	gene with protein product		600910				8666396, 9730618	Standard	NM_002195		Approved	EPIL	uc003ziy.3	Q14641	OTTHUMG00000019494	ENST00000239316.4:c.270A>G	chr9.hg19:g.5233727A>G		115.0	0.0		87.0	41.0	NM_002195	A8K678|Q5W127	Silent	SNP	ENST00000239316.4	hg19	CCDS6459.1																																																																																			.	.		0.408	INSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051616.2	NM_002195	
NFIB	4781	hgsc.bcm.edu	37	9	14113035	14113035	+	Intron	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr9:14113035A>G	ENST00000380959.3	-	8	1719				NFIB_ENST00000397579.2_Intron|NFIB_ENST00000543693.1_Missense_Mutation_p.L225P|NFIB_ENST00000397575.3_Missense_Mutation_p.L477P|NFIB_ENST00000397581.2_Missense_Mutation_p.L486P|NFIB_ENST00000380953.1_Missense_Mutation_p.L477P|NFIB_ENST00000380934.4_Intron|NFIB_ENST00000380924.1_Intron	NM_005596.3	NP_005587.2	O00712	NFIB_HUMAN	nuclear factor I/B						anterior commissure morphogenesis (GO:0021960)|chondrocyte differentiation (GO:0002062)|Clara cell differentiation (GO:0060486)|commissural neuron axon guidance (GO:0071679)|DNA replication (GO:0006260)|glial cell differentiation (GO:0010001)|hindbrain development (GO:0030902)|lung ciliated cell differentiation (GO:0061141)|negative regulation of DNA binding (GO:0043392)|negative regulation of epithelial cell proliferation involved in lung morphogenesis (GO:2000795)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|principal sensory nucleus of trigeminal nerve development (GO:0021740)|transcription from RNA polymerase II promoter (GO:0006366)|Type I pneumocyte differentiation (GO:0060509)|Type II pneumocyte differentiation (GO:0060510)	cerebellar mossy fiber (GO:0044300)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(50;4.4e-08)|LUAD - Lung adenocarcinoma(58;0.119)|Lung(218;0.164)		TCTTGGGCTTAGTCCCACATA	0.473			T	"""MYB, HGMA2"""	"""adenoid cystic carcinoma, lipoma"""																																p.L477P	Esophageal Squamous(132;921 1730 14828 40753 46471)	Atlas-SNP	.		Dom	yes		9	9p24.1	4781	nuclear factor I/B		E	.	NFIB	91	.	0			c.T1430C						.																																			SO:0001627	intron_variant	4781	exon10			GGGCTTAGTCCCA	U07810	CCDS6474.1, CCDS55291.1, CCDS55292.1, CCDS65007.1	9p24.1	2008-02-05			ENSG00000147862	ENSG00000147862			7785	protein-coding gene	gene with protein product		600728				7590749	Standard	NM_001190737		Approved	NFI-RED, NFIB2, NFIB3	uc003zlf.3	O00712	OTTHUMG00000021027	ENST00000380959.3:c.1245+7403T>C	chr9.hg19:g.14113035A>G		113.0	0.0		96.0	4.0	NM_001190737	G3V1P1|H7BYE8|O00166|Q12858|Q5VW29|Q63HM5|Q6ZNF9|Q96J45	Missense_Mutation	SNP	ENST00000380959.3	hg19	CCDS6474.1	.	.	.	.	.	.	.	.	.	.	A	18.54	3.645325	0.67358	.	.	ENSG00000147862	ENST00000380953;ENST00000397575;ENST00000397581;ENST00000543693	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.66470	0.2792	L	0.43923	1.385	0.80722	D	1	D;D	0.69078	0.995;0.997	P;D	0.75484	0.881;0.986	T	0.68887	-0.5290	10	0.87932	D	0	.	16.3948	0.83586	1.0:0.0:0.0:0.0	.	477;225	Q5VW29;G3V1P1	.;.	P	477;477;486;225	ENSP00000370340:L477P;ENSP00000380705:L477P;ENSP00000380711:L486P;ENSP00000442888:L225P	ENSP00000370340:L477P	L	-	2	0	NFIB	14103035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.686000	0.91250	2.326000	0.78906	0.533000	0.62120	CTA	.	.		0.473	NFIB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000055468.1	NM_005596	
TTC16	158248	hgsc.bcm.edu	37	9	130485486	130485486	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr9:130485486C>T	ENST00000373289.3	+	7	826	c.746C>T	c.(745-747)gCc>gTc	p.A249V	TTC16_ENST00000489226.1_3'UTR|TTC16_ENST00000393748.4_Missense_Mutation_p.A73V|PTRH1_ENST00000429848.1_Intron|PTRH1_ENST00000419060.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	249										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						AAGATGGTGGCCCAGGCCCAG	0.657																																					p.A249V		Atlas-SNP	.											.	TTC16	55	.	0			c.C746T						.						55.0	55.0	55.0					9																	130485486		2203	4300	6503	SO:0001583	missense	158248	exon7			TGGTGGCCCAGGC	AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.746C>T	chr9.hg19:g.130485486C>T	ENSP00000362386:p.Ala249Val	68.0	0.0		56.0	29.0	NM_144965	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	ENST00000373289.3	hg19	CCDS6875.1	.	.	.	.	.	.	.	.	.	.	C	8.413	0.844582	0.16963	.	.	ENSG00000167094	ENST00000373289;ENST00000393748;ENST00000316259	T	0.52526	0.66	5.08	-0.278	0.12894	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	1.774740	0.02217	N	0.063662	T	0.30355	0.0762	L	0.29908	0.895	0.09310	N	1	P;B;P	0.35656	0.514;0.185;0.514	B;B;B	0.32090	0.14;0.048;0.14	T	0.10636	-1.0621	10	0.29301	T	0.29	-7.9487	0.4353	0.00478	0.4256:0.1806:0.2135:0.1803	.	236;201;249	B4DZ42;B4DH05;Q8NEE8	.;.;TTC16_HUMAN	V	249;73;194	ENSP00000362386:A249V	ENSP00000319048:A194V	A	+	2	0	TTC16	129525307	0.014000	0.17966	0.635000	0.29338	0.237000	0.25408	0.600000	0.24104	0.107000	0.17824	-0.538000	0.04264	GCC	.	.		0.657	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054224.1	NM_144965	
NOTCH1	4851	hgsc.bcm.edu	37	9	139390565	139390565	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr9:139390565G>C	ENST00000277541.6	-	34	7701	c.7626C>G	c.(7624-7626)agC>agG	p.S2542R		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2542					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GGGACTGCATGCTGGTGGGAG	0.667			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																											p.S2542R		Atlas-SNP	.		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	.	NOTCH1	1980	.	0			c.C7626G						.						17.0	23.0	21.0					9																	139390565		1985	4146	6131	SO:0001583	missense	4851	exon34			CTGCATGCTGGTG	AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.7626C>G	chr9.hg19:g.139390565G>C	ENSP00000277541:p.Ser2542Arg	100.0	0.0		61.0	20.0	NM_017617	Q59ED8|Q5SXM3	Missense_Mutation	SNP	ENST00000277541.6	hg19	CCDS43905.1	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325899	0.60743	.	.	ENSG00000148400	ENST00000277541	D	0.81908	-1.55	4.98	1.53	0.23141	.	0.042024	0.85682	D	0.000000	T	0.80696	0.4672	L	0.47716	1.5	0.44771	D	0.997777	P	0.43938	0.822	P	0.51866	0.682	T	0.73972	-0.3814	10	0.26408	T	0.33	.	7.697	0.28600	0.4564:0.0:0.5435:0.0	.	2542	P46531	NOTC1_HUMAN	R	2542	ENSP00000277541:S2542R	ENSP00000277541:S2542R	S	-	3	2	NOTCH1	138510386	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	2.051000	0.41307	0.604000	0.29930	0.462000	0.41574	AGC	.	.		0.667	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055087.1	NM_017617	
OR51E2	81285	hgsc.bcm.edu	37	11	4703440	4703440	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:4703440A>C	ENST00000396950.3	-	2	741	c.502T>G	c.(502-504)Tgc>Ggc	p.C168G		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	168					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		TTGGAGTGGCAGAAGGCCAGC	0.517																																					p.C168G		Atlas-SNP	.											.	OR51E2	77	.	0			c.T502G						.						82.0	80.0	80.0					11																	4703440		2201	4298	6499	SO:0001583	missense	81285	exon2			AGTGGCAGAAGGC	AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.502T>G	chr11.hg19:g.4703440A>C	ENSP00000380153:p.Cys168Gly	94.0	0.0		90.0	39.0	NM_030774	B2RA63|Q6IF94	Missense_Mutation	SNP	ENST00000396950.3	hg19	CCDS7751.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059137	0.55325	.	.	ENSG00000167332	ENST00000396950	T	0.00224	8.51	5.0	5.0	0.66597	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000107	T	0.00906	0.0030	H	0.96175	3.78	0.38000	D	0.934181	D	0.89917	1.0	D	0.97110	1.0	T	0.46693	-0.9173	10	0.87932	D	0	.	13.681	0.62484	1.0:0.0:0.0:0.0	.	168	Q9H255	O51E2_HUMAN	G	168	ENSP00000380153:C168G	ENSP00000380153:C168G	C	-	1	0	OR51E2	4660016	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.834000	0.75339	2.112000	0.64535	0.533000	0.62120	TGC	.	.		0.517	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257198.1	NM_030774	
E2F8	79733	hgsc.bcm.edu	37	11	19256370	19256370	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:19256370A>T	ENST00000527884.1	-	5	919	c.687T>A	c.(685-687)caT>caA	p.H229Q	RP11-428C19.4_ENST00000527978.1_RNA|E2F8_ENST00000250024.4_Missense_Mutation_p.H229Q	NM_001256371.1|NM_001256372.1	NP_001243300.1|NP_001243301.1	A0AVK6	E2F8_HUMAN	E2F transcription factor 8	229					cell cycle comprising mitosis without cytokinesis (GO:0033301)|chorionic trophoblast cell differentiation (GO:0060718)|hepatocyte differentiation (GO:0070365)|negative regulation of cytokinesis (GO:0032466)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|placenta development (GO:0001890)|positive regulation of DNA endoreduplication (GO:0032877)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sprouting angiogenesis (GO:0002040)|trophoblast giant cell differentiation (GO:0060707)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ATTTGATGATATGATCCTCTA	0.418																																					p.H229Q		Atlas-SNP	.											.	E2F8	84	.	0			c.T687A						.						109.0	98.0	102.0					11																	19256370		2199	4293	6492	SO:0001583	missense	79733	exon5			GATGATATGATCC		CCDS7849.1	11p15	2008-02-05			ENSG00000129173	ENSG00000129173			24727	protein-coding gene	gene with protein product		612047				15722552	Standard	NM_024680		Approved	FLJ23311	uc001mpo.2	A0AVK6	OTTHUMG00000166102	ENST00000527884.1:c.687T>A	chr11.hg19:g.19256370A>T	ENSP00000434199:p.His229Gln	130.0	0.0		111.0	39.0	NM_001256372	A8K9H3|Q2VPJ3|Q3C1U6|Q5BKY4|Q8N340|Q9H5M0	Missense_Mutation	SNP	ENST00000527884.1	hg19	CCDS7849.1	.	.	.	.	.	.	.	.	.	.	A	7.449	0.642210	0.14451	.	.	ENSG00000129173	ENST00000527884;ENST00000531809;ENST00000396159;ENST00000250024	T;T	0.17054	2.3;2.3	5.52	-4.44	0.03557	.	0.696518	0.14005	N	0.347869	T	0.08447	0.0210	L	0.36672	1.1	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.39375	-0.9617	10	0.12766	T	0.61	-7.3611	3.8628	0.09004	0.2694:0.2235:0.4079:0.0992	.	229	A0AVK6	E2F8_HUMAN	Q	229	ENSP00000434199:H229Q;ENSP00000250024:H229Q	ENSP00000250024:H229Q	H	-	3	2	E2F8	19212946	0.003000	0.15002	0.808000	0.32385	0.996000	0.88848	-0.997000	0.03705	-0.807000	0.04393	0.533000	0.62120	CAT	.	.		0.418	E2F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387830.1	NM_024680	
HRASLS2	54979	hgsc.bcm.edu	37	11	63325963	63325963	+	Silent	SNP	T	T	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:63325963T>G	ENST00000255695.1	-	3	346	c.288A>C	c.(286-288)gcA>gcC	p.A96A		NM_017878.1	NP_060348.1	Q9NWW9	HRSL2_HUMAN	HRAS-like suppressor 2	96					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)|transferase activity, transferring acyl groups (GO:0016746)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6						CCAACTCCTCTGCCCGCTTGA	0.552																																					p.A96A		Atlas-SNP	.											.	HRASLS2	14	.	0			c.A288C						.						263.0	191.0	216.0					11																	63325963		2201	4298	6499	SO:0001819	synonymous_variant	54979	exon3			CTCCTCTGCCCGC		CCDS8046.1	11q12.2	2008-07-18			ENSG00000133328	ENSG00000133328			17824	protein-coding gene	gene with protein product		613866					Standard	NM_017878		Approved	FLJ20556	uc001nxg.1	Q9NWW9	OTTHUMG00000167851	ENST00000255695.1:c.288A>C	chr11.hg19:g.63325963T>G		138.0	0.0		124.0	68.0	NM_017878	B9A7L8	Silent	SNP	ENST00000255695.1	hg19	CCDS8046.1																																																																																			.	.		0.552	HRASLS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396631.1	NM_017878	
FGF3	2248	hgsc.bcm.edu	37	11	69625279	69625279	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:69625279T>C	ENST00000334134.2	-	3	604	c.514A>G	c.(514-516)Aca>Gca	p.T172A		NM_005247.2	NP_005238.1	P11487	FGF3_HUMAN	fibroblast growth factor 3	172					anatomical structure morphogenesis (GO:0009653)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of cardiac muscle tissue development (GO:0055026)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|otic vesicle formation (GO:0030916)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|post-anal tail morphogenesis (GO:0036342)|semicircular canal morphogenesis (GO:0048752)|signal transduction (GO:0007165)|thymus development (GO:0048538)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	growth factor activity (GO:0008083)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|urinary_tract(1)	13			LUSC - Lung squamous cell carcinoma(11;5.05e-15)|STAD - Stomach adenocarcinoma(18;0.0278)			GACTTCTGTGTGCGGCGGGTC	0.687																																					p.T172A		Atlas-SNP	.											.	FGF3	27	.	0			c.A514G						.						21.0	24.0	23.0					11																	69625279		2194	4266	6460	SO:0001583	missense	2248	exon3			TCTGTGTGCGGCG		CCDS8195.1	11q13	2010-06-25	2010-06-25		ENSG00000186895	ENSG00000186895			3681	protein-coding gene	gene with protein product	"""INT-2 proto-oncogene protein"", ""oncogene INT2"", ""V-INT2 murine mammary tumor virus integration site oncogene homolog"", ""murine mammary tumor virus integration site 2, mouse"""	164950	"""fibroblast growth factor 3 (murine mammary tumor virus integration site (v-int-2) oncogene homolog)"""	INT2			Standard	NM_005247		Approved	HBGF-3	uc001oph.3	P11487	OTTHUMG00000167888	ENST00000334134.2:c.514A>G	chr11.hg19:g.69625279T>C	ENSP00000334122:p.Thr172Ala	188.0	0.0		197.0	88.0	NM_005247	Q0VG69	Missense_Mutation	SNP	ENST00000334134.2	hg19	CCDS8195.1	.	.	.	.	.	.	.	.	.	.	T	18.26	3.584636	0.65992	.	.	ENSG00000186895	ENST00000334134	T	0.66995	-0.24	4.01	4.01	0.46588	.	0.051289	0.85682	D	0.000000	T	0.74749	0.3757	L	0.46157	1.445	0.54753	D	0.999989	D	0.76494	0.999	D	0.85130	0.997	T	0.73742	-0.3887	9	.	.	.	.	12.9501	0.58394	0.0:0.0:0.0:1.0	.	172	P11487	FGF3_HUMAN	A	172	ENSP00000334122:T172A	.	T	-	1	0	FGF3	69334460	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.594000	0.67557	1.440000	0.47531	0.379000	0.24179	ACA	.	.		0.687	FGF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396835.1	NM_005247	
LRRC32	2615	hgsc.bcm.edu	37	11	76376969	76376969	+	Silent	SNP	G	G	A	rs533407564		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:76376969G>A	ENST00000407242.2	-	2	272	c.30C>T	c.(28-30)gcC>gcT	p.A10A	LRRC32_ENST00000404995.1_Silent_p.A10A|AP001189.4_ENST00000447519.1_RNA|LRRC32_ENST00000260061.5_Silent_p.A10A|LRRC32_ENST00000464145.1_5'UTR	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	10					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GGGTCAGCAGGGCCAGGAGCA	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18819	0.0		0.0	False		,,,				2504	0.0				p.A10A		Atlas-SNP	.											.	LRRC32	74	.	0			c.C30T						.						168.0	146.0	153.0					11																	76376969		2200	4292	6492	SO:0001819	synonymous_variant	2615	exon2			CAGCAGGGCCAGG	Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.30C>T	chr11.hg19:g.76376969G>A		64.0	0.0		60.0	15.0	NM_005512	Q86V06	Silent	SNP	ENST00000407242.2	hg19	CCDS8245.1																																																																																			.	.		0.607	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257926.2	NM_005512	
TENM4	26011	hgsc.bcm.edu	37	11	78419516	78419516	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:78419516T>C	ENST00000278550.7	-	27	4561	c.4099A>G	c.(4099-4101)Acc>Gcc	p.T1367A		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1367					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CTGATCATGGTGCCATCCACG	0.522																																					p.T1367A		Atlas-SNP	.											.	.	.	.	0			c.A4099G						.						108.0	102.0	104.0					11																	78419516		2068	4215	6283	SO:0001583	missense	26011	exon27			TCATGGTGCCATC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.4099A>G	chr11.hg19:g.78419516T>C	ENSP00000278550:p.Thr1367Ala	107.0	0.0		89.0	40.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	hg19	CCDS44688.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.140591	0.77775	.	.	ENSG00000149256	ENST00000278550	D	0.89939	-2.59	5.52	4.4	0.53042	Six-bladed beta-propeller, TolB-like (1);	0.050063	0.85682	N	0.000000	D	0.92034	0.7476	L	0.59436	1.845	0.58432	D	0.999991	D	0.64830	0.994	D	0.70716	0.97	D	0.90929	0.4789	9	.	.	.	.	11.6913	0.51516	0.0:0.0687:0.0:0.9313	.	1367	Q6N022	TEN4_HUMAN	A	1367	ENSP00000278550:T1367A	.	T	-	1	0	ODZ4	78097164	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.884000	0.63135	1.110000	0.41699	-0.274000	0.10170	ACC	.	.		0.522	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
DDIAS	220042	hgsc.bcm.edu	37	11	82643852	82643852	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:82643852G>A	ENST00000533655.1	+	6	1684	c.1472G>A	c.(1471-1473)aGc>aAc	p.S491N	C11orf82_ENST00000528759.1_3'UTR|C11orf82_ENST00000525361.1_Intron|C11orf82_ENST00000430323.2_Missense_Mutation_p.S491N|C11orf82_ENST00000329143.3_Missense_Mutation_p.S190N	NM_145018.3	NP_659455.3	Q8IXT1	DDIAS_HUMAN		491					apoptotic process (GO:0006915)|cellular response to cytokine stimulus (GO:0071345)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to hydroperoxide (GO:0071447)|cellular response to UV (GO:0034644)|hemopoiesis (GO:0030097)|mitotic cell cycle arrest (GO:0071850)|negative regulation of fibroblast apoptotic process (GO:2000270)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	33						GCAAACTGTAGCAAAGATGAC	0.408																																					p.S491N		Atlas-SNP	.											.	C11orf82	71	.	0			c.G1472A						.						43.0	42.0	42.0					11																	82643852		2203	4300	6503	SO:0001583	missense	220042	exon6			ACTGTAGCAAAGA																												ENST00000533655.1:c.1472G>A	chr11.hg19:g.82643852G>A	ENSP00000435421:p.Ser491Asn	61.0	0.0		58.0	27.0	NM_145018	Q96LK6|Q9H856	Missense_Mutation	SNP	ENST00000533655.1	hg19	CCDS8263.1	.	.	.	.	.	.	.	.	.	.	G	1.717	-0.497592	0.04291	.	.	ENSG00000165490	ENST00000430323;ENST00000533655;ENST00000329143	T;T;T	0.18810	2.46;2.46;2.19	6.17	3.26	0.37387	.	0.808315	0.11926	N	0.516199	T	0.19127	0.0459	L	0.51422	1.61	0.09310	N	1	B	0.32245	0.361	B	0.33042	0.157	T	0.21621	-1.0240	9	.	.	.	.	6.5349	0.22348	0.1583:0.1484:0.6933:0.0	.	491	Q8IXT1	NOXIN_HUMAN	N	491;491;190	ENSP00000414687:S491N;ENSP00000435421:S491N;ENSP00000329930:S190N	.	S	+	2	0	C11orf82	82321500	0.926000	0.31397	0.005000	0.12908	0.012000	0.07955	1.074000	0.30703	0.458000	0.26988	0.655000	0.94253	AGC	.	.		0.408	C11orf82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391936.1		
FAT3	120114	hgsc.bcm.edu	37	11	92577113	92577113	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:92577113G>A	ENST00000298047.6	+	18	10597	c.10580G>A	c.(10579-10581)gGc>gAc	p.G3527D	FAT3_ENST00000525166.1_Missense_Mutation_p.G3377D|FAT3_ENST00000409404.2_Missense_Mutation_p.G3527D|FAT3_ENST00000533797.1_5'Flank			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3527	Cadherin 32. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AAGGATTCAGGCAAACCCCAG	0.443										TCGA Ovarian(4;0.039)																											p.G3527D		Atlas-SNP	.											.	FAT3	1822	.	0			c.G10580A						.						161.0	156.0	158.0					11																	92577113		1907	4134	6041	SO:0001583	missense	120114	exon18			ATTCAGGCAAACC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.10580G>A	chr11.hg19:g.92577113G>A	ENSP00000298047:p.Gly3527Asp	123.0	0.0		108.0	54.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	G	24.4	4.528660	0.85706	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.08546	3.08;3.08;3.08	5.62	5.62	0.85841	.	.	.	.	.	T	0.41581	0.1165	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52764	-0.8532	9	0.87932	D	0	.	19.6523	0.95822	0.0:0.0:1.0:0.0	.	3527	Q8TDW7-3	.	D	3527;3527;3377	ENSP00000298047:G3527D;ENSP00000387040:G3527D;ENSP00000432586:G3377D	ENSP00000298047:G3527D	G	+	2	0	FAT3	92216761	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.787000	0.99055	2.650000	0.89964	0.561000	0.74099	GGC	.	.		0.443	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
C11orf65	160140	hgsc.bcm.edu	37	11	108264021	108264021	+	Silent	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr11:108264021T>C	ENST00000529391.1	-	6	654	c.645A>G	c.(643-645)agA>agG	p.R215R	C11orf65_ENST00000393084.1_Silent_p.R215R|C11orf65_ENST00000526725.1_5'UTR|C11orf65_ENST00000525729.1_Silent_p.R166R			Q8NCR3	CK065_HUMAN	chromosome 11 open reading frame 65	215										endometrium(1)|large_intestine(3)|lung(4)|ovary(2)	10		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		CTTCAAAAGCTCTAATCAGCC	0.423																																					p.R215R		Atlas-SNP	.											.	C11orf65	29	.	0			c.A645G						.						258.0	227.0	238.0					11																	108264021		2201	4298	6499	SO:0001819	synonymous_variant	160140	exon7			AAAAGCTCTAATC	BC059411	CCDS8340.1	11q22.3	2012-05-30			ENSG00000166323	ENSG00000166323			28519	protein-coding gene	gene with protein product						12477932	Standard	NM_152587		Approved	MGC33948	uc001pkh.3	Q8NCR3	OTTHUMG00000166489	ENST00000529391.1:c.645A>G	chr11.hg19:g.108264021T>C		183.0	0.0		161.0	64.0	NM_152587	B4DZU4|Q6PCA8	Silent	SNP	ENST00000529391.1	hg19	CCDS8340.1	.	.	.	.	.	.	.	.	.	.	T	0.150	-1.092298	0.01858	.	.	ENSG00000166323	ENST00000524755	.	.	.	5.54	4.42	0.53409	.	.	.	.	.	T	0.34483	0.0899	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.21965	-1.0230	4	.	.	.	-5.2084	6.4841	0.22079	0.0:0.0847:0.1575:0.7578	.	.	.	.	G	47	.	.	E	-	2	0	C11orf65	107769231	0.000000	0.05858	0.001000	0.08648	0.100000	0.18952	0.610000	0.24253	0.952000	0.37798	0.460000	0.39030	GAG	.	.		0.423	C11orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390010.3	NM_152587	
KCNA5	3741	hgsc.bcm.edu	37	12	5154614	5154614	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr12:5154614T>A	ENST00000252321.3	+	1	1530	c.1301T>A	c.(1300-1302)cTg>cAg	p.L434Q		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	434					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	ATGAGGGAGCTGGGGCTGCTC	0.592																																					p.L434Q		Atlas-SNP	.											KCNA5,NS,carcinoma,0,1	KCNA5	138	.	0			c.T1301A						.						48.0	46.0	47.0					12																	5154614		2203	4287	6490	SO:0001583	missense	3741	exon1			GGGAGCTGGGGCT	M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1301T>A	chr12.hg19:g.5154614T>A	ENSP00000252321:p.Leu434Gln	119.0	0.0		111.0	35.0	NM_002234	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	ENST00000252321.3	hg19	CCDS8536.1	.	.	.	.	.	.	.	.	.	.	T	18.11	3.550909	0.65311	.	.	ENSG00000130037	ENST00000252321	D	0.98822	-5.16	4.87	4.87	0.63330	Ion transport (1);	0.000000	0.64402	D	0.000016	D	0.99462	0.9809	H	0.97806	4.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98150	1.0441	10	0.87932	D	0	.	13.8335	0.63395	0.0:0.0:0.0:1.0	.	434	P22460	KCNA5_HUMAN	Q	434	ENSP00000252321:L434Q	ENSP00000252321:L434Q	L	+	2	0	KCNA5	5024875	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	2.052000	0.61016	0.459000	0.35465	CTG	.	.		0.592	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398925.2	NM_002234	
CCER1	196477	hgsc.bcm.edu	37	12	91347318	91347318	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr12:91347318G>A	ENST00000358859.2	-	1	1635	c.1202C>T	c.(1201-1203)gCa>gTa	p.A401V	CCER1_ENST00000548187.1_Intron	NM_152638.2	NP_689851.1	Q8TC90	CCER1_HUMAN	coiled-coil glutamate-rich protein 1	401																	AAAGTCCTGTGCCATGAACAG	0.378																																					p.A401V		Atlas-SNP	.											.	.	.	.	0			c.C1202T						.						77.0	82.0	80.0					12																	91347318		2203	4300	6503	SO:0001583	missense	196477	exon1			TCCTGTGCCATGA	BC024183	CCDS9036.1	12q21.33	2012-05-30	2012-05-30	2012-05-30	ENSG00000197651	ENSG00000197651			28373	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 12"""	C12orf12		17967063	Standard	NM_152638		Approved	MGC26598	uc001tbj.3	Q8TC90	OTTHUMG00000170070	ENST00000358859.2:c.1202C>T	chr12.hg19:g.91347318G>A	ENSP00000351727:p.Ala401Val	101.0	0.0		84.0	32.0	NM_152638	Q8TC47	Missense_Mutation	SNP	ENST00000358859.2	hg19	CCDS9036.1	.	.	.	.	.	.	.	.	.	.	G	0.007	-2.001704	0.00431	.	.	ENSG00000197651	ENST00000358859	T	0.21031	2.03	5.17	4.04	0.47022	.	1.784620	0.03889	N	0.278315	T	0.09774	0.0240	N	0.04508	-0.205	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.30880	-0.9963	10	0.02654	T	1	-0.2725	7.0131	0.24873	0.8965:0.0:0.1035:0.0	.	401	Q8TC90	CL012_HUMAN	V	401	ENSP00000351727:A401V	ENSP00000351727:A401V	A	-	2	0	C12orf12	89871449	0.011000	0.17503	0.044000	0.18714	0.064000	0.16182	1.713000	0.37951	1.001000	0.39076	-0.469000	0.05056	GCA	.	.		0.378	CCER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407142.2	NM_152638	
BTBD11	121551	hgsc.bcm.edu	37	12	108029088	108029088	+	Silent	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr12:108029088C>T	ENST00000280758.5	+	12	3186	c.2658C>T	c.(2656-2658)tgC>tgT	p.C886C	BTBD11_ENST00000357167.4_Silent_p.C423C|BTBD11_ENST00000490090.2_Silent_p.C886C|BTBD11_ENST00000494235.2_5'UTR|BTBD11_ENST00000420571.2_Silent_p.C767C	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	886						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AGCAGCTGTGCGTCATCTTCA	0.567																																					p.C886C		Atlas-SNP	.											.	BTBD11	122	.	0			c.C2658T						.						152.0	136.0	141.0					12																	108029088		2203	4300	6503	SO:0001819	synonymous_variant	121551	exon12			GCTGTGCGTCATC	AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2658C>T	chr12.hg19:g.108029088C>T		70.0	0.0		56.0	25.0	NM_001018072	A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Silent	SNP	ENST00000280758.5	hg19	CCDS31893.1																																																																																			.	.		0.567	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318003.1	NM_152322	
LRRC43	254050	hgsc.bcm.edu	37	12	122677397	122677397	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr12:122677397G>A	ENST00000339777.4	+	7	1223	c.1195G>A	c.(1195-1197)Gaa>Aaa	p.E399K	LRRC43_ENST00000425921.1_Missense_Mutation_p.E214K	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	399	Glu-rich.									NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		TGAAGAGGTCGAAGGGTCTCT	0.532																																					p.E399K		Atlas-SNP	.											.	LRRC43	105	.	0			c.G1195A						.						97.0	105.0	103.0					12																	122677397		2090	4234	6324	SO:0001583	missense	254050	exon7			GAGGTCGAAGGGT	AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.1195G>A	chr12.hg19:g.122677397G>A	ENSP00000344233:p.Glu399Lys	263.0	0.0		188.0	85.0	NM_001098519	Q6ZVT9	Missense_Mutation	SNP	ENST00000339777.4	hg19	CCDS45001.1	.	.	.	.	.	.	.	.	.	.	G	7.653	0.683229	0.14907	.	.	ENSG00000158113	ENST00000339777;ENST00000289014;ENST00000425921	T;T	0.56444	0.46;0.89	3.73	0.829	0.18847	.	1.397600	0.04333	N	0.352750	T	0.40619	0.1124	L	0.41824	1.3	0.09310	N	1	B	0.23490	0.086	B	0.13407	0.009	T	0.16837	-1.0389	10	0.33940	T	0.23	-7.0232	3.2774	0.06903	0.2239:0.0:0.5718:0.2044	.	399	Q8N309	LRC43_HUMAN	K	399;270;214	ENSP00000344233:E399K;ENSP00000416628:E214K	ENSP00000289014:E270K	E	+	1	0	LRRC43	121243350	0.186000	0.23225	0.000000	0.03702	0.001000	0.01503	2.244000	0.43124	0.171000	0.19730	-0.150000	0.13652	GAA	.	.		0.532	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401589.1	NM_152759	
HMGB1	3146	hgsc.bcm.edu	37	13	31035627	31035627	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr13:31035627T>G	ENST00000405805.1	-	5	1455	c.515A>C	c.(514-516)aAa>aCa	p.K172T	HMGB1_ENST00000468384.1_5'Flank|HMGB1_ENST00000339872.4_Missense_Mutation_p.K172T|HMGB1_ENST00000399489.1_3'UTR|HMGB1_ENST00000341423.5_Missense_Mutation_p.K172T|HMGB1_ENST00000399494.1_Missense_Mutation_p.K172T			P09429	HMGB1_HUMAN	high mobility group box 1	172					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dendritic cell chemotaxis (GO:0002407)|DNA ligation involved in DNA repair (GO:0051103)|DNA recombination (GO:0006310)|DNA topological change (GO:0006265)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|myeloid dendritic cell activation (GO:0001773)|negative regulation of apoptotic cell clearance (GO:2000426)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron projection development (GO:0031175)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|V(D)J recombination (GO:0033151)	cell surface (GO:0009986)|condensed chromosome (GO:0000793)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chemoattractant activity (GO:0042056)|cytokine activity (GO:0005125)|damaged DNA binding (GO:0003684)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(1)|ovary(1)	8		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)		AACTCCCTTTTTTGCTGCATC	0.408																																					p.K172T		Atlas-SNP	.											.	HMGB1	21	.	0			c.A515C						.						28.0	28.0	28.0					13																	31035627		2112	4148	6260	SO:0001583	missense	3146	exon5			CCCTTTTTTGCTG	D63874	CCDS9335.1	13q12	2011-07-01	2011-04-05	2002-08-16	ENSG00000189403	ENSG00000189403		"""High-mobility group / Canonical"""	4983	protein-coding gene	gene with protein product	"""high mobility group box 1"", ""Sulfoglucuronyl carbohydrate binding protein"", ""Amphoterin"", ""high mobility group protein 1"""	163905	"""high-mobility group (nonhistone chromosomal) protein 1"", ""high-mobility group box 1"""	HMG1		8661151, 11279268	Standard	NM_002128		Approved	HMG3, SBP-1, DKFZp686A04236	uc001usx.3	P09429	OTTHUMG00000016670	ENST00000405805.1:c.515A>C	chr13.hg19:g.31035627T>G	ENSP00000384678:p.Lys172Thr	170.0	0.0		144.0	69.0	NM_002128	A5D8W9|Q14321|Q5T7C3|Q6IBE1	Missense_Mutation	SNP	ENST00000405805.1	hg19	CCDS9335.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.95|13.95	2.388477|2.388477	0.42308|0.42308	.|.	.|.	ENSG00000189403|ENSG00000189403	ENST00000426225|ENST00000405805;ENST00000339872;ENST00000341423;ENST00000399494	.|T;T;T;T	.|0.70631	.|-0.5;-0.5;-0.5;-0.5	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.211018|0.211018	0.32503|0.32503	N|N	0.006019|0.006019	T|T	0.66257|0.66257	0.2771|0.2771	L|L	0.55990|0.55990	1.75|1.75	0.80722|0.80722	D|D	1|1	.|B;B	.|0.30914	.|0.3;0.131	.|B;B	.|0.23275	.|0.045;0.026	T|T	0.67658|0.67658	-0.5614|-0.5614	7|10	0.27785|0.66056	T|D	0.31|0.02	.|.	15.9816|15.9816	0.80114|0.80114	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|133;172	.|B3KQ05;P09429	.|.;HMGB1_HUMAN	Q|T	161|172	.|ENSP00000384678:K172T;ENSP00000343040:K172T;ENSP00000345347:K172T;ENSP00000382417:K172T	ENSP00000411269:K161Q|ENSP00000343040:K172T	K|K	-|-	1|2	0|0	HMGB1|HMGB1	29933627|29933627	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.923000|0.923000	0.55619|0.55619	5.907000|5.907000	0.69908|0.69908	2.180000|2.180000	0.69256|0.69256	0.519000|0.519000	0.50382|0.50382	AAA|AAA	.	.		0.408	HMGB1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303998.2	NM_002128	
MAB21L1	4081	hgsc.bcm.edu	37	13	36049542	36049542	+	Missense_Mutation	SNP	C	C	T	rs574005569		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr13:36049542C>T	ENST00000379919.4	-	1	1290	c.734G>A	c.(733-735)gGc>gAc	p.G245D	NBEA_ENST00000310336.4_Intron|NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	245					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		CTTTCTGCAGCCCCCCATCTG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		17315	0.0		0.0	False		,,,				2504	0.001				p.G245D		Atlas-SNP	.											.	MAB21L1	52	.	0			c.G734A						.						70.0	76.0	74.0					13																	36049542		2203	4300	6503	SO:0001583	missense	4081	exon1			CTGCAGCCCCCCA	BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.734G>A	chr13.hg19:g.36049542C>T	ENSP00000369251:p.Gly245Asp	70.0	0.0		61.0	29.0	NM_005584	Q6I9T5	Missense_Mutation	SNP	ENST00000379919.4	hg19	CCDS9353.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220493	0.79464	.	.	ENSG00000180660	ENST00000379919	T	0.09255	3.0	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.38453	0.1041	M	0.82323	2.585	0.80722	D	1	D	0.67145	0.996	D	0.74674	0.984	T	0.04840	-1.0923	10	0.37606	T	0.19	-21.6831	19.9576	0.97228	0.0:1.0:0.0:0.0	.	245	Q13394	MB211_HUMAN	D	245	ENSP00000369251:G245D	ENSP00000369251:G245D	G	-	2	0	MAB21L1	34947542	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.736000	0.93811	0.655000	0.94253	GGC	.	.		0.577	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044459.3	NM_005584	
PRKD1	5587	hgsc.bcm.edu	37	14	30047494	30047494	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr14:30047494T>A	ENST00000331968.5	-	17	2736	c.2507A>T	c.(2506-2508)cAc>cTc	p.H836L	PRKD1_ENST00000415220.2_Missense_Mutation_p.H844L	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	836	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TAGCCAAGGGTGGCTCAAGGT	0.313																																					p.H836L		Atlas-SNP	.											.	PRKD1	316	.	0			c.A2507T						.						86.0	86.0	86.0					14																	30047494		2203	4300	6503	SO:0001583	missense	5587	exon17			CAAGGGTGGCTCA		CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.2507A>T	chr14.hg19:g.30047494T>A	ENSP00000333568:p.His836Leu	65.0	0.0		54.0	20.0	NM_002742	A6NL64|B2RAF6	Missense_Mutation	SNP	ENST00000331968.5	hg19	CCDS9637.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.765927	0.90020	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	D;D	0.86366	-2.11;-2.11	5.7	5.7	0.88788	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95033	0.8392	M	0.92459	3.31	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96085	0.9057	10	0.87932	D	0	-26.9263	15.9589	0.79910	0.0:0.0:0.0:1.0	.	836	Q15139	KPCD1_HUMAN	L	836;844	ENSP00000333568:H836L;ENSP00000390535:H844L	ENSP00000333568:H836L	H	-	2	0	PRKD1	29117245	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.040000	0.89188	2.178000	0.69098	0.477000	0.44152	CAC	.	.		0.313	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276611.2	NM_002742	
CDC42BPB	9578	hgsc.bcm.edu	37	14	103410434	103410434	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr14:103410434C>T	ENST00000361246.2	-	30	4490	c.4202G>A	c.(4201-4203)gGg>gAg	p.G1401E		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CTGCCCGTCCCCCTGGATGCT	0.587																																					p.G1401E		Atlas-SNP	.											.	CDC42BPB	123	.	0			c.G4202A						.						93.0	89.0	90.0					14																	103410434		2203	4300	6503	SO:0001583	missense	9578	exon30			CCGTCCCCCTGGA	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.4202G>A	chr14.hg19:g.103410434C>T	ENSP00000355237:p.Gly1401Glu	104.0	0.0		81.0	35.0	NM_006035		Missense_Mutation	SNP	ENST00000361246.2	hg19	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916676	0.92249	.	.	ENSG00000198752	ENST00000361246;ENST00000541396	T	0.65178	-0.14	5.46	5.46	0.80206	Citron-like (3);	0.000000	0.85682	D	0.000000	D	0.82453	0.5040	M	0.84683	2.71	0.80722	D	1	D;D	0.89917	1.0;0.992	D;D	0.83275	0.996;0.972	D	0.84676	0.0714	10	0.87932	D	0	.	19.6739	0.95923	0.0:1.0:0.0:0.0	.	1401;1401	A9JR72;Q9Y5S2	.;MRCKB_HUMAN	E	1401;512	ENSP00000355237:G1401E	ENSP00000355237:G1401E	G	-	2	0	CDC42BPB	102480187	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.776000	0.85560	2.728000	0.93425	0.655000	0.94253	GGG	.	.		0.587	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
MGA	23269	hgsc.bcm.edu	37	15	42034793	42034793	+	Silent	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:42034793A>G	ENST00000570161.1	+	14	4635	c.4635A>G	c.(4633-4635)aaA>aaG	p.K1545K	MGA_ENST00000219905.7_Silent_p.K1545K|MGA_ENST00000545763.1_Intron|MGA_ENST00000389936.4_Silent_p.K1545K|MGA_ENST00000566586.1_Intron			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGATGAGTAAAGTTGGAGCCT	0.473																																					p.K1545K		Atlas-SNP	.											.	MGA	264	.	0			c.A4635G						.						66.0	66.0	66.0					15																	42034793		1956	4159	6115	SO:0001819	synonymous_variant	23269	exon15			GAGTAAAGTTGGA	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.4635A>G	chr15.hg19:g.42034793A>G		79.0	0.0		73.0	41.0	NM_001164273	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	hg19	CCDS55959.1																																																																																			.	.		0.473	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MAP1A	4130	hgsc.bcm.edu	37	15	43821446	43821446	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:43821446T>A	ENST00000300231.5	+	4	8225	c.7775T>A	c.(7774-7776)gTa>gAa	p.V2592E	MAP1A_ENST00000399453.1_Missense_Mutation_p.V2592E|MAP1A_ENST00000382031.1_Missense_Mutation_p.V2830E			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2592					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TCTGGGAGAGTAGAGAGGCTA	0.672																																					p.V2592E		Atlas-SNP	.											.	MAP1A	189	.	0			c.T7775A						.						34.0	39.0	38.0					15																	43821446		1892	4098	5990	SO:0001583	missense	4130	exon4			GGAGAGTAGAGAG	U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.7775T>A	chr15.hg19:g.43821446T>A	ENSP00000300231:p.Val2592Glu	126.0	0.0		102.0	48.0	NM_002373	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	ENST00000300231.5	hg19	CCDS42031.1	.	.	.	.	.	.	.	.	.	.	T	11.33	1.606111	0.28623	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01359	4.98;4.98;4.98	4.95	1.35	0.21983	.	.	.	.	.	T	0.00815	0.0027	N	0.08118	0	0.29001	N	0.887487	B	0.33238	0.403	B	0.33196	0.159	T	0.46048	-0.9219	9	0.20046	T	0.44	-5.8035	3.981	0.09495	0.0:0.4114:0.2171:0.3714	.	2592	P78559	MAP1A_HUMAN	E	2830;2592;2592	ENSP00000371462:V2830E;ENSP00000382380:V2592E;ENSP00000300231:V2592E	ENSP00000300231:V2592E	V	+	2	0	MAP1A	41608738	0.036000	0.19791	0.998000	0.56505	0.979000	0.70002	0.425000	0.21346	0.381000	0.24851	0.379000	0.24179	GTA	.	.		0.672	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000132894.5	NM_002373	
FRMD5	84978	hgsc.bcm.edu	37	15	44487159	44487159	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:44487159T>C	ENST00000417257.1	-	1	270	c.94A>G	c.(94-96)Acc>Gcc	p.T32A	FRMD5_ENST00000402883.1_Missense_Mutation_p.T32A|FRMD5_ENST00000484674.1_5'Flank	NM_032892.3	NP_116281.2	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5	32	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		ACCTGGATGGTGCAGGTGTAC	0.721																																					p.T32A		Atlas-SNP	.											.	FRMD5	45	.	0			c.A94G						.						7.0	8.0	8.0					15																	44487159		2059	4057	6116	SO:0001583	missense	84978	exon1			GGATGGTGCAGGT	BC007796	CCDS10107.2, CCDS73715.1, CCDS73716.1	15q15.3	2005-08-09			ENSG00000171877	ENSG00000171877			28214	protein-coding gene	gene with protein product							Standard	XM_005254729		Approved	MGC14161	uc001ztl.3	Q7Z6J6	OTTHUMG00000060475	ENST00000417257.1:c.94A>G	chr15.hg19:g.44487159T>C	ENSP00000403067:p.Thr32Ala	42.0	0.0		43.0	15.0	NM_032892	Q8NBG4	Missense_Mutation	SNP	ENST00000417257.1	hg19	CCDS10107.2	.	.	.	.	.	.	.	.	.	.	T	13.04	2.118347	0.37339	.	.	ENSG00000171877	ENST00000417257;ENST00000402883	T;T	0.77229	-1.08;-1.08	4.39	3.23	0.37069	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.378404	0.24497	N	0.038009	T	0.57636	0.2067	N	0.04805	-0.155	0.80722	D	1	B	0.33807	0.426	B	0.36567	0.228	T	0.56111	-0.8033	10	0.56958	D	0.05	.	7.8785	0.29608	0.1842:0.0:0.0:0.8158	.	32	Q7Z6J6	FRMD5_HUMAN	A	32	ENSP00000403067:T32A;ENSP00000384142:T32A	ENSP00000384142:T32A	T	-	1	0	FRMD5	42274451	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	4.699000	0.61796	0.522000	0.28464	0.402000	0.26972	ACC	.	.		0.721	FRMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133879.1	NM_032892	
SEMA6D	80031	hgsc.bcm.edu	37	15	48056061	48056061	+	Silent	SNP	C	C	A	rs374731818		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:48056061C>A	ENST00000316364.5	+	10	1201	c.762C>A	c.(760-762)cgC>cgA	p.R254R	SEMA6D_ENST00000558014.1_Silent_p.R254R|SEMA6D_ENST00000389432.2_Silent_p.R254R|SEMA6D_ENST00000389425.3_Silent_p.R254R|SEMA6D_ENST00000355997.3_Silent_p.R254R|SEMA6D_ENST00000536845.2_Silent_p.R254R|SEMA6D_ENST00000354744.4_Silent_p.R254R|SEMA6D_ENST00000558816.1_Silent_p.R254R|SEMA6D_ENST00000358066.4_Silent_p.R254R|SEMA6D_ENST00000537942.1_Silent_p.R254R|SEMA6D_ENST00000389428.3_Silent_p.R254R|SEMA6D_ENST00000389433.2_Silent_p.R254R	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	254	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TGTATTCCCGCGTGGCCCGCA	0.493																																					p.R254R		Atlas-SNP	.											.	SEMA6D	322	.	0			c.C762A						.						136.0	133.0	134.0					15																	48056061		2198	4297	6495	SO:0001819	synonymous_variant	80031	exon10			TTCCCGCGTGGCC	AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.762C>A	chr15.hg19:g.48056061C>A		156.0	0.0		127.0	54.0	NM_153617	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	ENST00000316364.5	hg19	CCDS32225.1																																																																																			.	.		0.493	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416868.1	NM_024966	
FBN1	2200	hgsc.bcm.edu	37	15	48704920	48704920	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:48704920C>T	ENST00000316623.5	-	65	8527	c.8072G>A	c.(8071-8073)gGc>gAc	p.G2691D	FBN1_ENST00000561429.1_5'UTR	NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2691					extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TCGGCCCATGCCCATTCCAGA	0.502																																					p.G2691D		Atlas-SNP	.											.	FBN1	310	.	0			c.G8072A						.						157.0	151.0	153.0					15																	48704920		2198	4296	6494	SO:0001583	missense	2200	exon65			CCCATGCCCATTC	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.8072G>A	chr15.hg19:g.48704920C>T	ENSP00000325527:p.Gly2691Asp	120.0	0.0		85.0	27.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647484	0.87958	.	.	ENSG00000166147	ENST00000316623	D	0.81821	-1.54	5.38	5.38	0.77491	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.88599	0.6480	M	0.73598	2.24	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	D	0.85789	0.1366	10	0.27785	T	0.31	.	18.926	0.92544	0.0:1.0:0.0:0.0	.	2691	P35555	FBN1_HUMAN	D	2691	ENSP00000325527:G2691D	ENSP00000325527:G2691D	G	-	2	0	FBN1	46492212	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.651000	0.83577	2.793000	0.96121	0.655000	0.94253	GGC	.	.		0.502	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
MYO5C	55930	hgsc.bcm.edu	37	15	52497232	52497232	+	Silent	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:52497232G>A	ENST00000261839.7	-	38	4811	c.4650C>T	c.(4648-4650)tcC>tcT	p.S1550S	RP11-430B1.2_ENST00000560518.1_lincRNA	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1550	Dilute. {ECO:0000255|PROSITE- ProRule:PRU00503}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		GTTGCAGGACGGAGGTCATGG	0.587																																					p.S1550S		Atlas-SNP	.											.	MYO5C	162	.	0			c.C4650T						.						86.0	93.0	91.0					15																	52497232		2053	4181	6234	SO:0001819	synonymous_variant	55930	exon38			CAGGACGGAGGTC	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.4650C>T	chr15.hg19:g.52497232G>A		78.0	0.0		97.0	42.0	NM_018728	Q6P1W8	Silent	SNP	ENST00000261839.7	hg19	CCDS42036.1																																																																																			.	.		0.587	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
STRA6	64220	hgsc.bcm.edu	37	15	74494511	74494511	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:74494511T>C	ENST00000323940.5	-	2	343	c.98A>G	c.(97-99)gAg>gGg	p.E33G	STRA6_ENST00000416286.3_Missense_Mutation_p.E33G|STRA6_ENST00000535552.1_Missense_Mutation_p.E70G|STRA6_ENST00000423167.2_Missense_Mutation_p.E33G|STRA6_ENST00000563965.1_Missense_Mutation_p.E72G|STRA6_ENST00000574278.1_Missense_Mutation_p.E48G|RP11-60L3.1_ENST00000558645.1_RNA|STRA6_ENST00000395105.4_Missense_Mutation_p.E33G|STRA6_ENST00000574439.1_5'UTR|RP11-60L3.1_ENST00000560148.1_RNA|STRA6_ENST00000449139.2_Missense_Mutation_p.E33G|RP11-60L3.1_ENST00000561332.1_RNA|STRA6_ENST00000432245.2_Missense_Mutation_p.E33G	NM_001142617.1|NM_001142618.1|NM_001142619.1	NP_001136089.1|NP_001136090.1|NP_001136091.1	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid 6	33					adrenal gland development (GO:0030325)|alveolar primary septum development (GO:0061143)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|cognition (GO:0050890)|developmental growth (GO:0048589)|diaphragm development (GO:0060539)|digestive tract morphogenesis (GO:0048546)|ductus arteriosus closure (GO:0097070)|ear development (GO:0043583)|embryonic camera-type eye formation (GO:0060900)|embryonic digestive tract development (GO:0048566)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|feeding behavior (GO:0007631)|female genitalia development (GO:0030540)|head development (GO:0060322)|head morphogenesis (GO:0060323)|heart development (GO:0007507)|kidney development (GO:0001822)|learning (GO:0007612)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung vasculature development (GO:0060426)|neuromuscular process (GO:0050905)|nose morphogenesis (GO:0043585)|paramesonephric duct development (GO:0061205)|phototransduction, visible light (GO:0007603)|positive regulation of behavior (GO:0048520)|positive regulation of JAK-STAT cascade (GO:0046427)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol transport (GO:0034633)|smooth muscle tissue development (GO:0048745)|uterus morphogenesis (GO:0061038)|ventricular septum development (GO:0003281)|vitamin A import (GO:0071939)|vocal learning (GO:0042297)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	receptor activity (GO:0004872)|vitamin transporter activity (GO:0051183)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|stomach(2)	26						TGGCTGGAGCTCCTCGCCCCC	0.627																																					p.E72G		Atlas-SNP	.											.	STRA6	66	.	0			c.A215G						.						44.0	44.0	44.0					15																	74494511		2198	4297	6495	SO:0001583	missense	64220	exon2			TGGAGCTCCTCGC	AF352728	CCDS10261.1, CCDS45301.1, CCDS45302.1, CCDS55973.1, CCDS55974.1, CCDS58387.1	15q24.1	2014-07-14	2012-12-07		ENSG00000137868	ENSG00000137868			30650	protein-coding gene	gene with protein product	"""retinol binding protein 4 receptor"""	610745	"""stimulated by retinoic acid gene 6 homolog (mouse)"", ""stimulated by retinoic acid 6 homolog (mouse)"""			17255476, 17273977	Standard	NM_022369		Approved	FLJ12541	uc002axj.3	Q9BX79	OTTHUMG00000138998	ENST00000323940.5:c.98A>G	chr15.hg19:g.74494511T>C	ENSP00000326085:p.Glu33Gly	74.0	0.0		43.0	19.0	NM_001199042	A8K7F1|B7Z5M9|B7Z862|D3DW54|F5GYI8|I3L1G8|Q6PJF8|Q71RB9|Q7L9G1|Q7Z3U9|Q8TB21|Q9BX78|Q9H9U8	Missense_Mutation	SNP	ENST00000323940.5	hg19	CCDS10261.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.522948	0.44866	.	.	ENSG00000137868	ENST00000395105;ENST00000323940;ENST00000449139;ENST00000423167;ENST00000535552;ENST00000432245	D;D;D;D;T	0.82081	-1.55;-1.55;-1.56;-1.57;-1.26	4.51	-0.00192	0.14032	.	0.795454	0.10844	N	0.627861	D	0.84511	0.5488	M	0.67953	2.075	0.09310	N	1	P;P;D;P;P;P	0.57571	0.775;0.775;0.98;0.775;0.775;0.775	B;B;P;B;B;B	0.51453	0.306;0.306;0.67;0.306;0.306;0.306	T	0.74993	-0.3474	10	0.54805	T	0.06	-2.2681	10.9218	0.47169	0.0:0.0:0.672:0.328	.	70;71;33;33;33;72	F5GYI8;B7Z5G7;Q9BX79-2;Q9BX79-3;Q9BX79;Q9BX79-4	.;.;.;.;STRA6_HUMAN;.	G	33;33;72;33;70;33	ENSP00000378537:E33G;ENSP00000326085:E33G;ENSP00000413012:E33G;ENSP00000440238:E70G;ENSP00000407176:E33G	ENSP00000326085:E33G	E	-	2	0	STRA6	72281564	0.001000	0.12720	0.003000	0.11579	0.286000	0.27126	0.103000	0.15292	0.181000	0.19994	0.379000	0.24179	GAG	.	.		0.627	STRA6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272891.1		
AXIN1	8312	hgsc.bcm.edu	37	16	348175	348175	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr16:348175C>T	ENST00000262320.3	-	6	1702	c.1331G>A	c.(1330-1332)tGg>tAg	p.W444*	AXIN1_ENST00000481769.1_5'UTR|AXIN1_ENST00000354866.3_Nonsense_Mutation_p.W444*	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	444	Interaction with CTNNB1. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GAAGTGGTGCCAAGCGGGGGC	0.667											OREG0003699	type=REGULATORY REGION|Gene=AXIN1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.W444X		Atlas-SNP	.											.	AXIN1	290	.	0			c.G1331A						.						9.0	6.0	7.0					16																	348175		2100	4145	6245	SO:0001587	stop_gained	8312	exon6			TGGTGCCAAGCGG	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1331G>A	chr16.hg19:g.348175C>T	ENSP00000262320:p.Trp444*	63.0	0.0	587	34.0	29.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Nonsense_Mutation	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	29.7	5.028316	0.93518	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	4.48	3.45	0.39498	.	0.377447	0.27486	N	0.019155	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-18.9049	9.5891	0.39534	0.3761:0.6239:0.0:0.0	.	.	.	.	X	444	.	ENSP00000262320:W444X	W	-	2	0	AXIN1	288176	1.000000	0.71417	1.000000	0.80357	0.068000	0.16541	3.090000	0.50191	2.324000	0.78689	0.478000	0.44815	TGG	.	.		0.667	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
MEFV	4210	hgsc.bcm.edu	37	16	3304270	3304270	+	Silent	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr16:3304270C>T	ENST00000219596.1	-	2	837	c.798G>A	c.(796-798)aaG>aaA	p.K266K	MEFV_ENST00000541159.1_Intron|MEFV_ENST00000536379.1_Intron|MEFV_ENST00000339854.4_Intron	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	266	Interaction with RELA.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						TCGCAGCTGTCTTTTCCTCTA	0.572																																					p.K266K		Atlas-SNP	.											.	MEFV	170	.	0			c.G798A						.						121.0	137.0	131.0					16																	3304270		2197	4300	6497	SO:0001819	synonymous_variant	4210	exon2			AGCTGTCTTTTCC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.798G>A	chr16.hg19:g.3304270C>T		76.0	0.0		52.0	46.0	NM_000243	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Silent	SNP	ENST00000219596.1	hg19	CCDS10498.1																																																																																			.	.		0.572	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
XYLT1	64131	hgsc.bcm.edu	37	16	17228387	17228387	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr16:17228387C>A	ENST00000261381.6	-	9	2054	c.1970G>T	c.(1969-1971)cGc>cTc	p.R657L	CTD-2576D5.4_ENST00000567344.1_RNA	NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	657					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						AAGACCCAGGCGGGCAAAGGA	0.622																																					p.R657L		Atlas-SNP	.											.	XYLT1	147	.	0			c.G1970T						.						92.0	78.0	82.0					16																	17228387		2197	4300	6497	SO:0001583	missense	64131	exon9			CCCAGGCGGGCAA	AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.1970G>T	chr16.hg19:g.17228387C>A	ENSP00000261381:p.Arg657Leu	64.0	0.0		24.0	19.0	NM_022166	Q9H1B6	Missense_Mutation	SNP	ENST00000261381.6	hg19	CCDS10569.1	.	.	.	.	.	.	.	.	.	.	C	31	5.100144	0.94197	.	.	ENSG00000103489	ENST00000261381	T	0.55760	0.5	5.33	5.33	0.75918	.	0.103350	0.64402	D	0.000001	T	0.70962	0.3284	M	0.82323	2.585	0.80722	D	1	D	0.64830	0.994	D	0.63597	0.916	T	0.75379	-0.3338	10	0.87932	D	0	-34.3226	11.4711	0.50268	0.0:0.9182:0.0:0.0817	.	657	Q86Y38	XYLT1_HUMAN	L	657	ENSP00000261381:R657L	ENSP00000261381:R657L	R	-	2	0	XYLT1	17135888	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	6.061000	0.71148	2.489000	0.83994	0.561000	0.74099	CGC	.	.		0.622	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252241.2	NM_022166	
EVPLL	645027	hgsc.bcm.edu	37	17	18284693	18284693	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr17:18284693A>T	ENST00000399134.4	+	3	434	c.76A>T	c.(76-78)Agt>Tgt	p.S26C	RP1-37N7.1_ENST00000579352.1_RNA	NM_001145127.1	NP_001138599.1	A8MZ36	EVPLL_HUMAN	envoplakin-like	26										NS(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CCGGCTGAACAGTGAGCAGAG	0.662																																					p.S26C		Atlas-SNP	.											.	EVPLL	10	.	0			c.A76T						.						29.0	35.0	33.0					17																	18284693		692	1591	2283	SO:0001583	missense	645027	exon3			CTGAACAGTGAGC		CCDS45626.1	17p11.2	2009-08-25			ENSG00000214860	ENSG00000214860			35236	protein-coding gene	gene with protein product							Standard	NM_001145127		Approved		uc002gte.3	A8MZ36	OTTHUMG00000059095	ENST00000399134.4:c.76A>T	chr17.hg19:g.18284693A>T	ENSP00000382086:p.Ser26Cys	93.0	0.0		60.0	25.0	NM_001145127	B4DPD4	Missense_Mutation	SNP	ENST00000399134.4	hg19	CCDS45626.1	.	.	.	.	.	.	.	.	.	.	.	9.321	1.058101	0.19987	.	.	ENSG00000214860	ENST00000399134	T	0.19669	2.13	.	.	.	.	.	.	.	.	T	0.15652	0.0377	N	0.24115	0.695	0.09310	N	1	D	0.61080	0.989	P	0.49637	0.617	T	0.15037	-1.0451	7	0.38643	T	0.18	.	.	.	.	.	26	A8MZ36	EVPLL_HUMAN	C	26	ENSP00000382086:S26C	ENSP00000382086:S26C	S	+	1	0	EVPLL	18225418	0.485000	0.25972	0.688000	0.30117	0.325000	0.28411	3.638000	0.54332	-0.508000	0.06540	0.063000	0.15292	AGT	.	.		0.662	EVPLL-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000130836.2	NM_001145127	
C17orf75	64149	hgsc.bcm.edu	37	17	30665304	30665304	+	Silent	SNP	T	T	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr17:30665304T>G	ENST00000577809.1	-	4	463	c.414A>C	c.(412-414)acA>acC	p.T138T	C17orf75_ENST00000225805.4_Silent_p.T138T|RP11-227G15.3_ENST00000581915.1_RNA	NM_022344.3	NP_071739.2	Q9HAS0	NJMU_HUMAN	chromosome 17 open reading frame 75	138										ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			CTATCGTTACTGTTTCAGGAA	0.353																																					p.T138T		Atlas-SNP	.											.	C17orf75	23	.	0			c.A414C						.						117.0	112.0	113.0					17																	30665304		1837	4099	5936	SO:0001819	synonymous_variant	64149	exon4			CGTTACTGTTTCA	AB062437	CCDS58537.1	17q11.2	2013-01-21			ENSG00000108666	ENSG00000108666			30173	protein-coding gene	gene with protein product							Standard	NM_022344		Approved	NJMU-R1	uc002hhg.3	Q9HAS0		ENST00000577809.1:c.414A>C	chr17.hg19:g.30665304T>G		282.0	0.0		231.0	93.0	NM_022344	Q7Z2H4	Silent	SNP	ENST00000577809.1	hg19	CCDS58537.1																																																																																			.	.		0.353	C17orf75-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447204.1	NM_022344	
KRT36	8689	hgsc.bcm.edu	37	17	39644652	39644652	+	Splice_Site	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr17:39644652C>T	ENST00000328119.6	-	3	542		c.e3-1		KRT36_ENST00000393986.2_Splice_Site	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36						regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				TGTCTCATACCTGCACACACA	0.602																																					.		Atlas-SNP	.											.	KRT36	52	.	0			c.543-1G>A						.						60.0	52.0	55.0					17																	39644652		2203	4300	6503	SO:0001630	splice_region_variant	8689	exon4			TCATACCTGCACA	Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.543-1G>A	chr17.hg19:g.39644652C>T		52.0	0.0		53.0	25.0	NM_003771	Q86XG4	Splice_Site	SNP	ENST00000328119.6	hg19	CCDS11395.1	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830211	0.71258	.	.	ENSG00000126337	ENST00000393986;ENST00000328119	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1316	0.93410	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT36	36898178	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	7.487000	0.81328	2.769000	0.95229	0.563000	0.77884	.	.	.		0.602	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259508.1	NM_003771	Intron
TLK2	11011	hgsc.bcm.edu	37	17	60558480	60558480	+	Intron	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr17:60558480A>T	ENST00000326270.9	+	2	266				TLK2_ENST00000542523.1_Splice_Site|TLK2_ENST00000343388.7_Splice_Site|TLK2_ENST00000582809.1_Intron|TLK2_ENST00000577616.1_Intron|TLK2_ENST00000346027.5_Splice_Site	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2						cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						TTTCTTTTTCAGCAGAAATGA	0.388																																					.		Atlas-SNP	.											.	TLK2	223	.	0			.						.						88.0	84.0	85.0					17																	60558480		2203	4300	6503	SO:0001627	intron_variant	11011	.			TTTTTCAGCAGAA	AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.-2-5A>T	chr17.hg19:g.60558480A>T		69.0	0.0		79.0	35.0	.	D3DU07|Q9UKI7|Q9Y4F7	Splice_Site	SNP	ENST00000326270.9	hg19																																																																																				.	.		0.388	TLK2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000445140.1	NM_006852	
AXIN2	8313	hgsc.bcm.edu	37	17	63534461	63534461	+	Splice_Site	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr17:63534461T>A	ENST00000375702.5	-	4	1168	c.1060A>T	c.(1060-1062)Aga>Tga	p.R354*	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Splice_Site_p.R354*			Q9Y2T1	AXIN2_HUMAN	axin 2	354	Interaction with GSK3B. {ECO:0000250}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						CGGTGGGTTCTCTACAGGACG	0.627									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																												p.R354X		Atlas-SNP	.											.	AXIN2	92	.	0			c.A1060T						.						47.0	46.0	46.0					17																	63534461		2203	4300	6503	SO:0001630	splice_region_variant	8313	exon5	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	GGGTTCTCTACAG	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.1060-1A>T	chr17.hg19:g.63534461T>A		104.0	0.0		91.0	44.0	NM_004655	Q3MJ88|Q9H3M6|Q9UH84	Nonsense_Mutation	SNP	ENST00000375702.5	hg19		.	.	.	.	.	.	.	.	.	.	T	36	5.868443	0.97043	.	.	ENSG00000168646	ENST00000307078;ENST00000375702	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.4338	15.243	0.73485	0.0:0.0:0.0:1.0	.	.	.	.	X	354	.	ENSP00000302625:R354X	R	-	1	2	AXIN2	60964923	1.000000	0.71417	0.998000	0.56505	0.755000	0.42902	3.927000	0.56499	2.008000	0.58898	0.454000	0.30748	AGA	.	.		0.627	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000445901.1	NM_004655	Nonsense_Mutation
SDK2	54549	hgsc.bcm.edu	37	17	71361525	71361525	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr17:71361525G>A	ENST00000392650.3	-	38	5177	c.5177C>T	c.(5176-5178)gCt>gTt	p.A1726V	SDK2_ENST00000410094.1_5'UTR|SDK2_ENST00000388726.3_Missense_Mutation_p.A1707V	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1726	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CGAGCTGGGAGCGCTGGGGGC	0.577																																					p.A1726V		Atlas-SNP	.											.	SDK2	219	.	0			c.C5177T						.						29.0	26.0	27.0					17																	71361525		2203	4300	6503	SO:0001583	missense	54549	exon38			CTGGGAGCGCTGG	AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5177C>T	chr17.hg19:g.71361525G>A	ENSP00000376421:p.Ala1726Val	119.0	0.0		70.0	15.0	NM_001144952	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	ENST00000392650.3	hg19	CCDS45769.1	.	.	.	.	.	.	.	.	.	.	G	16.57	3.160046	0.57368	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.61742	0.08;0.08;0.08	4.95	4.95	0.65309	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.058384	0.64402	D	0.000002	T	0.64659	0.2618	M	0.73962	2.25	0.54753	D	0.999983	B;B;B	0.21147	0.052;0.007;0.005	B;B;B	0.31869	0.137;0.049;0.044	T	0.66101	-0.6007	10	0.59425	D	0.04	.	18.205	0.89852	0.0:0.0:1.0:0.0	.	1726;1726;1707	Q58EX2-2;Q58EX2;Q58EX2-3	.;SDK2_HUMAN;.	V	1350;1726;1707;883;1726;67	ENSP00000376421:A1726V;ENSP00000373378:A1707V;ENSP00000407098:A883V	ENSP00000324967:A1726V	A	-	2	0	SDK2	68873120	1.000000	0.71417	0.504000	0.27639	0.855000	0.48748	6.262000	0.72514	2.279000	0.76181	0.655000	0.94253	GCT	.	.		0.577	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327598.2	NM_019064	
DNAH17	8632	hgsc.bcm.edu	37	17	76497424	76497424	+	Silent	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr17:76497424C>A	ENST00000585328.1	-	35	5434	c.5310G>T	c.(5308-5310)gtG>gtT	p.V1770V	DNAH17_ENST00000389840.5_Silent_p.V1761V|DNAH17-AS1_ENST00000598378.1_3'UTR|RP11-559N14.5_ENST00000591373.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1761	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GAGAACTCTCCACCTGCAGGA	0.607																																					p.V1775V		Atlas-SNP	.											.	DNAH17	347	.	0			c.G5325T						.						49.0	52.0	51.0					17																	76497424		2068	4217	6285	SO:0001819	synonymous_variant	8632	exon35			ACTCTCCACCTGC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.5310G>T	chr17.hg19:g.76497424C>A		44.0	0.0		37.0	18.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	ENST00000585328.1	hg19																																																																																				.	.		0.607	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
DSC1	1823	hgsc.bcm.edu	37	18	28720171	28720171	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr18:28720171T>C	ENST00000257198.5	-	10	1615	c.1354A>G	c.(1354-1356)Aca>Gca	p.T452A	DSC1_ENST00000257197.3_Missense_Mutation_p.T452A|RP11-408H20.2_ENST00000581836.1_RNA	NM_024421.2	NP_077739.1	Q08554	DSC1_HUMAN	desmocollin 1	452	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			OV - Ovarian serous cystadenocarcinoma(10;0.00778)			GTGCACATTGTAGGAGTTTGT	0.433																																					p.T452A		Atlas-SNP	.											.	DSC1	240	.	0			c.A1354G						.						103.0	96.0	98.0					18																	28720171		2203	4300	6503	SO:0001583	missense	1823	exon10			ACATTGTAGGAGT	AF293358	CCDS11894.1, CCDS11895.1	18q12.1	2010-01-26			ENSG00000134765	ENSG00000134765		"""Cadherins / Major cadherins"""	3035	protein-coding gene	gene with protein product		125643				8486729	Standard	NM_024421		Approved	CDHF1	uc002kwn.3	Q08554	OTTHUMG00000131982	ENST00000257198.5:c.1354A>G	chr18.hg19:g.28720171T>C	ENSP00000257198:p.Thr452Ala	163.0	0.0		107.0	43.0	NM_004948	Q9HB01	Missense_Mutation	SNP	ENST00000257198.5	hg19	CCDS11894.1	.	.	.	.	.	.	.	.	.	.	T	1.259	-0.616498	0.03663	.	.	ENSG00000134765	ENST00000257197;ENST00000257198	T;T	0.50813	0.73;0.73	5.83	-1.36	0.09085	Cadherin (4);Cadherin-like (1);	0.379741	0.22022	N	0.065704	T	0.26484	0.0647	N	0.20685	0.6	0.09310	N	1	B;B	0.31125	0.309;0.309	B;B	0.37550	0.253;0.197	T	0.26189	-1.0110	10	0.13853	T	0.58	.	5.1495	0.15002	0.4987:0.1388:0.0:0.3626	.	452;452	Q08554;Q9HB00	DSC1_HUMAN;.	A	452	ENSP00000257197:T452A;ENSP00000257198:T452A	ENSP00000257197:T452A	T	-	1	0	DSC1	26974169	0.001000	0.12720	0.003000	0.11579	0.467000	0.32768	-0.567000	0.05916	-0.115000	0.11915	-0.263000	0.10527	ACA	.	.		0.433	DSC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254946.1	NM_004948, NM_024421	
ATP8B3	148229	hgsc.bcm.edu	37	19	1784853	1784853	+	Missense_Mutation	SNP	C	C	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:1784853C>G	ENST00000310127.6	-	28	3863	c.3625G>C	c.(3625-3627)Gtc>Ctc	p.V1209L	ATP8B3_ENST00000525591.1_Missense_Mutation_p.V1172L|ATP8B3_ENST00000539485.1_Missense_Mutation_p.V1219L	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1209					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAAGATGACTCGGAGGGCC	0.622																																					p.V1209L		Atlas-SNP	.											.	ATP8B3	108	.	0			c.G3625C						.						57.0	60.0	59.0					19																	1784853		2140	4253	6393	SO:0001583	missense	148229	exon28			AGATGACTCGGAG	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3625G>C	chr19.hg19:g.1784853C>G	ENSP00000311336:p.Val1209Leu	107.0	0.0		96.0	47.0	NM_138813	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	hg19	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	C	4.590	0.109613	0.08780	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.39787	1.06;1.06;1.06	3.33	-4.36	0.03645	.	1.071130	0.07246	N	0.865097	T	0.21718	0.0523	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.18209	-1.0344	10	0.37606	T	0.19	.	3.0243	0.06085	0.1282:0.4515:0.1296:0.2907	.	1209;1172	O60423;Q7Z485	AT8B3_HUMAN;.	L	1209;1219;1172	ENSP00000311336:V1209L;ENSP00000443574:V1219L;ENSP00000437115:V1172L	ENSP00000311336:V1209L	V	-	1	0	ATP8B3	1735853	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.810000	0.00755	-0.758000	0.04690	-0.459000	0.05422	GTC	.	.		0.622	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
CD70	970	hgsc.bcm.edu	37	19	6586380	6586380	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:6586380C>A	ENST00000245903.3	-	3	382	c.233G>T	c.(232-234)gGc>gTc	p.G78V	CD70_ENST00000423145.3_Missense_Mutation_p.G78V	NM_001252.3	NP_001243.1	P32970	CD70_HUMAN	CD70 molecule	78					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protease binding (GO:0002020)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|skin(1)	11						CAGTGCTGGGCCCCCCTGCCA	0.607																																					p.G78V	Pancreas(183;2617 2876 10173 34193)	Atlas-SNP	.											.	CD70	24	.	0			c.G233T						.						33.0	29.0	30.0					19																	6586380		2203	4300	6503	SO:0001583	missense	970	exon3			GCTGGGCCCCCCT	L08096	CCDS12170.1	19p13	2013-05-22	2006-10-27	2006-10-27		ENSG00000125726		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11937	protein-coding gene	gene with protein product		602840	"""tumor necrosis factor (ligand) superfamily, member 7"""	CD27LG, TNFSF7		8387892, 8120384	Standard	NM_001252		Approved	CD27L	uc002mfi.3	P32970		ENST00000245903.3:c.233G>T	chr19.hg19:g.6586380C>A	ENSP00000245903:p.Gly78Val	44.0	0.0		40.0	22.0	NM_001252	B4DPR8|Q53XX4|Q96J57	Missense_Mutation	SNP	ENST00000245903.3	hg19	CCDS12170.1	.	.	.	.	.	.	.	.	.	.	C	15.20	2.763199	0.49574	.	.	ENSG00000125726	ENST00000423145;ENST00000245903	D;T	0.94613	-3.47;-0.16	4.32	-0.377	0.12501	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.834321	0.10499	N	0.667475	D	0.92756	0.7697	N	0.19112	0.55	0.21445	N	0.999687	D;D	0.63880	0.993;0.983	D;P	0.64776	0.929;0.874	D	0.84641	0.0695	10	0.72032	D	0.01	-18.934	7.3189	0.26515	0.0:0.576:0.0:0.424	.	78;78	B4DPR8;P32970	.;CD70_HUMAN	V	78	ENSP00000395294:G78V;ENSP00000245903:G78V	ENSP00000245903:G78V	G	-	2	0	CD70	6537380	0.005000	0.15991	0.091000	0.20842	0.118000	0.20060	-0.332000	0.07904	0.077000	0.16863	-0.261000	0.10672	GGC	.	.		0.607	CD70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457860.1		
OR7G1	125962	hgsc.bcm.edu	37	19	9225702	9225702	+	Silent	SNP	A	A	T	rs146317150		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:9225702A>T	ENST00000541538.1	-	1	737	c.738T>A	c.(736-738)tcT>tcA	p.S246S	OR7G1_ENST00000293614.1_Silent_p.S246S	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	246						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						AGGAAAAAACAGAGAGGTGAC	0.428																																					p.S246S		Atlas-SNP	.											.	OR7G1	53	.	0			c.T738A						.						96.0	95.0	95.0					19																	9225702		2203	4300	6503	SO:0001819	synonymous_variant	125962	exon1			AAAAACAGAGAGG		CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.738T>A	chr19.hg19:g.9225702A>T		186.0	0.0		136.0	50.0	NM_001005192	Q6IFJ5|Q96RA1	Silent	SNP	ENST00000541538.1	hg19	CCDS32898.2																																																																																			.	.		0.428	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397912.1		
IL27RA	9466	hgsc.bcm.edu	37	19	14157256	14157256	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:14157256C>T	ENST00000263379.2	+	8	1092	c.967C>T	c.(967-969)Ccc>Tcc	p.P323S		NM_004843.3	NP_004834.1	Q6UWB1	I27RA_HUMAN	interleukin 27 receptor, alpha	323	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T-helper 1 type immune response (GO:0002827)|regulation of isotype switching to IgG isotypes (GO:0048302)	integral component of plasma membrane (GO:0005887)	interleukin-27 receptor activity (GO:0045509)|transmembrane signaling receptor activity (GO:0004888)			breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	26						AGCCTCTGCCCCCCGTAGCGT	0.637																																					p.P323S	Colon(164;1849 1896 4443 37792 47834)	Atlas-SNP	.											.	IL27RA	56	.	0			c.C967T						.						70.0	74.0	73.0					19																	14157256		2203	4300	6503	SO:0001583	missense	9466	exon8			TCTGCCCCCCGTA	AF053004	CCDS12303.1	19p13.11	2013-02-11				ENSG00000104998		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	17290	protein-coding gene	gene with protein product	"""T-cell cytokine receptor type 1"""	605350				9600072, 11057672	Standard	NM_004843		Approved	WSX-1, TCCR, CRL1, WSX1, zcytor1, IL-27R	uc002mxx.4	Q6UWB1		ENST00000263379.2:c.967C>T	chr19.hg19:g.14157256C>T	ENSP00000263379:p.Pro323Ser	88.0	0.0		63.0	36.0	NM_004843	A0N0L1|O60624	Missense_Mutation	SNP	ENST00000263379.2	hg19	CCDS12303.1	.	.	.	.	.	.	.	.	.	.	C	18.61	3.662112	0.67700	.	.	ENSG00000104998	ENST00000263379	T	0.79749	-1.3	4.68	4.68	0.58851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.40818	N	0.001019	D	0.88862	0.6552	M	0.80183	2.485	0.18873	N	0.999987	D	0.89917	1.0	D	0.97110	1.0	T	0.81276	-0.1006	10	0.45353	T	0.12	.	12.9653	0.58481	0.0:1.0:0.0:0.0	.	323	Q6UWB1	I27RA_HUMAN	S	323	ENSP00000263379:P323S	ENSP00000263379:P323S	P	+	1	0	IL27RA	14018256	0.553000	0.26513	0.386000	0.26170	0.183000	0.23260	3.576000	0.53878	2.433000	0.82419	0.650000	0.86243	CCC	.	.		0.637	IL27RA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458539.1	NM_004843	
EMR2	30817	hgsc.bcm.edu	37	19	14863218	14863218	+	Silent	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:14863218G>A	ENST00000315576.3	-	15	2162	c.1711C>T	c.(1711-1713)Ctg>Ttg	p.L571L	EMR2_ENST00000601345.1_Silent_p.L560L|EMR2_ENST00000353876.1_Silent_p.L478L|EMR2_ENST00000594076.1_Silent_p.L478L|EMR2_ENST00000596991.2_Silent_p.L560L|EMR2_ENST00000595839.1_Silent_p.L429L|EMR2_ENST00000594294.1_Silent_p.L522L|EMR2_ENST00000346057.1_Silent_p.L522L|EMR2_ENST00000392967.2_Silent_p.L560L|EMR2_ENST00000353005.1_Silent_p.L429L|EMR2_ENST00000392965.3_Silent_p.L513L|EMR2_ENST00000392964.3_3'UTR	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	571					cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						TGCAGATGCAGTGAGGTGCTG	0.567																																					p.L571L		Atlas-SNP	.											.	EMR2	99	.	0			c.C1711T						.						135.0	116.0	122.0					19																	14863218		2203	4300	6503	SO:0001819	synonymous_variant	30817	exon15			GATGCAGTGAGGT	AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.1711C>T	chr19.hg19:g.14863218G>A		172.0	0.0		152.0	61.0	NM_013447	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Silent	SNP	ENST00000315576.3	hg19	CCDS32935.1																																																																																			.	.		0.567	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466502.2		
OR7C1	26664	hgsc.bcm.edu	37	19	14910799	14910799	+	Silent	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:14910799G>A	ENST00000248073.2	-	1	224	c.150C>T	c.(148-150)tgC>tgT	p.C50C	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	50					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						GGGAGTCTGAGCATATGGCCA	0.493																																					p.C50C		Atlas-SNP	.											.	OR7C1	58	.	0			c.C150T						.						88.0	78.0	81.0					19																	14910799		2203	4300	6503	SO:0001819	synonymous_variant	26664	exon1			GTCTGAGCATATG	X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.150C>T	chr19.hg19:g.14910799G>A		248.0	0.0		199.0	93.0	NM_198944	Q15621|Q6IFP2|Q96R94	Silent	SNP	ENST00000248073.2	hg19	CCDS12317.1																																																																																			.	.		0.493	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466519.1		
ZNF257	113835	hgsc.bcm.edu	37	19	22256300	22256300	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:22256300A>G	ENST00000594947.1	+	3	304	c.160A>G	c.(160-162)Acc>Gcc	p.T54A	ZNF257_ENST00000600162.1_Missense_Mutation_p.T54A	NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	54	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGACCTGATCACCTGTCTGGA	0.423																																					p.T54A		Atlas-SNP	.											.	ZNF257	156	.	0			c.A160G						.						135.0	149.0	144.0					19																	22256300		2203	4300	6503	SO:0001583	missense	113835	exon3			CTGATCACCTGTC	AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.160A>G	chr19.hg19:g.22256300A>G	ENSP00000470209:p.Thr54Ala	79.0	0.0		89.0	44.0	NM_033468	B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	ENST00000594947.1	hg19	CCDS46030.1	.	.	.	.	.	.	.	.	.	.	A	7.556	0.663667	0.14710	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	0.86	-1.53	0.08611	Krueppel-associated box (3);	.	.	.	.	T	0.27731	0.0682	L	0.37561	1.115	0.09310	N	1	B	0.29805	0.257	B	0.30572	0.117	T	0.33214	-0.9877	8	0.62326	D	0.03	.	3.0291	0.06101	0.5239:0.4761:0.0:0.0	.	54	Q9Y2Q1	ZN257_HUMAN	A	54	.	ENSP00000380312:T54A	T	+	1	0	ZNF257	22048140	0.001000	0.12720	0.144000	0.22314	0.145000	0.21501	-0.133000	0.10451	0.257000	0.21650	0.254000	0.18369	ACC	.	.		0.423	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464382.1		
PSG6	5675	hgsc.bcm.edu	37	19	43414998	43414998	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:43414998T>A	ENST00000292125.2	-	3	484	c.440A>T	c.(439-441)aAg>aTg	p.K147M	PSG6_ENST00000187910.2_Missense_Mutation_p.K147M|PSG6_ENST00000402603.4_Missense_Mutation_p.K147M	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	147					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GATGGAGGGCTTGGGAGTCTC	0.517																																					p.K147M		Atlas-SNP	.											.	PSG6	89	.	0			c.A440T						.						140.0	140.0	140.0					19																	43414998		2201	4299	6500	SO:0001583	missense	5675	exon3			GAGGGCTTGGGAG		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.440A>T	chr19.hg19:g.43414998T>A	ENSP00000292125:p.Lys147Met	93.0	0.0		65.0	36.0	NM_001031850	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	hg19	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	11.14	1.551896	0.27739	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.01059	5.39;5.39;5.39	1.64	-3.0	0.05480	.	.	.	.	.	T	0.04363	0.0120	M	0.83603	2.65	0.09310	N	1	P;P;P	0.49559	0.743;0.716;0.925	P;P;P	0.60117	0.869;0.726;0.768	T	0.04693	-1.0933	9	0.72032	D	0.01	.	5.8099	0.18460	0.0:0.0:0.5498:0.4502	.	147;147;147	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	M	147	ENSP00000187910:K147M;ENSP00000385736:K147M;ENSP00000292125:K147M	ENSP00000187910:K147M	K	-	2	0	PSG6	48106838	0.169000	0.23002	0.000000	0.03702	0.004000	0.04260	-1.274000	0.02820	-0.960000	0.03613	0.163000	0.16589	AAG	.	.		0.517	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782	
DMPK	1760	hgsc.bcm.edu	37	19	46282568	46282568	+	Missense_Mutation	SNP	C	C	T	rs540031135		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:46282568C>T	ENST00000291270.4	-	4	511	c.386G>A	c.(385-387)cGg>cAg	p.R129Q	DMPK_ENST00000600757.1_Missense_Mutation_p.R139Q|DMPK_ENST00000343373.4_Missense_Mutation_p.R139Q|DMPK_ENST00000354227.5_Missense_Mutation_p.R129Q|DMPK_ENST00000595361.1_5'Flank|DMPK_ENST00000447742.2_Missense_Mutation_p.R129Q|DMPK_ENST00000458663.2_Missense_Mutation_p.R129Q	NM_004409.3	NP_004400.4	Q09013	DMPK_HUMAN	dystrophia myotonica-protein kinase	129	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular calcium ion homeostasis (GO:0006874)|muscle cell apoptotic process (GO:0010657)|nuclear envelope organization (GO:0006998)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|regulation of excitatory postsynaptic membrane potential involved in skeletal muscle contraction (GO:0014853)|regulation of heart contraction (GO:0008016)|regulation of myotube differentiation (GO:0010830)|regulation of skeletal muscle contraction by calcium ion signaling (GO:0014722)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of mitochondrial outer membrane (GO:0031307)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|myosin phosphatase regulator activity (GO:0017020)|protein serine/threonine kinase activity (GO:0004674)			endometrium(5)|kidney(1)|large_intestine(1)|lung(6)|stomach(1)|urinary_tract(2)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00616)|GBM - Glioblastoma multiforme(486;0.0825)|Epithelial(262;0.24)		CGTGATCCACCGCCGGTCCCC	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		13798	0.0		0.0	False		,,,				2504	0.001				p.R139Q	Esophageal Squamous(35;307 869 9153 24033 28903)	Atlas-SNP	.											.	DMPK	74	.	0			c.G416A						.						121.0	123.0	122.0					19																	46282568		2203	4300	6503	SO:0001583	missense	1760	exon3			ATCCACCGCCGGT	L19268	CCDS12674.1, CCDS46117.1, CCDS46118.1, CCDS46119.1, CCDS74400.1	19q13.3	2014-02-05					2.7.11.1		2933	protein-coding gene	gene with protein product	"""dystrophia myotonica 1"", ""DM protein kinase"", ""myotonin protein kinase A"", ""myotonic dystrophy associated protein kinase"", ""thymopoietin homolog"""	605377	"""dystrophia myotonica 1 (includes dystrophia myotonia protein kinase)"""	DM1, DM		1546325, 1546326	Standard	NM_001288765		Approved	DMK, DM1PK, MDPK, MT-PK	uc002pdf.1	Q09013		ENST00000291270.4:c.386G>A	chr19.hg19:g.46282568C>T	ENSP00000291270:p.Arg129Gln	119.0	0.0		66.0	32.0	NM_001081563	E5KR08|Q16205|Q6P5Z6	Missense_Mutation	SNP	ENST00000291270.4	hg19	CCDS12674.1	.	.	.	.	.	.	.	.	.	.	c	20.7	4.027869	0.75390	.	.	ENSG00000104936	ENST00000458663;ENST00000342805;ENST00000291270;ENST00000447742;ENST00000377750;ENST00000343373;ENST00000348168;ENST00000354227	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	4.55	4.55	0.56014	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43579	D	0.000559	T	0.43144	0.1234	N	0.20807	0.61	0.80722	D	1	P;P;D;D;D;D;D;D;D	0.89917	0.883;0.74;1.0;1.0;1.0;1.0;1.0;1.0;1.0	P;B;D;D;D;D;D;D;D	0.91635	0.475;0.163;0.983;0.985;0.999;0.998;0.991;0.999;0.994	T	0.18967	-1.0320	10	0.21540	T	0.41	.	8.4354	0.32784	0.0:0.8949:0.0:0.1051	.	139;129;129;155;129;129;129;176;139	B7Z9B5;Q09013-12;Q09013-16;G5E982;E5KR07;E5KR05;Q09013;Q59FU6;E5KR08	.;.;.;.;.;.;DMPK_HUMAN;.;.	Q	129;155;129;129;129;139;139;129	ENSP00000401753:R129Q;ENSP00000291270:R129Q;ENSP00000413417:R129Q;ENSP00000345997:R139Q;ENSP00000346168:R129Q	ENSP00000291270:R129Q	R	-	2	0	DMPK	50974408	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	1.676000	0.37565	2.366000	0.80165	0.561000	0.74099	CGG	.	.		0.647	DMPK-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460572.1	NM_004409	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48201917	48201917	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:48201917A>T	ENST00000396720.3	+	12	3469	c.3275A>T	c.(3274-3276)cAg>cTg	p.Q1092L	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	1092										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		CACAAACACCAGGGCTCCGTC	0.662											OREG0025594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q1092L		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.A3275T						.						79.0	82.0	81.0					19																	48201917		2013	4156	6169	SO:0001583	missense	29998	exon12			AACACCAGGGCTC	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.3275A>T	chr19.hg19:g.48201917A>T	ENSP00000379946:p.Gln1092Leu	92.0	0.0	952	73.0	31.0	NM_015711	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	hg19	CCDS46134.1	.	.	.	.	.	.	.	.	.	.	A	18.90	3.720598	0.68959	.	.	ENSG00000063169	ENST00000396720	T	0.49432	0.78	4.28	4.28	0.50868	.	.	.	.	.	T	0.63988	0.2558	M	0.64997	1.995	0.53005	D	0.999964	D	0.67145	0.996	D	0.77557	0.99	T	0.67887	-0.5554	9	0.87932	D	0	.	12.5169	0.56038	1.0:0.0:0.0:0.0	.	1092	Q9NZM4	GSCR1_HUMAN	L	1092	ENSP00000379946:Q1092L	ENSP00000379946:Q1092L	Q	+	2	0	GLTSCR1	52893729	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.995000	0.76257	1.805000	0.52779	0.459000	0.35465	CAG	.	.		0.662	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
BIRC8	112401	hgsc.bcm.edu	37	19	53793038	53793038	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:53793038A>C	ENST00000426466.1	-	1	1837	c.590T>G	c.(589-591)aTc>aGc	p.I197S		NM_033341.4	NP_203127.3	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat containing 8	197					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(10)|urinary_tract(1)	19				GBM - Glioblastoma multiforme(134;0.00304)		AACAACAGCGATATGTCTGTC	0.443																																					p.I197S		Atlas-SNP	.											.	BIRC8	54	.	0			c.T590G						.						113.0	112.0	112.0					19																	53793038		2203	4300	6503	SO:0001583	missense	112401	exon1			ACAGCGATATGTC	AF164682	CCDS12863.1	19q13.3-q13.4	2011-01-25	2011-01-25			ENSG00000163098		"""Baculoviral IAP repeat containing"""	14878	protein-coding gene	gene with protein product	"""IAP-like protein 2"", ""inhibitor of apoptosis-like protein 2"""		"""baculoviral IAP repeat-containing 8"""			11390657	Standard	NM_033341		Approved	ILP-2, hILP2	uc002qbk.3	Q96P09		ENST00000426466.1:c.590T>G	chr19.hg19:g.53793038A>C	ENSP00000412957:p.Ile197Ser	139.0	0.0		134.0	46.0	NM_033341	Q6IPY1|Q96RW5	Missense_Mutation	SNP	ENST00000426466.1	hg19	CCDS12863.1	.	.	.	.	.	.	.	.	.	.	A	10.57	1.387200	0.25031	.	.	ENSG00000163098	ENST00000426466	T	0.78003	-1.14	0.502	-1.0	0.10196	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	.	.	.	.	T	0.81418	0.4818	L	0.58354	1.805	0.09310	N	1	D	0.69078	0.997	D	0.72075	0.976	T	0.68780	-0.5318	9	0.87932	D	0	-7.3458	4.2707	0.10785	0.7447:0.0:0.2553:0.0	.	197	Q96P09	BIRC8_HUMAN	S	197	ENSP00000412957:I197S	ENSP00000412957:I197S	I	-	2	0	BIRC8	58484850	0.070000	0.21116	0.108000	0.21378	0.010000	0.07245	3.094000	0.50227	-0.475000	0.06852	-1.102000	0.02115	ATC	.	.		0.443	BIRC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464357.1	NM_033341	
NLRP12	91662	hgsc.bcm.edu	37	19	54327156	54327156	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr19:54327156T>A	ENST00000324134.6	-	1	441	c.273A>T	c.(271-273)agA>agT	p.R91S	NLRP12_ENST00000351894.4_Missense_Mutation_p.R91S|NLRP12_ENST00000354278.3_Missense_Mutation_p.R91S|NLRP12_ENST00000391775.3_Missense_Mutation_p.R91S|NLRP12_ENST00000391773.1_Missense_Mutation_p.R91S|NLRP12_ENST00000535162.1_Missense_Mutation_p.R91S|NLRP12_ENST00000345770.5_Missense_Mutation_p.R91S|NLRP12_ENST00000391772.1_Missense_Mutation_p.R91S	NM_001277126.1|NM_144687.2	NP_001264055.1|NP_653288.1	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12	91	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to cytokine stimulus (GO:0071345)|dendritic cell migration (GO:0036336)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of signal transduction (GO:0009968)|negative regulation of Toll signaling pathway (GO:0045751)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of MHC class I biosynthetic process (GO:0045345)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of interleukin-18 biosynthetic process (GO:0045381)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)			NS(1)|breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(1)|lung(36)|ovary(5)|pancreas(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	80	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		CCAGGTCCTCTCTCTGTCCTC	0.587																																					p.L91L		Atlas-SNP	.											.	NLRP12	236	.	0			c.G273T						.						104.0	100.0	102.0					19																	54327156		2202	4295	6497	SO:0001583	missense	91662	exon1			GTCCTCTCTCTGT	AY095146	CCDS12864.1, CCDS62784.1, CCDS62785.1	19q13.42	2014-09-17	2006-12-08	2006-12-08	ENSG00000142405	ENSG00000142405		"""Nucleotide-binding domain and leucine rich repeat containing"""	22938	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 12"""	609648	"""NACHT, leucine rich repeat and PYD containing 12"""	NALP12		12563287, 12019269	Standard	NM_001277129		Approved	RNO2, PYPAF7, Monarch1, PAN6, CLR19.3	uc002qcj.5	P59046	OTTHUMG00000060776	ENST00000324134.6:c.273A>T	chr19.hg19:g.54327156T>A	ENSP00000319377:p.Arg91Ser	89.0	0.0		84.0	35.0	NM_144687	A8MTQ2|B3KTE7|Q8NEU4|Q9BY26	Silent	SNP	ENST00000324134.6	hg19	CCDS12864.1	.	.	.	.	.	.	.	.	.	.	T	10.11	1.259674	0.23051	.	.	ENSG00000142405	ENST00000324134;ENST00000535162;ENST00000351894;ENST00000354278;ENST00000391775;ENST00000391773;ENST00000345770;ENST00000391772	T;T;T;T;T;T;T	0.51071	0.72;0.72;0.72;0.72;0.72;0.72;0.72	4.87	0.253	0.15551	Pyrin (2);DEATH-like (2);	0.613015	0.13947	N	0.351800	T	0.42177	0.1191	M	0.77103	2.36	0.09310	N	0.999999	P;P;P;P	0.38280	0.625;0.625;0.625;0.625	B;B;B;B	0.34931	0.192;0.192;0.192;0.192	T	0.37033	-0.9723	10	0.66056	D	0.02	.	4.3222	0.11022	0.0:0.277:0.1667:0.5564	.	91;91;91;91	F2Z321;A8K407;A8MTQ2;P59046	.;.;.;NAL12_HUMAN	S	91	ENSP00000319377:R91S;ENSP00000438030:R91S;ENSP00000340473:R91S;ENSP00000346231:R91S;ENSP00000375655:R91S;ENSP00000375653:R91S;ENSP00000375652:R91S	ENSP00000319377:R91S	R	-	3	2	NLRP12	59018968	0.007000	0.16637	0.574000	0.28523	0.390000	0.30446	-0.208000	0.09371	-0.240000	0.09696	-0.425000	0.05940	AGA	.	.		0.587	NLRP12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000134340.1	NM_144687	
BFSP1	631	hgsc.bcm.edu	37	20	17489605	17489605	+	Silent	SNP	G	G	T	rs141217196		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr20:17489605G>T	ENST00000377873.3	-	5	703	c.664C>A	c.(664-666)Cgg>Agg	p.R222R	BFSP1_ENST00000536626.1_Silent_p.R83R|BFSP1_ENST00000544874.1_Silent_p.R83R|BFSP1_ENST00000377868.2_Silent_p.R97R	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	222	Coil 2.|Rod.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						AGCTGACTCCGCAGGGCGGCC	0.642																																					p.R222R		Atlas-SNP	.											.	BFSP1	55	.	0			c.C664A						.						19.0	18.0	18.0					20																	17489605		2201	4295	6496	SO:0001819	synonymous_variant	631	exon5			GACTCCGCAGGGC	Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.664C>A	chr20.hg19:g.17489605G>T		109.0	0.0		141.0	94.0	NM_001195	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Silent	SNP	ENST00000377873.3	hg19	CCDS13126.1																																																																																			.	G|1.000;A|0.000		0.642	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078119.6	NM_001195	
DZANK1	55184	hgsc.bcm.edu	37	20	18433306	18433306	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr20:18433306C>T	ENST00000358866.6	-	5	518	c.496G>A	c.(496-498)Gct>Act	p.A166T	DZANK1_ENST00000357236.4_Silent_p.Q15Q|DZANK1_ENST00000487128.1_5'UTR|DZANK1_ENST00000262547.5_Missense_Mutation_p.A166T|DZANK1_ENST00000329494.5_Missense_Mutation_p.A168T			Q9NVP4	DZAN1_HUMAN	double zinc ribbon and ankyrin repeat domains 1	166							zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(10)	19						CCACCATAAGCTGGGATTTCC	0.398																																					p.A166T		Atlas-SNP	.											.	DZANK1	65	.	0			c.G496A						.						61.0	59.0	60.0					20																	18433306		1840	4076	5916	SO:0001583	missense	55184	exon6			CATAAGCTGGGAT	AK001462	CCDS46582.1	20p11.23	2013-01-11	2011-10-03	2011-10-03	ENSG00000089091	ENSG00000089091		"""Ankyrin repeat domain containing"""	15858	protein-coding gene	gene with protein product	"""ankyrin repeat domain 64"""		"""chromosome 20 open reading frame 12"""	C20orf84, C20orf12			Standard	NM_001099407		Approved	FLJ10600, dJ568F9.2, FLJ30892, bA189K21.8, ANKRD64	uc002wqq.4	Q9NVP4	OTTHUMG00000031968	ENST00000358866.6:c.496G>A	chr20.hg19:g.18433306C>T	ENSP00000351734:p.Ala166Thr	176.0	0.0		207.0	56.0	NM_001099407	B7ZLZ4|Q4F7X1|Q5QPD9|Q5QPE0|Q68DN8|Q6ZMX9|Q96NF0|Q9H1E0|Q9H442	Missense_Mutation	SNP	ENST00000358866.6	hg19	CCDS46582.1	.	.	.	.	.	.	.	.	.	.	C	8.111	0.778708	0.16120	.	.	ENSG00000089091	ENST00000262547;ENST00000329494	T;T	0.64085	-0.08;0.55	5.21	-1.55	0.08558	.	2.545780	0.01390	N	0.013202	T	0.46386	0.1390	L	0.29908	0.895	0.09310	N	0.999998	B;B	0.27380	0.177;0.082	B;B	0.26693	0.072;0.055	T	0.16129	-1.0413	10	0.12430	T	0.62	-0.2656	6.2396	0.20783	0.1215:0.4793:0.3222:0.077	.	185;166	B7Z631;Q9NVP4	.;DZAN1_HUMAN	T	166;168	ENSP00000262547:A166T;ENSP00000328866:A168T	ENSP00000262547:A166T	A	-	1	0	C20orf12	18381306	0.007000	0.16637	0.040000	0.18447	0.231000	0.25187	-0.317000	0.08060	-0.060000	0.13132	0.455000	0.32223	GCT	.	.		0.398	DZANK1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471926.1	NM_001099407	
CEP250	11190	hgsc.bcm.edu	37	20	34067158	34067158	+	Missense_Mutation	SNP	G	G	A	rs376769176		TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr20:34067158G>A	ENST00000397527.1	+	18	2917	c.2197G>A	c.(2197-2199)Gcc>Acc	p.A733T	RP3-477O4.14_ENST00000444933.1_RNA|RP3-477O4.14_ENST00000453914.1_RNA|RP3-477O4.14_ENST00000416260.1_RNA|CEP250_ENST00000342580.4_Missense_Mutation_p.A733T	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	733	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GGAGAAGGAGGCCCTAGTACG	0.627																																					p.A733T		Atlas-SNP	.											.	CEP250	141	.	0			c.G2197A						.	G	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	127.0	113.0	118.0		2197	2.1	1.0	20		118	0,8600		0,0,4300	no	missense	CEP250	NM_007186.3	58	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	733/2443	34067158	1,13005	2203	4300	6503	SO:0001583	missense	11190	exon18			AAGGAGGCCCTAG	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.2197G>A	chr20.hg19:g.34067158G>A	ENSP00000380661:p.Ala733Thr	161.0	0.0		226.0	69.0	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	hg19	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	G	9.983	1.228648	0.22542	2.27E-4	0.0	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.10288	2.89;2.9	5.15	2.07	0.26955	.	0.461084	0.20623	N	0.088726	T	0.09291	0.0229	M	0.71296	2.17	0.09310	N	1	B	0.15930	0.015	B	0.16289	0.015	T	0.34650	-0.9820	10	0.14252	T	0.57	.	0.9234	0.01320	0.2189:0.1323:0.3767:0.2721	.	733	Q9BV73	CP250_HUMAN	T	733	ENSP00000380661:A733T;ENSP00000341541:A733T	ENSP00000341541:A733T	A	+	1	0	CEP250	33530572	0.172000	0.23043	0.992000	0.48379	0.986000	0.74619	0.154000	0.16343	0.753000	0.32945	0.655000	0.94253	GCC	.	.		0.627	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
ZBTB46	140685	hgsc.bcm.edu	37	20	62421227	62421227	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr20:62421227G>T	ENST00000245663.4	-	2	1034	c.884C>A	c.(883-885)cCg>cAg	p.P295Q	ZBTB46_ENST00000302995.2_Missense_Mutation_p.P295Q|ZBTB46_ENST00000480766.1_5'Flank|ZBTB46_ENST00000395104.1_Missense_Mutation_p.P295Q	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	295					negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					GGACGGCACCGGGGAGCTGGC	0.627																																					p.P295Q		Atlas-SNP	.											.	ZBTB46	72	.	0			c.C884A						.						82.0	88.0	86.0					20																	62421227		2203	4300	6503	SO:0001583	missense	140685	exon2			GGCACCGGGGAGC	AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.884C>A	chr20.hg19:g.62421227G>T	ENSP00000245663:p.Pro295Gln	39.0	0.0		56.0	18.0	NM_025224	E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	ENST00000245663.4	hg19	CCDS13538.1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501888	0.64298	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.10763	2.84;2.84;2.84	5.8	5.8	0.92144	.	0.119030	0.56097	D	0.000026	T	0.28366	0.0701	M	0.61703	1.905	0.58432	D	0.999993	D	0.71674	0.998	D	0.62955	0.909	T	0.00742	-1.1585	10	0.19590	T	0.45	.	19.0349	0.92972	0.0:0.0:1.0:0.0	.	295	Q86UZ6	ZBT46_HUMAN	Q	295	ENSP00000245663:P295Q;ENSP00000303102:P295Q;ENSP00000378536:P295Q	ENSP00000245663:P295Q	P	-	2	0	ZBTB46	61891671	1.000000	0.71417	0.987000	0.45799	0.473000	0.32948	7.415000	0.80131	2.749000	0.94314	0.655000	0.94253	CCG	.	.		0.627	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080232.2	NM_025224	
DSCAM	1826	hgsc.bcm.edu	37	21	41725592	41725592	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr21:41725592G>C	ENST00000400454.1	-	5	1211	c.734C>G	c.(733-735)cCt>cGt	p.P245R		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	245	Ig-like C2-type 3.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CGCTTTGCAAGGCAGCTCCAC	0.567																																					p.P245R	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.C734G						.						32.0	32.0	32.0					21																	41725592		1923	4133	6056	SO:0001583	missense	1826	exon5			TTGCAAGGCAGCT	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.734C>G	chr21.hg19:g.41725592G>C	ENSP00000383303:p.Pro245Arg	74.0	0.0		51.0	19.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935967	0.73442	.	.	ENSG00000171587	ENST00000400454	T	0.65916	-0.18	5.31	4.42	0.53409	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.70666	0.3250	L	0.39326	1.205	0.58432	D	0.999995	D	0.76494	0.999	D	0.83275	0.996	T	0.70364	-0.4892	10	0.41790	T	0.15	.	13.9805	0.64301	0.0736:0.0:0.9264:0.0	.	245	O60469	DSCAM_HUMAN	R	245	ENSP00000383303:P245R	ENSP00000383303:P245R	P	-	2	0	DSCAM	40647462	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	9.302000	0.96175	1.352000	0.45808	0.650000	0.86243	CCT	.	.		0.567	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
LZTR1	8216	hgsc.bcm.edu	37	22	21348307	21348307	+	Splice_Site	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr22:21348307A>T	ENST00000215739.8	+	13	1807	c.1448A>T	c.(1447-1449)cAg>cTg	p.Q483L	LZTR1_ENST00000479606.1_3'UTR|LZTR1_ENST00000389355.3_Splice_Site_p.Q464L	NM_006767.3	NP_006758.2	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	483	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				anatomical structure morphogenesis (GO:0009653)|regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)	42	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			AGGCTGGCCCAGGTGAGGTGC	0.662																																					p.Q483L		Atlas-SNP	.											.	LZTR1	99	.	0			c.A1448T						.						23.0	26.0	25.0					22																	21348307		2196	4298	6494	SO:0001630	splice_region_variant	8216	exon13			TGGCCCAGGTGAG	D38496	CCDS33606.1	22q11.21	2013-01-09	2004-12-10		ENSG00000099949	ENSG00000099949		"""BTB/POZ domain containing"""	6742	protein-coding gene	gene with protein product		600574	"""leucine-zipper-like transcriptional regulator 1"""			7633402, 16356934	Standard	NM_006767		Approved	LZTR-1, BTBD29	uc002zto.3	Q8N653	OTTHUMG00000150878	ENST00000215739.8:c.1449+1A>T	chr22.hg19:g.21348307A>T		129.0	0.0		99.0	37.0	NM_006767	Q14776|Q20WK0	Missense_Mutation	SNP	ENST00000215739.8	hg19	CCDS33606.1	.	.	.	.	.	.	.	.	.	.	A	14.74	2.625912	0.46840	.	.	ENSG00000099949	ENST00000539817;ENST00000215739;ENST00000389355	T;T	0.59083	0.7;0.29	5.57	4.52	0.55395	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.054362	0.85682	D	0.000000	T	0.66944	0.2841	L	0.47716	1.5	0.80722	D	1	P;B;P;D	0.63046	0.681;0.006;0.906;0.992	B;B;P;D	0.72982	0.437;0.016;0.6;0.979	T	0.66188	-0.5986	10	0.52906	T	0.07	-33.0173	10.1899	0.43019	0.8509:0.0:0.0:0.1491	.	464;442;483;442	B7Z3T9;Q6ZSY0;Q8N653;F5GXU8	.;.;LZTR1_HUMAN;.	L	442;483;464	ENSP00000215739:Q483L;ENSP00000374006:Q464L	ENSP00000215739:Q483L	Q	+	2	0	LZTR1	19678307	1.000000	0.71417	0.995000	0.50966	0.317000	0.28152	5.657000	0.67996	0.919000	0.36945	0.455000	0.32223	CAG	.	.		0.662	LZTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320387.1	NM_006767	Missense_Mutation
EIF4ENIF1	56478	hgsc.bcm.edu	37	22	31851912	31851912	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr22:31851912G>A	ENST00000397525.1	-	8	1248	c.1025C>T	c.(1024-1026)tCt>tTt	p.S342F	EIF4ENIF1_ENST00000344710.5_Missense_Mutation_p.S179F|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.S342F|EIF4ENIF1_ENST00000382180.2_Missense_Mutation_p.S21F|RP11-247I13.11_ENST00000464523.1_RNA|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.S342F	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	342						cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GCTCGGGTTAGAGAACCACCT	0.448											OREG0003517	type=REGULATORY REGION|Gene=LOC486366|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.S342F		Atlas-SNP	.											.	EIF4ENIF1	80	.	0			c.C1025T						.						100.0	92.0	95.0					22																	31851912		2203	4300	6503	SO:0001583	missense	56478	exon8			GGGTTAGAGAACC	AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.1025C>T	chr22.hg19:g.31851912G>A	ENSP00000380659:p.Ser342Phe	148.0	0.0	828	140.0	55.0	NM_019843	B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	ENST00000397525.1	hg19	CCDS13898.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962855	0.92791	.	.	ENSG00000184708	ENST00000344710;ENST00000397525;ENST00000330125;ENST00000397523;ENST00000382180;ENST00000420671	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.76630	0.4014	L	0.55481	1.735	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.999;0.999	D;D;D;D	0.87578	0.972;0.998;0.974;0.998	T	0.76386	-0.2978	9	0.66056	D	0.02	-15.3639	17.8153	0.88630	0.0:0.0:1.0:0.0	.	179;342;179;342	B1AKL3;Q9NRA8;Q9NRA8-2;B1AKL4	.;4ET_HUMAN;.;.	F	179;342;342;342;21;342	.	ENSP00000328103:S342F	S	-	2	0	EIF4ENIF1	30181912	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.291000	0.78721	2.885000	0.99019	0.655000	0.94253	TCT	.	.		0.448	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127926.1	NM_019843	
KAL1	3730	hgsc.bcm.edu	37	X	8667788	8667788	+	Splice_Site	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrX:8667788T>C	ENST00000262648.3	-	2	357		c.e2-2			NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						ACCATTGTTCTGCAAAAAGAA	0.294																																					.		Atlas-SNP	.											.	KAL1	78	.	0			c.208-2A>G						.						47.0	40.0	42.0					X																	8667788		2203	4300	6503	SO:0001630	splice_region_variant	3730	exon3			TTGTTCTGCAAAA		CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.208-2A>G	chrX.hg19:g.8667788T>C		866.0	0.0		683.0	242.0	NM_000216	B2RPF8	Splice_Site	SNP	ENST00000262648.3	hg19	CCDS14130.1	.	.	.	.	.	.	.	.	.	.	T	13.44	2.236625	0.39498	.	.	ENSG00000011201	ENST00000262648	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5529	0.45099	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KAL1	8627788	1.000000	0.71417	0.981000	0.43875	0.682000	0.39822	4.227000	0.58612	1.498000	0.48600	0.417000	0.27973	.	.	.		0.294	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	Intron
SCML2	10389	hgsc.bcm.edu	37	X	18276345	18276345	+	Silent	SNP	A	A	G			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrX:18276345A>G	ENST00000251900.4	-	10	1251	c.1092T>C	c.(1090-1092)caT>caC	p.H364H	SCML2_ENST00000398048.3_Silent_p.H100H	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	364					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CAAAGTTTCCATGTTTGTTTA	0.443																																					p.H364H	Esophageal Squamous(100;1252 1965 19021 35517)	Atlas-SNP	.											.	SCML2	81	.	0			c.T1092C						.						84.0	82.0	82.0					X																	18276345		2203	4300	6503	SO:0001819	synonymous_variant	10389	exon10			GTTTCCATGTTTG	Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1092T>C	chrX.hg19:g.18276345A>G		413.0	0.0		314.0	135.0	NM_006089	Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Silent	SNP	ENST00000251900.4	hg19	CCDS14185.1																																																																																			.	.		0.443	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055941.1	NM_006089	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20183141	20183141	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrX:20183141T>C	ENST00000379565.3	-	18	1847	c.1640A>G	c.(1639-1641)tAt>tGt	p.Y547C	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.Y518C|RPS6KA3_ENST00000479809.1_Intron|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.Y517C|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.Y519C	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	547	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TTCATCCACATAAAGAATGTT	0.338																																					p.Y547C		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.A1640G						.						92.0	85.0	88.0					X																	20183141		2203	4300	6503	SO:0001583	missense	6197	exon18			TCCACATAAAGAA	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.1640A>G	chrX.hg19:g.20183141T>C	ENSP00000368884:p.Tyr547Cys	456.0	0.0		348.0	145.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.125108	0.77436	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.57	5.57	0.84162	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60261	0.2255	N	0.03224	-0.385	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;0.995;1.0;0.998	T	0.72510	-0.4271	10	0.87932	D	0	.	14.7398	0.69445	0.0:0.0:0.0:1.0	.	518;517;519;547	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	C	547;519;517;518	ENSP00000368884:Y547C;ENSP00000440220:Y519C;ENSP00000368865:Y517C;ENSP00000444837:Y518C	ENSP00000368865:Y517C	Y	-	2	0	RPS6KA3	20093062	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	1.862000	0.54008	0.486000	0.48141	TAT	.	.		0.338	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20213230	20213230	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrX:20213230T>C	ENST00000379565.3	-	5	566	c.359A>G	c.(358-360)gAt>gGt	p.D120G	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.D92G|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.D91G|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.D92G	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	120	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	TACCAAGATATCACGTTCCAT	0.363																																					p.D120G		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.A359G						.						182.0	141.0	155.0					X																	20213230		2203	4300	6503	SO:0001583	missense	6197	exon5			AAGATATCACGTT	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.359A>G	chrX.hg19:g.20213230T>C	ENSP00000368884:p.Asp120Gly	201.0	0.0		167.0	61.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	T	18.51	3.639795	0.67244	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145;ENST00000438357	T;T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15;-0.15	6.08	6.08	0.98989	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69513	0.3119	L	0.27975	0.815	0.80722	D	1	B;B;D;B	0.89917	0.02;0.024;1.0;0.115	B;B;D;B	0.97110	0.033;0.095;1.0;0.211	T	0.72465	-0.4285	10	0.56958	D	0.05	.	15.4992	0.75684	0.0:0.0:0.0:1.0	.	92;91;92;120	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	G	120;92;91;92;91;92	ENSP00000368884:D120G;ENSP00000440220:D92G;ENSP00000368865:D91G;ENSP00000444837:D92G;ENSP00000407655:D91G;ENSP00000388512:D92G	ENSP00000368865:D91G	D	-	2	0	RPS6KA3	20123151	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.044000	0.60594	0.486000	0.48141	GAT	.	.		0.363	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
DMD	1756	hgsc.bcm.edu	37	X	32663083	32663083	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrX:32663083C>T	ENST00000357033.4	-	10	1353	c.1147G>A	c.(1147-1149)Gag>Aag	p.E383K	DMD_ENST00000378677.2_Missense_Mutation_p.E379K|DMD_ENST00000288447.4_Missense_Mutation_p.E375K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	383					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)	p.E378*(1)|p.E383*(1)|p.E379*(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TAGTTTACCTCATGAGTATGA	0.353																																					p.E383K		Atlas-SNP	.											.	DMD	2127	.	3	Substitution - Nonsense(3)	lung(3)	c.G1147A						.						190.0	160.0	170.0					X																	32663083		2202	4300	6502	SO:0001583	missense	1756	exon10			TTACCTCATGAGT	AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1147G>A	chrX.hg19:g.32663083C>T	ENSP00000354923:p.Glu383Lys	164.0	0.0		134.0	62.0	NM_004006	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	ENST00000357033.4	hg19	CCDS14233.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.166875	0.78339	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000288447	T;T;T	0.47869	0.83;0.83;0.83	5.52	5.52	0.82312	.	0.000000	0.37437	U	0.002099	T	0.71324	0.3326	M	0.86953	2.85	0.80722	D	1	D;D;P;D;P	0.76494	0.96;0.999;0.944;0.996;0.955	D;D;P;D;P	0.83275	0.942;0.996;0.572;0.996;0.698	T	0.76361	-0.2987	10	0.87932	D	0	.	12.1871	0.54245	0.0:0.9198:0.0:0.0802	.	379;375;375;383;379	B1AK23;Q4G0X0;P11532-4;P11532;E9PDN5	.;.;.;DMD_HUMAN;.	K	375;379;383;383;260;375	ENSP00000367948:E379K;ENSP00000354923:E383K;ENSP00000288447:E375K	ENSP00000288447:E375K	E	-	1	0	DMD	32573004	1.000000	0.71417	1.000000	0.80357	0.516000	0.34256	7.670000	0.83925	2.458000	0.83093	0.600000	0.82982	GAG	.	.		0.353	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056182.2	NM_004006	
HUWE1	10075	hgsc.bcm.edu	37	X	53579727	53579727	+	Silent	SNP	A	A	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrX:53579727A>T	ENST00000342160.3	-	61	9079	c.8622T>A	c.(8620-8622)acT>acA	p.T2874T	HUWE1_ENST00000262854.6_Silent_p.T2874T			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2874					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAGCTGCTGAAGTGTCACCCA	0.587																																					p.T2874T		Atlas-SNP	.											.	HUWE1	724	.	0			c.T8622A						.						48.0	43.0	45.0					X																	53579727		2203	4300	6503	SO:0001819	synonymous_variant	10075	exon62			TGCTGAAGTGTCA	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.8622T>A	chrX.hg19:g.53579727A>T		259.0	0.0		206.0	10.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	A	0.151	-1.091425	0.01858	.	.	ENSG00000086758	ENST00000427052	.	.	.	5.58	-1.93	0.07594	.	.	.	.	.	T	0.21022	0.0506	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.26815	-1.0092	4	.	.	.	.	3.4561	0.07516	0.4893:0.1069:0.2937:0.1101	.	.	.	.	I	1908	.	.	F	-	1	0	HUWE1	53596452	0.061000	0.20836	0.491000	0.27477	0.089000	0.18198	-0.345000	0.07770	-0.499000	0.06623	-1.028000	0.02416	TTC	.	.		0.587	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
CXorf56	63932	hgsc.bcm.edu	37	X	118675326	118675326	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrX:118675326G>A	ENST00000371594.4	-	6	649	c.571C>T	c.(571-573)Cgc>Tgc	p.R191C	CXorf56_ENST00000320339.4_Missense_Mutation_p.R142C|CXorf56_ENST00000469448.1_5'UTR|CXorf56_ENST00000536133.1_Missense_Mutation_p.R177C	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	191								p.R191G(1)		cervix(1)|endometrium(2)|lung(7)	10						ATGCCTTTGCGCTCCAGCTGT	0.493																																					p.R191C		Atlas-SNP	.											.	CXorf56	26	.	1	Substitution - Missense(1)	lung(1)	c.C571T						.						158.0	131.0	140.0					X																	118675326		2203	4300	6503	SO:0001583	missense	63932	exon6			CTTTGCGCTCCAG	AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.571C>T	chrX.hg19:g.118675326G>A	ENSP00000360652:p.Arg191Cys	37.0	0.0		38.0	11.0	NM_022101	A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Missense_Mutation	SNP	ENST00000371594.4	hg19	CCDS14579.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427213	0.83667	.	.	ENSG00000018610	ENST00000486230;ENST00000320339;ENST00000371594;ENST00000536133;ENST00000476164	T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67	5.59	5.59	0.84812	.	0.045927	0.85682	N	0.000000	T	0.52092	0.1713	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.983	T	0.54761	-0.8245	10	0.87932	D	0	-13.1368	12.233	0.54499	0.0:0.0:0.8302:0.1698	.	177;191	F5GWL7;Q9H5V9	.;CX056_HUMAN	C	191;142;191;177;191	ENSP00000420787:R191C;ENSP00000320345:R142C;ENSP00000360652:R191C;ENSP00000441786:R177C;ENSP00000420635:R191C	ENSP00000320345:R142C	R	-	1	0	CXorf56	118559354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.285000	0.65633	2.352000	0.79861	0.597000	0.82753	CGC	.	.		0.493	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_022101	
MT-CYB	4519	hgsc.bcm.edu	37	M	15455	15455	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chrM:15455C>A	ENST00000361789.2	+	1	709	c.709C>A	c.(709-711)Ctc>Atc	p.L237I	MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	237					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						TTCTCTTCCTTCTCTCCTTAA	0.488											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L237I		Atlas-SNP	.											.	.	.	.	0			c.C709A						.																																			SO:0001583	missense	0	exon1			TTCCTTCTCTCCT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.709C>A	chrM.hg19:g.15455C>A	ENSP00000354554:p.Leu237Ile	21.0	0.0	585	37.0	10.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.488	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
SLC6A1	6529	hgsc.bcm.edu	37	3	11064071	11064089	+	Frame_Shift_Del	DEL	CGCTGGCCACTGGCCATCA	CGCTGGCCACTGGCCATCA	-			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	CGCTGGCCACTGGCCATCA	CGCTGGCCACTGGCCATCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr3:11064071_11064089delCGCTGGCCACTGGCCATCA	ENST00000287766.4	+	7	1052_1070	c.631_649delCGCTGGCCACTGGCCATCA	c.(631-651)cgctggccactggccatcacgfs	p.RWPLAIT211fs	SLC6A1_ENST00000536032.1_Frame_Shift_Del_p.RWPLAIT33fs	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	211					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	AGGTCAGATCCGCTGGCCACTGGCCATCACGCTGGCCAT	0.566																																					p.210_216del		Atlas-INDEL	.											.	SLC6A1	88	.	0			c.630_648del						.																																			SO:0001589	frameshift_variant	6529	exon7			.		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.631_649delCGCTGGCCACTGGCCATCA	chr3.hg19:g.11064071_11064089delCGCTGGCCACTGGCCATCA	ENSP00000287766:p.Arg211fs	130.0	0.0		86.0	22.0	NM_003042	Q8N4K8	Frame_Shift_Del	DEL	ENST00000287766.4	hg19	CCDS2603.1																																																																																			.	.		0.566	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	NM_003042	
BRD7	29117	hgsc.bcm.edu	37	16	50357561	50357582	+	Frame_Shift_Del	DEL	TGCCATGACATACGGATAATCT	TGCCATGACATACGGATAATCT	-	rs115202576|rs78557784|rs139109763|rs569809930	byFrequency	TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	TGCCATGACATACGGATAATCT	TGCCATGACATACGGATAATCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr16:50357561_50357582delTGCCATGACATACGGATAATCT	ENST00000394688.3	-	12	1518_1539	c.1359_1380delAGATTATCCGTATGTCATGGCA	c.(1357-1380)caagattatccgtatgtcatggcafs	p.QDYPYVMA453fs	BRD7_ENST00000394689.2_Frame_Shift_Del_p.QDYPYVMA453fs			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	453					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				GTAAACTATCTGCCATGACATACGGATAATCTTGGCACGTGG	0.428																																					p.454_461del		Atlas-INDEL	.											BRD7,NS,carcinoma,0,2	BRD7	61	.	0			c.1360_1381del						.																																			SO:0001589	frameshift_variant	29117	exon12			.	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1359_1380delAGATTATCCGTATGTCATGGCA	chr16.hg19:g.50357561_50357582delTGCCATGACATACGGATAATCT	ENSP00000378180:p.Gln453fs	96.0	0.0		34.0	22.0	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Frame_Shift_Del	DEL	ENST00000394688.3	hg19	CCDS10742.1																																																																																			.	.		0.428	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
IREB2	3658	hgsc.bcm.edu	37	15	78768702	78768703	+	Splice_Site	INS	-	-	T			TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr15:78768702_78768703insT	ENST00000258886.8	+	9	1344		c.e9+1		IREB2_ENST00000560440.1_3'UTR	NM_004136.2	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2						aging (GO:0007568)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|erythrocyte homeostasis (GO:0034101)|intestinal absorption (GO:0050892)|iron ion transport (GO:0006826)|osteoclast differentiation (GO:0030316)|post-embryonic development (GO:0009791)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to iron(II) ion (GO:0010040)|response to retinoic acid (GO:0032526)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|translation repressor activity (GO:0030371)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	41				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		GAACATACAGGTAAGAAGATAA	0.307																																					.	NSCLC(200;764 2208 35157 49871 50830)	Atlas-INDEL	.											.	IREB2	106	.	0			c.1195+1->T						.																																			SO:0001630	splice_region_variant	3658	exon9			.	M58511	CCDS10302.1	15q25.1	2013-09-20			ENSG00000136381	ENSG00000136381			6115	protein-coding gene	gene with protein product		147582				2172968	Standard	NM_004136		Approved	IRP2	uc002bdr.2	P48200	OTTHUMG00000143861	ENST00000258886.8:c.1195+1->T	chr15.hg19:g.78768703_78768703dupT		106.0	0.0		84.0	33.0	NM_004136	A8KAC7|E1CJT9|H0YKU0|Q13095|Q1HE21|Q59FQ7|Q8WVK6|Q9UF17	Splice_Site	INS	ENST00000258886.8	hg19	CCDS10302.1																																																																																			.	.		0.307	IREB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000290109.3	NM_004136	Intron
ZNF33A	7581	hgsc.bcm.edu	37	10	38344303	38344306	+	Frame_Shift_Del	DEL	GTGT	GTGT	-	rs138763916	byFrequency	TCGA-ED-A8O5-01A-11D-A35Z-10	TCGA-ED-A8O5-10A-01D-A35Z-10	GTGT	GTGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	a476994e-8feb-4689-b1fd-649179e672d6	c1d18b80-545a-4fe7-9486-6b7e8f52c426	g.chr10:38344303_38344306delGTGT	ENST00000458705.2	+	5	1406_1409	c.1248_1251delGTGT	c.(1246-1251)gcgtgtfs	p.AC416fs	ZNF33A_ENST00000432900.2_Frame_Shift_Del_p.AC423fs|ZNF33A_ENST00000374618.3_Frame_Shift_Del_p.AC417fs|ZNF33A_ENST00000307441.9_Frame_Shift_Del_p.AC416fs|ZNF33A_ENST00000469037.2_Intron			Q06730	ZN33A_HUMAN	zinc finger protein 33A	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						AATGTAATGCGTGTGGGAAAACTT	0.426																																					p.417_418del		Atlas-INDEL	.											.	ZNF33A	103	.	0			c.1250_1253del						.																																			SO:0001589	frameshift_variant	7581	exon5			.	D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.1248_1251delGTGT	chr10.hg19:g.38344303_38344306delGTGT	ENSP00000387713:p.Ala416fs	108.0	0.0		105.0	45.0	NM_006954	A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Frame_Shift_Del	DEL	ENST00000458705.2	hg19	CCDS31182.1																																																																																			.	.		0.426	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000047614.1	NM_006974	
