#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ERRFI1	54206	hgsc.bcm.edu	37	1	8073831	8073831	+	Silent	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:8073831G>A	ENST00000377482.5	-	4	1051	c.828C>T	c.(826-828)tcC>tcT	p.S276S	ERRFI1_ENST00000474874.1_Intron|ERRFI1_ENST00000467067.1_3'UTR|ERRFI1_ENST00000469499.1_3'UTR	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	276					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		TGTCTTCATCGGAGTTAGGAG	0.473																																					p.S276S		Atlas-SNP	.											.	ERRFI1	42	.	0			c.C828T						.						98.0	101.0	100.0					1																	8073831		2203	4300	6503	SO:0001819	synonymous_variant	54206	exon4			TTCATCGGAGTTA	BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.828C>T	chr1.hg19:g.8073831G>A		161.0	0.0		68.0	44.0	NM_018948	B2RDX9|Q9NTG9|Q9UD05	Silent	SNP	ENST00000377482.5	hg19	CCDS94.1																																																																																			.	.		0.473	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000003617.1	NM_018948	
CDC42	998	hgsc.bcm.edu	37	1	22405002	22405002	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:22405002G>A	ENST00000344548.3	+	3	282	c.31G>A	c.(31-33)Gat>Aat	p.D11N	CDC42_ENST00000421089.2_De_novo_Start_OutOfFrame|CDC42_ENST00000400259.1_Missense_Mutation_p.D11N|CDC42_ENST00000498236.1_3'UTR|CDC42_ENST00000315554.8_Missense_Mutation_p.D11N	NM_001039802.1	NP_001034891.1	P60953	CDC42_HUMAN	cell division cycle 42	11					actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway (GO:0060070)|cardiac conduction system development (GO:0003161)|cellular protein localization (GO:0034613)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell-cell adhesion (GO:0090136)|epithelial-mesenchymal cell signaling (GO:0060684)|establishment of Golgi localization (GO:0051683)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|keratinization (GO:0031424)|keratinocyte development (GO:0003334)|macrophage differentiation (GO:0030225)|multicellular organism growth (GO:0035264)|muscle cell differentiation (GO:0042692)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of gene expression (GO:0010629)|negative regulation of protein complex assembly (GO:0031333)|neuron fate determination (GO:0048664)|nuclear migration (GO:0007097)|nucleus localization (GO:0051647)|organelle transport along microtubule (GO:0072384)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of hair follicle cell proliferation (GO:0071338)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of JNK cascade (GO:0046330)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of synapse structural plasticity (GO:0051835)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of filopodium assembly (GO:0051489)|regulation of mitosis (GO:0007088)|regulation of protein catabolic process (GO:0042176)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein kinase activity (GO:0045859)|regulation of protein stability (GO:0031647)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|sprouting angiogenesis (GO:0002040)|submandibular salivary gland formation (GO:0060661)|substantia nigra development (GO:0021762)|T cell costimulation (GO:0031295)	apical part of cell (GO:0045177)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|spindle midzone (GO:0051233)	apolipoprotein A-I receptor binding (GO:0034191)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(4)	12		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)|Prostate(1639;0.0792)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0452)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.35e-07)|COAD - Colon adenocarcinoma(152;7.73e-06)|GBM - Glioblastoma multiforme(114;8.62e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000649)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00767)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.207)		TGTTGTGGGCGATGGTGCTGT	0.358																																					p.D11N		Atlas-SNP	.											.	CDC42	26	.	0			c.G31A						.						111.0	102.0	105.0					1																	22405002		2203	4300	6503	SO:0001583	missense	998	exon3			GTGGGCGATGGTG	BC018266	CCDS221.1, CCDS222.1	1p36.1	2013-01-17	2013-01-17		ENSG00000070831	ENSG00000070831			1736	protein-coding gene	gene with protein product	"""GTP binding protein, 25kDa"""	116952	"""cell division cycle 42 (GTP-binding protein, 25kD)"", ""cell division cycle 42 (GTP binding protein, 25kDa)"""			2124704, 2122236	Standard	NM_001039802		Approved	G25K, CDC42Hs	uc001bfr.3	P60953	OTTHUMG00000002753	ENST00000344548.3:c.31G>A	chr1.hg19:g.22405002G>A	ENSP00000341072:p.Asp11Asn	103.0	0.0		42.0	27.0	NM_001039802	P21181|P25763|Q7L8R5|Q9UDI2	Missense_Mutation	SNP	ENST00000344548.3	hg19	CCDS221.1	.	.	.	.	.	.	.	.	.	.	g	32	5.190950	0.94923	.	.	ENSG00000070831	ENST00000400259;ENST00000344548;ENST00000315554;ENST00000411827	T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34	4.91	4.91	0.64330	Small GTP-binding protein domain (1);	0.123452	0.64402	D	0.000019	D	0.92580	0.7643	H	0.95712	3.71	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.75020	0.969;0.985;0.917	D	0.94755	0.7931	10	0.72032	D	0.01	.	16.6589	0.85236	0.0:0.0:1.0:0.0	.	11;11;11	B4E1U9;P60953;P60953-1	.;CDC42_HUMAN;.	N	11	ENSP00000383118:D11N;ENSP00000341072:D11N;ENSP00000314458:D11N;ENSP00000398327:D11N	ENSP00000314458:D11N	D	+	1	0	CDC42	22277589	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	9.123000	0.94387	2.287000	0.76781	0.650000	0.86243	GAT	.	.		0.358	CDC42-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000007787.1	NM_001791	
SNIP1	79753	hgsc.bcm.edu	37	1	38006245	38006245	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:38006245A>C	ENST00000296215.6	-	3	511	c.439T>G	c.(439-441)Tcc>Gcc	p.S147A	SNIP1_ENST00000468040.1_5'UTR	NM_024700.3	NP_078976.2	Q8TAD8	SNIP1_HUMAN	Smad nuclear interacting protein 1	147	Arg-rich.				I-kappaB kinase/NF-kappaB signaling (GO:0007249)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	25		Myeloproliferative disorder(586;0.0393)				CTTTGGTGGGAATGGCCCCGG	0.607																																					p.S147A		Atlas-SNP	.											.	SNIP1	44	.	0			c.T439G						.						129.0	132.0	131.0					1																	38006245		2203	4300	6503	SO:0001583	missense	79753	exon3			GGTGGGAATGGCC		CCDS419.1	1p34.3	2010-07-06			ENSG00000163877	ENSG00000163877			30587	protein-coding gene	gene with protein product		608241				10887155, 15378006	Standard	NM_024700		Approved		uc001cbi.4	Q8TAD8	OTTHUMG00000004225	ENST00000296215.6:c.439T>G	chr1.hg19:g.38006245A>C	ENSP00000296215:p.Ser147Ala	83.0	0.0		48.0	20.0	NM_024700	Q96SP9|Q9H9T7	Missense_Mutation	SNP	ENST00000296215.6	hg19	CCDS419.1	.	.	.	.	.	.	.	.	.	.	A	8.391	0.839715	0.16891	.	.	ENSG00000163877	ENST00000296215;ENST00000436196	T	0.13778	2.56	5.25	0.0644	0.14353	.	0.440058	0.25055	N	0.033490	T	0.05410	0.0143	N	0.14661	0.345	0.09310	N	0.999995	B	0.02656	0.0	B	0.04013	0.001	T	0.35151	-0.9800	10	0.19590	T	0.45	-7.4856	2.5092	0.04652	0.5316:0.2299:0.1279:0.1107	.	147	Q8TAD8	SNIP1_HUMAN	A	147;131	ENSP00000296215:S147A	ENSP00000296215:S147A	S	-	1	0	SNIP1	37778832	0.877000	0.30153	0.911000	0.35937	0.461000	0.32589	0.347000	0.20014	-0.147000	0.11254	-0.290000	0.09829	TCC	.	.		0.607	SNIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012169.2	NM_024700	
MACF1	23499	hgsc.bcm.edu	37	1	39789908	39789908	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:39789908A>G	ENST00000372915.3	+	33	4382	c.4295A>G	c.(4294-4296)aAa>aGa	p.K1432R	MACF1_ENST00000539005.1_Missense_Mutation_p.K1432R|MACF1_ENST00000545844.1_Missense_Mutation_p.K1432R|MACF1_ENST00000567887.1_Missense_Mutation_p.K1464R|MACF1_ENST00000361689.2_Missense_Mutation_p.K1432R|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000317713.7_Missense_Mutation_p.K1432R|MACF1_ENST00000564288.1_Missense_Mutation_p.K1427R			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	1432					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GAGAAGGTTAAAGAACTTTTG	0.398																																					p.K1432R		Atlas-SNP	.											.	MACF1	909	.	0			c.A4295G						.						96.0	91.0	93.0					1																	39789908		2203	4300	6503	SO:0001583	missense	23499	exon35			AGGTTAAAGAACT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.4295A>G	chr1.hg19:g.39789908A>G	ENSP00000362006:p.Lys1432Arg	331.0	0.0		200.0	31.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.	.	.	.	.	.	.	.	.	.	A	20.9	4.063129	0.76187	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000530262	T;T;T;T;T;T	0.63580	0.0;-0.05;0.0;-0.03;0.16;1.96	6.16	6.16	0.99307	.	.	.	.	.	T	0.71126	0.3303	M	0.61703	1.905	0.80722	D	1	D;D;B	0.56521	0.976;0.959;0.016	P;P;B	0.59115	0.852;0.488;0.022	T	0.71297	-0.4635	9	0.40728	T	0.16	.	10.762	0.46270	0.9293:0.0:0.0707:0.0	.	1432;1432;1397	F8W8Q1;Q9UPN3-2;Q9UPN3-3	.;.;.	R	1432;1432;1432;1432;1432;1581	ENSP00000439537:K1432R;ENSP00000362006:K1432R;ENSP00000354573:K1432R;ENSP00000313438:K1432R;ENSP00000444364:K1432R;ENSP00000437059:K1581R	ENSP00000313438:K1432R	K	+	2	0	MACF1	39562495	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	5.626000	0.67777	2.367000	0.80283	0.528000	0.53228	AAA	.	.		0.398	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
CTH	1491	hgsc.bcm.edu	37	1	70899550	70899550	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:70899550A>T	ENST00000370938.3	+	9	1061	c.917A>T	c.(916-918)cAg>cTg	p.Q306L	CTH_ENST00000346806.2_Missense_Mutation_p.Q262L|CTH_ENST00000411986.2_Missense_Mutation_p.Q274L	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase	0						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						GTGAAGCGTCAGTGTACAGGT	0.408																																					p.Q306L		Atlas-SNP	.											.	CTH	48	.	0			c.A917T						.						122.0	107.0	112.0					1																	70899550		2203	4300	6503	SO:0001583	missense	1491	exon9			AGCGTCAGTGTAC	BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.917A>T	chr1.hg19:g.70899550A>T	ENSP00000359976:p.Gln306Leu	82.0	0.0		50.0	8.0	NM_001902	O95791|Q9NX42	Missense_Mutation	SNP	ENST00000370938.3	hg19	CCDS650.1	.	.	.	.	.	.	.	.	.	.	A	26.5	4.740552	0.89573	.	.	ENSG00000116761	ENST00000411986;ENST00000370938;ENST00000346806	D;D;D	0.82255	-1.59;-1.59;-1.59	5.01	5.01	0.66863	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.139623	0.53938	D	0.000042	D	0.88444	0.6438	M	0.80422	2.495	0.80722	D	1	P;P;D	0.63046	0.932;0.917;0.992	P;P;D	0.62955	0.708;0.657;0.909	D	0.90431	0.4424	10	0.87932	D	0	-14.7489	14.7337	0.69402	1.0:0.0:0.0:0.0	.	274;262;306	E9PDV0;P32929-2;P32929	.;.;CGL_HUMAN	L	274;306;262	ENSP00000413407:Q274L;ENSP00000359976:Q306L;ENSP00000311554:Q262L	ENSP00000311554:Q262L	Q	+	2	0	CTH	70672138	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.117000	0.94347	2.033000	0.60031	0.529000	0.55759	CAG	.	.		0.408	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025918.1	NM_001902	
CLCA2	9635	hgsc.bcm.edu	37	1	86916392	86916392	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:86916392T>A	ENST00000370565.4	+	12	2293	c.2131T>A	c.(2131-2133)Tat>Aat	p.Y711N	CLCA2_ENST00000498802.1_3'UTR	NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	711					cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		TCATGCTATGTATGTACCAGG	0.438																																					p.Y711N	Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)	Atlas-SNP	.											.	CLCA2	102	.	0			c.T2131A						.						151.0	137.0	142.0					1																	86916392		2203	4300	6503	SO:0001583	missense	9635	exon12			GCTATGTATGTAC		CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.2131T>A	chr1.hg19:g.86916392T>A	ENSP00000359596:p.Tyr711Asn	99.0	0.0		67.0	40.0	NM_006536	A8K2T3|Q9Y6N2	Missense_Mutation	SNP	ENST00000370565.4	hg19	CCDS708.1	.	.	.	.	.	.	.	.	.	.	T	19.55	3.848725	0.71603	.	.	ENSG00000137975	ENST00000370565	T	0.03212	4.01	5.36	4.24	0.50183	.	0.076637	0.53938	D	0.000050	T	0.12817	0.0311	M	0.89968	3.075	0.46542	D	0.999091	D	0.89917	1.0	D	0.87578	0.998	T	0.00855	-1.1539	10	0.66056	D	0.02	-10.3746	10.6832	0.45826	0.0:0.0757:0.0:0.9243	.	711	Q9UQC9	CLCA2_HUMAN	N	711	ENSP00000359596:Y711N	ENSP00000359596:Y711N	Y	+	1	0	CLCA2	86688980	1.000000	0.71417	0.983000	0.44433	0.989000	0.77384	3.442000	0.52900	0.898000	0.36418	0.528000	0.53228	TAT	.	.		0.438	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028284.1	NM_006536	
DENND2C	163259	hgsc.bcm.edu	37	1	115144131	115144131	+	Nonsense_Mutation	SNP	T	T	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:115144131T>A	ENST00000393274.1	-	13	2438	c.1813A>T	c.(1813-1815)Aag>Tag	p.K605*	DENND2C_ENST00000393276.3_Nonsense_Mutation_p.K548*|DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393277.1_Nonsense_Mutation_p.K605*	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	605	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCACTCACCTTTGAAAAAAGA	0.393																																					p.K605X		Atlas-SNP	.											.	DENND2C	105	.	0			c.A1813T						.						216.0	231.0	226.0					1																	115144131		2203	4300	6503	SO:0001587	stop_gained	163259	exon13			TCACCTTTGAAAA		CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.1813A>T	chr1.hg19:g.115144131T>A	ENSP00000376955:p.Lys605*	451.0	0.0		263.0	121.0	NM_001256404	B1AL26|Q5TCX6|Q6P3R3	Nonsense_Mutation	SNP	ENST00000393274.1	hg19	CCDS58018.1	.	.	.	.	.	.	.	.	.	.	T	45	11.909491	0.99616	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	.	.	.	5.54	5.54	0.83059	.	0.046307	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.73	0.77794	0.0:0.0:0.0:1.0	.	.	.	.	X	548;605;605;605	.	ENSP00000358553:K605X	K	-	1	0	DENND2C	114945654	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.403000	0.79983	2.129000	0.65627	0.477000	0.44152	AAG	.	.		0.393	DENND2C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000314822.1	NM_198459	
KCNN3	3782	hgsc.bcm.edu	37	1	154842253	154842253	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:154842253G>T	ENST00000271915.4	-	1	503	c.188C>A	c.(187-189)cCt>cAt	p.P63H	KCNN3_ENST00000358505.2_5'Flank	NM_001204087.1|NM_002249.5	NP_001191016.1|NP_002240.3	Q9UGI6	KCNN3_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3	63	Gln-rich.|Pro-rich.				potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(11)|prostate(4)|skin(1)	28	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)		Miconazole(DB01110)|Procaine(DB00721)	aagctgcggaggctgaggctg	0.697																																					p.P63H		Atlas-SNP	.											.	KCNN3	141	.	0			c.C188A						.						6.0	4.0	5.0					1																	154842253		1984	3925	5909	SO:0001583	missense	3782	exon1			TGCGGAGGCTGAG	AF031815	CCDS1072.1, CCDS30880.1, CCDS72928.1	1q21.3	2012-07-05			ENSG00000143603	ENSG00000143603		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6292	protein-coding gene	gene with protein product		602983				9491810, 16382103	Standard	NM_002249		Approved	KCa2.3, hSK3, SKCA3	uc021pah.1	Q9UGI6	OTTHUMG00000037260	ENST00000271915.4:c.188C>A	chr1.hg19:g.154842253G>T	ENSP00000271915:p.Pro63His	57.0	0.0		75.0	7.0	NM_001204087	B1ANX0|O43517|Q86VF9|Q8WXG7	Missense_Mutation	SNP	ENST00000271915.4	hg19	CCDS30880.1	.	.	.	.	.	.	.	.	.	.	g	11.14	1.552427	0.27739	.	.	ENSG00000143603	ENST00000271915;ENST00000539103	T	0.56275	0.47	5.07	3.18	0.36537	.	1.727610	0.03258	N	0.182822	T	0.18551	0.0445	N	0.08118	0	0.80722	D	1	.	.	.	.	.	.	T	0.11372	-1.0590	8	0.33141	T	0.24	-4.1487	6.4327	0.21807	0.0918:0.0:0.7284:0.1798	.	.	.	.	H	63;158	ENSP00000271915:P63H	ENSP00000271915:P63H	P	-	2	0	KCNN3	153108877	0.863000	0.29885	1.000000	0.80357	0.998000	0.95712	1.873000	0.39558	0.823000	0.34589	0.563000	0.77884	CCT	.	.		0.697	KCNN3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090688.3	NM_002249	
BCAN	63827	hgsc.bcm.edu	37	1	156616637	156616637	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:156616637C>A	ENST00000329117.5	+	3	472	c.136C>A	c.(136-138)Cag>Aag	p.Q46K	RP11-284F21.10_ENST00000605886.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.Q46K|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	46	Ig-like V-type.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CGCGCCACTGCAGGGCGTGCT	0.706																																					p.Q46K		Atlas-SNP	.											.	BCAN	174	.	0			c.C136A						.						15.0	18.0	17.0					1																	156616637		2176	4242	6418	SO:0001583	missense	63827	exon3			CCACTGCAGGGCG	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.136C>A	chr1.hg19:g.156616637C>A	ENSP00000331210:p.Gln46Lys	156.0	0.0		159.0	107.0	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	hg19	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	C	6.116	0.389604	0.11581	.	.	ENSG00000132692	ENST00000441358;ENST00000255029;ENST00000329117;ENST00000457777;ENST00000361588	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	4.41	4.41	0.53225	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.691681	0.13058	N	0.417098	T	0.17789	0.0427	N	0.05230	-0.09	0.09310	N	1	B;B	0.20261	0.043;0.002	B;B	0.20577	0.03;0.012	T	0.11397	-1.0589	10	0.11485	T	0.65	-0.9574	9.7176	0.40284	0.2067:0.7932:0.0:0.0	.	46;46	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	K	46	ENSP00000392731:Q46K;ENSP00000331210:Q46K;ENSP00000389898:Q46K;ENSP00000354925:Q46K	ENSP00000255029:Q46K	Q	+	1	0	BCAN	154883261	0.899000	0.30636	0.950000	0.38849	0.034000	0.12701	1.857000	0.39399	2.272000	0.75746	0.462000	0.41574	CAG	.	.		0.706	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
HMCN1	83872	hgsc.bcm.edu	37	1	185972870	185972870	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:185972870A>G	ENST00000271588.4	+	29	4598	c.4369A>G	c.(4369-4371)Acc>Gcc	p.T1457A	HMCN1_ENST00000367492.2_Missense_Mutation_p.T1457A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1457	Ig-like C2-type 12.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CATAATAGGTACCAACTTCCC	0.438																																					p.T1457A		Atlas-SNP	.											.	HMCN1	797	.	0			c.A4369G						.						168.0	149.0	155.0					1																	185972870		2203	4300	6503	SO:0001583	missense	83872	exon29			ATAGGTACCAACT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.4369A>G	chr1.hg19:g.185972870A>G	ENSP00000271588:p.Thr1457Ala	137.0	0.0		104.0	38.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	A	0.139	-1.104657	0.01828	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.64438	-0.1;-0.09	5.86	2.99	0.34606	Immunoglobulin-like (1);	0.270150	0.42964	N	0.000631	T	0.28896	0.0717	N	0.02296	-0.605	0.32626	N	0.522626	B	0.02656	0.0	B	0.04013	0.001	T	0.36089	-0.9762	10	0.05525	T	0.97	.	9.3547	0.38159	0.2239:0.0:0.7761:0.0	.	1457	Q96RW7	HMCN1_HUMAN	A	1457	ENSP00000271588:T1457A;ENSP00000356462:T1457A	ENSP00000271588:T1457A	T	+	1	0	HMCN1	184239493	1.000000	0.71417	0.840000	0.33206	0.336000	0.28762	2.370000	0.44240	0.388000	0.25054	-0.248000	0.11899	ACC	.	.		0.438	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMCN1	83872	hgsc.bcm.edu	37	1	185988695	185988695	+	Silent	SNP	A	A	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:185988695A>G	ENST00000271588.4	+	35	5722	c.5493A>G	c.(5491-5493)tcA>tcG	p.S1831S	HMCN1_ENST00000367492.2_Silent_p.S1831S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1831	Ig-like C2-type 16.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCAAGTCCTCAGGCCTTTCTG	0.423																																					p.S1831S		Atlas-SNP	.											.	HMCN1	797	.	0			c.A5493G						.						101.0	102.0	101.0					1																	185988695		2203	4299	6502	SO:0001819	synonymous_variant	83872	exon35			GTCCTCAGGCCTT	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5493A>G	chr1.hg19:g.185988695A>G		107.0	0.0		92.0	23.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.423	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
HMCN1	83872	hgsc.bcm.edu	37	1	186157140	186157140	+	Splice_Site	SNP	G	G	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:186157140G>C	ENST00000271588.4	+	106	16769	c.16540G>C	c.(16540-16542)Ggg>Cgg	p.G5514R	HMCN1_ENST00000367492.2_Splice_Site_p.G5397R	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	5514					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TCCTGTTTCAGGGTATGTCTT	0.478																																					p.G5514R		Atlas-SNP	.											.	HMCN1	797	.	0			c.G16540C						.						303.0	227.0	253.0					1																	186157140		2203	4300	6503	SO:0001630	splice_region_variant	83872	exon106			GTTTCAGGGTATG	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.16541+1G>C	chr1.hg19:g.186157140G>C		99.0	0.0		99.0	17.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	ENST00000271588.4	hg19	CCDS30956.1	.	.	.	.	.	.	.	.	.	.	G	32	5.160114	0.94727	.	.	ENSG00000143341	ENST00000271588;ENST00000367492;ENST00000414277	D;D;D	0.87412	-2.25;-2.25;-2.25	5.71	5.71	0.89125	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.90501	0.7024	L	0.50333	1.59	0.49798	D	0.999824	D	0.69078	0.997	P	0.57057	0.812	D	0.90424	0.4419	10	0.56958	D	0.05	.	19.8772	0.96880	0.0:0.0:1.0:0.0	.	5514	Q96RW7	HMCN1_HUMAN	R	5514;5397;189	ENSP00000271588:G5514R;ENSP00000356462:G5397R;ENSP00000406205:G189R	ENSP00000271588:G5514R	G	+	1	0	HMCN1	184423763	1.000000	0.71417	0.964000	0.40570	0.835000	0.47333	8.000000	0.88501	2.686000	0.91538	0.650000	0.86243	GGG	.	.		0.478	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	Missense_Mutation
LAMB3	3914	hgsc.bcm.edu	37	1	209796353	209796353	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr1:209796353C>T	ENST00000356082.4	-	17	2664	c.2530G>A	c.(2530-2532)Gcc>Acc	p.A844T	LAMB3_ENST00000367030.3_Missense_Mutation_p.A844T|LAMB3_ENST00000391911.1_Missense_Mutation_p.A844T|MIR4260_ENST00000583107.1_RNA	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	844	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TGGAGCTGGGCATTGAAGCCC	0.672																																					p.A844T		Atlas-SNP	.											.	LAMB3	136	.	0			c.G2530A						.						65.0	77.0	73.0					1																	209796353		2203	4299	6502	SO:0001583	missense	3914	exon17			GCTGGGCATTGAA	D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.2530G>A	chr1.hg19:g.209796353C>T	ENSP00000348384:p.Ala844Thr	137.0	0.0		131.0	46.0	NM_000228	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	ENST00000356082.4	hg19	CCDS1487.1	.	.	.	.	.	.	.	.	.	.	C	7.810	0.715425	0.15306	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030	T;T;T	0.21361	2.01;2.01;2.01	5.21	-6.23	0.02052	.	0.891913	0.09984	N	0.730574	T	0.08088	0.0202	N	0.20685	0.6	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.35674	-0.9779	10	0.14252	T	0.57	.	2.0835	0.03640	0.24:0.1972:0.0966:0.4662	.	844	Q13751	LAMB3_HUMAN	T	844	ENSP00000375778:A844T;ENSP00000348384:A844T;ENSP00000355997:A844T	ENSP00000348384:A844T	A	-	1	0	LAMB3	207862976	0.000000	0.05858	0.001000	0.08648	0.600000	0.36913	-1.075000	0.03423	-1.857000	0.01159	0.456000	0.33151	GCC	.	.		0.672	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088525.2	NM_000228	
SIX3	6496	hgsc.bcm.edu	37	2	45171797	45171797	+	Silent	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr2:45171797G>A	ENST00000260653.3	+	2	1239	c.897G>A	c.(895-897)acG>acA	p.T299T	SIX3-AS1_ENST00000419364.1_RNA	NM_005413.3	NP_005404.1	O95343	SIX3_HUMAN	SIX homeobox 3	299					brain development (GO:0007420)|circadian behavior (GO:0048512)|diencephalon development (GO:0021536)|eye development (GO:0001654)|forebrain anterior/posterior pattern specification (GO:0021797)|forebrain dorsal/ventral pattern formation (GO:0021798)|lens induction in camera-type eye (GO:0060235)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|protein import into nucleus (GO:0006606)|telencephalon development (GO:0021537)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|transcription corepressor binding (GO:0001222)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|skin(1)	11		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				CGCCGTCCACGGCGGCCAGCC	0.697																																					p.T299T		Atlas-SNP	.											.	SIX3	24	.	0			c.G897A						.						9.0	11.0	10.0					2																	45171797		1976	3947	5923	SO:0001819	synonymous_variant	6496	exon2			GTCCACGGCGGCC	AF092047	CCDS1821.1	2p21	2011-06-20	2007-07-13		ENSG00000138083	ENSG00000138083		"""Homeoboxes / SINE class"""	10889	protein-coding gene	gene with protein product		603714	"""holoprosencephaly 2, alobar or semilobar"", ""sine oculis homeobox homolog 3 (Drosophila)"""	HPE2		9889003, 10369266	Standard	NM_005413		Approved		uc002run.2	O95343	OTTHUMG00000152424	ENST00000260653.3:c.897G>A	chr2.hg19:g.45171797G>A		322.0	0.0		205.0	43.0	NM_005413	D6W5A5|Q53T42	Silent	SNP	ENST00000260653.3	hg19	CCDS1821.1																																																																																			.	.		0.697	SIX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326192.1	NM_005413	
FN1	2335	hgsc.bcm.edu	37	2	216273051	216273051	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr2:216273051T>C	ENST00000359671.1	-	16	2663	c.2398A>G	c.(2398-2400)Agt>Ggt	p.S800G	FN1_ENST00000323926.6_Missense_Mutation_p.S800G|FN1_ENST00000432072.2_Missense_Mutation_p.S800G|FN1_ENST00000336916.4_Missense_Mutation_p.S800G|FN1_ENST00000346544.3_Missense_Mutation_p.S800G|FN1_ENST00000357009.2_Missense_Mutation_p.S800G|FN1_ENST00000421182.1_Missense_Mutation_p.S800G|FN1_ENST00000345488.5_Missense_Mutation_p.S800G|FN1_ENST00000357867.4_Missense_Mutation_p.S800G|FN1_ENST00000446046.1_Missense_Mutation_p.S800G|FN1_ENST00000443816.1_Missense_Mutation_p.S800G|FN1_ENST00000356005.4_Missense_Mutation_p.S800G|FN1_ENST00000354785.4_Missense_Mutation_p.S800G			P02751	FINC_HUMAN	fibronectin 1	800	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	AGGATCAAACTCTGCTCCCCA	0.428																																					p.S800G		Atlas-SNP	.											.	FN1	521	.	0			c.A2398G						.						119.0	117.0	117.0					2																	216273051		2203	4300	6503	SO:0001583	missense	2335	exon16			TCAAACTCTGCTC		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.2398A>G	chr2.hg19:g.216273051T>C	ENSP00000352696:p.Ser800Gly	270.0	0.0		197.0	72.0	NM_212476	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.82	2.650492	0.47362	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005	T;T;T;T;T;T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.93	5.93	0.95920	.	0.277250	0.35838	N	0.002943	T	0.45736	0.1357	N	0.14661	0.345	0.40349	D	0.979118	D;B;P;B;P;B;B;B;B;P	0.56287	0.975;0.18;0.901;0.03;0.507;0.036;0.108;0.03;0.03;0.774	P;B;B;B;B;B;B;B;B;B	0.54174	0.744;0.082;0.323;0.018;0.138;0.035;0.134;0.018;0.018;0.129	T	0.41662	-0.9496	10	0.23891	T	0.37	.	11.4213	0.49982	0.0:0.0698:0.0:0.9302	.	800;800;800;800;800;800;800;800;800;800	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	G	800	ENSP00000394423:S800G;ENSP00000323534:S800G;ENSP00000338200:S800G;ENSP00000350534:S800G;ENSP00000346839:S800G;ENSP00000352696:S800G;ENSP00000265312:S800G;ENSP00000273049:S800G;ENSP00000349509:S800G;ENSP00000410422:S800G;ENSP00000415018:S800G;ENSP00000399538:S800G;ENSP00000348285:S800G	ENSP00000265313:S800G	S	-	1	0	FN1	215981296	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	3.967000	0.56802	2.271000	0.75665	0.533000	0.62120	AGT	.	.		0.428	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
ANKMY1	51281	hgsc.bcm.edu	37	2	241463326	241463326	+	Missense_Mutation	SNP	C	C	T	rs373595407		TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr2:241463326C>T	ENST00000272972.3	-	7	1755	c.1541G>A	c.(1540-1542)cGg>cAg	p.R514Q	ANKMY1_ENST00000373318.2_Missense_Mutation_p.R373Q|ANKMY1_ENST00000405523.3_Missense_Mutation_p.R373Q|ANKMY1_ENST00000405002.1_Missense_Mutation_p.R284Q|ANKMY1_ENST00000403283.1_Missense_Mutation_p.R452Q|ANKMY1_ENST00000406958.1_Missense_Mutation_p.R275Q|ANKMY1_ENST00000401804.1_Missense_Mutation_p.R603Q|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000391987.1_Missense_Mutation_p.R514Q|ANKMY1_ENST00000536462.1_Missense_Mutation_p.R326Q|ANKMY1_ENST00000373320.4_Missense_Mutation_p.R284Q|ANKMY1_ENST00000361678.4_Missense_Mutation_p.R373Q	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	514							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		CGCCATCCTCCGCATGGTCCC	0.627																																					p.R514Q		Atlas-SNP	.											.	ANKMY1	112	.	0			c.G1541A						.	C	GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	51.0	50.0	50.0		1541,1118	2.2	0.0	2		50	0,8600		0,0,4300	no	missense,missense	ANKMY1	NM_016552.2,NM_017844.2	43,43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	514/942,373/718	241463326	1,13005	2203	4300	6503	SO:0001583	missense	51281	exon7			ATCCTCCGCATGG	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1541G>A	chr2.hg19:g.241463326C>T	ENSP00000272972:p.Arg514Gln	52.0	0.0		41.0	19.0	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	hg19	CCDS2536.1	.	.	.	.	.	.	.	.	.	.	C	12.62	1.993217	0.35131	2.27E-4	0.0	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T;T	0.67698	-0.28;-0.28;0.32;-0.28;0.32;-0.28;2.24;0.29;0.23;1.76;0.74	4.06	2.21	0.28008	Ankyrin repeat-containing domain (1);	0.161766	0.37623	N	0.002018	T	0.69006	0.3063	L	0.36672	1.1	0.09310	N	1	D;D;D;D;D;D;D	0.89917	1.0;0.989;1.0;0.957;1.0;1.0;1.0	D;P;D;B;D;D;D	0.87578	0.998;0.578;0.988;0.178;0.967;0.995;0.998	T	0.57142	-0.7862	10	0.44086	T	0.13	-19.3592	7.2496	0.26142	0.0:0.7962:0.0:0.2038	.	514;326;284;373;275;373;514	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;B5MBY4;Q9P2S6-2;Q9P2S6	.;.;.;.;.;.;ANKY1_HUMAN	Q	373;275;514;373;514;284;452;603;326;373;284	ENSP00000362415:R373Q;ENSP00000384555:R275Q;ENSP00000272972:R514Q;ENSP00000355097:R373Q;ENSP00000375847:R514Q;ENSP00000362417:R284Q;ENSP00000383968:R452Q;ENSP00000385887:R603Q;ENSP00000444707:R326Q;ENSP00000385635:R373Q;ENSP00000385145:R284Q	ENSP00000272972:R514Q	R	-	2	0	ANKMY1	241111999	0.140000	0.22579	0.005000	0.12908	0.021000	0.10359	2.010000	0.40913	0.439000	0.26476	0.491000	0.48974	CGG	.	.		0.627	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
RTP5	285093	hgsc.bcm.edu	37	2	242815105	242815105	+	Silent	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr2:242815105G>A	ENST00000343216.3	+	2	1426	c.1398G>A	c.(1396-1398)acG>acA	p.T466T		NM_173821.2	NP_776182.2																					GCCCCATCACGGTTAGTGAGG	0.612																																					p.T466T		Atlas-SNP	.											C2orf85,NS,carcinoma,0,1	.	.	.	0			c.G1398A						.						59.0	67.0	65.0					2																	242815105		2047	4184	6231	SO:0001819	synonymous_variant	285093	exon2			CATCACGGTTAGT																												ENST00000343216.3:c.1398G>A	chr2.hg19:g.242815105G>A		82.0	0.0		53.0	19.0	NM_173821		Silent	SNP	ENST00000343216.3	hg19	CCDS42843.1																																																																																			.	.		0.612	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322310.1		
FYCO1	79443	hgsc.bcm.edu	37	3	45977942	45977942	+	Silent	SNP	C	C	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr3:45977942C>A	ENST00000296137.2	-	15	4243	c.4038G>T	c.(4036-4038)ctG>ctT	p.L1346L	FYCO1_ENST00000535325.1_Silent_p.L1366L|FYCO1_ENST00000438446.1_Silent_p.L17L	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1346	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		CCACTTACATCAGTTCTCCAG	0.597																																					p.L1346L		Atlas-SNP	.											.	FYCO1	115	.	0			c.G4038T						.						113.0	107.0	109.0					3																	45977942		2203	4300	6503	SO:0001819	synonymous_variant	79443	exon15			TTACATCAGTTCT	AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.4038G>T	chr3.hg19:g.45977942C>A		99.0	0.0		58.0	32.0	NM_024513	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Silent	SNP	ENST00000296137.2	hg19	CCDS2734.1	.	.	.	.	.	.	.	.	.	.	C	8.724	0.915126	0.17907	.	.	ENSG00000163820	ENST00000433878	.	.	.	5.54	0.693	0.18056	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-26.5402	4.5323	0.12011	0.1004:0.4478:0.2966:0.1552	.	.	.	.	L	135	.	.	X	-	2	2	FYCO1	45952946	0.998000	0.40836	0.939000	0.37840	0.786000	0.44442	0.470000	0.22084	-0.323000	0.08602	-2.462000	0.00205	TGA	.	.		0.597	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257320.2	NM_024513	
HGD	3081	hgsc.bcm.edu	37	3	120369681	120369681	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr3:120369681A>T	ENST00000283871.5	-	6	833	c.374T>A	c.(373-375)aTa>aAa	p.I125K	HGD_ENST00000488183.1_5'Flank	NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	125					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		GTTAGACTTTATGTCTCCAGC	0.512																																					p.I125K		Atlas-SNP	.											.	HGD	65	.	0			c.T374A						.						180.0	161.0	167.0					3																	120369681		2203	4296	6499	SO:0001583	missense	3081	exon6			GACTTTATGTCTC		CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.374T>A	chr3.hg19:g.120369681A>T	ENSP00000283871:p.Ile125Lys	114.0	0.0		84.0	21.0	NM_000187	A8K417|B2R8Z0	Missense_Mutation	SNP	ENST00000283871.5	hg19	CCDS3000.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.461726	0.63513	.	.	ENSG00000113924	ENST00000283871;ENST00000476082	D;D	0.98901	-5.22;-5.22	6.06	4.9	0.64082	Cupin, RmlC-type (1);	0.300334	0.35739	N	0.003014	D	0.96210	0.8764	L	0.29908	0.895	0.49483	D	0.999799	B	0.10296	0.003	B	0.30855	0.121	D	0.93226	0.6613	10	0.66056	D	0.02	-33.6709	8.1307	0.31024	0.8459:0.0:0.1541:0.0	.	125	Q93099	HGD_HUMAN	K	125;84	ENSP00000283871:I125K;ENSP00000419560:I84K	ENSP00000283871:I125K	I	-	2	0	HGD	121852371	1.000000	0.71417	0.984000	0.44739	0.978000	0.69477	4.540000	0.60664	2.323000	0.78572	0.528000	0.53228	ATA	.	.		0.512	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355410.1		
CCDC37	348807	hgsc.bcm.edu	37	3	126153141	126153141	+	Missense_Mutation	SNP	T	T	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr3:126153141T>G	ENST00000352312.1	+	15	1644	c.1545T>G	c.(1543-1545)gaT>gaG	p.D515E	CCDC37_ENST00000393425.1_Missense_Mutation_p.D516E|CCDC37_ENST00000506204.1_3'UTR|CCDC37_ENST00000505024.1_Missense_Mutation_p.D516E	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	515										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		ACCAGCTGGATGAGCTGCTAG	0.617																																					p.D515E		Atlas-SNP	.											.	CCDC37	69	.	0			c.T1545G						.						69.0	64.0	66.0					3																	126153141		2203	4300	6503	SO:0001583	missense	348807	exon15			GCTGGATGAGCTG	AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1545T>G	chr3.hg19:g.126153141T>G	ENSP00000344749:p.Asp515Glu	278.0	0.0		178.0	53.0	NM_182628	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	ENST00000352312.1	hg19	CCDS3037.1	.	.	.	.	.	.	.	.	.	.	T	12.41	1.930957	0.34096	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.20598	2.06;2.07;2.07	5.08	-7.49	0.01355	.	0.971544	0.08538	N	0.930996	T	0.16257	0.0391	N	0.20483	0.58	0.18873	N	0.999983	D;D	0.71674	0.998;0.996	D;P	0.63381	0.914;0.822	T	0.08597	-1.0714	10	0.02654	T	1	-10.463	6.7391	0.23424	0.1002:0.1239:0.0997:0.6762	.	516;515	Q494V2-2;Q494V2	.;CCD37_HUMAN	E	515;516;516	ENSP00000344749:D515E;ENSP00000377076:D516E;ENSP00000423046:D516E	ENSP00000344749:D515E	D	+	3	2	CCDC37	127635831	0.000000	0.05858	0.230000	0.23976	0.875000	0.50365	-2.459000	0.01000	-1.592000	0.01619	-0.353000	0.07706	GAT	.	.		0.617	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4	NM_182628	
MCF2L2	23101	hgsc.bcm.edu	37	3	183017980	183017980	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr3:183017980G>C	ENST00000328913.3	-	11	1415	c.1118C>G	c.(1117-1119)cCc>cGc	p.P373R	MCF2L2_ENST00000447025.2_Missense_Mutation_p.P373R|MCF2L2_ENST00000473233.1_Missense_Mutation_p.P373R|MCF2L2_ENST00000414362.2_Missense_Mutation_p.P373R	NM_015078.2	NP_055893	Q86YR7	MF2L2_HUMAN	MCF.2 cell line derived transforming sequence-like 2	373				P -> S (in Ref. 4; AAO19651 and 5; BAA74884). {ECO:0000305}.			Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(25)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CTTTTCCAGGGGCTCCTGCAA	0.602																																					p.P373R		Atlas-SNP	.											.	MCF2L2	164	.	0			c.C1118G						.						35.0	35.0	35.0					3																	183017980		2203	4300	6503	SO:0001583	missense	23101	exon11			TCCAGGGGCTCCT	AB020668	CCDS3243.1	3q27	2012-07-24			ENSG00000053524	ENSG00000053524		"""Rho guanine nucleotide exchange factors"""	30319	protein-coding gene	gene with protein product							Standard	NM_015078		Approved	KIAA0861, ARHGEF22	uc003fli.1	Q86YR7	OTTHUMG00000158388	ENST00000328913.3:c.1118C>G	chr3.hg19:g.183017980G>C	ENSP00000328118:p.Pro373Arg	50.0	0.0		42.0	13.0	NM_015078	O94942|Q6P2B8|Q6ZVJ5|Q8N318	Missense_Mutation	SNP	ENST00000328913.3	hg19	CCDS3243.1	.	.	.	.	.	.	.	.	.	.	G	2.327	-0.354383	0.05173	.	.	ENSG00000053524	ENST00000328913;ENST00000473233;ENST00000447025;ENST00000414362	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	4.59	4.59	0.56863	.	0.646275	0.15244	N	0.272701	T	0.25827	0.0629	L	0.57536	1.79	0.09310	N	1	P;P	0.44877	0.568;0.845	B;B	0.41988	0.242;0.372	T	0.10314	-1.0635	10	0.16896	T	0.51	.	11.1317	0.48351	0.0846:0.0:0.9154:0.0	.	373;373	Q86YR7-2;Q86YR7	.;MF2L2_HUMAN	R	373	ENSP00000328118:P373R;ENSP00000420070:P373R;ENSP00000388190:P373R;ENSP00000414131:P373R	ENSP00000328118:P373R	P	-	2	0	MCF2L2	184500674	0.660000	0.27420	0.486000	0.27416	0.239000	0.25481	2.971000	0.49248	2.369000	0.80426	0.655000	0.94253	CCC	.	.		0.602	MCF2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350868.1	NM_015078	
DDX46	9879	hgsc.bcm.edu	37	5	134147507	134147507	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr5:134147507A>G	ENST00000354283.4	+	18	2543	c.2408A>G	c.(2407-2409)gAt>gGt	p.D803G	DDX46_ENST00000452510.2_Missense_Mutation_p.D803G			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	803					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGTCTACAAGATTCAGATGAT	0.378																																					p.D803G	Colon(13;391 453 4901 21675 24897)	Atlas-SNP	.											.	DDX46	77	.	0			c.A2408G						.						127.0	129.0	129.0					5																	134147507		2203	4300	6503	SO:0001583	missense	9879	exon18			TACAAGATTCAGA		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.2408A>G	chr5.hg19:g.134147507A>G	ENSP00000346236:p.Asp803Gly	179.0	0.0		86.0	20.0	NM_014829	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	ENST00000354283.4	hg19	CCDS34240.1	.	.	.	.	.	.	.	.	.	.	A	16.82	3.228526	0.58777	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.27890	1.64;1.65	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.32010	0.0815	L	0.54965	1.715	0.80722	D	1	B	0.18461	0.028	B	0.19148	0.024	T	0.08006	-1.0743	10	0.46703	T	0.11	-24.9048	15.1303	0.72517	1.0:0.0:0.0:0.0	.	803	Q7L014	DDX46_HUMAN	G	803	ENSP00000416534:D803G;ENSP00000346236:D803G	ENSP00000346236:D803G	D	+	2	0	DDX46	134175406	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.287000	0.95975	2.031000	0.59945	0.402000	0.26972	GAT	.	.		0.378	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
PCDHGB1	56104	hgsc.bcm.edu	37	5	140730929	140730929	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr5:140730929C>T	ENST00000523390.1	+	1	1102	c.1102C>T	c.(1102-1104)Cga>Tga	p.R368*	PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018922.2|NM_032095.1	NP_061745.1|NP_115266.1	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1	368	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R368*(4)		central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATAAAAGTGCGAGACAAGGA	0.433																																					p.R368X		Atlas-SNP	.											PCDHGB1_ENST00000523390,NS,carcinoma,-1,4	PCDHGB1	198	.	4	Substitution - Nonsense(4)	large_intestine(4)	c.C1102T						.						43.0	42.0	42.0					5																	140730929		1908	4124	6032	SO:0001587	stop_gained	56104	exon1			AAAGTGCGAGACA	AF152517	CCDS54923.1, CCDS75330.1	5q31	2010-01-26				ENSG00000254221		"""Cadherins / Protocadherins : Clustered"""	8708	other	protocadherin	"""protocadherin gamma subfamily B, 1, isoform 2"""	606299				10380929	Standard	NM_018922		Approved	PCDH-GAMMA-B1		Q9Y5G3		ENST00000523390.1:c.1102C>T	chr5.hg19:g.140730929C>T	ENSP00000429273:p.Arg368*	81.0	0.0		48.0	28.0	NM_018922	Q3SY75|Q9Y5C8	Nonsense_Mutation	SNP	ENST00000523390.1	hg19	CCDS54923.1	.	.	.	.	.	.	.	.	.	.	.	23.2	4.385450	0.82792	.	.	ENSG00000254221	ENST00000523390	.	.	.	5.49	-1.73	0.08081	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	11.1443	0.48422	0.6713:0.2645:0.0:0.0642	.	.	.	.	X	368	.	ENSP00000429273:R368X	R	+	1	2	PCDHGB1	140711113	0.000000	0.05858	0.001000	0.08648	0.996000	0.88848	-3.032000	0.00637	-0.205000	0.10219	0.563000	0.77884	CGA	.	.		0.433	PCDHGB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374740.1	NM_018922	
DOCK2	1794	hgsc.bcm.edu	37	5	169412861	169412861	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr5:169412861C>A	ENST00000256935.8	+	29	3008	c.2928C>A	c.(2926-2928)ttC>ttA	p.F976L	DOCK2_ENST00000520908.1_Missense_Mutation_p.F468L|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.F37L	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	976	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCATCATGTTCAAGGACCTCA	0.468																																					p.F976L		Atlas-SNP	.											.	DOCK2	389	.	0			c.C2928A						.						257.0	239.0	245.0					5																	169412861		2203	4300	6503	SO:0001583	missense	1794	exon29			CATGTTCAAGGAC	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2928C>A	chr5.hg19:g.169412861C>A	ENSP00000256935:p.Phe976Leu	93.0	0.0		54.0	11.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.312575	0.81358	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.25085	1.82;1.82;1.82	5.19	3.38	0.38709	.	0.000000	0.85682	D	0.000000	T	0.45256	0.1333	M	0.76328	2.33	0.44611	D	0.997581	D;D	0.67145	0.996;0.982	D;D	0.70227	0.968;0.952	T	0.27872	-1.0061	10	0.33940	T	0.23	.	10.4257	0.44375	0.0:0.8124:0.0:0.1876	.	468;976	E7ERW7;Q92608	.;DOCK2_HUMAN	L	976;468;37	ENSP00000256935:F976L;ENSP00000429283:F468L;ENSP00000438827:F37L	ENSP00000256935:F976L	F	+	3	2	DOCK2	169345439	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	0.925000	0.28791	2.426000	0.82243	0.561000	0.74099	TTC	.	.		0.468	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
SLC44A4	80736	hgsc.bcm.edu	37	6	31842544	31842544	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr6:31842544T>C	ENST00000229729.6	-	6	442	c.422A>G	c.(421-423)tAt>tGt	p.Y141C	SLC44A4_ENST00000544672.1_Missense_Mutation_p.Y65C|SLC44A4_ENST00000375562.4_Intron|SLC44A4_ENST00000465707.1_5'UTR	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	141					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	GTTTTTTGTATAGAAGACTTC	0.527																																					p.Y141C		Atlas-SNP	.											.	SLC44A4	67	.	0			c.A422G						.						72.0	70.0	71.0					6																	31842544		2203	4300	6503	SO:0001583	missense	80736	exon6			TTTGTATAGAAGA	AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.422A>G	chr6.hg19:g.31842544T>C	ENSP00000229729:p.Tyr141Cys	157.0	0.0		104.0	53.0	NM_025257	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	ENST00000229729.6	hg19	CCDS4724.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.98|15.98	2.991913|2.991913	0.54041|0.54041	.|.	.|.	ENSG00000204385|ENSG00000204385	ENST00000414427|ENST00000229729;ENST00000544672	.|T;T	.|0.56776	.|0.44;0.44	4.63|4.63	2.09|2.09	0.27110|0.27110	.|.	.|0.148255	.|0.29814	.|N	.|0.011136	T|T	0.35740|0.35740	0.0942|0.0942	L|L	0.61036|0.61036	1.89|1.89	0.35590|0.35590	D|D	0.806972|0.806972	.|P	.|0.36010	.|0.532	.|B	.|0.42087	.|0.375	T|T	0.15435|0.15435	-1.0437|-1.0437	5|10	.|0.39692	.|T	.|0.17	-26.2564|-26.2564	8.8061|8.8061	0.34938|0.34938	0.0:0.0:0.3674:0.6326|0.0:0.0:0.3674:0.6326	.|.	.|141	.|Q53GD3	.|CTL4_HUMAN	V|C	137|141;65	.|ENSP00000229729:Y141C;ENSP00000444109:Y65C	.|ENSP00000229729:Y141C	I|Y	-|-	1|2	0|0	SLC44A4|SLC44A4	31950523|31950523	0.847000|0.847000	0.29606|0.29606	0.351000|0.351000	0.25721|0.25721	0.773000|0.773000	0.43773|0.43773	1.253000|1.253000	0.32886|0.32886	0.329000|0.329000	0.23460|0.23460	0.533000|0.533000	0.62120|0.62120	ATA|TAT	.	.		0.527	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076234.3		
BMP5	653	hgsc.bcm.edu	37	6	55623820	55623820	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr6:55623820C>T	ENST00000370830.3	-	6	1896	c.1198G>A	c.(1198-1200)Gct>Act	p.A400T	BMP5_ENST00000446683.2_Intron	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	400					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TGAACTATAGCGTGGTTGGTG	0.378																																					p.A400T		Atlas-SNP	.											.	BMP5	94	.	0			c.G1198A						.						160.0	151.0	154.0					6																	55623820		2203	4300	6503	SO:0001583	missense	653	exon6			CTATAGCGTGGTT		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.1198G>A	chr6.hg19:g.55623820C>T	ENSP00000359866:p.Ala400Thr	108.0	0.0		85.0	40.0	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	hg19	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576608	0.86645	.	.	ENSG00000112175	ENST00000370830	D	0.86497	-2.13	5.67	5.67	0.87782	Transforming growth factor-beta, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.94315	0.8173	M	0.87328	2.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94278	0.7517	10	0.87932	D	0	.	20.1272	0.97986	0.0:1.0:0.0:0.0	.	400	P22003	BMP5_HUMAN	T	400	ENSP00000359866:A400T	ENSP00000359866:A400T	A	-	1	0	BMP5	55731779	1.000000	0.71417	1.000000	0.80357	0.310000	0.27922	7.776000	0.85560	2.828000	0.97474	0.655000	0.94253	GCT	.	.		0.378	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
HTR1E	3354	hgsc.bcm.edu	37	6	87725376	87725376	+	Nonsense_Mutation	SNP	C	C	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr6:87725376C>A	ENST00000305344.5	+	2	1027	c.324C>A	c.(322-324)tgC>tgA	p.C108*		NM_000865.2	NP_000856.1	P28566	5HT1E_HUMAN	5-hydroxytryptamine (serotonin) receptor 1E, G protein-coupled	108					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(3)|endometrium(2)|kidney(3)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(3)	41		all_cancers(76;7.11e-06)|Acute lymphoblastic leukemia(125;1.2e-09)|Prostate(29;3.51e-09)|all_hematologic(105;7.43e-06)|all_epithelial(107;0.00819)		BRCA - Breast invasive adenocarcinoma(108;0.055)	Aripiprazole(DB01238)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Loxapine(DB00408)|Methysergide(DB00247)|Olanzapine(DB00334)|Quetiapine(DB01224)|Ziprasidone(DB00246)	GCTGCACCTGCTCCATCCTCC	0.562																																					p.C108X		Atlas-SNP	.											.	HTR1E	89	.	0			c.C324A						.						126.0	101.0	109.0					6																	87725376		2203	4300	6503	SO:0001587	stop_gained	3354	exon2			CACCTGCTCCATC		CCDS5006.1	6q14-q15	2013-06-19	2012-02-03		ENSG00000168830	ENSG00000168830		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5291	protein-coding gene	gene with protein product		182132	"""5-hydroxytryptamine (serotonin) receptor 1E"""			1608964	Standard	NM_000865		Approved	5-HT1E	uc003pli.3	P28566	OTTHUMG00000015154	ENST00000305344.5:c.324C>A	chr6.hg19:g.87725376C>A	ENSP00000307766:p.Cys108*	119.0	0.0		67.0	22.0	NM_000865	E1P503|Q9P1Y1	Nonsense_Mutation	SNP	ENST00000305344.5	hg19	CCDS5006.1	.	.	.	.	.	.	.	.	.	.	C	38	6.914581	0.97932	.	.	ENSG00000168830	ENST00000305344;ENST00000369584	.	.	.	4.57	1.19	0.21007	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	5.8317	0.18584	0.0:0.3137:0.0:0.6863	.	.	.	.	X	108	.	ENSP00000307766:C108X	C	+	3	2	HTR1E	87782095	0.994000	0.37717	1.000000	0.80357	0.989000	0.77384	0.328000	0.19681	0.360000	0.24265	0.404000	0.27445	TGC	.	.		0.562	HTR1E-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000472488.2	NM_000865	
NR2E1	7101	hgsc.bcm.edu	37	6	108492696	108492696	+	Silent	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr6:108492696C>T	ENST00000368986.4	+	2	768	c.60C>T	c.(58-60)ggC>ggT	p.G20G	NR2E1_ENST00000368983.3_Silent_p.G57G	NM_003269.3	NP_003260.1	Q9Y466	NR2E1_HUMAN	nuclear receptor subfamily 2, group E, member 1	20					aggressive behavior (GO:0002118)|amygdala development (GO:0021764)|anterior commissure morphogenesis (GO:0021960)|behavioral fear response (GO:0001662)|cell fate commitment (GO:0045165)|cerebral cortex neuron differentiation (GO:0021895)|dentate gyrus development (GO:0021542)|extracellular matrix organization (GO:0030198)|forebrain generation of neurons (GO:0021872)|gene expression (GO:0010467)|glial cell migration (GO:0008347)|layer formation in cerebral cortex (GO:0021819)|long-term synaptic potentiation (GO:0060291)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|olfactory bulb development (GO:0021772)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle (GO:0045787)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of stem cell proliferation (GO:2000648)|regulation of cell migration involved in sprouting angiogenesis (GO:0090049)|regulation of dendrite morphogenesis (GO:0048814)|regulation of timing of neuron differentiation (GO:0060164)|retina development in camera-type eye (GO:0060041)|social behavior (GO:0035176)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|visual perception (GO:0007601)	nucleoplasm (GO:0005654)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(16)|prostate(1)|skin(3)	30		all_cancers(87;8.13e-05)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00866)|Colorectal(196;0.0637)		BRCA - Breast invasive adenocarcinoma(108;0.013)|Epithelial(106;0.0521)|all cancers(137;0.068)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)		AAGTGTGTGGCGACCGCAGCT	0.577																																					p.G20G		Atlas-SNP	.											.	NR2E1	57	.	0			c.C60T						.						126.0	135.0	132.0					6																	108492696		2203	4300	6503	SO:0001819	synonymous_variant	7101	exon2			GTGTGGCGACCGC	Y13276	CCDS5063.1, CCDS69165.1	6q21	2013-01-16			ENSG00000112333	ENSG00000112333		"""Nuclear hormone receptors"""	7973	protein-coding gene	gene with protein product		603849		TLX		9628820	Standard	NM_003269		Approved	TLL, XTLL	uc003psg.3	Q9Y466	OTTHUMG00000015319	ENST00000368986.4:c.60C>T	chr6.hg19:g.108492696C>T		101.0	0.0		54.0	17.0	NM_003269	Q6ZMP8	Silent	SNP	ENST00000368986.4	hg19	CCDS5063.1																																																																																			.	.		0.577	NR2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041712.2		
TTLL2	83887	hgsc.bcm.edu	37	6	167754181	167754181	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr6:167754181T>A	ENST00000239587.5	+	3	881	c.793T>A	c.(793-795)Ttt>Att	p.F265I		NM_031949.4	NP_114155.4	Q9BWV7	TTLL2_HUMAN	tubulin tyrosine ligase-like family, member 2	265	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)		ligase activity (GO:0016874)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(66;7.8e-06)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		TGTTACTGGCTTTAAGCCTTT	0.368																																					p.F265I		Atlas-SNP	.											.	TTLL2	82	.	0			c.T793A						.						174.0	177.0	176.0					6																	167754181		2203	4300	6503	SO:0001583	missense	83887	exon3			ACTGGCTTTAAGC	AK093039	CCDS5301.1	6q27	2013-02-14		2004-01-14	ENSG00000120440	ENSG00000120440		"""Tubulin tyrosine ligase-like family"""	21211	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 104"""	C6orf104		11054573	Standard	XM_006715572		Approved	NYD-TSPG, dJ366N23.3	uc003qvs.1	Q9BWV7	OTTHUMG00000016023	ENST00000239587.5:c.793T>A	chr6.hg19:g.167754181T>A	ENSP00000239587:p.Phe265Ile	91.0	0.0		40.0	10.0	NM_031949	B2RB11|B3KS77|Q7Z6R8|Q86X22	Missense_Mutation	SNP	ENST00000239587.5	hg19	CCDS5301.1	.	.	.	.	.	.	.	.	.	.	T	11.65	1.702901	0.30232	.	.	ENSG00000120440	ENST00000239587;ENST00000540954	T	0.05580	3.42	3.4	0.819	0.18785	.	0.082324	0.47852	D	0.000214	T	0.07548	0.0190	L	0.53671	1.685	0.35763	D	0.820335	D	0.76494	0.999	D	0.76071	0.987	T	0.13150	-1.0520	10	0.72032	D	0.01	.	5.1452	0.14981	0.0:0.1031:0.1817:0.7152	.	265	Q9BWV7	TTLL2_HUMAN	I	265;192	ENSP00000239587:F265I	ENSP00000239587:F265I	F	+	1	0	TTLL2	167674171	1.000000	0.71417	0.027000	0.17364	0.003000	0.03518	3.952000	0.56691	0.054000	0.16065	-0.425000	0.05940	TTT	.	.		0.368	TTLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043127.3	NM_031949	
MLLT4	4301	hgsc.bcm.edu	37	6	168352526	168352526	+	Nonsense_Mutation	SNP	G	G	T	rs371470293		TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr6:168352526G>T	ENST00000447894.2	+	29	4471	c.4471G>T	c.(4471-4473)Gag>Tag	p.E1491*	MLLT4_ENST00000392112.1_Nonsense_Mutation_p.E1474*|MLLT4_ENST00000351017.4_Nonsense_Mutation_p.E1498*|MLLT4_ENST00000400822.3_Nonsense_Mutation_p.E1490*|MLLT4_ENST00000344191.4_Nonsense_Mutation_p.E1491*|MLLT4_ENST00000392108.3_Nonsense_Mutation_p.E1491*|MLLT4_ENST00000366806.2_Nonsense_Mutation_p.E1491*			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1491					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		CCGCACGATCGAGCGCAGAGA	0.602			T	MLL	AL																																p.E1491X		Atlas-SNP	.		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	.	MLLT4	351	.	0			c.G4471T						.						52.0	57.0	55.0					6																	168352526		2203	4300	6503	SO:0001587	stop_gained	4301	exon29			ACGATCGAGCGCA	AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.4471G>T	chr6.hg19:g.168352526G>T	ENSP00000404595:p.Glu1491*	292.0	1.0		175.0	117.0	NM_001040000	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Nonsense_Mutation	SNP	ENST00000447894.2	hg19		.	.	.	.	.	.	.	.	.	.	G	47	12.971183	0.99710	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	.	.	.	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-41.4019	18.7722	0.91896	0.0:0.0:1.0:0.0	.	.	.	.	X	1491;1498;1491;1491;1474;1491;1490;1491	.	ENSP00000345834:E1491X	E	+	1	0	MLLT4	168095375	1.000000	0.71417	0.968000	0.41197	0.989000	0.77384	9.180000	0.94867	2.423000	0.82170	0.561000	0.74099	GAG	.	.		0.602	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000372077.1	NM_005936	
WBSCR17	64409	hgsc.bcm.edu	37	7	71175897	71175897	+	Missense_Mutation	SNP	G	G	A	rs370276097		TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr7:71175897G>A	ENST00000333538.5	+	10	2286	c.1652G>A	c.(1651-1653)cGc>cAc	p.R551H	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	551	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CTGTACAAGCGCTGGAACTTC	0.607																																					p.R551H		Atlas-SNP	.											.	WBSCR17	208	.	0			c.G1652A						.	G	HIS/ARG	0,4406		0,0,2203	47.0	42.0	44.0		1652	5.3	1.0	7		44	1,8599	1.2+/-3.3	0,1,4299	no	missense	WBSCR17	NM_022479.1	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	551/599	71175897	1,13005	2203	4300	6503	SO:0001583	missense	64409	exon10			ACAAGCGCTGGAA	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1652G>A	chr7.hg19:g.71175897G>A	ENSP00000329654:p.Arg551His	58.0	0.0		40.0	6.0	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	hg19	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344400	0.61073	0.0	1.16E-4	ENSG00000185274	ENST00000333538	T	0.32272	1.46	5.28	5.28	0.74379	Ricin B-related lectin (1);Ricin B lectin (3);	0.085119	0.64402	D	0.000013	T	0.36386	0.0965	L	0.29908	0.895	0.47819	D	0.999523	D	0.65815	0.995	P	0.56648	0.803	T	0.01940	-1.1243	10	0.15066	T	0.55	.	17.6589	0.88185	0.0:0.0:1.0:0.0	.	551	Q6IS24	GLTL3_HUMAN	H	551	ENSP00000329654:R551H	ENSP00000329654:R551H	R	+	2	0	WBSCR17	70813833	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.846000	0.48262	2.746000	0.94184	0.655000	0.94253	CGC	.	.		0.607	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
MRPL15	29088	hgsc.bcm.edu	37	8	55047918	55047918	+	Silent	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr8:55047918C>T	ENST00000260102.4	+	1	149	c.75C>T	c.(73-75)gcC>gcT	p.A25A		NM_014175.3	NP_054894.1	Q9P015	RM15_HUMAN	mitochondrial ribosomal protein L15	25					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|skin(3)	10		Lung NSC(129;0.109)|all_epithelial(80;0.134)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;4.3e-07)|Epithelial(17;5.79e-05)|all cancers(17;0.000458)			TGAGCCTGGCCAACTTAAAGC	0.662																																					p.A25A		Atlas-SNP	.											.	MRPL15	26	.	0			c.C75T						.						12.0	14.0	14.0					8																	55047918		2077	4072	6149	SO:0001819	synonymous_variant	29088	exon1			CCTGGCCAACTTA	AB051619	CCDS6158.1	8q11.2-q13	2012-09-13			ENSG00000137547	ENSG00000137547		"""Mitochondrial ribosomal proteins / large subunits"""	14054	protein-coding gene	gene with protein product		611828				11543634	Standard	NM_014175		Approved	RPML7, MRP-L7, HSPC145, L15mt, MRP-L15	uc003xsa.2	Q9P015	OTTHUMG00000164315	ENST00000260102.4:c.75C>T	chr8.hg19:g.55047918C>T		508.0	0.0		435.0	126.0	NM_014175	Q96Q54|Q9H0Y1	Silent	SNP	ENST00000260102.4	hg19	CCDS6158.1																																																																																			.	.		0.662	MRPL15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378254.1	NM_014175	
NCOA2	10499	hgsc.bcm.edu	37	8	71128948	71128948	+	Silent	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr8:71128948G>A	ENST00000452400.2	-	3	214	c.33C>T	c.(31-33)ccC>ccT	p.P11P		NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	11					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			CTGCCCTGGAGGGGTCAGAGG	0.433			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																p.P11P		Atlas-SNP	.		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	.	NCOA2	147	.	0			c.C33T						.						175.0	166.0	169.0					8																	71128948		1862	4116	5978	SO:0001819	synonymous_variant	10499	exon3			CCTGGAGGGGTCA	X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.33C>T	chr8.hg19:g.71128948G>A		117.0	0.0		197.0	29.0	NM_006540	Q14CD2	Silent	SNP	ENST00000452400.2	hg19	CCDS47872.1																																																																																			.	.		0.433	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379696.1		
MMP16	4325	hgsc.bcm.edu	37	8	89209504	89209504	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr8:89209504G>A	ENST00000286614.6	-	2	445	c.164C>T	c.(163-165)cCg>cTg	p.P55L	MMP16_ENST00000544227.1_5'UTR	NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	55					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	GGGGTCAGTCGGTGGAAGGTA	0.418																																					p.P55L		Atlas-SNP	.											.	MMP16	176	.	0			c.C164T						.						83.0	74.0	77.0					8																	89209504		2203	4300	6503	SO:0001583	missense	4325	exon2			TCAGTCGGTGGAA	D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.164C>T	chr8.hg19:g.89209504G>A	ENSP00000286614:p.Pro55Leu	147.0	0.0		210.0	29.0	NM_005941	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	ENST00000286614.6	hg19	CCDS6246.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283010	0.80692	.	.	ENSG00000156103	ENST00000286614;ENST00000522726	T;T	0.37752	1.18;1.18	6.07	6.07	0.98685	Peptidoglycan binding-like (2);Metallopeptidase, catalytic domain (1);	0.147359	0.64402	D	0.000009	T	0.65291	0.2677	M	0.87328	2.875	0.80722	D	1	D;D	0.62365	0.991;0.985	P;P	0.60173	0.794;0.87	T	0.68534	-0.5383	10	0.66056	D	0.02	.	20.6525	0.99598	0.0:0.0:1.0:0.0	.	55;55	P51512-2;P51512	.;MMP16_HUMAN	L	55;72	ENSP00000286614:P55L;ENSP00000429147:P72L	ENSP00000286614:P55L	P	-	2	0	MMP16	89278620	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	3.042000	0.49815	2.890000	0.99128	0.585000	0.79938	CCG	.	.		0.418	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375304.2	NM_005941	
VPS13B	157680	hgsc.bcm.edu	37	8	100443809	100443809	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr8:100443809T>C	ENST00000358544.2	+	22	3238	c.3127T>C	c.(3127-3129)Tct>Cct	p.S1043P	VPS13B_ENST00000357162.2_Missense_Mutation_p.S1043P|VPS13B_ENST00000395996.1_Missense_Mutation_p.S1043P	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1043					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GTTGAATATATCTGAAAGCTG	0.338																																					p.S1043P	Colon(161;2205 2542 7338 31318)	Atlas-SNP	.											.	VPS13B	811	.	0			c.T3127C						.						80.0	88.0	85.0					8																	100443809		2202	4298	6500	SO:0001583	missense	157680	exon22			AATATATCTGAAA	AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.3127T>C	chr8.hg19:g.100443809T>C	ENSP00000351346:p.Ser1043Pro	117.0	0.0		172.0	8.0	NM_152564	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	ENST00000358544.2	hg19	CCDS6280.1	.	.	.	.	.	.	.	.	.	.	T	11.88	1.770651	0.31320	.	.	ENSG00000132549	ENST00000357162;ENST00000358544;ENST00000395996	T;T;T	0.37411	1.2;1.2;1.2	4.59	-1.39	0.08997	.	1.411450	0.04107	N	0.313987	T	0.21307	0.0513	N	0.24115	0.695	0.09310	N	0.999996	B;B;B;B	0.32693	0.256;0.256;0.38;0.168	B;B;B;B	0.29440	0.064;0.099;0.102;0.064	T	0.14699	-1.0463	10	0.32370	T	0.25	.	3.9247	0.09259	0.372:0.1526:0.0:0.4754	.	1042;1043;1043;1043	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3	.;.;VP13B_HUMAN;.	P	1043	ENSP00000349685:S1043P;ENSP00000351346:S1043P;ENSP00000379318:S1043P	ENSP00000349685:S1043P	S	+	1	0	VPS13B	100512985	0.090000	0.21635	0.071000	0.20095	0.808000	0.45660	0.389000	0.20751	-0.067000	0.12976	0.454000	0.30748	TCT	.	.		0.338	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000277138.1	NM_184042	
ANGPT1	284	hgsc.bcm.edu	37	8	108297043	108297043	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr8:108297043C>A	ENST00000520734.1	-	6	757	c.472G>T	c.(472-474)Ggg>Tgg	p.G158W	ANGPT1_ENST00000518386.1_Intron|ANGPT1_ENST00000520052.1_Missense_Mutation_p.G157W			Q15389	ANGP1_HUMAN	angiopoietin 1	358					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			AACTCATTCCCCAGCCAATAT	0.413																																					p.G358W		Atlas-SNP	.											.	ANGPT1	111	.	0			c.G1072T						.						74.0	68.0	70.0					8																	108297043		2203	4300	6503	SO:0001583	missense	284	exon7			CATTCCCCAGCCA	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.472G>T	chr8.hg19:g.108297043C>A	ENSP00000430750:p.Gly158Trp	165.0	0.0		237.0	41.0	NM_001146	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	hg19		.	.	.	.	.	.	.	.	.	.	C	28.5	4.928310	0.92389	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000520734;ENST00000520052	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	5.73	5.73	0.89815	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.000000	0.85682	D	0.000000	D	0.95924	0.8673	H	0.99659	4.685	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97718	1.0195	10	0.87932	D	0	.	19.8897	0.96925	0.0:1.0:0.0:0.0	.	157;358;358	E7ERK4;Q5HYA0;Q15389	.;.;ANGP1_HUMAN	W	358;357;158;157	ENSP00000428340:G358W;ENSP00000297450:G357W;ENSP00000430750:G158W;ENSP00000429349:G157W	ENSP00000297450:G357W	G	-	1	0	ANGPT1	108366219	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.709000	0.92574	0.650000	0.86243	GGG	.	.		0.413	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
PLEC	5339	hgsc.bcm.edu	37	8	144994165	144994165	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr8:144994165C>T	ENST00000322810.4	-	32	10404	c.10235G>A	c.(10234-10236)cGc>cAc	p.R3412H	PLEC_ENST00000345136.3_Missense_Mutation_p.R3275H|PLEC_ENST00000356346.3_Missense_Mutation_p.R3261H|PLEC_ENST00000398774.2_Missense_Mutation_p.R3243H|PLEC_ENST00000357649.2_Missense_Mutation_p.R3279H|PLEC_ENST00000354958.2_Missense_Mutation_p.R3253H|PLEC_ENST00000354589.3_Missense_Mutation_p.R3275H|PLEC_ENST00000436759.2_Missense_Mutation_p.R3302H|PLEC_ENST00000527096.1_Missense_Mutation_p.R3298H	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3412	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CTTGCCCGTGCGGAACTGACG	0.617																																					p.R3412H		Atlas-SNP	.											.	PLEC	1144	.	0			c.G10235A						.						62.0	72.0	69.0					8																	144994165		2184	4274	6458	SO:0001583	missense	5339	exon32			CCCGTGCGGAACT	U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10235G>A	chr8.hg19:g.144994165C>T	ENSP00000323856:p.Arg3412His	70.0	0.0		147.0	12.0	NM_201380	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	ENST00000322810.4	hg19	CCDS43772.1	.	.	.	.	.	.	.	.	.	.	C	6.557	0.471058	0.12461	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.78481	-1.15;-1.15;-1.18;-1.18;-1.17;-1.15;-1.15;-1.15;-1.15	4.91	3.06	0.35304	.	0.000000	0.64402	U	0.000008	T	0.70701	0.3254	M	0.64404	1.975	0.44073	D	0.996823	B;B;B;B;B;B;B;B	0.22211	0.066;0.038;0.038;0.039;0.038;0.038;0.066;0.066	B;B;B;B;B;B;B;B	0.17098	0.017;0.017;0.017;0.007;0.017;0.017;0.017;0.017	T	0.69687	-0.5078	10	0.72032	D	0.01	.	6.4724	0.22015	0.0:0.6151:0.0:0.3849	.	3302;3261;3253;3412;3243;3275;3279;3275	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	H	3275;3279;3275;3243;3412;3253;3261;3302;3298	ENSP00000344848:R3275H;ENSP00000350277:R3279H;ENSP00000346602:R3275H;ENSP00000381756:R3243H;ENSP00000323856:R3412H;ENSP00000347044:R3253H;ENSP00000348702:R3261H;ENSP00000388180:R3302H;ENSP00000434583:R3298H	ENSP00000323856:R3412H	R	-	2	0	PLEC	145066153	1.000000	0.71417	0.999000	0.59377	0.210000	0.24377	2.825000	0.48096	1.173000	0.42796	0.448000	0.29417	CGC	.	.		0.617	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383281.1	NM_000445	
ZNF483	158399	hgsc.bcm.edu	37	9	114304927	114304927	+	Missense_Mutation	SNP	G	G	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr9:114304927G>C	ENST00000309235.5	+	6	1870	c.1712G>C	c.(1711-1713)aGa>aCa	p.R571T	ZNF483_ENST00000358151.4_Intron	NM_133464.2	NP_597721.2	Q8TF39	ZN483_HUMAN	zinc finger protein 483	571					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(11)|ovary(1)|skin(5)	31						AAACATCAGAGAATTCATACT	0.408																																					p.R571T		Atlas-SNP	.											.	ZNF483	78	.	0			c.G1712C						.						57.0	64.0	62.0					9																	114304927		2203	4300	6503	SO:0001583	missense	158399	exon6			ATCAGAGAATTCA	AB075842	CCDS35105.1, CCDS35106.1	9q32	2013-01-09			ENSG00000173258	ENSG00000173258		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23384	protein-coding gene	gene with protein product							Standard	NM_001007169		Approved	ZKSCAN16, KIAA1962, ZSCAN48	uc004bff.2	Q8TF39	OTTHUMG00000020490	ENST00000309235.5:c.1712G>C	chr9.hg19:g.114304927G>C	ENSP00000311679:p.Arg571Thr	110.0	0.0		80.0	40.0	NM_133464	Q5VZN2|Q8NAE1	Missense_Mutation	SNP	ENST00000309235.5	hg19	CCDS35106.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777428	0.49786	.	.	ENSG00000173258	ENST00000309235	T	0.02421	4.3	3.84	3.84	0.44239	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.49305	D	0.000160	T	0.09468	0.0233	L	0.45228	1.405	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.17715	-1.0360	10	0.40728	T	0.16	-27.2936	14.0547	0.64761	0.0:0.0:1.0:0.0	.	571	Q8TF39	ZN483_HUMAN	T	571	ENSP00000311679:R571T	ENSP00000311679:R571T	R	+	2	0	ZNF483	113344748	0.797000	0.28877	0.997000	0.53966	0.863000	0.49368	2.136000	0.42121	2.436000	0.82500	0.655000	0.94253	AGA	.	.		0.408	ZNF483-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053641.1	XM_088567	
RASSF4	83937	hgsc.bcm.edu	37	10	45486499	45486499	+	Silent	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr10:45486499C>T	ENST00000340258.5	+	9	902	c.789C>T	c.(787-789)ggC>ggT	p.G263G	RASSF4_ENST00000374417.2_3'UTR|RASSF4_ENST00000334940.6_Silent_p.G272G|RASSF4_ENST00000472561.1_3'UTR	NM_032023.3	NP_114412.2	Q8WYP3	RIN2_HUMAN	Ras association (RalGDS/AF-6) domain family member 4	0					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(2)|large_intestine(6)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16						CTGACTTGGGCGTGGAAGTCC	0.582																																					p.G263G		Atlas-SNP	.											.	RASSF4	33	.	0			c.C789T						.						47.0	52.0	50.0					10																	45486499		2203	4300	6503	SO:0001819	synonymous_variant	83937	exon9			CTTGGGCGTGGAA	BC032593	CCDS7208.1	10q11.1	2008-02-22	2008-02-22		ENSG00000107551	ENSG00000107551			20793	protein-coding gene	gene with protein product		610559					Standard	NM_032023		Approved	AD037, MGC44914	uc001jbo.3	Q9H2L5	OTTHUMG00000018060	ENST00000340258.5:c.789C>T	chr10.hg19:g.45486499C>T		40.0	0.0		22.0	12.0	NM_032023	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	ENST00000340258.5	hg19	CCDS7208.1																																																																																			.	.		0.582	RASSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047745.2	NM_032023	
NCOA4	8031	hgsc.bcm.edu	37	10	51584844	51584844	+	Missense_Mutation	SNP	C	C	T	rs148951318		TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr10:51584844C>T	ENST00000443446.1	+	8	1172	c.943C>T	c.(943-945)Cgg>Tgg	p.R315W	NCOA4_ENST00000438493.1_Missense_Mutation_p.R331W|NCOA4_ENST00000344348.6_Missense_Mutation_p.R315W|NCOA4_ENST00000414907.2_Missense_Mutation_p.R149W|NCOA4_ENST00000452682.1_Missense_Mutation_p.R331W|NCOA4_ENST00000374082.1_Missense_Mutation_p.R315W|NCOA4_ENST00000430396.2_Missense_Mutation_p.R215W|NCOA4_ENST00000374087.4_Missense_Mutation_p.R315W	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	315					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						CCATAAGCTGCGGAAGCCTGA	0.453			T	RET	papillary thyroid																																p.R331W		Atlas-SNP	.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	.	NCOA4	58	.	0			c.C991T						.	C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	80.0	81.0	81.0		991,991,943,943,943	1.7	0.3	10	dbSNP_134	81	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense,missense,missense	NCOA4	NM_001145260.1,NM_001145261.1,NM_001145262.1,NM_001145263.1,NM_005437.3	101,101,101,101,101	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign,benign,benign	331/651,331/631,315/615,315/615,315/615	51584844	2,13004	2203	4300	6503	SO:0001583	missense	8031	exon9			AAGCTGCGGAAGC	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.943C>T	chr10.hg19:g.51584844C>T	ENSP00000390713:p.Arg315Trp	52.0	0.0		37.0	20.0	NM_001145261	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	hg19	CCDS7237.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.369|3.369	-0.128802|-0.128802	0.06753|0.06753	0.0|0.0	2.33E-4|2.33E-4	ENSG00000138293|ENSG00000138293	ENST00000431200|ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	.|T;T;T;T;T;T;T;T	.|0.31510	.|1.49;1.49;1.49;1.49;1.49;1.49;1.49;1.49	4.64|4.64	1.74|1.74	0.24563|0.24563	.|.	.|0.474612	.|0.20926	.|N	.|0.083197	T|T	0.13157|0.13157	0.0319|0.0319	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.11235	.|0.002;0.004;0.004;0.001	.|B;B;B;B	.|0.09377	.|0.003;0.003;0.003;0.004	T|T	0.28202|0.28202	-1.0051|-1.0051	5|9	.|.	.|.	.|.	-3.2217|-3.2217	8.2501|8.2501	0.31712|0.31712	0.0:0.3743:0.467:0.1587|0.0:0.3743:0.467:0.1587	.|.	.|215;331;331;315	.|B4DF87;B4E260;E9PAV7;Q13772	.|.;.;.;NCOA4_HUMAN	V|W	230|331;331;215;315;149;315;315;315	.|ENSP00000405146:R331W;ENSP00000395465:R331W;ENSP00000393053:R215W;ENSP00000363200:R315W;ENSP00000411018:R149W;ENSP00000344552:R315W;ENSP00000363195:R315W;ENSP00000390713:R315W	.|.	A|R	+|+	2|1	0|2	NCOA4|NCOA4	51254850|51254850	0.459000|0.459000	0.25768|0.25768	0.302000|0.302000	0.25058|0.25058	0.064000|0.064000	0.16182|0.16182	0.997000|0.997000	0.29731|0.29731	0.428000|0.428000	0.26173|0.26173	-0.795000|-0.795000	0.03280|0.03280	GCG|CGG	.	C|1.000;T|0.000		0.453	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
ANXA11	311	hgsc.bcm.edu	37	10	81926706	81926706	+	Silent	SNP	C	C	G	rs561842051		TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr10:81926706C>G	ENST00000438331.1	-	8	1166	c.684G>C	c.(682-684)ggG>ggC	p.G228G	ANXA11_ENST00000360615.4_Silent_p.G228G|ANXA11_ENST00000265447.4_Silent_p.G228G|ANXA11_ENST00000372231.3_Silent_p.G228G|ANXA11_ENST00000537102.1_Silent_p.G195G|ANXA11_ENST00000422982.3_Silent_p.G228G|ANXA11_ENST00000535999.1_Silent_p.G228G	NM_145869.1	NP_665876.1	P50995	ANX11_HUMAN	annexin A11	228					cytokinesis, completion of separation (GO:0007109)|phagocytosis (GO:0006909)|response to calcium ion (GO:0051592)	azurophil granule (GO:0042582)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|specific granule (GO:0042581)|spindle (GO:0005819)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|MHC class II protein complex binding (GO:0023026)|phosphatidylethanolamine binding (GO:0008429)|poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)			endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|urinary_tract(1)	17	Prostate(51;0.00985)|all_epithelial(25;0.0951)		Colorectal(32;0.109)			TGGAGCGACTCCCCAGGCAGT	0.632																																					p.G228G		Atlas-SNP	.											.	ANXA11	32	.	0			c.G684C						.						57.0	48.0	51.0					10																	81926706		2203	4300	6503	SO:0001819	synonymous_variant	311	exon7			GCGACTCCCCAGG	L19605	CCDS7364.1, CCDS60576.1	10q22.3	2005-11-09			ENSG00000122359	ENSG00000122359		"""Annexins"""	535	protein-coding gene	gene with protein product		602572		ANX11		7508441, 9503022	Standard	NM_001157		Approved		uc001kbt.1	P50995	OTTHUMG00000018604	ENST00000438331.1:c.684G>C	chr10.hg19:g.81926706C>G		41.0	0.0		21.0	9.0	NM_145868	B4DVE7	Silent	SNP	ENST00000438331.1	hg19	CCDS7364.1																																																																																			.	.		0.632	ANXA11-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049044.1	NM_145869	
TIAL1	7073	hgsc.bcm.edu	37	10	121338278	121338278	+	Nonsense_Mutation	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr10:121338278C>T	ENST00000436547.2	-	7	560	c.516G>A	c.(514-516)tgG>tgA	p.W172*	TIAL1_ENST00000463089.2_5'Flank|TIAL1_ENST00000369093.2_Nonsense_Mutation_p.W189*|TIAL1_ENST00000369092.4_Nonsense_Mutation_p.W49*	NM_003252.3	NP_003243.1	Q01085	TIAR_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein-like 1	172	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|defense response (GO:0006952)|germ cell development (GO:0007281)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell division (GO:0017145)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	13		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00239)|BRCA - Breast invasive adenocarcinoma(275;0.0932)		TACGAGTGGCCCAATTGGTTC	0.398																																					p.W189X		Atlas-SNP	.											.	TIAL1	47	.	0			c.G567A						.						160.0	141.0	147.0					10																	121338278		2203	4300	6503	SO:0001587	stop_gained	7073	exon7			AGTGGCCCAATTG	AL833106	CCDS7613.1, CCDS31295.1	10q	2013-02-12	2001-11-28		ENSG00000151923	ENSG00000151923		"""RNA binding motif (RRM) containing"""	11804	protein-coding gene	gene with protein product		603413	"""TIA1 cytotoxic granule-associated RNA-binding protein-like 1"""			1326761	Standard	XM_005270108		Approved	TIAR	uc001lej.1	Q01085	OTTHUMG00000019156	ENST00000436547.2:c.516G>A	chr10.hg19:g.121338278C>T	ENSP00000394902:p.Trp172*	162.0	0.0		103.0	20.0	NM_001033925	A8K3T0|A8K4L9	Nonsense_Mutation	SNP	ENST00000436547.2	hg19	CCDS7613.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708191	0.89018	.	.	ENSG00000151923	ENST00000369093;ENST00000369092;ENST00000436547	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.9553	19.646	0.95777	0.0:1.0:0.0:0.0	.	.	.	.	X	189;49;172	.	ENSP00000358088:W49X	W	-	3	0	TIAL1	121328268	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.644000	0.83416	2.645000	0.89757	0.591000	0.81541	TGG	.	.		0.398	TIAL1-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050672.2	NM_022333, NM_003252	
C10orf90	118611	hgsc.bcm.edu	37	10	128147623	128147623	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr10:128147623G>T	ENST00000284694.7	-	6	2003	c.1883C>A	c.(1882-1884)cCc>cAc	p.P628H	C10orf90_ENST00000544758.1_Missense_Mutation_p.P725H|C10orf90_ENST00000480379.1_Missense_Mutation_p.P32H|C10orf90_ENST00000356858.3_Missense_Mutation_p.P581H|C10orf90_ENST00000454341.1_Missense_Mutation_p.P531H	NM_001004298.2	NP_001004298.2	Q96M02	CJ090_HUMAN	chromosome 10 open reading frame 90	628	ALMS motif. {ECO:0000250}.				mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell growth (GO:0030308)|protein stabilization (GO:0050821)|response to ionizing radiation (GO:0010212)|response to UV (GO:0009411)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)				NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(19)|liver(1)|lung(29)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	65		all_epithelial(44;4.51e-05)|all_lung(145;0.0068)|Lung NSC(174;0.0105)|Colorectal(57;0.0848)|all_neural(114;0.0936)|Breast(234;0.203)		COAD - Colon adenocarcinoma(40;0.0442)|Colorectal(40;0.0479)		CAGAGGATGGGGAATCGTGAA	0.587																																					p.P628H		Atlas-SNP	.											.	C10orf90	121	.	0			c.C1883A						.						132.0	100.0	111.0					10																	128147623		2203	4300	6503	SO:0001583	missense	118611	exon6			GGATGGGGAATCG	BC034828	CCDS31310.1	10q26.2	2012-05-31			ENSG00000154493	ENSG00000154493			26563	protein-coding gene	gene with protein product	"""fragile-site associated tumor suppressor"""					20843368, 20154723	Standard	NM_001004298		Approved	FLJ32938, bA422P15.2, FATS	uc001ljq.3	Q96M02	OTTHUMG00000019245	ENST00000284694.7:c.1883C>A	chr10.hg19:g.128147623G>T	ENSP00000284694:p.Pro628His	64.0	0.0		42.0	25.0	NM_001004298	B9EIQ9|Q5JRP6|Q5T023|Q8NCV5|Q8WU75	Missense_Mutation	SNP	ENST00000284694.7	hg19	CCDS31310.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.94|15.94	2.981425|2.981425	0.53827|0.53827	.|.	.|.	ENSG00000154493|ENSG00000154493	ENST00000356858;ENST00000284694;ENST00000454341;ENST00000544758;ENST00000432642|ENST00000424927	T;T;T;T|T	0.22945|0.49432	2.01;2.07;2.04;1.93|0.78	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.000000|0.000000	0.43110|0.43110	D|D	0.000618|0.000618	T|T	0.62171|0.62171	0.2406|0.2406	M|M	0.65498|0.65498	2.005|2.005	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;0.999|.	T|T	0.65274|0.65274	-0.6208|-0.6208	10|8	0.87932|0.72032	D|D	0|0.01	-23.1691|-23.1691	15.1753|15.1753	0.72907|0.72907	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	725;628;531|.	F5GZL2;Q96M02;Q96M02-2|.	.;CJ090_HUMAN;.|.	H|T	581;628;531;725;628|171	ENSP00000284694:P628H;ENSP00000398786:P531H;ENSP00000444369:P725H;ENSP00000405995:P628H|ENSP00000411609:P171T	ENSP00000284694:P628H|ENSP00000411609:P171T	P|P	-|-	2|1	0|0	C10orf90|C10orf90	128137613|128137613	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.490000|0.490000	0.33462|0.33462	6.020000|6.020000	0.70826|0.70826	2.595000|2.595000	0.87683|0.87683	0.655000|0.655000	0.94253|0.94253	CCC|CCC	.	.		0.587	C10orf90-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004298	
MRGPRD	116512	hgsc.bcm.edu	37	11	68747517	68747517	+	Silent	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr11:68747517G>A	ENST00000309106.3	-	1	938	c.939C>T	c.(937-939)acC>acT	p.T313T		NM_198923.2	NP_944605.2	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	313						extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)	22			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TGGTGCCCACGGTGGGCGTCT	0.687																																					p.T313T		Atlas-SNP	.											.	MRGPRD	53	.	0			c.C939T						.																																			SO:0001819	synonymous_variant	116512	exon1			GCCCACGGTGGGC	AB083627	CCDS31625.1	11q13.3	2012-08-21			ENSG00000172938	ENSG00000172938		"""GPCR / Class A : Orphans"""	29626	protein-coding gene	gene with protein product		607231				11551509, 12909716	Standard	NM_198923		Approved	mrgD	uc010rqf.2	Q8TDS7	OTTHUMG00000167896	ENST00000309106.3:c.939C>T	chr11.hg19:g.68747517G>A		65.0	0.0		38.0	31.0	NM_198923	Q8NGK7	Silent	SNP	ENST00000309106.3	hg19	CCDS31625.1																																																																																			.	.		0.687	MRGPRD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396874.1	NM_198923	
DDX47	51202	hgsc.bcm.edu	37	12	12974235	12974235	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr12:12974235G>A	ENST00000358007.3	+	3	297	c.275G>A	c.(274-276)cGt>cAt	p.R92H	DDX47_ENST00000392155.2_3'UTR|DDX47_ENST00000352940.4_Missense_Mutation_p.R92H	NM_016355.3	NP_057439.2	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	92	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)		ACCCCGCAGCGTTTGTTTGCC	0.532																																					p.R92H		Atlas-SNP	.											.	DDX47	37	.	0			c.G275A						.						144.0	142.0	142.0					12																	12974235		2203	4300	6503	SO:0001583	missense	51202	exon3			CGCAGCGTTTGTT	AK127712	CCDS8655.1, CCDS8656.1	12p13.2	2010-07-06			ENSG00000213782	ENSG00000213782		"""DEAD-boxes"""	18682	protein-coding gene	gene with protein product		615428					Standard	NM_016355		Approved	DKFZp564O176, FLJ30012, HQ0256, RRP3	uc001rax.3	Q9H0S4	OTTHUMG00000168709	ENST00000358007.3:c.275G>A	chr12.hg19:g.12974235G>A	ENSP00000350698:p.Arg92His	135.0	0.0		86.0	31.0	NM_201224	B3KXP4|G5E955|Q96GM0|Q96NV8|Q9UI98	Missense_Mutation	SNP	ENST00000358007.3	hg19	CCDS8655.1	.	.	.	.	.	.	.	.	.	.	G	17.87	3.494810	0.64186	.	.	ENSG00000213782	ENST00000352940;ENST00000358007	T;T	0.42900	0.96;2.43	5.6	4.71	0.59529	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.30696	0.0773	N	0.25094	0.71	0.58432	D	0.999999	B;B;B;B	0.26120	0.038;0.044;0.036;0.142	B;B;B;B	0.22152	0.038;0.014;0.008;0.022	T	0.06075	-1.0847	10	0.40728	T	0.16	-5.7876	14.6773	0.68989	0.0699:0.0:0.93:0.0	.	92;92;92;92	B4DYP6;Q9H4E3;G5E955;Q9H0S4	.;.;.;DDX47_HUMAN	H	92	ENSP00000319578:R92H;ENSP00000350698:R92H	ENSP00000319578:R92H	R	+	2	0	DDX47	12865502	1.000000	0.71417	0.860000	0.33809	0.824000	0.46624	9.201000	0.95017	1.370000	0.46153	0.555000	0.69702	CGT	.	.		0.532	DDX47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400674.1	NM_016355	
OR6C74	254783	hgsc.bcm.edu	37	12	55641389	55641389	+	Silent	SNP	G	G	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr12:55641389G>T	ENST00000343870.4	+	1	408	c.318G>T	c.(316-318)ggG>ggT	p.G106G		NM_001005490.1	NP_001005490.1	A6NCV1	O6C74_HUMAN	olfactory receptor, family 6, subfamily C, member 74	106						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|large_intestine(3)|lung(7)|prostate(1)	12						TTCTCTTGGGGGCAACTGAAT	0.448																																					p.G106G		Atlas-SNP	.											.	OR6C74	52	.	0			c.G318T						.						163.0	169.0	167.0					12																	55641389		2203	4300	6503	SO:0001819	synonymous_variant	254783	exon1			CTTGGGGGCAACT		CCDS31816.1	12q13.13	2012-08-09			ENSG00000197706	ENSG00000197706		"""GPCR / Class A : Olfactory receptors"""	31303	protein-coding gene	gene with protein product							Standard	NM_001005490		Approved		uc010spg.2	A6NCV1	OTTHUMG00000165162	ENST00000343870.4:c.318G>T	chr12.hg19:g.55641389G>T		80.0	0.0		57.0	22.0	NM_001005490		Silent	SNP	ENST00000343870.4	hg19	CCDS31816.1																																																																																			.	.		0.448	OR6C74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382312.1		
TSFM	10102	hgsc.bcm.edu	37	12	58186770	58186770	+	Splice_Site	SNP	G	G	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr12:58186770G>T	ENST00000550559.1	+	5	500	c.485G>T	c.(484-486)gGt>gTt	p.G162V	TSFM_ENST00000350762.5_Splice_Site_p.G122V|TSFM_ENST00000543727.1_Splice_Site_p.G162V|TSFM_ENST00000497617.1_3'UTR|TSFM_ENST00000323833.8_Splice_Site_p.G183V|TSFM_ENST00000454289.3_Splice_Site_p.G162V|TSFM_ENST00000548851.1_Splice_Site_p.G162V|TSFM_ENST00000540550.1_Intron					Ts translation elongation factor, mitochondrial											endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)	8	all_cancers(7;6.31e-80)|Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)					TGCACTTAGGGTTTCTTGAAT	0.388																																					p.G183V		Atlas-SNP	.											.	TSFM	26	.	0			c.G548T						.						124.0	113.0	117.0					12																	58186770		2203	4300	6503	SO:0001630	splice_region_variant	10102	exon6			CTTAGGGTTTCTT	L37936	CCDS8958.2, CCDS53809.1, CCDS53810.1, CCDS53811.1	12q14.1	2006-06-10			ENSG00000123297	ENSG00000123297			12367	protein-coding gene	gene with protein product		604723				7615523	Standard	NM_005726		Approved	EF-Tsmt, EF-TS	uc001sqh.3	P43897	OTTHUMG00000153042	ENST00000550559.1:c.484-1G>T	chr12.hg19:g.58186770G>T		109.0	0.0		64.0	21.0	NM_001172696		Missense_Mutation	SNP	ENST00000550559.1	hg19		.	.	.	.	.	.	.	.	.	.	G	9.110	1.006363	0.19199	.	.	ENSG00000123297	ENST00000454289;ENST00000543727;ENST00000323833;ENST00000350762;ENST00000550559;ENST00000548851;ENST00000434359;ENST00000457189	T;T;T	0.76578	-1.03;-1.03;-1.03	5.07	5.07	0.68467	Translation elongation factor EFTs/EF1B, dimerisation (2);	0.153055	0.64402	D	0.000015	T	0.73241	0.3562	L	0.42245	1.32	0.80722	D	1	B;B;B	0.17667	0.023;0.016;0.01	B;B;B	0.25140	0.05;0.058;0.01	T	0.71115	-0.4686	10	0.62326	D	0.03	.	15.4596	0.75342	0.0:0.0:1.0:0.0	.	122;162;183	F8W6R3;P43897;P43897-2	.;EFTS_HUMAN;.	V	162;162;183;122;162;162;112;112	ENSP00000388330:G162V;ENSP00000242983:G122V;ENSP00000389162:G112V	ENSP00000313877:G183V	G	+	2	0	TSFM	56473037	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	1.596000	0.36718	2.631000	0.89168	0.655000	0.94253	GGT	.	.		0.388	TSFM-008	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000409343.1	NM_005726	Missense_Mutation
BBS10	79738	hgsc.bcm.edu	37	12	76741192	76741192	+	Silent	SNP	T	T	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr12:76741192T>G	ENST00000393262.3	-	2	656	c.573A>C	c.(571-573)tcA>tcC	p.S191S		NM_024685.3	NP_078961.3	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	191					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein complex assembly (GO:0051131)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|regulation of protein complex assembly (GO:0043254)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell projection (GO:0042995)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)	19						ACATCAACTGTGAAATAAATT	0.363									Bardet-Biedl syndrome																												p.S191S		Atlas-SNP	.											.	BBS10	46	.	0			c.A573C						.						88.0	81.0	83.0					12																	76741192		2203	4300	6503	SO:0001819	synonymous_variant	79738	exon2	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CAACTGTGAAATA	BC026355	CCDS9014.2	12q21.2	2014-06-17	2006-04-28	2006-04-28	ENSG00000179941	ENSG00000179941		"""Heat Shock Proteins / Chaperonins"""	26291	protein-coding gene	gene with protein product		610148	"""chromosome 12 open reading frame 58"""	C12orf58		16582908	Standard	NM_024685		Approved	FLJ23560	uc001syd.1	Q8TAM1	OTTHUMG00000147352	ENST00000393262.3:c.573A>C	chr12.hg19:g.76741192T>G		182.0	0.0		109.0	33.0	NM_024685	Q96CW2|Q9H5D2	Silent	SNP	ENST00000393262.3	hg19	CCDS9014.2																																																																																			.	.		0.363	BBS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303983.2	NM_024685	
PRDM4	11108	hgsc.bcm.edu	37	12	108136024	108136024	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr12:108136024T>C	ENST00000228437.5	-	9	2042	c.1583A>G	c.(1582-1584)tAt>tGt	p.Y528C	RP11-864J10.4_ENST00000546714.1_RNA	NM_012406.3	NP_036538.3	Q9UKN5	PRDM4_HUMAN	PR domain containing 4	528	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cell proliferation (GO:0008283)|negative regulation of cell cycle (GO:0045786)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|methyltransferase activity (GO:0008168)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|skin(2)|urinary_tract(1)	20						ATCTCGGCTATAATAAAAAAG	0.353																																					p.Y528C		Atlas-SNP	.											.	PRDM4	64	.	0			c.A1583G						.						81.0	78.0	79.0					12																	108136024		2203	4300	6503	SO:0001583	missense	11108	exon9			CGGCTATAATAAA	AF144757	CCDS9115.1	12q23-q24.1	2013-01-08				ENSG00000110851		"""Zinc fingers, C2H2-type"""	9348	protein-coding gene	gene with protein product		605780				10552934	Standard	NM_012406		Approved	PFM1	uc001tmp.3	Q9UKN5	OTTHUMG00000169914	ENST00000228437.5:c.1583A>G	chr12.hg19:g.108136024T>C	ENSP00000228437:p.Tyr528Cys	119.0	0.0		69.0	24.0	NM_012406	Q9UFA6	Missense_Mutation	SNP	ENST00000228437.5	hg19	CCDS9115.1	.	.	.	.	.	.	.	.	.	.	T	19.88	3.909270	0.72868	.	.	ENSG00000110851	ENST00000228437	T	0.81415	-1.49	5.76	5.76	0.90799	SET domain (2);	0.117422	0.64402	N	0.000012	D	0.89054	0.6606	M	0.89353	3.025	0.80722	D	1	D	0.89917	1.0	D	0.67725	0.953	D	0.87769	0.2604	10	0.05959	T	0.93	.	16.0843	0.81031	0.0:0.0:0.0:1.0	.	528	Q9UKN5	PRDM4_HUMAN	C	528	ENSP00000228437:Y528C	ENSP00000228437:Y528C	Y	-	2	0	PRDM4	106660154	1.000000	0.71417	0.956000	0.39512	0.966000	0.64601	5.656000	0.67988	2.191000	0.70037	0.533000	0.62120	TAT	.	.		0.353	PRDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406546.1	NM_012406	
SDSL	113675	hgsc.bcm.edu	37	12	113874658	113874658	+	Silent	SNP	G	G	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr12:113874658G>C	ENST00000403593.4	+	7	1036	c.774G>C	c.(772-774)gtG>gtC	p.V258V	SDSL_ENST00000345635.4_Silent_p.V258V			Q96GA7	SDSL_HUMAN	serine dehydratase-like	258					cellular amino acid metabolic process (GO:0006520)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	L-serine ammonia-lyase activity (GO:0003941)|L-threonine ammonia-lyase activity (GO:0004794)|pyridoxal phosphate binding (GO:0030170)			endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)	15						CCGAGGCTGTGAGCGCTGTGC	0.612																																					p.V258V		Atlas-SNP	.											SDSL,NS,carcinoma,0,1	SDSL	36	.	0			c.G774C						.						105.0	77.0	86.0					12																	113874658		2203	4300	6503	SO:0001819	synonymous_variant	113675	exon8			GGCTGTGAGCGCT	AF134473	CCDS9170.1	12q24.21	2014-06-24				ENSG00000139410			30404	protein-coding gene	gene with protein product						16580895	Standard	NM_138432		Approved	SDS-RS1, cSDH	uc001tvi.3	Q96GA7		ENST00000403593.4:c.774G>C	chr12.hg19:g.113874658G>C		47.0	0.0		17.0	7.0	NM_138432		Silent	SNP	ENST00000403593.4	hg19	CCDS9170.1	.	.	.	.	.	.	.	.	.	.	G	0.224	-1.026305	0.02045	.	.	ENSG00000139410	ENST00000546672	.	.	.	3.71	0.668	0.17912	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-24.3854	8.7232	0.34454	0.0885:0.2984:0.6131:0.0	.	.	.	.	S	154	.	.	X	+	2	2	SDSL	112359041	0.986000	0.35501	0.037000	0.18230	0.039000	0.13416	1.883000	0.39658	0.311000	0.23014	0.462000	0.41574	TGA	.	.		0.612	SDSL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404782.1	NM_138432	
PDS5B	23047	hgsc.bcm.edu	37	13	33232401	33232401	+	Missense_Mutation	SNP	A	A	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr13:33232401A>T	ENST00000315596.10	+	4	524	c.338A>T	c.(337-339)cAg>cTg	p.Q113L		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	113					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		ATAACAAGACAGTTGAAGGGG	0.299																																					p.Q113L		Atlas-SNP	.											.	PDS5B	141	.	0			c.A338T						.						51.0	47.0	49.0					13																	33232401		1789	4056	5845	SO:0001583	missense	23047	exon4			CAAGACAGTTGAA	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.338A>T	chr13.hg19:g.33232401A>T	ENSP00000313851:p.Gln113Leu	363.0	0.0		240.0	108.0	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	hg19	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.916995	0.92249	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	T	0.62788	-0.0	5.4	5.4	0.78164	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76183	0.3952	M	0.78456	2.415	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.87578	0.998;0.995	T	0.74269	-0.3720	10	0.07175	T	0.84	-20.387	15.4314	0.75102	1.0:0.0:0.0:0.0	.	113;113	Q9NTI5;Q9NTI5-3	PDS5B_HUMAN;.	L	113	ENSP00000313851:Q113L	ENSP00000313851:Q113L	Q	+	2	0	PDS5B	32130401	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	7.343000	0.79319	2.038000	0.60285	0.533000	0.62120	CAG	.	.		0.299	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
NPAS3	64067	hgsc.bcm.edu	37	14	34029335	34029335	+	Missense_Mutation	SNP	T	T	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr14:34029335T>A	ENST00000356141.4	+	5	477	c.477T>A	c.(475-477)gaT>gaA	p.D159E	NPAS3_ENST00000357798.5_Missense_Mutation_p.D146E|NPAS3_ENST00000551008.1_Missense_Mutation_p.D57E|NPAS3_ENST00000547068.1_Missense_Mutation_p.D55E|NPAS3_ENST00000346562.2_Missense_Mutation_p.D127E|NPAS3_ENST00000548645.1_Missense_Mutation_p.D129E|NPAS3_ENST00000341321.4_Missense_Mutation_p.D159E|NPAS3_ENST00000551492.1_Missense_Mutation_p.D164E			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	159	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		AGTCCCTGGATGGCTTTGTAT	0.323																																					p.D159E		Atlas-SNP	.											.	NPAS3	266	.	0			c.T477A						.						75.0	73.0	73.0					14																	34029335		2203	4300	6503	SO:0001583	missense	64067	exon5			CCTGGATGGCTTT	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.477T>A	chr14.hg19:g.34029335T>A	ENSP00000348460:p.Asp159Glu	262.0	0.0		175.0	33.0	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	hg19	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	T	19.13	3.766933	0.69878	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798;ENST00000547068;ENST00000551008;ENST00000546849	T;T;T;T;T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22;2.22	5.81	3.41	0.39046	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.32675	0.0837	L	0.60455	1.87	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.991;0.999;0.999;1.0;1.0	T	0.02020	-1.1228	10	0.35671	T	0.21	.	8.7798	0.34785	0.0:0.2082:0.0:0.7918	.	57;129;159;127;146	F8W0C2;Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;.;NPAS3_HUMAN;.;.	E	136;164;127;159;129;159;146;55;57;69	ENSP00000448373:D136E;ENSP00000450392:D164E;ENSP00000319610:D127E;ENSP00000344158:D159E;ENSP00000448916:D129E;ENSP00000348460:D159E;ENSP00000350446:D146E;ENSP00000449542:D55E;ENSP00000447213:D57E;ENSP00000446700:D69E	ENSP00000344158:D159E	D	+	3	2	NPAS3	33099086	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.619000	0.36965	1.022000	0.39626	0.377000	0.23210	GAT	.	.		0.323	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
OTX2	5015	hgsc.bcm.edu	37	14	57270981	57270981	+	Silent	SNP	G	G	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr14:57270981G>T	ENST00000555006.1	-	3	582	c.174C>A	c.(172-174)gcC>gcA	p.A58A	OTX2_ENST00000408990.3_Silent_p.A58A|OTX2_ENST00000554559.1_Intron|OTX2_ENST00000554788.1_Intron|OTX2_ENST00000339475.5_Silent_p.A66A			P32243	OTX2_HUMAN	orthodenticle homeobox 2	58					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					ACCGGGTCTTGGCAAACAGTG	0.612																																					p.A66A		Atlas-SNP	.											.	OTX2	47	.	0			c.C198A						.						88.0	73.0	78.0					14																	57270981		2203	4300	6503	SO:0001819	synonymous_variant	5015	exon2			GGTCTTGGCAAAC	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.174C>A	chr14.hg19:g.57270981G>T		126.0	0.0		62.0	16.0	NM_001270525	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Silent	SNP	ENST00000555006.1	hg19	CCDS41960.1																																																																																			.	.		0.612	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
ITPK1	3705	hgsc.bcm.edu	37	14	93407963	93407963	+	Silent	SNP	C	C	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr14:93407963C>G	ENST00000267615.6	-	11	1361	c.1188G>C	c.(1186-1188)tcG>tcC	p.S396S	ITPK1_ENST00000555495.1_Silent_p.S277S|ITPK1_ENST00000354313.3_Intron|ITPK1_ENST00000556603.2_Silent_p.S396S			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	396					blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		GGAAGCTGGGCGACACGCCGG	0.716																																					p.S396S		Atlas-SNP	.											.	ITPK1	53	.	0			c.G1188C						.						3.0	2.0	2.0					14																	93407963		1528	3078	4606	SO:0001819	synonymous_variant	3705	exon11			GCTGGGCGACACG	U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.1188G>C	chr14.hg19:g.93407963C>G		59.0	0.0		42.0	22.0	NM_001142593	Q9BTL6|Q9H2E7	Silent	SNP	ENST00000267615.6	hg19	CCDS9907.1																																																																																			.	.		0.716	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412421.2	NM_014216	
USP50	373509	hgsc.bcm.edu	37	15	50822035	50822035	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr15:50822035T>C	ENST00000532404.1	-	6	1068	c.895A>G	c.(895-897)Att>Gtt	p.I299V	USP50_ENST00000530218.1_5'UTR	NM_203494.4	NP_987090.2	Q70EL3	UBP50_HUMAN	ubiquitin specific peptidase 50	304	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(5)	13				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		TTCCGGAAAATTGAGCAAATA	0.368																																					p.I299V		Atlas-SNP	.											.	USP50	24	.	0			c.A895G						.						153.0	139.0	144.0					15																	50822035		1846	4081	5927	SO:0001583	missense	373509	exon6			GGAAAATTGAGCA	AI990110	CCDS53944.1	15q21.1	2008-02-05	2005-08-08			ENSG00000170236		"""Ubiquitin-specific peptidases"""	20079	protein-coding gene	gene with protein product			"""ubiquitin specific protease 50"""			12838346	Standard	NM_203494		Approved		uc021sky.1	Q70EL3		ENST00000532404.1:c.895A>G	chr15.hg19:g.50822035T>C	ENSP00000434676:p.Ile299Val	181.0	0.0		100.0	34.0	NM_203494	E9PP86	Missense_Mutation	SNP	ENST00000532404.1	hg19	CCDS53944.1	.	.	.	.	.	.	.	.	.	.	T	8.160	0.789334	0.16258	.	.	ENSG00000170236	ENST00000532404	T	0.29917	1.55	5.67	-8.07	0.01098	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.024370	0.07824	N	0.960209	T	0.12774	0.0310	N	0.05230	-0.09	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38001	-0.9681	10	0.21014	T	0.42	-5.4284	13.4312	0.61057	0.0:0.7007:0.1326:0.1667	.	304	Q70EL3	UBP50_HUMAN	V	299	ENSP00000434676:I299V	ENSP00000434676:I299V	I	-	1	0	USP50	48609327	0.019000	0.18553	0.482000	0.27366	0.542000	0.35054	-0.637000	0.05459	-1.272000	0.02427	0.533000	0.62120	ATT	.	.		0.368	USP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395249.1		
CCDC102A	92922	hgsc.bcm.edu	37	16	57555012	57555012	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr16:57555012G>T	ENST00000258214.2	-	4	1135	c.889C>A	c.(889-891)Ctg>Atg	p.L297M		NM_033212.3	NP_149989.2	Q96A19	C102A_HUMAN	coiled-coil domain containing 102A	297										endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	8						GTCTTGCTCAGCTCCTCATAC	0.552																																					p.L297M		Atlas-SNP	.											.	CCDC102A	22	.	0			c.C889A						.						169.0	143.0	152.0					16																	57555012		2198	4300	6498	SO:0001583	missense	92922	exon4			TGCTCAGCTCCTC	BC008285	CCDS10784.1	16q13	2008-02-05			ENSG00000135736	ENSG00000135736			28097	protein-coding gene	gene with protein product						12477932	Standard	NM_033212		Approved	MGC10992	uc002elw.3	Q96A19	OTTHUMG00000133472	ENST00000258214.2:c.889C>A	chr16.hg19:g.57555012G>T	ENSP00000258214:p.Leu297Met	38.0	0.0		22.0	16.0	NM_033212	Q9BT74	Missense_Mutation	SNP	ENST00000258214.2	hg19	CCDS10784.1	.	.	.	.	.	.	.	.	.	.	G	18.88	3.718379	0.68844	.	.	ENSG00000135736	ENST00000258214	T	0.55052	0.54	4.86	3.89	0.44902	.	0.086169	0.48767	D	0.000173	T	0.65790	0.2725	L	0.60067	1.865	0.53005	D	0.999961	D	0.89917	1.0	D	0.78314	0.991	T	0.64905	-0.6297	10	0.42905	T	0.14	-22.4329	11.6568	0.51324	0.0875:0.0:0.9125:0.0	.	297	Q96A19	C102A_HUMAN	M	297	ENSP00000258214:L297M	ENSP00000258214:L297M	L	-	1	2	CCDC102A	56112513	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.162000	0.77515	1.155000	0.42497	0.555000	0.69702	CTG	.	.		0.552	CCDC102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257348.1	NM_033212	
NTN1	9423	hgsc.bcm.edu	37	17	8926432	8926432	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr17:8926432C>T	ENST00000173229.2	+	2	849	c.742C>T	c.(742-744)Cgc>Tgc	p.R248C	NTN1_ENST00000546090.1_Missense_Mutation_p.R248C|NTN1_ENST00000538852.1_Missense_Mutation_p.R248C	NM_004822.2	NP_004813.2	O95631	NET1_HUMAN	netrin 1	248	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|establishment of nucleus localization (GO:0040023)|inner ear morphogenesis (GO:0042472)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of axon extension (GO:0030517)|neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of cell proliferation (GO:0008284)|regulation of cell migration (GO:0030334)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)			NTN1/ACLY(2)	central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|lung(5)	13						CACAGACATCCGCGTGGCCTT	0.687																																					p.R248C		Atlas-SNP	.											.	NTN1	31	.	0			c.C742T						.						12.0	12.0	12.0					17																	8926432		2146	4234	6380	SO:0001583	missense	9423	exon2			GACATCCGCGTGG	U75586	CCDS11148.1	17p13-p12	2013-03-01			ENSG00000065320	ENSG00000065320		"""Netrins"""	8029	protein-coding gene	gene with protein product	"""Netrin-1"""	601614				9950216	Standard	NM_004822		Approved	NTN1L	uc002glw.4	O95631	OTTHUMG00000130257	ENST00000173229.2:c.742C>T	chr17.hg19:g.8926432C>T	ENSP00000173229:p.Arg248Cys	81.0	0.0		48.0	34.0	NM_004822	E9KL51	Missense_Mutation	SNP	ENST00000173229.2	hg19	CCDS11148.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435631	0.62955	.	.	ENSG00000065320	ENST00000173229;ENST00000538852;ENST00000546090	D;D;D	0.84944	-1.92;-1.92;-1.92	4.72	4.72	0.59763	Laminin, N-terminal (3);	0.062767	0.64402	D	0.000006	D	0.93200	0.7834	M	0.93594	3.435	0.45366	D	0.998357	D	0.76494	0.999	D	0.67900	0.954	D	0.94223	0.7469	10	0.87932	D	0	.	11.3219	0.49428	0.3085:0.6915:0.0:0.0	.	248	O95631	NET1_HUMAN	C	248	ENSP00000173229:R248C;ENSP00000443259:R248C;ENSP00000441611:R248C	ENSP00000173229:R248C	R	+	1	0	NTN1	8867157	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.809000	0.47971	2.325000	0.78763	0.655000	0.94253	CGC	.	.		0.687	NTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252583.1		
HAP1	9001	hgsc.bcm.edu	37	17	39888530	39888530	+	Missense_Mutation	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr17:39888530C>T	ENST00000310778.5	-	3	675	c.666G>A	c.(664-666)atG>atA	p.M222I	HAP1_ENST00000347901.4_Missense_Mutation_p.M222I|HAP1_ENST00000393939.2_Missense_Mutation_p.M222I|HAP1_ENST00000341193.5_Missense_Mutation_p.M230I|JUP_ENST00000540235.1_Intron|RN7SL399P_ENST00000471648.2_RNA			P54257	HAP1_HUMAN	huntingtin-associated protein 1	222	HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TGTTCTCCTCCATCAAAACAC	0.587																																					p.M230I		Atlas-SNP	.											.	HAP1	48	.	0			c.G690A						.						76.0	69.0	71.0					17																	39888530		2203	4300	6503	SO:0001583	missense	9001	exon3			CTCCTCCATCAAA	AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.666G>A	chr17.hg19:g.39888530C>T	ENSP00000309392:p.Met222Ile	123.0	0.0		79.0	20.0	NM_001079870	A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	ENST00000310778.5	hg19		.	.	.	.	.	.	.	.	.	.	C	12.56	1.975737	0.34848	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	3.79	1.6	0.23607	.	0.131889	0.35378	N	0.003255	T	0.11965	0.0291	L	0.47716	1.5	0.23515	N	0.99752	P;P;B;B	0.38370	0.628;0.628;0.223;0.112	B;B;B;B	0.37601	0.254;0.254;0.085;0.084	T	0.12167	-1.0558	10	0.24483	T	0.36	-9.9294	4.6835	0.12747	0.0:0.6496:0.2259:0.1245	.	222;230;222;222	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	I	222;222;222;230	ENSP00000377513:M222I;ENSP00000309392:M222I;ENSP00000334002:M222I;ENSP00000343170:M230I	ENSP00000309392:M222I	M	-	3	0	HAP1	37142056	0.943000	0.32029	0.993000	0.49108	0.982000	0.71751	-0.195000	0.09546	0.937000	0.37394	0.561000	0.74099	ATG	.	.		0.587	HAP1-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000389619.1	NM_003949	
GHDC	84514	hgsc.bcm.edu	37	17	40344403	40344403	+	Missense_Mutation	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr17:40344403G>A	ENST00000301671.8	-	4	1186	c.745C>T	c.(745-747)Cgg>Tgg	p.R249W	GHDC_ENST00000587427.1_Missense_Mutation_p.R249W|GHDC_ENST00000593209.1_Missense_Mutation_p.R249W|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000428494.2_Missense_Mutation_p.R210W|GHDC_ENST00000436923.2_Missense_Mutation_p.R249W|GHDC_ENST00000414034.3_Missense_Mutation_p.R249W			Q8N2G8	GHDC_HUMAN	GH3 domain containing	249						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		GCCAGTCCCCGTGGCCCCTGC	0.682																																					p.R249W		Atlas-SNP	.											.	GHDC	63	.	0			c.C745T						.						44.0	52.0	49.0					17																	40344403		2201	4297	6498	SO:0001583	missense	84514	exon5			GTCCCCGTGGCCC	AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.745C>T	chr17.hg19:g.40344403G>A	ENSP00000301671:p.Arg249Trp	74.0	0.0		39.0	9.0	NM_001142623	B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	ENST00000301671.8	hg19	CCDS11422.1	.	.	.	.	.	.	.	.	.	.	G	16.44	3.123182	0.56613	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.21	3.24	0.37175	.	0.513584	0.16912	N	0.194459	T	0.55273	0.1910	M	0.64997	1.995	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.962;0.977;0.977	T	0.41466	-0.9507	9	0.72032	D	0.01	-3.9091	5.6388	0.17552	0.2491:0.0:0.7509:0.0	.	210;249;249	E9PDB5;Q8N2G8-2;Q8N2G8	.;.;GHDC_HUMAN	W	193;210;249;249;249	.	ENSP00000301671:R249W	R	-	1	2	GHDC	37597929	1.000000	0.71417	0.871000	0.34182	0.902000	0.53008	2.369000	0.44231	0.986000	0.38683	0.561000	0.74099	CGG	.	.		0.682	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449794.1	NM_032484	
CHAF1A	10036	hgsc.bcm.edu	37	19	4433231	4433231	+	Missense_Mutation	SNP	G	G	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr19:4433231G>T	ENST00000301280.5	+	13	2469	c.2368G>T	c.(2368-2370)Gcc>Tcc	p.A790S	CTB-50L17.5_ENST00000590159.1_RNA|CHAF1A_ENST00000587368.1_3'UTR	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	790	Binds to p60.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGAGGATGCCGCCATCCC	0.652								Chromatin Structure																													p.A790S		Atlas-SNP	.											.	CHAF1A	69	.	0			c.G2368T						.						71.0	72.0	71.0					19																	4433231		2203	4300	6503	SO:0001583	missense	10036	exon13			GAGGATGCCGCCA	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.2368G>T	chr19.hg19:g.4433231G>T	ENSP00000301280:p.Ala790Ser	114.0	0.0		48.0	12.0	NM_005483	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	ENST00000301280.5	hg19	CCDS32875.1	.	.	.	.	.	.	.	.	.	.	G	0.023	-1.398176	0.01175	.	.	ENSG00000167670	ENST00000301280	T	0.25749	1.78	5.65	-6.08	0.02151	.	.	.	.	.	T	0.07503	0.0189	N	0.02011	-0.69	0.09310	N	1	B	0.21381	0.055	B	0.20384	0.029	T	0.42103	-0.9471	8	.	.	.	-0.3293	8.5728	0.33581	0.6025:0.0:0.2903:0.1072	.	790	Q13111	CAF1A_HUMAN	S	790	ENSP00000301280:A790S	.	A	+	1	0	CHAF1A	4384231	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.035000	0.03564	-0.999000	0.03442	-0.345000	0.07892	GCC	.	.		0.652	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483	
UNC13A	23025	hgsc.bcm.edu	37	19	17752293	17752293	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr19:17752293C>A	ENST00000519716.2	-	21	2544	c.2545G>T	c.(2545-2547)Gcc>Tcc	p.A849S	UNC13A_ENST00000552293.1_Missense_Mutation_p.A849S|UNC13A_ENST00000551649.1_Missense_Mutation_p.A849S|UNC13A_ENST00000428389.2_Missense_Mutation_p.A937S|UNC13A_ENST00000252773.7_Missense_Mutation_p.A849S|UNC13A_ENST00000550896.1_Missense_Mutation_p.A847S	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	849					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						ACCTTCCAGGCATCGTCACCC	0.547																																					p.A849S		Atlas-SNP	.											.	UNC13A	299	.	0			c.G2545T						.						115.0	119.0	118.0					19																	17752293		2178	4285	6463	SO:0001583	missense	23025	exon20			TCCAGGCATCGTC	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.2545G>T	chr19.hg19:g.17752293C>A	ENSP00000429562:p.Ala849Ser	135.0	0.0		74.0	14.0	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	hg19	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	c	11.97	1.796618	0.31777	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.81163	-1.45;-1.46;-1.45;-1.31;-1.31;-1.44	3.0	3.0	0.34707	.	0.145258	0.44902	U	0.000415	T	0.63141	0.2486	N	0.16066	0.365	0.41098	D	0.985643	B	0.33299	0.407	B	0.32393	0.145	T	0.61569	-0.7036	10	0.23302	T	0.38	-11.5082	11.8562	0.52439	0.0:1.0:0.0:0.0	.	849	Q9UPW8	UN13A_HUMAN	S	849;937;849;849;849;847	ENSP00000429562:A849S;ENSP00000400409:A937S;ENSP00000252773:A849S;ENSP00000447236:A849S;ENSP00000447572:A849S;ENSP00000446831:A847S	ENSP00000252773:A849S	A	-	1	0	UNC13A	17613293	1.000000	0.71417	0.948000	0.38648	0.467000	0.32768	7.467000	0.80930	1.706000	0.51276	0.299000	0.19835	GCC	.	.		0.547	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
GDF15	9518	hgsc.bcm.edu	37	19	18499391	18499391	+	Silent	SNP	G	G	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr19:18499391G>A	ENST00000252809.3	+	2	605	c.573G>A	c.(571-573)ggG>ggA	p.G191G	MIR3189_ENST00000578735.1_RNA	NM_004864.2	NP_004855.2	Q99988	GDF15_HUMAN	growth differentiation factor 15	191					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)			kidney(2)|large_intestine(1)|liver(1)|lung(5)|prostate(2)|skin(1)	12						CCGCCAGGGGGCGCCGCAGAG	0.726											OREG0025363	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G191G		Atlas-SNP	.											.	GDF15	31	.	0			c.G573A						.						6.0	8.0	7.0					19																	18499391		1894	3896	5790	SO:0001819	synonymous_variant	9518	exon2			CAGGGGGCGCCGC	BC008962	CCDS12376.1	19p13.11	2008-05-14				ENSG00000130513			30142	protein-coding gene	gene with protein product	"""prostate differentiation factor"""	605312				11895857, 9593718	Standard	NM_004864		Approved	PLAB, MIC-1, PDF, MIC1, NAG-1, PTGFB	uc002niv.2	Q99988		ENST00000252809.3:c.573G>A	chr19.hg19:g.18499391G>A		84.0	0.0	726	51.0	11.0	NM_004864	O14629|P78360|Q9BWA0|Q9NRT0	Silent	SNP	ENST00000252809.3	hg19	CCDS12376.1																																																																																			.	.		0.726	GDF15-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466340.2	NM_004864	
SHANK1	50944	hgsc.bcm.edu	37	19	51171702	51171702	+	Missense_Mutation	SNP	C	C	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr19:51171702C>A	ENST00000293441.1	-	22	3533	c.3515G>T	c.(3514-3516)aGc>aTc	p.S1172I	SHANK1_ENST00000391814.1_Missense_Mutation_p.S1180I|SYT3_ENST00000544769.1_5'Flank|SHANK1_ENST00000359082.3_Missense_Mutation_p.S1163I|SHANK1_ENST00000391813.1_Missense_Mutation_p.S559I	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1172					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GCTGCCCTGGCTGCTGCGGCC	0.761																																					p.S1172I		Atlas-SNP	.											.	SHANK1	210	.	0			c.G3515T						.						18.0	19.0	19.0					19																	51171702		1537	3343	4880	SO:0001583	missense	50944	exon22			CCCTGGCTGCTGC	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.3515G>T	chr19.hg19:g.51171702C>A	ENSP00000293441:p.Ser1172Ile	51.0	0.0		24.0	13.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	hg19	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	c	6.535	0.467034	0.12402	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.65364	0.01;0.43;-0.04;-0.15	1.38	1.38	0.22167	.	0.000000	0.52532	U	0.000061	T	0.72326	0.3446	M	0.67397	2.05	0.44807	D	0.997816	D;D	0.69078	0.994;0.997	D;D	0.71184	0.937;0.972	T	0.72988	-0.4124	10	0.66056	D	0.02	.	9.7025	0.40196	0.0:1.0:0.0:0.0	.	1172;559	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	I	1172;559;1163;1180	ENSP00000293441:S1172I;ENSP00000375689:S559I;ENSP00000351984:S1163I;ENSP00000375690:S1180I	ENSP00000293441:S1172I	S	-	2	0	SHANK1	55863514	1.000000	0.71417	0.997000	0.53966	0.789000	0.44602	2.325000	0.43840	0.743000	0.32719	0.165000	0.16767	AGC	.	.		0.761	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
NRSN2	80023	hgsc.bcm.edu	37	20	330326	330326	+	Silent	SNP	C	C	T	rs368963058		TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr20:330326C>T	ENST00000382291.3	+	3	279	c.39C>T	c.(37-39)cgC>cgT	p.R13R	NRSN2_ENST00000492242.1_Intron|NRSN2_ENST00000608736.1_Silent_p.R13R|RP5-1103G7.4_ENST00000442637.1_RNA|NRSN2_ENST00000382285.2_Silent_p.R13R	NM_024958.2	NP_079234.1	Q9GZP1	NRSN2_HUMAN	neurensin 2	13						integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8		all_cancers(10;0.0834)				GCTGCAGCCGCGGCCCCAGCG	0.627																																					p.R13R		Atlas-SNP	.											.	NRSN2	20	.	0			c.C39T						.	C		1,4405	2.1+/-5.4	0,1,2202	47.0	44.0	45.0		39	-4.7	0.0	20		45	0,8600		0,0,4300	no	coding-synonymous	NRSN2	NM_024958.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		13/205	330326	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	80023	exon3			CAGCCGCGGCCCC	AL136915	CCDS12996.1	20p13	2008-02-04	2006-07-04	2006-07-04	ENSG00000125841	ENSG00000125841			16229	protein-coding gene	gene with protein product		610666	"""chromosome 20 open reading frame 98"""	C20orf98		16527258	Standard	NM_024958		Approved	dJ1103G7.6	uc002wdi.4	Q9GZP1	OTTHUMG00000031628	ENST00000382291.3:c.39C>T	chr20.hg19:g.330326C>T		32.0	0.0		59.0	14.0	NM_024958	A8K3B2|Q6FII5|Q9NUD3	Silent	SNP	ENST00000382291.3	hg19	CCDS12996.1																																																																																			.	.		0.627	NRSN2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077446.1	NM_024958	
ANKEF1	63926	hgsc.bcm.edu	37	20	10035112	10035112	+	Missense_Mutation	SNP	A	A	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr20:10035112A>C	ENST00000378380.3	+	9	2366	c.2037A>C	c.(2035-2037)gaA>gaC	p.E679D	SNAP25-AS1_ENST00000421143.2_RNA|AL109754.1_ENST00000408554.2_RNA|SNAP25-AS1_ENST00000603542.1_RNA|ANKEF1_ENST00000488991.1_3'UTR|ANKEF1_ENST00000378392.1_Missense_Mutation_p.E679D	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	679							calcium ion binding (GO:0005509)										GTTTCCAGGAACTGCTGTCAT	0.323																																					p.E679D		Atlas-SNP	.											.	.	.	.	0			c.A2037C						.						74.0	67.0	69.0					20																	10035112		2203	4300	6503	SO:0001583	missense	63926	exon9			CCAGGAACTGCTG	AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.2037A>C	chr20.hg19:g.10035112A>C	ENSP00000367631:p.Glu679Asp	271.0	1.0		253.0	148.0	NM_198798	B3KUQ0|Q9H6Y9	Missense_Mutation	SNP	ENST00000378380.3	hg19	CCDS13108.1	.	.	.	.	.	.	.	.	.	.	A	8.550	0.875343	0.17395	.	.	ENSG00000132623	ENST00000378392;ENST00000378380	T;T	0.67345	-0.26;-0.26	5.08	-0.00848	0.14005	.	0.832250	0.11081	N	0.601856	T	0.54046	0.1834	L	0.53249	1.67	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.39742	-0.9599	10	0.29301	T	0.29	-1.3069	3.9688	0.09444	0.5817:0.0:0.2672:0.1511	.	679	Q9NU02	ANKR5_HUMAN	D	679	ENSP00000367644:E679D;ENSP00000367631:E679D	ENSP00000367631:E679D	E	+	3	2	ANKRD5	9983112	0.472000	0.25870	0.034000	0.17996	0.005000	0.04900	0.965000	0.29319	0.015000	0.14971	0.533000	0.62120	GAA	.	.		0.323	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096	
HUNK	30811	hgsc.bcm.edu	37	21	33368209	33368209	+	Silent	SNP	C	C	T			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr21:33368209C>T	ENST00000270112.2	+	10	1794	c.1434C>T	c.(1432-1434)acC>acT	p.T478T	HUNK_ENST00000465574.1_3'UTR	NM_014586.1	NP_055401.1	P57058	HUNK_HUMAN	hormonally up-regulated Neu-associated kinase	478					multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(2)|stomach(1)	30						TTCAGAACACCAAAGCCCTCC	0.557																																					p.T478T		Atlas-SNP	.											.	HUNK	74	.	0			c.C1434T						.						53.0	49.0	50.0					21																	33368209		2203	4300	6503	SO:0001819	synonymous_variant	30811	exon10			GAACACCAAAGCC	AJ271722	CCDS13610.1	21q22.1	2008-06-05	2008-06-05		ENSG00000142149	ENSG00000142149			13326	protein-coding gene	gene with protein product		606532	"""hormonally upregulated Neu-associated kinase"""			10662544, 10830953	Standard	NM_014586		Approved		uc002yph.3	P57058	OTTHUMG00000085019	ENST00000270112.2:c.1434C>T	chr21.hg19:g.33368209C>T		295.0	0.0		212.0	39.0	NM_014586		Silent	SNP	ENST00000270112.2	hg19	CCDS13610.1																																																																																			.	.		0.557	HUNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000192782.1	NM_014586	
C22orf42	150297	hgsc.bcm.edu	37	22	32555161	32555161	+	Silent	SNP	G	G	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr22:32555161G>C	ENST00000382097.3	-	1	114	c.42C>G	c.(40-42)ggC>ggG	p.G14G	RP1-90G24.8_ENST00000426354.1_lincRNA	NM_001010859.1	NP_001010859.1	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	14										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	24						CACAGTTGAGGCCCCCGCTGG	0.572																																					p.G14G		Atlas-SNP	.											.	C22orf42	37	.	0			c.C42G						.						59.0	58.0	58.0					22																	32555161		2203	4300	6503	SO:0001819	synonymous_variant	150297	exon1			GTTGAGGCCCCCG	BC040263	CCDS33639.1	22q12.3	2009-03-05			ENSG00000205856	ENSG00000205856			27160	protein-coding gene	gene with protein product						12477932	Standard	XM_005261369		Approved		uc003amd.3	Q6IC83	OTTHUMG00000030380	ENST00000382097.3:c.42C>G	chr22.hg19:g.32555161G>C		68.0	0.0		28.0	12.0	NM_001010859	A4QPH5	Silent	SNP	ENST00000382097.3	hg19	CCDS33639.1																																																																																			.	.		0.572	C22orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075268.2	NM_001010859	
SBF1	6305	hgsc.bcm.edu	37	22	50903443	50903443	+	Missense_Mutation	SNP	T	T	C			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr22:50903443T>C	ENST00000390679.3	-	12	1503	c.1319A>G	c.(1318-1320)gAc>gGc	p.D440G	SBF1_ENST00000348911.6_Missense_Mutation_p.D441G|SBF1_ENST00000380817.3_Missense_Mutation_p.D440G			O95248	MTMR5_HUMAN	SET binding factor 1	440					cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		ATCGAACAGGTCCGTAGGGCG	0.632																																					p.D440G		Atlas-SNP	.											.	SBF1	211	.	0			c.A1319G						.						73.0	80.0	78.0					22																	50903443		2165	4243	6408	SO:0001583	missense	6305	exon12			AACAGGTCCGTAG	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.1319A>G	chr22.hg19:g.50903443T>C	ENSP00000375097:p.Asp440Gly	106.0	0.0		67.0	20.0	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	hg19		.	.	.	.	.	.	.	.	.	.	T	16.54	3.152443	0.57259	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	D;D;D	0.88664	-2.41;-2.41;-2.41	3.93	3.93	0.45458	.	0.000000	0.85682	D	0.000000	D	0.93268	0.7855	M	0.75615	2.305	0.80722	D	1	D;D;D	0.89917	1.0;0.986;0.993	D;P;P	0.72338	0.977;0.795;0.879	D	0.93877	0.7167	10	0.87932	D	0	.	12.6118	0.56556	0.0:0.0:0.0:1.0	.	440;441;440	O95248;G5E933;O95248-4	MTMR5_HUMAN;.;.	G	440;441;451;450;440	ENSP00000370196:D440G;ENSP00000252027:D441G;ENSP00000375097:D440G	ENSP00000336522:D450G	D	-	2	0	SBF1	49250309	1.000000	0.71417	0.986000	0.45419	0.251000	0.25915	5.941000	0.70195	1.650000	0.50662	0.533000	0.62120	GAC	.	.		0.632	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
CYLC1	1538	hgsc.bcm.edu	37	X	83128066	83128066	+	Missense_Mutation	SNP	A	A	G			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chrX:83128066A>G	ENST00000329312.4	+	4	387	c.350A>G	c.(349-351)aAg>aGg	p.K117R		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	117					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GAATATAAAAAGTCCAAAGAT	0.373																																					p.K117R		Atlas-SNP	.											.	CYLC1	272	.	0			c.A350G						.						31.0	29.0	30.0					X																	83128066		2199	4290	6489	SO:0001583	missense	1538	exon4			ATAAAAAGTCCAA	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.350A>G	chrX.hg19:g.83128066A>G	ENSP00000331556:p.Lys117Arg	649.0	0.0		274.0	84.0	NM_021118	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	ENST00000329312.4	hg19	CCDS35341.1	.	.	.	.	.	.	.	.	.	.	a	11.87	1.768219	0.31320	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.59502	0.26	4.53	-1.26	0.09376	.	.	.	.	.	T	0.42404	0.1201	L	0.34521	1.04	0.09310	N	1	B;B	0.25609	0.13;0.13	B;B	0.30029	0.11;0.11	T	0.39313	-0.9620	9	0.62326	D	0.03	0.0379	4.5435	0.12069	0.3438:0.3304:0.0:0.3258	.	117;117	P35663;F5H4V5	CYLC1_HUMAN;.	R	117	ENSP00000331556:K117R	ENSP00000331556:K117R	K	+	2	0	CYLC1	83014722	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.212000	0.17497	-0.431000	0.07307	-1.227000	0.01581	AAG	.	.		0.373	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
TRIP11	9321	hgsc.bcm.edu	37	14	92472196	92472197	+	Frame_Shift_Ins	INS	-	-	T	rs570814392	byFrequency	TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr14:92472196_92472197insT	ENST00000267622.4	-	11	2496_2497	c.2123_2124insA	c.(2122-2124)aacfs	p.N708fs		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	708					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CCACAATAGTGTTTTTTTCCAG	0.366			T	PDGFRB	AML																																p.N708fs	Ovarian(84;609 1888 9852 42686)	Atlas-INDEL	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.,1	TRIP11	184	.	0			c.2124_2125insA						.																																			SO:0001589	frameshift_variant	9321	exon11			.	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.2124dupA	chr14.hg19:g.92472203_92472203dupT	ENSP00000267622:p.Asn708fs	117.0	0.0		60.0	30.0	NM_004239	B2RUT2|O14689|O15154|O95949	Frame_Shift_Ins	INS	ENST00000267622.4	hg19	CCDS9899.1																																																																																			.	.		0.366	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
SNRNP200	23020	hgsc.bcm.edu	37	2	96943407	96943412	+	In_Frame_Del	DEL	CCATTG	CCATTG	-			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	CCATTG	CCATTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr2:96943407_96943412delCCATTG	ENST00000323853.5	-	41	5873_5878	c.5796_5801delCAATGG	c.(5794-5802)agcaatggg>agg	p.1932_1934SNG>R	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1932	SEC63 2.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						GCTGAGCCACCCATTGCTGGAAAGGA	0.558																																					p.1933_1934del		Atlas-INDEL	.											.	SNRNP200	195	.	0			c.5797_5802del						.																																			SO:0001651	inframe_deletion	23020	exon41			.	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.5796_5801delCAATGG	chr2.hg19:g.96943407_96943412delCCATTG	ENSP00000317123:p.Ser1932_Gly1934delinsArg	44.0	0.0		33.0	11.0	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	In_Frame_Del	DEL	ENST00000323853.5	hg19	CCDS2020.1																																																																																			.	.		0.558	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
EDRF1	26098	hgsc.bcm.edu	37	10	127412384	127412385	+	Frame_Shift_Ins	INS	-	-	A			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr10:127412384_127412385insA	ENST00000356792.4	+	4	621_622	c.389_390insA	c.(388-393)ataaaafs	p.IK130fs	C10orf137_ENST00000337623.3_Frame_Shift_Ins_p.IK130fs	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTTAAGAACATAAAAAAACTCC	0.322																																					p.I130fs		Atlas-INDEL	.											.	C10orf137	153	.	0			c.389_390insA						.																																			SO:0001589	frameshift_variant	26098	exon4			.																												ENST00000356792.4:c.396dupA	chr10.hg19:g.127412391_127412391dupA	ENSP00000349244:p.Ile130fs	450.0	0.0		264.0	120.0	NM_015608	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Frame_Shift_Ins	INS	ENST00000356792.4	hg19	CCDS55733.1																																																																																			.	.		0.322	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
UGT2B7	7364	hgsc.bcm.edu	37	4	69962520	69962521	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-ED-A8O6-01A-11D-A35Z-10	TCGA-ED-A8O6-10A-01D-A35Z-10	TA	TA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	221a49cd-a340-42e9-bd68-d2d4ccbc5de7	e2037316-e8bd-4188-93cb-eb040674c788	g.chr4:69962520_69962521delTA	ENST00000508661.1	+	1	309_310	c.282_283delTA	c.(280-285)attaagfs	p.K95fs	UGT2B7_ENST00000509763.1_Intron|UGT2B7_ENST00000305231.7_Frame_Shift_Del_p.K95fs			P16662	UD2B7_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B7	95					androgen metabolic process (GO:0008209)|cellular glucuronidation (GO:0052695)|lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	38					Atorvastatin(DB01076)|Carbamazepine(DB00564)|Chenodeoxycholic acid(DB06777)|Codeine(DB00318)|Dabigatran etexilate(DB06695)|Dapagliflozin(DB06292)|Diclofenac(DB00586)|Epirubicin(DB00445)|Etodolac(DB00749)|Ezetimibe(DB00973)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Losartan(DB00678)|Lovastatin(DB00227)|Mitiglinide(DB01252)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naproxen(DB00788)|Oxazepam(DB00842)|Pitavastatin(DB08860)|Silodosin(DB06207)|Simvastatin(DB00641)|Suprofen(DB00870)|Tapentadol(DB06204)|Valproic Acid(DB00313)|Zidovudine(DB00495)	TGCAACAGATTAAGAGATGGTC	0.327																																					p.94_94del		Atlas-INDEL	.											.	UGT2B7	79	.	0			c.281_282del						.																																			SO:0001589	frameshift_variant	7364	exon1			.	BC030974	CCDS3526.1	4q13	2008-02-05	2005-07-20		ENSG00000171234	ENSG00000171234		"""UDP glucuronosyltransferases"""	12554	protein-coding gene	gene with protein product		600068	"""UDP glycosyltransferase 2 family, polypeptide B7"""			2159463, 7835904	Standard	NM_001074		Approved	UGT2B9	uc003heg.4	P16662	OTTHUMG00000129404	ENST00000508661.1:c.282_283delTA	chr4.hg19:g.69962520_69962521delTA	ENSP00000427659:p.Lys95fs	181.0	0.0		128.0	46.0	NM_001074	B2R810|Q6GTW0	Frame_Shift_Del	DEL	ENST00000508661.1	hg19																																																																																				.	.		0.327	UGT2B7-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000362103.1	NM_001074	
