#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
ARID1A	8289	hgsc.bcm.edu	37	1	27101342	27101342	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:27101342G>T	ENST00000324856.7	+	18	4995	c.4624G>T	c.(4624-4626)Gaa>Taa	p.E1542*	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.E1159*|ARID1A_ENST00000457599.2_Intron	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1542					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.E1542*(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGCCAACCACGAAGGCTCGTG	0.642			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.E1542X		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	ARID1A,caecum,carcinoma,-2,1	ARID1A	842	.	1	Substitution - Nonsense(1)	ovary(1)	c.G4624T						.						60.0	63.0	62.0					1																	27101342		2203	4300	6503	SO:0001587	stop_gained	8289	exon18			AACCACGAAGGCT	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4624G>T	chr1.hg19:g.27101342G>T	ENSP00000320485:p.Glu1542*	79.0	0.0		50.0	36.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	43|43	10.343878|10.343878	0.99388|0.99388	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000324856;ENST00000374152|ENST00000430799	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.045702|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75287	.|0.3829	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72743	.|-0.4201	.|4	0.42905|.	T|.	0.14|.	-7.5866|-7.5866	19.3941|19.3941	0.94598|0.94598	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	1542;1159|438	.|.	ENSP00000320485:E1542X|.	E|R	+|+	1|2	0|0	ARID1A|ARID1A	26973929|26973929	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.479000|0.479000	0.33129|0.33129	9.144000|9.144000	0.94629|0.94629	2.822000|2.822000	0.97130|0.97130	0.557000|0.557000	0.71058|0.71058	GAA|CGA	.	.		0.642	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
AKIRIN1	79647	hgsc.bcm.edu	37	1	39463936	39463936	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:39463936C>T	ENST00000432648.3	+	2	472	c.314C>T	c.(313-315)tCg>tTg	p.S105L	AKIRIN1_ENST00000372984.4_Intron|AKIRIN1_ENST00000446189.2_Missense_Mutation_p.S105L	NM_024595.2	NP_078871.1	Q9H9L7	AKIR1_HUMAN	akirin 1	105						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				lung(1)|prostate(1)|skin(1)	3						GCTTGTGCTTCGGAAAGTCAA	0.388																																					p.S105L		Atlas-SNP	.											.	AKIRIN1	7	.	0			c.C314T						.						85.0	83.0	84.0					1																	39463936		2203	4300	6503	SO:0001583	missense	79647	exon2			GTGCTTCGGAAAG	AK022728	CCDS433.1, CCDS44113.1	1p34.3	2013-10-11	2008-06-23	2008-06-23	ENSG00000174574	ENSG00000174574			25744	protein-coding gene	gene with protein product		615164	"""chromosome 1 open reading frame 108"""	C1orf108		19200367	Standard	NM_024595		Approved	FLJ12666	uc001ccw.3	Q9H9L7	OTTHUMG00000007496	ENST00000432648.3:c.314C>T	chr1.hg19:g.39463936C>T	ENSP00000392678:p.Ser105Leu	68.0	0.0		38.0	24.0	NM_024595	B4DZU6|Q0VDB3|Q53FK8	Missense_Mutation	SNP	ENST00000432648.3	hg19	CCDS433.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.982818|3.982818	0.74474|0.74474	.|.	.|.	ENSG00000174574|ENSG00000174574	ENST00000531822|ENST00000432648;ENST00000446189	.|T;T	.|0.64260	.|-0.09;-0.09	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.274240	.|0.34777	.|N	.|0.003686	T|T	0.61714|0.61714	0.2369|0.2369	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;P	.|0.56521	.|0.976;0.948	.|P;B	.|0.51385	.|0.668;0.254	T|T	0.65841|0.65841	-0.6070|-0.6070	5|10	.|0.62326	.|D	.|0.03	-6.9641|-6.9641	16.4569|16.4569	0.84021|0.84021	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|105;105	.|B4DZU6;Q9H9L7	.|.;AKIR1_HUMAN	W|L	67|105	.|ENSP00000392678:S105L;ENSP00000389866:S105L	.|ENSP00000392678:S105L	R|S	+|+	1|2	2|0	AKIRIN1|AKIRIN1	39236523|39236523	0.988000|0.988000	0.35896|0.35896	0.966000|0.966000	0.40874|0.40874	0.982000|0.982000	0.71751|0.71751	2.292000|2.292000	0.43549|0.43549	2.534000|2.534000	0.85438|0.85438	0.563000|0.563000	0.77884|0.77884	CGG|TCG	.	.		0.388	AKIRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019687.2	NM_024595	
PRMT6	55170	hgsc.bcm.edu	37	1	107599362	107599362	+	Missense_Mutation	SNP	C	C	T	rs539124873	byFrequency	TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:107599362C>T	ENST00000370078.1	+	1	62	c.25C>T	c.(25-27)Ctt>Ttt	p.L9F	PRMT6_ENST00000361318.5_5'UTR			Q96LA8	ANM6_HUMAN	protein arginine methyltransferase 6	9					base-excision repair (GO:0006284)|histone H3-R2 methylation (GO:0034970)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	histone binding (GO:0042393)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H2A-R3 specific) (GO:0070612)|histone methyltransferase activity (H3-R2 specific) (GO:0070611)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)			biliary_tract(1)|breast(2)|kidney(1)|large_intestine(4)|lung(5)|urinary_tract(1)	14		all_epithelial(167;0.000429)|all_lung(203;0.00122)|Lung NSC(277;0.00185)		Lung(183;0.0305)|Epithelial(280;0.0765)|Colorectal(144;0.0998)|all cancers(265;0.14)|LUSC - Lung squamous cell carcinoma(189;0.173)|BRCA - Breast invasive adenocarcinoma(282;0.242)		GAAAAGAAAGCTTGAGTCGGG	0.706																																					p.L9F		Atlas-SNP	.											.	PRMT6	55	.	0			c.C25T						.						8.0	12.0	11.0					1																	107599362		683	1578	2261	SO:0001583	missense	55170	exon1			AGAAAGCTTGAGT	AK001421	CCDS41360.1, CCDS41360.2	1p13.2	2008-02-05	2006-02-16	2006-02-16	ENSG00000198890	ENSG00000198890		"""Protein arginine methyltransferases"""	18241	protein-coding gene	gene with protein product		608274	"""HMT1 hnRNP methyltransferase-like 6 (S. cerevisiae)"""	HRMT1L6		11724789	Standard	NM_018137		Approved	FLJ10559	uc010ous.2	Q96LA8	OTTHUMG00000010964	ENST00000370078.1:c.25C>T	chr1.hg19:g.107599362C>T	ENSP00000359095:p.Leu9Phe	37.0	0.0		34.0	14.0	NM_018137	A3KME1|B4DID8|Q5T5Y5|Q6DKI4|Q9NVR8	Missense_Mutation	SNP	ENST00000370078.1	hg19	CCDS41360.2	.	.	.	.	.	.	.	.	.	.	C	15.87	2.961994	0.53400	.	.	ENSG00000198890	ENST00000370078	T	0.26810	1.71	4.85	0.326	0.15908	.	3.494140	0.01036	N	0.004231	T	0.03739	0.0106	N	0.08118	0	0.80722	D	1	B	0.34015	0.435	B	0.24269	0.052	T	0.35226	-0.9797	10	0.38643	T	0.18	-9.5259	2.4087	0.04419	0.3624:0.3819:0.1583:0.0973	.	9	Q96LA8	ANM6_HUMAN	F	9	ENSP00000359095:L9F	ENSP00000359095:L9F	L	+	1	0	PRMT6	107400885	0.999000	0.42202	0.992000	0.48379	0.871000	0.50021	0.653000	0.24902	0.214000	0.20742	-0.332000	0.08345	CTT	.	.		0.706	PRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030185.1	NM_018137	
PRPF38B	55119	hgsc.bcm.edu	37	1	109242492	109242492	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:109242492T>C	ENST00000370025.4	+	6	1760	c.1491T>C	c.(1489-1491)tcT>tcC	p.S497S	PRPF38B_ENST00000370021.1_Silent_p.S386S	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	497					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		AAGAAAAATCTAGAAAGCGTA	0.398																																					p.S497S		Atlas-SNP	.											.	PRPF38B	55	.	0			c.T1491C						.						115.0	115.0	115.0					1																	109242492		2203	4300	6503	SO:0001819	synonymous_variant	55119	exon6			AAAATCTAGAAAG	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.1491T>C	chr1.hg19:g.109242492T>C		183.0	0.0		206.0	75.0	NM_018061	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Silent	SNP	ENST00000370025.4	hg19	CCDS788.1																																																																																			.	.		0.398	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030231.1	NM_018061	
LRIF1	55791	hgsc.bcm.edu	37	1	111494007	111494007	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:111494007T>C	ENST00000369763.4	-	2	1889	c.1499A>G	c.(1498-1500)aAa>aGa	p.K500R	RP11-96K19.2_ENST00000440689.1_RNA|LRIF1_ENST00000494675.1_Intron|LRIF1_ENST00000485275.2_Intron	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1	500					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						GACACTTCCTTTTCTAGCATA	0.393																																					p.K500R		Atlas-SNP	.											.	LRIF1	65	.	0			c.A1499G						.						166.0	156.0	160.0					1																	111494007		2203	4300	6503	SO:0001583	missense	55791	exon2			CTTCCTTTTCTAG	AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.1499A>G	chr1.hg19:g.111494007T>C	ENSP00000358778:p.Lys500Arg	135.0	0.0		128.0	44.0	NM_018372	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	Missense_Mutation	SNP	ENST00000369763.4	hg19	CCDS30800.1	.	.	.	.	.	.	.	.	.	.	T	1.571	-0.534080	0.04082	.	.	ENSG00000121931	ENST00000369763	T	0.39406	1.08	1.06	1.06	0.20224	.	.	.	.	.	T	0.14356	0.0347	L	0.51422	1.61	0.09310	N	1	B	0.30281	0.275	B	0.25405	0.06	T	0.21861	-1.0233	9	0.66056	D	0.02	-4.0474	4.0121	0.09627	0.0:0.0:0.0:1.0	.	500	Q5T3J3	LRIF1_HUMAN	R	500	ENSP00000358778:K500R	ENSP00000358778:K500R	K	-	2	0	LRIF1	111295530	0.935000	0.31712	0.697000	0.30258	0.646000	0.38490	0.147000	0.16202	0.115000	0.18071	0.113000	0.15668	AAA	.	.		0.393	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000032932.2	NM_018372	
NUP210L	91181	hgsc.bcm.edu	37	1	154042865	154042865	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:154042865A>G	ENST00000368559.3	-	17	2509	c.2438T>C	c.(2437-2439)tTc>tCc	p.F813S	NUP210L_ENST00000271854.3_Missense_Mutation_p.F813S	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	813					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TAGTGAACTGAAATTATCAAA	0.368																																					p.F813S		Atlas-SNP	.											.	NUP210L	181	.	0			c.T2438C						.						119.0	107.0	111.0					1																	154042865		1862	4089	5951	SO:0001583	missense	91181	exon17			GAACTGAAATTAT	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.2438T>C	chr1.hg19:g.154042865A>G	ENSP00000357547:p.Phe813Ser	121.0	0.0		142.0	47.0	NM_001159484	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	ENST00000368559.3	hg19	CCDS41399.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.985650	0.74589	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.24151	1.87;1.87	5.0	5.0	0.66597	.	0.109676	0.40908	D	0.000981	T	0.22085	0.0532	M	0.69358	2.11	0.31685	N	0.64267	D;D	0.57899	0.981;0.981	P;P	0.52109	0.69;0.69	T	0.08472	-1.0720	10	0.20046	T	0.44	-29.4441	12.3464	0.55124	1.0:0.0:0.0:0.0	.	813;813	E7EP56;Q5VU65	.;P210L_HUMAN	S	813	ENSP00000357547:F813S;ENSP00000271854:F813S	ENSP00000271854:F813S	F	-	2	0	NUP210L	152309489	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.731000	0.74785	1.910000	0.55303	0.321000	0.21382	TTC	.	.		0.368	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
LMNA	4000	hgsc.bcm.edu	37	1	156106182	156106183	+	Missense_Mutation	DNP	GG	GG	TA			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:156106182_156106183GG>TA	ENST00000368300.4	+	7	1547_1548	c.1335_1336GG>TA	c.(1333-1338)gtGGat>gtTAat	p.D446N	LMNA_ENST00000448611.2_Missense_Mutation_p.D334N|LMNA_ENST00000368297.1_Missense_Mutation_p.D365N|LMNA_ENST00000368301.2_Missense_Mutation_p.D446N|LMNA_ENST00000368299.3_Missense_Mutation_p.D446N|LMNA_ENST00000392353.3_Missense_Mutation_p.D365N|LMNA_ENST00000361308.4_Missense_Mutation_p.D446N|LMNA_ENST00000496738.1_3'UTR|LMNA_ENST00000473598.2_Missense_Mutation_p.D347N|LMNA_ENST00000347559.2_Missense_Mutation_p.D446N	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	446	LTD.|Tail.		D -> V (in EDMD2). {ECO:0000269|PubMed:14684700}.		activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					TGGAGGAGGTGGATGAGGAGGG	0.609									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.V445V|p.D446N		Atlas-SNP	.											.	LMNA	31	.	0			c.G1335T|c.G1336A						.																																			SO:0001583	missense	4000	exon7	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	GGAGGTGGATGAG|GAGGTGGATGAGG	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	Exception_encountered	chr1.hg19:g.156106182_156106183delinsTA	ENSP00000357283:p.Asp446Asn	53.0	0.0		69.0|68.0	35.0	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent|Missense_Mutation	SNP	ENST00000368300.4	hg19	CCDS1129.1																																																																																			.	.		0.609	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
NUF2	83540	hgsc.bcm.edu	37	1	163325198	163325198	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:163325198A>G	ENST00000271452.3	+	14	1613	c.1334A>G	c.(1333-1335)tAt>tGt	p.Y445C	NUF2_ENST00000524800.1_Missense_Mutation_p.Y398C|NUF2_ENST00000367900.3_Missense_Mutation_p.Y445C	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	445	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					GAGGACTCCTATGCTAAGATA	0.348																																					p.Y445C		Atlas-SNP	.											.	NUF2	138	.	0			c.A1334G						.						84.0	88.0	86.0					1																	163325198		2203	4300	6503	SO:0001583	missense	83540	exon14			ACTCCTATGCTAA	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1334A>G	chr1.hg19:g.163325198A>G	ENSP00000271452:p.Tyr445Cys	207.0	0.0		272.0	65.0	NM_145697	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	hg19	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	A	15.05	2.717779	0.48622	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.29655	1.56;1.56;1.56	5.11	-10.2	0.00374	.	2.319440	0.01322	N	0.010962	T	0.03305	0.0096	N	0.02011	-0.69	0.22961	N	0.998509	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.25117	-1.0141	9	0.45353	T	0.12	8.6129	10.061	0.42275	0.2144:0.3045:0.4811:0.0	.	398;445	E9PQC4;Q9BZD4	.;NUF2_HUMAN	C	398;445;445	ENSP00000436888:Y398C;ENSP00000356875:Y445C;ENSP00000271452:Y445C	ENSP00000271452:Y445C	Y	+	2	0	NUF2	161591822	0.000000	0.05858	0.000000	0.03702	0.962000	0.63368	-0.478000	0.06575	-1.513000	0.01789	0.482000	0.46254	TAT	.	.		0.348	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697	
IL18R1	8809	hgsc.bcm.edu	37	2	102988510	102988510	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:102988510A>C	ENST00000409599.1	+	5	756	c.400A>C	c.(400-402)Aaa>Caa	p.K134Q	IL18R1_ENST00000334376.3_Missense_Mutation_p.K134Q|IL18R1_ENST00000233957.1_Missense_Mutation_p.K134Q			Q13478	IL18R_HUMAN	interleukin 18 receptor 1	134	Ig-like C2-type 2.				immune response (GO:0006955)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|signal transduction (GO:0007165)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|interleukin-18 receptor activity (GO:0042008)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|large_intestine(11)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						GGAAGTTAAAAAATTTTTTCA	0.279																																					p.K134Q		Atlas-SNP	.											.	IL18R1	72	.	0			c.A400C						.						38.0	41.0	40.0					2																	102988510		2201	4295	6496	SO:0001583	missense	8809	exon3			GTTAAAAAATTTT	U43672	CCDS2060.1	2q12	2013-01-29			ENSG00000115604	ENSG00000115604		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5988	protein-coding gene	gene with protein product		604494				8626725, 10191101	Standard	NM_003855		Approved	IL1RRP, IL-1Rrp, CD218a	uc010fiy.3	Q13478	OTTHUMG00000130780	ENST00000409599.1:c.400A>C	chr2.hg19:g.102988510A>C	ENSP00000387211:p.Lys134Gln	190.0	0.0		178.0	65.0	NM_003855	B2R9Y5|Q52LC9	Missense_Mutation	SNP	ENST00000409599.1	hg19	CCDS2060.1	.	.	.	.	.	.	.	.	.	.	A	13.68	2.309550	0.40895	.	.	ENSG00000115604	ENST00000410040;ENST00000409599;ENST00000233957;ENST00000334376	T;T;T	0.10573	2.86;2.86;2.86	5.15	4.0	0.46444	.	0.355112	0.25552	N	0.029887	T	0.18383	0.0441	L	0.49778	1.585	0.09310	N	1	P;D;P	0.57257	0.901;0.979;0.901	P;P;P	0.59546	0.692;0.859;0.692	T	0.07385	-1.0775	10	0.23891	T	0.37	.	7.5431	0.27751	0.9023:0.0:0.0977:0.0	.	134;134;134	B7ZKV7;Q86YL8;Q13478	.;.;IL18R_HUMAN	Q	134	ENSP00000386663:K134Q;ENSP00000387211:K134Q;ENSP00000233957:K134Q	ENSP00000233957:K134Q	K	+	1	0	IL18R1	102354942	0.037000	0.19845	0.001000	0.08648	0.003000	0.03518	2.614000	0.46359	0.932000	0.37266	0.459000	0.35465	AAA	.	.		0.279	IL18R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253294.2	NM_003855	
ZNF804A	91752	hgsc.bcm.edu	37	2	185800964	185800964	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr2:185800964C>T	ENST00000302277.6	+	4	1435	c.841C>T	c.(841-843)Cca>Tca	p.P281S		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	281							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TTTTCATCCACCAGAGGCAAT	0.368																																					p.P281S		Atlas-SNP	.											.	ZNF804A	322	.	0			c.C841T						.						62.0	59.0	60.0					2																	185800964		2203	4299	6502	SO:0001583	missense	91752	exon4			CATCCACCAGAGG	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.841C>T	chr2.hg19:g.185800964C>T	ENSP00000303252:p.Pro281Ser	24.0	0.0		46.0	16.0	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	hg19	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	1.718	-0.497322	0.04291	.	.	ENSG00000170396	ENST00000302277	T	0.65364	-0.15	5.57	0.304	0.15796	.	0.359593	0.24083	N	0.041715	T	0.36220	0.0959	N	0.22421	0.69	0.09310	N	1	B	0.26195	0.144	B	0.15870	0.014	T	0.20672	-1.0268	10	0.08599	T	0.76	-0.3547	6.7364	0.23411	0.1192:0.4811:0.3323:0.0675	.	281	Q7Z570	Z804A_HUMAN	S	281	ENSP00000303252:P281S	ENSP00000303252:P281S	P	+	1	0	ZNF804A	185509209	0.282000	0.24268	0.345000	0.25642	0.849000	0.48306	1.301000	0.33447	-0.017000	0.14103	0.591000	0.81541	CCA	.	.		0.368	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
STXBP5L	9515	hgsc.bcm.edu	37	3	120876465	120876465	+	Missense_Mutation	SNP	A	A	G	rs371884493		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:120876465A>G	ENST00000273666.6	+	9	1139	c.868A>G	c.(868-870)Att>Gtt	p.I290V	STXBP5L_ENST00000492541.1_Missense_Mutation_p.I290V|STXBP5L_ENST00000472879.1_Missense_Mutation_p.I290V|STXBP5L_ENST00000497029.1_Missense_Mutation_p.I290V|STXBP5L_ENST00000471454.1_Missense_Mutation_p.I290V	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	290					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		CCAGACCACAATTCCACATGG	0.418																																					p.I290V		Atlas-SNP	.											.	STXBP5L	159	.	0			c.A868G						.	A	VAL/ILE	2,3800		0,2,1899	97.0	88.0	91.0		868	-1.1	1.0	3		91	0,8226		0,0,4113	no	missense	STXBP5L	NM_014980.2	29	0,2,6012	GG,GA,AA		0.0,0.0526,0.0166	benign	290/1187	120876465	2,12026	1901	4113	6014	SO:0001583	missense	9515	exon9			ACCACAATTCCAC	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.868A>G	chr3.hg19:g.120876465A>G	ENSP00000273666:p.Ile290Val	70.0	0.0		51.0	12.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	hg19	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	7.892	0.732435	0.15507	5.26E-4	0.0	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.54071	0.59;1.63;0.59;0.59;1.63;1.63	5.26	-1.14	0.09741	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.344395	0.34314	N	0.004078	T	0.19208	0.0461	N	0.02539	-0.55	0.26059	N	0.981373	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34403	-0.9830	10	0.02654	T	1	-31.9659	11.0024	0.47614	0.4002:0.0:0.5998:0.0	.	290;290	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	V	290	ENSP00000273666:I290V;ENSP00000420019:I290V;ENSP00000419627:I290V;ENSP00000420287:I290V;ENSP00000420666:I290V;ENSP00000420167:I290V	ENSP00000273666:I290V	I	+	1	0	STXBP5L	122359155	1.000000	0.71417	0.997000	0.53966	0.980000	0.70556	0.923000	0.28757	-0.119000	0.11830	-0.385000	0.06624	ATT	.	.		0.418	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
COL6A6	131873	hgsc.bcm.edu	37	3	130282231	130282231	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:130282231G>T	ENST00000358511.6	+	2	415	c.384G>T	c.(382-384)aaG>aaT	p.K128N	COL6A6_ENST00000453409.2_Missense_Mutation_p.K128N	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	128	Nonhelical region.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGAGAGACAAGAAACAGTTTC	0.498																																					p.K128N		Atlas-SNP	.											.	COL6A6	497	.	0			c.G384T						.						42.0	42.0	42.0					3																	130282231		1886	4112	5998	SO:0001583	missense	131873	exon2			AGACAAGAAACAG	AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.384G>T	chr3.hg19:g.130282231G>T	ENSP00000351310:p.Lys128Asn	86.0	0.0		75.0	36.0	NM_001102608	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	ENST00000358511.6	hg19	CCDS46911.1	.	.	.	.	.	.	.	.	.	.	G	8.613	0.889623	0.17540	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82984	-1.67;-1.67	5.21	3.29	0.37713	von Willebrand factor, type A (3);	0.460721	0.20698	N	0.087328	T	0.70456	0.3226	L	0.31476	0.935	0.22050	N	0.999394	B	0.06786	0.001	B	0.13407	0.009	T	0.57499	-0.7801	10	0.34782	T	0.22	.	6.782	0.23650	0.165:0.1489:0.6862:0.0	.	128	A6NMZ7	CO6A6_HUMAN	N	128	ENSP00000351310:K128N;ENSP00000399236:K128N	ENSP00000351310:K128N	K	+	3	2	COL6A6	131764921	0.047000	0.20315	0.873000	0.34254	0.315000	0.28087	0.440000	0.21592	1.334000	0.45468	0.561000	0.74099	AAG	.	.		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356705.5	NM_001102608	
PIK3R4	30849	hgsc.bcm.edu	37	3	130427320	130427320	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr3:130427320T>A	ENST00000356763.3	-	10	2905	c.2348A>T	c.(2347-2349)gAg>gTg	p.E783V		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	783	Poly-Glu.				innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TTTGTCTTCCTCTTCCTCTGT	0.358																																					p.E783V		Atlas-SNP	.											.	PIK3R4	145	.	0			c.A2348T						.						158.0	146.0	150.0					3																	130427320		2202	4300	6502	SO:0001583	missense	30849	exon10			TCTTCCTCTTCCT	Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.2348A>T	chr3.hg19:g.130427320T>A	ENSP00000349205:p.Glu783Val	163.0	0.0		200.0	78.0	NM_014602	Q2TBF4	Missense_Mutation	SNP	ENST00000356763.3	hg19	CCDS3067.1	.	.	.	.	.	.	.	.	.	.	T	12.99	2.103191	0.37145	.	.	ENSG00000196455	ENST00000356763;ENST00000508273	T;T	0.46451	0.87;0.89	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.38665	0.1049	L	0.51422	1.61	0.80722	D	1	B	0.19331	0.035	B	0.11329	0.006	T	0.15235	-1.0444	10	0.25751	T	0.34	-30.3496	15.4838	0.75548	0.0:0.0:0.0:1.0	.	783	Q99570	PI3R4_HUMAN	V	783;142	ENSP00000349205:E783V;ENSP00000427302:E142V	ENSP00000349205:E783V	E	-	2	0	PIK3R4	131910010	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.615000	0.83006	2.058000	0.61347	0.460000	0.39030	GAG	.	.		0.358	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356668.1	NM_014602	
EXOC1	55763	hgsc.bcm.edu	37	4	56744128	56744128	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:56744128A>G	ENST00000381295.2	+	9	1468	c.1120A>G	c.(1120-1122)Act>Gct	p.T374A	EXOC1_ENST00000346134.7_Missense_Mutation_p.T374A|EXOC1_ENST00000349598.6_Missense_Mutation_p.T374A	NM_001024924.1	NP_001020095.1	Q9NV70	EXOC1_HUMAN	exocyst complex component 1	374					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	35	Glioma(25;0.08)|all_neural(26;0.101)					TGTTGAACTGACTTTACCCAA	0.373																																					p.T374A		Atlas-SNP	.											.	EXOC1	103	.	0			c.A1120G						.						154.0	134.0	141.0					4																	56744128		2203	4300	6503	SO:0001583	missense	55763	exon9			GAACTGACTTTAC	AK027047	CCDS3502.1, CCDS3503.1	4q12	2013-01-22	2005-11-01	2005-11-01	ENSG00000090989	ENSG00000090989			30380	protein-coding gene	gene with protein product		607879	"""SEC3-like 1 (S. cerevisiae)"""	SEC3L1		11042152, 11406615	Standard	XM_005265747		Approved	SEC3, FLJ10893, BM-102, Sec3p	uc003hbf.1	Q9NV70	OTTHUMG00000102165	ENST00000381295.2:c.1120A>G	chr4.hg19:g.56744128A>G	ENSP00000370695:p.Thr374Ala	60.0	0.0		71.0	24.0	NM_018261	Q504V4|Q8WUE7|Q96T15|Q9NZE4	Missense_Mutation	SNP	ENST00000381295.2	hg19	CCDS3502.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.096395	0.56075	.	.	ENSG00000090989	ENST00000381295;ENST00000346134;ENST00000349598	.	.	.	5.65	4.46	0.54185	.	0.089605	0.85682	N	0.000000	T	0.45856	0.1363	L	0.41236	1.265	0.80722	D	1	B;B	0.22683	0.073;0.008	B;B	0.28305	0.088;0.042	T	0.22765	-1.0207	9	0.09843	T	0.71	.	10.8708	0.46883	0.9236:0.0:0.0764:0.0	.	374;374	Q9NV70-2;Q9NV70	.;EXOC1_HUMAN	A	374	.	ENSP00000326514:T374A	T	+	1	0	EXOC1	56438885	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.867000	0.69597	0.962000	0.38057	0.455000	0.32223	ACT	.	.		0.373	EXOC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361799.1	NM_018261	
CENPC	1060	hgsc.bcm.edu	37	4	68396566	68396566	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:68396566C>A	ENST00000273853.6	-	5	548	c.298G>T	c.(298-300)Gtt>Ttt	p.V100F		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	100					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										GGTTCTACAACAAACTGTAGA	0.388																																					p.V100F		Atlas-SNP	.											.	CENPC1	66	.	0			c.G298T						.						68.0	67.0	67.0					4																	68396566		1826	4082	5908	SO:0001583	missense	1060	exon5			CTACAACAAACTG	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.298G>T	chr4.hg19:g.68396566C>A	ENSP00000273853:p.Val100Phe	57.0	0.0		66.0	18.0	NM_001812	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	hg19	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	6.723	0.502156	0.12822	.	.	ENSG00000145241	ENST00000273853	.	.	.	4.22	-8.44	0.00950	.	2.868950	0.01019	N	0.003950	T	0.13200	0.0320	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24225	-1.0166	9	0.10902	T	0.67	2.1738	1.7234	0.02916	0.2099:0.3068:0.3181:0.1651	.	100;100	Q8IW27;Q03188	.;CENPC_HUMAN	F	100	.	ENSP00000273853:V100F	V	-	1	0	CENPC1	68079161	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-3.781000	0.00368	-2.873000	0.00322	-0.982000	0.02568	GTT	.	.		0.388	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
PF4V1	5197	hgsc.bcm.edu	37	4	74719566	74719566	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:74719566G>A	ENST00000226524.3	+	2	341	c.167G>A	c.(166-168)aGg>aAg	p.R56K		NM_002620.2	NP_002611.1	P10720	PF4V_HUMAN	platelet factor 4 variant 1	56					cell chemotaxis (GO:0060326)|immune response (GO:0006955)	extracellular space (GO:0005615)	heparin binding (GO:0008201)			endometrium(1)|liver(2)	3	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GTCCGTCCCAGGCACATCACC	0.607																																					p.R56K		Atlas-SNP	.											.	PF4V1	8	.	0			c.G167A						.						56.0	60.0	59.0					4																	74719566		2202	4296	6498	SO:0001583	missense	5197	exon2			GTCCCAGGCACAT	M26167	CCDS3561.1	4q12-q21	2008-08-15			ENSG00000109272	ENSG00000109272			8862	protein-coding gene	gene with protein product		173461				2725510	Standard	NM_002620		Approved	SCYB4V1, CXCL4V1, CXCL4L1	uc003hhg.1	P10720	OTTHUMG00000130177	ENST00000226524.3:c.167G>A	chr4.hg19:g.74719566G>A	ENSP00000226524:p.Arg56Lys	58.0	0.0		62.0	23.0	NM_002620	A1L4S0	Missense_Mutation	SNP	ENST00000226524.3	hg19	CCDS3561.1	.	.	.	.	.	.	.	.	.	.	G	0.799	-0.756074	0.03019	.	.	ENSG00000109272	ENST00000226524	T	0.04862	3.54	4.12	-4.36	0.03645	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.802256	0.11866	N	0.521853	T	0.02418	0.0074	N	0.04132	-0.27	0.09310	N	1	B	0.24651	0.108	B	0.28991	0.097	T	0.42515	-0.9447	10	0.02654	T	1	.	11.6031	0.51015	0.348:0.0:0.652:0.0	.	56	P10720	PF4V_HUMAN	K	56	ENSP00000226524:R56K	ENSP00000226524:R56K	R	+	2	0	PF4V1	74938430	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	0.038000	0.13862	-0.820000	0.04318	-0.768000	0.03414	AGG	.	.		0.607	PF4V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252495.1		
CDKL2	8999	hgsc.bcm.edu	37	4	76551045	76551045	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:76551045A>G	ENST00000429927.2	-	2	831	c.128T>C	c.(127-129)aTg>aCg	p.M43T	CDKL2_ENST00000307465.4_Missense_Mutation_p.M43T	NM_003948.3	NP_003939.1	Q92772	CDKL2_HUMAN	cyclin-dependent kinase-like 2 (CDC2-related kinase)	43	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				sex differentiation (GO:0007548)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)			breast(3)|endometrium(1)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(2)|stomach(2)	22			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			CTTTTTAACCATTTTGTCATC	0.323																																					p.M43T		Atlas-SNP	.											.	CDKL2	58	.	0			c.T128C						.						174.0	166.0	169.0					4																	76551045		2202	4300	6502	SO:0001583	missense	8999	exon2			TTAACCATTTTGT	U35146	CCDS3570.1	4q21.21	2011-11-04			ENSG00000138769	ENSG00000138769		"""Cyclin-dependent kinases"""	1782	protein-coding gene	gene with protein product		603442				9000130	Standard	NM_003948		Approved	P56, KKIAMRE	uc003hiq.3	Q92772	OTTHUMG00000130103	ENST00000429927.2:c.128T>C	chr4.hg19:g.76551045A>G	ENSP00000412365:p.Met43Thr	104.0	0.0		133.0	54.0	NM_003948	B2R695	Missense_Mutation	SNP	ENST00000429927.2	hg19	CCDS3570.1	.	.	.	.	.	.	.	.	.	.	A	4.164	0.028925	0.08054	.	.	ENSG00000138769	ENST00000429927;ENST00000307465	T;T	0.63744	-0.06;-0.06	5.04	2.68	0.31781	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.38348	0.1037	N	0.11845	0.185	0.30427	N	0.777591	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.30416	-0.9979	9	0.10902	T	0.67	-19.8366	8.963	0.35858	0.8371:0.0:0.1629:0.0	.	43;43	B4DH08;Q92772	.;CDKL2_HUMAN	T	43	ENSP00000412365:M43T;ENSP00000306340:M43T	ENSP00000306340:M43T	M	-	2	0	CDKL2	76770069	0.986000	0.35501	1.000000	0.80357	0.998000	0.95712	1.208000	0.32345	1.055000	0.40461	0.533000	0.62120	ATG	.	.		0.323	CDKL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252409.2	NM_003948	
WDFY3	23001	hgsc.bcm.edu	37	4	85663040	85663040	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:85663040T>C	ENST00000295888.4	-	38	6515	c.6108A>G	c.(6106-6108)ggA>ggG	p.G2036G	WDFY3_ENST00000322366.6_Silent_p.G2036G	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2036					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCTGGTAGCTTCCTCCACTGG	0.403																																					p.G2036G		Atlas-SNP	.											.	WDFY3	314	.	0			c.A6108G						.						73.0	72.0	73.0					4																	85663040		2203	4300	6503	SO:0001819	synonymous_variant	23001	exon38			GTAGCTTCCTCCA	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.6108A>G	chr4.hg19:g.85663040T>C		86.0	0.0		93.0	38.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	ENST00000295888.4	hg19	CCDS3609.1																																																																																			.	.		0.403	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
NDST3	9348	hgsc.bcm.edu	37	4	118975959	118975959	+	Silent	SNP	A	A	G	rs372361471		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr4:118975959A>G	ENST00000296499.5	+	2	1297	c.894A>G	c.(892-894)acA>acG	p.T298T	NDST3_ENST00000433996.2_Silent_p.T298T	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	298	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AGAGGCTGACATTGTCCTTGG	0.398																																					p.T298T		Atlas-SNP	.											.	NDST3	107	.	0			c.A894G						.	A		0,4406		0,0,2203	155.0	144.0	148.0		894	-10.5	0.0	4		148	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	NDST3	NM_004784.2		0,1,6501	GG,GA,AA		0.0116,0.0,0.0077		298/874	118975959	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	9348	exon2			GCTGACATTGTCC	AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.894A>G	chr4.hg19:g.118975959A>G		69.0	0.0		60.0	23.0	NM_004784	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Silent	SNP	ENST00000296499.5	hg19	CCDS3708.1																																																																																			.	.		0.398	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256517.4	NM_004784	
IL31RA	133396	hgsc.bcm.edu	37	5	55202077	55202077	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:55202077G>C	ENST00000447346.2	+	9	1278	c.1213G>C	c.(1213-1215)Gaa>Caa	p.E405Q	IL31RA_ENST00000297015.3_Missense_Mutation_p.E263Q|IL31RA_ENST00000396834.1_Missense_Mutation_p.E386Q|IL31RA_ENST00000359040.5_Missense_Mutation_p.E405Q|IL31RA_ENST00000354961.4_Missense_Mutation_p.E386Q|IL31RA_ENST00000396836.2_Missense_Mutation_p.E405Q|IL31RA_ENST00000490985.1_Missense_Mutation_p.E263Q	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	373	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				CCTTTCCTGGGAATCTGTGTC	0.527																																					p.E405Q		Atlas-SNP	.											.	IL31RA	84	.	0			c.G1213C						.						111.0	104.0	106.0					5																	55202077		2203	4300	6503	SO:0001583	missense	133396	exon9			TCCTGGGAATCTG	AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1213G>C	chr5.hg19:g.55202077G>C	ENSP00000415900:p.Glu405Gln	57.0	0.0		54.0	25.0	NM_001242637	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	ENST00000447346.2	hg19	CCDS3970.2	.	.	.	.	.	.	.	.	.	.	G	12.69	2.014725	0.35511	.	.	ENSG00000164509	ENST00000396836;ENST00000396834;ENST00000447346;ENST00000359040;ENST00000297015;ENST00000490985;ENST00000354961	T;T;T;T;T;T;T	0.44083	1.52;1.17;1.14;1.16;1.33;0.93;1.17	4.95	4.95	0.65309	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.903970	0.09722	N	0.764265	T	0.42449	0.1203	L	0.42581	1.335	0.29837	N	0.829572	P;P;P;P;P	0.51537	0.911;0.884;0.884;0.946;0.607	P;P;B;P;B	0.49665	0.532;0.54;0.421;0.618;0.419	T	0.06285	-1.0835	10	0.10377	T	0.69	-7.9589	11.4193	0.49971	0.0:0.1821:0.8179:0.0	.	373;405;386;405;405	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2;Q8NI17-8	IL31R_HUMAN;.;.;.;.	Q	405;386;405;405;263;263;386	ENSP00000380048:E405Q;ENSP00000380046:E386Q;ENSP00000415900:E405Q;ENSP00000351935:E405Q;ENSP00000297015:E263Q;ENSP00000427533:E263Q;ENSP00000347047:E386Q	ENSP00000297015:E263Q	E	+	1	0	IL31RA	55237834	1.000000	0.71417	0.997000	0.53966	0.813000	0.45954	3.262000	0.51538	2.586000	0.87340	0.655000	0.94253	GAA	.	.		0.527	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214148.1	NM_139017	
HTR1A	3350	hgsc.bcm.edu	37	5	63256420	63256420	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:63256420T>A	ENST00000323865.3	-	1	1360	c.1127A>T	c.(1126-1128)cAc>cTc	p.H376L	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	376					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GGTGGGCATGTGGCAGCTGCT	0.532																																					p.H376L		Atlas-SNP	.											.	HTR1A	128	.	0			c.A1127T						.						139.0	145.0	143.0					5																	63256420		2203	4300	6503	SO:0001583	missense	3350	exon1			GGCATGTGGCAGC	AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.1127A>T	chr5.hg19:g.63256420T>A	ENSP00000316244:p.His376Leu	61.0	0.0		63.0	24.0	NM_000524	Q6LAE7	Missense_Mutation	SNP	ENST00000323865.3	hg19	CCDS34168.1	.	.	.	.	.	.	.	.	.	.	T	8.267	0.812444	0.16537	.	.	ENSG00000178394	ENST00000323865	T	0.69435	-0.4	5.7	3.19	0.36642	GPCR, rhodopsin-like superfamily (1);	0.510690	0.22553	N	0.058571	T	0.44871	0.1314	N	0.21240	0.645	0.38590	D	0.950406	B	0.30146	0.27	B	0.28916	0.096	T	0.27971	-1.0058	10	0.09843	T	0.71	.	7.4116	0.27021	0.0:0.0747:0.1441:0.7812	.	376	P08908	5HT1A_HUMAN	L	376	ENSP00000316244:H376L	ENSP00000316244:H376L	H	-	2	0	HTR1A	63292176	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.751000	0.47508	0.998000	0.38996	0.533000	0.62120	CAC	.	.		0.532	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368397.1	NM_000524	
MTX3	345778	hgsc.bcm.edu	37	5	79287047	79287047	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:79287047C>A	ENST00000512528.1	-	1	35	c.15G>T	c.(13-15)ttG>ttT	p.L5F	MTX3_ENST00000509852.1_Missense_Mutation_p.L5F|MTX3_ENST00000512560.1_5'UTR			Q5HYI7	MTX3_HUMAN	metaxin 3	5					protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				endometrium(1)|large_intestine(3)|lung(2)|urinary_tract(1)	7		Lung NSC(167;0.00428)|all_lung(232;0.00455)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;1.63e-45)|Epithelial(54;2.9e-40)|all cancers(79;4.68e-35)		AACTGAGTTCCAAGGGGGCCG	0.652																																					p.L5F		Atlas-SNP	.											.	MTX3	29	.	0			c.G15T						.						5.0	7.0	6.0					5																	79287047		1640	3567	5207	SO:0001583	missense	345778	exon1			GAGTTCCAAGGGG	BX538064	CCDS47239.1, CCDS47239.2, CCDS54872.1	5q14.1	2004-08-18				ENSG00000177034			24812	protein-coding gene	gene with protein product						15087125	Standard	NM_001010891		Approved		uc010jah.3	Q5HYI7		ENST00000512528.1:c.15G>T	chr5.hg19:g.79287047C>A	ENSP00000424798:p.Leu5Phe	27.0	0.0		26.0	14.0	NM_001010891	B4DL65|E9PB57|Q7Z380|Q8NB92	Missense_Mutation	SNP	ENST00000512528.1	hg19		.	.	.	.	.	.	.	.	.	.	C	15.99	2.996853	0.54147	.	.	ENSG00000177034	ENST00000328496;ENST00000509852;ENST00000512528;ENST00000418095	T;T	0.54675	0.56;0.59	5.1	3.32	0.38043	.	0.167153	0.48286	D	0.000187	T	0.45816	0.1361	L	0.49126	1.545	0.28350	N	0.920937	B;B	0.31859	0.343;0.006	B;B	0.33799	0.17;0.011	T	0.46775	-0.9167	10	0.44086	T	0.13	-0.8557	10.5593	0.45135	0.0:0.8425:0.0:0.1575	.	5;5	Q5HYI7-4;Q5HYI7	.;MTX3_HUMAN	F	5	ENSP00000423302:L5F;ENSP00000424798:L5F	ENSP00000331672:L5F	L	-	3	2	MTX3	79322803	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.687000	0.46976	1.511000	0.48818	0.655000	0.94253	TTG	.	.		0.652	MTX3-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372567.1	XM_293971	
FBXW11	23291	hgsc.bcm.edu	37	5	171296743	171296743	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:171296743C>T	ENST00000265094.5	-	11	1594	c.1457G>A	c.(1456-1458)cGc>cAc	p.R486H	FBXW11_ENST00000393802.2_Missense_Mutation_p.R452H|FBXW11_ENST00000296933.6_Missense_Mutation_p.R473H|FBXW11_ENST00000425623.2_Missense_Mutation_p.R454H	NM_012300.2	NP_036432.2	Q9UKB1	FBW1B_HUMAN	F-box and WD repeat domain containing 11	486					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	21	Renal(175;0.000159)|Lung NSC(126;0.00384)|all_lung(126;0.00659)	Medulloblastoma(196;0.00853)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CACCAATGTGCGCAAACACAA	0.468																																					p.R486H		Atlas-SNP	.											.	FBXW11	72	.	0			c.G1457A						.						66.0	50.0	55.0					5																	171296743		2203	4300	6503	SO:0001583	missense	23291	exon11			AATGTGCGCAAAC	AB014596	CCDS34289.1, CCDS47340.1, CCDS47341.1	5q35.1	2013-01-09	2007-02-08	2004-06-16	ENSG00000072803	ENSG00000072803		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13607	protein-coding gene	gene with protein product		605651	"""F-box and WD-40 domain protein 1B"", ""F-box and WD-40 domain protein 11"""	FBXW1B		10531035, 10694485	Standard	NM_033644		Approved	KIAA0696, Fbw1b, BTRCP2, BTRC2, Hos, Fbw11	uc003mbm.1	Q9UKB1	OTTHUMG00000163267	ENST00000265094.5:c.1457G>A	chr5.hg19:g.171296743C>T	ENSP00000265094:p.Arg486His	48.0	0.0		46.0	22.0	NM_012300	B2RC98|Q9P2S8|Q9P2S9|Q9Y4C6	Missense_Mutation	SNP	ENST00000265094.5	hg19	CCDS34289.1	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478284	0.63849	.	.	ENSG00000072803	ENST00000296933;ENST00000265094;ENST00000393802;ENST00000425623	T;T;T;T	0.60424	0.19;0.19;0.19;0.19	5.48	5.48	0.80851	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.40570	0.1122	N	0.13198	0.31	0.80722	D	1	P;B;P;P	0.36392	0.551;0.346;0.551;0.496	B;B;B;B	0.26202	0.046;0.027;0.067;0.04	T	0.42413	-0.9453	10	0.48119	T	0.1	-10.3967	18.9821	0.92758	0.0:1.0:0.0:0.0	.	454;452;486;473	B4DH70;Q9UKB1-2;Q9UKB1;Q9UKB1-3	.;.;FBW1B_HUMAN;.	H	473;486;452;454	ENSP00000296933:R473H;ENSP00000265094:R486H;ENSP00000377391:R452H;ENSP00000444929:R454H	ENSP00000265094:R486H	R	-	2	0	FBXW11	171229348	1.000000	0.71417	1.000000	0.80357	0.635000	0.38103	7.770000	0.85390	2.572000	0.86782	0.655000	0.94253	CGC	.	.		0.468	FBXW11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000372382.1	NM_012300	
COL12A1	1303	hgsc.bcm.edu	37	6	75855116	75855116	+	Missense_Mutation	SNP	G	G	A	rs373216375		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:75855116G>A	ENST00000322507.8	-	25	4925	c.4616C>T	c.(4615-4617)aCg>aTg	p.T1539M	COL12A1_ENST00000416123.2_Missense_Mutation_p.T1539M|COL12A1_ENST00000483888.2_Missense_Mutation_p.T1539M|COL12A1_ENST00000345356.6_Missense_Mutation_p.T375M	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1539	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						TGCATACTCCGTGTTGGGAAC	0.478																																					p.T1539M		Atlas-SNP	.											.	COL12A1	385	.	0			c.C4616T						.						98.0	104.0	102.0					6																	75855116		2089	4232	6321	SO:0001583	missense	1303	exon25			TACTCCGTGTTGG	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4616C>T	chr6.hg19:g.75855116G>A	ENSP00000325146:p.Thr1539Met	34.0	0.0		24.0	17.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	ENST00000322507.8	hg19	CCDS43482.1	.	.	.	.	.	.	.	.	.	.	G	15.40	2.823489	0.50739	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.62232	0.04;0.04;0.04;0.04	5.34	4.46	0.54185	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.064401	0.64402	D	0.000009	T	0.78457	0.4286	M	0.89715	3.055	0.51233	D	0.999917	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83526	0.0088	10	0.56958	D	0.05	.	15.3834	0.74679	0.0:0.0:0.8594:0.1406	.	375;1539	Q99715-2;Q99715	.;COCA1_HUMAN	M	1539;1539;375;1539;1539	ENSP00000325146:T1539M;ENSP00000305147:T375M;ENSP00000412864:T1539M;ENSP00000421216:T1539M	ENSP00000325146:T1539M	T	-	2	0	COL12A1	75911836	1.000000	0.71417	0.663000	0.29738	0.024000	0.10985	9.395000	0.97266	1.226000	0.43582	0.655000	0.94253	ACG	.	.		0.478	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
FGFR1OP	11116	hgsc.bcm.edu	37	6	167438330	167438330	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:167438330A>G	ENST00000366847.4	+	9	1098	c.867A>G	c.(865-867)ttA>ttG	p.L289L	RP11-517H2.6_ENST00000609590.1_RNA|FGFR1OP_ENST00000349556.4_Silent_p.L269L	NM_007045.2	NP_008976.1	O95684	FR1OP_HUMAN	FGFR1 oncogene partner	289					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein tyrosine kinase activity (GO:0061099)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|protein tyrosine kinase inhibitor activity (GO:0030292)			large_intestine(2)|ovary(1)|stomach(1)	4		Breast(66;1.48e-05)|Ovarian(120;0.0607)		OV - Ovarian serous cystadenocarcinoma(33;1.73e-19)|BRCA - Breast invasive adenocarcinoma(81;5.1e-06)|GBM - Glioblastoma multiforme(31;0.00231)		CACCCCCCTTAAAAAGTGGAC	0.483			T	FGFR1	"""MPD, NHL"""																																p.L289L		Atlas-SNP	.		Dom	yes		6	6q27	11116	FGFR1 oncogene partner (FOP)		L	.	FGFR1OP	24	.	0			c.A867G						.						113.0	128.0	123.0					6																	167438330		2203	4300	6503	SO:0001819	synonymous_variant	11116	exon9			CCCCTTAAAAAGT	Y18046	CCDS5296.1, CCDS5297.1, CCDS75550.1	6q27	2008-02-05			ENSG00000213066	ENSG00000213066			17012	protein-coding gene	gene with protein product		605392				9949182, 10373756	Standard	NM_007045		Approved	FOP	uc003qvj.3	O95684	OTTHUMG00000016011	ENST00000366847.4:c.867A>G	chr6.hg19:g.167438330A>G		80.0	0.0		30.0	23.0	NM_007045	A8K1D1|B2R705|Q49AI0|Q5R3F6|Q96EW1	Silent	SNP	ENST00000366847.4	hg19	CCDS5296.1																																																																																			.	.		0.483	FGFR1OP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043099.2	NM_007045	
FAM220A	84792	hgsc.bcm.edu	37	7	6370386	6370386	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:6370386C>T	ENST00000313324.4	-	2	867	c.400G>A	c.(400-402)Ggg>Agg	p.G134R	FAM220A_ENST00000533877.1_5'Flank	NM_001037163.1	NP_001032240.1	Q7Z4H9	F220A_HUMAN	family with sequence similarity 220, member A	134						nucleus (GO:0005634)											GCCCTGGGCCCTCCTCCCAGC	0.612																																					p.G134R		Atlas-SNP	.											.	.	.	.	0			c.G400A						.						33.0	36.0	35.0					7																	6370386		2203	4300	6503	SO:0001583	missense	84792	exon2			TGGGCCCTCCTCC	BC006110	CCDS34599.1	7p22.1	2012-03-19	2012-03-19	2012-03-19	ENSG00000178397	ENSG00000178397			22422	protein-coding gene	gene with protein product	"""STAT3-interacting protein as a repressor"""		"""chromosome 7 open reading frame 70"""	C7orf70			Standard	NM_001037163		Approved	SIPAR, MGC12966	uc003spu.3	Q7Z4H9	OTTHUMG00000122091	ENST00000313324.4:c.400G>A	chr7.hg19:g.6370386C>T	ENSP00000317289:p.Gly134Arg	32.0	0.0		45.0	14.0	NM_001037163	Q75ML2|Q8NA52|Q9BRR7	Missense_Mutation	SNP	ENST00000313324.4	hg19	CCDS34599.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.069454	0.36470	.	.	ENSG00000178397	ENST00000313324	T	0.08370	3.1	5.29	2.44	0.29823	.	1.072050	0.07395	U	0.889859	T	0.17577	0.0422	L	0.50333	1.59	0.09310	N	0.999999	D	0.59357	0.985	P	0.58820	0.846	T	0.17776	-1.0358	10	0.51188	T	0.08	-0.2748	5.3453	0.16006	0.1483:0.632:0.1429:0.0768	.	134	Q7Z4H9	SIPAR_HUMAN	R	134	ENSP00000317289:G134R	ENSP00000317289:G134R	G	-	1	0	C7orf70	6336911	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	0.603000	0.24149	0.216000	0.20781	-0.175000	0.13238	GGG	.	.		0.612	FAM220A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000242853.2	NM_001037163	
GRM8	2918	hgsc.bcm.edu	37	7	126542649	126542649	+	Missense_Mutation	SNP	C	C	A	rs78947184		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr7:126542649C>A	ENST00000339582.2	-	6	1911	c.1103G>T	c.(1102-1104)gGc>gTc	p.G368V	GRM8_ENST00000444921.2_Missense_Mutation_p.G368V|GRM8_ENST00000358373.3_Missense_Mutation_p.G368V|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000405249.1_Missense_Mutation_p.G368V			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	368			G -> D. {ECO:0000269|Ref.6}.		adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TAACTTGCAGCCAAAATTCTC	0.373										HNSCC(24;0.065)																											p.G368V		Atlas-SNP	.											.	GRM8	377	.	0			c.G1103T						.						87.0	86.0	86.0					7																	126542649		2203	4300	6503	SO:0001583	missense	2918	exon5			TTGCAGCCAAAAT		CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1103G>T	chr7.hg19:g.126542649C>A	ENSP00000344173:p.Gly368Val	77.0	0.0		66.0	28.0	NM_000845	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	ENST00000339582.2	hg19	CCDS5794.1	.	.	.	.	.	.	.	.	.	.	C	12.29	1.893439	0.33442	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	4.88	4.88	0.63580	Extracellular ligand-binding receptor (1);	0.266832	0.38111	N	0.001801	D	0.84624	0.5513	L	0.47716	1.5	0.80722	D	1	B;B;B	0.18013	0.009;0.002;0.025	B;B;B	0.21151	0.021;0.003;0.033	T	0.82510	-0.0421	10	0.72032	D	0.01	.	17.0297	0.86457	0.0:1.0:0.0:0.0	.	368;368;368	O00222-3;O00222-2;O00222	.;.;GRM8_HUMAN	V	368	ENSP00000344173:G368V;ENSP00000409790:G368V;ENSP00000351142:G368V;ENSP00000385731:G368V	ENSP00000344173:G368V	G	-	2	0	GRM8	126329885	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.385000	0.44371	2.251000	0.74343	0.511000	0.50034	GGC	.	C|0.995;T|0.005		0.373	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000059209.4		
XKR5	389610	hgsc.bcm.edu	37	8	6681084	6681084	+	RNA	SNP	A	A	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:6681084A>T	ENST00000518724.1	-	0	746							Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		TTTGTAGAACAGAACCAGACT	0.532																																					p.L199Q		Atlas-SNP	.											.	XKR5	20	.	0			c.T596A						.						42.0	48.0	46.0					8																	6681084		2009	4167	6176			389610	exon4			TAGAACAGAACCA	AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		chr8.hg19:g.6681084A>T		82.0	0.0		85.0	36.0	NM_207411	Q5GH74	Missense_Mutation	SNP	ENST00000518724.1	hg19																																																																																				.	.		0.532	XKR5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000331969.2	NM_207411	
OPLAH	26873	hgsc.bcm.edu	37	8	145112593	145112593	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr8:145112593C>T	ENST00000426825.1	-	10	1261	c.1180G>A	c.(1180-1182)Gct>Act	p.A394T	OPLAH_ENST00000534424.1_5'UTR	NM_017570.3	NP_060040.1	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	394					glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	5-oxoprolinase (ATP-hydrolyzing) activity (GO:0017168)|ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	20	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACCAGATTAGCATCCGTCACT	0.647																																					p.A394T		Atlas-SNP	.											.	OPLAH	78	.	0			c.G1180A						.						18.0	22.0	21.0					8																	145112593		2015	4154	6169	SO:0001583	missense	26873	exon10			GATTAGCATCCGT	AF024672, AB122018	CCDS75802.1	8q24.3	2010-11-23			ENSG00000178814	ENSG00000178814	3.5.2.9		8149	protein-coding gene	gene with protein product		614243				14993790	Standard	NM_017570		Approved	OPLA, 5-Opase	uc003zar.3	O14841		ENST00000426825.1:c.1180G>A	chr8.hg19:g.145112593C>T	ENSP00000475943:p.Ala394Thr	58.0	0.0		48.0	22.0	NM_017570	A5PKY8|Q75W65|Q9Y4Q0	Missense_Mutation	SNP	ENST00000426825.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.55	2.567423	0.45694	.	.	ENSG00000178814	ENST00000426825	.	.	.	4.31	4.31	0.51392	.	0.054782	0.64402	D	0.000001	T	0.77922	0.4203	.	.	.	0.44908	D	0.997921	D	0.69078	0.997	D	0.69654	0.965	D	0.84442	0.0583	7	0.87932	D	0	.	14.6309	0.68655	0.0:1.0:0.0:0.0	.	394	O14841	OPLA_HUMAN	T	394	.	ENSP00000412071:A394T	A	-	1	0	OPLAH	145184581	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	3.592000	0.53993	2.103000	0.63969	0.467000	0.42956	GCT	.	.		0.647	OPLAH-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017570	
ABHD17B	51104	hgsc.bcm.edu	37	9	74481719	74481719	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:74481719T>G	ENST00000333421.6	-	4	962	c.851A>C	c.(850-852)gAa>gCa	p.E284A	ABHD17B_ENST00000377041.2_Missense_Mutation_p.E284A	NM_001025780.1	NP_001020951.1	Q5VST6	AB17B_HUMAN	abhydrolase domain containing 17B	284						extracellular region (GO:0005576)|membrane (GO:0016020)	hydrolase activity (GO:0016787)										ATTTACCAGTTCCTGTGACAC	0.388																																					p.E284A		Atlas-SNP	.											.	FAM108B1	24	.	0			c.A851C						.						55.0	52.0	53.0					9																	74481719		2203	4300	6503	SO:0001583	missense	51104	exon4			ACCAGTTCCTGTG	AF151825	CCDS35042.1, CCDS35043.1	9q21.2	2013-03-15	2013-03-15	2013-03-15	ENSG00000107362	ENSG00000107362		"""Abhydrolase domain containing"""	24278	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 77"", ""family with sequence similarity 108, member B1"""	C9orf77, FAM108B1		10810093	Standard	XM_006717134		Approved	CGI-67	uc004ail.3	Q5VST6	OTTHUMG00000020001	ENST00000333421.6:c.851A>C	chr9.hg19:g.74481719T>G	ENSP00000330222:p.Glu284Ala	40.0	0.0		31.0	12.0	NM_016014	A8KAJ5|Q5VST7|Q86YB6|Q8IY03|Q9Y377	Missense_Mutation	SNP	ENST00000333421.6	hg19	CCDS35043.1	.	.	.	.	.	.	.	.	.	.	T	19.47	3.833591	0.71258	.	.	ENSG00000107362	ENST00000377041;ENST00000333421	T;T	0.40476	1.03;1.4	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.65585	0.2705	M	0.77616	2.38	0.80722	D	1	D;D	0.65815	0.991;0.995	P;D	0.68621	0.881;0.959	T	0.70193	-0.4939	10	0.87932	D	0	-15.1162	16.07	0.80919	0.0:0.0:0.0:1.0	.	284;284	Q5VST6;Q5VST6-2	F108B_HUMAN;.	A	284	ENSP00000366240:E284A;ENSP00000330222:E284A	ENSP00000330222:E284A	E	-	2	0	FAM108B1	73671539	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.844000	0.86867	2.254000	0.74563	0.533000	0.62120	GAA	.	.		0.388	ABHD17B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052625.1	NM_016014	
CDK5RAP2	55755	hgsc.bcm.edu	37	9	123199606	123199606	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr9:123199606G>A	ENST00000349780.4	-	25	4101	c.3922C>T	c.(3922-3924)Ctg>Ttg	p.L1308L	CDK5RAP2_ENST00000360822.3_Silent_p.L1276L|CDK5RAP2_ENST00000360190.4_Silent_p.L1308L|CDK5RAP2_ENST00000359309.3_Silent_p.L1267L	NM_018249.4	NP_060719.4	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1308					brain development (GO:0007420)|centrosome organization (GO:0051297)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of centriole replication (GO:0046600)|negative regulation of neuron differentiation (GO:0045665)|neurogenesis (GO:0022008)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|regulation of spindle checkpoint (GO:0090231)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|protein kinase binding (GO:0019901)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)			breast(6)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(6)|urinary_tract(1)	58						TTCTCCAGCAGCTCAGCACAT	0.493																																					p.L1308L		Atlas-SNP	.											.	CDK5RAP2	157	.	0			c.C3922T						.						158.0	119.0	132.0					9																	123199606		2203	4300	6503	SO:0001819	synonymous_variant	55755	exon25			CCAGCAGCTCAGC	BK005504	CCDS6823.1, CCDS43871.1, CCDS75888.1	9q33.3	2014-02-21			ENSG00000136861	ENSG00000136861			18672	protein-coding gene	gene with protein product	"""centrosomin"""	608201	"""microcephaly, primary autosomal recessive 3"""	MCPH3		10721722, 17764569, 24466316	Standard	NM_018249		Approved	C48, FLJ10867, CEP215	uc004bkf.4	Q96SN8	OTTHUMG00000021043	ENST00000349780.4:c.3922C>T	chr9.hg19:g.123199606G>A		89.0	0.0		67.0	33.0	NM_018249	Q5JV18|Q7Z3L4|Q7Z3U1|Q7Z7I6|Q9BSW0|Q9H6J6|Q9HCD9|Q9NV90|Q9UIW9	Silent	SNP	ENST00000349780.4	hg19	CCDS6823.1																																																																																			.	.		0.493	CDK5RAP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055535.1	NM_018249	
ABCC8	6833	hgsc.bcm.edu	37	11	17418528	17418528	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:17418528G>A	ENST00000389817.3	-	33	4122	c.4054C>T	c.(4054-4056)Cgc>Tgc	p.R1352C	ABCC8_ENST00000302539.4_Missense_Mutation_p.R1353C			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1352	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> H (in LIH; partially impairs ATP- dependent potassium channel function). {ECO:0000269|PubMed:15356046}.|R -> P (in HHF1; dbSNP:rs28936370). {ECO:0000269|PubMed:9769320}.		carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTGTCGTAGCGCACGCTCAGG	0.627																																					p.R1352C		Atlas-SNP	.											ABCC8,NS,carcinoma,0,1	ABCC8	170	.	0			c.C4054T						.						134.0	107.0	116.0					11																	17418528		2200	4293	6493	SO:0001583	missense	6833	exon33			CGTAGCGCACGCT	L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4054C>T	chr11.hg19:g.17418528G>A	ENSP00000374467:p.Arg1352Cys	99.0	0.0		81.0	26.0	NM_000352	A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	ENST00000389817.3	hg19	CCDS31437.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.3|25.3	4.626477|4.626477	0.87560|0.87560	.|.	.|.	ENSG00000006071|ENSG00000006071	ENST00000528374|ENST00000389817;ENST00000302539	.|D;D	.|0.90955	.|-2.76;-2.76	4.83|4.83	4.83|4.83	0.62350|0.62350	.|ABC transporter-like (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.94162|0.94162	0.8127|0.8127	L|L	0.53561|0.53561	1.675|1.675	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.87578	.|0.998	D|D	0.94829|0.94829	0.7994|0.7994	5|10	.|0.87932	.|D	.|0	.|.	18.2867|18.2867	0.90117|0.90117	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1352	.|Q09428	.|ABCC8_HUMAN	V|C	179|1352;1353	.|ENSP00000374467:R1352C;ENSP00000303960:R1353C	.|ENSP00000303960:R1353C	A|R	-|-	2|1	0|0	ABCC8|ABCC8	17375104|17375104	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	7.637000|7.637000	0.83313|0.83313	2.386000|2.386000	0.81285|0.81285	0.555000|0.555000	0.69702|0.69702	GCG|CGC	.	.		0.627	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389093.1	NM_000352	
CTTN	2017	hgsc.bcm.edu	37	11	70260723	70260723	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr11:70260723G>A	ENST00000301843.8	+	6	573	c.367G>A	c.(367-369)Ggc>Agc	p.G123S	CTTN_ENST00000346329.3_Missense_Mutation_p.G123S|CTTN_ENST00000376561.3_Missense_Mutation_p.G123S	NM_005231.3	NP_005222.2	Q14247	SRC8_HUMAN	cortactin	123					negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|mitotic spindle midzone (GO:1990023)|ruffle (GO:0001726)				breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	31			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		TGGCTTCGGAGGCAAGTTTGG	0.572																																					p.G123S		Atlas-SNP	.											.	CTTN	162	.	0			c.G367A						.						143.0	128.0	133.0					11																	70260723		2200	4294	6494	SO:0001583	missense	2017	exon6			TTCGGAGGCAAGT	AJ288897	CCDS8197.1, CCDS41680.1, CCDS53676.1	11q13	2008-02-05	2004-06-08	2004-06-09	ENSG00000085733	ENSG00000085733			3338	protein-coding gene	gene with protein product		164765	"""ems1 sequence (mammary tumor and squamous cell carcinoma-associated (p80/85 src substrate)"""	EMS1		7685625	Standard	NM_005231		Approved		uc001opu.3	Q14247	OTTHUMG00000134307	ENST00000301843.8:c.367G>A	chr11.hg19:g.70260723G>A	ENSP00000301843:p.Gly123Ser	100.0	0.0		100.0	34.0	NM_001184740	Q8N707|Q96H99	Missense_Mutation	SNP	ENST00000301843.8	hg19	CCDS41680.1	.	.	.	.	.	.	.	.	.	.	G	36	5.623738	0.96660	.	.	ENSG00000085733	ENST00000346329;ENST00000301843;ENST00000376561	T;T;T	0.53423	0.77;0.78;0.62	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.77850	0.4192	M	0.92691	3.335	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.82808	-0.0274	10	0.87932	D	0	-52.3417	19.812	0.96551	0.0:0.0:1.0:0.0	.	123;123;123	Q96H99;Q14247;Q8N707	.;SRC8_HUMAN;.	S	123	ENSP00000317189:G123S;ENSP00000301843:G123S;ENSP00000365745:G123S	ENSP00000301843:G123S	G	+	1	0	CTTN	69938371	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	9.434000	0.97515	2.685000	0.91497	0.655000	0.94253	GGC	.	.		0.572	CTTN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259233.2	NM_138565	
PPM1H	57460	hgsc.bcm.edu	37	12	63083509	63083509	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:63083509G>A	ENST00000228705.6	-	8	1515	c.1215C>T	c.(1213-1215)taC>taT	p.Y405Y	PPM1H_ENST00000551214.1_5'UTR	NM_020700.1	NP_065751.1	Q9ULR3	PPM1H_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1H	405	PP2C-like.						phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)	18			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		ATGGTTTAATGTAGATGTTGG	0.463																																					p.Y405Y		Atlas-SNP	.											.	PPM1H	42	.	0			c.C1215T						.						97.0	96.0	96.0					12																	63083509		1898	4149	6047	SO:0001819	synonymous_variant	57460	exon8			TTTAATGTAGATG	AB032983	CCDS44934.1	12q14.1	2012-04-17	2010-03-05	2004-03-26	ENSG00000111110	ENSG00000111110	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	18583	protein-coding gene	gene with protein product	"""neurite extension-related protein phosphatase related to PP2C"""		"""ras homolog gene family, member C like 1"", ""protein phosphatase 1H (PP2C domain containing)"""	ARHCL1			Standard	NM_020700		Approved	KIAA1157, FLJ13253, NERPP-2C	uc001srk.3	Q9ULR3	OTTHUMG00000169990	ENST00000228705.6:c.1215C>T	chr12.hg19:g.63083509G>A		45.0	0.0		40.0	15.0	NM_020700	B1Q2A9|B2RXG4|Q6PI86	Silent	SNP	ENST00000228705.6	hg19	CCDS44934.1																																																																																			.	.		0.463	PPM1H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406760.2	NM_020700	
STAB2	55576	hgsc.bcm.edu	37	12	104118857	104118857	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:104118857C>T	ENST00000388887.2	+	45	4992	c.4788C>T	c.(4786-4788)cgC>cgT	p.R1596R		NM_017564.9	NP_060034.9			stabilin 2									p.R1596R(1)		NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTACCTGCCGCGGCAGCATTT	0.448																																					p.R1596R		Atlas-SNP	.											STAB2,colon,carcinoma,0,2	STAB2	370	.	1	Substitution - coding silent(1)	ovary(1)	c.C4788T						.						120.0	116.0	118.0					12																	104118857		2203	4300	6503	SO:0001819	synonymous_variant	55576	exon45			CTGCCGCGGCAGC	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4788C>T	chr12.hg19:g.104118857C>T		52.0	0.0		32.0	18.0	NM_017564		Silent	SNP	ENST00000388887.2	hg19	CCDS31888.1																																																																																			.	.		0.448	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		
TRPC4	7223	hgsc.bcm.edu	37	13	38248410	38248410	+	Silent	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr13:38248410G>A	ENST00000379705.3	-	5	2186	c.1329C>T	c.(1327-1329)tcC>tcT	p.S443S	TRPC4_ENST00000426868.2_Silent_p.S443S|TRPC4_ENST00000379673.2_Silent_p.S443S|TRPC4_ENST00000358477.2_Silent_p.S443S|TRPC4_ENST00000355779.2_Silent_p.S443S|TRPC4_ENST00000379679.1_Silent_p.S270S|TRPC4_ENST00000494529.1_5'UTR|TRPC4_ENST00000338947.5_Silent_p.S270S|TRPC4_ENST00000379681.3_Silent_p.S443S|TRPC4_ENST00000447043.1_Silent_p.S443S			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	443					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CTAAATATAAGGAGTTCATTA	0.343																																					p.S443S		Atlas-SNP	.											.	TRPC4	389	.	0			c.C1329T						.						74.0	72.0	73.0					13																	38248410		2203	4300	6503	SO:0001819	synonymous_variant	7223	exon5			ATATAAGGAGTTC	U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1329C>T	chr13.hg19:g.38248410G>A		106.0	0.0		106.0	40.0	NM_003306	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Silent	SNP	ENST00000379705.3	hg19	CCDS9365.1																																																																																			.	.		0.343	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044574.2	NM_003306	
SYT16	83851	hgsc.bcm.edu	37	14	62550927	62550927	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:62550927C>T	ENST00000430451.2	+	5	1645	c.1448C>T	c.(1447-1449)cCg>cTg	p.P483L		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	483					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		GGAGGGTCTCCGCTCAGCCCA	0.517																																					p.P483L		Atlas-SNP	.											.	SYT16	144	.	0			c.C1448T						.						99.0	97.0	97.0					14																	62550927		1982	4148	6130	SO:0001583	missense	83851	exon5			GGTCTCCGCTCAG	BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1448C>T	chr14.hg19:g.62550927C>T	ENSP00000394700:p.Pro483Leu	54.0	0.0		57.0	27.0	NM_031914	B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	ENST00000430451.2	hg19	CCDS45121.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365415	0.24684	.	.	ENSG00000139973	ENST00000430451	T	0.04083	3.71	5.44	2.45	0.29901	.	0.438877	0.25948	N	0.027265	T	0.02230	0.0069	N	0.14661	0.345	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42682	-0.9437	10	0.06099	T	0.92	-3.8934	5.2381	0.15458	0.4366:0.3745:0.0:0.1889	.	483	Q17RD7	SYT16_HUMAN	L	483	ENSP00000394700:P483L	ENSP00000394700:P483L	P	+	2	0	SYT16	61620680	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.294000	0.43567	0.381000	0.24851	0.643000	0.83706	CCG	.	.		0.517	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000411700.1	NM_031914	
FLRT2	23768	hgsc.bcm.edu	37	14	86089513	86089513	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr14:86089513T>C	ENST00000330753.4	+	2	2422	c.1655T>C	c.(1654-1656)aTa>aCa	p.I552T	FLRT2_ENST00000554746.1_Missense_Mutation_p.I552T	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	552					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGCGCGGTGATATTTGTGCTG	0.592																																					p.I552T		Atlas-SNP	.											.	FLRT2	168	.	0			c.T1655C						.						76.0	81.0	79.0					14																	86089513		2203	4300	6503	SO:0001583	missense	23768	exon2			CGGTGATATTTGT	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1655T>C	chr14.hg19:g.86089513T>C	ENSP00000332879:p.Ile552Thr	88.0	0.0		73.0	25.0	NM_013231	A0AV84|B7ZLP3	Missense_Mutation	SNP	ENST00000330753.4	hg19	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	T	11.30	1.597853	0.28445	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.58060	0.36;0.36	6.17	6.17	0.99709	.	0.047672	0.85682	D	0.000000	T	0.39989	0.1099	N	0.19112	0.55	0.51482	D	0.999921	B	0.27498	0.18	B	0.22753	0.041	T	0.19257	-1.0311	10	0.34782	T	0.22	-17.0787	16.8222	0.85835	0.0:0.0:0.0:1.0	.	552	O43155	FLRT2_HUMAN	T	552;552;205	ENSP00000332879:I552T;ENSP00000451050:I552T	ENSP00000332879:I552T	I	+	2	0	FLRT2	85159266	1.000000	0.71417	0.997000	0.53966	0.926000	0.56050	6.295000	0.72744	2.371000	0.80710	0.533000	0.62120	ATA	.	.		0.592	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
C15orf39	56905	hgsc.bcm.edu	37	15	75498804	75498804	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr15:75498804T>C	ENST00000360639.2	+	2	735	c.415T>C	c.(415-417)Tgc>Cgc	p.C139R	C15orf39_ENST00000567617.1_Missense_Mutation_p.C139R|C15orf39_ENST00000394987.4_Missense_Mutation_p.C139R			Q6ZRI6	CO039_HUMAN	chromosome 15 open reading frame 39	139						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16						CAACCCTCTGTGCTATGGGCT	0.622																																					p.C139R		Atlas-SNP	.											.	C15orf39	64	.	0			c.T415C						.						54.0	51.0	52.0					15																	75498804		2197	4295	6492	SO:0001583	missense	56905	exon2			CCTCTGTGCTATG	AK128205	CCDS10276.1	15q23	2013-03-14	2005-10-24		ENSG00000167173	ENSG00000167173			24497	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 38~Name Same As HGNC:28782"""				Standard	NM_015492		Approved	DKFZP434H132, FLJ46337	uc002azq.4	Q6ZRI6	OTTHUMG00000142820	ENST00000360639.2:c.415T>C	chr15.hg19:g.75498804T>C	ENSP00000353854:p.Cys139Arg	55.0	0.0		53.0	22.0	NM_015492	B3KWI3|C9J888|Q71JB1|Q7L3S0|Q8N3F2|Q96FB6|Q9NTU5	Missense_Mutation	SNP	ENST00000360639.2	hg19	CCDS10276.1	.	.	.	.	.	.	.	.	.	.	T	13.31	2.199280	0.38806	.	.	ENSG00000167173	ENST00000360639;ENST00000394987	T;T	0.71698	-0.59;-0.59	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.78748	0.4332	L	0.60455	1.87	0.58432	D	0.99999	D	0.71674	0.998	D	0.78314	0.991	T	0.80174	-0.1492	10	0.87932	D	0	-12.1195	7.7302	0.28783	0.0:0.0949:0.0:0.9051	.	139	Q6ZRI6	CO039_HUMAN	R	139	ENSP00000353854:C139R;ENSP00000378438:C139R	ENSP00000353854:C139R	C	+	1	0	C15orf39	73285857	0.998000	0.40836	0.999000	0.59377	0.929000	0.56500	4.534000	0.60622	1.938000	0.56188	0.459000	0.35465	TGC	.	.		0.622	C15orf39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286410.1	NM_015492	
SCNN1B	6338	hgsc.bcm.edu	37	16	23366664	23366664	+	Silent	SNP	T	T	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr16:23366664T>C	ENST00000343070.2	+	4	806	c.630T>C	c.(628-630)agT>agC	p.S210S	SCNN1B_ENST00000568085.1_Silent_p.S210S|SCNN1B_ENST00000568923.1_Intron|SCNN1B_ENST00000307331.5_Silent_p.S255S	NM_000336.2	NP_000327.2	P51168	SCNNB_HUMAN	sodium channel, non-voltage-gated 1, beta subunit	210					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|WW domain binding (GO:0050699)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	32				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)	ACTTCACCAGTGCTACCCAGG	0.587																																					p.S210S		Atlas-SNP	.											.	SCNN1B	81	.	0			c.T630C						.						146.0	105.0	119.0					16																	23366664		2197	4300	6497	SO:0001819	synonymous_variant	6338	exon4			CACCAGTGCTACC	X87159	CCDS10609.1	16p12.2-p12.1	2012-02-28	2012-02-28		ENSG00000168447	ENSG00000168447		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10600	protein-coding gene	gene with protein product	"""Liddle syndrome"""	600760	"""sodium channel, nonvoltage-gated 1, beta"", ""sodium channel, non-voltage-gated 1, beta"""				Standard	NM_000336		Approved	ENaCbeta	uc002dln.3	P51168	OTTHUMG00000131608	ENST00000343070.2:c.630T>C	chr16.hg19:g.23366664T>C		74.0	0.0		34.0	29.0	NM_000336	C5HTZ2|O60891|Q96KG2|Q9UJ32|Q9UMU5	Silent	SNP	ENST00000343070.2	hg19	CCDS10609.1																																																																																			.	.		0.587	SCNN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254495.2		
MYH1	4619	hgsc.bcm.edu	37	17	10404676	10404676	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:10404676G>T	ENST00000226207.5	-	27	3583	c.3489C>A	c.(3487-3489)gcC>gcA	p.A1163A	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1163				A -> T (in Ref. 4; CAA27380). {ECO:0000305}.	muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCTCAATCTGGGCTGAGGTGG	0.632																																					p.A1163A		Atlas-SNP	.											.	MYH1	403	.	0			c.C3489A						.						89.0	98.0	95.0					17																	10404676		2203	4300	6503	SO:0001819	synonymous_variant	4619	exon27			AATCTGGGCTGAG		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.3489C>A	chr17.hg19:g.10404676G>T		100.0	0.0		40.0	26.0	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	hg19	CCDS11155.1																																																																																			.	.		0.632	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
PSMD11	5717	hgsc.bcm.edu	37	17	30806343	30806343	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:30806343C>T	ENST00000261712.3	+	10	1250	c.987C>T	c.(985-987)aaC>aaT	p.N329N	PSMD11_ENST00000457654.2_Silent_p.N329N	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	329	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			TGTATGATAACTTACTAGAAC	0.498																																					p.N329N	Ovarian(130;1038 1716 9294 11987 19279)	Atlas-SNP	.											.	PSMD11	41	.	0			c.C987T						.						151.0	143.0	146.0					17																	30806343		2203	4300	6503	SO:0001819	synonymous_variant	5717	exon10			TGATAACTTACTA	AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.987C>T	chr17.hg19:g.30806343C>T		63.0	0.0		106.0	21.0	NM_002815	A8K3I7|E1P663|O00495|Q53FT5	Silent	SNP	ENST00000261712.3	hg19	CCDS11272.1	.	.	.	.	.	.	.	.	.	.	C	9.790	1.177547	0.21787	.	.	ENSG00000108671	ENST00000457654	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	T	0.72447	0.3461	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69822	-0.5041	4	.	.	.	-12.4301	16.7464	0.85473	0.0:1.0:0.0:0.0	.	.	.	.	F	67	.	.	L	+	1	0	PSMD11	27830456	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.803000	0.55560	2.826000	0.97356	0.561000	0.74099	CTT	.	.		0.498	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256252.2	NM_002815	
BRCA1	672	hgsc.bcm.edu	37	17	41228578	41228578	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:41228578C>G	ENST00000357654.3	-	13	4529	c.4411G>C	c.(4411-4413)Ggc>Cgc	p.G1471R	BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.G1424R|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000471181.2_Missense_Mutation_p.G1492R|BRCA1_ENST00000491747.2_Missense_Mutation_p.G367R|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000468300.1_Missense_Mutation_p.G367R|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.G1175R|BRCA1_ENST00000352993.3_Missense_Mutation_p.G329R|BRCA1_ENST00000351666.3_Missense_Mutation_p.G288R	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1471					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GCAGAAAGGCCTTCTGGATTC	0.368			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.G1492R		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.G4474C						.						145.0	138.0	140.0					17																	41228578		2202	4300	6502	SO:0001583	missense	672	exon14	Familial Cancer Database		AAAGGCCTTCTGG	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4411G>C	chr17.hg19:g.41228578C>G	ENSP00000350283:p.Gly1471Arg	81.0	0.0		75.0	29.0	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	hg19	CCDS11453.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.836|8.836	0.941068|0.941068	0.18281|0.18281	.|.	.|.	ENSG00000012048|ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000352993;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825|ENST00000461574	T;T;T;T;T;T;T;T;T;T;T|.	0.56444|.	0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46;0.46|.	4.97|4.97	-3.6|-3.6	0.04570|0.04570	.|.	1.054980|.	0.07355|.	N|.	0.883009|.	T|T	0.14874|0.14874	0.0359|0.0359	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;P;B;B;B;B;B;B|.	0.46706|.	0.002;0.883;0.001;0.037;0.001;0.004;0.201;0.007|.	B;B;B;B;B;B;B;B|.	0.39419|.	0.004;0.299;0.001;0.03;0.001;0.002;0.055;0.005|.	T|T	0.29397|0.29397	-1.0013|-1.0013	10|5	0.39692|.	T|.	0.17|.	.|.	6.6577|6.6577	0.22996|0.22996	0.0:0.4305:0.1377:0.4318|0.0:0.4305:0.1377:0.4318	.|.	367;320;366;368;367;1493;1471;1471|.	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2|.	.;.;.;.;.;.;BRCA1_HUMAN;.|.	R|N	1471;1492;329;288;1175;367;320;1493;1424;366;367;242;321;243|234	ENSP00000350283:G1471R;ENSP00000312236:G329R;ENSP00000338007:G288R;ENSP00000310938:G1175R;ENSP00000417148:G367R;ENSP00000377294:G320R;ENSP00000418775:G1424R;ENSP00000420412:G367R;ENSP00000419481:G242R;ENSP00000418819:G321R;ENSP00000418212:G243R|.	ENSP00000310938:G1175R|.	G|K	-|-	1|3	0|2	BRCA1|BRCA1	38482104|38482104	0.000000|0.000000	0.05858|0.05858	0.007000|0.007000	0.13788|0.13788	0.960000|0.960000	0.62799|0.62799	-0.366000|-0.366000	0.07563|0.07563	-0.901000|-0.901000	0.03891|0.03891	-0.291000|-0.291000	0.09656|0.09656	GGC|AAG	.	.		0.368	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
MUC16	94025	hgsc.bcm.edu	37	19	9057886	9057886	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:9057886C>G	ENST00000397910.4	-	3	29763	c.29560G>C	c.(29560-29562)Gtt>Ctt	p.V9854L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9856	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GATGTGAAAACAGTGGTATCG	0.468																																					p.V9854L		Atlas-SNP	.											.	MUC16	4315	.	0			c.G29560C						.						154.0	145.0	148.0					19																	9057886		2010	4183	6193	SO:0001583	missense	94025	exon3			TGAAAACAGTGGT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29560G>C	chr19.hg19:g.9057886C>G	ENSP00000381008:p.Val9854Leu	92.0	0.0		91.0	40.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	5.579	0.291676	0.10567	.	.	ENSG00000181143	ENST00000397910	T	0.35605	1.3	2.43	-4.75	0.03239	.	.	.	.	.	T	0.18551	0.0445	N	0.19112	0.55	.	.	.	B	0.02656	0.0	B	0.06405	0.002	T	0.23261	-1.0193	8	0.87932	D	0	.	4.0956	0.09990	0.0:0.2634:0.3471:0.3895	.	9854	B5ME49	.	L	9854	ENSP00000381008:V9854L	ENSP00000381008:V9854L	V	-	1	0	MUC16	8918886	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-5.919000	0.00090	-1.056000	0.03205	-0.232000	0.12228	GTT	.	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ELAVL3	1995	hgsc.bcm.edu	37	19	11577475	11577475	+	Silent	SNP	G	G	A	rs201270169	byFrequency	TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:11577475G>A	ENST00000359227.3	-	2	601	c.177C>T	c.(175-177)ttC>ttT	p.F59F	CTC-398G3.6_ENST00000585656.1_3'UTR|ELAVL3_ENST00000438662.2_Silent_p.F59F|RN7SL669P_ENST00000581926.1_RNA	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	59	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						CAATGCTGCCGAAGAGACTCT	0.547													g|||	3	0.000599042	0.0	0.0029	5008	,	,		20239	0.0		0.0	False		,,,				2504	0.001				p.F59F		Atlas-SNP	.											.	ELAVL3	58	.	0			c.C177T						.	A	,	0,4406		0,0,2203	163.0	143.0	150.0		177,177	-2.6	1.0	19		150	2,8598	1.2+/-3.3	0,2,4298	no	coding-synonymous,coding-synonymous	ELAVL3	NM_001420.3,NM_032281.2	,	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	,	59/368,59/361	11577475	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1995	exon2			GCTGCCGAAGAGA		CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.177C>T	chr19.hg19:g.11577475G>A		123.0	0.0		90.0	50.0	NM_032281	Q16135|Q96CL8|Q96QS9	Silent	SNP	ENST00000359227.3	hg19	CCDS32912.1																																																																																			.	G|0.999;A|0.001		0.547	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458827.2	NM_001420	
CRLF1	9244	hgsc.bcm.edu	37	19	18707746	18707746	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:18707746T>A	ENST00000392386.3	-	5	1004	c.811A>T	c.(811-813)Aaa>Taa	p.K271*	CRLF1_ENST00000594325.1_5'Flank	NM_004750.4	NP_004741.1	O75462	CRLF1_HUMAN	cytokine receptor-like factor 1	271	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of motor neuron apoptotic process (GO:2000672)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of cell proliferation (GO:0008284)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|ureteric bud development (GO:0001657)	CRLF-CLCF1 complex (GO:0097058)|extracellular space (GO:0005615)	cytokine binding (GO:0019955)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	9						ATCTGGTATTTGGCTTGAAAG	0.672																																					p.K271X		Atlas-SNP	.											.	CRLF1	32	.	0			c.A811T						.						78.0	63.0	68.0					19																	18707746		2203	4300	6503	SO:0001587	stop_gained	9244	exon5			GGTATTTGGCTTG	AF059293	CCDS32962.1	19p12	2013-02-11				ENSG00000006016		"""Fibronectin type III domain containing"""	2364	protein-coding gene	gene with protein product	"""cold-induced sweating syndrome"""	604237				9686600	Standard	NM_004750		Approved	CLF-1, CLF, CISS, CISS1	uc010ebt.2	O75462		ENST00000392386.3:c.811A>T	chr19.hg19:g.18707746T>A	ENSP00000376188:p.Lys271*	88.0	0.0		51.0	16.0	NM_004750	Q9UHH5	Nonsense_Mutation	SNP	ENST00000392386.3	hg19	CCDS32962.1	.	.	.	.	.	.	.	.	.	.	T	39	7.711627	0.98447	.	.	ENSG00000006016	ENST00000392386	.	.	.	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-28.6245	12.3848	0.55327	0.0:0.0:0.0:1.0	.	.	.	.	X	271	.	ENSP00000376188:K271X	K	-	1	0	CRLF1	18568746	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.235000	0.78143	1.894000	0.54839	0.402000	0.26972	AAA	.	.		0.672	CRLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465129.1		
ZNF419	79744	hgsc.bcm.edu	37	19	58004285	58004285	+	Silent	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:58004285C>T	ENST00000221735.7	+	5	546	c.360C>T	c.(358-360)ctC>ctT	p.L120L	ZNF419_ENST00000426954.2_Silent_p.L108L|ZNF419_ENST00000354197.4_Silent_p.L108L|ZNF419_ENST00000347466.6_Silent_p.L88L|AC003005.4_ENST00000601674.1_Intron|ZNF419_ENST00000415379.2_Silent_p.L74L|ZNF419_ENST00000424930.2_Silent_p.L121L|ZNF419_ENST00000442920.2_Silent_p.L107L			Q96HQ0	ZN419_HUMAN	zinc finger protein 419	120					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Breast(46;0.0848)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0252)|Lung(386;0.171)		TAGGACTGCTCAGTTCAAACA	0.473																																					p.L121L		Atlas-SNP	.											.	ZNF419	134	.	0			c.C363T						.						75.0	76.0	76.0					19																	58004285		2203	4300	6503	SO:0001819	synonymous_variant	79744	exon5			ACTGCTCAGTTCA	AK026886	CCDS42637.1, CCDS46211.1, CCDS54325.1, CCDS54326.1, CCDS54327.1, CCDS54328.1	19q13.43	2013-01-08	2006-12-15	2006-12-15	ENSG00000105136	ENSG00000105136		"""Zinc fingers, C2H2-type"", ""-"""	20648	protein-coding gene	gene with protein product			"""zinc finger protein 419A"""	ZNF419A			Standard	NM_001098492		Approved		uc010ety.1	Q96HQ0	OTTHUMG00000037073	ENST00000221735.7:c.360C>T	chr19.hg19:g.58004285C>T		77.0	0.0		122.0	41.0	NM_001098491	B4DXU7|B4E348|B7ZA41|E9PCP4|E9PED0|E9PET3|E9PFX9|Q9H5P0	Silent	SNP	ENST00000221735.7	hg19	CCDS54326.1	.	.	.	.	.	.	.	.	.	.	C	1.470	-0.560106	0.03967	.	.	ENSG00000105136	ENST00000427558	.	.	.	1.45	-1.07	0.09968	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.6393	0.04966	0.4876:0.3333:0.0:0.1791	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF419	62696097	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.061000	0.03472	-0.229000	0.09854	0.205000	0.17691	.	.	.		0.473	ZNF419-006	KNOWN	NAGNAG_splice_site|non_canonical_polymorphism|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000378506.1	NM_024691	
ZNF256	10172	hgsc.bcm.edu	37	19	58453498	58453498	+	Silent	SNP	A	A	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:58453498A>G	ENST00000282308.3	-	3	874	c.678T>C	c.(676-678)cgT>cgC	p.R226R	ZNF256_ENST00000598928.1_3'UTR	NM_005773.2	NP_005764.2	Q9Y2P7	ZN256_HUMAN	zinc finger protein 256	226					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0155)		GGTGCTGAACACGTACATGTT	0.428																																					p.R226R	NSCLC(55;1313 1552 8040 11996)	Atlas-SNP	.											.	ZNF256	117	.	0			c.T678C						.						198.0	176.0	184.0					19																	58453498		2203	4300	6503	SO:0001819	synonymous_variant	10172	exon3			CTGAACACGTACA	AF067165	CCDS12966.1	19q13	2013-01-08				ENSG00000152454		"""Zinc fingers, C2H2-type"", ""-"""	13049	protein-coding gene	gene with protein product		606956					Standard	NM_005773		Approved	BMZF-3	uc002qqu.3	Q9Y2P7		ENST00000282308.3:c.678T>C	chr19.hg19:g.58453498A>G		68.0	0.0		115.0	35.0	NM_005773	B2RA92|Q53Y85|Q9BV71	Silent	SNP	ENST00000282308.3	hg19	CCDS12966.1																																																																																			.	.		0.428	ZNF256-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466702.1		
GPCPD1	56261	hgsc.bcm.edu	37	20	5579378	5579378	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr20:5579378C>T	ENST00000379019.4	-	3	351	c.139G>A	c.(139-141)Ggt>Agt	p.G47S		NM_019593.3	NP_062539.1	Q9NPB8	GPCP1_HUMAN	glycerophosphocholine phosphodiesterase GDE1 homolog (S. cerevisiae)	47	CBM20. {ECO:0000255|PROSITE- ProRule:PRU00594}.				glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)	glycerophosphocholine phosphodiesterase activity (GO:0047389)|starch binding (GO:2001070)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)	16						CACCTTTCACCTGTGTCATTC	0.378																																					p.G47S		Atlas-SNP	.											.	GPCPD1	52	.	0			c.G139A						.						82.0	68.0	73.0					20																	5579378		2203	4300	6503	SO:0001583	missense	56261	exon3			TTTCACCTGTGTC		CCDS13090.1	20p12.3	2011-01-25			ENSG00000125772	ENSG00000125772			26957	protein-coding gene	gene with protein product		614124				10718198, 20576599	Standard	NM_019593		Approved	KIAA1434, GDE5, GDPD6	uc002wme.4	Q9NPB8	OTTHUMG00000031806	ENST00000379019.4:c.139G>A	chr20.hg19:g.5579378C>T	ENSP00000368305:p.Gly47Ser	73.0	0.0		82.0	30.0	NM_019593	D3DW06|Q9BQL8|Q9NUX0	Missense_Mutation	SNP	ENST00000379019.4	hg19	CCDS13090.1	.	.	.	.	.	.	.	.	.	.	C	11.83	1.754585	0.31046	.	.	ENSG00000125772	ENST00000379019	D	0.92446	-3.04	5.09	4.04	0.47022	Carbohydrate-binding-like fold (1);Glycoside hydrolase, carbohydrate-binding (2);Immunoglobulin-like fold (1);	0.595328	0.17773	N	0.162505	T	0.79627	0.4478	N	0.05441	-0.05	0.34433	D	0.698748	B	0.12013	0.005	B	0.17979	0.02	T	0.74618	-0.3605	10	0.08381	T	0.77	-7.2896	8.1899	0.31361	0.0:0.8484:0.0:0.1516	.	47	Q9NPB8	GPCP1_HUMAN	S	47	ENSP00000368305:G47S	ENSP00000368305:G47S	G	-	1	0	GPCPD1	5527378	1.000000	0.71417	1.000000	0.80357	0.490000	0.33462	1.368000	0.34216	2.356000	0.79943	0.561000	0.74099	GGT	.	.		0.378	GPCPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077869.1	NM_019593	
CLTCL1	8218	hgsc.bcm.edu	37	22	19168279	19168279	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr22:19168279T>A	ENST00000263200.10	-	31	4940	c.4868A>T	c.(4867-4869)gAg>gTg	p.E1623V	CLTCL1_ENST00000442042.2_5'UTR|SLC25A1_ENST00000215882.5_5'Flank|CLTCL1_ENST00000353891.5_Missense_Mutation_p.E1566V|CLTCL1_ENST00000427926.1_Missense_Mutation_p.E1623V|SLC25A1_ENST00000451283.1_5'Flank|SLC25A1_ENST00000461267.1_5'Flank	NM_007098.3	NP_009029.3	P53675	CLH2_HUMAN	clathrin, heavy chain-like 1	1623	Heavy chain arm.|Proximal segment.|Trimerization. {ECO:0000250}.			RKQEEHVTEPAPLVFDFDGHE -> PPSKRSM (in Ref. 3; AAB40908/AAB40909). {ECO:0000305}.	anatomical structure morphogenesis (GO:0009653)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|positive regulation of glucose import (GO:0046326)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|coated vesicle (GO:0030135)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|spindle (GO:0005819)|trans-Golgi network (GO:0005802)	signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	Colorectal(54;0.0993)					CACATGCTCCTCTTGCTTGCG	0.607			T	?	ALCL																																p.E1623V		Atlas-SNP	.		Dom	yes		22	22q11.21	8218	"""clathrin, heavy polypeptide-like 1"""		L	.	CLTCL1	115	.	0			c.A4868T						.						86.0	93.0	91.0					22																	19168279		2132	4251	6383	SO:0001583	missense	8218	exon31			TGCTCCTCTTGCT		CCDS46662.1, CCDS54497.1, CCDS46662.2, CCDS54497.2	22q11.2	2008-06-10	2006-09-29		ENSG00000070371	ENSG00000070371			2093	protein-coding gene	gene with protein product		601273	"""clathrin, heavy polypeptide-like 1"""	CLTCL		8844170, 15133132	Standard	NM_007098		Approved	CLTD, CLH22, CHC22	uc021wle.1	P53675	OTTHUMG00000150109	ENST00000263200.10:c.4868A>T	chr22.hg19:g.19168279T>A	ENSP00000445677:p.Glu1623Val	58.0	0.0		55.0	26.0	NM_007098	B7Z7U5|Q14017|Q15808|Q15809	Missense_Mutation	SNP	ENST00000263200.10	hg19	CCDS46662.1	.	.	.	.	.	.	.	.	.	.	T	10.91	1.484759	0.26598	.	.	ENSG00000070371	ENST00000353891;ENST00000263200;ENST00000427926	T;T;T	0.32988	1.43;1.43;1.43	4.69	2.52	0.30459	.	0.224775	0.36002	N	0.002851	T	0.27349	0.0671	L	0.50993	1.605	0.45005	D	0.998021	B;B;B	0.31680	0.005;0.335;0.081	B;B;B	0.36567	0.012;0.086;0.228	T	0.04165	-1.0972	10	0.48119	T	0.1	-2.4268	6.2511	0.20845	0.0:0.0809:0.3076:0.6115	.	1566;352;1623	P53675-2;B7Z1Z7;P53675	.;.;CLH2_HUMAN	V	1566;1623;1623	ENSP00000439662:E1566V;ENSP00000445677:E1623V;ENSP00000441158:E1623V	ENSP00000445677:E1623V	E	-	2	0	CLTCL1	17548279	0.999000	0.42202	0.000000	0.03702	0.001000	0.01503	3.028000	0.49705	0.302000	0.22762	-0.313000	0.08912	GAG	.	.		0.607	CLTCL1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316397.5	NM_007098	
RPS6KA3	6197	hgsc.bcm.edu	37	X	20206011	20206011	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:20206011G>A	ENST00000379565.3	-	9	916	c.709C>T	c.(709-711)Cca>Tca	p.P237S	RPS6KA3_ENST00000540702.1_Missense_Mutation_p.P209S|RPS6KA3_ENST00000544447.1_Missense_Mutation_p.P209S|RPS6KA3_ENST00000379548.4_Missense_Mutation_p.P208S	NM_004586.2	NP_004577.1	P51812	KS6A3_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 3	237	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|central nervous system development (GO:0007417)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(4)|endometrium(3)|kidney(2)|large_intestine(5)|liver(14)|lung(7)|ovary(1)|stomach(1)	41					Acetylsalicylic acid(DB00945)	ACTACTTCTGGAGCCATATAC	0.388																																					p.P237S		Atlas-SNP	.											.	RPS6KA3	110	.	0			c.C709T						.						159.0	143.0	148.0					X																	20206011		2203	4300	6503	SO:0001583	missense	6197	exon9			CTTCTGGAGCCAT	U08316	CCDS14197.1	Xp22.2-p22.1	2013-06-03	2002-08-29		ENSG00000177189	ENSG00000177189			10432	protein-coding gene	gene with protein product		300075	"""ribosomal protein S6 kinase, 90kD, polypeptide 3"", ""mental retardation, X-linked 19"", ""Coffin-Lowry syndrome"""	MRX19, CLS		8141249, 11896450, 16879200	Standard	XM_005274573		Approved	RSK, RSK2, HU-3	uc004czu.3	P51812	OTTHUMG00000021231	ENST00000379565.3:c.709C>T	chrX.hg19:g.20206011G>A	ENSP00000368884:p.Pro237Ser	202.0	0.0		177.0	71.0	NM_004586	B2R9V4|Q4VAP3|Q59H26|Q5JPK8|Q7Z3Z7	Missense_Mutation	SNP	ENST00000379565.3	hg19	CCDS14197.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.958932	0.92726	.	.	ENSG00000177189	ENST00000379565;ENST00000544447;ENST00000379548;ENST00000540702;ENST00000457145	T;T;T;T;T	0.75154	-0.91;-0.91;-0.91;-0.91;-0.91	5.08	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91673	0.7368	H	0.98133	4.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.95028	0.8166	10	0.87932	D	0	.	17.5586	0.87900	0.0:0.0:1.0:0.0	.	209;208;209;237	B4DG22;F5GYC4;B7ZB17;P51812	.;.;.;KS6A3_HUMAN	S	237;209;208;209;208	ENSP00000368884:P237S;ENSP00000440220:P209S;ENSP00000368865:P208S;ENSP00000444837:P209S;ENSP00000407655:P208S	ENSP00000368865:P208S	P	-	1	0	RPS6KA3	20115932	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.813000	0.99286	2.074000	0.62210	0.513000	0.50165	CCA	.	.		0.388	RPS6KA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056011.3	NM_004586	
TSPAN7	7102	hgsc.bcm.edu	37	X	38525510	38525510	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:38525510G>C	ENST00000378482.2	+	2	394	c.217G>C	c.(217-219)Ggc>Cgc	p.G73R	TM4SF2_ENST00000465127.1_Missense_Mutation_p.G103R|TSPAN7_ENST00000545599.1_Missense_Mutation_p.G47R|TSPAN7_ENST00000488893.1_3'UTR|TSPAN7_ENST00000422612.2_Missense_Mutation_p.G99R|TSPAN7_ENST00000286824.6_Missense_Mutation_p.G90R	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7	73					viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						TGTTGTCTTTGGCCTGTTTGG	0.448																																					p.G73R		Atlas-SNP	.											.	TSPAN7	33	.	0			c.G217C						.						245.0	165.0	192.0					X																	38525510		2202	4300	6502	SO:0001583	missense	7102	exon2			GTCTTTGGCCTGT	D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.217G>C	chrX.hg19:g.38525510G>C	ENSP00000367743:p.Gly73Arg	92.0	0.0		121.0	43.0	NM_004615	B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Missense_Mutation	SNP	ENST00000378482.2	hg19	CCDS14248.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.582598	0.86748	.	.	ENSG00000250349;ENSG00000156298;ENSG00000156298;ENSG00000156298;ENSG00000156298	ENST00000465127;ENST00000378482;ENST00000422612;ENST00000286824;ENST00000545599	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	5.96	5.1	0.69264	Tetraspanin, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93360	0.7883	M	0.94142	3.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.94750	0.7926	9	.	.	.	.	14.4266	0.67220	0.0722:0.0:0.9278:0.0	.	90;99;73	B4DDG0;B4DEA5;P41732	.;.;TSN7_HUMAN	R	103;73;99;90;47	ENSP00000417050:G103R;ENSP00000367743:G73R;ENSP00000388954:G99R;ENSP00000286824:G90R;ENSP00000441540:G47R	.	G	+	1	0	RP5-972B16.2;TSPAN7	38410454	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.476000	0.97823	1.274000	0.44362	0.594000	0.82650	GGC	.	.		0.448	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356412.1		
BCOR	54880	hgsc.bcm.edu	37	X	39922119	39922119	+	Silent	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:39922119G>T	ENST00000378444.4	-	9	4281	c.4053C>A	c.(4051-4053)acC>acA	p.T1351T	BCOR_ENST00000397354.3_Silent_p.T1317T|BCOR_ENST00000378455.4_Silent_p.T1299T|BCOR_ENST00000342274.4_Silent_p.T1317T|BCOR_ENST00000378463.1_Silent_p.T194T	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	1351					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CGCTGTTGTCGGTGTATTTCT	0.517			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic																														p.T1351T		Atlas-SNP	.		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		.	BCOR	351	.	0			c.C4053A						.						126.0	98.0	108.0					X																	39922119		2202	4300	6502	SO:0001819	synonymous_variant	54880	exon9			GTTGTCGGTGTAT	AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.4053C>A	chrX.hg19:g.39922119G>T		183.0	0.0		184.0	8.0	NM_001123385	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	ENST00000378444.4	hg19	CCDS48093.1	.	.	.	.	.	.	.	.	.	.	G	7.436	0.639723	0.14386	.	.	ENSG00000183337	ENST00000427012	.	.	.	5.67	3.81	0.43845	.	.	.	.	.	T	0.59582	0.2204	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53592	-0.8417	4	.	.	.	-8.1494	9.5913	0.39548	0.0:0.1328:0.5743:0.2929	.	.	.	.	Q	46	.	.	P	-	2	0	BCOR	39807063	0.883000	0.30277	0.951000	0.38953	0.926000	0.56050	-0.084000	0.11268	0.497000	0.27926	0.600000	0.82982	CCG	.	.		0.517	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000060666.2	NM_017745	
HTR2C	3358	hgsc.bcm.edu	37	X	114141874	114141874	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrX:114141874G>T	ENST00000276198.1	+	6	2001	c.1273G>T	c.(1273-1275)Gag>Tag	p.E425*	HTR2C_ENST00000371950.3_3'UTR|HTR2C_ENST00000371951.1_Nonsense_Mutation_p.E425*	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	425					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ACCGGTGATCGAGAAAGCCAG	0.468																																					p.E425X		Atlas-SNP	.											.	HTR2C	117	.	0			c.G1273T						.						144.0	141.0	142.0					X																	114141874		2203	4300	6503	SO:0001587	stop_gained	3358	exon6			GTGATCGAGAAAG		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.1273G>T	chrX.hg19:g.114141874G>T	ENSP00000276198:p.Glu425*	216.0	0.0		196.0	74.0	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Nonsense_Mutation	SNP	ENST00000276198.1	hg19	CCDS14564.1	.	.	.	.	.	.	.	.	.	.	G	33	5.200961	0.94997	.	.	ENSG00000147246	ENST00000276198;ENST00000371951	.	.	.	4.89	-3.99	0.04069	.	0.580762	0.17675	N	0.165808	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	6.367	0.21461	0.2236:0.4318:0.3446:0.0	.	.	.	.	X	425	.	ENSP00000276198:E425X	E	+	1	0	HTR2C	114048130	0.766000	0.28496	0.001000	0.08648	0.001000	0.01503	1.423000	0.34837	-0.371000	0.08004	-2.142000	0.00338	GAG	.	.		0.468	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
MT-ND5	4540	hgsc.bcm.edu	37	M	12769	12769	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrM:12769G>A	ENST00000361567.2	+	1	433	c.433G>A	c.(433-435)Gag>Aag	p.E145K	MT-TH_ENST00000387441.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	145			E -> G (in MELAS). {ECO:0000269|PubMed:12509858}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						TCATCGGCTGAGAGGGCGTAG	0.418																																					p.E145K		Atlas-SNP	.											.	.	.	.	0			c.G433A						.																																			SO:0001583	missense	0	exon1			GGCTGAGAGGGCG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.433G>A	chrM.hg19:g.12769G>A	ENSP00000354813:p.Glu145Lys	709.0	2.0		360.0	210.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.418	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-ND5	4540	hgsc.bcm.edu	37	M	13726	13726	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chrM:13726G>A	ENST00000361567.2	+	1	1390	c.1390G>A	c.(1390-1392)Gca>Aca	p.A464T	MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	464					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						GAAGCCTATTCGCAGGATTTC	0.498																																					p.A464T		Atlas-SNP	.											.	.	.	.	0			c.G1390A						.																																			SO:0001583	missense	0	exon1			CTATTCGCAGGAT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1390G>A	chrM.hg19:g.13726G>A	ENSP00000354813:p.Ala464Thr	661.0	0.0		304.0	84.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.498	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
CYP4F3	4051	hgsc.bcm.edu	37	19	15758035	15758046	+	In_Frame_Del	DEL	AAAGTGGAGCCG	AAAGTGGAGCCG	-			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	AAAGTGGAGCCG	AAAGTGGAGCCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:15758035_15758046delAAAGTGGAGCCG	ENST00000221307.8	+	5	473_484	c.426_437delAAAGTGGAGCCG	c.(424-438)gaaaagtggagccgc>gac	p.142_146EKWSR>D	CYP4F3_ENST00000585846.1_In_Frame_Del_p.142_146EKWSR>D|CYP4F3_ENST00000591058.1_In_Frame_Del_p.142_146EKWSR>D|CYP4F3_ENST00000586182.2_In_Frame_Del_p.142_146EKWSR>D	NM_000896.2	NP_000887.2	Q08477	CP4F3_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 3	142					arachidonic acid metabolic process (GO:0019369)|icosanoid metabolic process (GO:0006690)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-tocopherol omega-hydroxylase activity (GO:0052871)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)|monooxygenase activity (GO:0004497)			endometrium(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|stomach(1)	34						GTGCTGGTGAAAAGTGGAGCCGCCACCGTCGG	0.566																																					p.142_146del		Atlas-INDEL	.											.	CYP4F3	69	.	0			c.425_436del						.																																			SO:0001651	inframe_deletion	4051	exon5			.	AB002454	CCDS12332.1, CCDS59362.1	19p13.12	2013-02-21	2003-01-14		ENSG00000186529	ENSG00000186529		"""Cytochrome P450s"""	2646	protein-coding gene	gene with protein product		601270	"""cytochrome P450, subfamily IVF, polypeptide 3 (leukotriene B4 omega hydroxylase)"""	LTB4H		8486631, 9539102	Standard	NM_000896		Approved	CYP4F	uc010xol.2	Q08477	OTTHUMG00000182374	ENST00000221307.8:c.426_437delAAAGTGGAGCCG	chr19.hg19:g.15758035_15758046delAAAGTGGAGCCG	ENSP00000221307:p.Glu142_Arg146delinsAsp	67.0	0.0		48.0	12.0	NM_001199209	B7Z8Z3|O60634|Q5U740	In_Frame_Del	DEL	ENST00000221307.8	hg19	CCDS12332.1																																																																																			.	.		0.566	CYP4F3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460819.3	NM_000896	
HLA-B	3106	hgsc.bcm.edu	37	6	31324160	31324161	+	Frame_Shift_Ins	INS	-	-	A	rs45532737|rs137854719		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr6:31324160_31324161insA	ENST00000412585.2	-	3	430_431	c.402_403insT	c.(400-405)ctccgcfs	p.R135fs		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	135	Alpha-2.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						TCATGCCCGCGGAGGAGGCGCC	0.718									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																												p.R135fs		Atlas-INDEL	.											.,1	HLA-B	54	.	0			c.403_404insT						.																																			SO:0001589	frameshift_variant	3106	exon3	Familial Cancer Database	;Lichen Sclerosis, Familial	.	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.402_403insT	chr6.hg19:g.31324160_31324161insA	ENSP00000399168:p.Arg135fs	46.0	0.0		40.0	13.0	NM_005514	Q29764	Frame_Shift_Ins	INS	ENST00000412585.2	hg19	CCDS34394.1																																																																																			.	.		0.718	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076280.4	NM_005514	
PCBP2	5094	hgsc.bcm.edu	37	12	53856277	53856278	+	Frame_Shift_Ins	INS	-	-	C			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr12:53856277_53856278insC	ENST00000439930.3	+	7	539_540	c.517_518insC	c.(517-519)tccfs	p.S173fs	PCBP2_ENST00000603815.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000548933.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000546463.1_Splice_Site_p.S169fs|PCBP2_ENST00000359462.5_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000552819.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000437231.1_Splice_Site_p.S169fs|PCBP2_ENST00000359282.5_Splice_Site_p.S169fs|PCBP2_ENST00000549863.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000455667.3_Splice_Site_p.S169fs|PCBP2_ENST00000447282.1_Frame_Shift_Ins_p.S173fs|PCBP2_ENST00000552296.2_Splice_Site_p.S169fs|PCBP2_ENST00000541275.1_Splice_Site_p.S169fs|RP11-793H13.8_ENST00000547717.1_RNA			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	173					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						TCTCTCCCAGTCCCCCCCGAAG	0.5																																					p.S173fs		Atlas-INDEL	.											.,2	PCBP2	38	.	0			c.517_518insC						.																																			SO:0001589	frameshift_variant	5094	exon8			.	BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.524dupC	chr12.hg19:g.53856284_53856284dupC	ENSP00000408949:p.Ser173fs	21.0	0.0		33.0	10.0	NM_005016	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Frame_Shift_Ins	INS	ENST00000439930.3	hg19	CCDS44901.1																																																																																			.	.		0.500	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000407545.2	NM_005016	
ZNF134	7693	hgsc.bcm.edu	37	19	58132394	58132399	+	In_Frame_Del	DEL	CTTGTT	CTTGTT	-			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	CTTGTT	CTTGTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr19:58132394_58132399delCTTGTT	ENST00000396161.5	+	3	1217_1222	c.907_912delCTTGTT	c.(907-912)cttgttdel	p.LV303del		NM_003435.3	NP_003426.3	P52741	ZN134_HUMAN	zinc finger protein 134	303					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(3)|prostate(1)	11		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		CAAATCTACACTTGTTCAGCATGAGA	0.413																																					p.302_304del		Atlas-INDEL	.											.	ZNF134	34	.	0			c.906_911del						.																																			SO:0001651	inframe_deletion	7693	exon3			.	U09412	CCDS42638.1	19q13.4	2013-01-08	2006-06-13			ENSG00000213762		"""Zinc fingers, C2H2-type"""	12918	protein-coding gene	gene with protein product		604076	"""zinc finger protein 134 (clone pHZ-15)"""			7557990	Standard	NM_003435		Approved	pHZ-15	uc002qpn.2	P52741		ENST00000396161.5:c.907_912delCTTGTT	chr19.hg19:g.58132394_58132399delCTTGTT	ENSP00000379464:p.Leu303_Val304del	34.0	0.0		50.0	10.0	NM_003435	Q9Y4B2	In_Frame_Del	DEL	ENST00000396161.5	hg19	CCDS42638.1																																																																																			.	.		0.413	ZNF134-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466808.1	NM_003435	
ANKHD1	54882	hgsc.bcm.edu	37	5	139903797	139903798	+	Frame_Shift_Ins	INS	-	-	G			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr5:139903797_139903798insG	ENST00000360839.2	+	25	4618_4619	c.4464_4465insG	c.(4465-4467)gaafs	p.E1489fs	ANKHD1_ENST00000297183.6_Frame_Shift_Ins_p.E1489fs|ANKHD1-EIF4EBP3_ENST00000532219.1_Frame_Shift_Ins_p.E1489fs|ANKHD1_ENST00000544120.1_5'Flank	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1489						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACCAGAGGATGAAGATGAAGA	0.342																																					p.D1488fs		Atlas-INDEL	.											.	ANKHD1	233	.	0			c.4464_4465insG						.																																			SO:0001589	frameshift_variant	54882	exon25			.	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.4465dupG	chr5.hg19:g.139903798_139903798dupG	ENSP00000354085:p.Glu1489fs	410.0	0.0		479.0	160.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Frame_Shift_Ins	INS	ENST00000360839.2	hg19	CCDS4225.1																																																																																			.	.		0.342	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
MYH4	4622	hgsc.bcm.edu	37	17	10353951	10353951	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr17:10353951delC	ENST00000255381.2	-	30	4110	c.4000delG	c.(4000-4002)gccfs	p.A1334fs	RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1334					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						AGGGCATGGGCCAGAGTGCTC	0.483																																					p.A1334fs		Atlas-Indel,Pindel	.											.	MYH4	349	.	0			c.4001delC						.						84.0	74.0	77.0					17																	10353951		2203	4300	6503	SO:0001589	frameshift_variant	4622	exon30			.		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.4000delG	chr17.hg19:g.10353951delC	ENSP00000255381:p.Ala1334fs	49.0	0.0		31.0	18.0	NM_017533		Frame_Shift_Del	DEL	ENST00000255381.2	hg19	CCDS11154.1																																																																																			.	.		0.483	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
ADCY10	55811	hgsc.bcm.edu	37	1	167802265	167802267	+	In_Frame_Del	DEL	GAA	GAA	-	rs369038387		TCGA-FV-A23B-01A-11D-A16V-10	TCGA-FV-A23B-11A-11D-A16V-10	GAA	GAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	63adc09c-e1b1-40dd-9c35-2f8276b656fc	6c3072b0-3eb6-4a43-8a18-74e5a5869d4c	g.chr1:167802265_167802267delGAA	ENST00000367851.4	-	25	3735_3737	c.3551_3553delTTC	c.(3550-3555)tttcat>tat	p.1184_1185FH>Y	ADCY10_ENST00000367848.1_In_Frame_Del_p.1092_1093FH>Y|ADCY10_ENST00000545172.1_In_Frame_Del_p.1031_1032FH>Y	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1184					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						TTCACATAATGAAAGTGTCTGTT	0.488																																					p.1184_1185del		Atlas-Indel,Pindel	.											.	ADCY10	175	.	0			c.3552_3554del						.																																			SO:0001651	inframe_deletion	55811	exon25			.	AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.3551_3553delTTC	chr1.hg19:g.167802265_167802267delGAA	ENSP00000356825:p.Phe1184_His1185delinsTyr	101.0	0.0		121.0	28.0	NM_018417	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	In_Frame_Del	DEL	ENST00000367851.4	hg19	CCDS1265.1																																																																																			.	.		0.488	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083663.1	NM_018417	
