#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GPR157	80045	hgsc.bcm.edu	37	1	9188904	9188904	+	Silent	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:9188904G>A	ENST00000377411.4	-	1	325	c.183C>T	c.(181-183)gcC>gcT	p.A61A	GPR157_ENST00000414642.2_Silent_p.A61A	NM_024980.4	NP_079256.4	Q5UAW9	GP157_HUMAN	G protein-coupled receptor 157	61						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			lung(4)|prostate(1)	5	all_lung(157;0.185)	all_epithelial(116;5.02e-20)|all_lung(118;3.6e-06)|Lung NSC(185;7.93e-06)|Renal(390;0.000147)|Breast(348;0.000688)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.16e-07)|COAD - Colon adenocarcinoma(227;7.73e-05)|Kidney(185;0.000252)|KIRC - Kidney renal clear cell carcinoma(229;0.000917)|STAD - Stomach adenocarcinoma(132;0.00178)|BRCA - Breast invasive adenocarcinoma(304;0.00186)|READ - Rectum adenocarcinoma(331;0.0642)		AGTAGGAGGCGGCCGAGAGCA	0.706																																					p.A61A		Atlas-SNP	.											.	GPR157	14	.	0			c.C183T						.						12.0	12.0	12.0					1																	9188904		2191	4289	6480	SO:0001819	synonymous_variant	80045	exon1			GGAGGCGGCCGAG	AK022194	CCDS100.2	1p36.22	2012-08-21			ENSG00000180758	ENSG00000180758		"""GPCR / Class B : Orphans"""	23687	protein-coding gene	gene with protein product						10574461	Standard	XM_005263496		Approved	FLJ12132	uc001apq.1	Q5UAW9	OTTHUMG00000001758	ENST00000377411.4:c.183C>T	chr1.hg19:g.9188904G>A		28.0	0.0		43.0	17.0	NM_024980	A2A334|Q8WWB8|Q9HA73	Silent	SNP	ENST00000377411.4	hg19	CCDS100.2																																																																																			.	.		0.706	GPR157-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127658.2	NM_024980	
MRPS15	64960	hgsc.bcm.edu	37	1	36923570	36923570	+	Missense_Mutation	SNP	G	G	C	rs376585999		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:36923570G>C	ENST00000373116.5	-	6	559	c.398C>G	c.(397-399)tCt>tGt	p.S133C	MRPS15_ENST00000488606.1_5'UTR	NM_031280.3	NP_112570.2	P82914	RT15_HUMAN	mitochondrial ribosomal protein S15	133					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)	14		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GATCTTGACAGACAAGGCAAT	0.473																																					p.S133C		Atlas-SNP	.											.	MRPS15	21	.	0			c.C398G						.	G	CYS/SER	0,4406		0,0,2203	147.0	133.0	138.0		398	5.5	1.0	1		138	1,8599	1.2+/-3.3	0,1,4299	no	missense	MRPS15	NM_031280.3	112	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	possibly-damaging	133/258	36923570	1,13005	2203	4300	6503	SO:0001583	missense	64960	exon6			TTGACAGACAAGG	AB049946	CCDS411.1	1p34.3	2012-09-13			ENSG00000116898	ENSG00000116898		"""Mitochondrial ribosomal proteins / small subunits"""	14504	protein-coding gene	gene with protein product		611979					Standard	NM_031280		Approved	FLJ11564	uc001cas.2	P82914	OTTHUMG00000008042	ENST00000373116.5:c.398C>G	chr1.hg19:g.36923570G>C	ENSP00000362208:p.Ser133Cys	104.0	0.0		121.0	35.0	NM_031280	B2RD82|Q9H2K1	Missense_Mutation	SNP	ENST00000373116.5	hg19	CCDS411.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474612	0.84640	0.0	1.16E-4	ENSG00000116898	ENST00000373116	.	.	.	5.49	5.49	0.81192	S15/NS1, RNA-binding (2);	0.144121	0.64402	D	0.000008	T	0.67979	0.2951	L	0.61036	1.89	0.36412	D	0.863802	P	0.52577	0.954	P	0.52109	0.69	T	0.76493	-0.2939	9	0.87932	D	0	-1.174	18.3538	0.90348	0.0:0.0:1.0:0.0	.	133	P82914	RT15_HUMAN	C	133	.	ENSP00000362208:S133C	S	-	2	0	MRPS15	36696157	1.000000	0.71417	0.956000	0.39512	0.934000	0.57294	6.430000	0.73391	2.559000	0.86315	0.563000	0.77884	TCT	.	.		0.473	MRPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022052.2	NM_031280	
ITGB3BP	23421	hgsc.bcm.edu	37	1	63974243	63974243	+	Splice_Site	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:63974243T>C	ENST00000271002.10	-	2	87		c.e2-2		ITGB3BP_ENST00000371092.3_Splice_Site|ITGB3BP_ENST00000283568.8_Splice_Site	NM_014288.4	NP_055103.3	Q13352	CENPR_HUMAN	integrin beta 3 binding protein (beta3-endonexin)						apoptotic signaling pathway (GO:0097190)|cell adhesion (GO:0007155)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9						CTTTTAACACTACAAACAAAA	0.269																																					.		Atlas-SNP	.											.	ITGB3BP	20	.	0			c.6-2A>G						.						25.0	25.0	25.0					1																	63974243		2150	4205	6355	SO:0001630	splice_region_variant	23421	exon3			TAACACTACAAAC	U37139	CCDS30736.1, CCDS55603.1	1p31.3	2013-11-05			ENSG00000142856	ENSG00000142856			6157	protein-coding gene	gene with protein product	"""centromere protein R"""	605494				7593198, 10490654	Standard	NM_014288		Approved	NRIF3, HSU37139, TAP20, CENPR	uc001dbb.2	Q13352	OTTHUMG00000013364	ENST00000271002.10:c.6-2A>G	chr1.hg19:g.63974243T>C		256.0	0.0		311.0	99.0	NM_014288	B2R7D8|Q13353|Q5RJ42|Q5RJ44|Q5RJ45|Q7KYX2|Q96CD5|Q9UKB6	Splice_Site	SNP	ENST00000271002.10	hg19	CCDS30736.1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.872969	0.33069	.	.	ENSG00000142856	ENST00000271002;ENST00000371092;ENST00000283568	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3195	0.74109	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ITGB3BP	63746831	1.000000	0.71417	0.998000	0.56505	0.510000	0.34073	3.690000	0.54713	2.011000	0.59026	0.528000	0.53228	.	.	.		0.269	ITGB3BP-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000037242.2	NM_014288	Intron
DPYD	1806	hgsc.bcm.edu	37	1	98164998	98164998	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:98164998G>A	ENST00000370192.3	-	6	689	c.589C>T	c.(589-591)Cct>Tct	p.P197S	DPYD_ENST00000423006.2_3'UTR|DPYD_ENST00000474241.1_5'UTR	NM_000110.3	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase	197					beta-alanine biosynthetic process (GO:0019483)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase catabolic process (GO:0006145)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymidine catabolic process (GO:0006214)|thymine catabolic process (GO:0006210)|UMP biosynthetic process (GO:0006222)|uracil catabolic process (GO:0006212)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|dihydroorotate dehydrogenase activity (GO:0004152)|dihydropyrimidine dehydrogenase (NADP+) activity (GO:0017113)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(18)|lung(30)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	83		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Flavin adenine dinucleotide(DB03147)|Fluorouracil(DB00544)	ATACTTGCAGGCCCAGCACCA	0.423																																					p.P197S		Atlas-SNP	.											.	DPYD	219	.	0			c.C589T						.						161.0	159.0	160.0					1																	98164998		2203	4300	6503	SO:0001583	missense	1806	exon6			TTGCAGGCCCAGC	U20938	CCDS30777.1, CCDS53346.1	1p22	2014-09-17			ENSG00000188641	ENSG00000188641	1.3.1.2		3012	protein-coding gene	gene with protein product		612779				7713523	Standard	NM_000110		Approved	DPD	uc001drv.3	Q12882	OTTHUMG00000039683	ENST00000370192.3:c.589C>T	chr1.hg19:g.98164998G>A	ENSP00000359211:p.Pro197Ser	145.0	0.0		162.0	51.0	NM_000110	A2RRQ2|A2RRQ3|A8K5A2|A8MWG9|B1AN21|E9PFN1|Q16694|Q16761|Q32NB0|Q96HL6|Q96TH1	Missense_Mutation	SNP	ENST00000370192.3	hg19	CCDS30777.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.776208	0.90195	.	.	ENSG00000188641	ENST00000370192	D	0.96774	-4.12	5.5	5.5	0.81552	Alpha-helical ferredoxin (1);	0.000000	0.85682	D	0.000000	D	0.98356	0.9454	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99177	1.0866	10	0.87932	D	0	-15.1612	19.3869	0.94560	0.0:0.0:1.0:0.0	.	197	Q12882	DPYD_HUMAN	S	197	ENSP00000359211:P197S	ENSP00000359211:P197S	P	-	1	0	DPYD	97937586	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	9.431000	0.97494	2.591000	0.87537	0.585000	0.79938	CCT	.	.		0.423	DPYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095698.3	NM_000110	
PLPPR4	9890	hgsc.bcm.edu	37	1	99771771	99771771	+	Silent	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:99771771T>C	ENST00000370185.3	+	7	1994	c.1497T>C	c.(1495-1497)aaT>aaC	p.N499N	LPPR4_ENST00000457765.1_Silent_p.N441N|LPPR4_ENST00000370184.1_Silent_p.N341N	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		499					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GTCCTGGCAATCAGTACCTCA	0.572																																					p.N499N		Atlas-SNP	.											.	LPPR4	143	.	0			c.T1497C						.						159.0	161.0	160.0					1																	99771771		2203	4300	6503	SO:0001819	synonymous_variant	0	exon7			TGGCAATCAGTAC																												ENST00000370185.3:c.1497T>C	chr1.hg19:g.99771771T>C		93.0	0.0		96.0	38.0	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	ENST00000370185.3	hg19	CCDS757.1																																																																																			.	.		0.572	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
KIAA0040	9674	hgsc.bcm.edu	37	1	175129924	175129924	+	Missense_Mutation	SNP	C	C	T	rs150137790		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:175129924C>T	ENST00000423313.1	-	4	762	c.226G>A	c.(226-228)Gat>Aat	p.D76N	KIAA0040_ENST00000444639.1_Missense_Mutation_p.D76N|KIAA0040_ENST00000567124.1_5'Flank|KIAA0040_ENST00000545251.2_Missense_Mutation_p.D76N	NM_001162893.1|NM_001162895.1|NM_014656.2	NP_001156365.1|NP_001156367.1|NP_055471.2	Q15053	K0040_HUMAN	KIAA0040	0																	tcttcttcatccttcttcttc	0.502																																					p.D76N		Atlas-SNP	.											.	KIAA0040	2	.	0			c.G226A						.						120.0	100.0	106.0					1																	175129924		692	1591	2283	SO:0001583	missense	9674	exon3			CTTCATCCTTCTT	D25539		1q24-q25	2012-11-29			ENSG00000235750	ENSG00000235750			28950	protein-coding gene	gene with protein product							Standard	NM_014656		Approved		uc001gkn.3	Q15053	OTTHUMG00000034880	ENST00000423313.1:c.226G>A	chr1.hg19:g.175129924C>T	ENSP00000462172:p.Asp76Asn	117.0	0.0		120.0	6.0	NM_001162895	A8K9H6|Q2NKQ0	Missense_Mutation	SNP	ENST00000423313.1	hg19																																																																																				.	.		0.502	KIAA0040-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000084420.3	NM_014656	
LAD1	3898	hgsc.bcm.edu	37	1	201351823	201351823	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:201351823C>T	ENST00000391967.2	-	8	1732	c.1431G>A	c.(1429-1431)ctG>ctA	p.L477L	LAD1_ENST00000367313.3_Silent_p.L491L|LAD1_ENST00000488842.1_5'UTR	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	477						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						TGCTGATCCACAGGTTGAGCC	0.547																																					p.L477L		Atlas-SNP	.											.	LAD1	42	.	0			c.G1431A						.						91.0	64.0	73.0					1																	201351823		2203	4300	6503	SO:0001819	synonymous_variant	3898	exon8			GATCCACAGGTTG	U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.1431G>A	chr1.hg19:g.201351823C>T		55.0	0.0		53.0	16.0	NM_005558	O95614|Q96GD8	Silent	SNP	ENST00000391967.2	hg19	CCDS1410.1																																																																																			.	.		0.547	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086946.1	NM_005558	
ODC1	4953	hgsc.bcm.edu	37	2	10581663	10581663	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr2:10581663T>C	ENST00000234111.4	-	11	1723	c.1213A>G	c.(1213-1215)Atc>Gtc	p.I405V	ODC1_ENST00000405333.1_Missense_Mutation_p.I405V|ODC1_ENST00000446285.1_5'Flank	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	405					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	ACATAGTAGATCGTCGGCCTC	0.502																																					p.I405V		Atlas-SNP	.											.	ODC1	40	.	0			c.A1213G						.						59.0	53.0	55.0					2																	10581663		2203	4300	6503	SO:0001583	missense	4953	exon11			AGTAGATCGTCGG		CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.1213A>G	chr2.hg19:g.10581663T>C	ENSP00000234111:p.Ile405Val	118.0	0.0		140.0	98.0	NM_002539	Q53TU3|Q6LDS9	Missense_Mutation	SNP	ENST00000234111.4	hg19	CCDS1672.1	.	.	.	.	.	.	.	.	.	.	T	7.060	0.566151	0.13560	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000537630	T;T	0.37411	1.2;1.2	5.66	5.66	0.87406	Orn/DAP/Arg decarboxylase 2, C-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (2);	0.172204	0.56097	D	0.000037	T	0.20251	0.0487	N	0.16307	0.4	0.47341	D	0.999399	B	0.02656	0.0	B	0.09377	0.004	T	0.07966	-1.0745	10	0.06757	T	0.87	.	11.8398	0.52346	0.0:0.0:0.146:0.854	.	405	P11926	DCOR_HUMAN	V	405;405;276	ENSP00000234111:I405V;ENSP00000385333:I405V	ENSP00000234111:I405V	I	-	1	0	ODC1	10499114	1.000000	0.71417	0.907000	0.35723	0.830000	0.47004	3.927000	0.56499	2.157000	0.67596	0.482000	0.46254	ATC	.	.		0.502	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2		
SETD2	29072	hgsc.bcm.edu	37	3	47098921	47098921	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:47098921G>A	ENST00000409792.3	-	15	6395	c.6353C>T	c.(6352-6354)aCa>aTa	p.T2118I		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2118					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		GCGTTCCTCTGTAGAAAGTTT	0.428			"""N, F, S, Mis"""		clear cell renal carcinoma																																p.T2118I		Atlas-SNP	.		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	.	SETD2	721	.	0			c.C6353T						.						70.0	72.0	71.0					3																	47098921		2203	4300	6503	SO:0001583	missense	29072	exon15			TCCTCTGTAGAAA	AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6353C>T	chr3.hg19:g.47098921G>A	ENSP00000386759:p.Thr2118Ile	98.0	0.0		96.0	24.0	NM_014159	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	ENST00000409792.3	hg19	CCDS2749.2	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437857	0.83885	.	.	ENSG00000181555	ENST00000451092;ENST00000409792	T	0.25414	1.8	4.98	4.98	0.66077	.	0.000000	0.64402	D	0.000010	T	0.47801	0.1465	L	0.50333	1.59	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.44483	-0.9325	10	0.87932	D	0	.	18.7956	0.91993	0.0:0.0:1.0:0.0	.	2118;2118	F2Z317;Q9BYW2	.;SETD2_HUMAN	I	2118	ENSP00000386759:T2118I	ENSP00000386759:T2118I	T	-	2	0	SETD2	47073925	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.171000	0.94802	2.755000	0.94549	0.655000	0.94253	ACA	.	.		0.428	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257479.2	NM_014159	
ROBO1	6091	hgsc.bcm.edu	37	3	78685014	78685014	+	Silent	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:78685014A>G	ENST00000464233.1	-	23	3395	c.3282T>C	c.(3280-3282)tcT>tcC	p.S1094S	ROBO1_ENST00000467549.1_Silent_p.S994S|ROBO1_ENST00000436010.2_Silent_p.S1055S|ROBO1_ENST00000495273.1_Silent_p.S1049S	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1094					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GCTTCTCGCCAGAGTCCCCGC	0.517																																					p.S1094S		Atlas-SNP	.											.	ROBO1	833	.	0			c.T3282C						.						172.0	173.0	173.0					3																	78685014		2149	4260	6409	SO:0001819	synonymous_variant	6091	exon23			CTCGCCAGAGTCC	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.3282T>C	chr3.hg19:g.78685014A>G		178.0	0.0		178.0	60.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	ENST00000464233.1	hg19	CCDS54611.1																																																																																			.	.		0.517	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
OR5H14	403273	hgsc.bcm.edu	37	3	97868346	97868346	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:97868346C>A	ENST00000437310.1	+	1	177	c.117C>A	c.(115-117)atC>atA	p.I39I	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						TCATCACCATCATGGGGAATC	0.408																																					p.I39I		Atlas-SNP	.											.	OR5H14	56	.	0			c.C117A						.						207.0	210.0	209.0					3																	97868346		2203	4297	6500	SO:0001819	synonymous_variant	403273	exon1			CACCATCATGGGG		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.117C>A	chr3.hg19:g.97868346C>A		556.0	0.0		565.0	189.0	NM_001005514	B9EH15	Silent	SNP	ENST00000437310.1	hg19	CCDS33798.1																																																																																			.	.		0.408	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
BBX	56987	hgsc.bcm.edu	37	3	107510138	107510138	+	Missense_Mutation	SNP	C	C	T	rs138504832		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:107510138C>T	ENST00000325805.8	+	15	2632	c.2345C>T	c.(2344-2346)cCt>cTt	p.P782L	BBX_ENST00000415149.2_Missense_Mutation_p.P752L|BBX_ENST00000416476.2_Silent_p.L446L|BBX_ENST00000473542.1_3'UTR|BBX_ENST00000402543.1_Intron|BBX_ENST00000406780.1_Missense_Mutation_p.P752L			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	782					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			GCCATTCACCCTACAGAAGGT	0.338																																					p.P782L		Atlas-SNP	.											.	BBX	156	.	0			c.C2345T						.						97.0	93.0	94.0					3																	107510138		2203	4300	6503	SO:0001583	missense	56987	exon15			TTCACCCTACAGA	AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.2345C>T	chr3.hg19:g.107510138C>T	ENSP00000319974:p.Pro782Leu	215.0	0.0		230.0	53.0	NM_001142568	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	ENST00000325805.8	hg19	CCDS46881.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872662	0.51695	.	.	ENSG00000114439	ENST00000415149;ENST00000325805;ENST00000406780	T;T;T	0.30448	1.53;1.81;1.53	5.11	4.16	0.48862	.	0.577026	0.19862	N	0.104420	T	0.16171	0.0389	N	0.19112	0.55	0.36056	D	0.841114	P;B	0.36222	0.544;0.4	B;B	0.27170	0.072;0.077	T	0.14783	-1.0460	10	0.87932	D	0	-8.2148	7.6738	0.28473	0.0:0.8847:0.0:0.1153	.	782;752	Q8WY36;Q8WY36-2	BBX_HUMAN;.	L	752;782;752	ENSP00000408358:P752L;ENSP00000319974:P782L;ENSP00000385530:P752L	ENSP00000319974:P782L	P	+	2	0	BBX	108992828	0.999000	0.42202	1.000000	0.80357	0.982000	0.71751	1.992000	0.40737	2.656000	0.90262	0.557000	0.71058	CCT	.	C|1.000;A|0.000		0.338	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317820.1	NM_020235	
COPG1	22820	hgsc.bcm.edu	37	3	128973580	128973580	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:128973580C>A	ENST00000314797.6	+	6	497	c.393C>A	c.(391-393)atC>atA	p.I131I		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	131					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										TCTGCCAGATCACTGATGTGA	0.562																																					p.I131I		Atlas-SNP	.											.	.	.	.	0			c.C393A						.						54.0	57.0	56.0					3																	128973580		2203	4300	6503	SO:0001819	synonymous_variant	22820	exon6			CCAGATCACTGAT	AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.393C>A	chr3.hg19:g.128973580C>A		41.0	0.0		45.0	11.0	NM_016128	A8K6M8|B3KMF6|Q54AC4	Silent	SNP	ENST00000314797.6	hg19	CCDS33851.1																																																																																			.	.		0.562	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355456.1	NM_016128	
GPR87	53836	hgsc.bcm.edu	37	3	151017871	151017871	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:151017871C>A	ENST00000260843.4	-	2	482	c.18G>T	c.(16-18)acG>acT	p.T6T	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_023915.3	NP_076404.3	Q9BY21	GPR87_HUMAN	G protein-coupled receptor 87	6					negative regulation of adenylate cyclase activity (GO:0007194)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(6)|large_intestine(6)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	19			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATTTTGCAAGCGTCAAGTTGA	0.408																																					p.T6T		Atlas-SNP	.											.	GPR87	52	.	0			c.G18T						.						105.0	96.0	99.0					3																	151017871		2203	4300	6503	SO:0001819	synonymous_variant	53836	exon2			TGCAAGCGTCAAG	AF237763	CCDS3157.1	3q24	2012-08-21			ENSG00000138271	ENSG00000138271		"""GPCR / Class A : Orphans"""	4538	protein-coding gene	gene with protein product		606379		GPR95		11273702	Standard	NM_023915		Approved		uc003eyt.2	Q9BY21	OTTHUMG00000159858	ENST00000260843.4:c.18G>T	chr3.hg19:g.151017871C>A		84.0	0.0		84.0	4.0	NM_023915	Q5KU35|Q96JZ8|Q9BXC2	Silent	SNP	ENST00000260843.4	hg19	CCDS3157.1																																																																																			.	.		0.408	GPR87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357788.1		
NLGN1	22871	hgsc.bcm.edu	37	3	173998534	173998534	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr3:173998534C>A	ENST00000457714.1	+	7	2342	c.1913C>A	c.(1912-1914)cCt>cAt	p.P638H	NLGN1_ENST00000361589.4_Missense_Mutation_p.P638H|NLGN1_ENST00000545397.1_Missense_Mutation_p.P638H|NLGN1_ENST00000401917.3_Missense_Mutation_p.P678H	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	655					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			ACTTTCAGACCTACGAGAAAA	0.438																																					p.P638H		Atlas-SNP	.											.	NLGN1	209	.	0			c.C1913A						.						122.0	121.0	121.0					3																	173998534		2203	4300	6503	SO:0001583	missense	22871	exon7			TCAGACCTACGAG	AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1913C>A	chr3.hg19:g.173998534C>A	ENSP00000392500:p.Pro638His	166.0	0.0		148.0	40.0	NM_014932	Q9UPT2	Missense_Mutation	SNP	ENST00000457714.1	hg19	CCDS3222.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.821953	0.50633	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35	5.59	5.59	0.84812	.	0.055473	0.64402	D	0.000001	T	0.55130	0.1901	N	0.12961	0.28	0.58432	D	0.999999	B	0.16166	0.016	B	0.17722	0.019	T	0.52503	-0.8567	10	0.72032	D	0.01	.	19.9651	0.97262	0.0:1.0:0.0:0.0	.	638	Q8N2Q7-2	.	H	638;638;638;678	ENSP00000392500:P638H;ENSP00000354541:P638H;ENSP00000441108:P638H;ENSP00000385750:P678H	ENSP00000354541:P638H	P	+	2	0	NLGN1	175481228	0.993000	0.37304	0.999000	0.59377	0.968000	0.65278	2.911000	0.48774	2.793000	0.96121	0.655000	0.94253	CCT	.	.		0.438	NLGN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347054.3	NM_014932	
PPEF2	5470	hgsc.bcm.edu	37	4	76794280	76794280	+	Splice_Site	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr4:76794280C>A	ENST00000286719.7	-	12	1862	c.1506G>T	c.(1504-1506)aaG>aaT	p.K502N		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	502	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GAGCACCCACCTTGCGGTTGT	0.478																																					p.K502N	NSCLC(105;1359 1603 15961 44567 47947)	Atlas-SNP	.											.	PPEF2	108	.	0			c.G1506T						.						130.0	119.0	123.0					4																	76794280		2203	4300	6503	SO:0001630	splice_region_variant	5470	exon12			ACCCACCTTGCGG	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1506+1G>T	chr4.hg19:g.76794280C>A		76.0	0.0		92.0	21.0	NM_006239	O14831	Missense_Mutation	SNP	ENST00000286719.7	hg19	CCDS34013.1	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684002	0.47991	.	.	ENSG00000156194	ENST00000286719;ENST00000337500	T	0.05925	3.37	4.85	4.01	0.46588	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);	0.048452	0.85682	D	0.000000	T	0.16385	0.0394	L	0.46614	1.455	0.48830	D	0.999719	P;D	0.89917	0.929;1.0	P;D	0.85130	0.734;0.997	T	0.01093	-1.1454	9	.	.	.	-3.0911	10.8508	0.46769	0.0:0.9083:0.0:0.0917	.	502;502	O14830-2;O14830	.;PPE2_HUMAN	N	502	ENSP00000286719:K502N	.	K	-	3	2	PPEF2	77013304	1.000000	0.71417	1.000000	0.80357	0.026000	0.11368	5.382000	0.66213	1.274000	0.44362	0.563000	0.77884	AAG	.	.		0.478	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239	Missense_Mutation
TENM3	55714	hgsc.bcm.edu	37	4	183659598	183659598	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr4:183659598T>C	ENST00000511685.1	+	18	3403	c.3280T>C	c.(3280-3282)Tgg>Cgg	p.W1094R	TENM3_ENST00000502950.1_3'UTR|TENM3_ENST00000406950.2_Missense_Mutation_p.W1094R			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1094					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CCTGACTCTGTGGGAAAAGAG	0.468																																					p.W1094R		Atlas-SNP	.											.	.	.	.	0			c.T3280C						.						260.0	252.0	254.0					4																	183659598		1946	4161	6107	SO:0001583	missense	55714	exon17			ACTCTGTGGGAAA	AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.3280T>C	chr4.hg19:g.183659598T>C	ENSP00000424226:p.Trp1094Arg	136.0	0.0		155.0	48.0	NM_001080477	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	ENST00000511685.1	hg19	CCDS47165.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.410027	0.83340	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	D;D	0.92595	-3.07;-3.07	5.25	5.25	0.73442	.	.	.	.	.	D	0.96491	0.8855	M	0.88310	2.945	0.80722	D	1	D	0.71674	0.998	D	0.77557	0.99	D	0.97256	0.9901	9	0.87932	D	0	.	15.3185	0.74102	0.0:0.0:0.0:1.0	.	1094	Q9P273	TEN3_HUMAN	R	1094	ENSP00000424226:W1094R;ENSP00000385276:W1094R	ENSP00000385276:W1094R	W	+	1	0	ODZ3	183896592	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.868000	0.87116	2.206000	0.71126	0.533000	0.62120	TGG	.	.		0.468	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361734.1		
OCLN	100506658	hgsc.bcm.edu	37	5	68805338	68805338	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:68805338A>T	ENST00000355237.2	+	3	857	c.421A>T	c.(421-423)Atg>Ttg	p.M141L	OCLN_ENST00000380766.2_Missense_Mutation_p.M141L|OCLN_ENST00000538151.1_Intron|OCLN_ENST00000396442.2_Missense_Mutation_p.M141L|OCLN_ENST00000542132.1_Intron	NM_002538.3	NP_002529.1	Q16625	OCLN_HUMAN	occludin	141	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				apoptotic process (GO:0006915)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|protein complex assembly (GO:0006461)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethionine metabolic process (GO:0046500)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)|structural molecule activity (GO:0005198)|thiopurine S-methyltransferase activity (GO:0008119)			endometrium(2)|large_intestine(1)|liver(1)|prostate(1)|skin(1)	6		Lung NSC(167;4.15e-05)|Prostate(74;0.00996)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;3.04e-60)|Epithelial(20;7.09e-58)|all cancers(19;1.13e-53)|Lung(70;0.0174)		AAAGGGCTTCATGTTGGCCAT	0.463																																					p.M141L		Atlas-SNP	.											.	OCLN	22	.	0			c.A421T						.						159.0	112.0	128.0					5																	68805338		2203	4300	6503	SO:0001583	missense	100506658	exon3			GGCTTCATGTTGG	U49184	CCDS4006.1, CCDS54864.1	5q13.1	2014-06-13			ENSG00000197822	ENSG00000197822			8104	protein-coding gene	gene with protein product	"""tight junction protein occludin TM4 minus"", ""phosphatase 1, regulatory subunit 115"""	602876				8601611	Standard	NM_002538		Approved	PPP1R115	uc003jwu.3	Q16625	OTTHUMG00000099356	ENST00000355237.2:c.421A>T	chr5.hg19:g.68805338A>T	ENSP00000347379:p.Met141Leu	289.0	0.0		318.0	111.0	NM_001205254	B5BU70|D2DU64|D2DU65|D2IGC0|D2IGC1|E2CYV9|Q5U1V4|Q8N6K1	Missense_Mutation	SNP	ENST00000355237.2	hg19	CCDS4006.1	.	.	.	.	.	.	.	.	.	.	A	5.070	0.198593	0.09652	.	.	ENSG00000197822	ENST00000355237;ENST00000396442;ENST00000380766	T;T;T	0.24350	1.86;1.86;1.86	5.82	1.38	0.22167	Marvel (1);MARVEL-like domain (1);	0.486738	0.23288	N	0.049833	T	0.07458	0.0188	N	0.02142	-0.665	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19712	-1.0297	10	0.18276	T	0.48	-20.5348	4.9156	0.13844	0.5703:0.2415:0.0:0.1882	.	141	Q16625	OCLN_HUMAN	L	141	ENSP00000347379:M141L;ENSP00000379719:M141L;ENSP00000370143:M141L	ENSP00000347379:M141L	M	+	1	0	OCLN	68841094	1.000000	0.71417	0.980000	0.43619	0.626000	0.37791	1.178000	0.31981	0.353000	0.24079	-0.887000	0.02937	ATG	.	.		0.463	OCLN-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216794.1	NM_002538	
EDIL3	10085	hgsc.bcm.edu	37	5	83680126	83680126	+	Splice_Site	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:83680126C>T	ENST00000296591.5	-	1	485	c.67G>A	c.(67-69)Ggt>Agt	p.G23S	CTD-2269F5.1_ENST00000515688.1_RNA|CTD-2269F5.1_ENST00000509406.1_RNA|CTD-2269F5.1_ENST00000502253.1_RNA|EDIL3_ENST00000380138.3_Splice_Site_p.G23S|CTD-2269F5.1_ENST00000507060.1_RNA|CTD-2269F5.1_ENST00000514696.1_RNA	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	23					cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		GACGCCTTACCTTTGCCGAAC	0.697																																					p.G23S		Atlas-SNP	.											.	EDIL3	94	.	0			c.G67A						.						64.0	69.0	68.0					5																	83680126		2203	4300	6503	SO:0001630	splice_region_variant	10085	exon1			CCTTACCTTTGCC	U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.67+1G>A	chr5.hg19:g.83680126C>T		36.0	0.0		46.0	15.0	NM_005711	B2R763|O43855|Q5D094|Q8N610	Missense_Mutation	SNP	ENST00000296591.5	hg19	CCDS4062.1	.	.	.	.	.	.	.	.	.	.	C	15.49	2.849616	0.51270	.	.	ENSG00000164176	ENST00000296591;ENST00000380138	D;D	0.92752	-3.09;-3.1	4.26	4.26	0.50523	Epidermal growth factor-like, type 3 (1);	0.317991	0.22874	N	0.054593	D	0.85557	0.5724	N	0.21508	0.67	0.42244	D	0.991945	B;B	0.30021	0.004;0.265	B;B	0.33454	0.001;0.164	T	0.82086	-0.0631	9	.	.	.	-7.018	12.3834	0.55320	0.0:1.0:0.0:0.0	.	23;23	O43854-2;O43854	.;EDIL3_HUMAN	S	23	ENSP00000296591:G23S;ENSP00000369483:G23S	.	G	-	1	0	EDIL3	83715882	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	4.017000	0.57167	2.389000	0.81357	0.491000	0.48974	GGT	.	.		0.697	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239258.1	NM_005711	Missense_Mutation
WDR36	134430	hgsc.bcm.edu	37	5	110456277	110456277	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:110456277C>A	ENST00000513710.2	+	18	2160	c.2156C>A	c.(2155-2157)aCt>aAt	p.T719N	WDR36_ENST00000506538.2_Missense_Mutation_p.T719N			Q8NI36	WDR36_HUMAN	WD repeat domain 36	719					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		CTTCCTGGTACTTGTCAAACC	0.348																																					p.T719N		Atlas-SNP	.											.	WDR36	111	.	0			c.C2156A						.						135.0	132.0	133.0					5																	110456277		2202	4300	6502	SO:0001583	missense	134430	exon18			CTGGTACTTGTCA	AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2156C>A	chr5.hg19:g.110456277C>A	ENSP00000424628:p.Thr719Asn	91.0	0.0		104.0	26.0	NM_139281	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	ENST00000513710.2	hg19	CCDS4102.1	.	.	.	.	.	.	.	.	.	.	C	11.82	1.751290	0.31046	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.66995	-0.24;-0.24	5.72	3.92	0.45320	.	0.403741	0.32769	N	0.005679	T	0.61464	0.2349	L	0.54323	1.7	0.80722	D	1	B	0.12013	0.005	B	0.14578	0.011	T	0.60198	-0.7310	10	0.87932	D	0	-15.5734	12.0033	0.53243	0.0:0.8124:0.1218:0.0658	.	719	Q8NI36	WDR36_HUMAN	N	719	ENSP00000423067:T719N;ENSP00000424628:T719N	ENSP00000423067:T719N	T	+	2	0	WDR36	110484176	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.627000	0.54252	0.858000	0.35431	0.650000	0.86243	ACT	.	.		0.348	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000373504.3	NM_139281	
MYOT	9499	hgsc.bcm.edu	37	5	137219116	137219116	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:137219116G>T	ENST00000239926.4	+	7	1234	c.860G>T	c.(859-861)gGa>gTa	p.G287V	MYOT_ENST00000421631.2_Missense_Mutation_p.G103V|RP11-381K20.2_ENST00000508281.2_RNA|MYOT_ENST00000515645.1_Missense_Mutation_p.G172V|RP11-381K20.2_ENST00000514616.1_RNA|MYOT_ENST00000509812.1_Intron	NM_006790.2	NP_006781	Q9UBF9	MYOTI_HUMAN	myotilin	287	Ig-like C2-type 1.|Necessary for interaction with ACTA1.|Necessary for interaction with FLNC.				muscle contraction (GO:0006936)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	structural constituent of muscle (GO:0008307)			cervix(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TATCTAAATGGAAGAACAGTT	0.413																																					p.G287V		Atlas-SNP	.											MYOT,colon,carcinoma,0,1	MYOT	50	.	0			c.G860T						.						134.0	126.0	129.0					5																	137219116		2203	4300	6503	SO:0001583	missense	9499	exon7			TAAATGGAAGAAC	AF133820	CCDS4194.1, CCDS47268.1, CCDS75309.1	5q31.2	2014-09-17	2005-09-07	2005-09-07	ENSG00000120729	ENSG00000120729		"""Immunoglobulin superfamily / I-set domain containing"""	12399	protein-coding gene	gene with protein product		604103	"""titin immunoglobulin domain protein (myotilin)"", ""limb-girdle muscular dystrophy 1A (autosomal dominant)"""	TTID, LGMD1A, LGMD1		10486214, 10369880	Standard	NM_006790		Approved		uc003lbv.3	Q9UBF9	OTTHUMG00000129154	ENST00000239926.4:c.860G>T	chr5.hg19:g.137219116G>T	ENSP00000239926:p.Gly287Val	169.0	0.0		185.0	55.0	NM_006790	A0A4R6|B4DT79	Missense_Mutation	SNP	ENST00000239926.4	hg19	CCDS4194.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.938922	0.92526	.	.	ENSG00000120729	ENST00000239926;ENST00000421631;ENST00000515645	T;T;T	0.80033	-1.33;-1.33;-1.33	5.08	5.08	0.68730	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000009	D	0.94407	0.8201	H	0.98754	4.32	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96772	0.9569	10	0.87932	D	0	.	18.8467	0.92210	0.0:0.0:1.0:0.0	.	287	Q9UBF9	MYOTI_HUMAN	V	287;103;172	ENSP00000239926:G287V;ENSP00000391185:G103V;ENSP00000426281:G172V	ENSP00000239926:G287V	G	+	2	0	MYOT	137247015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.813000	0.99286	2.497000	0.84241	0.655000	0.94253	GGA	.	.		0.413	MYOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251219.2	NM_006790	
ANKHD1	54882	hgsc.bcm.edu	37	5	139889380	139889380	+	Silent	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:139889380T>C	ENST00000360839.2	+	21	4078	c.3924T>C	c.(3922-3924)tgT>tgC	p.C1308C	ANKHD1-EIF4EBP3_ENST00000532219.1_Silent_p.C1308C|ANKHD1_ENST00000297183.6_Silent_p.C1308C	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1308						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAAATTTTGTGAACTCCTGA	0.353																																					p.C1308C		Atlas-SNP	.											.	ANKHD1	233	.	0			c.T3924C						.						71.0	68.0	69.0					5																	139889380		2203	4300	6503	SO:0001819	synonymous_variant	54882	exon21			ATTTTGTGAACTC	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3924T>C	chr5.hg19:g.139889380T>C		104.0	0.0		165.0	56.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Silent	SNP	ENST00000360839.2	hg19	CCDS4225.1	.	.	.	.	.	.	.	.	.	.	T	8.191	0.795937	0.16327	.	.	ENSG00000131503	ENST00000246149	.	.	.	5.49	4.31	0.51392	.	.	.	.	.	T	0.61362	0.2341	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59532	-0.7437	4	.	.	.	.	11.0534	0.47903	0.0:0.1264:0.0:0.8736	.	.	.	.	A	534	.	.	V	+	2	0	ANKHD1	139869564	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.373000	0.52394	2.213000	0.71641	0.477000	0.44152	GTG	.	.		0.353	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHA10	56139	hgsc.bcm.edu	37	5	140235699	140235699	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:140235699C>T	ENST00000307360.5	+	1	66	c.66C>T	c.(64-66)gcC>gcT	p.A22A	PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Silent_p.A22A|PCDHA7_ENST00000525929.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018901.2	NP_061724.1	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10	22					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(11)|cervix(1)|endometrium(11)|kidney(5)|large_intestine(13)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	79			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCTCGCAGCCTGGGAGGTGG	0.597																																					p.A22A		Atlas-SNP	.											.	PCDHA10	358	.	0			c.C66T						.						58.0	68.0	64.0					5																	140235699		2196	4273	6469	SO:0001819	synonymous_variant	56139	exon1			CGCAGCCTGGGAG	AF152475	CCDS34255.1, CCDS54921.1, CCDS75325.1	5q31	2010-11-26			ENSG00000250120	ENSG00000250120		"""Cadherins / Protocadherins : Clustered"""	8664	other	complex locus constituent	"""KIAA0345-like 4"", ""ortholog to mouse CNR8"""	606316		CNRS8		10380929	Standard	NM_018901		Approved	CNR8, CRNR8, CNRN8, PCDH-ALPHA10		Q9Y5I2	OTTHUMG00000163372	ENST00000307360.5:c.66C>T	chr5.hg19:g.140235699C>T		64.0	0.0		76.0	52.0	NM_031859	A1L493|O75280|Q9NRU2	Silent	SNP	ENST00000307360.5	hg19	CCDS54921.1																																																																																			.	.		0.597	PCDHA10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372895.2	NM_018901	
ZNF354B	117608	hgsc.bcm.edu	37	5	178310382	178310382	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr5:178310382G>C	ENST00000322434.3	+	5	1155	c.929G>C	c.(928-930)aGg>aCg	p.R310T	RNU1-39P_ENST00000383897.1_RNA	NM_058230.2	NP_478137.1	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	310					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(2)|large_intestine(7)|liver(2)|lung(2)|ovary(2)|stomach(3)|urinary_tract(1)	21	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCAGTCGAAGGTCTGGGCTT	0.413																																					p.R310T		Atlas-SNP	.											.	ZNF354B	67	.	0			c.G929C						.						65.0	65.0	65.0					5																	178310382		2203	4300	6503	SO:0001583	missense	117608	exon5			GTCGAAGGTCTGG	AK057737	CCDS4439.1	5q35.3	2013-01-08			ENSG00000178338	ENSG00000178338		"""Zinc fingers, C2H2-type"", ""-"""	17197	protein-coding gene	gene with protein product							Standard	NM_058230		Approved	KID2, FLJ25008	uc003mjl.3	Q96LW1	OTTHUMG00000130896	ENST00000322434.3:c.929G>C	chr5.hg19:g.178310382G>C	ENSP00000327143:p.Arg310Thr	201.0	0.0		203.0	63.0	NM_058230	A8K0V2|Q5U5Z4	Missense_Mutation	SNP	ENST00000322434.3	hg19	CCDS4439.1	.	.	.	.	.	.	.	.	.	.	G	7.390	0.630654	0.14322	.	.	ENSG00000178338	ENST00000322434	T	0.35605	1.3	3.62	2.72	0.32119	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23806	0.0576	L	0.39245	1.2	0.09310	N	1	B	0.30870	0.298	B	0.25614	0.062	T	0.09228	-1.0684	9	0.22109	T	0.4	-9.7869	5.9037	0.18980	0.2414:0.0:0.7586:0.0	.	310	Q96LW1	Z354B_HUMAN	T	310	ENSP00000327143:R310T	ENSP00000327143:R310T	R	+	2	0	ZNF354B	178242988	0.000000	0.05858	0.869000	0.34112	0.127000	0.20565	0.091000	0.15046	1.855000	0.53841	0.561000	0.74099	AGG	.	.		0.413	ZNF354B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253482.1	NM_058230	
TFAP2A	7020	hgsc.bcm.edu	37	6	10398750	10398750	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:10398750G>T	ENST00000482890.1	-	8	1566	c.1214C>A	c.(1213-1215)gCc>gAc	p.A405D	TFAP2A_ENST00000379608.3_Missense_Mutation_p.A399D|TFAP2A_ENST00000497266.1_5'Flank|TFAP2A_ENST00000319516.4_Missense_Mutation_p.A401D|TFAP2A_ENST00000379604.2_Missense_Mutation_p.A405D|TFAP2A_ENST00000379613.3_Missense_Mutation_p.A407D			P05549	AP2A_HUMAN	transcription factor AP-2 alpha (activating enhancer binding protein 2 alpha)	405	H-S-H (helix-span-helix), dimerization.				anterior neuropore closure (GO:0021506)|basement membrane organization (GO:0071711)|bone morphogenesis (GO:0060349)|cellular response to iron ion (GO:0071281)|cornea development in camera-type eye (GO:0061303)|embryonic body morphogenesis (GO:0010172)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|embryonic pattern specification (GO:0009880)|epidermis morphogenesis (GO:0048730)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|keratinocyte development (GO:0003334)|kidney development (GO:0001822)|lens induction in camera-type eye (GO:0060235)|metanephric nephron development (GO:0072210)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell development (GO:0014032)|oculomotor nerve formation (GO:0021623)|optic cup structural organization (GO:0003409)|optic vesicle morphogenesis (GO:0003404)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of tooth mineralization (GO:0070172)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell differentiation (GO:0045595)|regulation of neuron differentiation (GO:0045664)|retina layer formation (GO:0010842)|sensory perception of sound (GO:0007605)|sympathetic nervous system development (GO:0048485)|transcription from RNA polymerase II promoter (GO:0006366)|trigeminal nerve development (GO:0021559)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|protein dimerization activity (GO:0046983)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	13	Breast(50;0.0427)|Ovarian(93;0.0991)	all_hematologic(90;0.107)				GGCCTTGAGGGCCTCGGTGAG	0.572																																					p.A405D		Atlas-SNP	.											.	TFAP2A	129	.	0			c.C1214A						.						272.0	279.0	277.0					6																	10398750		2203	4300	6503	SO:0001583	missense	7020	exon7			TTGAGGGCCTCGG	X52611	CCDS4510.1, CCDS34337.1, CCDS43422.1	6p24.3	2013-09-19	2001-11-28		ENSG00000137203	ENSG00000137203			11742	protein-coding gene	gene with protein product		107580	"""transcription factor AP-2 alpha (activating enhancer-binding protein 2 alpha)"""	TFAP2, AP2TF		1916817, 3063603	Standard	NM_001032280		Approved	AP-2	uc003myr.3	P05549	OTTHUMG00000014235	ENST00000482890.1:c.1214C>A	chr6.hg19:g.10398750G>T	ENSP00000418541:p.Ala405Asp	150.0	0.0		151.0	60.0	NM_003220	Q13777|Q5TAV5|Q8N1C6	Missense_Mutation	SNP	ENST00000482890.1	hg19	CCDS4510.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.075335	0.76415	.	.	ENSG00000137203	ENST00000379613;ENST00000379604;ENST00000319516;ENST00000379608;ENST00000482890	D;D;D;D;D	0.97575	-4.44;-4.44;-4.44;-4.44;-4.44	5.23	5.23	0.72850	Transcription factor AP-2, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98311	0.9440	M	0.78223	2.4	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	0.998;0.971;1.0	D	0.99372	1.0920	10	0.72032	D	0.01	-10.3232	18.824	0.92109	0.0:0.0:1.0:0.0	.	401;405;399	Q5TAV5;P05549;Q8N1C6	.;AP2A_HUMAN;.	D	407;405;401;399;405	ENSP00000368933:A407D;ENSP00000368924:A405D;ENSP00000316516:A401D;ENSP00000368928:A399D;ENSP00000418541:A405D	ENSP00000316516:A401D	A	-	2	0	TFAP2A	10506736	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.863000	0.99569	2.438000	0.82558	0.655000	0.94253	GCC	.	.		0.572	TFAP2A-007	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353619.2	NM_003220	
ZBTB9	221504	hgsc.bcm.edu	37	6	33424110	33424110	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:33424110T>A	ENST00000395064.2	+	2	1501	c.1233T>A	c.(1231-1233)ttT>ttA	p.F411L		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TTCGGCCTTTTGGCTGTGGCA	0.567																																					p.F411L		Atlas-SNP	.											.	ZBTB9	23	.	0			c.T1233A						.						79.0	63.0	68.0					6																	33424110		2203	4300	6503	SO:0001583	missense	221504	exon2			GCCTTTTGGCTGT	AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.1233T>A	chr6.hg19:g.33424110T>A	ENSP00000378503:p.Phe411Leu	44.0	0.0		44.0	8.0	NM_152735	A2AB19	Missense_Mutation	SNP	ENST00000395064.2	hg19	CCDS4780.1	.	.	.	.	.	.	.	.	.	.	T	19.41	3.822422	0.71028	.	.	ENSG00000213588	ENST00000395064	T	0.50548	0.74	5.1	2.42	0.29668	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.251437	0.26143	U	0.026084	T	0.47838	0.1467	M	0.67517	2.055	0.36311	D	0.857653	D	0.76494	0.999	D	0.65874	0.939	T	0.52388	-0.8582	10	0.72032	D	0.01	.	7.2285	0.26028	0.0:0.2261:0.0:0.7739	.	411	Q96C00	ZBTB9_HUMAN	L	411	ENSP00000378503:F411L	ENSP00000378503:F411L	F	+	3	2	ZBTB9	33532088	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	0.488000	0.22371	0.293000	0.22520	0.533000	0.62120	TTT	.	.		0.567	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276533.1	NM_152735	
EYS	346007	hgsc.bcm.edu	37	6	66044982	66044982	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:66044982G>T	ENST00000370621.3	-	11	2183	c.1657C>A	c.(1657-1659)Cta>Ata	p.L553I	EYS_ENST00000370616.2_Missense_Mutation_p.L553I|EYS_ENST00000370618.3_Missense_Mutation_p.L553I|EYS_ENST00000342421.5_Missense_Mutation_p.L553I|EYS_ENST00000503581.1_Missense_Mutation_p.L553I|EYS_ENST00000393380.2_Missense_Mutation_p.L553I			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	553					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						AGAAAACATAGATACCGATAT	0.353																																					p.L553I		Atlas-SNP	.											.	EYS	527	.	0			c.C1657A						.						178.0	162.0	167.0					6																	66044982		2203	4300	6503	SO:0001583	missense	346007	exon11			AACATAGATACCG		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1657C>A	chr6.hg19:g.66044982G>T	ENSP00000359655:p.Leu553Ile	140.0	0.0		143.0	53.0	NM_001142801	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	ENST00000370621.3	hg19		.	.	.	.	.	.	.	.	.	.	g	8.908	0.957920	0.18507	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	D;D;D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54;-1.54;-1.54	3.8	0.572	0.17357	.	.	.	.	.	T	0.42017	0.1184	N	0.24115	0.695	0.09310	N	1	B;B;B	0.27997	0.015;0.129;0.197	B;B;B	0.20767	0.031;0.031;0.014	T	0.17806	-1.0357	9	0.33940	T	0.23	.	3.6042	0.08037	0.1284:0.0:0.4253:0.4463	.	553;553;553	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	I	553	ENSP00000424243:L553I;ENSP00000359655:L553I;ENSP00000359650:L553I;ENSP00000377042:L553I;ENSP00000341818:L553I;ENSP00000359652:L553I	ENSP00000341818:L553I	L	-	1	2	EYS	66101703	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.527000	0.22987	0.671000	0.31185	0.491000	0.48974	CTA	.	.		0.353	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
FAM184A	79632	hgsc.bcm.edu	37	6	119345814	119345814	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:119345814A>C	ENST00000338891.7	-	2	767	c.324T>G	c.(322-324)atT>atG	p.I108M	FAM184A_ENST00000522284.1_De_novo_Start_InFrame|FAM184A_ENST00000521531.1_Missense_Mutation_p.I108M|FAM184A_ENST00000352896.5_De_novo_Start_InFrame|FAM184A_ENST00000368475.4_De_novo_Start_InFrame|RP11-351A11.1_ENST00000518570.1_RNA	NM_024581.4	NP_078857.5	Q8NB25	F184A_HUMAN	family with sequence similarity 184, member A	108						extracellular space (GO:0005615)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(5)|large_intestine(19)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(5)	52						CTAAAACTTGAATCTTTCTTC	0.333																																					p.I108M		Atlas-SNP	.											.	FAM184A	109	.	0			c.T324G						.						98.0	88.0	91.0					6																	119345814		1836	4090	5926	SO:0001583	missense	79632	exon2			AACTTGAATCTTT	BC009055	CCDS43499.1, CCDS43500.1, CCDS75508.1	6q22.31	2008-08-14	2008-08-14	2008-08-14	ENSG00000111879	ENSG00000111879			20991	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 60"""	C6orf60		11230166	Standard	NM_024581		Approved	FLJ13942	uc003pyj.3	Q8NB25	OTTHUMG00000015471	ENST00000338891.7:c.324T>G	chr6.hg19:g.119345814A>C	ENSP00000342604:p.Ile108Met	206.0	0.0		231.0	73.0	NM_024581	B9DI75|F8W8D6|Q5TBS9|Q7Z323|Q96GY8|Q9H0J8|Q9H851	Missense_Mutation	SNP	ENST00000338891.7	hg19	CCDS43499.1	.	.	.	.	.	.	.	.	.	.	A	13.01	2.110681	0.37242	.	.	ENSG00000111879	ENST00000338891;ENST00000521531	T;T	0.31769	1.48;1.48	5.82	-1.67	0.08238	.	0.060841	0.64402	D	0.000004	T	0.34774	0.0909	M	0.68317	2.08	0.80722	D	1	D	0.69078	0.997	D	0.63703	0.917	T	0.45308	-0.9270	10	0.62326	D	0.03	-12.4391	12.8401	0.57797	0.514:0.0:0.486:0.0	.	108	Q8NB25	F184A_HUMAN	M	108	ENSP00000342604:I108M;ENSP00000430442:I108M	ENSP00000342604:I108M	I	-	3	3	FAM184A	119387513	0.998000	0.40836	0.998000	0.56505	0.371000	0.29859	0.745000	0.26259	-0.061000	0.13110	-0.250000	0.11733	ATT	.	.		0.333	FAM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042009.3	NM_024581	
SMPDL3A	10924	hgsc.bcm.edu	37	6	123110566	123110566	+	Silent	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:123110566G>T	ENST00000368440.4	+	1	252	c.75G>T	c.(73-75)gtG>gtT	p.V25V	SMPDL3A_ENST00000539041.1_5'UTR|SMPDL3A_ENST00000487215.1_3'UTR	NM_006714.3	NP_006705.1	Q92484	ASM3A_HUMAN	sphingomyelin phosphodiesterase, acid-like 3A	25					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|cervix(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	10				GBM - Glioblastoma multiforme(226;0.236)		GGCTGCCCGTGGCGCCCGCAG	0.736											OREG0017641	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V25V		Atlas-SNP	.											.	SMPDL3A	31	.	0			c.G75T						.						4.0	4.0	4.0					6																	123110566		1594	2978	4572	SO:0001819	synonymous_variant	10924	exon1			GCCCGTGGCGCCC	AK000184	CCDS5128.1, CCDS69190.1	6q22.32	2006-04-12			ENSG00000172594	ENSG00000172594			17389	protein-coding gene	gene with protein product	"""acid sphingomyelinase-like phosphodiesterase 3a"""	610728				12442002	Standard	XM_005266798		Approved	FLJ20177, ASM3A, ASML3a, yR36GH4.1	uc003pzg.3	Q92484	OTTHUMG00000015490	ENST00000368440.4:c.75G>T	chr6.hg19:g.123110566G>T		3.0	0.0	1524	20.0	6.0	NM_006714	B7Z729|Q8WV13	Silent	SNP	ENST00000368440.4	hg19	CCDS5128.1																																																																																			.	.		0.736	SMPDL3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042039.1	NM_006714	
ADGB	79747	hgsc.bcm.edu	37	6	147109747	147109747	+	Splice_Site	SNP	G	G	A	rs370591540		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:147109747G>A	ENST00000397944.3	+	33	4613		c.e33+1		ADGB_ENST00000367493.3_Splice_Site|ADGB_ENST00000367488.1_Splice_Site	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin						oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GAAAACATTCGTAAGTATTGC	0.413																																					.		Atlas-SNP	.											.	ADGB	93	.	0			c.4537+1G>A						.	G		0,1384		0,0,692	129.0	129.0	129.0			3.2	0.4	6		129	1,3181		0,1,1590	no	splice-5	C6orf103	NM_024694.3		0,1,2282	AA,AG,GG		0.0314,0.0,0.0219			147109747	1,4565	692	1591	2283	SO:0001630	splice_region_variant	79747	exon33			ACATTCGTAAGTA	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4537+1G>A	chr6.hg19:g.147109747G>A		51.0	0.0		53.0	22.0	NM_024694	Q5T402|Q5T904|Q5T905	Splice_Site	SNP	ENST00000397944.3	hg19		.	.	.	.	.	.	.	.	.	.	G	10.42	1.345631	0.24426	0.0	3.14E-4	ENSG00000118492	ENST00000397944;ENST00000367490;ENST00000326916	.	.	.	3.2	3.2	0.36748	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.172	0.42915	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C6orf103	147151440	0.931000	0.31567	0.390000	0.26220	0.027000	0.11550	1.752000	0.38349	2.099000	0.63709	0.655000	0.94253	.	.	.		0.413	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	Intron
MAP3K4	4216	hgsc.bcm.edu	37	6	161470524	161470524	+	Nonsense_Mutation	SNP	T	T	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr6:161470524T>G	ENST00000392142.4	+	3	1368	c.1220T>G	c.(1219-1221)tTa>tGa	p.L407*	MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.L407*|MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.L407*|MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.L407*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	407					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AATCAGAAATTAAGGATTATG	0.428																																					p.L407X		Atlas-SNP	.											.	MAP3K4	364	.	0			c.T1220G						.						78.0	81.0	80.0					6																	161470524		2203	4300	6503	SO:0001587	stop_gained	4216	exon3			AGAAATTAAGGAT	AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1220T>G	chr6.hg19:g.161470524T>G	ENSP00000375986:p.Leu407*	164.0	0.0		171.0	64.0	NM_006724	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	ENST00000392142.4	hg19	CCDS34565.1	.	.	.	.	.	.	.	.	.	.	T	38	7.227635	0.98150	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.5699	16.4447	0.83919	0.0:0.0:0.0:1.0	.	.	.	.	X	407	.	ENSP00000297332:L407X	L	+	2	0	MAP3K4	161390514	1.000000	0.71417	0.031000	0.17742	0.938000	0.57974	7.671000	0.83941	2.284000	0.76573	0.528000	0.53228	TTA	.	.		0.428	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042988.3		
DFNA5	1687	hgsc.bcm.edu	37	7	24758722	24758722	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:24758722T>C	ENST00000342947.3	-	4	945	c.520A>G	c.(520-522)Atg>Gtg	p.M174V	DFNA5_ENST00000409970.1_Missense_Mutation_p.M10V|DFNA5_ENST00000419307.1_Missense_Mutation_p.M10V|DFNA5_ENST00000545231.1_Missense_Mutation_p.M10V|DFNA5_ENST00000559637.1_5'UTR|DFNA5_ENST00000409775.3_Missense_Mutation_p.M174V	NM_004403.2	NP_004394.1	O60443	DFNA5_HUMAN	deafness, autosomal dominant 5	174			M -> T (in dbSNP:rs876306).		apoptotic process (GO:0006915)|inner ear receptor cell differentiation (GO:0060113)|negative regulation of cell proliferation (GO:0008285)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(3)|stomach(1)	19						TCGACCTGCATGTGCTCAGAG	0.572																																					p.M174V	GBM(78;184 1250 20134 20900 23600)	Atlas-SNP	.											.	DFNA5	51	.	0			c.A520G						.						244.0	191.0	209.0					7																	24758722		2203	4300	6503	SO:0001583	missense	1687	exon4			CCTGCATGTGCTC	AF007790	CCDS5389.1, CCDS47563.1	7p15	2011-07-01			ENSG00000105928	ENSG00000105928			2810	protein-coding gene	gene with protein product		608798				8589696, 9450185	Standard	NM_004403		Approved	ICERE-1	uc010kus.1	O60443	OTTHUMG00000023237	ENST00000342947.3:c.520A>G	chr7.hg19:g.24758722T>C	ENSP00000339587:p.Met174Val	51.0	0.0		27.0	15.0	NM_001127453	A4D156|B2RAX9|B3KT05|O14590|Q08AQ8|Q9UBV3	Missense_Mutation	SNP	ENST00000342947.3	hg19	CCDS5389.1	.	.	.	.	.	.	.	.	.	.	T	0.003	-2.425193	0.00186	.	.	ENSG00000105928	ENST00000342947;ENST00000419307;ENST00000545231;ENST00000409970;ENST00000409775;ENST00000414428	T;T;T;T;T;T	0.38077	2.07;2.07;2.07;2.07;2.07;1.16	5.17	-2.25	0.06888	.	0.789923	0.11854	N	0.523022	T	0.07999	0.0200	N	0.00170	-1.935	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.41142	-0.9525	10	0.23302	T	0.38	-3.339	11.0721	0.48010	0.0:0.3196:0.0:0.6804	.	174;174	A4FTY0;O60443	.;DFNA5_HUMAN	V	174;10;10;10;174;10	ENSP00000339587:M174V;ENSP00000401332:M10V;ENSP00000442661:M10V;ENSP00000387119:M10V;ENSP00000386670:M174V;ENSP00000413963:M10V	ENSP00000339587:M174V	M	-	1	0	DFNA5	24725247	0.000000	0.05858	0.002000	0.10522	0.016000	0.09150	-1.261000	0.02855	-0.268000	0.09312	-0.242000	0.12053	ATG	.	.		0.572	DFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214060.2	NM_004403	
ZC3HAV1	56829	hgsc.bcm.edu	37	7	138764382	138764382	+	Silent	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:138764382C>A	ENST00000242351.5	-	4	1621	c.1305G>T	c.(1303-1305)gtG>gtT	p.V435V	ZC3HAV1_ENST00000464606.1_Silent_p.V435V|ZC3HAV1_ENST00000471652.1_Silent_p.V435V	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	435					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						TATCTGTGGCCACTCCATCAG	0.448																																					p.V435V		Atlas-SNP	.											.	ZC3HAV1	75	.	0			c.G1305T						.						103.0	104.0	104.0					7																	138764382		2203	4300	6503	SO:0001819	synonymous_variant	56829	exon4			TGTGGCCACTCCA	BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.1305G>T	chr7.hg19:g.138764382C>A		188.0	0.0		240.0	112.0	NM_024625	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Silent	SNP	ENST00000242351.5	hg19	CCDS5851.1																																																																																			.	.		0.448	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348915.1	NM_020119	
EPHA1	2041	hgsc.bcm.edu	37	7	143095957	143095957	+	Missense_Mutation	SNP	G	G	T	rs370810516		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:143095957G>T	ENST00000275815.3	-	6	1159	c.1073C>A	c.(1072-1074)aCg>aAg	p.T358K		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	358	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GCGTCCCCCCGTATCTGCTGG	0.667																																					p.T358K		Atlas-SNP	.											.	EPHA1	193	.	0			c.C1073A						.						32.0	29.0	30.0					7																	143095957		2203	4300	6503	SO:0001583	missense	2041	exon6			CCCCCCGTATCTG	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1073C>A	chr7.hg19:g.143095957G>T	ENSP00000275815:p.Thr358Lys	32.0	0.0		47.0	23.0	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	hg19	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	G	10.87	1.473010	0.26423	.	.	ENSG00000146904	ENST00000275815	T	0.57752	0.38	5.09	-6.72	0.01755	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.799430	0.02200	N	0.062196	T	0.53318	0.1789	L	0.52905	1.665	0.09310	N	1	B	0.22480	0.07	B	0.32211	0.142	T	0.55829	-0.8079	10	0.62326	D	0.03	.	15.5735	0.76356	0.1555:0.0:0.7204:0.1241	.	358	P21709	EPHA1_HUMAN	K	358	ENSP00000275815:T358K	ENSP00000275815:T358K	T	-	2	0	EPHA1	142806079	0.000000	0.05858	0.000000	0.03702	0.518000	0.34316	-0.376000	0.07465	-1.224000	0.02581	-1.021000	0.02439	ACG	.	.		0.667	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
EPHA1	2041	hgsc.bcm.edu	37	7	143095959	143095959	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr7:143095959A>T	ENST00000275815.3	-	6	1157	c.1071T>A	c.(1069-1071)gaT>gaA	p.D357E		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	357	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GTCCCCCCGTATCTGCTGGGG	0.662																																					p.D357E		Atlas-SNP	.											.	EPHA1	193	.	0			c.T1071A						.						31.0	28.0	29.0					7																	143095959		2203	4300	6503	SO:0001583	missense	2041	exon6			CCCCGTATCTGCT	M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1071T>A	chr7.hg19:g.143095959A>T	ENSP00000275815:p.Asp357Glu	32.0	0.0		46.0	22.0	NM_005232	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	ENST00000275815.3	hg19	CCDS5884.1	.	.	.	.	.	.	.	.	.	.	A	14.08	2.429602	0.43122	.	.	ENSG00000146904	ENST00000275815	T	0.56103	0.48	5.09	-3.69	0.04450	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000006	T	0.43255	0.1239	L	0.58428	1.81	0.21064	N	0.999799	B	0.25390	0.125	B	0.18263	0.021	T	0.31024	-0.9958	10	0.42905	T	0.14	.	13.8412	0.63439	0.466:0.0:0.534:0.0	.	357	P21709	EPHA1_HUMAN	E	357	ENSP00000275815:D357E	ENSP00000275815:D357E	D	-	3	2	EPHA1	142806081	0.001000	0.12720	0.001000	0.08648	0.505000	0.33919	-0.171000	0.09883	-0.851000	0.04147	-0.263000	0.10527	GAT	.	.		0.662	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342154.1		
RP1	6101	hgsc.bcm.edu	37	8	55539906	55539906	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr8:55539906A>G	ENST00000220676.1	+	4	3612	c.3464A>G	c.(3463-3465)aAc>aGc	p.N1155S		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1155					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AAGGCTACCAACAAATCTTCA	0.413																																					p.N1155S	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.A3464G						.						96.0	93.0	94.0					8																	55539906		2203	4300	6503	SO:0001583	missense	6101	exon4			CTACCAACAAATC	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3464A>G	chr8.hg19:g.55539906A>G	ENSP00000220676:p.Asn1155Ser	196.0	0.0		244.0	58.0	NM_006269		Missense_Mutation	SNP	ENST00000220676.1	hg19	CCDS6160.1	.	.	.	.	.	.	.	.	.	.	A	0.167	-1.075663	0.01903	.	.	ENSG00000104237	ENST00000220676	T	0.19532	2.14	5.7	-7.47	0.01365	.	1.011940	0.07920	N	0.975778	T	0.07369	0.0186	N	0.03324	-0.35	0.09310	N	1	B	0.14438	0.01	B	0.10450	0.005	T	0.47799	-0.9089	10	0.09843	T	0.71	-0.6741	13.0879	0.59151	0.2607:0.1047:0.6345:0.0	.	1155	P56715	RP1_HUMAN	S	1155	ENSP00000220676:N1155S	ENSP00000220676:N1155S	N	+	2	0	RP1	55702459	0.005000	0.15991	0.000000	0.03702	0.035000	0.12851	-0.013000	0.12678	-0.880000	0.03997	0.460000	0.39030	AAC	.	.		0.413	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
MATN2	4147	hgsc.bcm.edu	37	8	99045370	99045370	+	Silent	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr8:99045370T>C	ENST00000520016.1	+	16	2806	c.2682T>C	c.(2680-2682)tcT>tcC	p.S894S	MATN2_ENST00000522025.2_Silent_p.S610S|MATN2_ENST00000521689.1_Silent_p.S875S|MATN2_ENST00000254898.5_Silent_p.S894S|RPL30_ENST00000518164.1_Intron|MATN2_ENST00000524308.1_Silent_p.S853S			O00339	MATN2_HUMAN	matrilin 2	894						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			TTTTACGGTCTACACAAAAGC	0.368																																					p.S894S		Atlas-SNP	.											.	MATN2	165	.	0			c.T2682C						.						75.0	65.0	68.0					8																	99045370		1812	4081	5893	SO:0001819	synonymous_variant	4147	exon17			ACGGTCTACACAA	U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.2682T>C	chr8.hg19:g.99045370T>C		141.0	0.0		190.0	52.0	NM_002380	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Silent	SNP	ENST00000520016.1	hg19	CCDS55264.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.829|9.829	1.187959|1.187959	0.21954|0.21954	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000519582;ENST00000522135|ENST00000518154	.|.	.|.	.|.	5.76|5.76	-1.82|-1.82	0.07857|0.07857	.|.	.|.	.|.	.|.	.|.	T|T	0.39172|0.39172	0.1068|0.1068	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.33599|0.33599	-0.9862|-0.9862	4|4	.|.	.|.	.|.	-7.9502|-7.9502	1.1258|1.1258	0.01735|0.01735	0.3777:0.0909:0.2656:0.2659|0.3777:0.0909:0.2656:0.2659	.|.	.|.	.|.	.|.	P|H	131;57|658	.|.	.|.	L|Y	+|+	2|1	0|0	MATN2|MATN2	99114546|99114546	0.965000|0.965000	0.33210|0.33210	0.930000|0.930000	0.37139|0.37139	0.985000|0.985000	0.73830|0.73830	-0.112000|-0.112000	0.10791|0.10791	0.091000|0.091000	0.17302|0.17302	0.533000|0.533000	0.62120|0.62120	CTA|TAC	.	.		0.368	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380332.1		
C9orf64	84267	hgsc.bcm.edu	37	9	86571114	86571114	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr9:86571114G>A	ENST00000376344.3	-	1	518	c.302C>T	c.(301-303)tCc>tTc	p.S101F	C9orf64_ENST00000376340.2_5'UTR|C9orf64_ENST00000314700.1_5'UTR	NM_032307.3	NP_115683.3	Q5T6V5	CI064_HUMAN	chromosome 9 open reading frame 64	101										central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(8)|skin(1)	15						GGCGCACAGGGACCAGTACCC	0.547																																					p.S101F		Atlas-SNP	.											.	C9orf64	28	.	0			c.C302T						.						133.0	132.0	133.0					9																	86571114		2074	4207	6281	SO:0001583	missense	84267	exon1			CACAGGGACCAGT	AK090882	CCDS6666.2	9q22.1	2014-06-11			ENSG00000165118	ENSG00000165118			28144	protein-coding gene	gene with protein product		611342				24911101	Standard	NM_032307		Approved	MGC10999	uc004anb.3	Q5T6V5	OTTHUMG00000020111	ENST00000376344.3:c.302C>T	chr9.hg19:g.86571114G>A	ENSP00000365522:p.Ser101Phe	27.0	0.0		25.0	10.0	NM_032307	B2RPI6|Q8N2B1|Q9BT18	Missense_Mutation	SNP	ENST00000376344.3	hg19	CCDS6666.2	.	.	.	.	.	.	.	.	.	.	G	35	5.542036	0.96474	.	.	ENSG00000165118	ENST00000376344	.	.	.	5.3	5.3	0.74995	.	0.353084	0.29389	N	0.012286	T	0.81654	0.4868	M	0.86805	2.84	0.80722	D	1	P	0.47484	0.896	P	0.54210	0.745	D	0.84544	0.0640	9	0.66056	D	0.02	-5.9596	19.3129	0.94198	0.0:0.0:1.0:0.0	.	101	Q5T6V5	CI064_HUMAN	F	101	.	ENSP00000365522:S101F	S	-	2	0	C9orf64	85760934	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.447000	0.97595	2.645000	0.89757	0.563000	0.77884	TCC	.	.		0.547	C9orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052865.1	NM_032307	
MYO3A	53904	hgsc.bcm.edu	37	10	26414368	26414368	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:26414368G>T	ENST00000265944.5	+	19	2111	c.1945G>T	c.(1945-1947)Gct>Tct	p.A649S	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	649	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.A649S(1)		NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GCTACAAGAAGCTCTCACCTC	0.433																																					p.A649S		Atlas-SNP	.											MYO3A,NS,carcinoma,0,1	MYO3A	371	.	1	Substitution - Missense(1)	endometrium(1)	c.G1945T						.						97.0	89.0	91.0					10																	26414368		2203	4300	6503	SO:0001583	missense	53904	exon19			CAAGAAGCTCTCA	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1945G>T	chr10.hg19:g.26414368G>T	ENSP00000265944:p.Ala649Ser	165.0	0.0		127.0	34.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	G	34	5.388171	0.95988	.	.	ENSG00000095777	ENST00000265944	D	0.87887	-2.31	5.91	5.91	0.95273	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.92756	0.7697	M	0.69185	2.1	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	D	0.91608	0.5300	10	0.46703	T	0.11	.	20.2872	0.98536	0.0:0.0:1.0:0.0	.	649	Q8NEV4	MYO3A_HUMAN	S	649	ENSP00000265944:A649S	ENSP00000265944:A649S	A	+	1	0	MYO3A	26454374	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.799000	0.96334	0.585000	0.79938	GCT	.	.		0.433	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
CDHR1	92211	hgsc.bcm.edu	37	10	85971460	85971460	+	Silent	SNP	T	T	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:85971460T>A	ENST00000372117.3	+	14	1645	c.1542T>A	c.(1540-1542)acT>acA	p.T514T	CDHR1_ENST00000332904.3_Silent_p.T514T|CDHR1_ENST00000440770.2_Silent_p.T218T	NM_033100.2	NP_149091.1	Q96JP9	CDHR1_HUMAN	cadherin-related family member 1	514	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cellular process (GO:0009987)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(21)|ovary(1)|prostate(1)|skin(1)	36						CCTATGGGACTGGGGCAGACC	0.587																																					p.T514T		Atlas-SNP	.											.	CDHR1	122	.	0			c.T1542A						.						112.0	111.0	112.0					10																	85971460		2203	4300	6503	SO:0001819	synonymous_variant	92211	exon14			TGGGACTGGGGCA	AB053448	CCDS7372.1, CCDS53548.1	10q23.1	2014-01-28	2010-01-25	2010-01-25	ENSG00000148600	ENSG00000148600		"""Cadherins / Cadherin-related"""	14550	protein-coding gene	gene with protein product		609502	"""protocadherin 21"""	PCDH21		11597768	Standard	NM_001171971		Approved	KIAA1775, CORD15, RP65	uc001kcv.3	Q96JP9	OTTHUMG00000018634	ENST00000372117.3:c.1542T>A	chr10.hg19:g.85971460T>A		83.0	0.0		88.0	24.0	NM_001171971	Q69YZ8|Q8IXY5	Silent	SNP	ENST00000372117.3	hg19	CCDS7372.1																																																																																			.	.		0.587	CDHR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049111.1	NM_033100	
KIF20B	9585	hgsc.bcm.edu	37	10	91522476	91522476	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:91522476A>G	ENST00000371728.3	+	29	4938	c.4873A>G	c.(4873-4875)Att>Gtt	p.I1625V	KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.I1585V|KIF20B_ENST00000394289.2_Missense_Mutation_p.I1625V|KIF20B_ENST00000416354.1_Missense_Mutation_p.I1655V	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1625	Interaction with PIN1.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TGAGTTAGAGATTCAATTTAC	0.418																																					p.I1585V		Atlas-SNP	.											.	KIF20B	191	.	0			c.A4753G						.						88.0	82.0	84.0					10																	91522476		2203	4300	6503	SO:0001583	missense	9585	exon29			TTAGAGATTCAAT	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4873A>G	chr10.hg19:g.91522476A>G	ENSP00000360793:p.Ile1625Val	73.0	0.0		64.0	15.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	hg19		.	.	.	.	.	.	.	.	.	.	A	28.2	4.902998	0.92035	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	6.06	6.06	0.98353	.	0.000000	0.51477	D	0.000097	T	0.71126	0.3303	M	0.68952	2.095	0.58432	D	0.999994	D;D	0.76494	0.999;0.999	D;D	0.80764	0.987;0.994	T	0.73911	-0.3833	10	0.87932	D	0	-17.8459	15.5919	0.76537	1.0:0.0:0.0:0.0	.	1625;1585	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	V	1585;1655;1625;1625	ENSP00000260753:I1585V;ENSP00000411545:I1655V;ENSP00000377830:I1625V;ENSP00000360793:I1625V	ENSP00000260753:I1585V	I	+	1	0	KIF20B	91512456	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.147000	0.89628	2.324000	0.78689	0.533000	0.62120	ATT	.	.		0.418	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
LDB1	8861	hgsc.bcm.edu	37	10	103870721	103870721	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr10:103870721T>C	ENST00000425280.1	-	5	599	c.257A>G	c.(256-258)gAc>gGc	p.D86G	LDB1_ENST00000361198.5_Missense_Mutation_p.D50G|LDB1_ENST00000490751.1_5'UTR	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	86					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		CCAGAGATTGTCACACTCCTA	0.512																																					p.D86G		Atlas-SNP	.											.	LDB1	61	.	0			c.A257G						.						141.0	138.0	139.0					10																	103870721		2203	4300	6503	SO:0001583	missense	8861	exon5			AGATTGTCACACT	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.257A>G	chr10.hg19:g.103870721T>C	ENSP00000392466:p.Asp86Gly	95.0	0.0		91.0	39.0	NM_001113407	B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	ENST00000425280.1	hg19	CCDS44472.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.588789	0.86851	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.81422	0.4819	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.992;0.999	D	0.84672	0.0712	9	0.87932	D	0	-1.6521	15.6438	0.77033	0.0:0.0:0.0:1.0	.	86;50	Q86U70;Q86U70-3	LDB1_HUMAN;.	G	50;86	.	ENSP00000354616:D50G	D	-	2	0	LDB1	103860711	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.040000	0.89188	2.172000	0.68678	0.459000	0.35465	GAC	.	.		0.512	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113407	
MRGPRE	116534	hgsc.bcm.edu	37	11	3249346	3249346	+	Missense_Mutation	SNP	G	G	T	rs531538794		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:3249346G>T	ENST00000389832.5	-	2	990	c.684C>A	c.(682-684)ttC>ttA	p.F228L	MRGPRE_ENST00000436689.2_Missense_Mutation_p.F227L|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCAGGCCGCAGAAGAGGAAGA	0.657																																					p.F228L		Atlas-SNP	.											.	MRGPRE	35	.	0			c.C684A						.						16.0	22.0	20.0					11																	3249346		2058	4183	6241	SO:0001583	missense	116534	exon2			GCCGCAGAAGAGG	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.684C>A	chr11.hg19:g.3249346G>T	ENSP00000374482:p.Phe228Leu	38.0	0.0		32.0	13.0	NM_001039165	Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	hg19		.	.	.	.	.	.	.	.	.	.	g	0.404	-0.916686	0.02415	.	.	ENSG00000184350	ENST00000436689;ENST00000389832	.	.	.	3.9	1.87	0.25490	GPCR, rhodopsin-like superfamily (1);	0.576644	0.14260	U	0.330849	T	0.12944	0.0314	N	0.11106	0.095	0.09310	N	1	B	0.19817	0.039	B	0.12156	0.007	T	0.31724	-0.9933	9	0.02654	T	1	-15.8633	2.6616	0.05028	0.1085:0.1805:0.526:0.185	.	227	Q86SM8	MRGRE_HUMAN	L	228;227	.	ENSP00000374482:F227L	F	-	3	2	MRGPRE	3205922	0.002000	0.14202	0.002000	0.10522	0.009000	0.06853	0.359000	0.20233	0.833000	0.34828	-0.379000	0.06801	TTC	.	.		0.657	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536	
CAPRIN1	4076	hgsc.bcm.edu	37	11	34112151	34112151	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:34112151C>T	ENST00000341394.4	+	14	1669	c.1480C>T	c.(1480-1482)Cag>Tag	p.Q494*	CAPRIN1_ENST00000529307.1_Nonsense_Mutation_p.Q413*|CAPRIN1_ENST00000389645.3_Nonsense_Mutation_p.Q494*|CAPRIN1_ENST00000532820.1_Nonsense_Mutation_p.Q494*|CAPRIN1_ENST00000530820.1_Nonsense_Mutation_p.Q494*|CAPRIN1_ENST00000533657.1_3'UTR	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	494					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TCAAGTATTTCAGGCTGGGAC	0.408																																					p.Q494X		Atlas-SNP	.											.	CAPRIN1	110	.	0			c.C1480T						.						117.0	98.0	105.0					11																	34112151		2202	4298	6500	SO:0001587	stop_gained	4076	exon14			GTATTTCAGGCTG	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.1480C>T	chr11.hg19:g.34112151C>T	ENSP00000340329:p.Gln494*	136.0	0.0		134.0	6.0	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Nonsense_Mutation	SNP	ENST00000341394.4	hg19	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	C	39	7.570292	0.98365	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	.	.	.	5.72	5.72	0.89469	.	0.543163	0.21376	N	0.075556	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	19.8734	0.96858	0.0:1.0:0.0:0.0	.	.	.	.	X	494;494;494;494;413	.	ENSP00000340329:Q494X	Q	+	1	0	CAPRIN1	34068727	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	7.277000	0.78572	2.689000	0.91719	0.650000	0.86243	CAG	.	.		0.408	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
SLC22A10	387775	hgsc.bcm.edu	37	11	63059095	63059095	+	Silent	SNP	A	A	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:63059095A>T	ENST00000332793.6	+	2	488	c.486A>T	c.(484-486)atA>atT	p.I162I	SLC22A10_ENST00000526800.1_Silent_p.I110I|SLC22A10_ENST00000525620.1_Intron|SLC22A10_ENST00000544661.1_Silent_p.I7I|SLC22A10_ENST00000535888.1_Intron	NM_001039752.3	NP_001034841.3	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	162						integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28					Conjugated Estrogens(DB00286)|Probenecid(DB01032)|Salicylic acid(DB00936)	GAGGCATCATAGGTGGCCATG	0.433																																					p.I162I		Atlas-SNP	.											.	SLC22A10	79	.	0			c.A486T						.						147.0	145.0	145.0					11																	63059095		2074	4239	6313	SO:0001819	synonymous_variant	387775	exon2			CATCATAGGTGGC	AP003420	CCDS41661.1	11q12.3	2013-05-22	2008-01-11		ENSG00000184999	ENSG00000184999		"""Solute carriers"""	18057	protein-coding gene	gene with protein product		607580	"""solute carrier family 22 (organic anion/cation transporter), member 10"""			11327718	Standard	NM_001039752		Approved	OAT5, hOAT5	uc009yor.3	Q63ZE4	OTTHUMG00000165197	ENST00000332793.6:c.486A>T	chr11.hg19:g.63059095A>T		110.0	0.0		115.0	33.0	NM_001039752	Q68CJ0	Silent	SNP	ENST00000332793.6	hg19	CCDS41661.1																																																																																			.	.		0.433	SLC22A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382622.3	NM_001039752	
KAT5	10524	hgsc.bcm.edu	37	11	65482196	65482196	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:65482196G>T	ENST00000377046.3	+	8	1094	c.822G>T	c.(820-822)aaG>aaT	p.K274N	KAT5_ENST00000530446.1_Missense_Mutation_p.K255N|KAT5_ENST00000341318.4_Missense_Mutation_p.K307N|KAT5_ENST00000352980.4_Missense_Mutation_p.K222N|KAT5_ENST00000534650.1_Missense_Mutation_p.K63N	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	274	MYST-type HAT.				androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						GTAGTCTCAAGTGTCTTCAGC	0.577																																					p.K307N		Atlas-SNP	.											.	KAT5	36	.	0			c.G921T						.						264.0	234.0	244.0					11																	65482196		2201	4297	6498	SO:0001583	missense	10524	exon7			TCTCAAGTGTCTT	U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.822G>T	chr11.hg19:g.65482196G>T	ENSP00000366245:p.Lys274Asn	162.0	0.0		162.0	53.0	NM_182710	B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Missense_Mutation	SNP	ENST00000377046.3	hg19	CCDS31610.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698762	0.68501	.	.	ENSG00000172977	ENST00000377046;ENST00000352980;ENST00000341318;ENST00000530446;ENST00000531880;ENST00000534650	T;T;T;T;T	0.52754	0.89;0.88;0.88;0.88;0.65	4.97	4.97	0.65823	Acyl-CoA N-acyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.43875	0.1267	M	0.67625	2.065	0.58432	D	0.999997	P;P;B;B	0.42039	0.507;0.769;0.383;0.403	B;B;B;B	0.32724	0.12;0.131;0.151;0.072	T	0.50550	-0.8815	10	0.41790	T	0.15	-21.4041	15.7539	0.78009	0.0:0.0:1.0:0.0	.	255;307;222;274	B4E3C7;Q92993-3;Q92993-2;Q92993	.;.;.;KAT5_HUMAN	N	274;222;307;255;268;63	ENSP00000366245:K274N;ENSP00000344955:K222N;ENSP00000340330:K307N;ENSP00000434765:K255N;ENSP00000436012:K268N	ENSP00000340330:K307N	K	+	3	2	KAT5	65238772	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.448000	0.52943	2.567000	0.86603	0.561000	0.74099	AAG	.	.		0.577	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390866.2	NM_006388	
RAB6A	5870	hgsc.bcm.edu	37	11	73431941	73431941	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:73431941T>C	ENST00000336083.3	-	3	588	c.133A>G	c.(133-135)Aca>Gca	p.T45A	RP11-456I15.2_ENST00000538624.1_RNA|RAB6A_ENST00000541588.1_Missense_Mutation_p.T45A|RAB6A_ENST00000536566.1_Missense_Mutation_p.T12A|RAB6A_ENST00000310653.6_Missense_Mutation_p.T45A	NM_198896.1	NP_942599.1	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family	45					antigen processing and presentation (GO:0019882)|early endosome to Golgi transport (GO:0034498)|GTP catabolic process (GO:0006184)|minus-end-directed organelle transport along microtubule (GO:0072385)|peptidyl-cysteine methylation (GO:0018125)|protein localization to Golgi apparatus (GO:0034067)|protein targeting to Golgi (GO:0000042)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|protein domain specific binding (GO:0019904)			large_intestine(2)|lung(2)	4						ATGCCAATTGTTGCCTGTAAA	0.328																																					p.T45A		Atlas-SNP	.											.	RAB6A	17	.	0			c.A133G						.						106.0	105.0	105.0					11																	73431941		2199	4293	6492	SO:0001583	missense	5870	exon3			CAATTGTTGCCTG	AF130986	CCDS8223.1, CCDS8224.1, CCDS58155.1, CCDS58156.1	11q13.3	2008-08-08			ENSG00000175582	ENSG00000175582		"""RAB, member RAS oncogene"""	9786	protein-coding gene	gene with protein product		179513		RAB6			Standard	NM_001243718		Approved		uc001ouf.3	P20340	OTTHUMG00000134308	ENST00000336083.3:c.133A>G	chr11.hg19:g.73431941T>C	ENSP00000336850:p.Thr45Ala	113.0	0.0		118.0	31.0	NM_002869	A8K133|B7Z772|F5H668|Q1W5D8|Q5U0A8|Q9UBE4	Missense_Mutation	SNP	ENST00000336083.3	hg19	CCDS8224.1	.	.	.	.	.	.	.	.	.	.	T	29.0	4.965060	0.92855	.	.	ENSG00000175582	ENST00000310653;ENST00000336083;ENST00000393571;ENST00000536566;ENST00000541588;ENST00000539750;ENST00000535748;ENST00000542366	D;D;D;D	0.87491	-2.26;-2.26;-2.26;-2.26	5.55	5.55	0.83447	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.95752	0.8618	H	0.96720	3.87	0.54753	D	0.999986	D;P;P	0.89917	1.0;0.947;0.459	D;D;P	0.83275	0.996;0.915;0.645	D	0.97089	0.9789	10	0.87932	D	0	-0.0428	15.0229	0.71643	0.0:0.0:0.0:1.0	.	45;45;45	Q1W5D8;P20340;P20340-2	.;RAB6A_HUMAN;.	A	45;45;45;12;45;45;45;45	ENSP00000311449:T45A;ENSP00000336850:T45A;ENSP00000437863:T12A;ENSP00000445350:T45A	ENSP00000311449:T45A	T	-	1	0	RAB6A	73109589	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.312000	0.78968	2.330000	0.79161	0.477000	0.44152	ACA	.	.		0.328	RAB6A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000259241.2		
TNFRSF1A	7132	hgsc.bcm.edu	37	12	6443355	6443355	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:6443355G>T	ENST00000162749.2	-	2	394	c.95C>A	c.(94-96)cCt>cAt	p.P32H	TNFRSF1A_ENST00000540022.1_Missense_Mutation_p.P32H|TNFRSF1A_ENST00000366159.4_Missense_Mutation_p.P32H|TNFRSF1A_ENST00000437813.3_5'UTR	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	32					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						CCCTAGGTGAGGGACCAGTCC	0.502																																					p.P32H		Atlas-SNP	.											.	TNFRSF1A	39	.	0			c.C95A						.						109.0	110.0	110.0					12																	6443355		2203	4300	6503	SO:0001583	missense	7132	exon2			AGGTGAGGGACCA	M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.95C>A	chr12.hg19:g.6443355G>T	ENSP00000162749:p.Pro32His	117.0	0.0		116.0	43.0	NM_001065	A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Missense_Mutation	SNP	ENST00000162749.2	hg19	CCDS8542.1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220583	0.58560	.	.	ENSG00000067182	ENST00000162749;ENST00000540022;ENST00000539372;ENST00000366159;ENST00000440083;ENST00000536194	D;D;D;D;D;D	0.98849	-3.03;-3.17;-3.77;-4.19;-5.18;-5.05	3.89	3.89	0.44902	.	0.615734	0.16129	N	0.228289	D	0.98454	0.9485	L	0.58101	1.795	0.09310	N	0.999992	D;D;D	0.76494	0.997;0.999;0.997	P;D;P	0.66351	0.781;0.943;0.817	D	0.94886	0.8043	10	0.42905	T	0.14	-2.6243	11.2473	0.49004	0.0:0.0:1.0:0.0	.	32;32;32	B5M0B5;F5H061;P19438	.;.;TNR1A_HUMAN	H	32	ENSP00000162749:P32H;ENSP00000438343:P32H;ENSP00000442059:P32H;ENSP00000380389:P32H;ENSP00000413224:P32H;ENSP00000442919:P32H	ENSP00000162749:P32H	P	-	2	0	TNFRSF1A	6313616	0.656000	0.27385	0.939000	0.37840	0.786000	0.44442	2.233000	0.43027	2.022000	0.59522	0.563000	0.77884	CCT	.	.		0.502	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399038.1	NM_001065	
KMT2D	8085	hgsc.bcm.edu	37	12	49427419	49427420	+	Missense_Mutation	DNP	CC	CC	AT			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:49427419_49427420CC>AT	ENST00000301067.7	-	39	11067_11068	c.11068_11069GG>AT	c.(11068-11070)GGa>ATa	p.G3690I	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3690	Gln-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGCCAGGGATCCAGCCCCACCA	0.594																																					p.G3690V|p.G3690R		Atlas-SNP	.											.	MLL2	1173	.	0			c.G11069T|c.G11068A						.																																			SO:0001583	missense	8085	exon39			AGGGATCCAGCCC|GGGATCCAGCCCC	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.11068_11069delinsAT	chr12.hg19:g.49427419_49427420delinsAT	ENSP00000301067:p.Gly3690Ile	58.0|59.0	0.0		52.0	14.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1																																																																																			.	.		0.594	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
NOS1	4842	hgsc.bcm.edu	37	12	117723945	117723945	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr12:117723945C>T	ENST00000338101.4	-	5	1258	c.1254G>A	c.(1252-1254)tcG>tcA	p.S418S	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Silent_p.S418S			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CCACACAGCGCGAGGCATTCC	0.562																																					p.S418S	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											NOS1,caecum,carcinoma,0,1	NOS1	240	.	0			c.G1254A						.						130.0	131.0	130.0					12																	117723945		2168	4298	6466	SO:0001819	synonymous_variant	4842	exon6			ACAGCGCGAGGCA		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1254G>A	chr12.hg19:g.117723945C>T		157.0	0.0		122.0	32.0	NM_000620		Silent	SNP	ENST00000338101.4	hg19	CCDS55890.1																																																																																			.	.		0.562	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
HS6ST3	266722	hgsc.bcm.edu	37	13	97484795	97484795	+	Silent	SNP	C	C	T	rs368146960		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr13:97484795C>T	ENST00000376705.2	+	2	783	c.759C>T	c.(757-759)agC>agT	p.S253S		NM_153456.3	NP_703157.2	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	253	3'-phosphate binding. {ECO:0000255}.				heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)	integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			NS(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(1)	20	all_neural(89;0.0878)|Medulloblastoma(90;0.163)					GTTACCTGAGCGAGTGGAAAC	0.473																																					p.S253S		Atlas-SNP	.											.	HS6ST3	54	.	0			c.C759T						.	C		1,4405	2.1+/-5.4	0,1,2202	67.0	68.0	68.0		759	-3.3	1.0	13		68	0,8600		0,0,4300	no	coding-synonymous	HS6ST3	NM_153456.2		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		253/472	97484795	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	266722	exon2			CCTGAGCGAGTGG	AF539426	CCDS9481.1	13q32.2	2007-12-04			ENSG00000185352	ENSG00000185352		"""Sulfotransferases, membrane-bound"""	19134	protein-coding gene	gene with protein product		609401					Standard	NM_153456		Approved		uc001vmw.4	Q8IZP7	OTTHUMG00000017232	ENST00000376705.2:c.759C>T	chr13.hg19:g.97484795C>T		87.0	0.0		89.0	27.0	NM_153456	Q5W0L0|Q68CW6	Silent	SNP	ENST00000376705.2	hg19	CCDS9481.1																																																																																			.	.		0.473	HS6ST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045517.2	NM_153456	
APBA2	321	hgsc.bcm.edu	37	15	29398965	29398965	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr15:29398965C>T	ENST00000558402.1	+	13	2459	c.1860C>T	c.(1858-1860)tcC>tcT	p.S620S	APBA2_ENST00000558259.1_Silent_p.S620S|APBA2_ENST00000561069.1_Silent_p.S620S|APBA2_ENST00000411764.1_Silent_p.S608S|APBA2_ENST00000558330.1_Silent_p.S608S			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	620	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AGATCATGTCCATCAATGGCA	0.657																																					p.S620S		Atlas-SNP	.											.	APBA2	132	.	0			c.C1860T						.						64.0	60.0	61.0					15																	29398965		2203	4300	6503	SO:0001819	synonymous_variant	321	exon11			CATGTCCATCAAT	AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.1860C>T	chr15.hg19:g.29398965C>T		101.0	0.0		121.0	40.0	NM_005503	E9PGI4|O60571|Q5XKC0	Silent	SNP	ENST00000558402.1	hg19	CCDS10022.1																																																																																			.	.		0.657	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251362.3	NM_005503	
SPTBN5	51332	hgsc.bcm.edu	37	15	42158099	42158099	+	Silent	SNP	C	C	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr15:42158099C>T	ENST00000320955.6	-	39	7052	c.6825G>A	c.(6823-6825)gaG>gaA	p.E2275E	MIR4310_ENST00000582950.1_RNA	NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	2275					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		TCATCTTCACCTCCTGTGAAG	0.667																																					p.E2240E		Atlas-SNP	.											.	SPTBN5	171	.	0			c.G6720A						.						13.0	17.0	16.0					15																	42158099		2046	4170	6216	SO:0001819	synonymous_variant	51332	exon39			CTTCACCTCCTGT	AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.6825G>A	chr15.hg19:g.42158099C>T		61.0	0.0		70.0	20.0	NM_016642		Silent	SNP	ENST00000320955.6	hg19																																																																																				.	.		0.667	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000420237.1	NM_016642	
HDC	3067	hgsc.bcm.edu	37	15	50534990	50534990	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr15:50534990G>A	ENST00000267845.3	-	12	1858	c.1456C>T	c.(1456-1458)Cgg>Tgg	p.R486W	RN7SL494P_ENST00000461517.2_RNA|HDC_ENST00000543581.1_Missense_Mutation_p.R453W	NM_002112.3	NP_002103.2	Q9UBI9	HDC_HUMAN	histidine decarboxylase	0					respiratory tube development (GO:0030323)	membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)		TTCCCAACCCGAGGGCTGGGT	0.567																																					p.R486W	GBM(95;1627 1936 6910 9570)	Atlas-SNP	.											.	HDC	86	.	0			c.C1456T						.						42.0	47.0	45.0					15																	50534990		2196	4295	6491	SO:0001583	missense	3067	exon12			CAACCCGAGGGCT		CCDS10134.1	15q21.2	2013-09-20			ENSG00000140287	ENSG00000140287	4.1.1.22		4855	protein-coding gene	gene with protein product		142704				1487235	Standard	NM_002112		Approved		uc001zxz.3	P19113	OTTHUMG00000131644	ENST00000267845.3:c.1456C>T	chr15.hg19:g.50534990G>A	ENSP00000267845:p.Arg486Trp	69.0	0.0		60.0	17.0	NM_002112		Missense_Mutation	SNP	ENST00000267845.3	hg19	CCDS10134.1	.	.	.	.	.	.	.	.	.	.	G	9.894	1.204922	0.22205	.	.	ENSG00000140287	ENST00000267845;ENST00000543581	T;T	0.09723	3.05;2.95	5.95	2.89	0.33648	.	0.851923	0.10338	N	0.686708	T	0.08626	0.0214	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.31138	-0.9954	10	0.66056	D	0.02	-0.653	4.7158	0.12894	0.0822:0.2438:0.549:0.125	.	453;486	B7ZM01;P19113	.;DCHS_HUMAN	W	486;453	ENSP00000267845:R486W;ENSP00000440252:R453W	ENSP00000267845:R486W	R	-	1	2	HDC	48322282	0.446000	0.25665	0.029000	0.17559	0.246000	0.25737	1.871000	0.39539	0.844000	0.35094	0.563000	0.77884	CGG	.	.		0.567	HDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254540.1		
TP53	7157	hgsc.bcm.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr17:7578271T>C	ENST00000269305.4	-	6	767	c.578A>G	c.(577-579)cAt>cGt	p.H193R	TP53_ENST00000445888.2_Missense_Mutation_p.H193R|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.H193R|TP53_ENST00000413465.2_Missense_Mutation_p.H193R|TP53_ENST00000420246.2_Missense_Mutation_p.H193R|TP53_ENST00000455263.2_Missense_Mutation_p.H193R	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.H193R(80)|p.H193L(42)|p.H193P(18)|p.0?(8)|p.?(6)|p.H61R(4)|p.H100R(4)|p.H100L(4)|p.H61L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.H193fs*16(3)|p.P191fs*53(2)|p.H61P(2)|p.H100P(2)|p.A189fs*53(1)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P98_E105>Q(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCGGATAAGATGCTGAGGAGG	0.562		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.H193R	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,0,1	TP53	33396	.	193	Substitution - Missense(160)|Whole gene deletion(8)|Complex - deletion inframe(6)|Unknown(6)|Deletion - In frame(5)|Deletion - Frameshift(4)|Insertion - Frameshift(3)|Complex - frameshift(1)	lung(36)|upper_aerodigestive_tract(26)|ovary(20)|breast(18)|oesophagus(14)|haematopoietic_and_lymphoid_tissue(12)|endometrium(12)|biliary_tract(10)|liver(9)|stomach(7)|central_nervous_system(6)|large_intestine(6)|urinary_tract(5)|skin(5)|bone(4)|pancreas(2)|prostate(1)	c.A578G	GRCh37	CM083194|CM951225	TP53	M		.						97.0	87.0	90.0					17																	7578271		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ATAAGATGCTGAG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.578A>G	chr17.hg19:g.7578271T>C	ENSP00000269305:p.His193Arg	121.0	1.0		66.0	32.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.413611	0.42817	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99850	-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16;-7.16	5.41	4.33	0.51752	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.92738	3.34	0.58432	D	0.999992	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.97536	1.0083	10	0.72032	D	0.01	-29.0766	9.707	0.40222	0.0:0.0827:0.0:0.9173	.	154;193;193;100;193;193;193	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	R	193;193;193;193;193;193;182;100;61;100;61	ENSP00000410739:H193R;ENSP00000352610:H193R;ENSP00000269305:H193R;ENSP00000398846:H193R;ENSP00000391127:H193R;ENSP00000391478:H193R;ENSP00000425104:H61R;ENSP00000423862:H100R	ENSP00000269305:H193R	H	-	2	0	TP53	7518996	1.000000	0.71417	0.814000	0.32528	0.023000	0.10783	7.996000	0.88334	1.001000	0.39076	-0.256000	0.11100	CAT	.	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ZNF559	84527	hgsc.bcm.edu	37	19	9453375	9453375	+	Missense_Mutation	SNP	A	A	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:9453375A>C	ENST00000393883.2	+	6	1896	c.1248A>C	c.(1246-1248)aaA>aaC	p.K416N	ZNF559_ENST00000538743.1_Missense_Mutation_p.K336N|ZNF177_ENST00000446085.4_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000603380.1_Missense_Mutation_p.K416N|ZNF177_ENST00000602856.1_Intron|CTC-325H20.2_ENST00000592371.1_lincRNA|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000586255.1_Intron|ZNF559_ENST00000317221.7_3'UTR|ZNF177_ENST00000605471.1_Intron|ZNF559_ENST00000587557.1_Missense_Mutation_p.K480N	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						AGTGTGGGAAAGCCTTCATTC	0.408																																					p.K480N		Atlas-SNP	.											.	ZNF559	77	.	0			c.A1440C						.						86.0	69.0	74.0					19																	9453375		2203	4300	6503	SO:0001583	missense	84527	exon6			TGGGAAAGCCTTC	AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.1248A>C	chr19.hg19:g.9453375A>C	ENSP00000377461:p.Lys416Asn	144.0	0.0		87.0	47.0	NM_001202406	K7EMG6	Missense_Mutation	SNP	ENST00000393883.2	hg19	CCDS12211.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.962572	0.53400	.	.	ENSG00000188321	ENST00000317221;ENST00000538743;ENST00000393883	T;T	0.27890	1.64;1.64	2.22	2.22	0.28083	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.55449	0.1921	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.995	T	0.59731	-0.7399	9	0.72032	D	0.01	.	8.3425	0.32252	1.0:0.0:0.0:0.0	.	416;416;336	B3KPL8;Q9BR84;B4DP29	.;ZN559_HUMAN;.	N	416;336;416	ENSP00000442832:K336N;ENSP00000377461:K416N	ENSP00000325393:K416N	K	+	3	2	ZNF559	9314375	0.012000	0.17670	0.956000	0.39512	0.177000	0.22998	0.111000	0.15458	1.272000	0.44329	0.260000	0.18958	AAA	.	.		0.408	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000449021.1	NM_032497	
PALM3	342979	hgsc.bcm.edu	37	19	14167259	14167259	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:14167259C>A	ENST00000340790.4	-	4	335	c.336G>T	c.(334-336)agG>agT	p.R112S		NM_001145028.1	NP_001138500.1	A6NDB9	PALM3_HUMAN	paralemmin 3	112					negative regulation of cytokine-mediated signaling pathway (GO:0001960)|response to lipopolysaccharide (GO:0032496)|Toll signaling pathway (GO:0008063)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)			endometrium(1)|kidney(2)|pancreas(1)|skin(1)	5						GCCAGCTGGGCCTGCCTGAGG	0.617																																					p.R112S		Atlas-SNP	.											.	PALM3	26	.	0			c.G336T						.						56.0	60.0	59.0					19																	14167259		692	1591	2283	SO:0001583	missense	342979	exon4			GCTGGGCCTGCCT		CCDS46001.1	19p13.12	2010-04-15			ENSG00000187867	ENSG00000187867			33274	protein-coding gene	gene with protein product							Standard	NM_001145028		Approved		uc010xnk.1	A6NDB9		ENST00000340790.4:c.336G>T	chr19.hg19:g.14167259C>A	ENSP00000344996:p.Arg112Ser	79.0	0.0		56.0	30.0	NM_001145028		Missense_Mutation	SNP	ENST00000340790.4	hg19	CCDS46001.1	.	.	.	.	.	.	.	.	.	.	c	13.76	2.333669	0.41297	.	.	ENSG00000187867	ENST00000340790	T	0.35421	1.31	4.53	3.49	0.39957	.	.	.	.	.	T	0.29556	0.0737	L	0.43152	1.355	0.27920	N	0.938271	B	0.16396	0.017	B	0.12156	0.007	T	0.18429	-1.0337	9	0.42905	T	0.14	.	8.1516	0.31143	0.0:0.8872:0.0:0.1128	.	112	A6NDB9	PALM3_HUMAN	S	112	ENSP00000344996:R112S	ENSP00000344996:R112S	R	-	3	2	PALM3	14028259	0.990000	0.36364	0.994000	0.49952	0.869000	0.49853	0.521000	0.22893	0.923000	0.37045	0.555000	0.69702	AGG	.	.		0.617	PALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458540.1	NM_001145028	
LHB	3972	hgsc.bcm.edu	37	19	49519808	49519808	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:49519808G>T	ENST00000221421.2	-	2	178	c.179C>A	c.(178-180)aCc>aAc	p.T60N	CTB-60B18.10_ENST00000600007.1_lincRNA	NM_000894.2	NP_000885.1	P01229	LSHB_HUMAN	luteinizing hormone beta polypeptide	60					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|male gonad development (GO:0008584)|peptide hormone processing (GO:0016486)|progesterone biosynthetic process (GO:0006701)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	receptor binding (GO:0005102)			cervix(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		GCTCACCATGGTGGGGCAGTA	0.662																																					p.T60N		Atlas-SNP	.											.	LHB	20	.	0			c.C179A						.						48.0	40.0	43.0					19																	49519808		2193	4263	6456	SO:0001583	missense	3972	exon2			ACCATGGTGGGGC		CCDS12748.1	19q13.3	2013-02-26				ENSG00000104826		"""Endogenous ligands"""	6584	protein-coding gene	gene with protein product	"""lutropin, beta chain"", ""interstitial cell stimulating hormone, beta chain"", ""luteinizing hormone beta subunit"""	152780				1191677	Standard	NM_000894		Approved	LSH-B, CGB4, hLHB	uc002plt.3	P01229		ENST00000221421.2:c.179C>A	chr19.hg19:g.49519808G>T	ENSP00000221421:p.Thr60Asn	83.0	0.0		86.0	43.0	NM_000894	Q9UDI0	Missense_Mutation	SNP	ENST00000221421.2	hg19	CCDS12748.1	.	.	.	.	.	.	.	.	.	.	G	14.56	2.573017	0.45798	.	.	ENSG00000104826	ENST00000221421;ENST00000391870	D	0.92752	-3.1	4.03	2.97	0.34412	Cystine knot (1);Gonadotropin, beta subunit, conserved site (1);	0.103789	0.64402	D	0.000006	D	0.94430	0.8208	M	0.67397	2.05	0.36147	D	0.847169	D	0.71674	0.998	D	0.91635	0.999	D	0.95358	0.8453	10	0.87932	D	0	-18.2195	9.8631	0.41127	0.0:0.7858:0.2142:0.0	.	60	P01229	LSHB_HUMAN	N	60;76	ENSP00000221421:T60N	ENSP00000221421:T60N	T	-	2	0	LHB	54211620	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	1.932000	0.40143	1.035000	0.39972	-0.539000	0.04255	ACC	.	.		0.662	LHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466246.1	NM_000894	
CACNG7	59284	hgsc.bcm.edu	37	19	54417766	54417766	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr19:54417766G>T	ENST00000391767.1	+	3	421	c.209G>T	c.(208-210)gGt>gTt	p.G70V	CACNG7_ENST00000391766.1_Missense_Mutation_p.G70V|CACNG7_ENST00000222212.2_Missense_Mutation_p.G70V|CACNG7_ENST00000468076.1_Intron			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	70					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		CGGGAGAAAGGTCGCTGTGTG	0.557																																					p.G70V		Atlas-SNP	.											CACNG7,caecum,carcinoma,0,2	CACNG7	58	.	0			c.G209T						.						68.0	60.0	63.0					19																	54417766		2203	4300	6503	SO:0001583	missense	59284	exon2			AGAAAGGTCGCTG	AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.209G>T	chr19.hg19:g.54417766G>T	ENSP00000375647:p.Gly70Val	140.0	0.0		127.0	31.0	NM_031896	Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	ENST00000391767.1	hg19	CCDS12868.1	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688098	0.68271	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	D;D;D	0.88431	-2.38;-2.38;-2.38	3.14	3.14	0.36123	.	0.000000	0.85682	D	0.000000	D	0.93158	0.7821	M	0.82193	2.58	0.80722	D	1	D	0.61697	0.99	D	0.63033	0.91	D	0.92969	0.6396	10	0.46703	T	0.11	-8.4437	12.5577	0.56263	0.0:0.0:1.0:0.0	.	70	P62955	CCG7_HUMAN	V	70	ENSP00000375647:G70V;ENSP00000222212:G70V;ENSP00000375646:G70V	ENSP00000222212:G70V	G	+	2	0	CACNG7	59109578	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.208000	0.89748	2.084000	0.62774	0.561000	0.74099	GGT	.	.		0.557	CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139240.2		
NOP56	10528	hgsc.bcm.edu	37	20	2635458	2635458	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr20:2635458A>G	ENST00000329276.5	+	5	950	c.434A>G	c.(433-435)cAg>cGg	p.Q145R	SNORD110_ENST00000408189.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD86_ENST00000391196.1_RNA|SNORA51_ENST00000606420.1_RNA	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	145					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TGTAAAGCACAGCTGGGGCTG	0.522																																					p.Q145R		Atlas-SNP	.											.	NOP56	73	.	0			c.A434G						.						167.0	164.0	165.0					20																	2635458		2203	4300	6503	SO:0001583	missense	10528	exon5			AAGCACAGCTGGG	Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.434A>G	chr20.hg19:g.2635458A>G	ENSP00000370589:p.Gln145Arg	60.0	0.0		50.0	19.0	NM_006392	Q2M3T6|Q9NQ05	Missense_Mutation	SNP	ENST00000329276.5	hg19	CCDS13030.1	.	.	.	.	.	.	.	.	.	.	A	17.31	3.356329	0.61293	.	.	ENSG00000101361	ENST00000329276;ENST00000445139	T;T	0.59638	0.25;0.86	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.68668	0.3026	M	0.84433	2.695	0.80722	D	1	D	0.56035	0.974	P	0.48089	0.566	T	0.75243	-0.3386	10	0.62326	D	0.03	-26.6734	14.2555	0.66048	1.0:0.0:0.0:0.0	.	145	O00567	NOP56_HUMAN	R	145	ENSP00000370589:Q145R;ENSP00000388497:Q145R	ENSP00000370589:Q145R	Q	+	2	0	NOP56	2583458	1.000000	0.71417	0.929000	0.37066	0.001000	0.01503	9.090000	0.94144	2.245000	0.73994	0.454000	0.30748	CAG	.	.		0.522	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077631.2	NM_006392	
ZFX	7543	hgsc.bcm.edu	37	X	24229378	24229378	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:24229378C>A	ENST00000379177.1	+	11	2730	c.2303C>A	c.(2302-2304)tCc>tAc	p.S768Y	ZFX_ENST00000304543.5_Missense_Mutation_p.S768Y|ZFX_ENST00000540034.1_Missense_Mutation_p.S807Y|ZFX_ENST00000539115.1_Missense_Mutation_p.S539Y|ZFX_ENST00000338565.3_Missense_Mutation_p.S718Y|ZFX_ENST00000379188.3_Missense_Mutation_p.S768Y	NM_001178085.1|NM_003410.3	NP_001171556.1|NP_003401.2	P17010	ZFX_HUMAN	zinc finger protein, X-linked	768					death (GO:0016265)|fertilization (GO:0009566)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|parental behavior (GO:0060746)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(2)|lung(4)|ovary(2)|prostate(1)	24						CACGTTATTTCCATTCACACG	0.433																																					p.S768Y	Esophageal Squamous(20;306 562 7346 32868 37983)	Atlas-SNP	.											.	ZFX	61	.	0			c.C2303A						.						159.0	132.0	141.0					X																	24229378		2203	4300	6503	SO:0001583	missense	7543	exon10			TTATTTCCATTCA		CCDS14211.1, CCDS55390.1	Xp22.1-p21.3	2013-01-08			ENSG00000005889	ENSG00000005889		"""Zinc fingers, C2H2-type"""	12869	protein-coding gene	gene with protein product		314980					Standard	NM_003410		Approved	ZNF926	uc022bua.1	P17010	OTTHUMG00000021264	ENST00000379177.1:c.2303C>A	chrX.hg19:g.24229378C>A	ENSP00000368475:p.Ser768Tyr	352.0	0.0		310.0	111.0	NM_003410	B9EG97|O43668|Q8WYJ8	Missense_Mutation	SNP	ENST00000379177.1	hg19	CCDS14211.1	.	.	.	.	.	.	.	.	.	.	C	17.95	3.513648	0.64522	.	.	ENSG00000005889	ENST00000539115;ENST00000379188;ENST00000535562;ENST00000379177;ENST00000304543;ENST00000540034;ENST00000338565	T;T;T;T;T;T	0.15372	2.43;2.43;2.43;2.43;2.43;2.43	5.19	5.19	0.71726	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000003	T	0.45756	0.1358	M	0.77406	2.37	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.999;1.0;0.998	T	0.49184	-0.8966	10	0.72032	D	0.01	-6.9146	18.0792	0.89437	0.0:1.0:0.0:0.0	.	807;490;768	B9EG97;F5GYV7;P17010	.;.;ZFX_HUMAN	Y	539;768;490;768;768;807;718	ENSP00000438233:S539Y;ENSP00000368486:S768Y;ENSP00000368475:S768Y;ENSP00000304985:S768Y;ENSP00000441382:S807Y;ENSP00000343384:S718Y	ENSP00000304985:S768Y	S	+	2	0	ZFX	24139299	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.776000	0.85560	2.291000	0.77112	0.594000	0.82650	TCC	.	.		0.433	ZFX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056084.1	NM_003410	
FAM47A	158724	hgsc.bcm.edu	37	X	34149524	34149524	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:34149524G>C	ENST00000346193.3	-	1	923	c.872C>G	c.(871-873)aCa>aGa	p.T291R		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	291										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						ACCAGGCTCTGTGGGTTCGTC	0.572																																					p.T291R		Atlas-SNP	.											.	FAM47A	249	.	0			c.C872G						.						24.0	26.0	25.0					X																	34149524		2202	4300	6502	SO:0001583	missense	158724	exon1			GGCTCTGTGGGTT	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.872C>G	chrX.hg19:g.34149524G>C	ENSP00000345029:p.Thr291Arg	156.0	0.0		136.0	43.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	g	1.507	-0.550591	0.03996	.	.	ENSG00000185448	ENST00000346193	T	0.19105	2.17	0.13	0.13	0.14746	.	.	.	.	.	T	0.21186	0.0510	L	0.38175	1.15	0.09310	N	0.999999	P	0.47106	0.89	P	0.52554	0.702	T	0.21381	-1.0247	8	0.18276	T	0.48	.	.	.	.	.	291	Q5JRC9	FA47A_HUMAN	R	291	ENSP00000345029:T291R	ENSP00000345029:T291R	T	-	2	0	FAM47A	34059445	0.848000	0.29623	0.032000	0.17829	0.032000	0.12392	0.110000	0.15437	0.171000	0.19730	0.173000	0.16961	ACA	.	.		0.572	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
MAOB	4129	hgsc.bcm.edu	37	X	43655030	43655030	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:43655030T>A	ENST00000378069.4	-	7	871	c.724A>T	c.(724-726)Aga>Tga	p.R242*	MAOB_ENST00000487544.1_5'Flank|MAOB_ENST00000536181.1_Nonsense_Mutation_p.R226*|MAOB_ENST00000538942.1_Nonsense_Mutation_p.R226*	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	242					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	ACATTTTCTCTTGTCTGGTCA	0.448																																					p.R242X		Atlas-SNP	.											.	MAOB	52	.	0			c.A724T						.						169.0	141.0	151.0					X																	43655030		2203	4300	6503	SO:0001587	stop_gained	4129	exon7			TTTCTCTTGTCTG		CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.724A>T	chrX.hg19:g.43655030T>A	ENSP00000367309:p.Arg242*	121.0	0.0		116.0	44.0	NM_000898	B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Nonsense_Mutation	SNP	ENST00000378069.4	hg19	CCDS14261.1	.	.	.	.	.	.	.	.	.	.	T	37	6.394621	0.97533	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	.	.	.	5.29	4.39	0.52855	.	0.049371	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-9.4189	9.8539	0.41073	0.0:0.8363:0.0:0.1637	.	.	.	.	X	242;226;226	.	ENSP00000367309:R242X	R	-	1	2	MAOB	43539974	0.880000	0.30214	0.997000	0.53966	0.771000	0.43674	1.737000	0.38197	1.113000	0.41760	-0.383000	0.06682	AGA	.	.		0.448	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056303.1	NM_000898	
MTMR8	55613	hgsc.bcm.edu	37	X	63548663	63548663	+	Silent	SNP	G	G	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:63548663G>T	ENST00000374852.3	-	12	1537	c.1470C>A	c.(1468-1470)ccC>ccA	p.P490P	MTMR8_ENST00000453546.1_Intron|MTMR8_ENST00000478487.1_5'Flank	NM_017677.3	NP_060147.2	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	490	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)	p.0?(1)		breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|skin(3)	37						GAATGTTGTAGGGCACAGTAC	0.458																																					p.P490P		Atlas-SNP	.											.	MTMR8	178	.	1	Whole gene deletion(1)	ovary(1)	c.C1470A						.						143.0	123.0	130.0					X																	63548663		2203	4300	6503	SO:0001819	synonymous_variant	55613	exon12			GTTGTAGGGCACA	AK000133	CCDS14379.1	Xq11.2-q12	2013-01-11			ENSG00000102043	ENSG00000102043		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	16825	protein-coding gene	gene with protein product						11275328	Standard	NM_017677		Approved	FLJ20126	uc004dvs.3	Q96EF0	OTTHUMG00000021707	ENST00000374852.3:c.1470C>A	chrX.hg19:g.63548663G>T		26.0	0.0		35.0	12.0	NM_017677	Q5JT99|Q9NXP6	Silent	SNP	ENST00000374852.3	hg19	CCDS14379.1	.	.	.	.	.	.	.	.	.	.	G	7.410	0.634610	0.14322	.	.	ENSG00000102043	ENST00000442913	.	.	.	2.93	0.856	0.19019	.	.	.	.	.	T	0.43144	0.1234	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.25847	-1.0120	4	.	.	.	.	2.3034	0.04168	0.4169:0.0:0.3475:0.2357	.	.	.	.	I	294	.	.	L	-	1	2	MTMR8	63465388	1.000000	0.71417	0.987000	0.45799	0.982000	0.71751	0.850000	0.27737	0.427000	0.26145	0.506000	0.49869	CTA	.	.		0.458	MTMR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056949.2	NM_017677	
FAM127C	441518	hgsc.bcm.edu	37	X	134156305	134156305	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chrX:134156305G>A	ENST00000391440.1	-	1	254	c.185C>T	c.(184-186)gCc>gTc	p.A62V		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	62										breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					CACCTTCAGGGCGTCGTTGGA	0.602																																					p.A62V		Atlas-SNP	.											.	FAM127C	27	.	0			c.C185T						.						63.0	68.0	67.0					X																	134156305		2097	4207	6304	SO:0001583	missense	441518	exon1			TTCAGGGCGTCGT	BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.185C>T	chrX.hg19:g.134156305G>A	ENSP00000375268:p.Ala62Val	137.0	0.0		160.0	54.0	NM_001078173		Missense_Mutation	SNP	ENST00000391440.1	hg19	CCDS43996.1	.	.	.	.	.	.	.	.	.	.	g	14.44	2.535163	0.45176	.	.	ENSG00000212747	ENST00000391440	T	0.30448	1.53	2.35	1.38	0.22167	.	1.095140	0.07417	U	0.893459	T	0.30792	0.0776	M	0.66939	2.045	0.21627	N	0.999616	B	0.31949	0.348	B	0.32980	0.156	T	0.30475	-0.9977	10	0.34782	T	0.22	.	5.3275	0.15915	0.0:0.0:0.6638:0.3362	.	62	Q17RB0	F127C_HUMAN	V	62	ENSP00000375268:A62V	ENSP00000375268:A62V	A	-	2	0	FAM127C	133983971	0.747000	0.28283	0.967000	0.41034	0.955000	0.61496	0.112000	0.15479	0.360000	0.24265	0.436000	0.28706	GCC	.	.		0.602	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058389.2	NM_001078173	
CYP4A22	284541	hgsc.bcm.edu	37	1	47609480	47609481	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:47609480_47609481insT	ENST00000371891.3	+	6	713_714	c.682_683insT	c.(682-684)gttfs	p.V228fs	CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000371890.3_Intron|CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000294337.3_Frame_Shift_Ins_p.V228fs	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	228						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GAACAGCCTGGTTTTTTGCTGT	0.55																																					p.V228fs	Pancreas(88;1240 1470 2099 14214 37557)	Atlas-INDEL	.											CYP4A22,NS,malignant_melanoma,0,1	CYP4A22	60	.	0			c.682_683insT						.																																			SO:0001589	frameshift_variant	284541	exon6			.		CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.688dupT	chr1.hg19:g.47609486_47609486dupT	ENSP00000360958:p.Val228fs	189.0	0.0		157.0	48.0	NM_001010969	Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Frame_Shift_Ins	INS	ENST00000371891.3	hg19	CCDS30707.1																																																																																			.	.		0.550	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021635.1	XM_208213	
CEP350	9857	hgsc.bcm.edu	37	1	180062616	180062617	+	Frame_Shift_Ins	INS	-	-	T			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:180062616_180062617insT	ENST00000367607.3	+	34	7794_7795	c.7376_7377insT	c.(7375-7380)aagtccfs	p.KS2459fs	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2459					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TTGGAACTCAAGTCCCCTACTG	0.465																																					p.K2459fs		Atlas-INDEL	.											.	CEP350	418	.	0			c.7376_7377insT						.																																			SO:0001589	frameshift_variant	9857	exon34			.	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	Exception_encountered	chr1.hg19:g.180062616_180062617insT	ENSP00000356579:p.Lys2459fs	252.0	0.0		325.0	156.0	NM_014810	O75068|Q8TDK3|Q8WY20	Frame_Shift_Ins	INS	ENST00000367607.3	hg19	CCDS1336.1																																																																																			.	.		0.465	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098960	178098974	+	In_Frame_Del	DEL	CTATATCTTGCCTCC	CTATATCTTGCCTCC	-			TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	CTATATCTTGCCTCC	CTATATCTTGCCTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr2:178098960_178098974delCTATATCTTGCCTCC	ENST00000397062.3	-	2	625_639	c.71_85delGGAGGCAAGATATAG	c.(70-87)tggaggcaagatatagat>tat	p.24_29WRQDID>Y	NFE2L2_ENST00000423513.1_In_Frame_Del_p.8_13WRQDID>Y|NFE2L2_ENST00000446151.2_In_Frame_Del_p.8_13WRQDID>Y|NFE2L2_ENST00000464747.1_In_Frame_Del_p.8_13WRQDID>Y|NFE2L2_ENST00000397063.4_In_Frame_Del_p.8_13WRQDID>Y	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	24					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.D29H(11)|p.W24C(5)|p.D29N(2)|p.D29Y(2)|p.Q26K(1)|p.D27H(1)|p.Q26L(1)|p.Q26E(1)|p.D27Y(1)|p.I28T(1)|p.Q26P(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ACTCCAAGATCTATATCTTGCCTCCAAAGTATGTC	0.349			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.24_29del		Atlas-Indel,Pindel	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,bladder,carcinoma,-1,8	NFE2L2	225	.	27	Substitution - Missense(27)	lung(16)|oesophagus(4)|upper_aerodigestive_tract(3)|cervix(1)|endometrium(1)|liver(1)|kidney(1)	c.72_86del						.																																			SO:0001651	inframe_deletion	4780	exon2			.		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.71_85delGGAGGCAAGATATAG	chr2.hg19:g.178098960_178098974delCTATATCTTGCCTCC	ENSP00000380252:p.Trp24_Asp29delinsTyr	127.0	0.0		159.0	125.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	In_Frame_Del	DEL	ENST00000397062.3	hg19	CCDS42782.1																																																																																			.	.		0.349	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
DEPDC1	55635	hgsc.bcm.edu	37	1	68944871	68944874	+	Frame_Shift_Del	DEL	GTAA	GTAA	-	rs534583672		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	GTAA	GTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr1:68944871_68944874delGTAA	ENST00000456315.2	-	10	2179_2182	c.2065_2068delTTAC	c.(2065-2070)ttacagfs	p.LQ689fs	DEPDC1_ENST00000370966.5_Frame_Shift_Del_p.LQ405fs|RP4-694A7.2_ENST00000425820.1_RNA	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	689					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		ACTGCAGTCTGTAAGTAAGAGGGT	0.377																																					p.689_690del		Atlas-Indel,Pindel	.											.	DEPDC1	102	.	0			c.2066_2069del						.																																			SO:0001589	frameshift_variant	55635	exon10			.	AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.2065_2068delTTAC	chr1.hg19:g.68944875_68944878delGTAA	ENSP00000412292:p.Leu689fs	208.0	0.0		172.0	51.0	NM_001114120	A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Frame_Shift_Del	DEL	ENST00000456315.2	hg19	CCDS44159.1																																																																																			.	.		0.377	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000025514.2	NM_017779	
NCAM1	4684	hgsc.bcm.edu	37	11	112832332	112832363	+	5'UTR	DEL	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	-	rs6589347|rs11284059|rs559828324|rs201772924|rs563686839|rs7105734|rs112306738		TCGA-FV-A3I1-01A-11D-A22F-10	TCGA-FV-A3I1-10A-01D-A22F-10	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	CATCCCTCCCAGCCAGCAGATTACAATGCTGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	992d9566-b1da-421a-bf36-d23382b115fa	5cce4752-30c6-4bc7-8c28-90617e8dcd3b	g.chr11:112832332_112832363delCATCCCTCCCAGCCAGCAGATTACAATGCTGC	ENST00000533760.1	+	0	243_274				NCAM1_ENST00000397957.4_3'UTR|RP11-629G13.1_ENST00000532002.1_RNA|RP11-629G13.1_ENST00000500537.2_RNA	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		CAGCAGATTACAATGCTGCCAAACTAAGGATTTCATTTGGACTTTGTTTTTC	0.491																																					.		Pindel	.											.	NCAM1	372	.	0			.						.																																			SO:0001623	5_prime_UTR_variant	4684	wholegene			.		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.-326CATCCCTCCCAGCCAGCAGATTACAATGCTGC>-	chr11.hg19:g.112832332_112832363delCATCCCTCCCAGCCAGCAGATTACAATGCTGC		167.0	0.0		160.0	26.0	NM_001242608	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Frame_Shift_Del	DEL	ENST00000533760.1	hg19																																																																																				.	.		0.491	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
