#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PHTF1	10745	hgsc.bcm.edu	37	1	114255975	114255975	+	Nonsense_Mutation	SNP	G	G	A	rs61730007	byFrequency	TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:114255975G>A	ENST00000369604.1	-	8	1192	c.709C>T	c.(709-711)Caa>Taa	p.Q237*	PHTF1_ENST00000393357.2_Nonsense_Mutation_p.Q237*|PHTF1_ENST00000447664.2_Intron|PHTF1_ENST00000369596.2_Nonsense_Mutation_p.Q184*|PHTF1_ENST00000369600.1_Nonsense_Mutation_p.Q184*|PHTF1_ENST00000369598.1_Nonsense_Mutation_p.Q192*|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000357783.2_Nonsense_Mutation_p.Q237*			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	237					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGTCGACATTGTCTCCTCTTA	0.343																																					p.Q237X		Atlas-SNP	.											.	PHTF1	69	.	0			c.C709T						.						146.0	143.0	144.0					1																	114255975		2203	4300	6503	SO:0001587	stop_gained	10745	exon7			GACATTGTCTCCT	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.709C>T	chr1.hg19:g.114255975G>A	ENSP00000358617:p.Gln237*	175.0	0.0		216.0	72.0	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Nonsense_Mutation	SNP	ENST00000369604.1	hg19	CCDS861.1	.	.	.	.	.	.	.	.	.	.	G	41	8.969095	0.99019	.	.	ENSG00000116793	ENST00000369597;ENST00000393357;ENST00000369596;ENST00000369598;ENST00000369600;ENST00000369604;ENST00000357783	.	.	.	5.55	4.62	0.57501	.	0.524935	0.20981	N	0.082206	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-4.9277	10.4484	0.44507	0.0:0.1453:0.7037:0.1509	.	.	.	.	X	192;237;184;192;184;237;237	.	ENSP00000350428:Q237X	Q	-	1	0	PHTF1	114057498	1.000000	0.71417	0.885000	0.34714	0.601000	0.36947	3.570000	0.53834	1.314000	0.45095	0.467000	0.42956	CAA	.	G|0.991;T|0.009		0.343	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
LGR6	59352	hgsc.bcm.edu	37	1	202249945	202249945	+	Silent	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:202249945C>A	ENST00000367278.3	+	6	770	c.681C>A	c.(679-681)acC>acA	p.T227T	LGR6_ENST00000439764.2_Intron|LGR6_ENST00000255432.7_Silent_p.T175T|LGR6_ENST00000308543.3_3'UTR	NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	227					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						ATCTGGGGACCCACAGCTTCG	0.562																																					p.T227T		Atlas-SNP	.											.	LGR6	102	.	0			c.C681A						.						125.0	111.0	116.0					1																	202249945		2203	4300	6503	SO:0001819	synonymous_variant	59352	exon6			GGGGACCCACAGC	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.681C>A	chr1.hg19:g.202249945C>A		44.0	0.0		73.0	26.0	NM_001017403	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Silent	SNP	ENST00000367278.3	hg19	CCDS30971.1																																																																																			.	.		0.562	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
OR2T11	127077	hgsc.bcm.edu	37	1	248790035	248790035	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:248790035A>G	ENST00000330803.2	-	1	456	c.395T>C	c.(394-396)cTg>cCg	p.L132P		NM_001001964.1	NP_001001964.1	Q8NH01	O2T11_HUMAN	olfactory receptor, family 2, subfamily T, member 11 (gene/pseudogene)	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(5)|lung(20)|skin(2)	28	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCGGTTCATCAGGACTGGGTA	0.537																																					p.L132P		Atlas-SNP	.											.	OR2T11	64	.	0			c.T395C						.						50.0	57.0	55.0					1																	248790035		2050	4232	6282	SO:0001583	missense	127077	exon1			TTCATCAGGACTG	BK004476	CCDS31122.1	1q44	2013-10-10	2013-10-10		ENSG00000183130	ENSG00000183130		"""GPCR / Class A : Olfactory receptors"""	19574	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 11"""				Standard	NM_001001964		Approved	OR2T11Q	uc001ier.1	Q8NH01	OTTHUMG00000040384	ENST00000330803.2:c.395T>C	chr1.hg19:g.248790035A>G	ENSP00000328934:p.Leu132Pro	86.0	0.0		88.0	40.0	NM_001001964	Q6IEY6	Missense_Mutation	SNP	ENST00000330803.2	hg19	CCDS31122.1	.	.	.	.	.	.	.	.	.	.	.	15.10	2.733512	0.48939	.	.	ENSG00000183130	ENST00000330803	T	0.33654	1.4	4.38	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35739	N	0.003008	T	0.66587	0.2804	M	0.92880	3.355	0.53005	D	0.999962	D	0.89917	1.0	D	0.72338	0.977	T	0.75701	-0.3226	10	0.87932	D	0	.	12.724	0.57159	1.0:0.0:0.0:0.0	.	132	Q8NH01	O2T11_HUMAN	P	132	ENSP00000328934:L132P	ENSP00000328934:L132P	L	-	2	0	OR2T11	246856658	0.001000	0.12720	0.445000	0.26908	0.376000	0.30014	1.352000	0.34033	1.820000	0.53075	0.533000	0.62120	CTG	.	.		0.537	OR2T11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097134.1	NM_001001964	
SPTBN1	6711	hgsc.bcm.edu	37	2	54853192	54853192	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:54853192G>A	ENST00000356805.4	+	12	1746	c.1465G>A	c.(1465-1467)Gag>Aag	p.E489K	SPTBN1_ENST00000333896.5_Missense_Mutation_p.E476K	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	489					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			CAGGGAGCTCGAGGCCGAGAA	0.582																																					p.E489K		Atlas-SNP	.											.	SPTBN1	378	.	0			c.G1465A						.						104.0	101.0	102.0					2																	54853192		2203	4300	6503	SO:0001583	missense	6711	exon12			GAGCTCGAGGCCG		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1465G>A	chr2.hg19:g.54853192G>A	ENSP00000349259:p.Glu489Lys	134.0	0.0		108.0	42.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	G	36	5.600953	0.96614	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;T	0.50548	0.74;0.74;0.74	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.58694	0.2140	L	0.49699	1.58	0.80722	D	1	P;D	0.60575	0.88;0.988	B;P	0.54238	0.212;0.746	T	0.57980	-0.7717	10	0.51188	T	0.08	.	19.5969	0.95544	0.0:0.0:1.0:0.0	.	476;489	Q01082-3;Q01082	.;SPTB2_HUMAN	K	489;489;476	ENSP00000349259:E489K;ENSP00000374630:E489K;ENSP00000334156:E476K	ENSP00000334156:E476K	E	+	1	0	SPTBN1	54706696	1.000000	0.71417	0.952000	0.39060	0.885000	0.51271	9.802000	0.99131	2.634000	0.89283	0.650000	0.86243	GAG	.	.		0.582	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
LRP1B	53353	hgsc.bcm.edu	37	2	141660519	141660519	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:141660519C>A	ENST00000389484.3	-	23	4707	c.3736G>T	c.(3736-3738)Gat>Tat	p.D1246Y		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1246	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CCGTCTACATCCAGCTTCCAA	0.378										TSP Lung(27;0.18)																											p.D1246Y	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											LRP1B,NS,malignant_melanoma,0,1	LRP1B	1315	.	0			c.G3736T						.						152.0	140.0	144.0					2																	141660519		2203	4300	6503	SO:0001583	missense	53353	exon23			CTACATCCAGCTT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3736G>T	chr2.hg19:g.141660519C>A	ENSP00000374135:p.Asp1246Tyr	120.0	1.0		116.0	46.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	18.12	3.553433	0.65425	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.88431	-2.38;-2.38	5.44	3.62	0.41486	Epidermal growth factor-like (1);EGF-like region, conserved site (1);	0.390918	0.25189	N	0.032471	D	0.90981	0.7164	M	0.77406	2.37	0.36641	D	0.876823	P;P	0.51933	0.949;0.681	P;B	0.55871	0.786;0.235	D	0.91653	0.5336	10	0.62326	D	0.03	.	5.4998	0.16823	0.0:0.6243:0.0:0.3757	.	429;1246	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	Y	1246;1184;391	ENSP00000374135:D1246Y;ENSP00000413239:D391Y	ENSP00000374135:D1246Y	D	-	1	0	LRP1B	141376989	0.601000	0.26907	0.966000	0.40874	0.845000	0.48019	1.583000	0.36579	1.428000	0.47296	0.585000	0.79938	GAT	.	.		0.378	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
CACNB4	785	hgsc.bcm.edu	37	2	152695776	152695776	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:152695776A>T	ENST00000539935.1	-	14	1487	c.1420T>A	c.(1420-1422)Ttg>Atg	p.L474M	CACNB4_ENST00000360283.6_Missense_Mutation_p.L441M|CACNB4_ENST00000427385.1_Missense_Mutation_p.L456M|CACNB4_ENST00000201943.5_Missense_Mutation_p.L412M|CACNB4_ENST00000534999.1_Missense_Mutation_p.L440M|CACNB4_ENST00000397327.2_Missense_Mutation_p.L427M	NM_000726.3|NM_001145798.1	NP_000717.2|NP_001139270.1	O00305	CACB4_HUMAN	calcium channel, voltage-dependent, beta 4 subunit	474					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|cAMP metabolic process (GO:0046058)|cellular calcium ion homeostasis (GO:0006874)|detection of light stimulus involved in visual perception (GO:0050908)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|membrane depolarization (GO:0051899)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|neuronal action potential propagation (GO:0019227)|Peyer's patch development (GO:0048541)|regulation of voltage-gated calcium channel activity (GO:1901385)|spleen development (GO:0048536)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)|transport (GO:0006810)	cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11				BRCA - Breast invasive adenocarcinoma(221;0.156)	Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CTGGAAGACAAGCGGTTCCTA	0.463																																					p.L474M		Atlas-SNP	.											.	CACNB4	108	.	0			c.T1420A						.						113.0	113.0	113.0					2																	152695776		1985	4183	6168	SO:0001583	missense	785	exon14			AAGACAAGCGGTT	AF038852	CCDS46426.1, CCDS46427.1, CCDS46428.1, CCDS54409.1	2q22-q23	2009-09-04			ENSG00000182389	ENSG00000182389		"""Calcium channel subunits"""	1404	protein-coding gene	gene with protein product		601949				9628818	Standard	NM_000726		Approved	EJM4	uc002tya.3	O00305	OTTHUMG00000155091	ENST00000539935.1:c.1420T>A	chr2.hg19:g.152695776A>T	ENSP00000438949:p.Leu474Met	173.0	0.0		180.0	77.0	NM_000726	A7BJ74|A8K1Y4|B4DG40|O60515|Q6B000|Q96L40	Missense_Mutation	SNP	ENST00000539935.1	hg19	CCDS46426.1	.	.	.	.	.	.	.	.	.	.	A	10.18	1.278017	0.23307	.	.	ENSG00000182389	ENST00000539935;ENST00000360283;ENST00000543269;ENST00000439467;ENST00000534999;ENST00000397327;ENST00000427385;ENST00000201943;ENST00000339254	T;T;T;T;T;T;T	0.73897	-0.7;-0.7;-0.7;-0.7;-0.69;-0.7;-0.79	5.26	4.12	0.48240	.	0.136662	0.51477	D	0.000092	T	0.53753	0.1816	N	0.11560	0.145	0.51012	D	0.999903	B;B;B;B	0.18610	0.006;0.017;0.017;0.029	B;B;B;B	0.17979	0.009;0.015;0.015;0.02	T	0.51560	-0.8690	10	0.33141	T	0.24	-8.5623	10.4536	0.44537	0.9235:0.0:0.0765:0.0	.	412;474;456;440	A7BJ74;O00305;B4DG40;O00305-2	.;CACB4_HUMAN;.;.	M	474;441;369;469;440;427;456;412;475	ENSP00000438949:L474M;ENSP00000353425:L441M;ENSP00000390161:L469M;ENSP00000443893:L440M;ENSP00000380490:L427M;ENSP00000410978:L456M;ENSP00000201943:L412M	ENSP00000201943:L412M	L	-	1	2	CACNB4	152404022	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.249000	0.51437	1.988000	0.58038	0.377000	0.23210	TTG	.	.		0.463	CACNB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000338385.4	NM_000726.3	
RFTN2	130132	hgsc.bcm.edu	37	2	198436936	198436936	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:198436936G>T	ENST00000295049.4	-	9	1838	c.1302C>A	c.(1300-1302)gaC>gaA	p.D434E		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	434					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						ACGAGGTTGTGTCTAATCCGA	0.527																																					p.D434E		Atlas-SNP	.											.	RFTN2	68	.	0			c.C1302A						.						284.0	228.0	247.0					2																	198436936		2203	4300	6503	SO:0001583	missense	130132	exon9			GGTTGTGTCTAAT	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.1302C>A	chr2.hg19:g.198436936G>T	ENSP00000295049:p.Asp434Glu	162.0	0.0		170.0	62.0	NM_144629	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	ENST00000295049.4	hg19	CCDS2323.1	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844456	0.32606	.	.	ENSG00000162944	ENST00000295049;ENST00000454447	T;T	0.30182	1.54;1.54	4.84	0.951	0.19579	.	0.929500	0.09076	N	0.852065	T	0.24314	0.0589	L	0.29908	0.895	0.23227	N	0.998087	D	0.56035	0.974	P	0.46275	0.51	T	0.14309	-1.0477	10	0.40728	T	0.16	-11.1573	5.7903	0.18357	0.2988:0.129:0.5722:0.0	.	434	Q52LD8	RFTN2_HUMAN	E	434;126	ENSP00000295049:D434E;ENSP00000387459:D126E	ENSP00000295049:D434E	D	-	3	2	RFTN2	198145181	1.000000	0.71417	0.007000	0.13788	0.042000	0.13812	2.750000	0.47500	-0.000000	0.14550	0.561000	0.74099	GAC	.	.		0.527	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	NM_144629	
ANKMY1	51281	hgsc.bcm.edu	37	2	241463777	241463777	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr2:241463777C>T	ENST00000272972.3	-	7	1304	c.1090G>A	c.(1090-1092)Gtt>Att	p.V364I	ANKMY1_ENST00000536462.1_Missense_Mutation_p.V176I|ANKMY1_ENST00000462004.1_5'Flank|ANKMY1_ENST00000403283.1_Missense_Mutation_p.V302I|ANKMY1_ENST00000405523.3_Missense_Mutation_p.V223I|ANKMY1_ENST00000391987.1_Missense_Mutation_p.V364I|ANKMY1_ENST00000373320.4_Missense_Mutation_p.V134I|ANKMY1_ENST00000361678.4_Missense_Mutation_p.V223I|ANKMY1_ENST00000401804.1_Missense_Mutation_p.V453I|ANKMY1_ENST00000373318.2_Missense_Mutation_p.V223I|ANKMY1_ENST00000406958.1_Missense_Mutation_p.V223I|ANKMY1_ENST00000405002.1_Missense_Mutation_p.V134I	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	364							metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		AGGATTGGAACAACTGGGAAT	0.448																																					p.V364I		Atlas-SNP	.											.	ANKMY1	112	.	0			c.G1090A						.						40.0	44.0	43.0					2																	241463777		2201	4295	6496	SO:0001583	missense	51281	exon7			TTGGAACAACTGG	AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.1090G>A	chr2.hg19:g.241463777C>T	ENSP00000272972:p.Val364Ile	65.0	0.0		56.0	17.0	NM_016552	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	ENST00000272972.3	hg19	CCDS2536.1	.	.	.	.	.	.	.	.	.	.	C	4.064	0.009642	0.07912	.	.	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002	T;T;T;T;T;T;T;T;T;T;T	0.56103	2.88;3.59;0.5;2.21;0.5;4.36;2.44;0.48;2.16;2.18;2.44	3.16	-4.41	0.03590	Ankyrin repeat-containing domain (1);	1.581880	0.04098	N	0.312380	T	0.30823	0.0777	N	0.14661	0.345	0.09310	N	1	B;B;B;B;B;B;B	0.33171	0.003;0.003;0.013;0.002;0.002;0.4;0.003	B;B;B;B;B;B;B	0.30646	0.002;0.002;0.008;0.001;0.001;0.118;0.002	T	0.20840	-1.0263	10	0.51188	T	0.08	-32.2219	5.1322	0.14917	0.0:0.3825:0.37:0.2475	.	364;176;134;223;223;223;364	Q4ZFV3;F5H558;Q9P2S6-4;Q6GPI0;B5MBY4;Q9P2S6-2;Q9P2S6	.;.;.;.;.;.;ANKY1_HUMAN	I	223;223;364;223;364;134;302;453;176;223;134	ENSP00000362415:V223I;ENSP00000384555:V223I;ENSP00000272972:V364I;ENSP00000355097:V223I;ENSP00000375847:V364I;ENSP00000362417:V134I;ENSP00000383968:V302I;ENSP00000385887:V453I;ENSP00000444707:V176I;ENSP00000385635:V223I;ENSP00000385145:V134I	ENSP00000272972:V364I	V	-	1	0	ANKMY1	241112450	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.170000	0.09897	-0.920000	0.03799	-0.339000	0.08088	GTT	.	.		0.448	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257187.2	NM_017844	
SATB1	6304	hgsc.bcm.edu	37	3	18462375	18462375	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr3:18462375T>G	ENST00000338745.6	-	2	1819	c.85A>C	c.(85-87)Aag>Cag	p.K29Q	SATB1_ENST00000493952.2_Missense_Mutation_p.K29Q|SATB1_ENST00000417717.2_Missense_Mutation_p.K29Q|TBC1D5_ENST00000414318.2_Intron|SATB1_ENST00000454909.2_Missense_Mutation_p.K29Q	NM_002971.4	NP_002962.1	Q01826	SATB1_HUMAN	SATB homeobox 1	29					activated T cell proliferation (GO:0050798)|apoptotic process (GO:0006915)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|epidermis development (GO:0008544)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|reflex (GO:0060004)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|endometrium(6)|large_intestine(4)|lung(10)|ovary(1)|skin(5)|upper_aerodigestive_tract(2)	32						CGGGCAATCTTGGCTGGTGGA	0.512																																					p.K29Q		Atlas-SNP	.											.	SATB1	96	.	0			c.A85C						.						134.0	137.0	136.0					3																	18462375		2203	4300	6503	SO:0001583	missense	6304	exon2			CAATCTTGGCTGG		CCDS2631.1, CCDS56242.1	3p24.3	2011-07-19	2007-02-15		ENSG00000182568	ENSG00000182568		"""Homeoboxes / CUT class"""	10541	protein-coding gene	gene with protein product		602075	"""special AT-rich sequence binding protein 1 (binds to nuclear matrix/scaffold-associating DNA)"""			1505028	Standard	NM_002971		Approved		uc003cbj.3	Q01826	OTTHUMG00000129890	ENST00000338745.6:c.85A>C	chr3.hg19:g.18462375T>G	ENSP00000341024:p.Lys29Gln	134.0	0.0		164.0	95.0	NM_002971	B3KXF1|C9JTR6|Q59EQ0	Missense_Mutation	SNP	ENST00000338745.6	hg19	CCDS2631.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.949754	0.92660	.	.	ENSG00000182568	ENST00000338745;ENST00000454909;ENST00000417717;ENST00000440737;ENST00000452260;ENST00000415069;ENST00000457005;ENST00000414509;ENST00000444341	T;T;T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.83	5.83	0.93111	.	0.093160	0.64402	D	0.000001	T	0.79100	0.4389	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80921	-0.1166	10	0.87932	D	0	-26.1861	16.2147	0.82198	0.0:0.0:0.0:1.0	.	29;29	Q01826-2;Q01826	.;SATB1_HUMAN	Q	29	ENSP00000341024:K29Q;ENSP00000399708:K29Q;ENSP00000399518:K29Q;ENSP00000402982:K29Q;ENSP00000406727:K29Q;ENSP00000390529:K29Q;ENSP00000398072:K29Q;ENSP00000408871:K29Q;ENSP00000391344:K29Q	ENSP00000341024:K29Q	K	-	1	0	SATB1	18437379	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.665000	0.83852	2.231000	0.72958	0.460000	0.39030	AAG	.	.		0.512	SATB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252138.4	NM_001131010	
MB21D2	151963	hgsc.bcm.edu	37	3	192516790	192516790	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr3:192516790C>T	ENST00000392452.2	-	2	1181	c.861G>A	c.(859-861)tgG>tgA	p.W287*		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	287							protein complex binding (GO:0032403)			endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						AGGACAGCCGCCATTCATTGT	0.507																																					p.W287X		Atlas-SNP	.											.	MB21D2	75	.	0			c.G861A						.						43.0	37.0	39.0					3																	192516790		2203	4300	6503	SO:0001587	stop_gained	151963	exon2			CAGCCGCCATTCA	AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.861G>A	chr3.hg19:g.192516790C>T	ENSP00000376246:p.Trp287*	56.0	0.0		79.0	47.0	NM_178496	Q86VD8	Nonsense_Mutation	SNP	ENST00000392452.2	hg19	CCDS3302.2	.	.	.	.	.	.	.	.	.	.	C	38	6.718924	0.97788	.	.	ENSG00000180611	ENST00000392452	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3039	18.4392	0.90658	0.0:1.0:0.0:0.0	.	.	.	.	X	287	.	ENSP00000376246:W287X	W	-	3	0	MB21D2	193999484	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.783000	0.85696	2.593000	0.87608	0.655000	0.94253	TGG	.	.		0.507	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341543.1	NM_178496	
LNX1	84708	hgsc.bcm.edu	37	4	54373548	54373548	+	Silent	SNP	C	C	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr4:54373548C>G	ENST00000263925.7	-	4	1025	c.711G>C	c.(709-711)ggG>ggC	p.G237G	LNX1-AS1_ENST00000511989.1_RNA|LNX1_ENST00000306888.2_Silent_p.G141G|LNX1-AS1_ENST00000514364.1_RNA|LNX1-AS1_ENST00000510785.1_RNA|FIP1L1_ENST00000507166.1_Intron	NM_001126328.2	NP_001119800.1	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1, E3 ubiquitin protein ligase	237	Interaction with MAGEB18.				protein homooligomerization (GO:0051260)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.G141G(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|endometrium(3)|large_intestine(11)|lung(6)|ovary(3)|urinary_tract(4)	32	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			CAACTGCACTCCCGCTCTTTG	0.478																																					p.G237G		Atlas-SNP	.											LNX1,NS,carcinoma,0,1	LNX1	139	.	1	Substitution - coding silent(1)	lung(1)	c.G711C						.						130.0	121.0	124.0					4																	54373548		2203	4300	6503	SO:0001819	synonymous_variant	84708	exon4			TGCACTCCCGCTC	AF237782	CCDS3492.1, CCDS47057.1	4q12	2013-01-09	2012-02-23	2005-11-04	ENSG00000072201	ENSG00000072201		"""RING-type (C3HC4) zinc fingers"""	6657	protein-coding gene	gene with protein product		609732	"""ligand of numb-protein X"", ""ligand of numb-protein X 1"""	LNX		11521506, 11782429	Standard	NM_032622		Approved	MPDZ, PDZRN2	uc003hag.5	Q8TBB1	OTTHUMG00000102099	ENST00000263925.7:c.711G>C	chr4.hg19:g.54373548C>G		115.0	0.0		110.0	37.0	NM_001126328	Q4W5K7|Q8N4C2|Q96MJ7|Q9BY20	Silent	SNP	ENST00000263925.7	hg19	CCDS47057.1																																																																																			.	.		0.478	LNX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219934.2		
SHROOM3	57619	hgsc.bcm.edu	37	4	77661969	77661969	+	Silent	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr4:77661969G>A	ENST00000296043.6	+	5	3596	c.2643G>A	c.(2641-2643)ccG>ccA	p.P881P		NM_020859.3	NP_065910.3	Q8TF72	SHRM3_HUMAN	shroom family member 3	881					actin cytoskeleton organization (GO:0030036)|apical protein localization (GO:0045176)|cell morphogenesis (GO:0000902)|cellular pigment accumulation (GO:0043482)|columnar/cuboidal epithelial cell development (GO:0002066)|neural tube closure (GO:0001843)|pattern specification process (GO:0007389)|regulation of cell shape (GO:0008360)	adherens junction (GO:0005912)|apical junction complex (GO:0043296)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule (GO:0005874)				NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(29)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	60			Lung(101;0.0903)			CCCAGAGGCCGGACGCTCGGC	0.701																																					p.P881P		Atlas-SNP	.											.	SHROOM3	134	.	0			c.G2643A						.						10.0	13.0	12.0					4																	77661969		2112	4128	6240	SO:0001819	synonymous_variant	57619	exon5			GAGGCCGGACGCT	AB055660	CCDS3579.2	4q21.1	2009-11-25			ENSG00000138771	ENSG00000138771			30422	protein-coding gene	gene with protein product		604570				10589677, 16615870	Standard	NM_020859		Approved	ShrmL, SHRM, KIAA1481, APXL3	uc011cbx.2	Q8TF72	OTTHUMG00000157075	ENST00000296043.6:c.2643G>A	chr4.hg19:g.77661969G>A		5.0	0.0		9.0	6.0	NM_020859	Q5QTQ3|Q6ZRW3|Q96IR9|Q9P247	Silent	SNP	ENST00000296043.6	hg19	CCDS3579.2																																																																																			.	.		0.701	SHROOM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252408.2	NM_020859	
MRPL1	65008	hgsc.bcm.edu	37	4	78806454	78806454	+	Silent	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr4:78806454A>G	ENST00000315567.8	+	4	776	c.447A>G	c.(445-447)ccA>ccG	p.P149P	MRPL1_ENST00000506674.1_3'UTR	NM_020236.3	NP_064621.3	Q9BYD6	RM01_HUMAN	mitochondrial ribosomal protein L1	149					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)	17						TGCCATACCCATTTGCTTCCG	0.328																																					p.P149P		Atlas-SNP	.											.	MRPL1	37	.	0			c.A447G						.						129.0	129.0	129.0					4																	78806454		2202	4300	6502	SO:0001819	synonymous_variant	65008	exon4			ATACCCATTTGCT	AB049474	CCDS3583.2	4q21.1	2012-09-13			ENSG00000169288	ENSG00000169288		"""Mitochondrial ribosomal proteins / large subunits"""	14275	protein-coding gene	gene with protein product		611821					Standard	NM_020236		Approved	BM022	uc003hku.2	Q9BYD6	OTTHUMG00000130200	ENST00000315567.8:c.447A>G	chr4.hg19:g.78806454A>G		131.0	0.0		127.0	55.0	NM_020236	A6NG03|Q4W5B8|Q6IAG4|Q96BW3|Q9H793|Q9NRL5	Silent	SNP	ENST00000315567.8	hg19	CCDS3583.2	.	.	.	.	.	.	.	.	.	.	A	1.625	-0.520506	0.04171	.	.	ENSG00000169288	ENST00000502384	.	.	.	5.71	-3.31	0.04988	.	.	.	.	.	T	0.37865	0.1019	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.33317	-0.9873	4	.	.	.	-2.3981	0.9725	0.01419	0.2409:0.3202:0.133:0.3059	.	.	.	.	V	103	.	.	I	+	1	0	MRPL1	79025478	0.812000	0.29077	0.677000	0.29947	0.045000	0.14185	-0.258000	0.08733	-0.665000	0.05317	0.524000	0.50904	ATT	.	.		0.328	MRPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252518.3	NM_020236	
CDH9	1007	hgsc.bcm.edu	37	5	26889956	26889956	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:26889956T>C	ENST00000231021.4	-	9	1673	c.1501A>G	c.(1501-1503)Aaa>Gaa	p.K501E		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	501	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						TGCCCAGGTTTTGCATTTTCA	0.308																																					p.K501E	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.A1501G						.						81.0	83.0	82.0					5																	26889956		2203	4300	6503	SO:0001583	missense	1007	exon9			CAGGTTTTGCATT	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1501A>G	chr5.hg19:g.26889956T>C	ENSP00000231021:p.Lys501Glu	95.0	0.0		139.0	48.0	NM_016279	Q3B7I5	Missense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084226	0.76642	.	.	ENSG00000113100	ENST00000231021	T	0.51574	0.7	5.31	5.31	0.75309	Cadherin (3);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.53367	0.1792	M	0.71581	2.175	0.52501	D	0.999951	B;B	0.28636	0.107;0.218	B;B	0.38327	0.256;0.271	T	0.51896	-0.8647	9	.	.	.	.	14.0813	0.64925	0.0:0.0:0.0:1.0	.	94;501	B4DFP0;Q9ULB4	.;CADH9_HUMAN	E	501	ENSP00000231021:K501E	.	K	-	1	0	CDH9	26925713	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.664000	0.83830	2.010000	0.58986	0.450000	0.29827	AAA	.	.		0.308	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
VCAN	1462	hgsc.bcm.edu	37	5	82836955	82836955	+	Silent	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:82836955T>A	ENST00000265077.3	+	8	8698	c.8133T>A	c.(8131-8133)gcT>gcA	p.A2711A	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000343200.5_Silent_p.A1724A|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2711	GAG-beta.			IKAEA -> EFREV (in Ref. 7; AAA36437). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GAATAAAAGCTGAAGCAAAAG	0.423																																					p.A2711A		Atlas-SNP	.											.	VCAN	498	.	0			c.T8133A						.						61.0	58.0	59.0					5																	82836955		2203	4300	6503	SO:0001819	synonymous_variant	1462	exon8			AAAAGCTGAAGCA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8133T>A	chr5.hg19:g.82836955T>A		88.0	0.0		94.0	27.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	ENST00000265077.3	hg19	CCDS4060.1																																																																																			.	.		0.423	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
SKP1	6500	hgsc.bcm.edu	37	5	133494206	133494206	+	Silent	SNP	A	A	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:133494206A>C	ENST00000353411.6	-	5	579	c.396T>G	c.(394-396)ccT>ccG	p.P132P	SKP1_ENST00000522552.1_Silent_p.P132P|SKP1_ENST00000517625.1_Silent_p.P132P|SKP1_ENST00000522855.1_Silent_p.P132P|SKP1_ENST00000521216.1_Silent_p.P132P	NM_170679.2	NP_733779.1	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1	132	Interaction with the F-box domain of F- box proteins. {ECO:0000250}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H2A monoubiquitination (GO:0035518)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|viral process (GO:0016032)	Cul7-RING ubiquitin ligase complex (GO:0031467)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|SCF ubiquitin ligase complex (GO:0019005)	ubiquitin-protein transferase activity (GO:0004842)			large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAATCTCCTCAGGAGTTTTCC	0.408																																					p.P132P		Atlas-SNP	.											.	SKP1	10	.	0			c.T396G						.						143.0	138.0	139.0					5																	133494206		2203	4300	6503	SO:0001819	synonymous_variant	6500	exon5			CTCCTCAGGAGTT	U33760	CCDS4171.1, CCDS4172.1	5q31	2011-11-18	2007-11-13	2007-11-13	ENSG00000113558	ENSG00000113558			10899	protein-coding gene	gene with protein product		601434	"""S-phase kinase-associated protein 1A (p19A)"""	SKP1A		7553852, 8646875	Standard	NM_006930		Approved	EMC19, OCP2, TCEB1L, MGC34403, OCP-II, p19A	uc003kzc.4	P63208	OTTHUMG00000129117	ENST00000353411.6:c.396T>G	chr5.hg19:g.133494206A>C		106.0	0.0		126.0	44.0	NM_170679	D3DQ97|D3DQ98|P34991|Q8TAY2	Silent	SNP	ENST00000353411.6	hg19	CCDS4171.1																																																																																			.	.		0.408	SKP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251162.2	NM_170679	
TMEM173	340061	hgsc.bcm.edu	37	5	138856001	138856001	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:138856001C>A	ENST00000330794.4	-	8	1318	c.985G>T	c.(985-987)Gtt>Ttt	p.V329F	TMEM173_ENST00000511850.1_5'Flank	NM_198282.2	NP_938023.1	Q86WV6	STING_HUMAN	transmembrane protein 173	329	c-di-GMP-binding domain (CBD).				activation of innate immune response (GO:0002218)|apoptotic process (GO:0006915)|cellular response to exogenous dsRNA (GO:0071360)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	cyclic-di-GMP binding (GO:0035438)|cyclic-GMP-AMP binding (GO:0061507)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|lung(6)|upper_aerodigestive_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TGCCGGAGAACCTCCTGGGAC	0.557																																					p.V329F		Atlas-SNP	.											.	TMEM173	19	.	0			c.G985T						.						56.0	54.0	55.0					5																	138856001		2203	4300	6503	SO:0001583	missense	340061	exon8			GGAGAACCTCCTG		CCDS4215.1	5q31.2	2009-11-06			ENSG00000184584	ENSG00000184584			27962	protein-coding gene	gene with protein product		612374				12477932	Standard	XM_005268445		Approved	FLJ38577, NET23	uc003lep.3	Q86WV6	OTTHUMG00000129239	ENST00000330794.4:c.985G>T	chr5.hg19:g.138856001C>A	ENSP00000331288:p.Val329Phe	33.0	0.0		67.0	13.0	NM_198282	A8K3P6|B6EB35|D6RBX0|D6RE01|D6RID9	Missense_Mutation	SNP	ENST00000330794.4	hg19	CCDS4215.1	.	.	.	.	.	.	.	.	.	.	C	12.50	1.956615	0.34565	.	.	ENSG00000184584	ENST00000330794	T	0.27720	1.65	5.19	3.04	0.35103	.	0.129349	0.49305	D	0.000144	T	0.23210	0.0561	L	0.36672	1.1	0.38398	D	0.94559	P	0.49090	0.919	B	0.43274	0.414	T	0.06058	-1.0848	10	0.72032	D	0.01	-6.136	5.9319	0.19144	0.0:0.1885:0.0:0.8115	.	329	Q86WV6	TM173_HUMAN	F	329	ENSP00000331288:V329F	ENSP00000331288:V329F	V	-	1	0	TMEM173	138836185	0.825000	0.29262	0.989000	0.46669	0.235000	0.25334	1.011000	0.29911	0.421000	0.25980	-0.379000	0.06801	GTT	.	.		0.557	TMEM173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251338.1	NM_198282	
ATP10B	23120	hgsc.bcm.edu	37	5	160033981	160033981	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr5:160033981G>T	ENST00000327245.5	-	19	3797	c.2951C>A	c.(2950-2952)tCc>tAc	p.S984Y		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	984					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGAGGTGATGGATGGTGTCTT	0.468																																					p.S984Y		Atlas-SNP	.											.	ATP10B	201	.	0			c.C2951A						.						127.0	120.0	122.0					5																	160033981		1949	4140	6089	SO:0001583	missense	23120	exon19			GTGATGGATGGTG	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2951C>A	chr5.hg19:g.160033981G>T	ENSP00000313600:p.Ser984Tyr	187.0	1.0		300.0	166.0	NM_025153	Q9H725	Missense_Mutation	SNP	ENST00000327245.5	hg19	CCDS43394.1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631877	0.29068	.	.	ENSG00000118322	ENST00000327245	T	0.06218	3.33	5.05	5.05	0.67936	HAD-like domain (1);	0.544252	0.18094	N	0.151903	T	0.13372	0.0324	M	0.68593	2.085	0.19575	N	0.999966	P	0.49253	0.921	P	0.48952	0.596	T	0.08576	-1.0715	9	.	.	.	.	10.9146	0.47129	0.0959:0.0:0.9041:0.0	.	984	O94823	AT10B_HUMAN	Y	984	ENSP00000313600:S984Y	.	S	-	2	0	ATP10B	159966559	0.024000	0.19004	0.078000	0.20375	0.061000	0.15899	2.123000	0.41996	2.344000	0.79699	0.563000	0.77884	TCC	.	.		0.468	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
GMNN	51053	hgsc.bcm.edu	37	6	24785914	24785914	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:24785914G>C	ENST00000230056.3	+	7	849	c.517G>C	c.(517-519)Gaa>Caa	p.E173Q	GMNN_ENST00000356509.3_Missense_Mutation_p.E173Q	NM_015895.4	NP_056979.1	O75496	GEMI_HUMAN	geminin, DNA replication inhibitor	173	Homeodomain binding.				mitotic cell cycle (GO:0000278)|negative regulation of cell cycle (GO:0045786)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|skin(1)	10						GGATAATCAGGAATTTGATTC	0.353																																					p.E173Q		Atlas-SNP	.											.	GMNN	19	.	0			c.G517C						.						86.0	89.0	88.0					6																	24785914		2203	4300	6503	SO:0001583	missense	51053	exon7			AATCAGGAATTTG	AF067855	CCDS4560.1	6p21.32	2008-10-31			ENSG00000112312	ENSG00000112312			17493	protein-coding gene	gene with protein product		602842				9635433	Standard	NM_001251989		Approved	Gem	uc003nem.3	O75496	OTTHUMG00000014363	ENST00000230056.3:c.517G>C	chr6.hg19:g.24785914G>C	ENSP00000230056:p.Glu173Gln	71.0	0.0		143.0	40.0	NM_001251991	B3KMM8|Q9H1Z1	Missense_Mutation	SNP	ENST00000230056.3	hg19	CCDS4560.1	.	.	.	.	.	.	.	.	.	.	G	17.12	3.309312	0.60414	.	.	ENSG00000112312	ENST00000356509;ENST00000230056;ENST00000378054	T;T;T	0.15487	2.42;2.42;2.42	5.95	5.95	0.96441	.	0.453554	0.25810	N	0.028155	T	0.17534	0.0421	M	0.68317	2.08	0.31892	N	0.617107	D	0.54397	0.966	P	0.52109	0.69	T	0.06499	-1.0823	10	0.30854	T	0.27	-9.3621	12.2941	0.54836	0.0772:0.0:0.9228:0.0	.	173	O75496	GEMI_HUMAN	Q	173	ENSP00000348902:E173Q;ENSP00000230056:E173Q;ENSP00000367293:E173Q	ENSP00000230056:E173Q	E	+	1	0	GMNN	24893893	1.000000	0.71417	1.000000	0.80357	0.652000	0.38707	4.852000	0.62904	2.824000	0.97209	0.655000	0.94253	GAA	.	.		0.353	GMNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040021.2	NM_015895	
OR12D2	26529	hgsc.bcm.edu	37	6	29364910	29364910	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:29364910C>A	ENST00000383555.2	+	1	495	c.434C>A	c.(433-435)aCa>aAa	p.T145K	OR5V1_ENST00000377154.1_Intron	NM_013936.3	NP_039224.2	P58182	O12D2_HUMAN	olfactory receptor, family 12, subfamily D, member 2 (gene/pseudogene)	145						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(20)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	31						ATGGCCATCACAATCTGGGTC	0.488																																					p.T145K		Atlas-SNP	.											.	OR12D2	42	.	0			c.C434A						.						142.0	137.0	139.0					6																	29364910		1511	2709	4220	SO:0001583	missense	26529	exon1			CCATCACAATCTG		CCDS4659.1	6p22.2-p21.31	2013-10-10	2013-10-10		ENSG00000168787	ENSG00000168787		"""GPCR / Class A : Olfactory receptors"""	8178	protein-coding gene	gene with protein product			"""olfactory receptor, family 12, subfamily D, member 2"""				Standard	NM_013936		Approved	hs6M1-20	uc003nmf.4	P58182	OTTHUMG00000031049	ENST00000383555.2:c.434C>A	chr6.hg19:g.29364910C>A	ENSP00000373047:p.Thr145Lys	160.0	0.0		227.0	63.0	NM_013936	B0S862|Q5SUN9|Q6IET9	Missense_Mutation	SNP	ENST00000383555.2	hg19	CCDS4659.1	.	.	.	.	.	.	.	.	.	.	C	3.847	-0.032719	0.07543	.	.	ENSG00000168787	ENST00000383555	T	0.37752	1.18	3.94	0.994	0.19832	GPCR, rhodopsin-like superfamily (1);	0.428574	0.21811	N	0.068773	T	0.21186	0.0510	M	0.75085	2.285	0.09310	N	1	P	0.34699	0.464	B	0.39971	0.315	T	0.13872	-1.0493	10	0.48119	T	0.1	.	6.8125	0.23812	0.0:0.685:0.1437:0.1713	.	145	P58182	O12D2_HUMAN	K	145	ENSP00000373047:T145K	ENSP00000373047:T145K	T	+	2	0	OR12D2	29472889	0.000000	0.05858	0.001000	0.08648	0.052000	0.14988	0.451000	0.21779	0.308000	0.22923	0.205000	0.17691	ACA	.	.		0.488	OR12D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076054.2		
HSPA1L	3305	hgsc.bcm.edu	37	6	31778524	31778524	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:31778524C>T	ENST00000375654.4	-	2	1415	c.1226G>A	c.(1225-1227)gGg>gAg	p.G409E	HSPA1L_ENST00000417199.3_Missense_Mutation_p.G409E	NM_005527.3	NP_005518.3	P34931	HS71L_HUMAN	heat shock 70kDa protein 1-like	409					binding of sperm to zona pellucida (GO:0007339)|protein refolding (GO:0042026)|response to unfolded protein (GO:0006986)	blood microparticle (GO:0072562)|cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(10)|ovary(3)|pleura(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	34						CATCACGCCCCCAGCCGTCTC	0.602																																					p.G409E		Atlas-SNP	.											.	HSPA1L	185	.	0			c.G1226A						.						78.0	74.0	75.0					6																	31778524		2203	4300	6503	SO:0001583	missense	3305	exon2			ACGCCCCCAGCCG	D85730	CCDS34413.1	6p21.3	2014-01-21	2002-08-29		ENSG00000204390	ENSG00000204390		"""Heat shock proteins / HSP70"""	5234	protein-coding gene	gene with protein product		140559	"""heat shock 70kD protein-like 1"""			9685725, 9349405	Standard	NM_005527		Approved	HSP70-HOM, hum70t	uc003nxh.3	P34931	OTTHUMG00000031208	ENST00000375654.4:c.1226G>A	chr6.hg19:g.31778524C>T	ENSP00000364805:p.Gly409Glu	104.0	0.0		149.0	38.0	NM_005527	A6NNB0|B0UXW8|O75634|Q2HXR3|Q8NE72|Q96QC9|Q9UQM1	Missense_Mutation	SNP	ENST00000375654.4	hg19	CCDS34413.1	.	.	.	.	.	.	.	.	.	.	C	13.71	2.319751	0.41096	.	.	ENSG00000204390	ENST00000375654;ENST00000417199;ENST00000375653	T;T	0.05996	3.36;3.36	5.2	5.2	0.72013	.	0.000000	0.35407	N	0.003222	T	0.39410	0.1077	H	0.99454	4.575	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65311	-0.6199	10	0.87932	D	0	-17.4554	16.2725	0.82628	0.0:1.0:0.0:0.0	.	409	P34931	HS71L_HUMAN	E	409;409;354	ENSP00000364805:G409E;ENSP00000387691:G409E	ENSP00000364804:G354E	G	-	2	0	HSPA1L	31886503	1.000000	0.71417	0.390000	0.26220	0.006000	0.05464	5.930000	0.70104	2.704000	0.92352	0.585000	0.79938	GGG	.	.		0.602	HSPA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076416.2		
IP6K3	117283	hgsc.bcm.edu	37	6	33690707	33690707	+	Silent	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:33690707G>A	ENST00000293756.4	-	6	1349	c.1023C>T	c.(1021-1023)ggC>ggT	p.G341G	IP6K3_ENST00000451316.1_Silent_p.G341G	NM_054111.4	NP_473452.2	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	341					inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol metabolic process (GO:0046488)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol hexakisphosphate 6-kinase activity (GO:0000831)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			skin(1)	1						GATGCGGGCTGCCTGGGGCTC	0.562																																					p.G341G		Atlas-SNP	.											.	IP6K3	52	.	0			c.C1023T						.						70.0	71.0	71.0					6																	33690707		2203	4300	6503	SO:0001819	synonymous_variant	117283	exon7			CGGGCTGCCTGGG	AF393812	CCDS34435.1	6p21.31	2009-01-05	2009-01-05	2008-12-22	ENSG00000161896	ENSG00000161896			17269	protein-coding gene	gene with protein product		606993	"""inositol hexaphosphate kinase 3"""	IHPK3		11502751	Standard	NM_054111		Approved	INSP6K3	uc003ofb.2	Q96PC2	OTTHUMG00000014531	ENST00000293756.4:c.1023C>T	chr6.hg19:g.33690707G>A		107.0	0.0		166.0	41.0	NM_001142883	Q96MQ9	Silent	SNP	ENST00000293756.4	hg19	CCDS34435.1																																																																																			.	.		0.562	IP6K3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040203.1	NM_054111	
FIG4	9896	hgsc.bcm.edu	37	6	110059526	110059526	+	Splice_Site	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr6:110059526A>G	ENST00000230124.3	+	7	770		c.e7-1		FIG4_ENST00000368941.1_Intron|FIG4_ENST00000441478.2_Intron	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase						cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		TTTATTTTTCAGGGGTATTTG	0.323																																					.		Atlas-SNP	.											.	FIG4	77	.	0			c.647-2A>G						.						107.0	112.0	110.0					6																	110059526		2203	4298	6501	SO:0001630	splice_region_variant	9896	exon7			TTTTTCAGGGGTA	D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.647-1A>G	chr6.hg19:g.110059526A>G		121.0	0.0		90.0	54.0	NM_014845	Q53H49|Q5TCS6	Splice_Site	SNP	ENST00000230124.3	hg19	CCDS5078.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.162390	0.78226	.	.	ENSG00000112367	ENST00000230124;ENST00000454215	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0957	0.81123	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FIG4	110166219	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	8.617000	0.90927	2.199000	0.70637	0.533000	0.62120	.	.	.		0.323	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041768.1	NM_014845	Intron
BMPER	168667	hgsc.bcm.edu	37	7	34118587	34118587	+	Silent	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:34118587G>T	ENST00000297161.2	+	13	1571	c.1197G>T	c.(1195-1197)tcG>tcT	p.S399S	BMPER_ENST00000426693.1_Silent_p.S399S	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	399	VWFD. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)		p.S399S(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CCCCTGCCTCGCCCTTCCAGG	0.582																																					p.S399S		Atlas-SNP	.											BMPER,NS,carcinoma,0,1	BMPER	131	.	1	Substitution - coding silent(1)	lung(1)	c.G1197T						.						99.0	105.0	103.0					7																	34118587		2203	4300	6503	SO:0001819	synonymous_variant	168667	exon13			TGCCTCGCCCTTC		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.1197G>T	chr7.hg19:g.34118587G>T		58.0	0.0		70.0	21.0	NM_133468	A8K1P8|Q8TF36	Silent	SNP	ENST00000297161.2	hg19	CCDS5442.1																																																																																			.	.		0.582	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
TYW1	55253	hgsc.bcm.edu	37	7	66463919	66463919	+	Missense_Mutation	SNP	G	G	T	rs542889524		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:66463919G>T	ENST00000359626.5	+	3	415	c.251G>T	c.(250-252)gGt>gTt	p.G84V		NM_018264.2	NP_060734.2	Q9NV66	TYW1_HUMAN	tRNA-yW synthesizing protein 1 homolog (S. cerevisiae)	84	Flavodoxin-like. {ECO:0000255|PROSITE- ProRule:PRU00088}.				tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(8)|kidney(10)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(3)|stomach(2)|urinary_tract(2)	46		Lung NSC(55;0.0846)|all_lung(88;0.183)				ATTTTTTATGGTTCTCAGACT	0.368																																					p.G84V		Atlas-SNP	.											.	TYW1	71	.	0			c.G251T						.						115.0	111.0	112.0					7																	66463919		2203	4300	6503	SO:0001583	missense	55253	exon3			TTTATGGTTCTCA	AK001762	CCDS5538.1	7q11.21	2007-11-29	2007-11-29	2007-11-29	ENSG00000198874	ENSG00000198874			25598	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 1 homolog A (S. cerevisiae)"""	611243	"""radical S-adenosyl methionine and flavodoxin domains 1"""	RSAFD1		16162496, 17150819	Standard	NM_018264		Approved	FLJ10900, MGC23001, MGC60291, YPL207W, TYW1A	uc003tvn.4	Q9NV66	OTTHUMG00000129723	ENST00000359626.5:c.251G>T	chr7.hg19:g.66463919G>T	ENSP00000352645:p.Gly84Val	89.0	0.0		131.0	35.0	NM_018264	Q6PJG8|Q75MG8|Q75MN3|Q86V12|Q8IVS7|Q9H9C4	Missense_Mutation	SNP	ENST00000359626.5	hg19	CCDS5538.1	.	.	.	.	.	.	.	.	.	.	G	17.29	3.351430	0.61183	.	.	ENSG00000198874	ENST00000359626;ENST00000442959	T;D	0.87571	-0.15;-2.27	4.45	3.52	0.40303	Flavodoxin/nitric oxide synthase (2);	0.066589	0.64402	U	0.000013	D	0.94689	0.8287	H	0.96398	3.815	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.94988	0.8132	9	.	.	.	.	10.4509	0.44522	0.0:0.1967:0.8033:0.0	.	84	Q9NV66	TYW1_HUMAN	V	84	ENSP00000352645:G84V;ENSP00000398897:G84V	.	G	+	2	0	TYW1	66101354	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	4.002000	0.57053	2.328000	0.79073	0.563000	0.77884	GGT	.	.		0.368	TYW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251932.2	NM_018264	
PPP1R3A	5506	hgsc.bcm.edu	37	7	113519285	113519285	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:113519285C>T	ENST00000284601.3	-	4	1930	c.1862G>A	c.(1861-1863)aGa>aAa	p.R621K		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	621					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATTTCCAGTTCTTGATGAACA	0.383																																					p.R621K		Atlas-SNP	.											.	PPP1R3A	317	.	0			c.G1862A						.						94.0	92.0	92.0					7																	113519285		2203	4300	6503	SO:0001583	missense	5506	exon4			CCAGTTCTTGATG	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.1862G>A	chr7.hg19:g.113519285C>T	ENSP00000284601:p.Arg621Lys	273.0	0.0		309.0	163.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	ENST00000284601.3	hg19	CCDS5759.1	.	.	.	.	.	.	.	.	.	.	C	1.268	-0.613821	0.03690	.	.	ENSG00000154415	ENST00000284601	T	0.17528	2.27	6.02	-1.78	0.07957	.	0.538685	0.18505	N	0.139238	T	0.12390	0.0301	M	0.67953	2.075	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.30060	-0.9991	10	0.17369	T	0.5	-0.4639	2.544	0.04732	0.1062:0.2339:0.1966:0.4633	.	621	Q16821	PPR3A_HUMAN	K	621	ENSP00000284601:R621K	ENSP00000284601:R621K	R	-	2	0	PPP1R3A	113306521	0.158000	0.22850	0.683000	0.30040	0.044000	0.14063	0.130000	0.15850	-0.035000	0.13691	-0.727000	0.03589	AGA	.	.		0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
WNT2	7472	hgsc.bcm.edu	37	7	116955172	116955172	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:116955172C>T	ENST00000265441.3	-	3	840	c.541G>A	c.(541-543)Gat>Aat	p.D181N	AC002465.2_ENST00000436097.1_RNA	NM_003391.2	NP_003382.1	P09544	WNT2_HUMAN	wingless-type MMTV integration site family member 2	181					atrial cardiac muscle tissue morphogenesis (GO:0055009)|canonical Wnt signaling pathway (GO:0060070)|cardiac epithelial to mesenchymal transition (GO:0060317)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|iris morphogenesis (GO:0061072)|labyrinthine layer blood vessel development (GO:0060716)|lens development in camera-type eye (GO:0002088)|lung development (GO:0030324)|lung induction (GO:0060492)|mammary gland epithelium development (GO:0061180)|neuron differentiation (GO:0030182)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	cytokine activity (GO:0005125)|frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			breast(2)|central_nervous_system(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|liver(1)|lung(13)|ovary(3)|prostate(1)|skin(2)	31	all_epithelial(6;2.24e-06)|Lung NSC(10;0.000936)|all_lung(10;0.00109)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		GCTCTGGCAtcctttcctttc	0.463																																					p.D181N		Atlas-SNP	.											.	WNT2	56	.	0			c.G541A						.						132.0	121.0	125.0					7																	116955172		2203	4300	6503	SO:0001583	missense	7472	exon3			TGGCATCCTTTCC	X07876	CCDS5771.1	7q31	2013-02-28			ENSG00000105989	ENSG00000105989		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12780	protein-coding gene	gene with protein product	"""secreted growth factor"""	147870		INT1L1		2971536	Standard	NM_003391		Approved	IRP	uc003viz.3	P09544	OTTHUMG00000023428	ENST00000265441.3:c.541G>A	chr7.hg19:g.116955172C>T	ENSP00000265441:p.Asp181Asn	195.0	0.0		354.0	94.0	NM_003391	A4D0V1|Q75N05|Q9UDP9	Missense_Mutation	SNP	ENST00000265441.3	hg19	CCDS5771.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353979	0.82243	.	.	ENSG00000105989	ENST00000265441	T	0.76839	-1.05	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.88028	0.6327	M	0.73319	2.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.86549	0.1833	10	0.45353	T	0.12	.	20.0965	0.97849	0.0:1.0:0.0:0.0	.	181;181	A4D0V1;P09544	.;WNT2_HUMAN	N	181	ENSP00000265441:D181N	ENSP00000265441:D181N	D	-	1	0	WNT2	116742408	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.050000	0.71063	2.824000	0.97209	0.655000	0.94253	GAT	.	.		0.463	WNT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059749.3	NM_003391	
KCNH2	3757	hgsc.bcm.edu	37	7	150644109	150644109	+	Silent	SNP	A	A	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr7:150644109A>T	ENST00000262186.5	-	14	3587	c.3186T>A	c.(3184-3186)acT>acA	p.T1062T	KCNH2_ENST00000330883.4_Silent_p.T722T|KCNH2_ENST00000392968.2_Silent_p.T966T	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1062					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	GCTGCAGGACAGTGGCCATGT	0.667																																					p.T1062T	GBM(137;110 1844 13671 20123 45161)	Atlas-SNP	.											.	KCNH2	157	.	0			c.T3186A						.						40.0	43.0	42.0					7																	150644109		2203	4300	6503	SO:0001819	synonymous_variant	3757	exon14			CAGGACAGTGGCC	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3186T>A	chr7.hg19:g.150644109A>T		98.0	0.0		166.0	46.0	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Silent	SNP	ENST00000262186.5	hg19	CCDS5910.1																																																																																			.	.		0.667	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
PI15	51050	hgsc.bcm.edu	37	8	75761417	75761417	+	Missense_Mutation	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr8:75761417T>A	ENST00000260113.2	+	6	885	c.706T>A	c.(706-708)Tat>Aat	p.Y236N	PI15_ENST00000523773.1_Missense_Mutation_p.Y236N|RP11-758M4.4_ENST00000518128.1_RNA|RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000522914.1_RNA	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	236						extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			TCCTCCAAGTTATGGGGGATC	0.393																																					p.Y236N		Atlas-SNP	.											.	PI15	73	.	0			c.T706A						.						199.0	177.0	184.0					8																	75761417		2203	4300	6503	SO:0001583	missense	51050	exon6			CCAAGTTATGGGG	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.706T>A	chr8.hg19:g.75761417T>A	ENSP00000260113:p.Tyr236Asn	191.0	0.0		259.0	65.0	NM_015886	Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	hg19	CCDS6218.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.465498	0.84425	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.10099	2.91;2.91	5.15	5.15	0.70609	.	0.059145	0.64402	D	0.000001	T	0.36331	0.0963	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.14531	-1.0469	10	0.46703	T	0.11	.	15.4212	0.75011	0.0:0.0:0.0:1.0	.	236	O43692	PI15_HUMAN	N	236	ENSP00000260113:Y236N;ENSP00000428567:Y236N	ENSP00000260113:Y236N	Y	+	1	0	PI15	75923972	1.000000	0.71417	0.992000	0.48379	0.949000	0.60115	7.482000	0.81143	2.285000	0.76669	0.477000	0.44152	TAT	.	.		0.393	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886	
ANGPT1	284	hgsc.bcm.edu	37	8	108334350	108334350	+	5'UTR	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr8:108334350T>A	ENST00000520734.1	-	0	267				ANGPT1_ENST00000520052.1_5'UTR|ANGPT1_ENST00000518386.1_5'Flank			Q15389	ANGP1_HUMAN	angiopoietin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell-substrate adhesion (GO:0031589)|glomerulus vasculature development (GO:0072012)|hemopoiesis (GO:0030097)|heparin biosynthetic process (GO:0030210)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of vascular permeability (GO:0043116)|positive chemotaxis (GO:0050918)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of receptor internalization (GO:0002092)|protein localization to cell surface (GO:0034394)|regulation of satellite cell proliferation (GO:0014842)|sprouting angiogenesis (GO:0002040)|Tie signaling pathway (GO:0048014)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(13)|ovary(4)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	43	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TTTTATGTTCTAATAAACTAC	0.303																																					p.L194F		Atlas-SNP	.											.	ANGPT1	111	.	0			c.A582T						.						82.0	78.0	80.0					8																	108334350		2203	4300	6503	SO:0001623	5_prime_UTR_variant	284	exon4			ATGTTCTAATAAA	D13628	CCDS6306.1, CCDS56551.1	8q23.1	2013-02-06			ENSG00000154188	ENSG00000154188		"""Fibrinogen C domain containing"""	484	protein-coding gene	gene with protein product		601667				9545648	Standard	NM_001146		Approved	KIAA0003, Ang1	uc003ymn.3	Q15389	OTTHUMG00000164812	ENST00000520734.1:c.-19A>T	chr8.hg19:g.108334350T>A		129.0	0.0		210.0	45.0	NM_001199859	Q5HYA0	Missense_Mutation	SNP	ENST00000520734.1	hg19		.	.	.	.	.	.	.	.	.	.	T	17.54	3.414374	0.62511	.	.	ENSG00000154188	ENST00000517746;ENST00000297450;ENST00000395820	T;T	0.44881	0.91;0.91	5.77	4.61	0.57282	.	0.000000	0.56097	D	0.000027	T	0.59473	0.2196	M	0.76838	2.35	0.80722	D	1	D;D	0.64830	0.994;0.994	D;D	0.65140	0.932;0.932	T	0.61869	-0.6974	10	0.87932	D	0	.	7.4641	0.27312	0.1346:0.0711:0.0:0.7943	.	194;194	Q5HYA0;Q15389	.;ANGP1_HUMAN	F	194;194;6	ENSP00000428340:L194F;ENSP00000297450:L194F	ENSP00000297450:L194F	L	-	3	2	ANGPT1	108403526	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	2.466000	0.45084	1.017000	0.39495	0.533000	0.62120	TTA	.	.		0.303	ANGPT1-002	PUTATIVE	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000380428.2	NM_001146, NM_139290	
FER1L6	654463	hgsc.bcm.edu	37	8	125072474	125072474	+	Silent	SNP	C	C	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr8:125072474C>G	ENST00000522917.1	+	23	3134	c.2928C>G	c.(2926-2928)acC>acG	p.T976T	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6-AS2_ENST00000601180.1_RNA|FER1L6_ENST00000399018.1_Silent_p.T976T	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	976						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CAGACATCACCCAGATCTACC	0.572																																					p.T976T		Atlas-SNP	.											.	FER1L6	268	.	0			c.C2928G						.						104.0	116.0	112.0					8																	125072474		2198	4297	6495	SO:0001819	synonymous_variant	654463	exon23			CATCACCCAGATC	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2928C>G	chr8.hg19:g.125072474C>G		52.0	0.0		71.0	13.0	NM_001039112		Silent	SNP	ENST00000522917.1	hg19	CCDS43767.1																																																																																			.	.		0.572	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
ADAMTSL1	92949	hgsc.bcm.edu	37	9	18777712	18777712	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:18777712G>A	ENST00000380548.4	+	19	3824	c.3485G>A	c.(3484-3486)cGc>cAc	p.R1162H		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1162						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		AGGCCACACCGCAAGCCCACC	0.677																																					p.R1162H		Atlas-SNP	.											ADAMTSL1_ENST00000380548,NS,neuroblastoma,0,1	ADAMTSL1	306	.	0			c.G3485A						.						25.0	31.0	29.0					9																	18777712		2152	4234	6386	SO:0001583	missense	92949	exon19			CACACCGCAAGCC	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3485G>A	chr9.hg19:g.18777712G>A	ENSP00000369921:p.Arg1162His	68.0	0.0		96.0	13.0	NM_001040272	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	ENST00000380548.4	hg19	CCDS47954.1	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971403	0.53614	.	.	ENSG00000178031	ENST00000380548	T	0.63913	-0.07	6.03	6.03	0.97812	.	0.274117	0.29314	N	0.012501	T	0.53965	0.1829	L	0.29908	0.895	0.80722	D	1	D	0.60160	0.987	P	0.45232	0.474	T	0.53927	-0.8369	10	0.40728	T	0.16	.	14.1466	0.65355	0.0765:0.0:0.9235:0.0	.	1162	Q8N6G6	ATL1_HUMAN	H	1162	ENSP00000369921:R1162H	ENSP00000369921:R1162H	R	+	2	0	ADAMTSL1	18767712	0.082000	0.21442	0.998000	0.56505	0.112000	0.19704	1.951000	0.40333	2.868000	0.98415	0.557000	0.71058	CGC	.	.		0.677	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
ZNF618	114991	hgsc.bcm.edu	37	9	116731402	116731402	+	Silent	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:116731402C>T	ENST00000374126.5	+	2	138	c.39C>T	c.(37-39)gaC>gaT	p.D13D	ZNF618_ENST00000288466.7_Silent_p.D13D			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	13					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						TGCAGGCTGACGGAGCCAGTG	0.557																																					p.D13D		Atlas-SNP	.											.	ZNF618	184	.	0			c.C39T						.						134.0	149.0	144.0					9																	116731402		2016	4205	6221	SO:0001819	synonymous_variant	114991	exon2			GGCTGACGGAGCC	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.39C>T	chr9.hg19:g.116731402C>T		30.0	0.0		20.0	16.0	NM_133374	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Silent	SNP	ENST00000374126.5	hg19																																																																																				.	.		0.557	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983	
FANK1	92565	hgsc.bcm.edu	37	10	127697046	127697046	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr10:127697046G>T	ENST00000368693.1	+	8	880	c.776G>T	c.(775-777)aGg>aTg	p.R259M	FANK1_ENST00000477963.1_3'UTR|FANK1_ENST00000368695.1_Missense_Mutation_p.R253M			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	259						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GGAAATCAGAGGGTGGCCTCT	0.532																																					p.R259M		Atlas-SNP	.											.	FANK1	46	.	0			c.G776T						.						111.0	107.0	109.0					10																	127697046		2203	4300	6503	SO:0001583	missense	92565	exon8			ATCAGAGGGTGGC	BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.776G>T	chr10.hg19:g.127697046G>T	ENSP00000357682:p.Arg259Met	89.0	0.0		109.0	41.0	NM_145235	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	ENST00000368693.1	hg19	CCDS31309.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.49|11.49	1.653705|1.653705	0.29425|0.29425	.|.	.|.	ENSG00000203780|ENSG00000203780	ENST00000456942|ENST00000368695;ENST00000368693;ENST00000368691;ENST00000368692	.|T;T;T	.|0.65732	.|-0.14;-0.14;-0.17	5.62|5.62	0.54|0.54	0.17163|0.17163	.|Ankyrin repeat-containing domain (4);	.|1.429690	.|0.04021	.|N	.|0.299830	T|T	0.59649|0.59649	0.2209|0.2209	L|L	0.37507|0.37507	1.11|1.11	0.58432|0.58432	D|D	0.999997|0.999997	.|P;P;P	.|0.48016	.|0.904;0.786;0.73	.|B;B;P	.|0.44623	.|0.443;0.326;0.455	T|T	0.50898|0.50898	-0.8773|-0.8773	5|10	.|0.72032	.|D	.|0.01	-2.3728|-2.3728	11.8524|11.8524	0.52419|0.52419	0.881:0.0:0.119:0.0|0.881:0.0:0.119:0.0	.|.	.|285;259;259	.|Q8TC84-3;Q8TC84-2;Q8TC84	.|.;.;FANK1_HUMAN	W|M	154|253;259;237;285	.|ENSP00000357684:R253M;ENSP00000357682:R259M;ENSP00000357680:R237M	.|ENSP00000357680:R237M	G|R	+|+	1|2	0|0	FANK1|FANK1	127687036|127687036	0.324000|0.324000	0.24652|0.24652	0.287000|0.287000	0.24848|0.24848	0.048000|0.048000	0.14542|0.14542	0.655000|0.655000	0.24933|0.24933	-0.135000|-0.135000	0.11495|0.11495	0.655000|0.655000	0.94253|0.94253	GGG|AGG	.	.		0.532	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_145235	
IFITM5	387733	hgsc.bcm.edu	37	11	299408	299408	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:299408G>A	ENST00000382614.2	-	1	118	c.83C>T	c.(82-84)gCc>gTc	p.A28V		NM_001025295.2	NP_001020466.1	A6NNB3	IFM5_HUMAN	interferon induced transmembrane protein 5	28					bone mineralization (GO:0030282)|regulation of bone mineralization (GO:0030500)|response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.73e-28)|Epithelial(43;3.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.14e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0328)|LUSC - Lung squamous cell carcinoma(625;0.122)		GGGGTGCGGGGCCCCCAGTGT	0.682																																					p.A28V		Atlas-SNP	.											.	IFITM5	12	.	0			c.C83T						.						22.0	22.0	22.0					11																	299408		2184	4278	6462	SO:0001583	missense	387733	exon1			TGCGGGGCCCCCA	AA463818, CR747200, DY654432	CCDS31323.1	11p15.5	2010-05-12			ENSG00000206013	ENSG00000206013			16644	protein-coding gene	gene with protein product		614757				11106657, 12659663, 18442316	Standard	NM_001025295		Approved	fragilis4, Hrmp1, BRIL	uc001low.2	A6NNB3	OTTHUMG00000165355	ENST00000382614.2:c.83C>T	chr11.hg19:g.299408G>A	ENSP00000372059:p.Ala28Val	35.0	0.0		61.0	29.0	NM_001025295		Missense_Mutation	SNP	ENST00000382614.2	hg19	CCDS31323.1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262466	0.23051	.	.	ENSG00000206013	ENST00000382614	D	0.86164	-2.08	4.23	3.3	0.37823	.	0.733349	0.12020	N	0.507048	T	0.81688	0.4875	L	0.38175	1.15	0.09310	N	1	B	0.23442	0.085	B	0.25759	0.063	T	0.68135	-0.5489	10	0.33940	T	0.23	-5.7791	11.9061	0.52713	0.0:0.0:0.8239:0.1761	.	28	A6NNB3	IFM5_HUMAN	V	28	ENSP00000372059:A28V	ENSP00000372059:A28V	A	-	2	0	IFITM5	289408	0.091000	0.21658	0.001000	0.08648	0.018000	0.09664	1.957000	0.40392	0.722000	0.32252	0.561000	0.74099	GCC	.	.		0.682	IFITM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383588.1	NM_001025295	
LGR4	55366	hgsc.bcm.edu	37	11	27389536	27389536	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:27389536C>A	ENST00000379214.4	-	18	3177	c.2734G>T	c.(2734-2736)Gaa>Taa	p.E912*	LGR4_ENST00000389858.4_Nonsense_Mutation_p.E888*	NM_018490.2	NP_060960.2	Q9BXB1	LGR4_HUMAN	leucine-rich repeat containing G protein-coupled receptor 4	912					bone mineralization (GO:0030282)|bone remodeling (GO:0046849)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cell differentiation involved in metanephros development (GO:0072202)|epithelial cell proliferation (GO:0050673)|innate immune response (GO:0045087)|male genitalia development (GO:0030539)|metanephric glomerulus development (GO:0072224)|metanephric nephron tubule morphogenesis (GO:0072282)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast differentiation (GO:0001649)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(10)|ovary(1)	32						AAGGAATCTTCTTCATCTGCA	0.532																																					p.E912X		Atlas-SNP	.											.	LGR4	87	.	0			c.G2734T						.						74.0	75.0	75.0					11																	27389536		2202	4299	6501	SO:0001587	stop_gained	55366	exon18			AATCTTCTTCATC	AF257182	CCDS31449.1	11p14-p13	2012-08-21	2011-01-25	2004-11-12	ENSG00000205213	ENSG00000205213		"""GPCR / Class A : Orphans"""	13299	protein-coding gene	gene with protein product		606666	"""G protein-coupled receptor 48"", ""leucine-rich repeat-containing G protein-coupled receptor 4"""	GPR48		10894923	Standard	NM_018490		Approved		uc001mrj.4	Q9BXB1	OTTHUMG00000133508	ENST00000379214.4:c.2734G>T	chr11.hg19:g.27389536C>A	ENSP00000368516:p.Glu912*	83.0	0.0		58.0	17.0	NM_018490	A6NCH3|G5E9B3|Q8N537|Q9NYD1	Nonsense_Mutation	SNP	ENST00000379214.4	hg19	CCDS31449.1	.	.	.	.	.	.	.	.	.	.	C	43	10.343996	0.99388	.	.	ENSG00000205213	ENST00000379214;ENST00000389858	.	.	.	5.78	5.78	0.91487	.	0.261784	0.44097	D	0.000482	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	20.005	0.97433	0.0:1.0:0.0:0.0	.	.	.	.	X	912;888	.	ENSP00000368516:E912X	E	-	1	0	LGR4	27346112	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.625000	0.83145	2.745000	0.94114	0.555000	0.69702	GAA	.	.		0.532	LGR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257467.1	NM_018490	
DAGLA	747	hgsc.bcm.edu	37	11	61502408	61502408	+	Silent	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:61502408C>A	ENST00000257215.5	+	10	1178	c.1062C>A	c.(1060-1062)atC>atA	p.I354I		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	354					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CCATTGCCATCCGGCGCCACT	0.632																																					p.I354I		Atlas-SNP	.											.	DAGLA	109	.	0			c.C1062A						.						218.0	198.0	205.0					11																	61502408		2202	4299	6501	SO:0001819	synonymous_variant	747	exon10			TGCCATCCGGCGC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.1062C>A	chr11.hg19:g.61502408C>A		56.0	0.0		37.0	11.0	NM_006133	A7E233|Q6WQJ0	Silent	SNP	ENST00000257215.5	hg19	CCDS31578.1																																																																																			.	.		0.632	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
OR10G8	219869	hgsc.bcm.edu	37	11	123900948	123900948	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:123900948T>C	ENST00000431524.1	+	1	652	c.619T>C	c.(619-621)Tcg>Ccg	p.S207P		NM_001004464.1	NP_001004464.1	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G, member 8	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(7)|large_intestine(2)|lung(21)|ovary(1)|prostate(5)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	44		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		AATAGTGGCCTCGGGCTGCTT	0.537																																					p.S207P		Atlas-SNP	.											.	OR10G8	132	.	0			c.T619C						.						193.0	169.0	177.0					11																	123900948		2201	4299	6500	SO:0001583	missense	219869	exon1			GTGGCCTCGGGCT	AB065755	CCDS31704.1	11q24.1	2012-08-09			ENSG00000234560	ENSG00000234560		"""GPCR / Class A : Olfactory receptors"""	14845	protein-coding gene	gene with protein product							Standard	NM_001004464		Approved		uc001pzp.1	Q8NGN5	OTTHUMG00000165968	ENST00000431524.1:c.619T>C	chr11.hg19:g.123900948T>C	ENSP00000389072:p.Ser207Pro	246.0	0.0		215.0	95.0	NM_001004464	B2RNJ3|Q6IEV2	Missense_Mutation	SNP	ENST00000431524.1	hg19	CCDS31704.1	.	.	.	.	.	.	.	.	.	.	T	10.03	1.239663	0.22711	.	.	ENSG00000234560	ENST00000431524	T	0.37584	1.19	2.91	2.91	0.33838	GPCR, rhodopsin-like superfamily (1);	0.953949	0.08599	N	0.921764	T	0.41971	0.1182	N	0.12961	0.28	0.09310	N	1	D	0.53151	0.958	D	0.65573	0.936	T	0.42783	-0.9431	10	0.72032	D	0.01	.	11.0743	0.48021	0.0:0.0:0.0:1.0	.	207	Q8NGN5	O10G8_HUMAN	P	207	ENSP00000389072:S207P	ENSP00000389072:S207P	S	+	1	0	OR10G8	123406158	0.000000	0.05858	0.780000	0.31762	0.263000	0.26337	0.369000	0.20416	1.319000	0.45190	0.455000	0.32223	TCG	.	.		0.537	OR10G8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387270.1	NM_001004464	
FOXRED1	55572	hgsc.bcm.edu	37	11	126145999	126145999	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr11:126145999A>G	ENST00000263578.5	+	8	930	c.856A>G	c.(856-858)Att>Gtt	p.I286V	FOXRED1_ENST00000442061.2_Missense_Mutation_p.I116V|FOXRED1_ENST00000534011.1_3'UTR|FOXRED1_ENST00000532125.1_Missense_Mutation_p.I272V	NM_017547.3	NP_060017.1	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing 1	286						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)		GGAATGCGCCATTGTGATCAA	0.642																																					p.I286V		Atlas-SNP	.											.	FOXRED1	38	.	0			c.A856G						.						32.0	30.0	31.0					11																	126145999		2201	4295	6496	SO:0001583	missense	55572	exon8			TGCGCCATTGTGA		CCDS8471.1	11q24.2	2006-02-03			ENSG00000110074	ENSG00000110074			26927	protein-coding gene	gene with protein product		613622				10497265	Standard	NM_017547		Approved	H17	uc001qdi.3	Q96CU9	OTTHUMG00000165827	ENST00000263578.5:c.856A>G	chr11.hg19:g.126145999A>G	ENSP00000263578:p.Ile286Val	94.0	0.0		81.0	25.0	NM_017547	B3KN84|B4DHU2|Q71MG0|Q9BU39|Q9UKY9	Missense_Mutation	SNP	ENST00000263578.5	hg19	CCDS8471.1	.	.	.	.	.	.	.	.	.	.	A	7.716	0.696190	0.15106	.	.	ENSG00000110074	ENST00000263578;ENST00000442061;ENST00000532125	T;T;T	0.80653	-1.4;-1.4;-1.4	5.61	-4.83	0.03161	FAD dependent oxidoreductase (1);	0.654096	0.16038	N	0.232524	T	0.49355	0.1552	N	0.05230	-0.09	0.22096	N	0.999364	B;B;B	0.13145	0.001;0.007;0.001	B;B;B	0.22753	0.002;0.041;0.002	T	0.51442	-0.8705	10	0.06757	T	0.87	-1.6918	4.9131	0.13833	0.2152:0.4994:0.1921:0.0933	.	272;153;286	Q96CU9-3;B4DI59;Q96CU9	.;.;FXRD1_HUMAN	V	286;116;272	ENSP00000263578:I286V;ENSP00000404371:I116V;ENSP00000434178:I272V	ENSP00000263578:I286V	I	+	1	0	FOXRED1	125651209	0.004000	0.15560	0.071000	0.20095	0.665000	0.39181	-1.127000	0.03251	-0.798000	0.04444	-1.834000	0.00590	ATT	.	.		0.642	FOXRED1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386434.1	NM_017547	
ADCY6	112	hgsc.bcm.edu	37	12	49176704	49176704	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:49176704C>A	ENST00000307885.4	-	1	1208	c.514G>T	c.(514-516)Gca>Tca	p.A172S	ADCY6_ENST00000550422.1_Missense_Mutation_p.A172S|ADCY6_ENST00000357869.3_Missense_Mutation_p.A172S	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	172					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						CGGGCGGGTGCGGCGTGGAAA	0.647																																					p.A172S		Atlas-SNP	.											ADCY6,bladder,carcinoma,0,1	ADCY6	81	.	0			c.G514T						.						33.0	34.0	34.0					12																	49176704		2203	4300	6503	SO:0001583	missense	112	exon2			CGGGTGCGGCGTG		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.514G>T	chr12.hg19:g.49176704C>A	ENSP00000311405:p.Ala172Ser	43.0	0.0		52.0	23.0	NM_020983	Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	hg19	CCDS8767.1	.	.	.	.	.	.	.	.	.	.	C	4.574	0.106554	0.08780	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	T;T;T	0.23754	1.89;1.89;1.89	5.36	5.36	0.76844	.	0.587296	0.16428	N	0.214838	T	0.14960	0.0361	N	0.11201	0.11	0.09310	N	1	B;B	0.18863	0.031;0.002	B;B	0.20184	0.028;0.003	T	0.13469	-1.0508	10	0.33940	T	0.23	.	11.3629	0.49655	0.0:0.9154:0.0:0.0846	.	172;172	O43306-2;O43306	.;ADCY6_HUMAN	S	172	ENSP00000350536:A172S;ENSP00000446730:A172S;ENSP00000311405:A172S	ENSP00000311405:A172S	A	-	1	0	ADCY6	47462971	0.003000	0.15002	0.130000	0.21974	0.136000	0.21042	1.090000	0.30902	2.515000	0.84797	0.462000	0.41574	GCA	.	.		0.647	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
HNRNPA1	3178	hgsc.bcm.edu	37	12	54676893	54676893	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:54676893C>G	ENST00000340913.6	+	8	835	c.782C>G	c.(781-783)tCt>tGt	p.S261C	HNRNPA1_ENST00000547276.1_Intron|HNRNPA1_ENST00000546500.1_Intron|HNRNPA1_ENST00000330752.8_Intron|RP11-968A15.8_ENST00000553061.1_RNA	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	261	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						CCTGGTTACTCTGGAGGAAGC	0.488																																					p.S261C	Colon(83;502 1289 8436 16406 24870)	Atlas-SNP	.											.	HNRNPA1	72	.	0			c.C782G						.						55.0	57.0	56.0					12																	54676893		2005	4171	6176	SO:0001583	missense	3178	exon8			GTTACTCTGGAGG	BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.782C>G	chr12.hg19:g.54676893C>G	ENSP00000341826:p.Ser261Cys	71.0	0.0		81.0	34.0	NM_031157	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	ENST00000340913.6	hg19	CCDS44909.1	.	.	.	.	.	.	.	.	.	.	C	11.31	1.600276	0.28534	.	.	ENSG00000135486	ENST00000340913	D	0.88818	-2.43	3.87	2.98	0.34508	.	.	.	.	.	D	0.85869	0.5797	L	0.55213	1.73	0.80722	D	1	P	0.46064	0.872	P	0.45071	0.468	T	0.83188	-0.0085	9	0.41790	T	0.15	.	7.6131	0.28142	0.0:0.8837:0.0:0.1163	.	261	P09651	ROA1_HUMAN	C	261	ENSP00000341826:S261C	ENSP00000341826:S261C	S	+	2	0	HNRNPA1	52963160	0.992000	0.36948	1.000000	0.80357	0.981000	0.71138	1.421000	0.34815	1.222000	0.43521	0.305000	0.20034	TCT	.	.		0.488	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405480.1	NM_031157	
ANO4	121601	hgsc.bcm.edu	37	12	101520844	101520844	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:101520844C>A	ENST00000392977.3	+	27	3074	c.2864C>A	c.(2863-2865)cCg>cAg	p.P955Q	ANO4_ENST00000550015.1_Missense_Mutation_p.P475Q|ANO4_ENST00000299222.9_Missense_Mutation_p.P475Q|ANO4_ENST00000392979.3_Missense_Mutation_p.P920Q			Q32M45	ANO4_HUMAN	anoctamin 4	955					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.P920L(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						AACGAGTGGCCGTGACCATGT	0.483										HNSCC(74;0.22)																											p.P920Q		Atlas-SNP	.											ANO4,rectum,carcinoma,0,1	ANO4	183	.	1	Substitution - Missense(1)	large_intestine(1)	c.C2759A						.						97.0	66.0	76.0					12																	101520844		2203	4300	6503	SO:0001583	missense	121601	exon26			AGTGGCCGTGACC	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2864C>A	chr12.hg19:g.101520844C>A	ENSP00000376703:p.Pro955Gln	87.0	0.0		73.0	26.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	hg19		.	.	.	.	.	.	.	.	.	.	C	25.2	4.614633	0.87359	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.72282	-0.59;-0.33;-0.64;-0.33	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.78039	0.4221	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80165	-0.1496	10	0.87932	D	0	.	19.9299	0.97115	0.0:1.0:0.0:0.0	.	475;955;920	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	Q	920;475;955;475	ENSP00000376705:P920Q;ENSP00000299222:P475Q;ENSP00000376703:P955Q;ENSP00000450192:P475Q	ENSP00000299222:P475Q	P	+	2	0	ANO4	100044975	1.000000	0.71417	0.972000	0.41901	0.680000	0.39746	7.772000	0.85439	2.769000	0.95229	0.655000	0.94253	CCG	.	.		0.483	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
KSR2	283455	hgsc.bcm.edu	37	12	118298110	118298110	+	Nonsense_Mutation	SNP	T	T	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr12:118298110T>A	ENST00000339824.5	-	2	1034	c.307A>T	c.(307-309)Aag>Tag	p.K103*	KSR2_ENST00000425217.1_Nonsense_Mutation_p.K74*			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	103					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					AGGACCTCCTTGCGCACATCG	0.632																																					p.K74X		Atlas-SNP	.											.	KSR2	208	.	0			c.A220T						.						57.0	61.0	60.0					12																	118298110		1568	3582	5150	SO:0001587	stop_gained	283455	exon2			CCTCCTTGCGCAC	AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.307A>T	chr12.hg19:g.118298110T>A	ENSP00000339952:p.Lys103*	24.0	0.0		23.0	8.0	NM_173598	A0PJT2|Q3B828|Q8N775	Nonsense_Mutation	SNP	ENST00000339824.5	hg19		.	.	.	.	.	.	.	.	.	.	T	35	5.493094	0.96339	.	.	ENSG00000171435	ENST00000425217;ENST00000339824	.	.	.	4.54	2.09	0.27110	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.5154	0.22244	0.0:0.0849:0.1567:0.7585	.	.	.	.	X	74;103	.	ENSP00000339952:K103X	K	-	1	0	KSR2	116782493	1.000000	0.71417	0.999000	0.59377	0.712000	0.41017	3.307000	0.51888	0.332000	0.23536	0.260000	0.18958	AAG	.	.		0.632	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000401987.2	NM_173598	
ZNF410	57862	hgsc.bcm.edu	37	14	74363143	74363143	+	Silent	SNP	G	G	A	rs150263864		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:74363143G>A	ENST00000555044.1	+	4	488	c.294G>A	c.(292-294)ccG>ccA	p.P98P	ZNF410_ENST00000412490.3_3'UTR|RP5-1021I20.5_ENST00000554009.1_RNA|ZNF410_ENST00000324593.6_Silent_p.P98P|RP5-1021I20.4_ENST00000556551.2_3'UTR|ZNF410_ENST00000442160.3_Silent_p.P115P|ZNF410_ENST00000334521.4_Silent_p.P45P|ZNF410_ENST00000540593.1_Intron|ZNF410_ENST00000556797.1_Silent_p.P45P	NM_001242928.1|NM_021188.2	NP_001229857.1|NP_067011.1	Q86VK4	ZN410_HUMAN	zinc finger protein 410	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	13				BRCA - Breast invasive adenocarcinoma(234;0.00369)		AGAAATCCCCGGAGTTTTTGT	0.478																																					p.P115P		Atlas-SNP	.											.	ZNF410	25	.	0			c.G345A						.	G	,,,,	1,4405	2.1+/-5.4	0,1,2202	137.0	132.0	133.0		345,294,,,294	-10.4	0.4	14	dbSNP_134	133	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,intron,utr-5,coding-synonymous	ZNF410	NM_001242924.1,NM_001242926.1,NM_001242927.1,NM_001242928.1,NM_021188.2	,,,,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,,,	115/517,98/432,,,98/479	74363143	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57862	exon5			ATCCCCGGAGTTT	U90919	CCDS9821.1, CCDS55929.1, CCDS55930.1, CCDS55931.1	14q24.3	2013-01-08				ENSG00000119725		"""Zinc fingers, C2H2-type"""	20144	protein-coding gene	gene with protein product						12370286	Standard	NM_001242924		Approved	APA1, APA-1	uc010arz.2	Q86VK4		ENST00000555044.1:c.294G>A	chr14.hg19:g.74363143G>A		100.0	0.0		122.0	33.0	NM_001242924	B4DDV5|B4DR78|O00153|Q9BQ19	Silent	SNP	ENST00000555044.1	hg19	CCDS9821.1	.	.	.	.	.	.	.	.	.	.	G	6.079	0.382894	0.11524	2.27E-4	0.0	ENSG00000119725	ENST00000458102	.	.	.	5.3	-10.4	0.00318	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999997	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.2662	0.31815	0.6921:0.0737:0.1204:0.1138	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF410	73432896	0.026000	0.19158	0.400000	0.26346	0.160000	0.22226	-1.039000	0.03550	-2.003000	0.00962	-0.948000	0.02665	.	.	G|1.000;A|0.000		0.478	ZNF410-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412597.1	NM_021188	
GSTZ1	2954	hgsc.bcm.edu	37	14	77796672	77796672	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:77796672G>T	ENST00000556627.1	+	7	544	c.413G>T	c.(412-414)tGc>tTc	p.C138F	GSTZ1_ENST00000393734.1_Missense_Mutation_p.C110F|GSTZ1_ENST00000554279.1_Missense_Mutation_p.C151F|GSTZ1_ENST00000216465.5_Missense_Mutation_p.C165F|GSTZ1_ENST00000557053.1_Missense_Mutation_p.C68F|GSTZ1_ENST00000557639.1_Missense_Mutation_p.C110F|GSTZ1_ENST00000553586.1_Missense_Mutation_p.C166F|GSTZ1_ENST00000361389.4_Missense_Mutation_p.C110F|GSTZ1_ENST00000349555.3_Missense_Mutation_p.C123F			O43708	MAAI_HUMAN	glutathione S-transferase zeta 1	165	GST C-terminal.				cellular nitrogen compound metabolic process (GO:0034641)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|L-phenylalanine catabolic process (GO:0006559)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	glutathione peroxidase activity (GO:0004602)|glutathione transferase activity (GO:0004364)|maleylacetoacetate isomerase activity (GO:0016034)|protein homodimerization activity (GO:0042803)			lung(2)|prostate(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)	Glutathione(DB00143)	GCTGATCTGTGCTTGGTGCCT	0.612																																					p.C165F		Atlas-SNP	.											.	GSTZ1	35	.	0			c.G494T						.						196.0	173.0	180.0					14																	77796672		2203	4300	6503	SO:0001583	missense	2954	exon8			ATCTGTGCTTGGT	U86529	CCDS9858.1, CCDS9859.1, CCDS9860.1	14q24.3	2012-06-22	2012-06-22		ENSG00000100577	ENSG00000100577	5.2.1.2, 2.5.1.18	"""Glutathione S-transferases / Soluble"""	4643	protein-coding gene	gene with protein product	"""maleylacetoacetate isomerase"""	603758	"""glutathione transferase zeta 1"""			9396740, 9417084	Standard	NM_001513		Approved	GSTZ1-1, MAAI, MAI	uc001xtj.3	O43708	OTTHUMG00000171551	ENST00000556627.1:c.413G>T	chr14.hg19:g.77796672G>T	ENSP00000450487:p.Cys138Phe	79.0	0.0		72.0	27.0	NM_145870	A6NED0|A6NNB8|A8MWD7|B2RCK3|O15308|O75430|Q6IB17|Q7Z610|Q9BV63	Missense_Mutation	SNP	ENST00000556627.1	hg19		.	.	.	.	.	.	.	.	.	.	G	18.00	3.524815	0.64747	.	.	ENSG00000100577	ENST00000216465;ENST00000361389;ENST00000554279;ENST00000557639;ENST00000349555;ENST00000556627;ENST00000557053;ENST00000393734;ENST00000553586	T;T;T;T;T;T;T;T;T	0.01998	4.51;4.51;4.51;4.51;4.51;4.51;4.51;4.51;4.51	5.62	5.62	0.85841	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.05686	0.0149	L	0.55017	1.72	0.80722	D	1	P;D	0.56035	0.763;0.974	P;P	0.48627	0.582;0.584	T	0.35992	-0.9766	10	0.45353	T	0.12	-0.1006	16.5453	0.84444	0.0:0.0:1.0:0.0	.	123;165	A6NED0;O43708	.;MAAI_HUMAN	F	165;110;151;110;123;138;68;110;166	ENSP00000216465:C165F;ENSP00000354959:C110F;ENSP00000452498:C151F;ENSP00000451927:C110F;ENSP00000314404:C123F;ENSP00000450487:C138F;ENSP00000451150:C68F;ENSP00000377335:C110F;ENSP00000451976:C166F	ENSP00000216465:C165F	C	+	2	0	GSTZ1	76866425	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	6.841000	0.75374	2.648000	0.89879	0.462000	0.41574	TGC	.	.		0.612	GSTZ1-012	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000414090.1	NM_145870	
BTBD7	55727	hgsc.bcm.edu	37	14	93720038	93720038	+	Silent	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr14:93720038G>T	ENST00000334746.5	-	7	2014	c.1707C>A	c.(1705-1707)atC>atA	p.I569I	BTBD7_ENST00000554565.1_Silent_p.I218I|BTBD7_ENST00000393170.2_Silent_p.I143I	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	569					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GACGAACATAGATGCCAGCAT	0.403																																					p.I569I		Atlas-SNP	.											.	BTBD7	112	.	0			c.C1707A						.						172.0	155.0	161.0					14																	93720038		2203	4300	6503	SO:0001819	synonymous_variant	55727	exon7			AACATAGATGCCA	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1707C>A	chr14.hg19:g.93720038G>T		72.0	0.0		90.0	33.0	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Silent	SNP	ENST00000334746.5	hg19	CCDS32146.1																																																																																			.	.		0.403	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
ICE2	79664	hgsc.bcm.edu	37	15	60740303	60740303	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr15:60740303C>T	ENST00000261520.4	-	11	2395	c.2161G>A	c.(2161-2163)Gaa>Aaa	p.E721K	NARG2_ENST00000439632.1_Missense_Mutation_p.E584K	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						GCTAGGTATTCCGATGTATCT	0.368																																					p.E721K		Atlas-SNP	.											.	NARG2	82	.	0			c.G2161A						.						75.0	71.0	73.0					15																	60740303		2203	4300	6503	SO:0001583	missense	79664	exon11			GGTATTCCGATGT																												ENST00000261520.4:c.2161G>A	chr15.hg19:g.60740303C>T	ENSP00000261520:p.Glu721Lys	62.0	0.0		77.0	31.0	NM_024611		Missense_Mutation	SNP	ENST00000261520.4	hg19	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819076	0.90873	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.99	5.02	0.67125	NMDA receptor-regulated gene protein 2 (1);	0.096319	0.64402	D	0.000001	T	0.66416	0.2787	L	0.44542	1.39	0.39315	D	0.96514	D	0.63046	0.992	D	0.63192	0.912	T	0.69179	-0.5213	9	0.72032	D	0.01	-28.0583	14.1784	0.65557	0.0:0.8508:0.1492:0.0	.	721	Q659A1	NARG2_HUMAN	K	721;584	.	ENSP00000261520:E721K	E	-	1	0	NARG2	58527595	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	1.964000	0.40462	2.831000	0.97527	0.650000	0.86243	GAA	.	.		0.368	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
AXIN1	8312	hgsc.bcm.edu	37	16	360070	360070	+	Splice_Site	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr16:360070C>A	ENST00000262320.3	-	4	1391		c.e4-1		AXIN1_ENST00000354866.3_Splice_Site|AXIN1_ENST00000481769.1_Splice_Site	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1						activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				GATCCCATCCCTGTCCAGGAG	0.627																																					.		Atlas-SNP	.											.	AXIN1	290	.	0			c.1020-1G>T						.						50.0	34.0	39.0					16																	360070		2201	4300	6501	SO:0001630	splice_region_variant	8312	exon5			CCATCCCTGTCCA	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.1020-1G>T	chr16.hg19:g.360070C>A		35.0	0.0		24.0	12.0	NM_181050	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Splice_Site	SNP	ENST00000262320.3	hg19	CCDS10405.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150069	0.37923	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9963	0.89185	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AXIN1	300071	1.000000	0.71417	0.995000	0.50966	0.058000	0.15608	7.310000	0.78947	2.257000	0.74773	0.456000	0.33151	.	.	.		0.627	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		Intron
PRPF8	10594	hgsc.bcm.edu	37	17	1580416	1580416	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:1580416A>T	ENST00000572621.1	-	14	2300	c.2035T>A	c.(2035-2037)Tca>Aca	p.S679T	PRPF8_ENST00000304992.6_Missense_Mutation_p.S679T			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	679					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TCAAAATGTGACTCCACTCGC	0.512																																					p.S679T		Atlas-SNP	.											.	PRPF8	169	.	0			c.T2035A						.						167.0	141.0	150.0					17																	1580416		2203	4300	6503	SO:0001583	missense	10594	exon15			AATGTGACTCCAC	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.2035T>A	chr17.hg19:g.1580416A>T	ENSP00000460348:p.Ser679Thr	53.0	0.0		59.0	21.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	hg19	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	A	15.59	2.879960	0.51801	.	.	ENSG00000174231	ENST00000304992	D	0.83335	-1.71	5.94	5.94	0.96194	PROCN (1);	0.000000	0.85682	D	0.000000	D	0.89677	0.6784	M	0.76838	2.35	0.80722	D	1	D	0.55800	0.973	P	0.60068	0.868	D	0.88651	0.3182	10	0.33940	T	0.23	.	16.3951	0.83601	1.0:0.0:0.0:0.0	.	679	Q6P2Q9	PRP8_HUMAN	T	679	ENSP00000304350:S679T	ENSP00000304350:S679T	S	-	1	0	PRPF8	1527166	1.000000	0.71417	0.982000	0.44146	0.566000	0.35808	9.297000	0.96120	2.272000	0.75746	0.460000	0.39030	TCA	.	.		0.512	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
TP53	7157	hgsc.bcm.edu	37	17	7577022	7577022	+	Nonsense_Mutation	SNP	G	G	A	rs121913344		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:7577022G>A	ENST00000269305.4	-	8	1105	c.916C>T	c.(916-918)Cga>Tga	p.R306*	TP53_ENST00000445888.2_Nonsense_Mutation_p.R306*|TP53_ENST00000455263.2_Nonsense_Mutation_p.R306*|TP53_ENST00000359597.4_Nonsense_Mutation_p.R306*|TP53_ENST00000420246.2_Nonsense_Mutation_p.R306*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	306	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.		R -> P (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R306*(133)|p.0?(8)|p.?(3)|p.R306fs*39(2)|p.K305fs*1(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGCTTACCTCGCTTAGTGCTC	0.562	R306*(HCC1937_BREAST)|R306*(JURLMK1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(MFE296_ENDOMETRIUM)|R306*(MOLT4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R306*(RCM1_LARGE_INTESTINE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R306X	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,adenocarcinoma,0,166	TP53	33396	.	147	Substitution - Nonsense(133)|Whole gene deletion(8)|Unknown(3)|Deletion - Frameshift(2)|Insertion - Frameshift(1)	large_intestine(39)|breast(21)|upper_aerodigestive_tract(15)|ovary(11)|central_nervous_system(10)|oesophagus(10)|stomach(8)|lung(8)|endometrium(6)|bone(4)|pancreas(3)|haematopoietic_and_lymphoid_tissue(3)|biliary_tract(3)|kidney(2)|NS(2)|urinary_tract(1)|liver(1)	c.C916T	GRCh37	CM971506	TP53	M	rs121913344	.						120.0	106.0	110.0					17																	7577022		2203	4300	6503	SO:0001587	stop_gained	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TACCTCGCTTAGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.916C>T	chr17.hg19:g.7577022G>A	ENSP00000269305:p.Arg306*	64.0	1.0		39.0	21.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782988	0.90282	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	3.21	0.36854	.	1.348720	0.05032	N	0.474808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.4785	0.44678	0.0:0.0:0.6334:0.3666	.	.	.	.	X	306;306;306;306;306;295;174	.	ENSP00000269305:R306X	R	-	1	2	TP53	7517747	1.000000	0.71417	0.970000	0.41538	0.345000	0.29048	2.280000	0.43443	0.735000	0.32537	0.561000	0.74099	CGA	.	.		0.562	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
TMEM88	92162	hgsc.bcm.edu	37	17	7758491	7758491	+	Silent	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:7758491C>T	ENST00000301599.6	+	1	109	c.99C>T	c.(97-99)gcC>gcT	p.A33A	CYB5D1_ENST00000570446.1_5'Flank|CYB5D1_ENST00000571846.1_5'Flank|CYB5D1_ENST00000332439.4_5'Flank|LSMD1_ENST00000570555.1_5'Flank|TMEM88_ENST00000574668.1_Silent_p.A33A	NM_203411.1	NP_981956.1	Q6PEY1	TMM88_HUMAN	transmembrane protein 88	33					multicellular organismal development (GO:0007275)|Wnt signaling pathway (GO:0016055)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				lung(1)	1		all_cancers(10;0.00528)|Prostate(122;0.202)				TTGTAACAGCCCAGAATCTGC	0.637																																					p.A33A		Atlas-SNP	.											.	TMEM88	6	.	0			c.C99T						.						75.0	68.0	71.0					17																	7758491		2203	4300	6503	SO:0001819	synonymous_variant	92162	exon1			AACAGCCCAGAAT	BC057812	CCDS11121.1	17p13.1	2005-12-13				ENSG00000167874			32371	protein-coding gene	gene with protein product							Standard	NM_203411		Approved	MGC71744, FLJ20025	uc002giy.3	Q6PEY1		ENST00000301599.6:c.99C>T	chr17.hg19:g.7758491C>T		46.0	0.0		25.0	18.0	NM_203411		Silent	SNP	ENST00000301599.6	hg19	CCDS11121.1																																																																																			.	.		0.637	TMEM88-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440252.1	NM_203411	
CHD3	1107	hgsc.bcm.edu	37	17	7811224	7811224	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:7811224G>T	ENST00000330494.7	+	34	5189	c.5039G>T	c.(5038-5040)gGt>gTt	p.G1680V	CHD3_ENST00000380358.4_Missense_Mutation_p.G1739V|SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000358181.4_Missense_Mutation_p.G1646V	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1680	Required for interaction with PCNT.				centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GATGTAAAAGGTGACCGGGAG	0.547																																					p.G1739V		Atlas-SNP	.											.	CHD3	169	.	0			c.G5216T						.						81.0	73.0	76.0					17																	7811224		2203	4300	6503	SO:0001583	missense	1107	exon34			TAAAAGGTGACCG	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.5039G>T	chr17.hg19:g.7811224G>T	ENSP00000332628:p.Gly1680Val	74.0	0.0		24.0	15.0	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	hg19	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.611752	0.28712	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494;ENST00000439235	D;D;D	0.90069	-2.61;-2.53;-2.54	4.65	-0.0728	0.13738	.	0.156126	0.29900	N	0.010920	T	0.67249	0.2873	N	0.08118	0	0.46586	D	0.999116	B;P;B;B	0.37864	0.01;0.61;0.019;0.013	B;B;B;B	0.32864	0.003;0.154;0.006;0.003	T	0.56450	-0.7977	10	0.30078	T	0.28	-11.2383	0.5219	0.00613	0.2433:0.1397:0.218:0.399	.	257;1646;1680;1739	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	V	1739;1646;1680;8	ENSP00000369716:G1739V;ENSP00000350907:G1646V;ENSP00000332628:G1680V	ENSP00000332628:G1680V	G	+	2	0	CHD3	7751949	0.078000	0.21339	0.949000	0.38748	0.883000	0.51084	0.246000	0.18160	0.170000	0.19704	-0.314000	0.08810	GGT	.	.		0.547	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
ODF4	146852	hgsc.bcm.edu	37	17	8243610	8243610	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:8243610C>T	ENST00000328248.2	+	1	429	c.241C>T	c.(241-243)Cag>Tag	p.Q81*	ODF4_ENST00000584943.1_Intron|RP11-849F2.4_ENST00000585275.1_lincRNA	NM_153007.4	NP_694552.2	Q2M2E3	ODFP4_HUMAN	outer dense fiber of sperm tails 4	81					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|outer dense fiber (GO:0001520)				endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|stomach(1)	8						CTGGATGGCCCAGGTGTTGGC	0.562																																					p.Q81X		Atlas-SNP	.											.	ODF4	23	.	0			c.C241T						.						65.0	57.0	60.0					17																	8243610		2203	4300	6503	SO:0001587	stop_gained	146852	exon1			ATGGCCCAGGTGT	AB081120	CCDS11140.1	17p13	2010-09-27			ENSG00000184650	ENSG00000184650			19056	protein-coding gene	gene with protein product	"""cancer/testis antigen 136"""	610097					Standard	NM_153007		Approved	OPPO1, CT136	uc002gle.1	Q2M2E3	OTTHUMG00000108190	ENST00000328248.2:c.241C>T	chr17.hg19:g.8243610C>T	ENSP00000331086:p.Gln81*	67.0	0.0		41.0	28.0	NM_153007	Q8J021	Nonsense_Mutation	SNP	ENST00000328248.2	hg19	CCDS11140.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202207	0.79127	.	.	ENSG00000184650	ENST00000328248	.	.	.	4.89	3.86	0.44501	.	0.164598	0.29314	N	0.012508	.	.	.	.	.	.	0.21386	N	0.999706	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-18.6581	9.4822	0.38908	0.2263:0.7737:0.0:0.0	.	.	.	.	X	81	.	ENSP00000331086:Q81X	Q	+	1	0	ODF4	8184335	0.713000	0.27926	0.208000	0.23602	0.013000	0.08279	1.788000	0.38714	2.526000	0.85167	0.655000	0.94253	CAG	.	.		0.562	ODF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226996.1		
SLFN14	342618	hgsc.bcm.edu	37	17	33884944	33884944	+	Silent	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:33884944G>T	ENST00000415846.3	-	1	173	c.138C>A	c.(136-138)atC>atA	p.I46I		NM_001129820.1	NP_001123292.1	P0C7P3	SLN14_HUMAN	schlafen family member 14	46							ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(3)	9						ATATAGCCCGGATAATTCTAG	0.408																																					p.I46I		Atlas-SNP	.											.	SLFN14	43	.	0			c.C138A						.						128.0	103.0	110.0					17																	33884944		692	1591	2283	SO:0001819	synonymous_variant	342618	exon1			AGCCCGGATAATT		CCDS45650.1	17q12	2009-09-22				ENSG00000236320			32689	protein-coding gene	gene with protein product		614958				9846487	Standard	NM_001129820		Approved		uc010ctu.1	P0C7P3		ENST00000415846.3:c.138C>A	chr17.hg19:g.33884944G>T		137.0	0.0		152.0	61.0	NM_001129820	B2RTW9	Silent	SNP	ENST00000415846.3	hg19	CCDS45650.1																																																																																			.	.		0.408	SLFN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448928.1	NM_001129820	
GOSR2	9570	hgsc.bcm.edu	37	17	45015970	45015970	+	Silent	SNP	T	T	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:45015970T>G	ENST00000393456.2	+	6	540	c.483T>G	c.(481-483)acT>acG	p.T161T	GOSR2_ENST00000576910.2_Silent_p.T114T|GOSR2_ENST00000439730.2_Silent_p.T161T|RP11-156P1.2_ENST00000571841.1_Silent_p.T161T|GOSR2_ENST00000225567.4_Silent_p.T161T	NM_004287.3	NP_004278.2	O14653	GOSR2_HUMAN	golgi SNAP receptor complex member 2	161					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|skin(1)	7			BRCA - Breast invasive adenocarcinoma(9;0.102)			CCCAGGGGACTCAGAAGAAGA	0.478																																					p.T161T		Atlas-SNP	.											.	GOSR2	38	.	0			c.T483G						.						265.0	266.0	266.0					17																	45015970		2203	4300	6503	SO:0001819	synonymous_variant	9570	exon6			GGGGACTCAGAAG	AF007548	CCDS11507.1, CCDS42355.1, CCDS45719.1	17q21	2006-02-10				ENSG00000108433			4431	protein-coding gene	gene with protein product		604027				9349823, 10198168	Standard	XM_005257843		Approved	GS27, Bos1	uc002ikz.3	O14653		ENST00000393456.2:c.483T>G	chr17.hg19:g.45015970T>G		69.0	0.0		68.0	22.0	NM_004287	D3DXJ5|D3DXJ6|Q8N4B8|Q96DA5|Q9BZZ4	Silent	SNP	ENST00000393456.2	hg19	CCDS42355.1																																																																																			.	.		0.478	GOSR2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440438.1		
UNC13D	201294	hgsc.bcm.edu	37	17	73840324	73840324	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr17:73840324G>A	ENST00000207549.4	-	1	474	c.95C>T	c.(94-96)cCc>cTc	p.P32L	UNC13D_ENST00000412096.2_Missense_Mutation_p.P32L|UNC13D_ENST00000587504.1_5'Flank	NM_199242.2	NP_954712.1	Q70J99	UN13D_HUMAN	unc-13 homolog D (C. elegans)	32					defense response to virus (GO:0051607)|germinal center formation (GO:0002467)|granuloma formation (GO:0002432)|natural killer cell degranulation (GO:0043320)|phagocytosis (GO:0006909)|positive regulation of exocytosis (GO:0045921)|regulation of mast cell degranulation (GO:0043304)	endosome (GO:0005768)|exocytic vesicle (GO:0070382)|lysosome (GO:0005764)|membrane (GO:0016020)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTGGGGCGGGGGATCCTGTAG	0.652									Familial Hemophagocytic Lymphohistiocytosis																												p.P32L		Atlas-SNP	.											.	UNC13D	68	.	0			c.C95T						.						43.0	49.0	47.0					17																	73840324		2202	4300	6502	SO:0001583	missense	201294	exon1	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GGCGGGGGATCCT	AK024474	CCDS11730.1	17q25.3	2014-09-17				ENSG00000092929			23147	protein-coding gene	gene with protein product		608897					Standard	NM_199242		Approved	Munc13-4	uc002jpp.3	Q70J99		ENST00000207549.4:c.95C>T	chr17.hg19:g.73840324G>A	ENSP00000207549:p.Pro32Leu	27.0	0.0		21.0	10.0	NM_199242	B4DWG9|Q9H7K5	Missense_Mutation	SNP	ENST00000207549.4	hg19	CCDS11730.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644735	0.29246	.	.	ENSG00000092929	ENST00000207549;ENST00000412096;ENST00000448606	T;T	0.70164	-0.43;-0.46	4.04	2.0	0.26442	.	0.495999	0.17124	N	0.186104	T	0.54447	0.1859	L	0.48642	1.525	0.09310	N	1	B	0.27823	0.19	B	0.24155	0.051	T	0.50684	-0.8799	10	0.72032	D	0.01	-0.5365	6.5283	0.22312	0.2264:0.0:0.7736:0.0	.	32	Q70J99	UN13D_HUMAN	L	32	ENSP00000207549:P32L;ENSP00000388093:P32L	ENSP00000207549:P32L	P	-	2	0	UNC13D	71351919	0.397000	0.25270	0.000000	0.03702	0.497000	0.33675	1.716000	0.37981	0.369000	0.24510	0.561000	0.74099	CCC	.	.		0.652	UNC13D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448847.2	XM_113950	
POTEC	388468	hgsc.bcm.edu	37	18	14542851	14542851	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr18:14542851C>A	ENST00000358970.5	-	1	294	c.295G>T	c.(295-297)Ggc>Tgc	p.G99C	POTEC_ENST00000389891.4_5'UTR	NM_001137671.1	NP_001131143.1	B2RU33	POTEC_HUMAN	POTE ankyrin domain family, member C	99										NS(2)|breast(1)|endometrium(9)|kidney(13)|lung(14)|prostate(3)|skin(6)|soft_tissue(1)|urinary_tract(3)	52						CACCACTTGCCCATCTTGCTC	0.622																																					p.G99C		Atlas-SNP	.											POTEC,NS,carcinoma,0,1	POTEC	129	.	0			c.G295T						.						39.0	45.0	43.0					18																	14542851		692	1591	2283	SO:0001583	missense	388468	exon1			ACTTGCCCATCTT	BX649118	CCDS45835.1	18p11.21	2013-01-10	2008-11-26	2008-11-26	ENSG00000183206	ENSG00000183206		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33894	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 6"""		"""ANKRD26-like family B, member 2"""	A26B2			Standard	NM_001137671		Approved	POTE18, POTE-18, DKFZp686J0529, CT104.6	uc010dln.3	B2RU33	OTTHUMG00000162963	ENST00000358970.5:c.295G>T	chr18.hg19:g.14542851C>A	ENSP00000351856:p.Gly99Cys	247.0	0.0		268.0	91.0	NM_001137671		Missense_Mutation	SNP	ENST00000358970.5	hg19	CCDS45835.1	.	.	.	.	.	.	.	.	.	.	C	5.295	0.239815	0.10023	.	.	ENSG00000183206	ENST00000358970;ENST00000389891	T	0.37915	1.17	0.399	0.399	0.16325	.	.	.	.	.	T	0.35913	0.0948	L	0.39898	1.24	0.09310	N	1	D	0.55172	0.97	P	0.51487	0.671	T	0.19451	-1.0305	8	0.66056	D	0.02	.	.	.	.	.	99	B2RU33	POTEC_HUMAN	C	99	ENSP00000351856:G99C	ENSP00000351856:G99C	G	-	1	0	POTEC	14532851	0.000000	0.05858	0.010000	0.14722	0.029000	0.11900	-0.174000	0.09839	0.448000	0.26722	0.175000	0.17021	GGC	.	.		0.622	POTEC-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371179.1	XM_496269	
TCF4	6925	hgsc.bcm.edu	37	18	52901914	52901914	+	Splice_Site	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr18:52901914C>T	ENST00000356073.4	-	16	1962	c.1351G>A	c.(1351-1353)Gtg>Atg	p.V451M	TCF4_ENST00000564228.1_Splice_Site_p.V380M|TCF4_ENST00000566286.1_Splice_Site_p.V448M|TCF4_ENST00000544241.2_Splice_Site_p.V380M|TCF4_ENST00000567880.1_Splice_Site_p.V391M|TCF4_ENST00000537856.3_Splice_Site_p.V321M|TCF4_ENST00000543082.1_Splice_Site_p.V409M|TCF4_ENST00000570177.2_Splice_Site_p.V321M|TCF4_ENST00000561992.1_Splice_Site_p.V321M|TCF4_ENST00000398339.1_Splice_Site_p.V553M|TCF4_ENST00000564403.2_Splice_Site_p.V457M|TCF4_ENST00000537578.1_Splice_Site_p.V427M|TCF4_ENST00000354452.3_Splice_Site_p.V451M|TCF4_ENST00000568673.1_Splice_Site_p.V427M|TCF4_ENST00000566279.1_Splice_Site_p.V391M|TCF4_ENST00000565018.2_Splice_Site_p.V451M|TCF4_ENST00000457482.3_Splice_Site_p.V291M|TCF4_ENST00000570287.2_Splice_Site_p.V291M|TCF4_ENST00000540999.1_Splice_Site_p.V427M|TCF4_ENST00000561831.3_Splice_Site_p.V291M|TCF4_ENST00000568740.1_Splice_Site_p.V426M|TCF4_ENST00000564999.1_Splice_Site_p.V451M	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	451					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		TGGGTCCCCACCTGAAAGGGC	0.567											OREG0024990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V553M		Atlas-SNP	.											.	TCF4	178	.	0			c.G1657A						.						77.0	81.0	80.0					18																	52901914		2203	4300	6503	SO:0001630	splice_region_variant	6925	exon17			TCCCCACCTGAAA	M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1351-1G>A	chr18.hg19:g.52901914C>T		45.0	0.0	988	27.0	16.0	NM_001243226	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	ENST00000356073.4	hg19	CCDS11960.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537000	0.65085	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.79621	0.4477	L	0.56396	1.775	0.80722	D	1	P;D;D;D;D;P;P;P;D	0.89917	0.928;0.995;1.0;0.993;0.968;0.935;0.935;0.815;0.994	P;D;D;D;P;P;P;B;D	0.80764	0.737;0.965;0.994;0.943;0.652;0.737;0.737;0.387;0.986	T	0.78239	-0.2281	10	0.45353	T	0.12	-2.8082	18.3978	0.90504	0.0:1.0:0.0:0.0	.	427;451;291;553;451;409;380;291;448	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	M	451;291;451;409;427;427;380;321;553	ENSP00000346440:V451M;ENSP00000409447:V291M;ENSP00000348374:V451M;ENSP00000439656:V409M;ENSP00000445202:V427M;ENSP00000440731:V427M;ENSP00000441562:V380M;ENSP00000439827:V321M;ENSP00000381382:V553M	ENSP00000346440:V451M	V	-	1	0	TCF4	51052912	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	6.414000	0.73318	2.723000	0.93209	0.563000	0.77884	GTG	.	.		0.567	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256014.1	NM_003199	Missense_Mutation
NETO1	81832	hgsc.bcm.edu	37	18	70417752	70417752	+	Silent	SNP	G	G	A	rs145217972		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr18:70417752G>A	ENST00000327305.6	-	9	1743	c.1086C>T	c.(1084-1086)atC>atT	p.I362I	NETO1_ENST00000583169.1_Silent_p.I362I|NETO1_ENST00000299430.2_Silent_p.I361I|RNA5SP460_ENST00000516789.1_RNA	NM_138966.3	NP_620416	Q8TDF5	NETO1_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 1	362					memory (GO:0007613)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|receptor localization to synapse (GO:0097120)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|visual learning (GO:0008542)	cell junction (GO:0030054)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				NS(3)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(36)|ovary(2)|prostate(3)|skin(3)|stomach(1)	63		Esophageal squamous(42;0.129)		READ - Rectum adenocarcinoma(1;0.0487)		TGATCTGTACGATGACAGAGA	0.453																																					p.I362I		Atlas-SNP	.											.	NETO1	178	.	0			c.C1086T						.	G	,	1,4405	2.1+/-5.4	0,1,2202	94.0	79.0	84.0		1086,1086	-5.1	1.0	18	dbSNP_134	84	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	NETO1	NM_001201465.1,NM_138966.3	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	362/534,362/534	70417752	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	81832	exon9			CTGTACGATGACA	AF448838	CCDS12000.1, CCDS42444.1	18q22.2	2008-08-01			ENSG00000166342	ENSG00000166342			13823	protein-coding gene	gene with protein product		607973				11943477, 12810072	Standard	NM_138999		Approved	BTCL1, BCTL1	uc002lkw.3	Q8TDF5	OTTHUMG00000132834	ENST00000327305.6:c.1086C>T	chr18.hg19:g.70417752G>A		58.0	0.0		71.0	21.0	NM_001201465	Q86W85|Q8ND78|Q8TDF4	Silent	SNP	ENST00000327305.6	hg19	CCDS12000.1																																																																																			.	G|1.000;A|0.000		0.453	NETO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256301.2	NM_138999	
MUC16	94025	hgsc.bcm.edu	37	19	9057255	9057255	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:9057255G>T	ENST00000397910.4	-	3	30394	c.30191C>A	c.(30190-30192)aCa>aAa	p.T10064K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10066	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCTGTGCTTGTGTCTGTAGT	0.468																																					p.T10064K		Atlas-SNP	.											.	MUC16	4315	.	0			c.C30191A						.						93.0	85.0	87.0					19																	9057255		1963	4172	6135	SO:0001583	missense	94025	exon3			GTGCTTGTGTCTG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.30191C>A	chr19.hg19:g.9057255G>T	ENSP00000381008:p.Thr10064Lys	110.0	0.0		90.0	45.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	2.945	-0.218029	0.06101	.	.	ENSG00000181143	ENST00000397910	T	0.23348	1.91	2.35	-2.18	0.07037	.	.	.	.	.	T	0.14570	0.0352	N	0.19112	0.55	.	.	.	B	0.20550	0.046	B	0.26416	0.069	T	0.26430	-1.0103	8	0.87932	D	0	.	4.6718	0.12692	0.305:0.2249:0.4701:0.0	.	10064	B5ME49	.	K	10064	ENSP00000381008:T10064K	ENSP00000381008:T10064K	T	-	2	0	MUC16	8918255	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.161000	0.10026	-0.743000	0.04784	-1.595000	0.00837	ACA	.	.		0.468	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CACNA1A	773	hgsc.bcm.edu	37	19	13387893	13387893	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:13387893A>G	ENST00000360228.5	-	23	3871	c.3872T>C	c.(3871-3873)aTg>aCg	p.M1291T	CACNA1A_ENST00000573710.2_Missense_Mutation_p.M1292T	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1292					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CTTGATCACCATCTCAAAGGT	0.453											OREG0025295	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.M1292T		Atlas-SNP	.											.	CACNA1A	715	.	0			c.T3875C						.						105.0	94.0	98.0					19																	13387893		1909	4123	6032	SO:0001583	missense	773	exon23			ATCACCATCTCAA	U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.3872T>C	chr19.hg19:g.13387893A>G	ENSP00000353362:p.Met1291Thr	48.0	0.0	687	55.0	17.0	NM_001127221	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	ENST00000360228.5	hg19	CCDS45998.1	.	.	.	.	.	.	.	.	.	.	A	13.47	2.247403	0.39697	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.97575	-4.44	4.54	4.54	0.55810	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97663	0.9234	M	0.63843	1.955	0.58432	D	0.999999	D;D;D	0.76494	0.996;0.999;0.961	D;D;P	0.69142	0.952;0.962;0.584	D	0.98239	1.0487	10	0.87932	D	0	.	12.8714	0.57966	1.0:0.0:0.0:0.0	.	1292;1295;1291	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	T	1291;1295;1292;1292	ENSP00000353362:M1291T	ENSP00000317661:M1292T	M	-	2	0	CACNA1A	13248893	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	8.712000	0.91403	1.690000	0.51089	0.482000	0.46254	ATG	.	.		0.453	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000104062.2	NM_000068	
KIAA0355	9710	hgsc.bcm.edu	37	19	34810943	34810943	+	Silent	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:34810943C>T	ENST00000299505.6	+	3	1500	c.627C>T	c.(625-627)ggC>ggT	p.G209G		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	209										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					AGAACAGCGGCAGTGGCGGCG	0.562																																					p.G209G		Atlas-SNP	.											.	KIAA0355	105	.	0			c.C627T						.						85.0	82.0	83.0					19																	34810943		2203	4300	6503	SO:0001819	synonymous_variant	9710	exon3			CAGCGGCAGTGGC		CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.627C>T	chr19.hg19:g.34810943C>T		107.0	0.0		95.0	41.0	NM_014686	Q2M3W4	Silent	SNP	ENST00000299505.6	hg19	CCDS12436.1																																																																																			.	.		0.562	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451678.4	NM_014686	
NUP62	23636	hgsc.bcm.edu	37	19	50411919	50411919	+	Silent	SNP	C	C	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:50411919C>A	ENST00000596217.1	-	2	3033	c.1146G>T	c.(1144-1146)gtG>gtT	p.V382V	NUP62_ENST00000597029.1_Silent_p.V382V|NUP62_ENST00000413454.1_Silent_p.V382V|NUP62_ENST00000597723.1_Silent_p.V306V|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000422090.2_Silent_p.V382V|IL4I1_ENST00000341114.3_Intron|NUP62_ENST00000352066.3_Silent_p.V382V|NUP62_ENST00000600583.1_5'Flank			P37198	NUP62_HUMAN	nucleoporin 62kDa	382					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GGTCCAGCTTCACCTTCTCCA	0.607																																					p.V382V		Atlas-SNP	.											.	NUP62	50	.	0			c.G1146T						.						112.0	106.0	108.0					19																	50411919		2203	4300	6503	SO:0001819	synonymous_variant	23636	exon3			CAGCTTCACCTTC	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.1146G>T	chr19.hg19:g.50411919C>A		54.0	0.0		58.0	22.0	NM_153719	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Silent	SNP	ENST00000596217.1	hg19	CCDS12788.1																																																																																			.	.		0.607	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
P2RX6	9127	hgsc.bcm.edu	37	22	21380718	21380718	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr22:21380718C>T	ENST00000413302.2	+	12	1286	c.1138C>T	c.(1138-1140)Ccg>Tcg	p.P380S	P2RX6_ENST00000336296.2_Missense_Mutation_p.P370S|P2RX6_ENST00000402329.3_3'UTR|P2RX6_ENST00000443995.3_Missense_Mutation_p.P327S|P2RX6_ENST00000401443.1_Missense_Mutation_p.P354S			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6	380					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										GGCCAAGGCCCCGAAAGCAAC	0.632																																					p.P380S		Atlas-SNP	.											.	.	.	.	0			c.C1138T						.						42.0	38.0	39.0					22																	21380718		2202	4296	6498	SO:0001583	missense	9127	exon12			AAGGCCCCGAAAG		CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689	ENST00000413302.2:c.1138C>T	chr22.hg19:g.21380718C>T	ENSP00000416193:p.Pro380Ser	65.0	0.0		57.0	19.0	NM_005446	F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	Missense_Mutation	SNP	ENST00000413302.2	hg19	CCDS13788.2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.091536	0.76756	.	.	ENSG00000099957	ENST00000413302;ENST00000336296;ENST00000401443;ENST00000443995	T;T;T;T	0.03920	3.76;3.76;3.76;3.76	4.54	3.53	0.40419	.	0.000000	0.53938	D	0.000043	T	0.13200	0.0320	L	0.59436	1.845	0.23758	N	0.996924	D;P	0.76494	0.999;0.551	D;B	0.70935	0.971;0.209	T	0.06570	-1.0819	10	0.27082	T	0.32	-9.0567	8.801	0.34909	0.0:0.8993:0.0:0.1007	.	380;354	O15547;F6V3D7	P2RX6_HUMAN;.	S	380;370;354;327	ENSP00000416193:P380S;ENSP00000338797:P370S;ENSP00000385309:P354S;ENSP00000408088:P327S	ENSP00000338797:P370S	P	+	1	0	P2RX6	19710718	0.136000	0.22515	0.512000	0.27736	0.659000	0.38960	3.664000	0.54525	1.506000	0.48736	0.655000	0.94253	CCG	.	.		0.632	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319625.2	NM_005446	
MAPK1	5594	hgsc.bcm.edu	37	22	22160192	22160192	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr22:22160192G>A	ENST00000215832.6	-	3	627	c.439C>T	c.(439-441)Cac>Tac	p.H147Y	MAPK1_ENST00000398822.3_Missense_Mutation_p.H147Y|MAPK1_ENST00000544786.1_Missense_Mutation_p.H147Y	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	147	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	AGGTCACGGTGCAGAACGTTA	0.428																																					p.H147Y		Atlas-SNP	.											.	MAPK1	38	.	0			c.C439T						.						200.0	179.0	186.0					22																	22160192		2203	4300	6503	SO:0001583	missense	5594	exon3			CACGGTGCAGAAC	M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.439C>T	chr22.hg19:g.22160192G>A	ENSP00000215832:p.His147Tyr	156.0	0.0		135.0	46.0	NM_002745	A8CZ64	Missense_Mutation	SNP	ENST00000215832.6	hg19	CCDS13795.1	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444037	0.83993	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.72051	-0.62;-0.62;-0.62	4.77	3.76	0.43208	Serine/threonine-protein kinase-like domain (1);MAP kinase, conserved site (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046654	0.85682	N	0.000000	D	0.87120	0.6098	M	0.93678	3.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90244	0.4288	10	0.87932	D	0	-7.6907	13.3578	0.60638	0.0765:0.0:0.9235:0.0	.	147;147	A8CZ64;P28482	.;MK01_HUMAN	Y	147;135;147;147	ENSP00000215832:H147Y;ENSP00000381803:H147Y;ENSP00000440842:H147Y	ENSP00000215832:H147Y	H	-	1	0	MAPK1	20490192	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.640000	0.98453	1.374000	0.46228	0.650000	0.86243	CAC	.	.		0.428	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000075396.2		
BRD1	23774	hgsc.bcm.edu	37	22	50169766	50169766	+	Missense_Mutation	SNP	C	C	T	rs540212211		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr22:50169766C>T	ENST00000216267.8	-	10	3256	c.2770G>A	c.(2770-2772)Gcc>Acc	p.A924T	BRD1_ENST00000542442.1_Missense_Mutation_p.A612T|BRD1_ENST00000404760.1_Missense_Mutation_p.A1055T|BRD1_ENST00000457780.2_3'UTR|BRD1_ENST00000342989.5_Missense_Mutation_p.A650T|BRD1_ENST00000404034.1_Missense_Mutation_p.A924T	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	924					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		AGCACCGAGGCGGCGGCATCA	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		11138	0.0		0.0	False		,,,				2504	0.001				p.A924T		Atlas-SNP	.											.	BRD1	144	.	0			c.G2770A						.						52.0	48.0	49.0					22																	50169766		2203	4300	6503	SO:0001583	missense	23774	exon10			CCGAGGCGGCGGC	AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.2770G>A	chr22.hg19:g.50169766C>T	ENSP00000216267:p.Ala924Thr	7.0	0.0		12.0	7.0	NM_014577	A6ZJA4	Missense_Mutation	SNP	ENST00000216267.8	hg19	CCDS14080.1	.	.	.	.	.	.	.	.	.	.	C	6.565	0.472478	0.12461	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000542442;ENST00000342989;ENST00000419212	T;T;T;T;T	0.26223	2.68;2.68;2.67;1.75;2.13	4.45	4.45	0.53987	.	0.208414	0.50627	D	0.000106	T	0.10165	0.0249	N	0.04043	-0.29	0.80722	D	1	B;B;B;B	0.14012	0.001;0.009;0.001;0.001	B;B;B;B	0.04013	0.001;0.001;0.0;0.001	T	0.19451	-1.0305	10	0.12766	T	0.61	.	8.5562	0.33483	0.0:0.8571:0.0:0.1429	.	1055;650;924;1055	Q86X06;B7Z926;O95696;O95696-2	.;.;BRD1_HUMAN;.	T	924;924;1055;612;650;515	ENSP00000216267:A924T;ENSP00000384076:A924T;ENSP00000385858:A1055T;ENSP00000437514:A612T;ENSP00000345886:A650T	ENSP00000216267:A924T	A	-	1	0	BRD1	48555770	0.963000	0.33076	0.942000	0.38095	0.012000	0.07955	1.992000	0.40737	2.304000	0.77564	0.585000	0.79938	GCC	.	.		0.692	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317402.1	NM_014577	
RGAG1	57529	hgsc.bcm.edu	37	X	109695878	109695878	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrX:109695878C>T	ENST00000465301.2	+	3	2279	c.2033C>T	c.(2032-2034)gCa>gTa	p.A678V	RGAG1_ENST00000540313.1_Missense_Mutation_p.A678V	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	678										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GCTTCTGGAGCAATGTCCACA	0.507																																					p.A678V		Atlas-SNP	.											.	RGAG1	168	.	0			c.C2033T						.						109.0	90.0	97.0					X																	109695878		2203	4300	6503	SO:0001583	missense	57529	exon3			CTGGAGCAATGTC	AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2033C>T	chrX.hg19:g.109695878C>T	ENSP00000419786:p.Ala678Val	79.0	0.0		48.0	38.0	NM_020769	Q9P2M8	Missense_Mutation	SNP	ENST00000465301.2	hg19	CCDS14552.1	.	.	.	.	.	.	.	.	.	.	C	4.134	0.023173	0.08006	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.50001	0.76;0.76	4.08	-1.83	0.07833	.	1.573820	0.04513	N	0.383154	T	0.33030	0.0849	L	0.34521	1.04	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.11060	-1.0603	9	.	.	.	2.2927	4.7846	0.13219	0.1646:0.3668:0.0:0.4686	.	678	Q8NET4	RGAG1_HUMAN	V	678	ENSP00000419786:A678V;ENSP00000441452:A678V	.	A	+	2	0	RGAG1	109582534	0.001000	0.12720	0.000000	0.03702	0.348000	0.29142	-0.810000	0.04505	-0.564000	0.06070	0.600000	0.82982	GCA	.	.		0.507	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057906.2	NM_020769	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130219933	130219933	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrX:130219933G>T	ENST00000276211.5	+	9	1496	c.1151G>T	c.(1150-1152)gGa>gTa	p.G384V	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.G248V|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.G372V	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	384	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						TTGGTGTTTGGATCTGCTCTC	0.478																																					p.G384V		Atlas-SNP	.											.	ARHGAP36	171	.	0			c.G1151T						.						245.0	232.0	236.0					X																	130219933		2203	4300	6503	SO:0001583	missense	158763	exon9			TGTTTGGATCTGC		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1151G>T	chrX.hg19:g.130219933G>T	ENSP00000276211:p.Gly384Val	80.0	0.0		80.0	61.0	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	hg19	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	G	14.42	2.530778	0.45073	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	4.71	4.71	0.59529	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.43416	D	0.000578	T	0.74581	0.3735	M	0.93507	3.425	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.81086	-0.1092	10	0.87932	D	0	.	11.8103	0.52179	0.0:0.0:1.0:0.0	.	353;372;384	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	V	384;372;353;248	ENSP00000276211:G384V;ENSP00000359960:G372V;ENSP00000408515:G353V;ENSP00000359959:G248V	ENSP00000276211:G384V	G	+	2	0	ARHGAP36	130047614	1.000000	0.71417	1.000000	0.80357	0.415000	0.31203	6.835000	0.75344	2.170000	0.68504	0.529000	0.55759	GGA	.	.		0.478	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
USP9Y	8287	hgsc.bcm.edu	37	Y	14968377	14968377	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chrY:14968377G>T	ENST00000338981.3	+	43	8122	c.7177G>T	c.(7177-7179)Gta>Tta	p.V2393L	USP9Y_ENST00000426564.2_3'UTR	NM_004654.3	NP_004645.2	O00507	USP9Y_HUMAN	ubiquitin specific peptidase 9, Y-linked	2393					BMP signaling pathway (GO:0030509)|protein deubiquitination (GO:0016579)|spermatogenesis (GO:0007283)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)	co-SMAD binding (GO:0070410)|cysteine-type peptidase activity (GO:0008234)|ubiquitin-specific protease activity (GO:0004843)			kidney(1)|large_intestine(8)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						AAAATGTATGGTAGCTCTATT	0.383																																					p.V2393L		Atlas-SNP	.											.	USP9Y	49	.	0			c.G7177T						.						79.0	85.0	84.0					Y																	14968377		604	1939	2543	SO:0001583	missense	8287	exon43			TGTATGGTAGCTC	Y13618	CCDS14781.1	Yq11.2	2010-04-09	2009-03-17		ENSG00000114374	ENSG00000114374		"""Ubiquitin-specific peptidases"""	12633	protein-coding gene	gene with protein product	"""fat facets-like homolog (Drosophila)"""	400005	"""ubiquitin specific peptidase 9, Y-linked (fat facets-like, Drosophila)"""			8922996, 9384609, 19246359	Standard	NM_004654		Approved	DFFRY	uc004fst.1	O00507	OTTHUMG00000036469	ENST00000338981.3:c.7177G>T	chrY.hg19:g.14968377G>T	ENSP00000342812:p.Val2393Leu	118.0	0.0		92.0	75.0	NM_004654	O14601	Missense_Mutation	SNP	ENST00000338981.3	hg19	CCDS14781.1	.	.	.	.	.	.	.	.	.	.	-	13.72	2.321304	0.41096	.	.	ENSG00000114374	ENST00000453031	.	.	.	2.34	2.34	0.29019	.	.	.	.	.	T	0.56761	0.2007	M	0.76328	2.33	.	.	.	.	.	.	.	.	.	T	0.60031	-0.7342	3	.	.	.	.	.	.	.	.	.	.	.	C	74	.	.	W	+	3	0	USP9Y	13477771	1.000000	0.71417	1.000000	0.80357	0.117000	0.20001	8.981000	0.93465	1.336000	0.45506	0.271000	0.19318	TGG	.	.		0.383	USP9Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088703.2	NM_004654	
NEFH	4744	hgsc.bcm.edu	37	22	29885586	29885587	+	In_Frame_Ins	INS	-	-	AGTCCCCTGAGAAGGCCA	rs200984527|rs267607533		TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr22:29885586_29885587insAGTCCCCTGAGAAGGCCA	ENST00000310624.6	+	4	1990_1991	c.1957_1958insAGTCCCCTGAGAAGGCCA	c.(1957-1959)aag>aAGTCCCCTGAGAAGGCCAag	p.653_653K>KSPEKAK		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	659	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						TGAGAAGGCCAAGTCCCCAGAG	0.564																																					p.K653delinsKSPEKAK		Atlas-INDEL	.											.,1	NEFH	178	.	0			c.1957_1958insAGTCCCCTGAGAAGGCCA						.																																			SO:0001652	inframe_insertion	4744	exon4			.		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1940_1957dupAGTCCCCTGAGAAGGCCA	chr22.hg19:g.29885586_29885587insAGTCCCCTGAGAAGGCCA	ENSP00000311997:p.SerProGluLysAlaLys653dup	103.0	0.0		111.0	69.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	In_Frame_Ins	INS	ENST00000310624.6	hg19	CCDS13858.1																																																																																			.	.		0.564	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
SHANK1	50944	hgsc.bcm.edu	37	19	51169520	51169526	+	Frame_Shift_Del	DEL	CCCACTG	CCCACTG	-			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	CCCACTG	CCCACTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr19:51169520_51169526delCCCACTG	ENST00000293441.1	-	22	5709_5715	c.5691_5697delCAGTGGG	c.(5689-5697)ggcagtgggfs	p.GSG1897fs	SHANK1_ENST00000359082.3_Frame_Shift_Del_p.GSG1888fs|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000391814.1_Frame_Shift_Del_p.GSG1905fs|SHANK1_ENST00000391813.1_Frame_Shift_Del_p.GSG1284fs	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1897	Poly-Gly.				adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CTCCGCCTCCCCCACTGCCTCCTCGGG	0.662																																					p.1898_1900del		Atlas-Indel,Pindel	.											.	SHANK1	210	.	0			c.5692_5698del						.																																			SO:0001589	frameshift_variant	50944	exon22			.	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5691_5697delCAGTGGG	chr19.hg19:g.51169520_51169526delCCCACTG	ENSP00000293441:p.Gly1897fs	33.0	0.0		42.0	19.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Frame_Shift_Del	DEL	ENST00000293441.1	hg19	CCDS12799.1																																																																																			.	.		0.662	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
KIF14	9928	hgsc.bcm.edu	37	1	200587131	200587131	+	Frame_Shift_Del	DEL	G	G	-			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr1:200587131delG	ENST00000367350.4	-	2	1159	c.721delC	c.(721-723)cagfs	p.Q241fs		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	241	Required for PRC1-binding.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						AACTTGCTCTGAGTAGGTTTC	0.383																																					p.Q241fs		Atlas-Indel,Pindel	.											.	KIF14	156	.	0			c.722delA						.						168.0	172.0	171.0					1																	200587131		2203	4300	6503	SO:0001589	frameshift_variant	9928	exon2			.	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.721delC	chr1.hg19:g.200587131delG	ENSP00000356319:p.Gln241fs	156.0	0.0		135.0	56.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Frame_Shift_Del	DEL	ENST00000367350.4	hg19	CCDS30963.1																																																																																			.	.		0.383	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
TSC1	7248	hgsc.bcm.edu	37	9	135786464	135786464	+	Frame_Shift_Del	DEL	T	T	-			TCGA-FV-A3R2-01A-11D-A22F-10	TCGA-FV-A3R2-11A-11D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b9098b7c-eab0-4ef5-b968-8d3024bf32f7	3600db40-c4e6-463b-89f9-a95454c88e2b	g.chr9:135786464delT	ENST00000298552.3	-	11	1287	c.1066delA	c.(1066-1068)accfs	p.T357fs	TSC1_ENST00000545250.1_Frame_Shift_Del_p.T306fs|TSC1_ENST00000440111.2_Frame_Shift_Del_p.T357fs	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	357					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		GGAGGAGTGGTCATACCACAA	0.438			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.T356fs		Atlas-Indel,Pindel	.	yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	TSC1,NS,neuroblastoma,0,1	TSC1	167	.	1	Unknown(1)	bone(1)	c.1067delC						.						618.0	584.0	596.0					9																	135786464		2203	4300	6503	SO:0001589	frameshift_variant	7248	exon11	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	.	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.1066delA	chr9.hg19:g.135786464delT	ENSP00000298552:p.Thr357fs	86.0	0.0		49.0	28.0	NM_001162426	B7Z897|Q5VVN5	Frame_Shift_Del	DEL	ENST00000298552.3	hg19	CCDS6956.1																																																																																			.	.		0.438	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054799.1		
