#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
NEK2	4751	hgsc.bcm.edu	37	1	211848801	211848801	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr1:211848801G>T	ENST00000366999.4	-	1	159	c.21C>A	c.(19-21)gaC>gaA	p.D7E	NEK2_ENST00000540251.1_Intron|NEK2_ENST00000366998.3_Missense_Mutation_p.D7E|RP11-122M14.1_ENST00000415202.1_RNA	NM_002497.3	NP_002488.1	P51955	NEK2_HUMAN	NIMA-related kinase 2	7					blastocyst development (GO:0001824)|centrosome separation (GO:0051299)|chromosome segregation (GO:0007059)|G2/M transition of mitotic cell cycle (GO:0000086)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of centriole-centriole cohesion (GO:1903126)|negative regulation of DNA binding (GO:0043392)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of mitosis (GO:0007088)|regulation of mitotic centrosome separation (GO:0046602)|spindle assembly (GO:0051225)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|microtubule (GO:0005874)|midbody (GO:0030496)|nucleus (GO:0005634)|protein complex (GO:0043234)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|stomach(1)	3				OV - Ovarian serous cystadenocarcinoma(81;0.00203)|all cancers(67;0.0339)|Epithelial(68;0.0546)		ACACTTCATAGTCCTCAGCCC	0.647																																					p.D7E		Atlas-SNP	.											.	NEK2	49	.	0			c.C21A						.						62.0	62.0	62.0					1																	211848801		2203	4300	6503	SO:0001583	missense	4751	exon1			TTCATAGTCCTCA	U11050	CCDS1500.1, CCDS55682.1, CCDS73024.1	1q32.3	2014-06-12	2012-11-15		ENSG00000117650	ENSG00000117650			7745	protein-coding gene	gene with protein product	"""HsPK 21"", ""protein phosphatase 1, regulatory subunit 111"""	604043	"""NIMA (never in mitosis gene a)-related kinase 2"""			8274451, 24043777	Standard	NM_002497		Approved	NLK1, NEK2A, RP67, PPP1R111	uc001hir.2	P51955	OTTHUMG00000037121	ENST00000366999.4:c.21C>A	chr1.hg19:g.211848801G>T	ENSP00000355966:p.Asp7Glu	80.0	0.0		67.0	10.0	NM_002497	Q53FD6|Q5I1Z9|Q5VXZ1|Q6NZX8|Q7Z634|Q86XH2|Q96QN9	Missense_Mutation	SNP	ENST00000366999.4	hg19	CCDS1500.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035155	0.75617	.	.	ENSG00000117650	ENST00000366999;ENST00000366998	T;T	0.25749	1.78;1.78	5.35	5.35	0.76521	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.29652	0.0740	M	0.68317	2.08	0.80722	D	1	P;P;P	0.40083	0.525;0.578;0.702	B;B;B	0.40636	0.205;0.18;0.335	T	0.01409	-1.1362	10	0.25106	T	0.35	.	12.8788	0.58006	0.074:0.0:0.926:0.0	.	7;7;7	P51955-2;P51955;P51955-4	.;NEK2_HUMAN;.	E	7	ENSP00000355966:D7E;ENSP00000355965:D7E	ENSP00000355965:D7E	D	-	3	2	NEK2	209915424	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.547000	0.45786	2.941000	0.99782	0.655000	0.94253	GAC	.	.		0.647	NEK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090154.1	NM_002497	
FMN2	56776	hgsc.bcm.edu	37	1	240371393	240371393	+	Missense_Mutation	SNP	C	C	A	rs201701711		TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr1:240371393C>A	ENST00000319653.9	+	5	3511	c.3281C>A	c.(3280-3282)gCg>gAg	p.A1094E		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1094	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CTACCCGGAGCGGGCATACCC	0.731																																					p.A1094E		Atlas-SNP	.											.	FMN2	451	.	0			c.C3281A						.						5.0	7.0	6.0					1																	240371393		1888	3892	5780	SO:0001583	missense	56776	exon5			CCGGAGCGGGCAT	AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3281C>A	chr1.hg19:g.240371393C>A	ENSP00000318884:p.Ala1094Glu	76.0	0.0		58.0	13.0	NM_020066	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	ENST00000319653.9	hg19	CCDS31069.2	.	.	.	.	.	.	.	.	.	.	c	7.269	0.606854	0.14002	.	.	ENSG00000155816	ENST00000319653	T	0.59083	0.29	3.16	-1.05	0.10036	Actin-binding FH2/DRF autoregulatory (1);Formin Homology 1 (2);	2.671950	0.01759	N	0.030419	T	0.42988	0.1227	L	0.33189	0.99	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.05869	-1.0859	9	.	.	.	.	3.0177	0.06065	0.364:0.3658:0.0:0.2702	.	1094	Q9NZ56	FMN2_HUMAN	E	1094	ENSP00000318884:A1094E	.	A	+	2	0	FMN2	238438016	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.328000	0.01112	-0.352000	0.08237	-0.350000	0.07774	GCG	.	C|0.999;T|0.001		0.731	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096217.2	XM_371352	
GLI2	2736	hgsc.bcm.edu	37	2	121747077	121747077	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr2:121747077G>A	ENST00000452319.1	+	14	3647	c.3587G>A	c.(3586-3588)gGg>gAg	p.G1196E	GLI2_ENST00000314490.11_Intron|GLI2_ENST00000361492.4_Missense_Mutation_p.G1196E					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GCTAGCCCTGGGGGCCTGGAC	0.672																																					p.G1196E		Atlas-SNP	.											.	GLI2	187	.	0			c.G3587A						.						13.0	17.0	15.0					2																	121747077		2182	4252	6434	SO:0001583	missense	2736	exon13			GCCCTGGGGGCCT		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3587G>A	chr2.hg19:g.121747077G>A	ENSP00000390436:p.Gly1196Glu	63.0	0.0		78.0	19.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	hg19	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	G	4.102	0.016996	0.07959	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.13196	2.61;2.61	4.72	2.81	0.32909	.	0.692268	0.14606	N	0.309348	T	0.09024	0.0223	L	0.41236	1.265	0.09310	N	1	B;P	0.36535	0.421;0.557	B;B	0.31101	0.058;0.124	T	0.22138	-1.0225	9	.	.	.	.	5.287	0.15706	0.1455:0.0:0.5539:0.3006	.	1196;851	P10070;P10070-2	GLI2_HUMAN;.	E	1196	ENSP00000390436:G1196E;ENSP00000354586:G1196E	.	G	+	2	0	GLI2	121463547	0.005000	0.15991	0.002000	0.10522	0.088000	0.18126	0.755000	0.26405	1.176000	0.42840	0.449000	0.29647	GGG	.	.		0.672	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
PTPN23	25930	hgsc.bcm.edu	37	3	47452056	47452056	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr3:47452056C>T	ENST00000265562.4	+	20	2845	c.2768C>T	c.(2767-2769)aCc>aTc	p.T923I	PTPN23_ENST00000431726.1_Missense_Mutation_p.T797I	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	923	His.|Pro-rich.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACGCCTTACACCTACCCTGCA	0.682																																					p.T923I		Atlas-SNP	.											.	PTPN23	85	.	0			c.C2768T						.						32.0	32.0	32.0					3																	47452056		2203	4300	6503	SO:0001583	missense	25930	exon20			CTTACACCTACCC	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.2768C>T	chr3.hg19:g.47452056C>T	ENSP00000265562:p.Thr923Ile	135.0	0.0		62.0	18.0	NM_015466	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	ENST00000265562.4	hg19	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	C	4.877	0.162968	0.09287	.	.	ENSG00000076201	ENST00000265562	T	0.02552	4.25	4.88	3.99	0.46301	.	0.875688	0.09919	N	0.738743	T	0.02380	0.0073	N	0.14661	0.345	0.21355	N	0.999711	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.48007	-0.9072	10	0.21540	T	0.41	-5.1617	11.0456	0.47857	0.0:0.8117:0.1883:0.0	.	797;923	B4DST5;Q9H3S7	.;PTN23_HUMAN	I	923	ENSP00000265562:T923I	ENSP00000265562:T923I	T	+	2	0	PTPN23	47427060	0.003000	0.15002	0.086000	0.20670	0.099000	0.18886	1.465000	0.35299	1.013000	0.39391	0.557000	0.71058	ACC	.	.		0.682	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466	
SMC4	10051	hgsc.bcm.edu	37	3	160141354	160141354	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr3:160141354T>G	ENST00000357388.3	+	14	2612	c.2161T>G	c.(2161-2163)Ttg>Gtg	p.L721V	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000360111.2_Missense_Mutation_p.L721V|SMC4_ENST00000462787.1_Missense_Mutation_p.L721V|SMC4_ENST00000469762.1_Missense_Mutation_p.L696V|SMC4_ENST00000344722.5_Missense_Mutation_p.L721V	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	721	Flexible hinge.				kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGCTGACAACTTGGATCAAGC	0.338																																					p.L721V		Atlas-SNP	.											.	SMC4	135	.	0			c.T2161G						.						161.0	173.0	169.0					3																	160141354		2203	4300	6503	SO:0001583	missense	10051	exon13			GACAACTTGGATC	AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.2161T>G	chr3.hg19:g.160141354T>G	ENSP00000349961:p.Leu721Val	85.0	0.0		103.0	24.0	NM_005496	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	ENST00000357388.3	hg19	CCDS3189.1	.	.	.	.	.	.	.	.	.	.	T	18.67	3.674261	0.67928	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000469762;ENST00000462787;ENST00000344722;ENST00000545277	D;D;D;D;D	0.88741	-2.42;-2.42;-2.42;-2.42;-2.42	5.87	4.7	0.59300	SMCs flexible hinge (3);RecF/RecN/SMC (1);	0.058771	0.64402	D	0.000001	D	0.93697	0.7986	M	0.88031	2.925	0.53005	D	0.999965	D;D;B;D	0.61697	0.978;0.964;0.005;0.99	P;D;B;D	0.64237	0.833;0.919;0.034;0.923	D	0.93114	0.6519	10	0.87932	D	0	-8.8311	7.3892	0.26901	0.0:0.1099:0.1315:0.7586	.	721;696;696;721	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	V	721;721;696;721;721;315	ENSP00000349961:L721V;ENSP00000353225:L721V;ENSP00000417964:L696V;ENSP00000420734:L721V;ENSP00000341382:L721V	ENSP00000341382:L721V	L	+	1	2	SMC4	161624048	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	2.064000	0.41432	1.024000	0.39682	0.528000	0.53228	TTG	.	.		0.338	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352862.1		
MUC4	4585	hgsc.bcm.edu	37	3	195513066	195513066	+	Silent	SNP	G	G	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr3:195513066G>T	ENST00000463781.3	-	2	5844	c.5385C>A	c.(5383-5385)gtC>gtA	p.V1795V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.V1795V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAACGTCGGTGACAGGAAGAC	0.592																																					p.V1795V		Atlas-SNP	.											.	MUC4	1505	.	0			c.C5385A						.						78.0	79.0	79.0					3																	195513066		689	1591	2280	SO:0001819	synonymous_variant	4585	exon2			GTCGGTGACAGGA	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5385C>A	chr3.hg19:g.195513066G>T		539.0	0.0		411.0	53.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	ENST00000463781.3	hg19	CCDS54700.1																																																																																			.	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
DTHD1	401124	hgsc.bcm.edu	37	4	36296584	36296584	+	Silent	SNP	C	C	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr4:36296584C>T	ENST00000456874.2	+	4	1249	c.1191C>T	c.(1189-1191)aaC>aaT	p.N397N	DTHD1_ENST00000507598.1_Silent_p.N437N|DTHD1_ENST00000357504.3_Silent_p.N232N	NM_001170700.2	NP_001164171.1	Q6ZMT9	DTHD1_HUMAN	death domain containing 1	397					signal transduction (GO:0007165)					breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|stomach(1)	8						TTGATAAAAACAACCTTGGTT	0.373																																					p.N397N		Atlas-SNP	.											.	DTHD1	63	.	0			c.C1191T						.						180.0	151.0	160.0					4																	36296584		692	1591	2283	SO:0001819	synonymous_variant	401124	exon4			TAAAAACAACCTT	AK094684	CCDS54754.1	4p14	2009-10-02			ENSG00000197057	ENSG00000197057			37261	protein-coding gene	gene with protein product							Standard	NM_001170700		Approved	FLJ16686	uc021xne.2	Q6ZMT9	OTTHUMG00000160371	ENST00000456874.2:c.1191C>T	chr4.hg19:g.36296584C>T		223.0	0.0		152.0	39.0	NM_001170700	B2RXK4|B4E2N7	Silent	SNP	ENST00000456874.2	hg19	CCDS54754.1																																																																																			.	.		0.373	DTHD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001136536	
ARHGAP24	83478	hgsc.bcm.edu	37	4	86643102	86643102	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr4:86643102A>T	ENST00000395184.1	+	3	711	c.245A>T	c.(244-246)aAg>aTg	p.K82M	ARHGAP24_ENST00000506421.1_3'UTR|MIR4451_ENST00000580577.1_RNA|ARHGAP24_ENST00000503995.1_Missense_Mutation_p.K82M	NM_001025616.2	NP_001020787.2	Q8N264	RHG24_HUMAN	Rho GTPase activating protein 24	82	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of ruffle assembly (GO:1900028)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|wound healing, spreading of epidermal cells (GO:0035313)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)	Rac GTPase activator activity (GO:0030675)	p.K82T(1)		breast(3)|cervix(1)|endometrium(3)|large_intestine(4)|lung(10)|skin(1)|stomach(1)|urinary_tract(1)	24		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000571)		AACCCAGGGAAGTTCCTTTTT	0.383																																					p.K82M		Atlas-SNP	.											ARHGAP24_ENST00000395184,NS,carcinoma,0,1	ARHGAP24	116	.	1	Substitution - Missense(1)	prostate(1)	c.A245T						.						129.0	128.0	128.0					4																	86643102		2203	4300	6503	SO:0001583	missense	83478	exon3			CAGGGAAGTTCCT	AK091196	CCDS3611.1, CCDS34025.1, CCDS43246.1	4q22.1	2013-01-10			ENSG00000138639	ENSG00000138639		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	25361	protein-coding gene	gene with protein product		610586				11230166, 15254788	Standard	NM_001042669		Approved	DKFZP564B1162, FLJ33877, FilGAP	uc003hpk.3	Q8N264	OTTHUMG00000130427	ENST00000395184.1:c.245A>T	chr4.hg19:g.86643102A>T	ENSP00000378611:p.Lys82Met	207.0	0.0		172.0	22.0	NM_001025616	Q4KMG1|Q6ZNV3|Q86TI5|Q86WE4|Q9H0T6	Missense_Mutation	SNP	ENST00000395184.1	hg19	CCDS34025.1	.	.	.	.	.	.	.	.	.	.	A	16.28	3.079527	0.55753	.	.	ENSG00000138639	ENST00000395184;ENST00000503995	T;T	0.14516	2.5;2.5	4.97	4.97	0.65823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.40979	0.1139	M	0.88181	2.935	0.80722	D	1	P;B;D	0.69078	0.955;0.018;0.997	P;B;D	0.63192	0.768;0.074;0.912	T	0.50709	-0.8796	10	0.87932	D	0	.	13.9319	0.64001	1.0:0.0:0.0:0.0	.	82;82;227	Q8N264;Q8N264-4;Q8N264-5	RHG24_HUMAN;.;.	M	82	ENSP00000378611:K82M;ENSP00000423206:K82M	ENSP00000378611:K82M	K	+	2	0	ARHGAP24	86862126	1.000000	0.71417	0.985000	0.45067	0.939000	0.58152	6.030000	0.70903	1.998000	0.58463	0.528000	0.53228	AAG	.	.		0.383	ARHGAP24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252815.2	NM_031305	
GRIA2	2891	hgsc.bcm.edu	37	4	158254023	158254023	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr4:158254023G>A	ENST00000264426.9	+	7	1214	c.935G>A	c.(934-936)cGc>cAc	p.R312H	GRIA2_ENST00000393815.2_Missense_Mutation_p.R265H|GRIA2_ENST00000296526.7_Missense_Mutation_p.R312H|GRIA2_ENST00000449365.1_Missense_Mutation_p.R265H|GRIA2_ENST00000507898.1_Missense_Mutation_p.R265H	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	312					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GAAGCCTTCCGCAACCTAAGG	0.463																																					p.R312H		Atlas-SNP	.											.	GRIA2	358	.	0			c.G935A						.						99.0	105.0	103.0					4																	158254023		2203	4300	6503	SO:0001583	missense	2891	exon7			CCTTCCGCAACCT		CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.935G>A	chr4.hg19:g.158254023G>A	ENSP00000264426:p.Arg312His	121.0	0.0		118.0	15.0	NM_000826	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	ENST00000264426.9	hg19	CCDS43274.1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.213521	0.79352	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	D;D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5	5.09	5.09	0.68999	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.85771	0.5774	L	0.42245	1.32	0.80722	D	1	D;B;D	0.89917	1.0;0.04;0.999	D;B;D	0.74674	0.95;0.002;0.984	D	0.83595	0.0125	10	0.28530	T	0.3	.	18.4737	0.90783	0.0:0.0:1.0:0.0	.	312;312;265	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	H	265;265;312;312;265	ENSP00000426845:R265H;ENSP00000377403:R265H;ENSP00000296526:R312H;ENSP00000264426:R312H;ENSP00000389837:R265H	ENSP00000264426:R312H	R	+	2	0	GRIA2	158473473	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.869000	0.99810	2.341000	0.79615	0.557000	0.71058	CGC	.	.		0.463	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000258367.2		
LIFR	3977	hgsc.bcm.edu	37	5	38482266	38482266	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr5:38482266C>A	ENST00000263409.4	-	20	2887	c.2725G>T	c.(2725-2727)Gag>Tag	p.E909*	LIFR_ENST00000453190.2_Nonsense_Mutation_p.E909*	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	909					cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					TCCAGAACCTCAACATTATTT	0.383			T	PLAG1	salivary adenoma																																p.E909X	Melanoma(13;4 730 6426 9861 34751)	Atlas-SNP	.		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	.	LIFR	348	.	0			c.G2725T						.						61.0	63.0	62.0					5																	38482266		2203	4300	6503	SO:0001587	stop_gained	3977	exon20			GAACCTCAACATT	X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2725G>T	chr5.hg19:g.38482266C>A	ENSP00000263409:p.Glu909*	90.0	0.0		86.0	14.0	NM_002310	Q6LCD9	Nonsense_Mutation	SNP	ENST00000263409.4	hg19	CCDS3927.1	.	.	.	.	.	.	.	.	.	.	C	40	8.492486	0.98834	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	.	.	.	6.06	6.06	0.98353	.	0.466719	0.26307	N	0.025129	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-30.0859	20.6397	0.99537	0.0:1.0:0.0:0.0	.	.	.	.	X	909	.	ENSP00000263409:E909X	E	-	1	0	LIFR	38518023	0.999000	0.42202	0.996000	0.52242	0.979000	0.70002	5.114000	0.64648	2.880000	0.98712	0.650000	0.86243	GAG	.	.		0.383	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253823.1	NM_002310	
PDE4D	5144	hgsc.bcm.edu	37	5	58511685	58511685	+	Nonsense_Mutation	SNP	C	C	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr5:58511685C>A	ENST00000340635.6	-	2	740	c.565G>T	c.(565-567)Gag>Tag	p.E189*	PDE4D_ENST00000502484.2_Nonsense_Mutation_p.E128*|PDE4D_ENST00000405755.2_Nonsense_Mutation_p.E67*|PDE4D_ENST00000360047.5_Nonsense_Mutation_p.E53*|PDE4D_ENST00000546160.1_Nonsense_Mutation_p.E128*|PDE4D_ENST00000502575.1_Nonsense_Mutation_p.E125*|PDE4D_ENST00000507116.1_Nonsense_Mutation_p.E125*|PDE4D_ENST00000503258.1_Nonsense_Mutation_p.E59*|PDE4D_ENST00000503947.1_5'UTR	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	189					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	AGGAAGGACTCCCGTCGTTGA	0.532																																					p.E189X		Atlas-SNP	.											.	PDE4D	345	.	0			c.G565T						.						108.0	106.0	107.0					5																	58511685		1906	4121	6027	SO:0001587	stop_gained	5144	exon2			AGGACTCCCGTCG		CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.565G>T	chr5.hg19:g.58511685C>A	ENSP00000345502:p.Glu189*	97.0	0.0		76.0	25.0	NM_001104631	O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Nonsense_Mutation	SNP	ENST00000340635.6	hg19	CCDS47213.1	.	.	.	.	.	.	.	.	.	.	C	45	11.328100	0.99547	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000502575	.	.	.	4.66	4.66	0.58398	.	0.282883	0.32918	N	0.005489	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.9427	0.89030	0.0:1.0:0.0:0.0	.	.	.	.	X	189;58;53;125;59;67;128;128;125	.	ENSP00000308485:E125X	E	-	1	0	PDE4D	58547442	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.296000	0.77279	0.591000	0.81541	GAG	.	.		0.532	PDE4D-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367940.3		
PCDHGA4	56111	hgsc.bcm.edu	37	5	140736620	140736620	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr5:140736620C>T	ENST00000571252.1	+	1	1853	c.1853C>T	c.(1852-1854)gCa>gTa	p.A618V	PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	618	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACTATTTGCAGTGGGGCTG	0.622																																					p.A618V		Atlas-SNP	.											.	PCDHGA4	150	.	0			c.C1853T						.						37.0	45.0	42.0					5																	140736620		2197	4297	6494	SO:0001583	missense	56111	exon1			TATTTGCAGTGGG	AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.1853C>T	chr5.hg19:g.140736620C>T	ENSP00000458570:p.Ala618Val	177.0	0.0		143.0	15.0	NM_018917	Q9Y5D3	Missense_Mutation	SNP	ENST00000571252.1	hg19	CCDS58979.1																																																																																			.	.		0.622	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437959.1	NM_018917	
BMP5	653	hgsc.bcm.edu	37	6	55620459	55620459	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr6:55620459G>C	ENST00000370830.3	-	7	1935	c.1237C>G	c.(1237-1239)Cac>Gac	p.H413D	BMP5_ENST00000446683.2_Missense_Mutation_p.H376D	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	413					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTTGGTACGTGGTCAGGAAAC	0.308																																					p.H413D		Atlas-SNP	.											.	BMP5	94	.	0			c.C1237G						.						105.0	104.0	104.0					6																	55620459		2203	4299	6502	SO:0001583	missense	653	exon7			GTACGTGGTCAGG		CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.1237C>G	chr6.hg19:g.55620459G>C	ENSP00000359866:p.His413Asp	242.0	0.0		266.0	20.0	NM_021073	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	ENST00000370830.3	hg19	CCDS4958.1	.	.	.	.	.	.	.	.	.	.	G	9.080	0.998956	0.19121	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	D;D	0.83335	-1.71;-1.71	5.73	5.73	0.89815	Transforming growth factor-beta, C-terminal (3);	0.045134	0.85682	D	0.000000	T	0.66376	0.2783	N	0.12182	0.205	0.48762	D	0.999708	B;B	0.29805	0.131;0.257	B;B	0.36030	0.145;0.216	T	0.65405	-0.6176	10	0.28530	T	0.3	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	376;413	B4E0Y4;P22003	.;BMP5_HUMAN	D	413;376	ENSP00000359866:H413D;ENSP00000391818:H376D	ENSP00000359866:H413D	H	-	1	0	BMP5	55728418	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	4.582000	0.60957	2.854000	0.98071	0.655000	0.94253	CAC	.	.		0.308	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041000.1		
SYNE1	23345	hgsc.bcm.edu	37	6	152644792	152644792	+	Silent	SNP	C	C	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr6:152644792C>T	ENST00000367255.5	-	82	16339	c.15738G>A	c.(15736-15738)gaG>gaA	p.E5246E	SYNE1_ENST00000448038.1_Silent_p.E5175E|SYNE1_ENST00000341594.5_Silent_p.E4939E|SYNE1_ENST00000423061.1_Silent_p.E5175E|SYNE1_ENST00000265368.4_Silent_p.E5246E	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5246					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.E5246D(2)		NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GAGTTAAGAGCTCTGCTTTCG	0.488										HNSCC(10;0.0054)																											p.E5246E		Atlas-SNP	.											SYNE1_ENST00000265368,NS,carcinoma,0,2	SYNE1	3227	.	2	Substitution - Missense(2)	ovary(2)	c.G15738A						.						102.0	95.0	97.0					6																	152644792		2203	4300	6503	SO:0001819	synonymous_variant	23345	exon82			TAAGAGCTCTGCT	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.15738G>A	chr6.hg19:g.152644792C>T		86.0	0.0		69.0	4.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	ENST00000367255.5	hg19	CCDS5236.2																																																																																			.	.		0.488	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
C9orf57	138240	hgsc.bcm.edu	37	9	74667237	74667237	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr9:74667237C>A	ENST00000377024.3	-	5	556	c.461G>T	c.(460-462)tGc>tTc	p.C154F	C9orf57_ENST00000424431.2_Missense_Mutation_p.C120F	NM_001128618.1	NP_001122090.1	Q5W0N0	CI057_HUMAN	chromosome 9 open reading frame 57	154						integral component of membrane (GO:0016021)				endometrium(1)	1						AGAATGATTGCAGCAGTGAGT	0.428																																					p.C154F		Atlas-SNP	.											.	C9orf57	16	.	0			c.G461T						.						223.0	190.0	200.0					9																	74667237		692	1591	2283	SO:0001583	missense	138240	exon5			TGATTGCAGCAGT	BC036255	CCDS47980.1	9q21.2	2012-03-15			ENSG00000204669	ENSG00000204669			27037	protein-coding gene	gene with protein product						12477932	Standard	NM_001128618		Approved		uc004aip.3	Q5W0N0	OTTHUMG00000020003	ENST00000377024.3:c.461G>T	chr9.hg19:g.74667237C>A	ENSP00000366223:p.Cys154Phe	86.0	0.0		79.0	13.0	NM_001128618	A1L456	Missense_Mutation	SNP	ENST00000377024.3	hg19	CCDS47980.1	.	.	.	.	.	.	.	.	.	.	C	12.54	1.968291	0.34754	.	.	ENSG00000204669	ENST00000377024;ENST00000424431	D;D	0.99158	-5.5;-5.5	4.66	4.66	0.58398	.	0.000000	0.37530	U	0.002041	D	0.98317	0.9442	N	0.24115	0.695	0.37319	D	0.909478	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99871	1.1096	10	0.87932	D	0	-10.9597	13.226	0.59914	0.0:1.0:0.0:0.0	.	120;154	A1L456;Q5W0N0	.;CI057_HUMAN	F	154;120	ENSP00000366223:C154F;ENSP00000412956:C120F	ENSP00000366223:C154F	C	-	2	0	C9orf57	73857057	0.999000	0.42202	0.993000	0.49108	0.019000	0.09904	3.137000	0.50562	2.584000	0.87258	0.453000	0.30009	TGC	.	.		0.428	C9orf57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052631.1	NM_001128618	
KRT83	3889	hgsc.bcm.edu	37	12	52712959	52712959	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr12:52712959G>T	ENST00000293670.3	-	2	636	c.574C>A	c.(574-576)Ctg>Atg	p.L192M		NM_002282.3	NP_002273.3	P78385	KRT83_HUMAN	keratin 83	192	Coil 1B.|Rod.				aging (GO:0007568)|epidermis development (GO:0008544)|hair cycle (GO:0042633)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(4)|stomach(7)|upper_aerodigestive_tract(1)	32	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		TAGCCCTCCAGCACCTCCTGC	0.622																																					p.L192M	GBM(41;747 834 12702 24089 39393)|Esophageal Squamous(97;805 1414 12559 28198 31861)	Atlas-SNP	.											.	KRT83	64	.	0			c.C574A						.						138.0	147.0	144.0					12																	52712959		2203	4300	6503	SO:0001583	missense	3889	exon2			CCTCCAGCACCTC	X99141	CCDS8823.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000170523	ENSG00000170523		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6460	protein-coding gene	gene with protein product	"""hard keratin type II"""	602765	"""keratin, hair, basic, 3"""	KRTHB3		9084137, 16831889	Standard	NM_002282		Approved	Hb-3	uc001saf.2	P78385	OTTHUMG00000169632	ENST00000293670.3:c.574C>A	chr12.hg19:g.52712959G>T	ENSP00000293670:p.Leu192Met	142.0	0.0		121.0	31.0	NM_002282	A1A4S9|B2RC21|Q6NT21|Q9NSB3	Missense_Mutation	SNP	ENST00000293670.3	hg19	CCDS8823.1	.	.	.	.	.	.	.	.	.	.	G	15.52	2.857935	0.51376	.	.	ENSG00000170523	ENST00000293670	D	0.88431	-2.38	4.81	2.89	0.33648	Filament (1);	0.000000	0.33712	U	0.004633	D	0.88047	0.6332	L	0.58428	1.81	0.27882	N	0.939653	B	0.32324	0.364	P	0.46320	0.512	T	0.80400	-0.1398	10	0.45353	T	0.12	.	3.2963	0.06968	0.0818:0.262:0.3858:0.2704	.	192	P78385	KRT83_HUMAN	M	192	ENSP00000293670:L192M	ENSP00000293670:L192M	L	-	1	2	KRT83	50999226	0.977000	0.34250	1.000000	0.80357	0.998000	0.95712	1.893000	0.39758	0.490000	0.27771	0.563000	0.77884	CTG	.	.		0.622	KRT83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405182.1	NM_002282	
PTPRQ	374462	hgsc.bcm.edu	37	12	80862537	80862537	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr12:80862537A>T	ENST00000266688.5	+	12	947	c.947A>T	c.(946-948)aAg>aTg	p.K316M				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	362					regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						ATCACAGGAAAGTCCTTTTCA	0.338																																					p.K148M		Atlas-SNP	.											.	PTPRQ	119	.	0			c.A443T						.						158.0	137.0	143.0					12																	80862537		692	1591	2283	SO:0001583	missense	374462	exon4			CAGGAAAGTCCTT	AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.947A>T	chr12.hg19:g.80862537A>T	ENSP00000266688:p.Lys316Met	98.0	0.0		122.0	18.0	NM_001145026		Missense_Mutation	SNP	ENST00000266688.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.31|16.31	3.087163|3.087163	0.55968|0.55968	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.57752|.	0.38|.	4.0|4.0	1.61|1.61	0.23674|0.23674	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.46483|0.46483	0.1395|0.1395	.|.	.|.	.|.	0.33448|0.33448	D|D	0.583348|0.583348	D|.	0.57571|.	0.98|.	P|.	0.59171|.	0.853|.	T|T	0.52593|0.52593	-0.8555|-0.8555	8|4	0.72032|.	D|.	0.01|.	.|.	7.0384|7.0384	0.25006|0.25006	0.7339:0.0:0.2661:0.0|0.7339:0.0:0.2661:0.0	.|.	362|.	Q9UMZ3|.	PTPRQ_HUMAN|.	M|C	316|17	ENSP00000266688:K316M|.	ENSP00000266688:K316M|.	K|S	+|+	2|1	0|0	PTPRQ|PTPRQ	79386668|79386668	0.933000|0.933000	0.31639|0.31639	0.977000|0.977000	0.42913|0.42913	0.980000|0.980000	0.70556|0.70556	1.448000|1.448000	0.35112|0.35112	0.152000|0.152000	0.19188|0.19188	0.528000|0.528000	0.53228|0.53228	AAG|AGT	.	.		0.338	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001145026	
TM9SF2	9375	hgsc.bcm.edu	37	13	100206607	100206607	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr13:100206607A>G	ENST00000376387.4	+	14	1728	c.1538A>G	c.(1537-1539)gAa>gGa	p.E513G		NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2	513					transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					CAGATTCCTGAACAGTCGTTC	0.398																																					p.E513G		Atlas-SNP	.											.	TM9SF2	52	.	0			c.A1538G						.						169.0	159.0	162.0					13																	100206607		2203	4300	6503	SO:0001583	missense	9375	exon14			TTCCTGAACAGTC	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.1538A>G	chr13.hg19:g.100206607A>G	ENSP00000365567:p.Glu513Gly	167.0	0.0		145.0	24.0	NM_004800	A8K399|Q2TAY5	Missense_Mutation	SNP	ENST00000376387.4	hg19	CCDS9493.1	.	.	.	.	.	.	.	.	.	.	A	17.73	3.462123	0.63513	.	.	ENSG00000125304	ENST00000376387	T	0.48201	0.82	5.93	5.93	0.95920	.	0.046005	0.85682	D	0.000000	T	0.57858	0.2082	M	0.87900	2.915	0.80722	D	1	B;B	0.19706	0.038;0.014	B;B	0.24394	0.053;0.053	T	0.58864	-0.7561	10	0.52906	T	0.07	-16.5071	16.3943	0.83563	1.0:0.0:0.0:0.0	.	479;513	E9PHW5;Q99805	.;TM9S2_HUMAN	G	513	ENSP00000365567:E513G	ENSP00000365567:E513G	E	+	2	0	TM9SF2	99004608	1.000000	0.71417	0.931000	0.37212	0.994000	0.84299	7.076000	0.76806	2.281000	0.76405	0.533000	0.62120	GAA	.	.		0.398	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3		
COQ6	51004	hgsc.bcm.edu	37	14	74422552	74422552	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr14:74422552T>G	ENST00000334571.2	+	4	442	c.402T>G	c.(400-402)gaT>gaG	p.D134E	COQ6_ENST00000394026.4_Missense_Mutation_p.D109E|COQ6_ENST00000554920.1_Missense_Mutation_p.D134E|COQ6_ENST00000238709.4_Missense_Mutation_p.D59E|COQ6_ENST00000555552.1_3'UTR	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	134					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		TTGATAAGGATAATTTAGATG	0.468																																					p.D134E		Atlas-SNP	.											.	COQ6	27	.	0			c.T402G						.						185.0	174.0	178.0					14																	74422552		2203	4300	6503	SO:0001583	missense	51004	exon4			TAAGGATAATTTA	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.402T>G	chr14.hg19:g.74422552T>G	ENSP00000333946:p.Asp134Glu	122.0	0.0		91.0	17.0	NM_182476	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Missense_Mutation	SNP	ENST00000334571.2	hg19	CCDS9823.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.747178	0.49257	.	.	ENSG00000119723	ENST00000394026;ENST00000555376;ENST00000238709;ENST00000553462;ENST00000334571;ENST00000556300;ENST00000554153;ENST00000557584;ENST00000554920;ENST00000557205;ENST00000554320;ENST00000555392	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.51	-1.29	0.09288	.	0.283457	0.44285	N	0.000467	T	0.17916	0.0430	N	0.12663	0.25	0.45962	D	0.998787	B;B;B;B;B;B;B;B	0.29988	0.264;0.036;0.234;0.012;0.0;0.036;0.019;0.001	B;B;B;B;B;B;B;B	0.28465	0.057;0.086;0.09;0.004;0.002;0.023;0.015;0.002	T	0.06215	-1.0839	10	0.20519	T	0.43	-1.5003	6.1558	0.20335	0.0:0.2834:0.1231:0.5935	.	79;134;79;109;134;59;59;59	B7Z8E9;B7Z357;B7Z262;B7Z3K8;Q9Y2Z9;G3V3A1;G3XA86;Q86U30	.;.;.;.;COQ6_HUMAN;.;.;.	E	109;59;59;59;134;134;79;79;134;79;59;59	ENSP00000377594:D109E;ENSP00000238709:D59E;ENSP00000333946:D134E;ENSP00000451123:D59E	ENSP00000238709:D59E	D	+	3	2	COQ6	73492305	0.360000	0.24964	0.743000	0.31040	0.968000	0.65278	-0.499000	0.06413	-0.346000	0.08312	0.459000	0.35465	GAT	.	.		0.468	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
VPS13C	54832	hgsc.bcm.edu	37	15	62182512	62182512	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr15:62182512T>C	ENST00000261517.5	-	67	9266	c.9193A>G	c.(9193-9195)Acc>Gcc	p.T3065A	VPS13C_ENST00000249837.3_Missense_Mutation_p.T3022A|VPS13C_ENST00000395896.4_Missense_Mutation_p.T3065A|VPS13C_ENST00000395898.3_Missense_Mutation_p.T3022A	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						ACATCATCGGTGAAAAGCAAA	0.453																																					p.T3065A		Atlas-SNP	.											.	VPS13C	506	.	0			c.A9193G						.						89.0	78.0	82.0					15																	62182512		2203	4300	6503	SO:0001583	missense	54832	exon67			CATCGGTGAAAAG	AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.9193A>G	chr15.hg19:g.62182512T>C	ENSP00000261517:p.Thr3065Ala	112.0	0.0		70.0	16.0	NM_020821		Missense_Mutation	SNP	ENST00000261517.5	hg19	CCDS32257.1	.	.	.	.	.	.	.	.	.	.	T	26.9	4.783518	0.90282	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.52295	0.67;0.67;0.67	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.75332	0.3835	M	0.90870	3.155	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.999;1.0;0.997	T	0.81906	-0.0718	10	0.87932	D	0	.	15.6116	0.76727	0.0:0.0:0.0:1.0	.	3022;3065;3022;3065	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	A	3022;3065;3065;3065	ENSP00000249837:T3022A;ENSP00000261517:T3065A;ENSP00000379233:T3065A	ENSP00000249837:T3022A	T	-	1	0	VPS13C	59969804	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.503000	0.81632	2.079000	0.62486	0.533000	0.62120	ACC	.	.		0.453	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000415997.1	NM_017684	
FSD2	123722	hgsc.bcm.edu	37	15	83451591	83451591	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr15:83451591T>C	ENST00000334574.8	-	4	1103	c.922A>G	c.(922-924)Aca>Gca	p.T308A	FSD2_ENST00000541889.1_Missense_Mutation_p.T308A			A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing 2	308										breast(2)|central_nervous_system(1)|large_intestine(5)|lung(10)	18						TCCTCTATTGTTTCCATCAGT	0.378																																					p.T308A		Atlas-SNP	.											.	FSD2	45	.	0			c.A922G						.						305.0	288.0	293.0					15																	83451591		1894	4118	6012	SO:0001583	missense	123722	exon4			CTATTGTTTCCAT	AK122875	CCDS45332.1, CCDS61738.1	15q25.2	2013-02-11	2006-01-11	2006-01-11		ENSG00000186628		"""Fibronectin type III domain containing"""	18024	protein-coding gene	gene with protein product			"""SPRY domain containing 1"""	SPRYD1			Standard	NM_001007122		Approved	RP11-127F21	uc002bjd.2	A1L4K1		ENST00000334574.8:c.922A>G	chr15.hg19:g.83451591T>C	ENSP00000335651:p.Thr308Ala	286.0	0.0		220.0	24.0	NM_001007122	B3KVG1|B7ZM02	Missense_Mutation	SNP	ENST00000334574.8	hg19	CCDS45332.1	.	.	.	.	.	.	.	.	.	.	T	17.50	3.404838	0.62288	.	.	ENSG00000186628	ENST00000334574;ENST00000541889	T;T	0.63417	0.44;-0.04	6.04	3.69	0.42338	.	0.108638	0.64402	D	0.000012	T	0.58119	0.2100	M	0.66939	2.045	0.31242	N	0.695044	B;P	0.47762	0.354;0.9	B;B	0.43990	0.217;0.438	T	0.62201	-0.6904	10	0.41790	T	0.15	-13.9101	6.0078	0.19557	0.1232:0.1369:0.0:0.74	.	308;308	B7ZM02;A1L4K1	.;FSD2_HUMAN	A	308	ENSP00000335651:T308A;ENSP00000444078:T308A	ENSP00000335651:T308A	T	-	1	0	FSD2	81248645	1.000000	0.71417	0.793000	0.32043	0.950000	0.60333	2.497000	0.45354	0.497000	0.27926	0.459000	0.35465	ACA	.	.		0.378	FSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418385.1	NM_001007122	
AKAP13	11214	hgsc.bcm.edu	37	15	86265519	86265519	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr15:86265519T>G	ENST00000394518.2	+	25	6532	c.6437T>G	c.(6436-6438)gTa>gGa	p.V2146G	AKAP13_ENST00000361243.2_Missense_Mutation_p.V2150G|AKAP13_ENST00000394510.2_Missense_Mutation_p.V391G|AKAP13_ENST00000560579.1_3'UTR	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	2146	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.|Interaction with ESR1.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ATATTGCTTGTAACTCAGCGG	0.413																																					p.V2150G	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.T6449G						.						237.0	226.0	230.0					15																	86265519		2202	4299	6501	SO:0001583	missense	11214	exon25			TGCTTGTAACTCA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.6437T>G	chr15.hg19:g.86265519T>G	ENSP00000378026:p.Val2146Gly	136.0	0.0		138.0	14.0	NM_006738	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	T	27.4	4.824186	0.90955	.	.	ENSG00000170776	ENST00000426424;ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540;ENST00000394510	T;T;T	0.68765	-0.35;-0.35;-0.35	5.69	5.69	0.88448	Dbl homology (DH) domain (5);	.	.	.	.	T	0.79747	0.4499	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.81276	-0.1006	9	0.62326	D	0.03	.	15.117	0.72410	0.0:0.0:0.0:1.0	.	2126;2146;2150	Q12802-4;Q12802;Q12802-2	.;AKP13_HUMAN;.	G	226;2150;2146;2149;2125;391	ENSP00000354718:V2150G;ENSP00000378026:V2146G;ENSP00000378018:V391G	ENSP00000354718:V2150G	V	+	2	0	AKAP13	84066523	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	7.698000	0.84413	2.150000	0.67090	0.533000	0.62120	GTA	.	.		0.413	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
SLC5A11	115584	hgsc.bcm.edu	37	16	24902218	24902218	+	Silent	SNP	A	A	G			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr16:24902218A>G	ENST00000347898.3	+	9	1315	c.693A>G	c.(691-693)ggA>ggG	p.G231G	SLC5A11_ENST00000424767.2_Silent_p.G196G|SLC5A11_ENST00000545376.1_Silent_p.G161G|SLC5A11_ENST00000567758.1_Silent_p.G196G|SLC5A11_ENST00000449109.2_Intron|SLC5A11_ENST00000569071.1_Intron|SLC5A11_ENST00000565769.1_Silent_p.G167G|SLC5A11_ENST00000539472.1_Silent_p.G167G|SLC5A11_ENST00000568579.1_Silent_p.G161G	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		GGATGGAAGGACTGAAGGAGA	0.547																																					p.G231G		Atlas-SNP	.											.	SLC5A11	97	.	0			c.A693G						.						136.0	138.0	138.0					16																	24902218		2197	4300	6497	SO:0001819	synonymous_variant	115584	exon9			GGAAGGACTGAAG	AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.693A>G	chr16.hg19:g.24902218A>G		84.0	0.0		61.0	12.0	NM_052944		Silent	SNP	ENST00000347898.3	hg19	CCDS10625.1																																																																																			.	.		0.547	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214091.3	NM_052944	
POLR2A	5430	hgsc.bcm.edu	37	17	7400976	7400976	+	Missense_Mutation	SNP	A	A	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr17:7400976A>T	ENST00000322644.6	+	7	1388	c.989A>T	c.(988-990)cAg>cTg	p.Q330L	POLR2A_ENST00000572844.1_Missense_Mutation_p.Q330L	NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	330					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				CAGGCCATGCAGAAGTCTGGG	0.602																																					p.Q330L		Atlas-SNP	.											.	POLR2A	157	.	0			c.A989T						.						48.0	49.0	49.0					17																	7400976		2203	4300	6503	SO:0001583	missense	5430	exon7			CCATGCAGAAGTC			17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.989A>T	chr17.hg19:g.7400976A>T	ENSP00000314949:p.Gln330Leu	89.0	0.0		73.0	20.0	NM_000937	A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	ENST00000322644.6	hg19	CCDS32548.1	.	.	.	.	.	.	.	.	.	.	A	16.49	3.138761	0.56936	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.25250	1.81	5.74	5.74	0.90152	RNA polymerase, N-terminal (1);RNA polymerase Rpb1, domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	M	0.74258	2.255	0.80722	D	1	P;B	0.44195	0.828;0.249	P;B	0.53912	0.737;0.143	T	0.47032	-0.9148	10	0.87932	D	0	-10.9531	15.0177	0.71600	1.0:0.0:0.0:0.0	.	330;330	P24928;Q6NX41	RPB1_HUMAN;.	L	286;330	ENSP00000314949:Q330L	ENSP00000314949:Q330L	Q	+	2	0	SLC35G6	7341700	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.444000	0.90323	2.189000	0.69895	0.460000	0.39030	CAG	.	.		0.602	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437967.1	NM_000937	
MUC16	94025	hgsc.bcm.edu	37	19	9060181	9060181	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr19:9060181T>G	ENST00000397910.4	-	3	27468	c.27265A>C	c.(27265-27267)Aca>Cca	p.T9089P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9091	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCCCTTGATGTAGCCCCAGGA	0.478																																					p.T9089P		Atlas-SNP	.											.	MUC16	4315	.	0			c.A27265C						.						179.0	166.0	170.0					19																	9060181		1922	4131	6053	SO:0001583	missense	94025	exon3			TTGATGTAGCCCC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27265A>C	chr19.hg19:g.9060181T>G	ENSP00000381008:p.Thr9089Pro	111.0	0.0		108.0	14.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	3.272	-0.148960	0.06585	.	.	ENSG00000181143	ENST00000397910	T	0.02579	4.24	2.5	-4.99	0.03010	.	.	.	.	.	T	0.01730	0.0055	N	0.24115	0.695	.	.	.	B	0.28713	0.22	B	0.27076	0.076	T	0.44360	-0.9333	8	0.87932	D	0	.	0.1031	0.00050	0.3214:0.2327:0.1631:0.2828	.	9089	B5ME49	.	P	9089	ENSP00000381008:T9089P	ENSP00000381008:T9089P	T	-	1	0	MUC16	8921181	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.710000	0.05024	-1.618000	0.01568	-0.658000	0.03865	ACA	.	.		0.478	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF793	390927	hgsc.bcm.edu	37	19	38028241	38028241	+	Silent	SNP	C	C	T	rs371897623		TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr19:38028241C>T	ENST00000587143.1	+	6	916	c.681C>T	c.(679-681)caC>caT	p.H227H	ZNF793_ENST00000589319.1_Intron|ZNF793_ENST00000445217.1_Silent_p.H227H|ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000542455.1_Silent_p.H227H			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAAACCCCACGTCTGTAGTG	0.473																																					p.H227H	Melanoma(44;400 1431 1499 19093)	Atlas-SNP	.											ZNF793_ENST00000445217,NS,carcinoma,0,1	ZNF793	50	.	0			c.C681T						.	C		1,4047		0,1,2023	31.0	33.0	32.0		681	-6.8	0.1	19		32	0,8414		0,0,4207	no	coding-synonymous	ZNF793	NM_001013659.2		0,1,6230	TT,TC,CC		0.0,0.0247,0.0080		227/407	38028241	1,12461	2024	4207	6231	SO:0001819	synonymous_variant	390927	exon8			ACCCCACGTCTGT	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.681C>T	chr19.hg19:g.38028241C>T		59.0	0.0		72.0	15.0	NM_001013659	E9PGN4|Q7Z3Q9	Silent	SNP	ENST00000587143.1	hg19	CCDS46062.1																																																																																			.	.		0.473	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
ZNF607	84775	hgsc.bcm.edu	37	19	38189048	38189048	+	Missense_Mutation	SNP	T	T	A	rs371361210		TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr19:38189048T>A	ENST00000355202.4	-	5	2579	c.1984A>T	c.(1984-1986)Ata>Tta	p.I662L	ZNF607_ENST00000395835.3_Missense_Mutation_p.I661L|CTD-2528L19.4_ENST00000586606.2_Intron	NM_032689.4	NP_116078.4	Q96SK3	ZN607_HUMAN	zinc finger protein 607	662					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|lung(8)|urinary_tract(1)	27			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)			CTATGATGTATACTAAGTTCA	0.378																																					p.I662L		Atlas-SNP	.											.	ZNF607	82	.	0			c.A1984T						.	T	LEU/ILE,LEU/ILE	0,4406		0,0,2203	110.0	108.0	109.0		1981,1984	-3.9	0.3	19		109	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZNF607	NM_001172677.1,NM_032689.4	5,5	0,1,6502	AA,AT,TT		0.0116,0.0,0.0077	benign,benign	661/696,662/697	38189048	1,13005	2203	4300	6503	SO:0001583	missense	84775	exon5			GATGTATACTAAG	AK127464	CCDS33006.1, CCDS54259.1	19q13.1	2013-01-08				ENSG00000198182		"""Zinc fingers, C2H2-type"", ""-"""	28192	protein-coding gene	gene with protein product						14702039	Standard	NM_032689		Approved	MGC13071, FLJ14802	uc002ohc.2	Q96SK3		ENST00000355202.4:c.1984A>T	chr19.hg19:g.38189048T>A	ENSP00000347338:p.Ile662Leu	123.0	0.0		120.0	22.0	NM_032689	F5H141|Q6ZMN2|Q6ZMN4|Q96C40	Missense_Mutation	SNP	ENST00000355202.4	hg19	CCDS33006.1	.	.	.	.	.	.	.	.	.	.	T	11.15	1.553069	0.27739	0.0	1.16E-4	ENSG00000198182	ENST00000355202;ENST00000395835	T;T	0.17854	2.25;2.25	1.96	-3.91	0.04168	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10380	0.0254	L	0.31926	0.97	0.09310	N	1	B;B	0.13145	0.004;0.007	B;B	0.17433	0.001;0.018	T	0.37454	-0.9705	9	0.29301	T	0.29	.	5.837	0.18613	0.0:0.137:0.4228:0.4402	.	662;661	Q96SK3;F5H141	ZN607_HUMAN;.	L	662;661	ENSP00000347338:I662L;ENSP00000438015:I661L	ENSP00000347338:I662L	I	-	1	0	ZNF607	42880888	0.000000	0.05858	0.340000	0.25575	0.870000	0.49936	-4.480000	0.00227	-0.467000	0.06932	0.379000	0.24179	ATA	.	.		0.378	ZNF607-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459502.2	NM_032689	
EPB41L1	2036	hgsc.bcm.edu	37	20	34761813	34761813	+	Silent	SNP	C	C	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr20:34761813C>A	ENST00000338074.2	+	2	275	c.114C>A	c.(112-114)ggC>ggA	p.G38G	EPB41L1_ENST00000373950.2_Intron|EPB41L1_ENST00000373946.3_Intron|EPB41L1_ENST00000373941.1_Silent_p.G38G|EPB41L1_ENST00000202028.5_Intron|EPB41L1_ENST00000441639.1_Intron	NM_001258329.1|NM_012156.2	NP_001245258.1|NP_036288.2	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	38					cortical actin cytoskeleton organization (GO:0030866)|synaptic transmission (GO:0007268)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(10)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	37	Breast(12;0.0239)					CAGGCCACGGCCACCCAGAGG	0.662																																					p.G38G		Atlas-SNP	.											.	EPB41L1	111	.	0			c.C114A						.						37.0	34.0	35.0					20																	34761813		2203	4300	6503	SO:0001819	synonymous_variant	2036	exon3			CCACGGCCACCCA	AB002336	CCDS13271.1, CCDS13272.1, CCDS58771.1	20q11.2-q12	2003-03-17			ENSG00000088367	ENSG00000088367			3378	protein-coding gene	gene with protein product		602879				9570967, 9828140	Standard	NM_012156		Approved	KIAA0338	uc002xfb.3	Q9H4G0	OTTHUMG00000032378	ENST00000338074.2:c.114C>A	chr20.hg19:g.34761813C>A		81.0	0.0		71.0	17.0	NM_001258329	O15046|Q4VXM6|Q4VXM7|Q4VXM8|Q4VXN4|Q6ZT61|Q8IUU7|Q96CV5|Q96L65	Silent	SNP	ENST00000338074.2	hg19	CCDS13271.1																																																																																			.	.		0.662	EPB41L1-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078978.3	NM_012156	
DHX35	60625	hgsc.bcm.edu	37	20	37621023	37621023	+	Silent	SNP	C	C	T	rs549854740		TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr20:37621023C>T	ENST00000252011.3	+	7	570	c.537C>T	c.(535-537)caC>caT	p.H179H	DHX35_ENST00000373325.2_Silent_p.H179H|DHX35_ENST00000373323.4_Silent_p.H148H	NM_021931.3	NP_068750.2	Q9H5Z1	DHX35_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 35	179	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	40		Myeloproliferative disorder(115;0.00878)				ATGAAGCCCACGAGAGGACCT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		19396	0.0		0.0	False		,,,				2504	0.001				p.H179H		Atlas-SNP	.											.	DHX35	82	.	0			c.C537T						.						223.0	199.0	207.0					20																	37621023		2203	4300	6503	SO:0001819	synonymous_variant	60625	exon7			AGCCCACGAGAGG	AK026412	CCDS13310.1, CCDS54463.1	20q11.22-q12	2003-06-13	2003-06-13	2003-06-13	ENSG00000101452	ENSG00000101452		"""DEAH-boxes"""	15861	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 35"""	C20orf15, DDX35			Standard	NM_001190809		Approved	FLJ22759, KAIA0875	uc002xjh.3	Q9H5Z1	OTTHUMG00000032463	ENST00000252011.3:c.537C>T	chr20.hg19:g.37621023C>T		138.0	0.0		130.0	11.0	NM_021931	A2RTX3|B4E0J0|F5GXM6|Q5THR0|Q9H4H7|Q9H6T6	Silent	SNP	ENST00000252011.3	hg19	CCDS13310.1																																																																																			.	.		0.413	DHX35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079212.2	NM_021931	
PCK1	5105	hgsc.bcm.edu	37	20	56139383	56139383	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr20:56139383G>A	ENST00000319441.4	+	7	1284	c.1120G>A	c.(1120-1122)Gat>Aat	p.D374N	PCK1_ENST00000535860.1_Missense_Mutation_p.D242N|PCK1_ENST00000543666.1_Missense_Mutation_p.D57N	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	374					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			GGAAGGCATTGATGAGCCGCT	0.557																																					p.D374N		Atlas-SNP	.											PCK1,right_upper_lobe,carcinoma,0,1	PCK1	95	.	0			c.G1120A						.						104.0	91.0	96.0					20																	56139383		2203	4300	6503	SO:0001583	missense	5105	exon7			GGCATTGATGAGC		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1120G>A	chr20.hg19:g.56139383G>A	ENSP00000319814:p.Asp374Asn	131.0	0.0		94.0	16.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Missense_Mutation	SNP	ENST00000319441.4	hg19	CCDS13460.1	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210471	0.39102	.	.	ENSG00000124253	ENST00000540165;ENST00000319441;ENST00000543666;ENST00000535860	T;T;T	0.09911	2.93;2.93;2.93	5.31	5.31	0.75309	.	0.086985	0.85682	D	0.000000	T	0.16128	0.0388	M	0.76574	2.34	0.80722	D	1	B;B	0.15930	0.002;0.015	B;B	0.22753	0.013;0.041	T	0.01635	-1.1307	10	0.35671	T	0.21	-44.3202	12.6654	0.56840	0.0757:0.0:0.9243:0.0	.	57;374	B4DT64;P35558	.;PCKGC_HUMAN	N	56;374;57;242	ENSP00000319814:D374N;ENSP00000445767:D57N;ENSP00000444342:D242N	ENSP00000319814:D374N	D	+	1	0	PCK1	55572789	1.000000	0.71417	0.228000	0.23943	0.120000	0.20174	7.505000	0.81655	2.636000	0.89361	0.655000	0.94253	GAT	.	.		0.557	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
GNAS	2778	hgsc.bcm.edu	37	20	57484420	57484420	+	Missense_Mutation	SNP	C	C	T	rs11554273		TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr20:57484420C>T	ENST00000371085.3	+	8	1025	c.601C>T	c.(601-603)Cgt>Tgt	p.R201C	GNAS_ENST00000306090.10_Missense_Mutation_p.R187C|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000354359.7_Missense_Mutation_p.R202C|GNAS_ENST00000371100.4_Missense_Mutation_p.R844C|GNAS_ENST00000371095.3_Missense_Mutation_p.R187C|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000265620.7_Missense_Mutation_p.R186C|GNAS_ENST00000371102.4_Missense_Mutation_p.R830C|GNAS_ENST00000371075.3_3'UTR	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	201			R -> C (in MAS and somatotrophinoma; dbSNP:rs11554273). {ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> G (in MAS). {ECO:0000269|PubMed:10571700}.|R -> H (in MAS, somatotrophinoma and AIMAH1). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:1594625, ECO:0000269|PubMed:1944469, ECO:0000269|PubMed:2549426}.|R -> L (in non-MAS endocrine tumors). {ECO:0000269|PubMed:7751320}.|R -> S (in AIMAH1, pituitary tumor and polyostotic fibrous dysplasia). {ECO:0000269|PubMed:12727968, ECO:0000269|PubMed:8766942, ECO:0000269|PubMed:9267696}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)	p.R201C(228)|p.R844C(9)|p.R201S(5)		adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			GCTTCGCTGCCGTGTCCTGAC	0.428			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.R844C	Colon(117;935 1597 6045 8307 46442)	Atlas-SNP	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	GNAS_ENST00000371100,NS,adenocarcinoma,0,338	GNAS	867	.	242	Substitution - Missense(242)	pituitary(141)|pancreas(35)|large_intestine(14)|ovary(12)|thyroid(10)|adrenal_gland(7)|biliary_tract(6)|parathyroid(5)|liver(3)|kidney(3)|testis(2)|upper_aerodigestive_tract(2)|autonomic_ganglia(1)|haematopoietic_and_lymphoid_tissue(1)	c.C2530T						.						80.0	78.0	79.0					20																	57484420		2203	4300	6503	SO:0001583	missense	2778	exon8			CGCTGCCGTGTCC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.601C>T	chr20.hg19:g.57484420C>T	ENSP00000360126:p.Arg201Cys	97.0	0.0		95.0	28.0	NM_080425	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000371085.3	hg19	CCDS13472.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.215896	0.79352	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090	D;D;D;D;D;D;D	0.99466	-5.95;-5.95;-5.95;-5.95;-5.95;-2.99;-5.95	5.53	4.53	0.55603	G protein alpha subunit, helical insertion (2);	0.000000	0.85682	D	0.000000	D	0.99775	0.9907	H	0.99732	4.735	0.80722	D	1	D;D;D;D	0.89917	0.999;0.983;0.979;1.0	D;P;P;D	0.97110	0.939;0.845;0.643;1.0	D	0.96814	0.9599	10	0.87932	D	0	.	13.0593	0.58997	0.2437:0.7563:0.0:0.0	rs11554273	201;202;186;844	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	C	844;830;187;201;202;186;187	ENSP00000360141:R844C;ENSP00000360143:R830C;ENSP00000360136:R187C;ENSP00000360126:R201C;ENSP00000346328:R202C;ENSP00000265620:R186C;ENSP00000304472:R187C	ENSP00000265620:R186C	R	+	1	0	GNAS	56917815	1.000000	0.71417	0.998000	0.56505	0.941000	0.58515	4.055000	0.57441	2.596000	0.87737	0.563000	0.77884	CGT	.	C|1.000		0.428	GNAS-015	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080431.2	NM_000516	
DIDO1	11083	hgsc.bcm.edu	37	20	61511712	61511712	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr20:61511712C>T	ENST00000266070.4	-	16	5921	c.5596G>A	c.(5596-5598)Gcc>Acc	p.A1866T	DIDO1_ENST00000395343.1_Missense_Mutation_p.A1866T	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1866	Pro-rich.				apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TGGGCGGGGGCGCCCGTCACC	0.612																																					p.A1866T	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.G5596A						.						43.0	47.0	46.0					20																	61511712		2202	4295	6497	SO:0001583	missense	11083	exon16			CGGGGGCGCCCGT	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.5596G>A	chr20.hg19:g.61511712C>T	ENSP00000266070:p.Ala1866Thr	50.0	0.0		53.0	9.0	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	C	3.128	-0.179083	0.06380	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.08282	3.11;3.11	4.97	-1.09	0.09904	.	0.536184	0.15455	N	0.261401	T	0.06325	0.0163	N	0.22421	0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.28073	-1.0055	10	0.45353	T	0.12	-1.363	13.92	0.63926	0.0:0.5771:0.3057:0.1173	.	1866	Q9BTC0	DIDO1_HUMAN	T	1866	ENSP00000266070:A1866T;ENSP00000378752:A1866T	ENSP00000266070:A1866T	A	-	1	0	DIDO1	60982157	0.085000	0.21516	0.000000	0.03702	0.006000	0.05464	0.270000	0.18607	-0.453000	0.07076	-1.332000	0.01269	GCC	.	.		0.612	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
ITIH6	347365	hgsc.bcm.edu	37	X	54785172	54785172	+	Silent	SNP	G	G	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chrX:54785172G>A	ENST00000218436.6	-	8	1364	c.1335C>T	c.(1333-1335)aaC>aaT	p.N445N		NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	445	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CTATTCCCCGGTTTTCCAGGG	0.582																																					p.N445N		Atlas-SNP	.											.	.	.	.	0			c.C1335T						.						53.0	47.0	49.0					X																	54785172		2203	4300	6503	SO:0001819	synonymous_variant	347365	exon8			TCCCCGGTTTTCC	AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.1335C>T	chrX.hg19:g.54785172G>A		120.0	0.0		80.0	24.0	NM_198510	A6NN03	Silent	SNP	ENST00000218436.6	hg19	CCDS14361.1																																																																																			.	.		0.582	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056814.2	NM_198510	
ZXDA	7789	hgsc.bcm.edu	37	X	57936066	57936066	+	Silent	SNP	G	G	A			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chrX:57936066G>A	ENST00000358697.4	-	1	1001	c.789C>T	c.(787-789)ggC>ggT	p.G263G		NM_007156.4	NP_009087.1	P98168	ZXDA_HUMAN	zinc finger, X-linked, duplicated A	263					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(13)|ovary(2)|prostate(2)|skin(1)	37						ACAGCACCACGCCTGGACCAG	0.731																																					p.G263G		Atlas-SNP	.											.	ZXDA	70	.	0			c.C789T						.						9.0	10.0	10.0					X																	57936066		2182	4274	6456	SO:0001819	synonymous_variant	7789	exon1			CACCACGCCTGGA	L14787	CCDS14376.1	Xp11.21	2013-01-08			ENSG00000198205	ENSG00000198205		"""Zinc fingers, C2H2-type"""	13198	protein-coding gene	gene with protein product	"""zinc finger protein 896"""	300235				8268913	Standard	NM_007156		Approved	ZNF896	uc004dve.3	P98168	OTTHUMG00000021688	ENST00000358697.4:c.789C>T	chrX.hg19:g.57936066G>A		36.0	0.0		36.0	11.0	NM_007156	Q9UJP7	Silent	SNP	ENST00000358697.4	hg19	CCDS14376.1																																																																																			.	.		0.731	ZXDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056925.1	NM_007156	
MID2	11043	hgsc.bcm.edu	37	X	107084301	107084301	+	Nonsense_Mutation	SNP	C	C	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chrX:107084301C>T	ENST00000262843.6	+	2	954	c.406C>T	c.(406-408)Cga>Tga	p.R136*	MID2_ENST00000443968.2_Nonsense_Mutation_p.R136*	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	136					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						GTCTAGCGAGCGAATTGCTTG	0.562																																					p.R136X		Atlas-SNP	.											.	MID2	122	.	0			c.C406T						.						42.0	38.0	39.0					X																	107084301		2203	4300	6503	SO:0001587	stop_gained	11043	exon2			AGCGAGCGAATTG		CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.406C>T	chrX.hg19:g.107084301C>T	ENSP00000262843:p.Arg136*	90.0	0.0		75.0	12.0	NM_012216	A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Nonsense_Mutation	SNP	ENST00000262843.6	hg19	CCDS14532.2	.	.	.	.	.	.	.	.	.	.	C	18.02	3.530285	0.64860	.	.	ENSG00000080561	ENST00000451923;ENST00000262843;ENST00000443968	.	.	.	5.94	-0.583	0.11706	.	0.168083	0.38778	N	0.001561	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	17.1355	0.86738	0.7736:0.2264:0.0:0.0	.	.	.	.	X	116;136;136	.	ENSP00000262843:R136X	R	+	1	2	MID2	106970957	0.011000	0.17503	0.748000	0.31131	0.960000	0.62799	0.541000	0.23207	-0.644000	0.05465	0.600000	0.82982	CGA	.	.		0.562	MID2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057852.2	NM_012216	
AMMECR1	9949	hgsc.bcm.edu	37	X	109444278	109444278	+	Splice_Site	SNP	C	C	T			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chrX:109444278C>T	ENST00000262844.5	-	5	958	c.791G>A	c.(790-792)gGa>gAa	p.G264E	AMMECR1_ENST00000372057.1_Splice_Site_p.G141E|AMMECR1_ENST00000372059.2_Splice_Site_p.G227E	NM_015365.2	NP_056180.1	Q9Y4X0	AMMR1_HUMAN	Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1	264	AMMECR1. {ECO:0000255|PROSITE- ProRule:PRU00467}.									large_intestine(1)|lung(4)|ovary(1)|stomach(1)	7						ATGGTCCCATCCTGTAGAGAG	0.383																																					p.G264E		Atlas-SNP	.											.	AMMECR1	16	.	0			c.G791A						.						171.0	148.0	156.0					X																	109444278		2203	4300	6503	SO:0001630	splice_region_variant	9949	exon5			TCCCATCCTGTAG	AJ007014	CCDS14551.1, CCDS35368.1, CCDS55476.1	Xq22.3	2014-06-17	2008-09-12		ENSG00000101935	ENSG00000101935			467	protein-coding gene	gene with protein product		300195				10049589, 9480748	Standard	NM_001171689		Approved		uc004eoo.3	Q9Y4X0	OTTHUMG00000022197	ENST00000262844.5:c.791-1G>A	chrX.hg19:g.109444278C>T		97.0	0.0		72.0	10.0	NM_015365	Q5JYV9|Q6P9D8|Q8WX22|Q9UIQ8	Missense_Mutation	SNP	ENST00000262844.5	hg19	CCDS14551.1	.	.	.	.	.	.	.	.	.	.	C	18.32	3.597226	0.66332	.	.	ENSG00000101935	ENST00000262844;ENST00000372059;ENST00000372057	.	.	.	5.8	4.94	0.65067	AMMECR1 domain (2);	0.000000	0.85682	D	0.000000	T	0.73353	0.3576	M	0.75884	2.315	0.80722	D	1	P;P	0.49696	0.911;0.927	P;P	0.54706	0.55;0.759	T	0.75470	-0.3306	9	0.52906	T	0.07	.	13.9424	0.64064	0.0:0.9255:0.0:0.0745	.	227;264	Q9Y4X0-3;Q9Y4X0	.;AMER1_HUMAN	E	264;227;141	.	ENSP00000262844:G264E	G	-	2	0	AMMECR1	109330934	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.487000	0.81328	1.206000	0.43276	0.600000	0.82982	GGA	.	.		0.383	AMMECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057907.1		Missense_Mutation
AKNA	80709	hgsc.bcm.edu	37	9	117122236	117122236	+	Frame_Shift_Del	DEL	A	A	-			TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr9:117122236delA	ENST00000307564.4	-	10	2392	c.2231delT	c.(2230-2232)ctgfs	p.L744fs	AKNA_ENST00000374088.3_Frame_Shift_Del_p.L744fs|AKNA_ENST00000223791.3_Frame_Shift_Del_p.L204fs|AKNA_ENST00000312033.3_Frame_Shift_Del_p.L744fs|AKNA_ENST00000374075.5_Frame_Shift_Del_p.L663fs	NM_030767.4	NP_110394.3	Q7Z591	AKNA_HUMAN	AT-hook transcription factor	744					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(7)|liver(2)|lung(22)|ovary(4)|stomach(2)	51						GAGTCGGGCCAGGGGGTCCTG	0.632																																					p.L744fs		Atlas-INDEL	.											.	AKNA	119	.	0			c.2232delG						.						92.0	73.0	80.0					9																	117122236		2203	4300	6503	SO:0001589	frameshift_variant	80709	exon10			.	AK024431	CCDS6805.1	9q32	2008-02-05			ENSG00000106948	ENSG00000106948			24108	protein-coding gene	gene with protein product		605729				11268217, 11853319	Standard	NM_030767		Approved	KIAA1968	uc004bis.3	Q7Z591	OTTHUMG00000020538	ENST00000307564.4:c.2231delT	chr9.hg19:g.117122236delA	ENSP00000303769:p.Leu744fs	76.0	0.0		49.0	11.0	NM_030767	Q05BK5|Q5T535|Q5T536|Q5T537|Q64FX6|Q64FX7|Q64FX8|Q64FY2|Q6ZMK0|Q6ZNL2|Q6ZTX0|Q8TET1|Q8TF33|Q96RR9|Q9H7P7	Frame_Shift_Del	DEL	ENST00000307564.4	hg19	CCDS6805.1																																																																																			.	.		0.632	AKNA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053767.2	NM_030767	
ZBTB10	65986	hgsc.bcm.edu	37	8	81412242	81412243	+	Frame_Shift_Ins	INS	-	-	A	rs199777283		TCGA-FV-A3R3-01A-11D-A22F-10	TCGA-FV-A3R3-10A-01D-A22F-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c285c2fa-24b4-47a1-874d-86e74b002b05	64edddfd-f366-4d51-a8b4-a357b2c68e6c	g.chr8:81412242_81412243insA	ENST00000430430.1	+	3	2265_2266	c.1486_1487insA	c.(1486-1488)caafs	p.Q496fs	ZBTB10_ENST00000455036.3_Frame_Shift_Ins_p.Q496fs|ZBTB10_ENST00000379091.4_Frame_Shift_Ins_p.Q204fs|ZBTB10_ENST00000426744.2_Frame_Shift_Ins_p.Q496fs	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			ATCACGGGATCAAAAAATTGCC	0.361																																					p.Q496fs		Atlas-INDEL	.											.	ZBTB10	51	.	0			c.1486_1487insA						.																																			SO:0001589	frameshift_variant	65986	exon2			.	AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1492dupA	chr8.hg19:g.81412248_81412248dupA	ENSP00000387462:p.Gln496fs	72.0	0.0		91.0	26.0	NM_023929	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Frame_Shift_Ins	INS	ENST00000430430.1	hg19	CCDS47880.1																																																																																			.	.		0.361	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338055.2	NM_023929	
