#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LAMTOR5	10542	hgsc.bcm.edu	37	1	110950487	110950487	+	5'Flank	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:110950487A>G	ENST00000602318.1	-	0	0				LAMTOR5-AS1_ENST00000608499.1_RNA|LAMTOR5_ENST00000602858.1_5'Flank|LAMTOR5-AS1_ENST00000598454.1_RNA|LAMTOR5-AS1_ENST00000608602.1_RNA|LAMTOR5-AS1_ENST00000609244.1_RNA|LAMTOR5_ENST00000256644.4_Start_Codon_SNP_p.M1T|LAMTOR5_ENST00000474861.2_5'Flank|LAMTOR5-AS1_ENST00000590826.1_RNA|LAMTOR5-AS1_ENST00000457535.1_RNA|LAMTOR5_ENST00000483260.1_5'Flank|LAMTOR5-AS1_ENST00000587691.1_RNA|LAMTOR5-AS1_ENST00000590413.1_RNA|LAMTOR5-AS1_ENST00000610148.1_RNA|LAMTOR5-AS1_ENST00000608486.1_RNA|LAMTOR5-AS1_ENST00000608253.1_RNA|LAMTOR5-AS1_ENST00000609709.1_RNA|LAMTOR5-AS1_ENST00000609512.1_RNA|LAMTOR5-AS1_ENST00000608067.1_RNA			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5						cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											ACCTGGCTCCATGGCGGAACC	0.607																																					p.M1T		Atlas-SNP	.											.	.	.	.	0			c.T2C						.						23.0	24.0	24.0					1																	110950487		2202	4300	6502	SO:0001631	upstream_gene_variant	10542	exon1			GGCTCCATGGCGG	AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568		chr1.hg19:g.110950487A>G	Exception_encountered	137.0	0.0		132.0	28.0	NM_006402	Q6IBD8	Missense_Mutation	SNP	ENST00000602318.1	hg19		.	.	.	.	.	.	.	.	.	.	A	8.799	0.932524	0.18131	.	.	ENSG00000134248	ENST00000256644	.	.	.	2.79	-1.36	0.09085	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.40597	D	0.981544	.	.	.	.	.	.	T	0.23511	-1.0186	4	.	.	.	12.3757	2.9096	0.05732	0.2253:0.4913:0.0:0.2833	.	.	.	.	T	1	.	.	M	-	2	0	HBXIP	110752010	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.177000	0.03096	-0.282000	0.09128	-0.656000	0.03901	ATG	.	.		0.607	LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000467909.1	NM_006402	
SPAG17	200162	hgsc.bcm.edu	37	1	118629516	118629516	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:118629516C>A	ENST00000336338.5	-	11	1540	c.1475G>T	c.(1474-1476)tGt>tTt	p.C492F		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	492						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		CTCTGAGAGACAGAGTGAGGG	0.488																																					p.C492F		Atlas-SNP	.											SPAG17,colon,carcinoma,0,1	SPAG17	263	.	0			c.G1475T						.						130.0	124.0	126.0					1																	118629516		2203	4300	6503	SO:0001583	missense	200162	exon11			GAGAGACAGAGTG		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.1475G>T	chr1.hg19:g.118629516C>A	ENSP00000337804:p.Cys492Phe	177.0	0.0		125.0	25.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	hg19	CCDS899.1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.503450	0.64298	.	.	ENSG00000155761	ENST00000336338	T	0.18960	2.18	5.32	5.32	0.75619	.	0.540233	0.21061	N	0.080831	T	0.33235	0.0856	M	0.73962	2.25	0.31059	N	0.714391	D	0.69078	0.997	D	0.66497	0.944	T	0.12268	-1.0554	10	0.54805	T	0.06	.	13.077	0.59093	0.0:0.7916:0.2084:0.0	.	492	Q6Q759	SPG17_HUMAN	F	492	ENSP00000337804:C492F	ENSP00000337804:C492F	C	-	2	0	SPAG17	118431039	0.998000	0.40836	0.998000	0.56505	0.976000	0.68499	1.903000	0.39858	2.655000	0.90218	0.655000	0.94253	TGT	.	.		0.488	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
TARS2	80222	hgsc.bcm.edu	37	1	150461451	150461451	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:150461451C>G	ENST00000369064.3	+	3	309	c.275C>G	c.(274-276)gCa>gGa	p.A92G	TARS2_ENST00000369054.2_Missense_Mutation_p.A92G|TARS2_ENST00000606933.1_Missense_Mutation_p.A92G|TARS2_ENST00000438568.2_Missense_Mutation_p.A92G	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	92					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	TCAACACTGGCAGATACTGCA	0.453																																					p.A92G		Atlas-SNP	.											.	TARS2	91	.	0			c.C275G						.						134.0	146.0	142.0					1																	150461451		2203	4300	6503	SO:0001583	missense	80222	exon3			CACTGGCAGATAC	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.275C>G	chr1.hg19:g.150461451C>G	ENSP00000358060:p.Ala92Gly	72.0	0.0		101.0	17.0	NM_001271896	Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	ENST00000369064.3	hg19	CCDS952.1	.	.	.	.	.	.	.	.	.	.	C	19.05	3.752192	0.69533	.	.	ENSG00000143374	ENST00000438568;ENST00000369054;ENST00000369064;ENST00000369053	.	.	.	5.05	5.05	0.67936	TGS-like (1);TGS (1);Beta-grasp fold, ferredoxin-type (1);	0.066074	0.64402	D	0.000011	T	0.73345	0.3575	M	0.78344	2.41	0.45634	D	0.998568	D;D	0.69078	0.995;0.997	D;D	0.65773	0.932;0.938	T	0.74396	-0.3679	8	.	.	.	0.9546	15.9261	0.79618	0.0:1.0:0.0:0.0	.	92;92	Q9H9V2;Q9BW92	.;SYTM_HUMAN	G	92	.	.	A	+	2	0	TARS2	148728075	0.998000	0.40836	1.000000	0.80357	0.908000	0.53690	4.021000	0.57196	2.614000	0.88457	0.555000	0.69702	GCA	.	.		0.453	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
CRNN	49860	hgsc.bcm.edu	37	1	152382192	152382192	+	Missense_Mutation	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:152382192C>G	ENST00000271835.3	-	3	1428	c.1366G>C	c.(1366-1368)Gac>Cac	p.D456H	RP1-91G5.3_ENST00000411804.1_RNA	NM_016190.2	NP_057274.1	Q9UBG3	CRNN_HUMAN	cornulin	456					response to heat (GO:0009408)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGCCCTGGTCCAGCCTGAGG	0.557																																					p.D456H		Atlas-SNP	.											.	CRNN	78	.	0			c.G1366C						.						190.0	146.0	161.0					1																	152382192		2203	4300	6503	SO:0001583	missense	49860	exon3			CCTGGTCCAGCCT	AF077831	CCDS1010.1	1q21	2014-01-28	2005-06-13	2005-06-13	ENSG00000143536	ENSG00000143536		"""EF-hand domain containing"""	1230	protein-coding gene	gene with protein product		611312	"""chromosome 1 open reading frame 10"""	C1orf10		11056050, 15854041	Standard	NM_016190		Approved	SEP53	uc001ezx.2	Q9UBG3	OTTHUMG00000012383	ENST00000271835.3:c.1366G>C	chr1.hg19:g.152382192C>G	ENSP00000271835:p.Asp456His	225.0	0.0		321.0	33.0	NM_016190	B2RE60|Q8N613	Missense_Mutation	SNP	ENST00000271835.3	hg19	CCDS1010.1	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756006	0.49362	.	.	ENSG00000143536	ENST00000271835	T	0.18338	2.22	4.92	4.01	0.46588	.	0.365222	0.23528	N	0.047203	T	0.19927	0.0479	M	0.64170	1.965	0.23845	N	0.996686	D	0.71674	0.998	D	0.62955	0.909	T	0.03524	-1.1028	10	0.87932	D	0	.	9.3273	0.38001	0.0:0.9023:0.0:0.0977	.	456	Q9UBG3	CRNN_HUMAN	H	456	ENSP00000271835:D456H	ENSP00000271835:D456H	D	-	1	0	CRNN	150648816	0.006000	0.16342	0.068000	0.19968	0.005000	0.04900	0.880000	0.28159	1.282000	0.44496	0.650000	0.86243	GAC	.	.		0.557	CRNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034503.1	NM_016190	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155935533	155935533	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:155935533G>C	ENST00000361247.4	-	5	458	c.359C>G	c.(358-360)cCa>cGa	p.P120R	ARHGEF2_ENST00000368315.4_Missense_Mutation_p.P121R|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.P165R|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313695.7_Missense_Mutation_p.P93R|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.P93R|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.P120R	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	120					actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GGCCGAGCTTGGCCGCTCCCG	0.622																																					p.P120R	Melanoma(178;35 2768 6610 28839)	Atlas-SNP	.											.	ARHGEF2	81	.	0			c.C359G						.						38.0	45.0	43.0					1																	155935533		2203	4300	6503	SO:0001583	missense	9181	exon5			GAGCTTGGCCGCT	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.359C>G	chr1.hg19:g.155935533G>C	ENSP00000354837:p.Pro120Arg	23.0	0.0		75.0	5.0	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	hg19	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.436471	0.83885	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000435736;ENST00000543433;ENST00000313667	T;T;T;T;T	0.68765	-0.35;-0.22;-0.24;-0.35;-0.35	4.97	4.97	0.65823	.	0.000000	0.47852	D	0.000213	T	0.78110	0.4232	M	0.74647	2.275	0.58432	D	0.999994	D;D;D;D	0.89917	0.998;0.969;1.0;0.993	D;P;D;D	0.91635	0.985;0.766;0.999;0.949	T	0.80353	-0.1418	10	0.72032	D	0.01	-29.5863	15.7654	0.78123	0.0:0.0:1.0:0.0	.	165;165;120;120	B7Z977;D3DVA5;Q92974;Q92974-2	.;.;ARHG2_HUMAN;.	R	93;120;121;93;165;93;120	ENSP00000315325:P93R;ENSP00000354837:P120R;ENSP00000357298:P121R;ENSP00000357299:P93R;ENSP00000314787:P120R	ENSP00000314787:P120R	P	-	2	0	ARHGEF2	154202157	1.000000	0.71417	0.972000	0.41901	0.912000	0.54170	9.382000	0.97209	2.596000	0.87737	0.561000	0.74099	CCA	.	.		0.622	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
C1orf110	339512	hgsc.bcm.edu	37	1	162824806	162824806	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:162824806C>A	ENST00000367910.1	-	4	778	c.658G>T	c.(658-660)Ggg>Tgg	p.G220W	C1orf110_ENST00000524691.1_Intron|C1orf110_ENST00000367912.2_Intron|C1orf110_ENST00000367911.2_Intron	NM_178550.4	NP_848645.3	Q86UF4	CA110_HUMAN	chromosome 1 open reading frame 110	220										endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	12						CCAGTGTTCCCATCTGGCTTT	0.463																																					p.G220W		Atlas-SNP	.											.	C1orf110	22	.	0			c.G658T						.						165.0	153.0	157.0					1																	162824806		1951	4166	6117	SO:0001583	missense	339512	exon4			TGTTCCCATCTGG	BC040018	CCDS44269.1	1q23.3	2012-06-26			ENSG00000185860	ENSG00000185860			28736	protein-coding gene	gene with protein product						12477932	Standard	NM_178550		Approved	MGC48998	uc001gck.2	Q86UF4	OTTHUMG00000034421	ENST00000367910.1:c.658G>T	chr1.hg19:g.162824806C>A	ENSP00000356886:p.Gly220Trp	247.0	0.0		258.0	28.0	NM_178550	Q5JSG1|Q6ZW57	Missense_Mutation	SNP	ENST00000367910.1	hg19	CCDS44269.1	.	.	.	.	.	.	.	.	.	.	C	11.34	1.609365	0.28623	.	.	ENSG00000185860	ENST00000367910	.	.	.	4.09	-4.94	0.03057	.	1.631300	0.03254	N	0.182241	T	0.06962	0.0177	L	0.27053	0.805	0.32358	N	0.557544	B	0.09022	0.002	B	0.10450	0.005	T	0.16364	-1.0405	8	0.37606	T	0.19	2.7745	0.7306	0.00956	0.2174:0.182:0.1615:0.4392	.	220	Q86UF4	CA110_HUMAN	W	220	.	ENSP00000356886:G220W	G	-	1	0	C1orf110	161091430	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.775000	0.26689	-0.804000	0.04410	-0.181000	0.13052	GGG	.	.		0.463	C1orf110-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083211.2	NM_178550	
PKP1	5317	hgsc.bcm.edu	37	1	201291111	201291111	+	Silent	SNP	G	G	A	rs376484047		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:201291111G>A	ENST00000352845.3	+	9	1416	c.1416G>A	c.(1414-1416)gtG>gtA	p.V472V	PKP1_ENST00000263946.3_Silent_p.V472V|PKP1_ENST00000367324.3_Silent_p.V451V			Q13835	PKP1_HUMAN	plakophilin 1	472					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CCCAGTCTGTGGAAAACTGCA	0.622																																					p.V472V		Atlas-SNP	.											.	PKP1	127	.	0			c.G1416A						.	G	,	1,4405	2.1+/-5.4	0,1,2202	118.0	94.0	102.0		1416,1353	5.4	1.0	1		102	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	PKP1	NM_000299.3,NM_001005337.2	,	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,	472/748,451/727	201291111	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	5317	exon9			GTCTGTGGAAAAC	X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.1416G>A	chr1.hg19:g.201291111G>A		119.0	0.0		113.0	18.0	NM_000299	O00645|Q14CA0|Q15152	Silent	SNP	ENST00000352845.3	hg19	CCDS30966.1																																																																																			.	.		0.622	PKP1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000086897.1	NM_000299	
DISC1	27185	hgsc.bcm.edu	37	1	231858293	231858293	+	Silent	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:231858293A>G	ENST00000317586.4	+	3	1109	c.1056A>G	c.(1054-1056)ccA>ccG	p.P352P	TSNAX-DISC1_ENST00000602962.1_Intron|DISC1_ENST00000602281.1_Intron|DISC1_ENST00000366636.4_Intron|DISC1_ENST00000537876.1_Intron|DISC1_ENST00000602873.1_Intron|DISC1_ENST00000366637.3_Intron|DISC1_ENST00000539444.1_Intron|DISC1_ENST00000535983.1_Intron|DISC1_ENST00000366633.3_Intron|DISC1_ENST00000439617.2_Intron	NM_001012958.1	NP_001012976.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	352	Interaction with TRAF3IP1.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				AGCTGGAACCAATTGCTTTGG	0.398																																					p.N418D		Atlas-SNP	.											.	DISC1	207	.	0			c.A1252G						.						114.0	105.0	108.0					1																	231858293		2203	4300	6503	SO:0001819	synonymous_variant	27185	exon5			GGAACCAATTGCT	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000317586.4:c.1056A>G	chr1.hg19:g.231858293A>G		121.0	0.0		125.0	12.0	NM_001164550	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000317586.4	hg19	CCDS31056.1	.	.	.	.	.	.	.	.	.	.	A	8.375	0.836251	0.16891	.	.	ENSG00000162946	ENST00000366632	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	T	0.64929	0.2643	.	.	.	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.64321	0.924;0.924	T	0.60707	-0.7210	7	0.17832	T	0.49	.	11.08	0.48053	1.0:0.0:0.0:0.0	.	418;376	C4P0D2;C4P0D0	.;.	D	227	.	ENSP00000355592:N227D	N	+	1	0	DISC1	229924916	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.627000	0.24506	1.820000	0.53075	0.528000	0.53228	AAT	.	.		0.398	DISC1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000092355.2	NM_018662	
LHCGR	3973	hgsc.bcm.edu	37	2	48925801	48925801	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:48925801C>T	ENST00000294954.7	-	9	840	c.819G>A	c.(817-819)ttG>ttA	p.L273L	LHCGR_ENST00000401907.1_Silent_p.L273L|STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000403273.1_Silent_p.L273L|LHCGR_ENST00000344775.3_Intron|LHCGR_ENST00000405626.1_Silent_p.L273L	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	273					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TGGGGTAAGTCAACGTGGCCT	0.433																																					p.L273L		Atlas-SNP	.											.	LHCGR	154	.	0			c.G819A						.						107.0	107.0	107.0					2																	48925801		2203	4300	6503	SO:0001819	synonymous_variant	3973	exon9			GTAAGTCAACGTG		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.819G>A	chr2.hg19:g.48925801C>T		74.0	0.0		64.0	5.0	NM_000233	Q14751|Q15996|Q9UEW9	Silent	SNP	ENST00000294954.7	hg19	CCDS1842.1																																																																																			.	.		0.433	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
FN1	2335	hgsc.bcm.edu	37	2	216249663	216249663	+	Missense_Mutation	SNP	G	G	T	rs202245868		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr2:216249663G>T	ENST00000359671.1	-	28	4641	c.4376C>A	c.(4375-4377)gCg>gAg	p.A1459E	FN1_ENST00000357867.4_Missense_Mutation_p.A1459E|FN1_ENST00000356005.4_Missense_Mutation_p.A1459E|FN1_ENST00000354785.4_Missense_Mutation_p.A1550E|FN1_ENST00000446046.1_Missense_Mutation_p.A1459E|FN1_ENST00000421182.1_Missense_Mutation_p.A1459E|FN1_ENST00000346544.3_Missense_Mutation_p.A1459E|FN1_ENST00000357009.2_Missense_Mutation_p.A1459E|FN1_ENST00000443816.1_Missense_Mutation_p.A1459E|FN1_ENST00000345488.5_Missense_Mutation_p.A1459E|FN1_ENST00000323926.6_Missense_Mutation_p.A1550E|FN1_ENST00000336916.4_Missense_Mutation_p.A1459E|FN1_ENST00000432072.2_Missense_Mutation_p.A1550E|FN1_ENST00000490833.1_5'Flank			P02751	FINC_HUMAN	fibronectin 1	1459	Cell-attachment.|Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	GGTGGGGGTCGCAGCAACAAC	0.433																																					p.A1550E		Atlas-SNP	.											.	FN1	521	.	0			c.C4649A						.						58.0	59.0	59.0					2																	216249663		2203	4300	6503	SO:0001583	missense	2335	exon29			GGGGTCGCAGCAA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.4376C>A	chr2.hg19:g.216249663G>T	ENSP00000352696:p.Ala1459Glu	377.0	0.0		348.0	42.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	G	16.09	3.024409	0.54683	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43	6.02	6.02	0.97574	.	0.690178	0.14110	N	0.340748	T	0.46814	0.1412	N	0.17278	0.47	0.22581	N	0.998968	B;B;B;B;B;B;B;B;B;B	0.34241	0.264;0.033;0.237;0.066;0.444;0.003;0.31;0.171;0.096;0.033	B;B;B;B;B;B;B;B;B;B	0.37508	0.106;0.045;0.131;0.066;0.252;0.007;0.17;0.106;0.066;0.066	T	0.51529	-0.8694	10	0.66056	D	0.02	.	20.5407	0.99260	0.0:0.0:1.0:0.0	.	1550;1550;1459;1459;1459;1459;1460;1459;1459;1550	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.;.	E	1459;1550;1459;1459;1550;1460;1459;1459;1459;1459;1459;1459;1550;1459;266	ENSP00000394423:A1459E;ENSP00000323534:A1550E;ENSP00000338200:A1459E;ENSP00000350534:A1459E;ENSP00000346839:A1550E;ENSP00000352696:A1459E;ENSP00000265312:A1459E;ENSP00000273049:A1459E;ENSP00000349509:A1459E;ENSP00000410422:A1459E;ENSP00000415018:A1459E;ENSP00000399538:A1550E;ENSP00000348285:A1459E;ENSP00000416139:A266E	ENSP00000265313:A1460E	A	-	2	0	FN1	215957908	0.997000	0.39634	0.009000	0.14445	0.298000	0.27526	7.628000	0.83189	2.865000	0.98341	0.655000	0.94253	GCG	.	G|1.000;A|0.000		0.433	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
CAND2	23066	hgsc.bcm.edu	37	3	12859283	12859283	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:12859283G>T	ENST00000456430.2	+	10	2893	c.2852G>T	c.(2851-2853)gGc>gTc	p.G951V	CAND2_ENST00000295989.5_Missense_Mutation_p.G858V	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	951					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GCTGAGGAGGGCACCCGGGGG	0.672																																					p.G951V	GBM(43;676 868 1633 6395 37496)	Atlas-SNP	.											.	CAND2	138	.	0			c.G2852T						.						63.0	75.0	71.0					3																	12859283		2038	4177	6215	SO:0001583	missense	23066	exon10			AGGAGGGCACCCG		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.2852G>T	chr3.hg19:g.12859283G>T	ENSP00000387641:p.Gly951Val	90.0	0.0		68.0	10.0	NM_001162499	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	hg19	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.864563	0.71949	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.56611	0.45;0.45	4.64	4.64	0.57946	Armadillo-like helical (1);Armadillo-type fold (1);	0.067453	0.64402	D	0.000018	T	0.78259	0.4255	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.83210	-0.0074	10	0.52906	T	0.07	-39.1272	15.364	0.74507	0.0:0.0:1.0:0.0	.	951;858	O75155;O75155-2	CAND2_HUMAN;.	V	858;951	ENSP00000295989:G858V;ENSP00000387641:G951V	ENSP00000295989:G858V	G	+	2	0	CAND2	12834283	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	9.618000	0.98365	2.289000	0.77006	0.561000	0.74099	GGC	.	.		0.672	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
SACM1L	22908	hgsc.bcm.edu	37	3	45754687	45754687	+	Splice_Site	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:45754687A>T	ENST00000389061.5	+	6	746	c.542A>T	c.(541-543)gAg>gTg	p.E181V	SACM1L_ENST00000541314.1_Splice_Site_p.E120V|SACM1L_ENST00000418611.1_Splice_Site_p.E78V	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	181	SAC. {ECO:0000255|PROSITE- ProRule:PRU00183}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		GCACAGCCAGAGGTAATGTAC	0.358																																					p.E181V		Atlas-SNP	.											.	SACM1L	38	.	0			c.A542T						.						73.0	74.0	73.0					3																	45754687		2203	4300	6503	SO:0001630	splice_region_variant	22908	exon6			AGCCAGAGGTAAT	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.543+1A>T	chr3.hg19:g.45754687A>T		21.0	0.0		18.0	7.0	NM_014016	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	ENST00000389061.5	hg19	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	A	30	5.055486	0.93793	.	.	ENSG00000211456	ENST00000418611;ENST00000389061;ENST00000541314	T;T;T	0.58358	0.34;0.34;0.34	5.79	5.79	0.91817	Synaptojanin, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.66147	0.2760	L	0.56340	1.77	0.80722	D	1	D;P	0.59767	0.986;0.885	D;P	0.64144	0.922;0.566	T	0.63817	-0.6551	10	0.35671	T	0.21	-20.9518	16.1323	0.81449	1.0:0.0:0.0:0.0	.	120;181	B4DK71;Q9NTJ5	.;SAC1_HUMAN	V	78;181;120	ENSP00000396387:E78V;ENSP00000373713:E181V;ENSP00000443373:E120V	ENSP00000373713:E181V	E	+	2	0	SACM1L	45729691	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.833000	0.92089	2.223000	0.72356	0.454000	0.30748	GAG	.	.		0.358	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	Missense_Mutation
MYH15	22989	hgsc.bcm.edu	37	3	108127246	108127246	+	Missense_Mutation	SNP	T	T	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr3:108127246T>G	ENST00000273353.3	-	33	4617	c.4561A>C	c.(4561-4563)Att>Ctt	p.I1521L		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1521						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AGATTAGAAATCTCTTCTGGA	0.413																																					p.I1521L		Atlas-SNP	.											.	MYH15	223	.	0			c.A4561C						.						120.0	108.0	112.0					3																	108127246		1850	4096	5946	SO:0001583	missense	22989	exon33			TAGAAATCTCTTC	AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4561A>C	chr3.hg19:g.108127246T>G	ENSP00000273353:p.Ile1521Leu	88.0	0.0		108.0	25.0	NM_014981		Missense_Mutation	SNP	ENST00000273353.3	hg19	CCDS43127.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.627648	0.66901	.	.	ENSG00000144821	ENST00000273353	T	0.79141	-1.24	5.56	1.82	0.25136	Myosin tail (1);	.	.	.	.	T	0.73837	0.3638	L	0.49571	1.57	0.34368	D	0.691686	B	0.29481	0.245	B	0.37550	0.253	T	0.74417	-0.3672	9	0.62326	D	0.03	.	9.4452	0.38693	0.0:0.1906:0.0:0.8094	.	1521	Q9Y2K3	MYH15_HUMAN	L	1521	ENSP00000273353:I1521L	ENSP00000273353:I1521L	I	-	1	0	MYH15	109609936	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	2.129000	0.42055	0.073000	0.16731	0.533000	0.62120	ATT	.	.		0.413	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353935.1	XM_036988	
KIAA1211	57482	hgsc.bcm.edu	37	4	57164398	57164398	+	Start_Codon_SNP	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:57164398G>A	ENST00000504228.1	+	2	108	c.3G>A	c.(1-3)atG>atA	p.M1I	KIAA1211_ENST00000541073.1_5'UTR|KIAA1211_ENST00000264229.6_Start_Codon_SNP_p.M1I			Q6ZU35	K1211_HUMAN	KIAA1211	1										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					ACTATTCTATGGGAACCCGGG	0.418																																					p.M1I		Atlas-SNP	.											.	KIAA1211	178	.	0			c.G3A						.						92.0	87.0	89.0					4																	57164398		1805	4086	5891	SO:0001582	initiator_codon_variant	57482	exon4			TTCTATGGGAACC	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3G>A	chr4.hg19:g.57164398G>A	ENSP00000423366:p.Met1Ile	84.0	0.0		64.0	12.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	hg19	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	G	17.16	3.318908	0.60524	.	.	ENSG00000109265	ENST00000264229;ENST00000504228	T;T	0.13901	2.55;2.55	5.18	5.18	0.71444	.	.	.	.	.	T	0.30696	0.0773	.	.	.	0.80722	D	1	D	0.55800	0.973	P	0.53593	0.73	T	0.02093	-1.1215	8	0.87932	D	0	-28.4395	18.8905	0.92399	0.0:0.0:1.0:0.0	.	1	Q6ZU35	K1211_HUMAN	I	1	ENSP00000264229:M1I;ENSP00000423366:M1I	ENSP00000264229:M1I	M	+	3	0	KIAA1211	56859155	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.141000	0.64814	2.707000	0.92482	0.655000	0.94253	ATG	.	.		0.418	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	Missense_Mutation
KIAA1211	57482	hgsc.bcm.edu	37	4	57181429	57181429	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:57181429G>A	ENST00000504228.1	+	6	1866	c.1761G>A	c.(1759-1761)tcG>tcA	p.S587S	KIAA1211_ENST00000541073.1_Silent_p.S580S|KIAA1211_ENST00000264229.6_Silent_p.S587S			Q6ZU35	K1211_HUMAN	KIAA1211	587										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCCTACCGTCGTCCCTGAGCG	0.677																																					p.S587S		Atlas-SNP	.											.	KIAA1211	178	.	0			c.G1761A						.						17.0	24.0	22.0					4																	57181429		2047	4179	6226	SO:0001819	synonymous_variant	57482	exon8			ACCGTCGTCCCTG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1761G>A	chr4.hg19:g.57181429G>A		24.0	0.0		32.0	14.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	ENST00000504228.1	hg19	CCDS43230.1																																																																																			.	.		0.677	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
LPHN3	23284	hgsc.bcm.edu	37	4	62599267	62599267	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:62599267G>T	ENST00000514591.1	+	7	1519	c.1190G>T	c.(1189-1191)aGa>aTa	p.R397I	LPHN3_ENST00000508693.1_Missense_Mutation_p.R465I|LPHN3_ENST00000511324.1_Missense_Mutation_p.R465I|LPHN3_ENST00000512091.2_Missense_Mutation_p.R397I|LPHN3_ENST00000545650.1_Missense_Mutation_p.R397I|LPHN3_ENST00000507164.1_Missense_Mutation_p.R465I|LPHN3_ENST00000507625.1_Missense_Mutation_p.R465I|LPHN3_ENST00000506746.1_Missense_Mutation_p.R465I|LPHN3_ENST00000506700.1_Missense_Mutation_p.R397I|LPHN3_ENST00000514157.1_Missense_Mutation_p.R397I|LPHN3_ENST00000509896.1_Missense_Mutation_p.R465I|LPHN3_ENST00000514996.1_Missense_Mutation_p.R397I|LPHN3_ENST00000506720.1_Missense_Mutation_p.R465I|LPHN3_ENST00000504896.1_Missense_Mutation_p.R397I|LPHN3_ENST00000508946.1_Missense_Mutation_p.R397I			Q9HAR2	LPHN3_HUMAN	latrophilin 3	397					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CTGGATAGTAGATCAGGTAAG	0.353																																					p.R397I		Atlas-SNP	.											.	LPHN3	800	.	0			c.G1190T						.						34.0	32.0	33.0					4																	62599267		1832	4090	5922	SO:0001583	missense	23284	exon5			ATAGTAGATCAGG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.1190G>T	chr4.hg19:g.62599267G>T	ENSP00000422533:p.Arg397Ile	142.0	0.0		113.0	13.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028304	0.35797	.	.	ENSG00000150471	ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000534975;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.70749	-0.48;-0.47;-0.5;-0.5;-0.48;-0.47;-0.5;-0.49;-0.49;-0.47;-0.47;-0.48;-0.5;-0.51;-0.48	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.51856	0.1699	N	0.19112	0.55	0.80722	D	1	B;P;P	0.38020	0.244;0.543;0.615	B;B;B	0.29785	0.107;0.096;0.107	T	0.58956	-0.7544	10	0.56958	D	0.05	.	11.4352	0.50064	0.0827:0.0:0.9173:0.0	.	397;465;397	E9PE04;E7EN28;Q9HAR2-2	.;.;.	I	397;397;465;465;397;397;397;397;397;465;465;465;397;397;397;465;465;397	ENSP00000423388:R397I;ENSP00000422533:R397I;ENSP00000423787:R465I;ENSP00000425033:R465I;ENSP00000424120:R397I;ENSP00000439831:R397I;ENSP00000421476:R465I;ENSP00000424030:R465I;ENSP00000421372:R465I;ENSP00000425201:R397I;ENSP00000423434:R397I;ENSP00000421627:R397I;ENSP00000420931:R465I;ENSP00000425884:R465I;ENSP00000424258:R397I	ENSP00000280009:R397I	R	+	2	0	LPHN3	62281862	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.469000	0.73555	2.471000	0.83476	0.557000	0.71058	AGA	.	.		0.353	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
HPSE	10855	hgsc.bcm.edu	37	4	84222134	84222134	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:84222134C>T	ENST00000405413.2	-	12	1587	c.1451G>A	c.(1450-1452)gGa>gAa	p.G484E	HPSE_ENST00000311412.5_Missense_Mutation_p.G484E|HPSE_ENST00000512196.1_Missense_Mutation_p.G410E|HPSE_ENST00000513463.1_Missense_Mutation_p.G426E	NM_006665.5	NP_006656.2	Q9Y251	HPSE_HUMAN	heparanase	484					carbohydrate metabolic process (GO:0005975)|cell-matrix adhesion (GO:0007160)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan catabolic process (GO:0030200)|positive regulation of blood coagulation (GO:0030194)|positive regulation of hair follicle development (GO:0051798)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation vascular endothelial growth factor production (GO:0010575)|proteoglycan metabolic process (GO:0006029)|regulation of hair follicle development (GO:0051797)|small molecule metabolic process (GO:0044281)|vascular wound healing (GO:0061042)	extracellular region (GO:0005576)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)	beta-glucuronidase activity (GO:0004566)|heparanase activity (GO:0030305)|protein dimerization activity (GO:0046983)|syndecan binding (GO:0045545)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	20		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Dalteparin(DB06779)|Heparin(DB01109)	TCCATGAGGTCCCAAAGGTCT	0.368																																					p.G484E		Atlas-SNP	.											.	HPSE	55	.	0			c.G1451A						.						102.0	104.0	103.0					4																	84222134		2203	4299	6502	SO:0001583	missense	10855	exon11			TGAGGTCCCAAAG	AF144325	CCDS3602.1, CCDS54774.1, CCDS56337.1	4q21.3	2008-02-05			ENSG00000173083	ENSG00000173083			5164	protein-coding gene	gene with protein product		604724				10395325, 10395326	Standard	NM_006665		Approved	HPA, HSE1, HPSE1	uc003hoj.4	Q9Y251	OTTHUMG00000130425	ENST00000405413.2:c.1451G>A	chr4.hg19:g.84222134C>T	ENSP00000384262:p.Gly484Glu	88.0	0.0		70.0	15.0	NM_001098540	A9JIG7|C7F7I3|C7F7I4|E9PCA9|E9PGR1|Q53GE5|Q9UL39	Missense_Mutation	SNP	ENST00000405413.2	hg19	CCDS3602.1	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906633	0.33628	.	.	ENSG00000173083	ENST00000311412;ENST00000405413;ENST00000512196;ENST00000513463	T;T;T;T	0.46451	0.87;0.87;0.93;0.92	4.55	3.69	0.42338	.	0.159887	0.56097	D	0.000033	T	0.58409	0.2120	M	0.69463	2.115	0.24690	N	0.993311	D;D;D;P	0.89917	1.0;0.969;0.982;0.928	D;P;P;P	0.85130	0.997;0.52;0.713;0.52	T	0.46289	-0.9202	10	0.54805	T	0.06	-14.6443	10.1559	0.42823	0.0:0.9007:0.0:0.0993	.	410;426;426;484	E9PCA9;A9JIG7;E9PGR1;Q9Y251	.;.;.;HPSE_HUMAN	E	484;484;410;426	ENSP00000308107:G484E;ENSP00000384262:G484E;ENSP00000423265:G410E;ENSP00000421365:G426E	ENSP00000308107:G484E	G	-	2	0	HPSE	84441158	0.848000	0.29623	0.377000	0.26055	0.306000	0.27790	3.052000	0.49893	2.513000	0.84729	0.650000	0.86243	GGA	.	.		0.368	HPSE-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252812.2	NM_006665	
TACR3	6870	hgsc.bcm.edu	37	4	104511152	104511152	+	Splice_Site	SNP	C	C	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:104511152C>G	ENST00000304883.2	-	5	1226		c.e5-1		RP11-297P16.3_ENST00000512401.1_RNA|RP11-297P16.3_ENST00000502936.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3						aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		AGCTCGAAATCTGAGGAAAAG	0.418																																					.		Atlas-SNP	.											.	TACR3	102	.	0			c.1086-1G>C						.						47.0	47.0	47.0					4																	104511152		2203	4300	6503	SO:0001630	splice_region_variant	6870	exon6			CGAAATCTGAGGA	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1086-1G>C	chr4.hg19:g.104511152C>G		105.0	0.0		77.0	14.0	NM_001059	Q0P510	Splice_Site	SNP	ENST00000304883.2	hg19	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.342453	0.81911	.	.	ENSG00000169836	ENST00000304883	.	.	.	5.81	5.81	0.92471	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0794	0.93175	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TACR3	104730601	1.000000	0.71417	0.996000	0.52242	0.888000	0.51559	7.356000	0.79445	2.746000	0.94184	0.591000	0.81541	.	.	.		0.418	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	Intron
C5orf42	65250	hgsc.bcm.edu	37	5	37176032	37176032	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr5:37176032T>C	ENST00000508244.1	-	30	6050	c.5957A>G	c.(5956-5958)gAt>gGt	p.D1986G	C5orf42_ENST00000425232.2_Missense_Mutation_p.D1986G|C5orf42_ENST00000274258.7_Missense_Mutation_p.D866G			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	1986						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			TGAACTCGTATCTACTTGCAT	0.348																																					p.D1986G		Atlas-SNP	.											.	C5orf42	422	.	0			c.A5957G						.						195.0	207.0	203.0					5																	37176032		2203	4300	6503	SO:0001583	missense	65250	exon31			CTCGTATCTACTT		CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.5957A>G	chr5.hg19:g.37176032T>C	ENSP00000421690:p.Asp1986Gly	82.0	0.0		141.0	21.0	NM_023073	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Missense_Mutation	SNP	ENST00000508244.1	hg19	CCDS34146.2	.	.	.	.	.	.	.	.	.	.	T	17.83	3.486665	0.63962	.	.	ENSG00000197603	ENST00000508244;ENST00000425232;ENST00000274258;ENST00000514429;ENST00000388739	T;T;T;T	0.28666	1.62;1.62;1.6;1.6	5.77	5.77	0.91146	.	0.077668	0.45126	D	0.000397	T	0.46288	0.1385	L	0.48642	1.525	0.30868	N	0.7328	D;D	0.76494	0.999;0.996	D;D	0.67382	0.951;0.929	T	0.50154	-0.8861	10	0.40728	T	0.16	.	13.4698	0.61276	0.0:0.0:0.0:1.0	.	1986;866	E9PH94;Q9H799	.;CE042_HUMAN	G	1986;1986;866;1034;866	ENSP00000421690:D1986G;ENSP00000389014:D1986G;ENSP00000274258:D866G;ENSP00000424223:D1034G	ENSP00000274258:D866G	D	-	2	0	C5orf42	37211789	0.998000	0.40836	0.920000	0.36463	0.099000	0.18886	4.272000	0.58908	2.203000	0.70933	0.533000	0.62120	GAT	.	.		0.348	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360806.1	NM_023073	
TNPO1	3842	hgsc.bcm.edu	37	5	72144312	72144312	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr5:72144312G>T	ENST00000337273.5	+	2	542	c.116G>T	c.(115-117)aGa>aTa	p.R39I	TNPO1_ENST00000506351.2_Missense_Mutation_p.R31I|TNPO1_ENST00000454282.1_Missense_Mutation_p.R39I|TNPO1_ENST00000447967.2_Missense_Mutation_p.R31I|TNPO1_ENST00000513944.1_3'UTR|TNPO1_ENST00000523768.1_Missense_Mutation_p.R39I	NM_002270.3	NP_002261.3	Q92973	TNPO1_HUMAN	transportin 1	39					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|protein import into nucleus, translocation (GO:0000060)|RNA metabolic process (GO:0016070)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(10)|lung(6)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	36		Lung NSC(167;0.0053)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;6.14e-54)		ACCATCCAGAGAACCGTGCAA	0.652																																					p.R39I		Atlas-SNP	.											.	TNPO1	90	.	0			c.G116T						.						82.0	71.0	75.0					5																	72144312		2203	4300	6503	SO:0001583	missense	3842	exon2			TCCAGAGAACCGT	U70322	CCDS4016.1, CCDS43329.1	5q13.1	2009-01-12	2004-01-29	2004-01-30	ENSG00000083312	ENSG00000083312		"""Importins"""	6401	protein-coding gene	gene with protein product	"""importin 2"""	602901	"""karyopherin (importin) beta 2"""	KPNB2		8808633, 9144189	Standard	NM_153188		Approved	MIP, TRN, IPO2, MIP1	uc003kci.4	Q92973	OTTHUMG00000100967	ENST00000337273.5:c.116G>T	chr5.hg19:g.72144312G>T	ENSP00000336712:p.Arg39Ile	49.0	0.0		60.0	4.0	NM_002270	B4DVC6|Q92957|Q92975	Missense_Mutation	SNP	ENST00000337273.5	hg19	CCDS43329.1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.131614	0.56828	.	.	ENSG00000083312	ENST00000337273;ENST00000454282;ENST00000447967;ENST00000523768;ENST00000506351	T;T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31;-0.31	3.06	2.14	0.27477	Armadillo-like helical (1);Armadillo-type fold (1);	0.110918	0.64402	D	0.000015	T	0.70684	0.3252	M	0.85859	2.78	0.80722	D	1	P;B	0.47762	0.9;0.134	P;B	0.44359	0.447;0.126	T	0.75491	-0.3299	10	0.66056	D	0.02	-1.2586	12.0099	0.53280	0.0:0.1769:0.8231:0.0	.	39;39	Q92973-3;Q92973	.;TNPO1_HUMAN	I	39;39;31;39;31	ENSP00000336712:R39I;ENSP00000398524:R39I;ENSP00000415164:R31I;ENSP00000428899:R39I;ENSP00000425118:R31I	ENSP00000336712:R39I	R	+	2	0	TNPO1	72180068	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	6.708000	0.74660	0.580000	0.29522	0.305000	0.20034	AGA	.	.		0.652	TNPO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000218577.3	NM_002270	
PCDHGA5	56110	hgsc.bcm.edu	37	5	140745937	140745937	+	Silent	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr5:140745937C>A	ENST00000518069.1	+	1	2040	c.2040C>A	c.(2038-2040)acC>acA	p.T680T	PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	680	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTATCAAGACCCCCATTGACC	0.602																																					p.T680T		Atlas-SNP	.											.	PCDHGA5	215	.	0			c.C2040A						.						293.0	309.0	303.0					5																	140745937		2201	4299	6500	SO:0001819	synonymous_variant	56110	exon1			CAAGACCCCCATT	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.2040C>A	chr5.hg19:g.140745937C>A		174.0	0.0		191.0	40.0	NM_032054	Q2M3F5|Q9Y5D2	Silent	SNP	ENST00000518069.1	hg19	CCDS54925.1																																																																																			.	.		0.602	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
GPRC6A	222545	hgsc.bcm.edu	37	6	117113958	117113958	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr6:117113958T>C	ENST00000310357.3	-	6	2149	c.2128A>G	c.(2128-2130)Act>Gct	p.T710A	GPRC6A_ENST00000368549.3_Missense_Mutation_p.T639A|GPRC6A_ENST00000530250.1_Missense_Mutation_p.T535A	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	710					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		CCCGTGCAAGTGAAGATAATA	0.438																																					p.T710A		Atlas-SNP	.											.	GPRC6A	152	.	0			c.A2128G						.						81.0	76.0	77.0					6																	117113958		2203	4300	6503	SO:0001583	missense	222545	exon6			TGCAAGTGAAGAT	AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.2128A>G	chr6.hg19:g.117113958T>C	ENSP00000309493:p.Thr710Ala	110.0	0.0		103.0	15.0	NM_148963	Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Missense_Mutation	SNP	ENST00000310357.3	hg19	CCDS5112.1	.	.	.	.	.	.	.	.	.	.	T	2.357	-0.347610	0.05208	.	.	ENSG00000173612	ENST00000310357;ENST00000368549;ENST00000530250	D;D;D	0.87029	-2.2;-2.2;-2.2	4.61	2.14	0.27477	GPCR, family 3, C-terminal (2);	0.224010	0.31312	N	0.007873	T	0.53658	0.1810	N	0.12831	0.26	0.09310	N	1	B;P;B	0.44090	0.151;0.826;0.259	B;B;B	0.40101	0.052;0.319;0.186	T	0.55755	-0.8091	10	0.27082	T	0.32	.	5.1681	0.15096	0.2764:0.0776:0.0:0.646	.	639;535;710	Q5T6X5-3;Q5T6X5-2;Q5T6X5	.;.;GPC6A_HUMAN	A	710;639;535	ENSP00000309493:T710A;ENSP00000357537:T639A;ENSP00000433465:T535A	ENSP00000309493:T710A	T	-	1	0	GPRC6A	117220651	0.017000	0.18338	0.015000	0.15790	0.005000	0.04900	0.397000	0.20883	0.265000	0.21872	-0.353000	0.07706	ACT	.	.		0.438	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041966.2		
THEMIS	387357	hgsc.bcm.edu	37	6	128135050	128135051	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr6:128135050_128135051GG>TT	ENST00000368248.2	-	4	883_884	c.735_736CC>AA	c.(733-738)ctCCcc>ctAAcc	p.P246T	THEMIS_ENST00000543064.1_Missense_Mutation_p.P246T|THEMIS_ENST00000537166.1_Missense_Mutation_p.P211T|THEMIS_ENST00000368250.1_Missense_Mutation_p.P167T	NM_001010923.2	NP_001010923.1	Q8N1K5	THMS1_HUMAN	thymocyte selection associated	246	CABIT 1.				negative T cell selection (GO:0043383)|positive T cell selection (GO:0043368)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(3)	60						TCTAGACTGGGGAGGATGCGGA	0.351																																					p.P246T|p.L245L		Atlas-SNP	.											THEMIS,NS,carcinoma,0,1|.	THEMIS	168	.	0			c.C736A|c.C735A						.																																			SO:0001583	missense	387357	exon4			GACTGGGGAGGAT|ACTGGGGAGGATG	AK094863	CCDS34534.1, CCDS55055.1	6q22.33	2012-02-08	2009-06-25	2009-06-25	ENSG00000172673	ENSG00000172673			21569	protein-coding gene	gene with protein product	"""thymocyte expressed molecule involved in selection"""	613607	"""chromosome 6 open reading frame 207"", ""chromosome 6 open reading frame 190"", ""thymocyte selection pathway associated"""	C6orf207, C6orf190, TSEPA		19597499, 19597498, 19597497	Standard	NM_001010923		Approved	bA325O24.4, FLJ40584, bA325O24.3	uc011ebt.2	Q8N1K5	OTTHUMG00000015534	ENST00000368248.2:c.735_736delinsTT	chr6.hg19:g.128135050_128135051delinsTT	ENSP00000357231:p.Pro246Thr	80.0|79.0	0.0		63.0	16.0	NM_001010923	A1L4F0|A8K7N1|B3KT31|B3KW32|B3KY07|F5H1J9|Q5T3C4|Q5T3C5|Q6MZT7	Missense_Mutation|Silent	SNP	ENST00000368248.2	hg19	CCDS34534.1																																																																																			.	.		0.351	THEMIS-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_001010923	
MRPL32	64983	hgsc.bcm.edu	37	7	42976921	42976921	+	Splice_Site	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr7:42976921A>G	ENST00000223324.2	+	3	500	c.313A>G	c.(313-315)Aac>Gac	p.N105D	MRPL32_ENST00000496564.1_Intron	NM_031903.2	NP_114109.1	Q9BYC8	RM32_HUMAN	mitochondrial ribosomal protein L32	105					translation (GO:0006412)	large ribosomal subunit (GO:0015934)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)	10						TGTTTTAAAGAACAACATAGA	0.368																																					p.N105D		Atlas-SNP	.											.	MRPL32	25	.	0			c.A313G						.						125.0	117.0	119.0					7																	42976921		2203	4300	6503	SO:0001630	splice_region_variant	64983	exon3			TTAAAGAACAACA	AB051343	CCDS5468.1	7p14	2012-09-13			ENSG00000106591	ENSG00000106591		"""Mitochondrial ribosomal proteins / large subunits"""	14035	protein-coding gene	gene with protein product		611839				11543634	Standard	NM_031903		Approved	HSPC283, L32mt, MRP-L32, bMRP-59b	uc003tia.3	Q9BYC8	OTTHUMG00000155180	ENST00000223324.2:c.313-1A>G	chr7.hg19:g.42976921A>G		167.0	0.0		251.0	67.0	NM_031903	Q96Q68|Q9P098	Missense_Mutation	SNP	ENST00000223324.2	hg19	CCDS5468.1	.	.	.	.	.	.	.	.	.	.	A	10.20	1.285418	0.23478	.	.	ENSG00000106591	ENST00000223324	.	.	.	5.9	0.948	0.19561	.	0.698413	0.15874	N	0.240395	T	0.27629	0.0679	L	0.27053	0.805	0.33983	D	0.648258	B	0.17852	0.024	B	0.18871	0.023	T	0.18840	-1.0324	8	.	.	.	-6.3114	4.1015	0.10015	0.5604:0.2598:0.0651:0.1147	.	105	Q9BYC8	RM32_HUMAN	D	105	.	.	N	+	1	0	MRPL32	42943446	0.961000	0.32948	0.958000	0.39756	0.561000	0.35649	1.973000	0.40550	0.135000	0.18707	0.528000	0.53228	AAC	.	.		0.368	MRPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338669.1	NM_031903	Missense_Mutation
TOX	9760	hgsc.bcm.edu	37	8	59750851	59750851	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr8:59750851C>T	ENST00000361421.1	-	5	933	c.713G>A	c.(712-714)cGg>cAg	p.R238Q		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	238						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				AGAGGCAGGCCGCTTCTCTCC	0.433																																					p.R238Q	Pancreas(161;610 1969 17913 21374 22725)	Atlas-SNP	.											.	TOX	83	.	0			c.G713A						.						54.0	63.0	60.0					8																	59750851		2199	4298	6497	SO:0001583	missense	9760	exon5			GCAGGCCGCTTCT		CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.713G>A	chr8.hg19:g.59750851C>T	ENSP00000354842:p.Arg238Gln	22.0	0.0		37.0	5.0	NM_014729	Q96AV5	Missense_Mutation	SNP	ENST00000361421.1	hg19	CCDS34897.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.454202	0.84209	.	.	ENSG00000198846	ENST00000361421	T	0.16324	2.35	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.25975	0.0633	L	0.52206	1.635	0.58432	D	0.999994	D	0.57899	0.981	P	0.47603	0.551	T	0.00289	-1.1844	9	.	.	.	.	20.0368	0.97565	0.0:1.0:0.0:0.0	.	238	O94900	TOX_HUMAN	Q	238	ENSP00000354842:R238Q	.	R	-	2	0	TOX	59913405	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.727000	0.93392	0.591000	0.81541	CGG	.	.		0.433	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378307.1	NM_014729	
RALYL	138046	hgsc.bcm.edu	37	8	85799965	85799965	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr8:85799965C>T	ENST00000521268.1	+	8	1917	c.812C>T	c.(811-813)aCa>aTa	p.T271I	RALYL_ENST00000518566.1_Missense_Mutation_p.T260I|RALYL_ENST00000523850.1_Missense_Mutation_p.T198I|RALYL_ENST00000521695.1_Missense_Mutation_p.T271I|RALYL_ENST00000517638.1_Missense_Mutation_p.T284I|RALYL_ENST00000521376.1_Intron|RALYL_ENST00000522455.1_Missense_Mutation_p.T271I	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	271							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GAAGAGATGACAGATGGGATA	0.483																																					p.T284I		Atlas-SNP	.											.	RALYL	123	.	0			c.C851T						.						155.0	159.0	157.0					8																	85799965		2011	4174	6185	SO:0001583	missense	138046	exon8			AGATGACAGATGG		CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.812C>T	chr8.hg19:g.85799965C>T	ENSP00000430367:p.Thr271Ile	135.0	0.0		278.0	18.0	NM_001100391	B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	ENST00000521268.1	hg19	CCDS55253.1	.	.	.	.	.	.	.	.	.	.	C	24.7	4.554996	0.86231	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850	T;T;T;T;T;T	0.15718	2.81;2.81;2.81;2.8;2.8;2.4	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.41119	0.1145	M	0.63428	1.95	0.80722	D	1	D;D;D;D	0.76494	0.995;0.999;0.999;0.995	D;D;D;D	0.80764	0.979;0.994;0.994;0.979	T	0.10222	-1.0639	10	0.44086	T	0.13	-7.1315	18.7753	0.91908	0.0:1.0:0.0:0.0	.	260;198;284;271	B3KT61;Q86SE5-2;G3V129;Q86SE5	.;.;.;RALYL_HUMAN	I	271;271;271;260;284;198	ENSP00000430394:T271I;ENSP00000428667:T271I;ENSP00000430367:T271I;ENSP00000430065:T260I;ENSP00000430128:T284I;ENSP00000428807:T198I	ENSP00000430128:T284I	T	+	2	0	RALYL	85962520	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.474000	0.73578	2.445000	0.82738	0.561000	0.74099	ACA	.	.		0.483	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379448.1		
TMEM2	23670	hgsc.bcm.edu	37	9	74355033	74355033	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:74355033A>G	ENST00000377044.4	-	5	1689	c.1150T>C	c.(1150-1152)Tat>Cat	p.Y384H	TMEM2_ENST00000377066.5_Missense_Mutation_p.Y384H	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	384					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		TCCACAGTATAAAATTCTCTT	0.408																																					p.Y384H		Atlas-SNP	.											.	TMEM2	112	.	0			c.T1150C						.						111.0	107.0	108.0					9																	74355033		2203	4300	6503	SO:0001583	missense	23670	exon5			CAGTATAAAATTC		CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.1150T>C	chr9.hg19:g.74355033A>G	ENSP00000366243:p.Tyr384His	88.0	0.0		85.0	21.0	NM_001135820	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	ENST00000377044.4	hg19	CCDS6638.1	.	.	.	.	.	.	.	.	.	.	A	7.603	0.673129	0.14776	.	.	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.72942	-0.7;-0.59	5.65	3.26	0.37387	.	0.522566	0.22405	N	0.060494	T	0.43166	0.1235	N	0.11427	0.14	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.09574	-1.0668	10	0.15066	T	0.55	.	3.445	0.07477	0.5441:0.2613:0.0689:0.1257	.	384;384	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	H	384	ENSP00000366243:Y384H;ENSP00000366266:Y384H	ENSP00000366243:Y384H	Y	-	1	0	TMEM2	73544853	0.999000	0.42202	0.996000	0.52242	0.957000	0.61999	0.876000	0.28092	0.402000	0.25451	0.402000	0.26972	TAT	.	.		0.408	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052618.2	NM_013390	
CEP78	84131	hgsc.bcm.edu	37	9	80861605	80861605	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:80861605G>T	ENST00000424347.2	+	6	1088	c.799G>T	c.(799-801)Ggc>Tgc	p.G267C	CEP78_ENST00000277082.5_Missense_Mutation_p.G267C|CEP78_ENST00000376597.4_Missense_Mutation_p.G267C|CEP78_ENST00000415759.2_Missense_Mutation_p.G267C|CEP78_ENST00000376598.2_Missense_Mutation_p.G267C			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	267					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						GCAACAGTGCGGCCTCACCAA	0.413																																					p.G267C		Atlas-SNP	.											.	CEP78	79	.	0			c.G799T						.						76.0	74.0	75.0					9																	80861605		1837	4102	5939	SO:0001583	missense	84131	exon6			CAGTGCGGCCTCA	BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.799G>T	chr9.hg19:g.80861605G>T	ENSP00000411284:p.Gly267Cys	64.0	0.0		76.0	4.0	NM_001098802	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Missense_Mutation	SNP	ENST00000424347.2	hg19		.	.	.	.	.	.	.	.	.	.	G	21.4	4.138721	0.77775	.	.	ENSG00000148019	ENST00000424347;ENST00000415085;ENST00000415759;ENST00000376597;ENST00000277082;ENST00000376598	T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56	5.61	5.61	0.85477	.	0.141721	0.44097	D	0.000498	T	0.71771	0.3379	M	0.73753	2.245	0.54753	D	0.999985	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	T	0.74654	-0.3593	10	0.87932	D	0	-13.3175	13.9467	0.64089	0.0751:0.0:0.9249:0.0	.	180;267;267;267	B7Z8H9;E9PHX5;Q5JTW2-2;Q5JTW2	.;.;.;CEP78_HUMAN	C	267	ENSP00000411284:G267C;ENSP00000399286:G267C;ENSP00000365782:G267C;ENSP00000277082:G267C;ENSP00000365783:G267C	ENSP00000277082:G267C	G	+	1	0	CEP78	80051425	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	8.880000	0.92407	2.627000	0.88993	0.561000	0.74099	GGC	.	.		0.413	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000052766.2	XM_095991	
GALNT12	79695	hgsc.bcm.edu	37	9	101608380	101608380	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:101608380A>G	ENST00000375011.3	+	9	1580	c.1580A>G	c.(1579-1581)gAg>gGg	p.E527G	RP11-92C4.3_ENST00000433997.1_RNA|RP11-92C4.3_ENST00000589257.1_RNA	NM_024642.4	NP_078918.3	Q8IXK2	GLT12_HUMAN	polypeptide N-acetylgalactosaminyltransferase 12	527	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	17		Acute lymphoblastic leukemia(62;0.0559)				ACTGCCCCAGAGAATCAGAAG	0.502																																					p.E527G		Atlas-SNP	.											.	GALNT12	37	.	0			c.A1580G						.						140.0	128.0	132.0					9																	101608380		2203	4300	6503	SO:0001583	missense	79695	exon9			CCCCAGAGAATCA	AB078146	CCDS6737.1	9q22.33	2014-03-13	2014-03-13		ENSG00000119514	ENSG00000119514	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19877	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 12"""	610290	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12)"""			12135769	Standard	NM_024642		Approved	GalNAc-T12	uc004ayz.3	Q8IXK2	OTTHUMG00000020348	ENST00000375011.3:c.1580A>G	chr9.hg19:g.101608380A>G	ENSP00000364150:p.Glu527Gly	257.0	0.0		252.0	44.0	NM_024642	Q5TCF7|Q8NG54|Q96CT9|Q9H771	Missense_Mutation	SNP	ENST00000375011.3	hg19	CCDS6737.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296467	0.23650	.	.	ENSG00000119514	ENST00000375011	T	0.28069	1.63	5.93	5.93	0.95920	Ricin B-related lectin (1);Ricin B lectin (3);	0.348674	0.34178	N	0.004194	T	0.35364	0.0929	L	0.39692	1.235	0.46954	D	0.999265	P	0.49559	0.925	P	0.49922	0.626	T	0.03212	-1.1060	10	0.33141	T	0.24	.	14.3318	0.66561	1.0:0.0:0.0:0.0	.	527	Q8IXK2	GLT12_HUMAN	G	527	ENSP00000364150:E527G	ENSP00000364150:E527G	E	+	2	0	GALNT12	100648201	1.000000	0.71417	0.349000	0.25694	0.161000	0.22273	2.696000	0.47052	2.271000	0.75665	0.533000	0.62120	GAG	.	.		0.502	GALNT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053382.1	NM_024642	
TLR4	7099	hgsc.bcm.edu	37	9	120475751	120475751	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:120475751C>T	ENST00000355622.6	+	3	1446	c.1345C>T	c.(1345-1347)Ctc>Ttc	p.L449F	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.L409F	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	449					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	ACTCAGAAACCTCATTTACCT	0.393																																					p.L449F		Atlas-SNP	.											.	TLR4	220	.	0			c.C1345T						.						97.0	96.0	97.0					9																	120475751		2203	4300	6503	SO:0001583	missense	7099	exon3			AGAAACCTCATTT	U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1345C>T	chr9.hg19:g.120475751C>T	ENSP00000363089:p.Leu449Phe	123.0	0.0		83.0	11.0	NM_138554	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	ENST00000355622.6	hg19	CCDS6818.1	.	.	.	.	.	.	.	.	.	.	C	18.00	3.524352	0.64747	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.06294	3.32;3.32	5.92	5.92	0.95590	.	0.000000	0.64402	D	0.000010	T	0.38585	0.1046	M	0.93763	3.455	0.44221	D	0.997058	D	0.89917	1.0	D	0.97110	1.0	T	0.48151	-0.9060	10	0.87932	D	0	.	20.3213	0.98679	0.0:1.0:0.0:0.0	.	449	O00206	TLR4_HUMAN	F	409;449	ENSP00000377997:L409F;ENSP00000363089:L449F	ENSP00000363089:L449F	L	+	1	0	TLR4	119515572	0.981000	0.34729	0.099000	0.21106	0.834000	0.47266	2.744000	0.47450	2.810000	0.96702	0.650000	0.86243	CTC	.	.		0.393	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055549.3	NM_138554	
PRRC2B	84726	hgsc.bcm.edu	37	9	134363453	134363453	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr9:134363453C>T	ENST00000357304.4	+	27	6250	c.6195C>T	c.(6193-6195)gcC>gcT	p.A2065A	PRRC2B_ENST00000405995.1_Silent_p.A1371A|SNORD62B_ENST00000426867.1_RNA|PRRC2B_ENST00000372249.1_Silent_p.A162A|PRRC2B_ENST00000458550.1_Silent_p.A1371A|SNORD62A_ENST00000428514.1_RNA	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	2065							poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						GCCTGGGTGCCTCCCAGATGT	0.587																																					p.A2065A		Atlas-SNP	.											.	PRRC2B	266	.	0			c.C6195T						.						24.0	26.0	26.0					9																	134363453		1970	4140	6110	SO:0001819	synonymous_variant	84726	exon27			GGGTGCCTCCCAG	AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.6195C>T	chr9.hg19:g.134363453C>T		108.0	0.0		113.0	14.0	NM_013318	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	ENST00000357304.4	hg19	CCDS48044.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287123	0.23478	.	.	ENSG00000130723	ENST00000320547	.	.	.	4.82	3.91	0.45181	.	.	.	.	.	T	0.62048	0.2396	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59867	-0.7373	4	.	.	.	-23.7936	11.898	0.52667	0.0:0.9144:0.0:0.0856	.	.	.	.	F	72	.	.	L	+	1	0	PRRC2B	133353274	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	1.153000	0.31676	2.382000	0.81193	0.561000	0.74099	CTC	.	.		0.587	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ANKRD30A	91074	hgsc.bcm.edu	37	10	37442511	37442511	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:37442511G>A	ENST00000602533.1	+	13	1650	c.1551G>A	c.(1549-1551)gaG>gaA	p.E517E	ANKRD30A_ENST00000361713.1_Silent_p.E517E|ANKRD30A_ENST00000374660.1_Silent_p.E517E			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	573					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GTCTCTGTGAGACTGTTTCAC	0.269																																					p.E517E		Atlas-SNP	.											.	ANKRD30A	448	.	0			c.G1551A						.						104.0	106.0	106.0					10																	37442511		1794	4063	5857	SO:0001819	synonymous_variant	91074	exon13			CTGTGAGACTGTT	AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1551G>A	chr10.hg19:g.37442511G>A		886.0	0.0		900.0	66.0	NM_052997	Q5W025	Silent	SNP	ENST00000602533.1	hg19																																																																																				.	.		0.269	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000047588.2	NM_052997	
ARID5B	84159	hgsc.bcm.edu	37	10	63851583	63851583	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:63851583C>A	ENST00000279873.7	+	10	2771	c.2361C>A	c.(2359-2361)agC>agA	p.S787R	ARID5B_ENST00000309334.5_Missense_Mutation_p.S544R	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	787					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					ACCGCTGCAGCTTCTCCAAGC	0.502																																					p.S787R		Atlas-SNP	.											.	ARID5B	125	.	0			c.C2361A						.						93.0	95.0	94.0					10																	63851583		2203	4300	6503	SO:0001583	missense	84159	exon10			CTGCAGCTTCTCC	M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.2361C>A	chr10.hg19:g.63851583C>A	ENSP00000279873:p.Ser787Arg	98.0	0.0		96.0	16.0	NM_032199	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Missense_Mutation	SNP	ENST00000279873.7	hg19	CCDS31208.1	.	.	.	.	.	.	.	.	.	.	C	10.59	1.392859	0.25118	.	.	ENSG00000150347	ENST00000279873;ENST00000309334	T;T	0.43688	0.95;0.94	5.87	2.68	0.31781	.	0.509120	0.25783	N	0.028325	T	0.27798	0.0684	L	0.34521	1.04	0.18873	N	0.999986	B	0.33448	0.412	B	0.31614	0.133	T	0.13818	-1.0495	10	0.46703	T	0.11	-4.3184	7.1541	0.25626	0.0:0.566:0.0:0.434	.	787	Q14865	ARI5B_HUMAN	R	787;544	ENSP00000279873:S787R;ENSP00000308862:S544R	ENSP00000279873:S787R	S	+	3	2	ARID5B	63521589	1.000000	0.71417	0.998000	0.56505	0.979000	0.70002	0.770000	0.26618	0.827000	0.34685	0.655000	0.94253	AGC	.	.		0.502	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048233.1	XM_084482	
LRIT1	26103	hgsc.bcm.edu	37	10	86001094	86001094	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:86001094C>A	ENST00000372105.3	-	1	123	c.102G>T	c.(100-102)atG>atT	p.M34I		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	34	LRRNT.					integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						TGCCATCACCCATGATATGGA	0.642																																					p.M34I		Atlas-SNP	.											.	LRIT1	73	.	0			c.G102T						.						35.0	35.0	35.0					10																	86001094		2203	4298	6501	SO:0001583	missense	26103	exon1			ATCACCCATGATA	AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.102G>T	chr10.hg19:g.86001094C>A	ENSP00000361177:p.Met34Ile	153.0	0.0		181.0	70.0	NM_015613	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	ENST00000372105.3	hg19	CCDS7373.1	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474448	0.26423	.	.	ENSG00000148602	ENST00000372105	T	0.34072	1.38	4.31	3.36	0.38483	Leucine-rich repeat-containing N-terminal (1);	0.172115	0.39834	N	0.001256	T	0.17152	0.0412	N	0.14661	0.345	0.22754	N	0.99877	B	0.02656	0.0	B	0.01281	0.0	T	0.12016	-1.0564	10	0.17832	T	0.49	.	6.0871	0.19973	0.0:0.5717:0.3174:0.1109	.	34	Q9P2V4	LRIT1_HUMAN	I	34	ENSP00000361177:M34I	ENSP00000361177:M34I	M	-	3	0	LRIT1	85991074	0.974000	0.33945	1.000000	0.80357	0.851000	0.48451	0.272000	0.18644	2.205000	0.71048	0.491000	0.48974	ATG	.	.		0.642	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049109.1	NM_015613	
CHUK	1147	hgsc.bcm.edu	37	10	101953098	101953098	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr10:101953098C>T	ENST00000370397.7	-	19	2151	c.2065G>A	c.(2065-2067)Gaa>Aaa	p.E689K	CHUK_ENST00000590930.1_5'UTR|RP11-316M21.7_ENST00000443919.1_RNA	NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	689					anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	TGATCATGTTCTGCTGAAGTC	0.473																																					p.E689K	Ovarian(159;52 1904 10536 35305 37148)	Atlas-SNP	.											.	CHUK	71	.	0			c.G2065A						.						127.0	109.0	115.0					10																	101953098		2203	4300	6503	SO:0001583	missense	1147	exon19			CATGTTCTGCTGA	AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.2065G>A	chr10.hg19:g.101953098C>T	ENSP00000359424:p.Glu689Lys	115.0	0.0		119.0	24.0	NM_001278	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	ENST00000370397.7	hg19	CCDS7488.1	.	.	.	.	.	.	.	.	.	.	C	8.738	0.918202	0.17982	.	.	ENSG00000213341	ENST00000370397	T	0.71103	-0.54	5.73	4.82	0.62117	.	0.692508	0.15390	N	0.264899	T	0.57051	0.2027	L	0.36672	1.1	0.26122	N	0.980533	B	0.17667	0.023	B	0.14578	0.011	T	0.39702	-0.9601	10	0.06236	T	0.91	-8.2869	12.3854	0.55328	0.0:0.8127:0.1873:0.0	.	689	O15111	IKKA_HUMAN	K	689	ENSP00000359424:E689K	ENSP00000359424:E689K	E	-	1	0	CHUK	101943088	1.000000	0.71417	0.993000	0.49108	0.946000	0.59487	2.494000	0.45329	1.391000	0.46566	0.650000	0.86243	GAA	.	.		0.473	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049836.1	NM_001278	
DCHS1	8642	hgsc.bcm.edu	37	11	6650989	6650989	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:6650989T>C	ENST00000299441.3	-	11	5360	c.4949A>G	c.(4948-4950)cAg>cGg	p.Q1650R	RP11-732A19.6_ENST00000526633.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	1650	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTCCTGCTGCTGGAAAGTAGG	0.652																																					p.Q1650R		Atlas-SNP	.											.	DCHS1	277	.	0			c.A4949G						.						40.0	41.0	41.0					11																	6650989		2201	4296	6497	SO:0001583	missense	8642	exon11			TGCTGCTGGAAAG	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.4949A>G	chr11.hg19:g.6650989T>C	ENSP00000299441:p.Gln1650Arg	58.0	0.0		66.0	9.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	hg19	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	T	4.728	0.135420	0.09032	.	.	ENSG00000166341	ENST00000299441	T	0.01705	4.68	5.25	-0.211	0.13172	Cadherin (2);Cadherin-like (1);	0.544274	0.15628	N	0.252516	T	0.01870	0.0059	L	0.33339	1.005	0.23739	N	0.996971	B	0.18166	0.026	B	0.20184	0.028	T	0.44112	-0.9349	10	0.19147	T	0.46	.	14.6338	0.68676	0.0:0.0:0.488:0.512	.	1650	Q96JQ0	PCD16_HUMAN	R	1650	ENSP00000299441:Q1650R	ENSP00000299441:Q1650R	Q	-	2	0	DCHS1	6607565	0.758000	0.28405	0.997000	0.53966	0.048000	0.14542	0.832000	0.27490	0.083000	0.17047	-0.460000	0.05396	CAG	.	.		0.652	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
SBF2	81846	hgsc.bcm.edu	37	11	9829584	9829584	+	Missense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:9829584G>T	ENST00000256190.8	-	32	4543	c.4406C>A	c.(4405-4407)gCt>gAt	p.A1469D	SBF2-AS1_ENST00000525636.1_RNA|SBF2-AS1_ENST00000534671.1_RNA|SBF2-AS1_ENST00000498905.2_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1469	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		GAAGACTGGAGCAAAACCACT	0.438																																					p.A1469D		Atlas-SNP	.											.	SBF2	146	.	0			c.C4406A						.						83.0	70.0	75.0					11																	9829584		2201	4294	6495	SO:0001583	missense	81846	exon32			ACTGGAGCAAAAC	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.4406C>A	chr11.hg19:g.9829584G>T	ENSP00000256190:p.Ala1469Asp	96.0	0.0		102.0	5.0	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	hg19	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	G	19.79	3.892446	0.72524	.	.	ENSG00000133812	ENST00000256190	D	0.93604	-3.25	5.91	5.91	0.95273	Myotubularin phosphatase domain (1);	0.414893	0.31051	N	0.008348	D	0.94414	0.8203	M	0.80508	2.5	0.48040	D	0.999579	P	0.36465	0.554	B	0.43575	0.424	D	0.94257	0.7499	10	0.87932	D	0	.	13.4829	0.61348	0.0708:0.0:0.9291:0.0	.	1469	Q86WG5	MTMRD_HUMAN	D	1469	ENSP00000256190:A1469D	ENSP00000256190:A1469D	A	-	2	0	SBF2	9786160	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.061000	0.89467	2.793000	0.96121	0.655000	0.94253	GCT	.	.		0.438	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
TEAD1	7003	hgsc.bcm.edu	37	11	12958680	12958680	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:12958680G>A	ENST00000526600.1	+	8	1127	c.904G>A	c.(904-906)Gaa>Aaa	p.E302K	TEAD1_ENST00000361985.2_Missense_Mutation_p.E398K|TEAD1_ENST00000527636.1_Missense_Mutation_p.E398K|TEAD1_ENST00000361905.4_Missense_Mutation_p.E383K|TEAD1_ENST00000334310.6_Missense_Mutation_p.E329K|TEAD1_ENST00000527575.1_Missense_Mutation_p.E340K			P28347	TEAD1_HUMAN	TEA domain family member 1 (SV40 transcriptional enhancer factor)	398	Transcriptional activation. {ECO:0000255}.				gene expression (GO:0010467)|hippo signaling (GO:0035329)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)	17				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGATACACAAGAAACTCTACT	0.353																																					p.E398K		Atlas-SNP	.											.	TEAD1	40	.	0			c.G1192A						.						97.0	90.0	92.0					11																	12958680		2200	4294	6494	SO:0001583	missense	7003	exon13			ACACAAGAAACTC	X84839	CCDS7810.1, CCDS7810.2	11p15.4	2008-11-12				ENSG00000187079			11714	protein-coding gene	gene with protein product		189967	"""atrophia areata, peripapillary chorioretinal degeneration"""	TCF13, AA		1851669, 9889009, 15016762	Standard	NM_021961		Approved	TEF-1	uc021qdx.1	P28347		ENST00000526600.1:c.904G>A	chr11.hg19:g.12958680G>A	ENSP00000435393:p.Glu302Lys	160.0	0.0		152.0	23.0	NM_021961	A4FUP2|E7EV65	Missense_Mutation	SNP	ENST00000526600.1	hg19		.	.	.	.	.	.	.	.	.	.	G	26.4	4.736256	0.89482	.	.	ENSG00000187079	ENST00000361905;ENST00000527636;ENST00000527575;ENST00000334310;ENST00000361985;ENST00000526600	T;T;T;T;T;T	0.31769	1.48;1.48;1.48;1.48;1.48;1.48	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.68109	0.2965	M	0.93507	3.425	0.52501	D	0.999956	D;D;D	0.89917	0.978;0.999;1.0	D;D;D	0.91635	0.966;0.998;0.999	T	0.76838	-0.2811	10	0.87932	D	0	-5.4151	19.2947	0.94117	0.0:0.0:1.0:0.0	.	329;302;398	A4FUP2;E9PKB7;P28347	.;.;TEAD1_HUMAN	K	383;398;340;329;398;302	ENSP00000355332:E383K;ENSP00000435233:E398K;ENSP00000435977:E340K;ENSP00000334754:E329K;ENSP00000354588:E398K;ENSP00000435393:E302K	ENSP00000334754:E329K	E	+	1	0	TEAD1	12915256	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.803000	0.99136	2.652000	0.90054	0.650000	0.86243	GAA	.	.		0.353	TEAD1-007	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000387220.1	NM_021961	
GLYATL1	92292	hgsc.bcm.edu	37	11	58722261	58722261	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:58722261G>A	ENST00000317391.4	+	6	545	c.205G>A	c.(205-207)Gat>Aat	p.D69N	GLYATL1_ENST00000300079.5_Missense_Mutation_p.D100N|RP11-142C4.6_ENST00000533954.1_RNA	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	69						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	TGATGACATGGATTCATACAC	0.363																																					p.D100N		Atlas-SNP	.											.	GLYATL1	89	.	0			c.G298A						.						94.0	88.0	90.0					11																	58722261		2201	4295	6496	SO:0001583	missense	92292	exon5			GACATGGATTCAT	AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.205G>A	chr11.hg19:g.58722261G>A	ENSP00000322223:p.Asp69Asn	225.0	0.0		150.0	35.0	NM_080661	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	ENST00000317391.4	hg19	CCDS55768.1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.036001	0.35893	.	.	ENSG00000166840	ENST00000526351;ENST00000317391;ENST00000532726;ENST00000300079	T;T;T;T	0.28255	1.62;1.62;1.62;1.62	2.37	0.244	0.15507	Acyl-CoA N-acyltransferase (1);Glycine N-acyltransferase, N-terminal (1);	0.680488	0.12904	U	0.429543	T	0.29976	0.0750	M	0.83223	2.63	0.09310	N	0.999999	B;B	0.30033	0.17;0.266	B;B	0.25506	0.015;0.061	T	0.27191	-1.0081	10	0.46703	T	0.11	.	3.6059	0.08042	0.1662:0.2604:0.5733:0.0	.	100;69	Q969I3-2;Q969I3	.;GLYL1_HUMAN	N	92;69;69;100	ENSP00000434652:D92N;ENSP00000322223:D69N;ENSP00000436116:D69N;ENSP00000300079:D100N	ENSP00000300079:D100N	D	+	1	0	GLYATL1	58478837	0.404000	0.25328	0.000000	0.03702	0.038000	0.13279	1.183000	0.32041	-0.073000	0.12842	0.195000	0.17529	GAT	.	.		0.363	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393783.1	NM_080661	
SLC35F2	54733	hgsc.bcm.edu	37	11	107663412	107663412	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr11:107663412T>C	ENST00000525815.1	-	8	1474	c.1054A>G	c.(1054-1056)Agc>Ggc	p.S352G	SLC35F2_ENST00000265836.7_Missense_Mutation_p.S204G|SLC35F2_ENST00000525071.1_Silent_p.P349P|SLC35F2_ENST00000429869.1_Missense_Mutation_p.S352G|SLC35F2_ENST00000375682.4_Missense_Mutation_p.S305G	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	352					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		ATCCCAATGCTGGTGACTGGA	0.592																																					p.S352G		Atlas-SNP	.											.	SLC35F2	29	.	0			c.A1054G						.						56.0	61.0	59.0					11																	107663412		1996	4181	6177	SO:0001583	missense	54733	exon8			CAATGCTGGTGAC		CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.1054A>G	chr11.hg19:g.107663412T>C	ENSP00000436785:p.Ser352Gly	120.0	0.0		79.0	20.0	NM_017515	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	ENST00000525815.1	hg19	CCDS41709.1	.	.	.	.	.	.	.	.	.	.	T	14.66	2.601920	0.46423	.	.	ENSG00000110660	ENST00000525815;ENST00000265836;ENST00000375682;ENST00000429869	.	.	.	5.13	-0.488	0.12056	.	0.648971	0.16728	N	0.201974	T	0.29556	0.0737	L	0.43152	1.355	0.26718	N	0.970839	B	0.22080	0.064	B	0.30943	0.122	T	0.22208	-1.0223	9	0.28530	T	0.3	.	3.3906	0.07287	0.2951:0.1757:0.0:0.5292	.	352	Q8IXU6	S35F2_HUMAN	G	352;204;305;352	.	ENSP00000265836:S204G	S	-	1	0	SLC35F2	107168622	0.965000	0.33210	0.980000	0.43619	0.782000	0.44232	-0.021000	0.12504	-0.235000	0.09767	-0.336000	0.08194	AGC	.	.		0.592	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389417.1	NM_017515	
KLRK1	22914	hgsc.bcm.edu	37	12	10531200	10531200	+	Missense_Mutation	SNP	T	T	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:10531200T>C	ENST00000240618.6	-	6	522	c.382A>G	c.(382-384)Atg>Gtg	p.M128V	KLRC4-KLRK1_ENST00000539300.1_3'UTR|RP11-277P12.20_ENST00000500682.1_RNA|KLRK1_ENST00000540818.1_Missense_Mutation_p.M128V	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	128	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TTTTGAGACATACAAGAAGCC	0.368																																					p.M128V		Atlas-SNP	.											.	.	.	.	0			c.A382G						.						93.0	97.0	95.0					12																	10531200		2203	4300	6503	SO:0001583	missense	0	exon11			GAGACATACAAGA	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.382A>G	chr12.hg19:g.10531200T>C	ENSP00000240618:p.Met128Val	93.0	0.0		60.0	23.0	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	hg19	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.219305	0.00286	.	.	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.62498	0.02;0.02	5.96	-10.6	0.00265	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.711003	0.13304	N	0.398000	T	0.24774	0.0601	N	0.10664	0.02	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.12156	0.007;0.002	T	0.39563	-0.9608	10	0.02654	T	1	.	7.2069	0.25911	0.0964:0.5271:0.1015:0.275	.	109;128	Q1HEA1;P26718	.;NKG2D_HUMAN	V	128	ENSP00000240618:M128V;ENSP00000446003:M128V	ENSP00000240618:M128V	M	-	1	0	KLRK1	10422467	0.001000	0.12720	0.000000	0.03702	0.028000	0.11728	-0.835000	0.04386	-1.503000	0.01812	-1.127000	0.01993	ATG	.	.		0.368	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
MON2	23041	hgsc.bcm.edu	37	12	62926222	62926222	+	Nonsense_Mutation	SNP	G	G	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:62926222G>T	ENST00000393632.2	+	12	1796	c.1405G>T	c.(1405-1407)Gaa>Taa	p.E469*	MON2_ENST00000552738.1_Nonsense_Mutation_p.E469*|MON2_ENST00000552115.1_Nonsense_Mutation_p.E469*|MON2_ENST00000393630.3_Nonsense_Mutation_p.E469*|MON2_ENST00000280379.6_Nonsense_Mutation_p.E469*|MON2_ENST00000546600.1_Nonsense_Mutation_p.E469*|MON2_ENST00000393629.2_Nonsense_Mutation_p.E469*	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	469					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTTCAGCTTAGAAATGTTGGA	0.328																																					p.E469X		Atlas-SNP	.											MON2,NS,carcinoma,0,1	MON2	160	.	0			c.G1405T						.						97.0	84.0	89.0					12																	62926222		2203	4300	6503	SO:0001587	stop_gained	23041	exon12			AGCTTAGAAATGT		CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.1405G>T	chr12.hg19:g.62926222G>T	ENSP00000377252:p.Glu469*	122.0	0.0		124.0	19.0	NM_015026	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Nonsense_Mutation	SNP	ENST00000393632.2	hg19	CCDS31849.1	.	.	.	.	.	.	.	.	.	.	G	41	8.997676	0.99031	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	.	.	.	5.4	4.51	0.55191	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-6.3575	14.2964	0.66316	0.072:0.0:0.928:0.0	.	.	.	.	X	469;469;469;469;397;469;469;469	.	.	E	+	1	0	MON2	61212489	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	9.869000	0.99810	1.259000	0.44117	0.563000	0.77884	GAA	.	.		0.328	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406767.3	NM_015026	
SETD1B	23067	hgsc.bcm.edu	37	12	122252796	122252796	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr12:122252796C>T	ENST00000604567.1	+	7	2743	c.2675C>T	c.(2674-2676)gCc>gTc	p.A892V	SETD1B_ENST00000542440.1_Missense_Mutation_p.A892V|SETD1B_ENST00000267197.5_Missense_Mutation_p.A892V			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	892	Pro-rich.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						GCTTTCCGGGCCTTTGACGAG	0.637																																					p.A892V		Atlas-SNP	.											.	SETD1B	105	.	0			c.C2675T						.						86.0	78.0	80.0					12																	122252796		692	1591	2283	SO:0001583	missense	23067	exon6			TCCGGGCCTTTGA	AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.2675C>T	chr12.hg19:g.122252796C>T	ENSP00000474253:p.Ala892Val	130.0	0.0		119.0	30.0	NM_015048	F6MFW1	Missense_Mutation	SNP	ENST00000604567.1	hg19		.	.	.	.	.	.	.	.	.	.	C	14.58	2.577164	0.45902	.	.	ENSG00000139718	ENST00000542440;ENST00000267197	D;D	0.95069	-3.6;-3.6	4.78	4.78	0.61160	.	.	.	.	.	D	0.95790	0.8630	M	0.65498	2.005	0.48696	D	0.999695	D	0.60575	0.988	P	0.54759	0.76	D	0.96261	0.9191	9	0.66056	D	0.02	.	17.8046	0.88598	0.0:1.0:0.0:0.0	.	892	Q9UPS6	SET1B_HUMAN	V	892	ENSP00000442924:A892V;ENSP00000267197:A892V	ENSP00000267197:A892V	A	+	2	0	SETD1B	120737179	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.936000	0.70153	2.181000	0.69327	0.561000	0.74099	GCC	.	.		0.637	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000468264.1	XM_037523	
BRCA2	675	hgsc.bcm.edu	37	13	32914479	32914479	+	Missense_Mutation	SNP	C	C	G	rs80358834		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:32914479C>G	ENST00000380152.3	+	11	6220	c.5987C>G	c.(5986-5988)gCa>gGa	p.A1996G	BRCA2_ENST00000544455.1_Missense_Mutation_p.A1996G			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1996					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTACAAAACGCAAGACAAGTG	0.378			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											p.A1996G	Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)	Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	.	BRCA2	812	.	0			c.C5987G						.						64.0	69.0	67.0					13																	32914479		2202	4298	6500	SO:0001583	missense	675	exon11	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	AAAACGCAAGACA	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.5987C>G	chr13.hg19:g.32914479C>G	ENSP00000369497:p.Ala1996Gly	66.0	0.0		56.0	22.0	NM_000059	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	ENST00000380152.3	hg19	CCDS9344.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.598770	0.87055	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	D;D	0.82344	-1.6;-1.6	5.72	5.72	0.89469	.	0.086607	0.50627	D	0.000120	D	0.91236	0.7238	M	0.75264	2.295	0.50813	D	0.999898	D	0.89917	1.0	D	0.72338	0.977	D	0.91407	0.5148	10	0.72032	D	0.01	.	19.8965	0.96963	0.0:1.0:0.0:0.0	.	1996	P51587	BRCA2_HUMAN	G	1996	ENSP00000369497:A1996G;ENSP00000439902:A1996G	ENSP00000369497:A1996G	A	+	2	0	BRCA2	31812479	1.000000	0.71417	0.973000	0.42090	0.975000	0.68041	6.118000	0.71583	2.717000	0.92951	0.655000	0.94253	GCA	.	.		0.378	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046000.2	NM_000059	
PCDH17	27253	hgsc.bcm.edu	37	13	58206732	58206732	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:58206732C>A	ENST00000377918.3	+	1	78	c.52C>A	c.(52-54)Ctc>Atc	p.L18I		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	18	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TGCCCTCACTCTCAAGAACCT	0.612																																					p.L18I	Melanoma(72;952 1291 1619 12849 33676)	Atlas-SNP	.											.	PCDH17	304	.	0			c.C52A						.						48.0	44.0	46.0					13																	58206732		2203	4300	6503	SO:0001583	missense	27253	exon1			CTCACTCTCAAGA	AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.52C>A	chr13.hg19:g.58206732C>A	ENSP00000367151:p.Leu18Ile	103.0	0.0		98.0	23.0	NM_001040429	A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	ENST00000377918.3	hg19	CCDS31986.1	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070716	0.36566	.	.	ENSG00000118946	ENST00000377918	T	0.15487	2.42	5.55	4.7	0.59300	Cadherin (2);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.34861	0.0912	M	0.76328	2.33	0.42050	D	0.991119	D;D	0.57571	0.972;0.98	P;P	0.59643	0.861;0.729	T	0.11275	-1.0594	9	.	.	.	.	10.0683	0.42317	0.0:0.7905:0.1386:0.0709	.	18;18	O14917-2;O14917	.;PCD17_HUMAN	I	18	ENSP00000367151:L18I	.	L	+	1	0	PCDH17	57104733	0.804000	0.28969	0.984000	0.44739	0.843000	0.47879	1.364000	0.34171	1.570000	0.49709	0.655000	0.94253	CTC	.	.		0.612	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045139.1	NM_001040429	
LMO7	4008	hgsc.bcm.edu	37	13	76381696	76381696	+	Missense_Mutation	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:76381696C>A	ENST00000321797.8	+	8	1299	c.578C>A	c.(577-579)aCt>aAt	p.T193N	LMO7_ENST00000357063.3_Missense_Mutation_p.T478N|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000377534.3_Missense_Mutation_p.T478N|LMO7_ENST00000526202.1_Intron|LMO7_ENST00000465261.2_Missense_Mutation_p.T193N|RP11-29G8.3_ENST00000563635.1_RNA			Q8WWI1	LMO7_HUMAN	LIM domain 7	478					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		ATTGATCCCACTTCTGGCCCA	0.468																																					p.T193N		Atlas-SNP	.											.	LMO7	334	.	0			c.C578A						.						102.0	90.0	94.0					13																	76381696		1568	3582	5150	SO:0001583	missense	4008	exon7			ATCCCACTTCTGG	AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.578C>A	chr13.hg19:g.76381696C>A	ENSP00000317802:p.Thr193Asn	86.0	0.0		84.0	39.0	NM_015842	E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	ENST00000321797.8	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.514042|4.514042	0.85389|0.85389	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000447038|ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526528	.|T;T;T;T	.|0.56275	.|0.47;0.47;0.47;0.47	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	.|0.055457	.|0.64402	.|D	.|0.000001	T|T	0.72145|0.72145	0.3424|0.3424	M|M	0.66939|0.66939	2.045|2.045	0.54753|0.54753	D|D	0.999988|0.999988	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.69307	.|0.963;0.963	T|T	0.73382|0.73382	-0.4000|-0.4000	5|10	.|0.72032	.|D	.|0.01	-17.5198|-17.5198	19.8807|19.8807	0.96899|0.96899	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|478;193	.|Q8WWI1;E9PLH4	.|LMO7_HUMAN;.	Q|N	101|478;478;193;193;99	.|ENSP00000349571:T478N;ENSP00000366757:T478N;ENSP00000317802:T193N;ENSP00000433352:T193N	.|ENSP00000317802:T193N	H|T	+|+	3|2	2|0	LMO7|LMO7	75279697|75279697	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.921000|0.921000	0.55340|0.55340	7.206000|7.206000	0.77891|0.77891	2.698000|2.698000	0.92095|0.92095	0.655000|0.655000	0.94253|0.94253	CAC|ACT	.	.		0.468	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000045301.3	NM_005358	
UBAC2	337867	hgsc.bcm.edu	37	13	100020041	100020041	+	Splice_Site	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:100020041G>A	ENST00000403766.3	+	8	943	c.808G>A	c.(808-810)Gga>Aga	p.G270R	UBAC2_ENST00000460562.1_3'UTR|UBAC2_ENST00000376440.2_Splice_Site_p.G235R	NM_001144072.1	NP_001137544.1	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2	270					protein localization to endoplasmic reticulum (GO:0070972)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)	10	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTCTTTTTAGGGAGGAATGAT	0.458																																					p.G270R		Atlas-SNP	.											.	UBAC2	23	.	0			c.G808A						.						140.0	123.0	129.0					13																	100020041		2203	4300	6503	SO:0001630	splice_region_variant	337867	exon8			TTTTAGGGAGGAA	AK055110	CCDS9490.1, CCDS45064.1	13q32.3	2012-02-01	2007-04-20	2007-04-20	ENSG00000134882	ENSG00000134882			20486	protein-coding gene	gene with protein product			"""phosphoglycerate dehydrogenase like 1"""	PHGDHL1			Standard	NM_177967		Approved	FLJ30548, RP11-178C10.1	uc001voa.4	Q8NBM4	OTTHUMG00000017267	ENST00000403766.3:c.808-1G>A	chr13.hg19:g.100020041G>A		153.0	0.0		142.0	45.0	NM_001144072	B3KNV7|Q0VAB5|Q5W0W6|Q5W0W9|Q6GQR2|Q6P4B0|Q8N2E8|Q96NW2	Missense_Mutation	SNP	ENST00000403766.3	hg19	CCDS45064.1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867522	0.72065	.	.	ENSG00000134882	ENST00000403766;ENST00000355700;ENST00000376440	.	.	.	5.56	3.83	0.44106	.	0.328328	0.34628	N	0.003816	T	0.68192	0.2974	M	0.65975	2.015	0.43517	D	0.995789	B;D;D;P	0.69078	0.214;0.997;0.979;0.828	B;D;P;B	0.64410	0.062;0.925;0.606;0.223	T	0.66156	-0.5994	8	.	.	.	-15.2089	8.4545	0.32890	0.179:0.0:0.821:0.0	.	200;235;270;270	B7Z6T7;Q8NBM4-2;A8K2S7;Q8NBM4	.;.;.;UBAC2_HUMAN	R	270;136;235	.	.	G	+	1	0	UBAC2	98818042	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.457000	0.66672	0.709000	0.31976	0.561000	0.74099	GGA	.	.		0.458	UBAC2-002	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045588.1	NM_177967	Missense_Mutation
EXOC3L4	91828	hgsc.bcm.edu	37	14	103568956	103568956	+	Missense_Mutation	SNP	C	C	T	rs371500721		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr14:103568956C>T	ENST00000380069.3	+	2	972	c.896C>T	c.(895-897)cCc>cTc	p.P299L		NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	299					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						GAGGTGCAGCCCGCGTATGCG	0.731													C|||	1	0.000199681	0.0	0.0	5008	,	,		11558	0.0		0.001	False		,,,				2504	0.0				p.P299L		Atlas-SNP	.											.	EXOC3L4	35	.	0			c.C896T						.	C	LEU/PRO	0,3814		0,0,1907	4.0	7.0	6.0		896	4.3	0.8	14		6	6,7644		0,6,3819	no	missense	EXOC3L4	NM_001077594.1	98	0,6,5726	TT,TC,CC		0.0784,0.0,0.0523	probably-damaging	299/723	103568956	6,11458	1907	3825	5732	SO:0001583	missense	91828	exon2			TGCAGCCCGCGTA	AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.896C>T	chr14.hg19:g.103568956C>T	ENSP00000369409:p.Pro299Leu	2.0	0.0		5.0	4.0	NM_001077594	Q14CR2	Missense_Mutation	SNP	ENST00000380069.3	hg19	CCDS32163.1	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104215	0.37145	0.0	7.84E-4	ENSG00000205436	ENST00000380069	T	0.09911	2.93	4.33	4.33	0.51752	.	0.390087	0.23470	N	0.047831	T	0.25531	0.0621	M	0.65975	2.015	0.50467	D	0.999877	D	0.69078	0.997	D	0.65874	0.939	T	0.00664	-1.1620	10	0.72032	D	0.01	-33.0873	8.042	0.30527	0.0:0.8914:0.0:0.1086	.	299	Q17RC7	EX3L4_HUMAN	L	299	ENSP00000369409:P299L	ENSP00000369409:P299L	P	+	2	0	EXOC3L4	102638709	0.041000	0.20044	0.834000	0.33040	0.184000	0.23303	1.627000	0.37050	2.242000	0.73789	0.491000	0.48974	CCC	.	.		0.731	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415663.1	XM_941093	
SHCBP1	79801	hgsc.bcm.edu	37	16	46651615	46651615	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr16:46651615C>T	ENST00000303383.3	-	3	584	c.318G>A	c.(316-318)ttG>ttA	p.L106L	SHCBP1_ENST00000564272.1_5'Flank	NM_024745.4	NP_079021	Q8NEM2	SHCBP_HUMAN	SHC SH2-domain binding protein 1	106					fibroblast growth factor receptor signaling pathway (GO:0008543)|regulation of neural precursor cell proliferation (GO:2000177)					breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		all_cancers(37;0.00404)|all_epithelial(9;0.00527)|all_lung(18;0.0413)|Lung NSC(13;0.213)				GGACCTTCTCCAAGAACTCAG	0.448																																					p.L106L		Atlas-SNP	.											.	SHCBP1	54	.	0			c.G318A						.						111.0	102.0	105.0					16																	46651615		2203	4300	6503	SO:0001819	synonymous_variant	79801	exon3			CTTCTCCAAGAAC	AK055931	CCDS10720.1	16q11	2008-02-05			ENSG00000171241	ENSG00000171241			29547	protein-coding gene	gene with protein product		611027				10086341	Standard	NM_024745		Approved	FLJ22009	uc002eec.4	Q8NEM2	OTTHUMG00000132540	ENST00000303383.3:c.318G>A	chr16.hg19:g.46651615C>T		111.0	0.0		99.0	4.0	NM_024745	Q96N60|Q9BVS0|Q9H6P6	Silent	SNP	ENST00000303383.3	hg19	CCDS10720.1																																																																																			.	.		0.448	SHCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255740.1	NM_024745	
TP53	7157	hgsc.bcm.edu	37	17	7577082	7577082	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:7577082C>T	ENST00000269305.4	-	8	1045	c.856G>A	c.(856-858)Gaa>Aaa	p.E286K	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.E286K|TP53_ENST00000420246.2_Missense_Mutation_p.E286K|TP53_ENST00000445888.2_Missense_Mutation_p.E286K|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.E286K	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	286	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in LFS; germline mutation and in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:11023613, ECO:0000269|PubMed:8316628}.|E -> L (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> Q (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:8829627}.|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E286K(58)|p.E286*(22)|p.0?(8)|p.E286Q(5)|p.?(2)|p.E286fs*59(2)|p.E286fs*17(2)|p.R283fs*16(2)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.T284fs*57(1)|p.T284_G293del10(1)|p.E285_L289delEEENL(1)|p.R283fs*56(1)|p.E285fs*13(1)|p.G279fs*59(1)|p.R283fs*59(1)|p.V272_K292del21(1)|p.E285_N288delEEEN(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGATTCTCTTCCTCTGTGCGC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.E286K	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,malignant_melanoma,0,1	TP53	33396	.	112	Substitution - Missense(63)|Substitution - Nonsense(22)|Deletion - Frameshift(11)|Whole gene deletion(8)|Deletion - In frame(6)|Unknown(2)	lung(18)|upper_aerodigestive_tract(13)|breast(10)|large_intestine(9)|urinary_tract(9)|skin(9)|oesophagus(9)|haematopoietic_and_lymphoid_tissue(8)|liver(7)|central_nervous_system(6)|bone(4)|ovary(3)|stomach(2)|vulva(1)|soft_tissue(1)|eye(1)|biliary_tract(1)|endometrium(1)	c.G856A	GRCh37	CM076567	TP53	M		.						95.0	81.0	86.0					17																	7577082		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	TCTCTTCCTCTGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.856G>A	chr17.hg19:g.7577082C>T	ENSP00000269305:p.Glu286Lys	91.0	1.0		107.0	66.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.310731	0.81358	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99856	-7.21;-7.21;-7.21;-7.21;-7.21;-7.21	4.99	4.99	0.66335	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99883	0.9944	M	0.92077	3.27	0.58432	D	0.999999	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.77557	0.983;0.985;0.982;0.99	D	0.96355	0.9261	10	0.87932	D	0	-23.2961	15.807	0.78520	0.0:1.0:0.0:0.0	.	286;286;286;286	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	K	286;286;286;286;286;275;154	ENSP00000352610:E286K;ENSP00000269305:E286K;ENSP00000398846:E286K;ENSP00000391127:E286K;ENSP00000391478:E286K;ENSP00000425104:E154K	ENSP00000269305:E286K	E	-	1	0	TP53	7517807	1.000000	0.71417	0.972000	0.41901	0.455000	0.32408	7.587000	0.82613	2.579000	0.87056	0.462000	0.41574	GAA	.	.		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
VEZF1	7716	hgsc.bcm.edu	37	17	56056622	56056622	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:56056622C>T	ENST00000581208.1	-	5	1069	c.1029G>A	c.(1027-1029)caG>caA	p.Q343Q	VEZF1_ENST00000584396.1_Silent_p.Q334Q	NM_007146.2	NP_009077.2	Q14119	VEZF1_HUMAN	vascular endothelial zinc finger 1	343	Poly-Gln.				angiogenesis (GO:0001525)|cellular defense response (GO:0006968)|endothelial cell development (GO:0001885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(2)|lung(5)|ovary(1)	10						gctgctgctgctgctgctgct	0.453																																					p.Q343Q		Atlas-SNP	.											.	VEZF1	50	.	0			c.G1029A						.																																			SO:0001819	synonymous_variant	7716	exon5			CTGCTGCTGCTGC	D28118	CCDS32687.1	17q22	2012-10-05	2006-08-16	2006-08-16	ENSG00000136451	ENSG00000136451		"""Zinc fingers, C2H2-type"""	12949	protein-coding gene	gene with protein product		606747	"""zinc finger protein 161"""	ZNF161		8035792	Standard	XM_005257643		Approved	DB1	uc002ivf.1	Q14119	OTTHUMG00000178777	ENST00000581208.1:c.1029G>A	chr17.hg19:g.56056622C>T		130.0	0.0		224.0	34.0	NM_007146		Silent	SNP	ENST00000581208.1	hg19	CCDS32687.1																																																																																			.	.		0.453	VEZF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443321.1		
STRADA	92335	hgsc.bcm.edu	37	17	61791458	61791458	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr17:61791458G>A	ENST00000336174.6	-	5	246	c.134C>T	c.(133-135)gCg>gTg	p.A45V	STRADA_ENST00000582137.1_Missense_Mutation_p.A16V|RP11-51F16.8_ENST00000580553.1_3'UTR|STRADA_ENST00000447001.3_Intron|STRADA_ENST00000580039.1_Intron|STRADA_ENST00000245865.5_5'UTR|STRADA_ENST00000579340.1_5'UTR|STRADA_ENST00000375840.4_5'UTR|STRADA_ENST00000392950.4_Missense_Mutation_p.A8V	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	45					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)	p.A45V(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						CTCTGAGCTCGCATCATTGGT	0.473																																					p.A45V		Atlas-SNP	.											STRADA,NS,carcinoma,0,1	STRADA	27	.	1	Substitution - Missense(1)	kidney(1)	c.C134T						.						117.0	98.0	104.0					17																	61791458		2203	4300	6503	SO:0001583	missense	92335	exon5			GAGCTCGCATCAT	AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.134C>T	chr17.hg19:g.61791458G>A	ENSP00000336655:p.Ala45Val	106.0	1.0		132.0	64.0	NM_001003787	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	ENST00000336174.6	hg19	CCDS32703.1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.961836	0.53400	.	.	ENSG00000125695	ENST00000336174;ENST00000392950;ENST00000245865	T;T	0.56103	0.54;0.48	5.66	5.66	0.87406	Protein kinase-like domain (1);	0.140365	0.48767	D	0.000164	T	0.43389	0.1245	N	0.24115	0.695	0.80722	D	1	P;P;P;P	0.49253	0.555;0.921;0.456;0.555	B;B;B;B	0.40256	0.08;0.324;0.118;0.08	T	0.48281	-0.9049	10	0.59425	D	0.04	.	19.7543	0.96284	0.0:0.0:1.0:0.0	.	16;8;8;45	B4DW17;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;STRAA_HUMAN	V	45;8;7	ENSP00000336655:A45V;ENSP00000376677:A8V	ENSP00000245865:A7V	A	-	2	0	STRADA	59145190	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.567000	0.73983	2.680000	0.91292	0.561000	0.74099	GCG	.	.		0.473	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443894.1		
MYOM1	8736	hgsc.bcm.edu	37	18	3083787	3083787	+	Splice_Site	SNP	T	T	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr18:3083787T>A	ENST00000356443.4	-	33	4817	c.4484A>T	c.(4483-4485)aAt>aTt	p.N1495I	MYOM1_ENST00000261606.7_Splice_Site_p.N1399I|MYOM1_ENST00000400569.3_Splice_Site_p.N1495I	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1495					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ATTTACTTACTTGTGGGACCA	0.483																																					p.N1495I		Atlas-SNP	.											.	MYOM1	192	.	0			c.A4484T						.						59.0	56.0	57.0					18																	3083787		1872	4099	5971	SO:0001630	splice_region_variant	8736	exon33			ACTTACTTGTGGG	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4484+1A>T	chr18.hg19:g.3083787T>A		41.0	0.0		63.0	9.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	hg19	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.758566	0.89843	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.42131	0.98;0.98;0.98	5.84	5.84	0.93424	Immunoglobulin-like fold (1);	0.044427	0.85682	D	0.000000	T	0.57286	0.2043	L	0.51422	1.61	0.80722	D	1	P;P	0.51057	0.941;0.492	P;P	0.62649	0.905;0.467	T	0.53380	-0.8447	9	.	.	.	.	16.2302	0.82332	0.0:0.0:0.0:1.0	.	1399;1495	P52179-2;P52179	.;MYOM1_HUMAN	I	1495;1495;1399	ENSP00000348821:N1495I;ENSP00000383413:N1495I;ENSP00000261606:N1399I	.	N	-	2	0	MYOM1	3073787	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	8.040000	0.89188	2.228000	0.72767	0.533000	0.62120	AAT	.	.		0.483	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	Missense_Mutation
TXNDC2	84203	hgsc.bcm.edu	37	18	9887134	9887134	+	Nonsense_Mutation	SNP	A	A	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr18:9887134A>T	ENST00000306084.6	+	2	857	c.658A>T	c.(658-660)Aag>Tag	p.K220*	TXNDC2_ENST00000536353.2_Intron|TXNDC2_ENST00000357775.5_Nonsense_Mutation_p.K153*	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	220	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CATCCAGCCCAAGCTGGGCAA	0.557																																					p.K220X		Atlas-SNP	.											.	TXNDC2	168	.	0			c.A658T						.						132.0	135.0	134.0					18																	9887134		2203	4300	6503	SO:0001587	stop_gained	84203	exon2			CAGCCCAAGCTGG	AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.658A>T	chr18.hg19:g.9887134A>T	ENSP00000304908:p.Lys220*	142.0	0.0		143.0	7.0	NM_001098529	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Nonsense_Mutation	SNP	ENST00000306084.6	hg19	CCDS42414.1	.	.	.	.	.	.	.	.	.	.	a	32	5.105591	0.94292	.	.	ENSG00000168454	ENST00000357775;ENST00000306084;ENST00000426718	.	.	.	3.17	3.17	0.36434	.	1.422770	0.04949	N	0.459936	.	.	.	.	.	.	0.32652	N	0.51932	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.3162	9.811	0.40824	1.0:0.0:0.0:0.0	.	.	.	.	X	153;220;220	.	.	K	+	1	0	TXNDC2	9877134	0.000000	0.05858	0.055000	0.19348	0.237000	0.25408	0.195000	0.17155	1.484000	0.48361	0.519000	0.50382	AAG	.	.		0.557	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254487.1		
SLC14A1	6563	hgsc.bcm.edu	37	18	43310324	43310324	+	Silent	SNP	C	C	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr18:43310324C>A	ENST00000321925.4	+	3	271	c.39C>A	c.(37-39)ccC>ccA	p.P13P	RP11-116O18.3_ENST00000586213.1_RNA|SLC14A1_ENST00000535474.1_Intron|SLC14A1_ENST00000402943.2_Intron|SLC14A1_ENST00000436407.3_Silent_p.P69P|SLC14A1_ENST00000415427.3_Silent_p.P69P|SLC14A1_ENST00000591943.1_3'UTR|SLC14A1_ENST00000502059.2_Intron|RP11-116O18.3_ENST00000589510.1_RNA|SLC14A1_ENST00000586142.1_Silent_p.P13P|SLC14A1_ENST00000589700.1_Silent_p.P13P	NM_001128588.3|NM_001146036.2|NM_015865.6	NP_001122060.3|NP_001139508.2|NP_056949.4	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter), member 1 (Kidd blood group)	13					transmembrane transport (GO:0055085)|urea transmembrane transport (GO:0071918)|urea transport (GO:0015840)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	urea channel activity (GO:0015265)|urea transmembrane transporter activity (GO:0015204)|water transmembrane transporter activity (GO:0005372)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	21						TGGACAGCCCCACTATGGTTA	0.517																																					p.P69P		Atlas-SNP	.											.	SLC14A1	84	.	0			c.C207A						.						112.0	100.0	104.0					18																	43310324		2203	4300	6503	SO:0001819	synonymous_variant	6563	exon2			CAGCCCCACTATG	BC040128	CCDS11925.1, CCDS45860.1	18q11-q12	2014-07-19	2014-01-02		ENSG00000141469	ENSG00000141469		"""Blood group antigens"", ""Solute carriers"""	10918	protein-coding gene	gene with protein product		613868	"""Kidd blood group"", ""solute carrier family 14 (urea transporter), member 1"""	JK		7797558	Standard	NM_001146037		Approved	HsT1341, RACH1, RACH2	uc010dnk.3	Q13336	OTTHUMG00000132617	ENST00000321925.4:c.39C>A	chr18.hg19:g.43310324C>A		104.0	0.0		165.0	12.0	NM_001146037	A8K0P3|B3KR62|B3KVX3|C9EHF2|Q86VM5	Silent	SNP	ENST00000321925.4	hg19	CCDS11925.1																																																																																			.	.		0.517	SLC14A1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000255860.2	NM_015865	
ARID3A	1820	hgsc.bcm.edu	37	19	932472	932472	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:932472G>C	ENST00000263620.3	+	3	750	c.423G>C	c.(421-423)gaG>gaC	p.E141D		NM_005224.2	NP_005215.1	Q99856	ARI3A_HUMAN	AT rich interactive domain 3A (BRIGHT-like)	141	Acidic.|Glu-rich.					cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)	10		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		aggatgaggaggaggaggagg	0.662																																					p.E141D	Pancreas(29;54 1022 32760 50921)	Atlas-SNP	.											.	ARID3A	35	.	0			c.G423C						.						14.0	12.0	13.0					19																	932472		2189	4272	6461	SO:0001583	missense	1820	exon3			TGAGGAGGAGGAG	U88047	CCDS12050.1	19p13.3	2013-02-07	2006-11-08	2004-01-30		ENSG00000116017		"""-"""	3031	protein-coding gene	gene with protein product		603265	"""dead ringer-like 1 (Drosophila)"", ""AT rich interactive domain 3A (BRIGHT- like)"""	DRIL1		9722953	Standard	NM_005224		Approved	BRIGHT	uc002lql.3	Q99856		ENST00000263620.3:c.423G>C	chr19.hg19:g.932472G>C	ENSP00000263620:p.Glu141Asp	53.0	0.0		59.0	13.0	NM_005224	Q5I858|Q6P9C6|Q8IZA7|Q8N4Z3	Missense_Mutation	SNP	ENST00000263620.3	hg19	CCDS12050.1	.	.	.	.	.	.	.	.	.	.	G	11.69	1.713060	0.30413	.	.	ENSG00000116017	ENST00000263620	T	0.17528	2.27	3.66	1.25	0.21368	.	0.809613	0.10420	U	0.676796	T	0.09730	0.0239	L	0.29908	0.895	0.25290	N	0.989363	B	0.06786	0.001	B	0.04013	0.001	T	0.40117	-0.9580	10	0.13853	T	0.58	.	3.683	0.08317	0.2274:0.0:0.5806:0.1919	.	141	Q99856	ARI3A_HUMAN	D	141	ENSP00000263620:E141D	ENSP00000263620:E141D	E	+	3	2	ARID3A	883472	0.039000	0.19947	0.423000	0.26634	0.846000	0.48090	-1.707000	0.01893	0.701000	0.31803	0.457000	0.33378	GAG	.	.		0.662	ARID3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458219.1	NM_005224	
MUC16	94025	hgsc.bcm.edu	37	19	9060557	9060557	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:9060557G>A	ENST00000397910.4	-	3	27092	c.26889C>T	c.(26887-26889)tcC>tcT	p.S8963S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8965	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ATGTCACTTTGGATGGCTCTG	0.453																																					p.S8963S		Atlas-SNP	.											.	MUC16	4315	.	0			c.C26889T						.						205.0	191.0	195.0					19																	9060557		1974	4164	6138	SO:0001819	synonymous_variant	94025	exon3			CACTTTGGATGGC	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26889C>T	chr19.hg19:g.9060557G>A		308.0	0.0		305.0	65.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF791	163049	hgsc.bcm.edu	37	19	12739344	12739344	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:12739344G>A	ENST00000343325.4	+	4	1163	c.1001G>A	c.(1000-1002)gGg>gAg	p.G334E	ZNF791_ENST00000540038.1_Missense_Mutation_p.G225E|ZNF791_ENST00000458122.3_Missense_Mutation_p.G302E|AC010422.1_ENST00000408416.1_RNA|ZNF791_ENST00000446165.1_3'UTR|ZNF490_ENST00000465656.1_Intron	NM_153358.2	NP_699189.2	Q3KP31	ZN791_HUMAN	zinc finger protein 791	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(5)|lung(6)|ovary(2)|prostate(3)	19						AAAGAATGTGGGAAATCTTTC	0.403																																					p.G334E		Atlas-SNP	.											.	ZNF791	53	.	0			c.G1001A						.						50.0	55.0	53.0					19																	12739344		2203	4300	6503	SO:0001583	missense	163049	exon4			AATGTGGGAAATC	AK074877	CCDS12273.1	19p13.2-p13.13	2013-01-08			ENSG00000173875	ENSG00000173875		"""Zinc fingers, C2H2-type"", ""-"""	26895	protein-coding gene	gene with protein product							Standard	NM_153358		Approved	FLJ90396	uc002mua.2	Q3KP31	OTTHUMG00000156426	ENST00000343325.4:c.1001G>A	chr19.hg19:g.12739344G>A	ENSP00000342974:p.Gly334Glu	38.0	0.0		52.0	20.0	NM_153358	B7Z586|Q8NC99	Missense_Mutation	SNP	ENST00000343325.4	hg19	CCDS12273.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.357771	0.61403	.	.	ENSG00000173875	ENST00000343325;ENST00000393303;ENST00000458122;ENST00000540038	T;T;T	0.58210	0.35;0.35;0.35	1.83	1.83	0.25207	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.63058	0.2479	M	0.61703	1.905	0.38136	D	0.938308	D	0.71674	0.998	D	0.65140	0.932	T	0.65602	-0.6128	9	0.49607	T	0.09	.	9.2247	0.37398	0.0:0.0:1.0:0.0	.	334	Q3KP31	ZN791_HUMAN	E	334;316;302;225	ENSP00000342974:G334E;ENSP00000441761:G302E;ENSP00000441038:G225E	ENSP00000342974:G334E	G	+	2	0	ZNF791	12600344	1.000000	0.71417	0.586000	0.28679	0.918000	0.54935	4.460000	0.60108	1.007000	0.39238	0.491000	0.48974	GGG	.	.		0.403	ZNF791-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344140.1	NM_153358	
LPHN1	22859	hgsc.bcm.edu	37	19	14274081	14274081	+	Missense_Mutation	SNP	G	G	A	rs369670781		TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:14274081G>A	ENST00000340736.6	-	6	844	c.547C>T	c.(547-549)Cgc>Tgc	p.R183C	LPHN1_ENST00000361434.3_Missense_Mutation_p.R178C|CTB-55O6.12_ENST00000588387.1_RNA|LPHN1_ENST00000591528.1_5'UTR|CTB-55O6.12_ENST00000592086.1_RNA	NM_001008701.2	NP_001008701.1	O94910	LPHN1_HUMAN	latrophilin 1	183	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|heterophilic cell-cell adhesion (GO:0007157)|neuropeptide signaling pathway (GO:0007218)|positive regulation of synapse maturation (GO:0090129)	axon (GO:0030424)|cell junction (GO:0030054)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	carbohydrate binding (GO:0030246)|cell adhesion molecule binding (GO:0050839)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(3)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						GTGTCCGTGCGGTAGGGGATC	0.657																																					p.R183C		Atlas-SNP	.											.	LPHN1	107	.	0			c.C547T						.	G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	86.0	65.0	72.0		547,532	4.0	1.0	19		72	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LPHN1	NM_001008701.2,NM_014921.4	180,180	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging	183/1475,178/1470	14274081	1,13005	2203	4300	6503	SO:0001583	missense	22859	exon6			CCGTGCGGTAGGG	AB020628	CCDS12307.1, CCDS32928.1	19p13.2	2014-08-08				ENSG00000072071		"""-"", ""GPCR / Class B : Orphans"""	20973	protein-coding gene	gene with protein product						10994649	Standard	NM_014921		Approved	KIAA0821, CIRL1, LEC2	uc010xnn.2	O94910		ENST00000340736.6:c.547C>T	chr19.hg19:g.14274081G>A	ENSP00000340688:p.Arg183Cys	134.0	0.0		160.0	38.0	NM_001008701	Q96IE7|Q9BU07|Q9HAR3	Missense_Mutation	SNP	ENST00000340736.6	hg19	CCDS32928.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427192	0.83667	0.0	1.16E-4	ENSG00000072071	ENST00000340736;ENST00000361434	D;D	0.89343	-2.5;-2.5	5.06	3.98	0.46160	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.94656	0.8277	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.993;0.998	D	0.95163	0.8283	10	0.87932	D	0	.	12.7117	0.57094	0.0:0.0:0.8356:0.1644	.	178;183	O94910-2;O94910	.;LPHN1_HUMAN	C	183;178	ENSP00000340688:R183C;ENSP00000355328:R178C	ENSP00000340688:R183C	R	-	1	0	LPHN1	14135081	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.219000	0.72231	2.347000	0.79759	0.655000	0.94253	CGC	.	.		0.657	LPHN1-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000459696.1	NM_014921	
CLPTM1	1209	hgsc.bcm.edu	37	19	45488541	45488541	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:45488541G>A	ENST00000337392.5	+	6	802	c.652G>A	c.(652-654)Gcg>Acg	p.A218T	CLPTM1_ENST00000589158.1_3'UTR|CLPTM1_ENST00000541297.2_Missense_Mutation_p.A204T|CLPTM1_ENST00000546079.1_Missense_Mutation_p.A116T	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	218					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		AGAGACAGAAGCGGACCCAGA	0.532																																					p.A218T		Atlas-SNP	.											.	CLPTM1	109	.	0			c.G652A						.						104.0	99.0	100.0					19																	45488541		2203	4300	6503	SO:0001583	missense	1209	exon6			ACAGAAGCGGACC	AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.652G>A	chr19.hg19:g.45488541G>A	ENSP00000336994:p.Ala218Thr	115.0	0.0		100.0	27.0	NM_001294	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Missense_Mutation	SNP	ENST00000337392.5	hg19	CCDS12651.1	.	.	.	.	.	.	.	.	.	.	G	18.27	3.587693	0.66105	.	.	ENSG00000104853	ENST00000546079;ENST00000541297;ENST00000337392;ENST00000347493	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.50667	0.1629	L	0.39633	1.23	0.80722	D	1	P;B;B	0.37276	0.589;0.444;0.444	B;B;B	0.39027	0.259;0.288;0.288	T	0.44174	-0.9345	9	0.19147	T	0.46	-14.6335	16.3245	0.82970	0.0:0.0:1.0:0.0	.	204;218;218	F5H8J3;B3KQH2;O96005	.;.;CLPT1_HUMAN	T	116;204;218;218	.	ENSP00000336994:A218T	A	+	1	0	CLPTM1	50180381	1.000000	0.71417	0.998000	0.56505	0.895000	0.52256	8.519000	0.90563	2.450000	0.82876	0.650000	0.86243	GCG	.	.		0.532	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453267.1	NM_001294	
ERVV-1	147664	hgsc.bcm.edu	37	19	53518514	53518514	+	Missense_Mutation	SNP	C	C	T	rs11670105	byFrequency	TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr19:53518514C>T	ENST00000602168.1	+	1	1341	c.1171C>T	c.(1171-1173)Ctc>Ttc	p.L391F	CTD-2620I22.3_ENST00000596769.1_lincRNA	NM_152473.2	NP_689686.2	B6SEH8	ERVV1_HUMAN	endogenous retrovirus group V, member 1	391						integral component of membrane (GO:0016021)											cttagattacctcttagcaga	0.413													N|||	264	0.0527157	0.0038	0.0245	5008	,	,		21814	0.0129		0.0706	False		,,,				2504	0.1616				p.L391F		Atlas-SNP	.											.	ERVV-1	1	.	0			c.C1171T						.																																			SO:0001583	missense	147664	exon1			GATTACCTCTTAG	AK056776, BC104018, BC104019	CCDS59419.1	19q13.41	2014-05-02			ENSG00000269526	ENSG00000269526			26501	other	endogenous retrovirus						18826608, 21542922	Standard	NM_152473		Approved	FLJ32214, HERV-V1, ENVV1	uc002qap.3	B6SEH8	OTTHUMG00000182942	ENST00000602168.1:c.1171C>T	chr19.hg19:g.53518514C>T	ENSP00000473153:p.Leu391Phe	0.0	0.0		4.0	4.0	NM_152473		Missense_Mutation	SNP	ENST00000602168.1	hg19	CCDS59419.1																																																																																			.	.		0.413	ERVV-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464402.1	NM_152473	
C20orf196	149840	hgsc.bcm.edu	37	20	5843711	5843711	+	Missense_Mutation	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr20:5843711G>A	ENST00000303142.6	+	3	307	c.220G>A	c.(220-222)Gct>Act	p.A74T		NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	74										endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						CTCCTGGACCGCTGAGAACTT	0.413																																					p.A74T		Atlas-SNP	.											.	C20orf196	17	.	0			c.G220A						.						54.0	59.0	57.0					20																	5843711		2203	4300	6503	SO:0001583	missense	149840	exon3			TGGACCGCTGAGA	AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.220G>A	chr20.hg19:g.5843711G>A	ENSP00000305875:p.Ala74Thr	79.0	0.0		90.0	9.0	NM_152504	A8K9J3|Q5TGA9|Q96LU1	Missense_Mutation	SNP	ENST00000303142.6	hg19	CCDS13091.1	.	.	.	.	.	.	.	.	.	.	T	6.629	0.484505	0.12641	.	.	ENSG00000171984	ENST00000303142;ENST00000378971;ENST00000445603;ENST00000442185	T;T;T	0.44881	0.91;0.91;0.91	5.64	1.84	0.25277	.	0.896271	0.09593	N	0.781229	T	0.17323	0.0416	N	0.02011	-0.69	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.20806	-1.0264	10	0.66056	D	0.02	-10.2391	4.9941	0.14230	0.3636:0.0:0.2744:0.362	.	74	Q8IYI0	CT196_HUMAN	T	74;74;74;121	ENSP00000305875:A74T;ENSP00000399331:A74T;ENSP00000410534:A121T	ENSP00000305875:A74T	A	+	1	0	C20orf196	5791711	0.366000	0.25014	0.033000	0.17914	0.002000	0.02628	1.084000	0.30828	0.073000	0.16731	-1.207000	0.01640	GCT	.	.		0.413	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077882.2	NM_152504	
PTPRT	11122	hgsc.bcm.edu	37	20	40980875	40980875	+	Missense_Mutation	SNP	G	G	C			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr20:40980875G>C	ENST00000373187.1	-	10	1610	c.1611C>G	c.(1609-1611)agC>agG	p.S537R	PTPRT_ENST00000373184.1_Missense_Mutation_p.S537R|PTPRT_ENST00000356100.2_Missense_Mutation_p.S537R|PTPRT_ENST00000373198.4_Missense_Mutation_p.S537R|PTPRT_ENST00000373190.1_Missense_Mutation_p.S537R|PTPRT_ENST00000373201.1_Missense_Mutation_p.S537R|PTPRT_ENST00000373193.3_Missense_Mutation_p.S537R			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	537	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TCCCCCTCTGGCTCGAGAGGT	0.527																																					p.S537R		Atlas-SNP	.											PTPRT,right_upper_lobe,carcinoma,0,1	PTPRT	372	.	0			c.C1611G						.						78.0	83.0	81.0					20																	40980875		1957	4137	6094	SO:0001583	missense	11122	exon10			CCTCTGGCTCGAG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.1611C>G	chr20.hg19:g.40980875G>C	ENSP00000362283:p.Ser537Arg	101.0	0.0		86.0	15.0	NM_007050	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	hg19	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	G	15.73	2.919965	0.52653	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.35236	1.32;1.32;1.32;1.32;1.32;1.32;1.32	5.88	4.93	0.64822	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.097628	0.64402	D	0.000001	T	0.17916	0.0430	N	0.02765	-0.5	0.41397	D	0.987659	B;B	0.32731	0.382;0.302	B;B	0.36766	0.149;0.232	T	0.08722	-1.0708	10	0.48119	T	0.1	.	9.3838	0.38329	0.0716:0.0:0.7841:0.1443	.	537;537	O14522-1;O14522	.;PTPRT_HUMAN	R	537	ENSP00000362286:S537R;ENSP00000362283:S537R;ENSP00000362289:S537R;ENSP00000348408:S537R;ENSP00000362294:S537R;ENSP00000362280:S537R;ENSP00000362297:S537R	ENSP00000348408:S537R	S	-	3	2	PTPRT	40414289	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.924000	0.40065	2.777000	0.95525	0.551000	0.68910	AGC	.	.		0.527	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
PI4KA	5297	hgsc.bcm.edu	37	22	21153477	21153477	+	Silent	SNP	G	G	A			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr22:21153477G>A	ENST00000572273.1	-	16	1964	c.1734C>T	c.(1732-1734)ccC>ccT	p.P578P	PI4KA_ENST00000255882.6_Silent_p.P636P			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	578					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TCTGCAGAATGGGCTCCATGA	0.557																																					p.P636P	GBM(136;1332 1831 3115 23601 50806)	Atlas-SNP	.											.	PI4KA	313	.	0			c.C1908T						.						93.0	80.0	84.0					22																	21153477		2203	4300	6503	SO:0001819	synonymous_variant	5297	exon16			CAGAATGGGCTCC	L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.1734C>T	chr22.hg19:g.21153477G>A		60.0	0.0		64.0	17.0	NM_058004	Q7Z625|Q9UPG2	Silent	SNP	ENST00000572273.1	hg19																																																																																				.	.		0.557	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_058004	
ZNF280B	140883	hgsc.bcm.edu	37	22	22843682	22843682	+	Silent	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr22:22843682C>T	ENST00000406426.1	-	4	784	c.42G>A	c.(40-42)caG>caA	p.Q14Q	ZNF280B_ENST00000360412.2_Silent_p.Q14Q			Q86YH2	Z280B_HUMAN	zinc finger protein 280B	14					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(2)	22	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GTATGTTCTTCTGTGGTTCAG	0.388																																					p.Q14Q		Atlas-SNP	.											.	ZNF280B	67	.	0			c.G42A						.						141.0	124.0	129.0					22																	22843682		2203	4300	6503	SO:0001819	synonymous_variant	140883	exon4			GTTCTTCTGTGGT	AK097608	CCDS13799.1	22q11.2	2007-09-20	2007-09-20	2007-09-20	ENSG00000198477	ENSG00000275004			23022	protein-coding gene	gene with protein product			"""zinc finger protein 279"", ""suppressor of hairy wing homolog 2 (Drosophila)"""	ZNF279, SUHW2		9074928	Standard	NM_080764		Approved	5'OY11.1, ZNF632	uc002zwc.1	Q86YH2	OTTHUMG00000151066	ENST00000406426.1:c.42G>A	chr22.hg19:g.22843682C>T		316.0	0.0		293.0	45.0	NM_080764		Silent	SNP	ENST00000406426.1	hg19	CCDS13799.1																																																																																			.	.		0.388	ZNF280B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321170.2	NM_080764	
OTUD5	55593	hgsc.bcm.edu	37	X	48814825	48814825	+	Missense_Mutation	SNP	A	A	G			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chrX:48814825A>G	ENST00000156084.4	-	1	68	c.8T>C	c.(7-9)aTa>aCa	p.I3T	OTUD5_ENST00000376488.3_Missense_Mutation_p.I3T|RNU6-722P_ENST00000411377.1_RNA|OTUD5_ENST00000396743.3_Missense_Mutation_p.I3T|OTUD5_ENST00000428668.2_Intron|OTUD5_ENST00000484499.1_5'Flank	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	3					innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						TTTGGGGAGTATAGTCATGGC	0.731																																					p.I3T		Atlas-SNP	.											.	OTUD5	66	.	0			c.T8C						.						1.0	2.0	1.0					X																	48814825		652	1617	2269	SO:0001583	missense	55593	exon1			GGGAGTATAGTCA		CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.8T>C	chrX.hg19:g.48814825A>G	ENSP00000156084:p.Ile3Thr	47.0	0.0		55.0	43.0	NM_001136157	B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Missense_Mutation	SNP	ENST00000156084.4	hg19	CCDS14313.1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.857657	0.51376	.	.	ENSG00000068308	ENST00000396743;ENST00000453548;ENST00000156084;ENST00000376488	.	.	.	3.19	3.19	0.36642	.	0.000000	0.64402	D	0.000007	T	0.53594	0.1806	N	0.24115	0.695	0.45250	D	0.998251	P;D	0.54772	0.947;0.968	D;D	0.72625	0.95;0.978	T	0.56214	-0.8016	9	0.87932	D	0	8.2187	7.1699	0.25712	1.0:0.0:0.0:0.0	.	3;3	Q96G74;G5E9D7	OTUD5_HUMAN;.	T	3	.	ENSP00000156084:I3T	I	-	2	0	OTUD5	48699769	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	5.576000	0.67437	1.500000	0.48636	0.416000	0.27883	ATA	.	.		0.731	OTUD5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000060799.1	NM_017602	
ARHGEF6	9459	hgsc.bcm.edu	37	X	135863020	135863020	+	Missense_Mutation	SNP	C	C	T			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chrX:135863020C>T	ENST00000250617.6	-	1	1227	c.22G>A	c.(22-24)Gtg>Atg	p.V8M		NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	8	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					AGCCATGTCACGATTTGTTCT	0.463																																					p.V8M		Atlas-SNP	.											.	ARHGEF6	111	.	0			c.G22A						.						91.0	80.0	84.0					X																	135863020		2203	4300	6503	SO:0001583	missense	9459	exon1			ATGTCACGATTTG	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.22G>A	chrX.hg19:g.135863020C>T	ENSP00000250617:p.Val8Met	41.0	0.0		36.0	25.0	NM_004840	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	hg19	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334154	0.81801	.	.	ENSG00000129675	ENST00000250617	D	0.95171	-3.63	6.03	6.03	0.97812	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.97545	0.9196	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.97880	1.0291	10	0.87932	D	0	.	19.4624	0.94922	0.0:1.0:0.0:0.0	.	8	Q15052	ARHG6_HUMAN	M	8	ENSP00000250617:V8M	ENSP00000250617:V8M	V	-	1	0	ARHGEF6	135690686	1.000000	0.71417	0.998000	0.56505	0.902000	0.53008	7.487000	0.81328	2.550000	0.86006	0.506000	0.49869	GTG	.	.		0.463	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
TRAM1L1	133022	hgsc.bcm.edu	37	4	118005773	118005789	+	Frame_Shift_Del	DEL	CAAGATAAACACAATGG	CAAGATAAACACAATGG	-			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	CAAGATAAACACAATGG	CAAGATAAACACAATGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr4:118005773_118005789delCAAGATAAACACAATGG	ENST00000310754.4	-	1	947_963	c.761_777delCCATTGTGTTTATCTTG	c.(760-777)gccattgtgtttatcttgfs	p.AIVFIL254fs		NM_152402.2	NP_689615.2	Q8N609	TR1L1_HUMAN	translocation associated membrane protein 1-like 1	254	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22						CAAGTCTACCCAAGATAAACACAATGGCCCACAGAGA	0.415																																					p.254_260del		Atlas-Indel,Pindel	.											.	TRAM1L1	55	.	0			c.762_778del						.																																			SO:0001589	frameshift_variant	133022	exon1			.	AK074617	CCDS3707.1	4q26	2008-02-05			ENSG00000174599	ENSG00000174599			28371	protein-coding gene	gene with protein product						12477932	Standard	NM_152402		Approved	MGC26568	uc003ibv.4	Q8N609	OTTHUMG00000132956	ENST00000310754.4:c.761_777delCCATTGTGTTTATCTTG	chr4.hg19:g.118005773_118005789delCAAGATAAACACAATGG	ENSP00000309402:p.Ala254fs	115.0	0.0		59.0	14.0	NM_152402	Q8N2L7	Frame_Shift_Del	DEL	ENST00000310754.4	hg19	CCDS3707.1																																																																																			.	.		0.415	TRAM1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256513.1	NM_152402	
METTL21C	196541	hgsc.bcm.edu	37	13	103339396	103339396	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr13:103339396delC	ENST00000267273.6	-	3	299	c.294delG	c.(292-294)ttgfs	p.L98fs		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	98					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						AGTATTGACACAAAGCCATAG	0.393																																					p.C99fs		Atlas-INDEL	.											.	METTL21C	23	.	0			c.295delT						.						72.0	70.0	70.0					13																	103339396		2203	4300	6503	SO:0001589	frameshift_variant	196541	exon3			.		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.294delG	chr13.hg19:g.103339396delC	ENSP00000267273:p.Leu98fs	74.0	0.0		64.0	10.0	NM_001010977		Frame_Shift_Del	DEL	ENST00000267273.6	hg19	CCDS32003.1																																																																																			.	.		0.393	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
CACNA1E	777	hgsc.bcm.edu	37	1	181725193	181725193	+	Frame_Shift_Del	DEL	C	C	-			TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr1:181725193delC	ENST00000367573.2	+	29	4091	c.4091delC	c.(4090-4092)accfs	p.T1364fs	CACNA1E_ENST00000358338.5_Frame_Shift_Del_p.T1296fs|CACNA1E_ENST00000357570.5_Frame_Shift_Del_p.T1315fs|CACNA1E_ENST00000360108.3_Frame_Shift_Del_p.T1345fs|CACNA1E_ENST00000367570.1_Frame_Shift_Del_p.T1364fs|CACNA1E_ENST00000367567.4_Frame_Shift_Del_p.T971fs|CACNA1E_ENST00000526775.1_Frame_Shift_Del_p.T1345fs	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1364					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCCCTGCTGACCCTCTTCACC	0.522																																					p.T1364fs		Atlas-Indel,Pindel	.											.	CACNA1E	778	.	0			c.4090delA						.						68.0	70.0	69.0					1																	181725193		2053	4216	6269	SO:0001589	frameshift_variant	777	exon29			.	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4091delC	chr1.hg19:g.181725193delC	ENSP00000356545:p.Thr1364fs	149.0	0.0		162.0	62.0	NM_000721	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Frame_Shift_Del	DEL	ENST00000367573.2	hg19	CCDS55664.1																																																																																			.	.		0.522	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
ZNF512B	57473	hgsc.bcm.edu	37	20	62597492	62597583	+	Splice_Site	DEL	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	-	rs200518817|rs376642783|rs540039560|rs200940725|rs371234637|rs139142804|rs146666443	byFrequency	TCGA-FV-A4ZP-01A-12D-A25V-10	TCGA-FV-A4ZP-11A-12D-A25V-10	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	34a92167-000d-4968-bfc4-0a818857cbd4	d898cddf-8721-4cee-8a60-926c4c0dfc7c	g.chr20:62597492_62597583delGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	ENST00000450537.1	-	5	1005_1095	c.945_1035delAGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTCGGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTC	c.(943-1035)agagggaggaacagtggtaagaaaaggtatgggggctcgtcccaggtcggggaggaacagtggtaagaaaaggtatgggggctcgtcccaggt>ag	p.RGRNSGKKRYGGSSQVGEEQW*EKVWGLVPG315fs	ZNF512B_ENST00000217130.3_Splice_Site_p.RGRNSGKKRYGGSSQVGEEQW*EKVWGLVPG315fs|ZNF512B_ENST00000369888.1_Splice_Site_p.RGRNSGKKRYGGSSQVGEEQW*EKVWGLVPG315fs			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCTGTGGCACGAGGTGCTTTGTTCTCCGACCTGGTCAGCAGCACCATTTTGCAGGGCGGTGTGTGTCTGCTGATAGCAA	0.575																																					p.338_345del		Pindel	.											.	ZNF512B	72	.	0			c.1012_1034del						.																																			SO:0001630	splice_region_variant	57473	exon5			.	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1034+1AGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTCGGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTC>-	chr20.hg19:g.62597492_62597583delGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT		279.0	0.0		330.0	24.0	NM_020713	Q08AK9|Q9ULM4	Frame_Shift_Del	DEL	ENST00000450537.1	hg19	CCDS13548.1																																																																																			.	.		0.575	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	Frame_Shift_Del
