#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
PLA2R1	22925	hgsc.bcm.edu	37	2	160804063	160804063	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:160804063T>C	ENST00000283243.7	-	26	3923	c.3717A>G	c.(3715-3717)agA>agG	p.R1239R	PLA2R1_ENST00000392771.1_Silent_p.R1239R|PLA2R1_ENST00000460710.1_5'Flank	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1239					cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						GTTCAGATTGTCTTGTTTCTG	0.328																																					p.R1239R		Atlas-SNP	.											.	PLA2R1	153	.	0			c.A3717G						.						96.0	105.0	102.0					2																	160804063		2201	4299	6500	SO:0001819	synonymous_variant	22925	exon26			AGATTGTCTTGTT	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3717A>G	chr2.hg19:g.160804063T>C		77.0	0.0		118.0	21.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Silent	SNP	ENST00000283243.7	hg19	CCDS33309.1																																																																																			.	.		0.328	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
TTN	7273	hgsc.bcm.edu	37	2	179430304	179430304	+	Missense_Mutation	SNP	C	C	T	rs202149931|rs397517716		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:179430304C>T	ENST00000591111.1	-	276	75856	c.75632G>A	c.(75631-75633)cGt>cAt	p.R25211H	TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R24284H|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R17912H|TTN_ENST00000460472.2_Missense_Mutation_p.R17787H|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R26852H|TTN_ENST00000342175.6_Missense_Mutation_p.R17979H|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25211	Fibronectin type-III 83. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCCTTGACACGGAACTGATA	0.418													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22005	0.0		0.0	False		,,,				2504	0.0				p.R26852H		Atlas-SNP	.											.	TTN	18412	.	0			c.G80555A						.	C	HIS/ARG,HIS/ARG,HIS/ARG,HIS/ARG	2,3760		0,2,1879	190.0	188.0	189.0		53936,53735,72851,53360	3.7	1.0	2		189	1,8237		0,1,4118	no	missense,missense,missense,missense	TTN	NM_133437.3,NM_133432.3,NM_133378.4,NM_003319.4	29,29,29,29	0,3,5997	TT,TC,CC		0.0121,0.0532,0.025	benign,benign,benign,benign	17979/27119,17912/27052,24284/33424,17787/26927	179430304	3,11997	1881	4119	6000	SO:0001583	missense	7273	exon326			TTGACACGGAACT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75632G>A	chr2.hg19:g.179430304C>T	ENSP00000465570:p.Arg25211His	70.0	0.0		97.0	26.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	10.81	1.454795	0.26161	5.32E-4	1.21E-4	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.60920	0.15;0.15;0.15;0.15	5.48	3.65	0.41850	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67258	0.2874	H	0.96142	3.775	0.48696	D	0.999696	B;B;B;B	0.29909	0.261;0.261;0.261;0.261	B;B;B;B	0.20184	0.028;0.028;0.028;0.028	T	0.76334	-0.2997	9	0.87932	D	0	.	12.1629	0.54113	0.0:0.8355:0.0:0.1645	.	17787;17912;17979;25211	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	24284;17787;17979;17912;17785	ENSP00000343764:R24284H;ENSP00000434586:R17787H;ENSP00000340554:R17979H;ENSP00000352154:R17912H	ENSP00000340554:R17979H	R	-	2	0	TTN	179138550	0.893000	0.30496	1.000000	0.80357	0.631000	0.37964	1.834000	0.39171	2.589000	0.87451	0.484000	0.47621	CGT	.	C|0.999;T|0.001		0.418	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179610836	179610836	+	Intron	SNP	C	C	T	rs141483365		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:179610836C>T	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.E5431K			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCTTCTCCTCGCTAATCACG	0.393													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19328	0.0		0.0	False		,,,				2504	0.0				p.E5431K		Atlas-SNP	.											.	TTN	18412	.	0			c.G16291A						.	C	,,LYS/GLU,,	0,4406		0,0,2203	120.0	124.0	123.0		,,16291,,	5.0	1.0	2	dbSNP_134	123	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,missense,intron,intron	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	,,56,,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	,,5431/5605,,	179610836	1,13005	2203	4300	6503	SO:0001627	intron_variant	7273	exon46			TCTCCTCGCTAAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4188G>A	chr2.hg19:g.179610836C>T		91.0	0.0		101.0	23.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	4.889	0.165308	0.09339	0.0	1.16E-4	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.66815	-0.23	5.88	5.01	0.66863	.	.	.	.	.	T	0.48021	0.1477	L	0.40543	1.245	0.20926	N	0.999822	P	0.38280	0.625	B	0.31337	0.128	T	0.36335	-0.9752	9	0.07813	T	0.8	.	7.0279	0.24950	0.0:0.6947:0.153:0.1523	.	5431	Q8WZ42-6	.	K	5431;712	ENSP00000354117:E5431K	ENSP00000304714:E712K	E	-	1	0	TTN	179319081	0.994000	0.37717	0.998000	0.56505	0.745000	0.42441	2.399000	0.44495	1.506000	0.48736	-0.123000	0.14984	GAG	.	C|1.000;T|0.000		0.393	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
PAX3	5077	hgsc.bcm.edu	37	2	223066132	223066132	+	3'UTR	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr2:223066132C>T	ENST00000350526.4	-	0	2087				PAX3_ENST00000464706.1_5'Flank|PAX3_ENST00000336840.6_Splice_Site_p.S401S|PAX3_ENST00000409551.3_Missense_Mutation_p.A483T|PAX3_ENST00000392069.2_Splice_Site_p.A484T|PAX3_ENST00000392070.2_Missense_Mutation_p.A484T|PAX3_ENST00000344493.4_Silent_p.S401S	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3						apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A484T(1)	PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TTCACTTACGCGATATCTGGC	0.443			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.A484T		Atlas-SNP	.		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	PAX3,NS,carcinoma,0,1	PAX3	106	.	1	Substitution - Missense(1)	endometrium(1)	c.G1450A						.						88.0	89.0	88.0					2																	223066132		2203	4300	6503	SO:0001624	3_prime_UTR_variant	5077	exon9			CTTACGCGATATC		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.*511G>A	chr2.hg19:g.223066132C>T		58.0	0.0		61.0	22.0	NM_181459	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	hg19	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.027007	0.54683	.	.	ENSG00000135903	ENST00000392069;ENST00000392070;ENST00000409551	D;D;D	0.94537	-3.4;-3.44;-3.45	5.77	5.77	0.91146	.	1.499710	0.04241	N	0.336907	D	0.90573	0.7045	N	0.14661	0.345	0.80722	D	1	B;P	0.39920	0.005;0.695	B;B	0.29077	0.002;0.098	T	0.78831	-0.2049	10	0.66056	D	0.02	.	20.3627	0.98863	0.0:1.0:0.0:0.0	.	483;484	Q494Z4;G5E9C1	.;.	T	484;484;483	ENSP00000375921:A484T;ENSP00000375922:A484T;ENSP00000386750:A483T	ENSP00000375921:A484T	A	-	1	0	PAX3	222774376	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.015000	0.57152	2.885000	0.99019	0.655000	0.94253	GCT;GCG;GCG	.	.		0.443	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
BAP1	8314	hgsc.bcm.edu	37	3	52439874	52439874	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:52439874G>A	ENST00000460680.1	-	10	1309	c.838C>T	c.(838-840)Cag>Tag	p.Q280*	BAP1_ENST00000296288.5_Nonsense_Mutation_p.Q262*	NM_004656.2	NP_004647.1	Q99496	RING2_HUMAN	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)	191					anterior/posterior axis specification (GO:0009948)|gastrulation with mouth forming second (GO:0001702)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K119 monoubiquitination (GO:0036353)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	euchromatin (GO:0000791)|MLL1 complex (GO:0071339)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|RING-like zinc finger domain binding (GO:0071535)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.Q280*(1)		NS(1)|breast(4)|endometrium(3)|eye(42)|kidney(60)|large_intestine(3)|lung(9)|ovary(4)|pleura(39)|prostate(4)|skin(9)|urinary_tract(2)	180				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		TCAGGCAGCTGTGACTCTTGA	0.567			"""N, Mis, F, S, O"""		"""uveal melanoma, breast, NSCLC, RCC"""	"""mesothelioma, uveal melanoma"""																															p.Q280X	GBM(101;493 1458 7992 21037 25532)	Atlas-SNP	.		Rec	yes		3	3p21.31-p21.2	8314	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)		E	BAP1,NS,carcinoma,0,1	BAP1	371	.	1	Substitution - Nonsense(1)	breast(1)	c.C838T						.						70.0	69.0	70.0					3																	52439874		2203	4300	6503	SO:0001587	stop_gained	8314	exon10			GCAGCTGTGACTC	AF045581	CCDS2853.1	3p21.31-p21.2	2014-09-17			ENSG00000163930	ENSG00000163930			950	protein-coding gene	gene with protein product		603089				9528852	Standard	NM_004656		Approved	hucep-6, KIAA0272, UCHL2	uc003ddx.4	Q92560	OTTHUMG00000158392	ENST00000460680.1:c.838C>T	chr3.hg19:g.52439874G>A	ENSP00000417132:p.Gln280*	39.0	0.0		28.0	19.0	NM_004656	B2RBS7|B3KRH1|Q5TEN1|Q5TEN2	Nonsense_Mutation	SNP	ENST00000460680.1	hg19	CCDS2853.1	.	.	.	.	.	.	.	.	.	.	G	32	5.123994	0.94429	.	.	ENSG00000163930	ENST00000460680;ENST00000296288	.	.	.	5.35	5.35	0.76521	.	0.252992	0.42172	D	0.000752	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	-5.5978	19.4309	0.94765	0.0:0.0:1.0:0.0	.	.	.	.	X	280;262	.	ENSP00000296288:Q262X	Q	-	1	0	BAP1	52414914	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.676000	0.74498	2.663000	0.90544	0.561000	0.74099	CAG	.	.		0.567	BAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350895.1		
CD96	10225	hgsc.bcm.edu	37	3	111319663	111319663	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:111319663C>G	ENST00000283285.5	+	8	1168	c.1037C>G	c.(1036-1038)gCc>gGc	p.A346G	CD96_ENST00000438817.2_Missense_Mutation_p.A330G|CD96_ENST00000352690.4_Missense_Mutation_p.A330G	NM_198196.2	NP_937839.1	P40200	TACT_HUMAN	CD96 molecule	346	Ig-like C2-type.				cell adhesion (GO:0007155)|immune response (GO:0006955)|regulation of immune response (GO:0050776)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(4)|liver(2)|lung(14)|skin(5)	35						AATAAACCAGCCCAATCAGAC	0.383									Opitz Trigonocephaly syndrome																												p.A346G		Atlas-SNP	.											.	CD96	75	.	0			c.C1037G						.						115.0	115.0	115.0					3																	111319663		2203	4300	6503	SO:0001583	missense	10225	exon8	Familial Cancer Database	C syndrome, Trigonocephaly syndrome	AACCAGCCCAATC	M88282	CCDS2958.1, CCDS2959.1	3p13-q13.2	2013-01-11	2006-03-28		ENSG00000153283	ENSG00000153283		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16892	protein-coding gene	gene with protein product		606037	"""CD96 antigen"""			1313846	Standard	XR_241462		Approved	TACTILE	uc003dxx.3	P40200	OTTHUMG00000159275	ENST00000283285.5:c.1037C>G	chr3.hg19:g.111319663C>G	ENSP00000283285:p.Ala346Gly	79.0	0.0		64.0	35.0	NM_198196	Q5JPB3	Missense_Mutation	SNP	ENST00000283285.5	hg19	CCDS2959.1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365945	0.24684	.	.	ENSG00000153283	ENST00000352690;ENST00000283285;ENST00000438817	T;T;T	0.65916	-0.15;-0.13;-0.18	5.04	2.12	0.27331	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.999489	0.08098	N	0.998280	T	0.45196	0.1330	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.17852	0.024;0.019;0.01;0.01	B;B;B;B	0.19391	0.025;0.015;0.015;0.015	T	0.31861	-0.9928	10	0.26408	T	0.33	-1.9133	5.5991	0.17343	0.0:0.6406:0.1674:0.192	.	330;330;346;330	E9PEJ1;P40200-2;P40200;Q8WUE2	.;.;TACT_HUMAN;.	G	330;346;330	ENSP00000342040:A330G;ENSP00000283285:A346G;ENSP00000389801:A330G	ENSP00000283285:A346G	A	+	2	0	CD96	112802353	0.003000	0.15002	0.924000	0.36721	0.820000	0.46376	0.110000	0.15437	0.591000	0.29711	0.650000	0.86243	GCC	.	.		0.383	CD96-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000354312.2		
KIAA1109	84162	hgsc.bcm.edu	37	4	123238013	123238013	+	Silent	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr4:123238013C>T	ENST00000264501.4	+	62	11039	c.10666C>T	c.(10666-10668)Ctg>Ttg	p.L3556L	KIAA1109_ENST00000455637.1_Silent_p.L3556L|KIAA1109_ENST00000388738.3_Silent_p.L3556L			Q2LD37	K1109_HUMAN	KIAA1109	3556					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						AATAGATGATCTGAAGTATGT	0.328																																					p.L3556L		Atlas-SNP	.											.	KIAA1109	424	.	0			c.C10666T						.						88.0	88.0	88.0					4																	123238013		1822	4084	5906	SO:0001819	synonymous_variant	84162	exon60			GATGATCTGAAGT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10666C>T	chr4.hg19:g.123238013C>T		129.0	0.0		77.0	16.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	hg19	CCDS43267.1	.	.	.	.	.	.	.	.	.	.	C	7.460	0.644447	0.14451	.	.	ENSG00000138688	ENST00000419325	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	T	0.71256	0.3318	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.69457	-0.5140	4	.	.	.	.	14.8521	0.70306	0.0:0.9294:0.0:0.0706	.	.	.	.	F	1513	.	.	S	+	2	0	KIAA1109	123457463	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	4.655000	0.61476	2.637000	0.89404	0.655000	0.94253	TCT	.	.		0.328	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
SPIDR	23514	hgsc.bcm.edu	37	8	48614552	48614552	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:48614552C>G	ENST00000297423.4	+	14	2336	c.1952C>G	c.(1951-1953)gCc>gGc	p.A651G	SPIDR_ENST00000518074.1_Missense_Mutation_p.A591G|SPIDR_ENST00000517693.1_Missense_Mutation_p.A126G|SPIDR_ENST00000521214.1_3'UTR|SPIDR_ENST00000541342.1_Missense_Mutation_p.A581G	NM_001080394.2|NM_001282916.1	NP_001073863.1|NP_001269845.1	Q14159	SPIDR_HUMAN	scaffolding protein involved in DNA repair	651					cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of protein complex assembly (GO:0031334)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of establishment of protein localization to chromosome (GO:0070202)	nuclear chromosome (GO:0000228)											AGTTTCTATGCCACGGTGATT	0.438																																					p.A651G		Atlas-SNP	.											.	KIAA0146	64	.	0			c.C1952G						.						115.0	107.0	110.0					8																	48614552		1900	4127	6027	SO:0001583	missense	23514	exon14			TCTATGCCACGGT	AK055680	CCDS43737.1, CCDS64890.1, CCDS64891.1	8q11.21	2013-07-02	2013-07-02	2013-07-02	ENSG00000164808	ENSG00000164808			28971	protein-coding gene	gene with protein product		615384	"""KIAA0146"""	KIAA0146		8590280, 23509288	Standard	XM_005251189		Approved		uc003xqd.3	Q14159	OTTHUMG00000164176	ENST00000297423.4:c.1952C>G	chr8.hg19:g.48614552C>G	ENSP00000297423:p.Ala651Gly	121.0	0.0		126.0	59.0	NM_001080394	B4DFV2|B4E0Y6|Q96BI5	Missense_Mutation	SNP	ENST00000297423.4	hg19	CCDS43737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.59|16.59	3.164646|3.164646	0.57476|0.57476	.|.	.|.	ENSG00000164808|ENSG00000164808	ENST00000297423;ENST00000518074;ENST00000541342;ENST00000519141;ENST00000517693;ENST00000519362;ENST00000522321;ENST00000518692;ENST00000521056|ENST00000519401	.|.	.|.	.|.	5.61|5.61	4.74|4.74	0.60224|0.60224	.|.	0.116963|.	0.56097|.	D|.	0.000027|.	T|T	0.60340|0.60340	0.2261|0.2261	L|L	0.51422|0.51422	1.61|1.61	0.34809|0.34809	D|D	0.737514|0.737514	B;B;P;D;P;B;D|.	0.89917|.	0.38;0.38;0.884;1.0;0.884;0.38;1.0|.	B;B;P;D;P;B;D|.	0.77004|.	0.178;0.178;0.636;0.989;0.826;0.178;0.989|.	T|T	0.68603|0.68603	-0.5365|-0.5365	9|5	0.40728|.	T|.	0.16|.	.|.	12.2897|12.2897	0.54810|0.54810	0.0:0.9208:0.0:0.0792|0.0:0.9208:0.0:0.0792	.|.	141;156;591;581;651;126;651|.	B4DZY2;B4DWT8;B4E0Y6;B4DFV2;B4DEV5;B3KP42;Q14159|.	.;.;.;.;.;.;K0146_HUMAN|.	G|A	651;591;581;156;126;126;12;12;12|333	.|.	ENSP00000297423:A651G|.	A|P	+|+	2|1	0|0	KIAA0146|KIAA0146	48777105|48777105	0.981000|0.981000	0.34729|0.34729	0.984000|0.984000	0.44739|0.44739	0.433000|0.433000	0.31745|0.31745	2.015000|2.015000	0.40961|0.40961	1.388000|1.388000	0.46506|0.46506	0.650000|0.650000	0.86243|0.86243	GCC|CCA	.	.		0.438	SPIDR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000377611.1	NM_001080394	
SLC30A8	169026	hgsc.bcm.edu	37	8	118170071	118170071	+	Missense_Mutation	SNP	C	C	T	rs141202988		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr8:118170071C>T	ENST00000456015.2	+	4	560	c.560C>T	c.(559-561)gCg>gTg	p.A187V	SLC30A8_ENST00000519688.1_Missense_Mutation_p.A138V|SLC30A8_ENST00000427715.2_Missense_Mutation_p.A138V|SLC30A8_ENST00000521243.1_Missense_Mutation_p.A138V	NM_173851.2	NP_776250.2	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 (zinc transporter), member 8	187					cellular zinc ion homeostasis (GO:0006882)|insulin secretion (GO:0030073)|positive regulation of insulin secretion (GO:0032024)|regulation of sequestering of zinc ion (GO:0061088)|regulation of vesicle-mediated transport (GO:0060627)|response to glucose (GO:0009749)|response to interferon-gamma (GO:0034341)|response to interleukin-1 (GO:0070555)|sequestering of zinc ion (GO:0032119)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.A187V(1)		breast(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(18)|ovary(2)|pancreas(2)|skin(5)	41	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TGCGCAGTGGCGGCCAACATT	0.517																																					p.A187V	Ovarian(162;1202 1922 6011 16223 52092)	Atlas-SNP	.											SLC30A8,caecum,carcinoma,-1,4	SLC30A8	102	.	1	Substitution - Missense(1)	ovary(1)	c.C560T						.	C	VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	179.0	149.0	159.0		413,413,413,413,560	2.1	1.0	8	dbSNP_134	159	3,8597	3.0+/-9.4	0,3,4297	no	missense,missense,missense,missense,missense	SLC30A8	NM_001172811.1,NM_001172813.1,NM_001172814.1,NM_001172815.1,NM_173851.2	64,64,64,64,64	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	benign,benign,benign,benign,benign	138/321,138/321,138/321,138/321,187/370	118170071	3,13003	2203	4300	6503	SO:0001583	missense	169026	exon4			CAGTGGCGGCCAA		CCDS6322.1, CCDS55272.1	8q24.11	2014-08-12			ENSG00000164756			"""Solute carriers"""	20303	protein-coding gene	gene with protein product		611145					Standard	NM_001172811		Approved		uc003yoh.3	Q8IWU4	OTTHUMG00000164962	ENST00000456015.2:c.560C>T	chr8.hg19:g.118170071C>T	ENSP00000415011:p.Ala187Val	88.0	0.0		101.0	65.0	NM_173851	A0AVP9|A5YM39|B4DPE0|Q8TCL3	Missense_Mutation	SNP	ENST00000456015.2	hg19	CCDS6322.1	.	.	.	.	.	.	.	.	.	.	C	0.744	-0.775314	0.02951	0.0	3.49E-4	ENSG00000164756	ENST00000521243;ENST00000427715;ENST00000519688;ENST00000456015	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.76	2.11	0.27256	.	0.832250	0.11028	N	0.607612	T	0.34135	0.0887	N	0.21240	0.645	0.25532	N	0.987267	B	0.06786	0.001	B	0.09377	0.004	T	0.29212	-1.0019	10	0.05620	T	0.96	0.941	4.8273	0.13423	0.0:0.2227:0.135:0.6423	.	187	Q8IWU4	ZNT8_HUMAN	V	138;138;138;187	ENSP00000428545:A138V;ENSP00000407505:A138V;ENSP00000431069:A138V;ENSP00000415011:A187V	ENSP00000407505:A138V	A	+	2	0	SLC30A8	118239252	0.389000	0.25205	0.993000	0.49108	0.213000	0.24496	1.004000	0.29822	0.101000	0.17610	0.650000	0.86243	GCG	.	C|1.000;T|0.000		0.517	SLC30A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381205.1	NM_173851	
CST6	1474	hgsc.bcm.edu	37	11	65780325	65780325	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr11:65780325C>A	ENST00000312134.2	+	2	473	c.269C>A	c.(268-270)aCg>aAg	p.T90K		NM_001323.3	NP_001314.1	Q15828	CYTM_HUMAN	cystatin E/M	90					anatomical structure morphogenesis (GO:0009653)|epidermis development (GO:0008544)|negative regulation of endopeptidase activity (GO:0010951)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			large_intestine(1)|lung(1)|ovary(1)	3						TACTTCCTGACGATGGAGATG	0.602																																					p.T90K		Atlas-SNP	.											CST6,rectum,carcinoma,0,1	CST6	14	.	0			c.C269A						.						80.0	66.0	71.0					11																	65780325		2201	4296	6497	SO:0001583	missense	1474	exon2			TCCTGACGATGGA	U62800	CCDS8126.1	11q13	2005-09-29			ENSG00000175315	ENSG00000175315			2478	protein-coding gene	gene with protein product		601891				9154125, 9099741	Standard	NM_001323		Approved		uc001ogr.3	Q15828	OTTHUMG00000166750	ENST00000312134.2:c.269C>A	chr11.hg19:g.65780325C>A	ENSP00000311313:p.Thr90Lys	53.0	0.0		35.0	25.0	NM_001323	Q540N7	Missense_Mutation	SNP	ENST00000312134.2	hg19	CCDS8126.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.529899	0.45073	.	.	ENSG00000175315	ENST00000312134	T	0.24538	1.85	5.66	2.77	0.32553	Proteinase inhibitor I25, cystatin, conserved site (1);Proteinase inhibitor I25, cystatin (2);	0.124523	0.52532	D	0.000071	T	0.23572	0.0570	L	0.58669	1.825	0.24883	N	0.992218	P	0.41420	0.749	B	0.42188	0.379	T	0.09015	-1.0694	10	0.30854	T	0.27	-17.3569	5.4001	0.16291	0.1613:0.6795:0.0:0.1592	.	90	Q15828	CYTM_HUMAN	K	90	ENSP00000311313:T90K	ENSP00000311313:T90K	T	+	2	0	CST6	65536901	0.591000	0.26824	0.190000	0.23270	0.220000	0.24768	0.865000	0.27940	0.327000	0.23409	0.563000	0.77884	ACG	.	.		0.602	CST6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391348.1	NM_001323	
TAS2R30	259293	hgsc.bcm.edu	37	12	11286203	11286203	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr12:11286203T>A	ENST00000539585.1	-	1	1040	c.641A>T	c.(640-642)aAa>aTa	p.K214I	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_001097643.1	NP_001091112.1	P59541	T2R30_HUMAN	taste receptor, type 2, member 30	214					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	13						TTGAGATCCTTTGCCATGGAG	0.423																																					p.K214I		Atlas-SNP	.											.	TAS2R30	28	.	0			c.A641T						.						215.0	230.0	225.0					12																	11286203		2203	4300	6503	SO:0001583	missense	259293	exon1			GATCCTTTGCCAT	AX097746, AF494233	CCDS53750.1	12p13.2	2012-08-22				ENSG00000256188		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	19112	protein-coding gene	gene with protein product		613963	"""taste receptor, type 2, member 47"""	TAS2R47			Standard	NM_001097643		Approved	T2R30	uc009zhs.1	P59541		ENST00000539585.1:c.641A>T	chr12.hg19:g.11286203T>A	ENSP00000444736:p.Lys214Ile	131.0	0.0		205.0	22.0	NM_001097643	Q645X7	Missense_Mutation	SNP	ENST00000539585.1	hg19	CCDS53750.1	.	.	.	.	.	.	.	.	.	.	-	12.77	2.038617	0.35989	.	.	ENSG00000256188	ENST00000539585	T	0.38560	1.13	2.6	1.35	0.21983	.	.	.	.	.	T	0.59445	0.2194	M	0.79693	2.465	0.09310	N	1	D	0.64830	0.994	D	0.73708	0.981	T	0.45600	-0.9250	9	0.62326	D	0.03	.	4.7585	0.13095	0.278:0.0:0.0:0.722	.	214	P59541	T2R30_HUMAN	I	214	ENSP00000444736:K214I	ENSP00000444736:K214I	K	-	2	0	TAS2R30	11177470	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-0.060000	0.11712	0.205000	0.20568	0.260000	0.18958	AAA	.	.		0.423	TAS2R30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400238.1	NM_001097643	
PCID2	55795	hgsc.bcm.edu	37	13	113835485	113835485	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr13:113835485T>C	ENST00000337344.4	-	10	821	c.745A>G	c.(745-747)Agg>Ggg	p.R249G	PCID2_ENST00000375459.1_Missense_Mutation_p.R247G|PCID2_ENST00000375457.2_Missense_Mutation_p.R247G|PCID2_ENST00000375479.2_Missense_Mutation_p.R249G|PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000375477.1_Missense_Mutation_p.R249G|PCID2_ENST00000246505.5_Missense_Mutation_p.R303G	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	249					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			AGAATCATCCTTTTGTTCTTC	0.433																																					p.R303G		Atlas-SNP	.											.	PCID2	30	.	0			c.A907G						.						146.0	126.0	133.0					13																	113835485		2203	4300	6503	SO:0001583	missense	55795	exon10			TCATCCTTTTGTT	AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.745A>G	chr13.hg19:g.113835485T>C	ENSP00000337405:p.Arg249Gly	54.0	0.0		31.0	11.0	NM_001258212	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	ENST00000337344.4	hg19	CCDS9532.2	.	.	.	.	.	.	.	.	.	.	T	17.51	3.406644	0.62399	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000375462;ENST00000246506;ENST00000351317	.	.	.	5.25	2.7	0.31948	PCI/PINT associated module (1);	0.000000	0.85682	D	0.000000	T	0.79275	0.4418	M	0.87038	2.855	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.71184	0.972;0.951	T	0.79799	-0.1651	9	0.52906	T	0.07	-30.4952	12.5786	0.56378	0.0:0.0:0.4358:0.5641	.	303;249	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	G	249;249;249;303;247;247;226;249;226	.	ENSP00000246505:R303G	R	-	1	2	PCID2	112883486	0.990000	0.36364	0.994000	0.49952	0.878000	0.50629	1.076000	0.30729	0.269000	0.21961	0.460000	0.39030	AGG	.	.		0.433	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045897.1	NM_018386	
UNC13C	440279	hgsc.bcm.edu	37	15	54306377	54306377	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:54306377C>T	ENST00000260323.11	+	1	1277	c.1277C>T	c.(1276-1278)aCa>aTa	p.T426I	UNC13C_ENST00000537900.1_Missense_Mutation_p.T426I|UNC13C_ENST00000545554.1_Missense_Mutation_p.T426I	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	426					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCCTCCCAGACATATGAGAGC	0.393																																					p.T426I		Atlas-SNP	.											.	UNC13C	674	.	0			c.C1277T						.						101.0	97.0	98.0					15																	54306377		1861	4098	5959	SO:0001583	missense	440279	exon1			CCCAGACATATGA	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1277C>T	chr15.hg19:g.54306377C>T	ENSP00000260323:p.Thr426Ile	65.0	0.0		86.0	36.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	hg19	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	13.68	2.309250	0.40895	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83755	-1.75;-1.76;-1.75	5.64	5.64	0.86602	.	.	.	.	.	D	0.82628	0.5078	L	0.27053	0.805	0.48087	D	0.999588	D	0.58620	0.983	P	0.53490	0.727	T	0.82275	-0.0538	9	0.39692	T	0.17	.	18.6946	0.91596	0.0:1.0:0.0:0.0	.	426	Q8NB66	UN13C_HUMAN	I	426	ENSP00000260323:T426I;ENSP00000438156:T426I;ENSP00000442569:T426I	ENSP00000260323:T426I	T	+	2	0	UNC13C	52093669	1.000000	0.71417	0.987000	0.45799	0.394000	0.30568	6.086000	0.71352	2.665000	0.90641	0.655000	0.94253	ACA	.	.		0.393	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
IDH2	3418	hgsc.bcm.edu	37	15	90631837	90631837	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr15:90631837C>G	ENST00000330062.3	-	4	629	c.516G>C	c.(514-516)agG>agC	p.R172S	IDH2_ENST00000540499.2_Missense_Mutation_p.R120S|IDH2_ENST00000539790.1_Missense_Mutation_p.R42S|IDH2_ENST00000559482.1_Intron	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	172					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)	p.R172S(17)|p.R172N(1)		biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			CATGGGCGTGCCTGCCAATGG	0.637			M		GBM																																p.R172S		Atlas-SNP	.		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	IDH2,NS,haematopoietic_neoplasm,-1,1	IDH2	1372	.	18	Substitution - Missense(18)	bone(11)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(2)|biliary_tract(1)|large_intestine(1)	c.G516C						.						85.0	80.0	82.0					15																	90631837		2200	4298	6498	SO:0001583	missense	3418	exon4			GGCGTGCCTGCCA		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.516G>C	chr15.hg19:g.90631837C>G	ENSP00000331897:p.Arg172Ser	132.0	0.0		96.0	41.0	NM_002168	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	hg19	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	C	12.66	2.005845	0.35415	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	D;D;D	0.86865	-2.18;-2.18;-2.18	5.93	-3.19	0.05171	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.94112	0.8112	H	0.98487	4.245	0.53005	D	0.999962	D	0.89917	1.0	D	0.91635	0.999	D	0.89382	0.3682	10	0.87932	D	0	.	5.0108	0.14312	0.237:0.2848:0.0:0.4782	.	172	P48735	IDHP_HUMAN	S	172;42;120	ENSP00000331897:R172S;ENSP00000438457:R42S;ENSP00000446147:R120S	ENSP00000331897:R172S	R	-	3	2	IDH2	88432841	0.145000	0.22656	0.004000	0.12327	0.001000	0.01503	-0.449000	0.06812	-0.649000	0.05430	-1.288000	0.01363	AGG	.	.		0.637	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
SMG6	23293	hgsc.bcm.edu	37	17	2203159	2203159	+	Silent	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:2203159C>A	ENST00000263073.6	-	2	938	c.888G>T	c.(886-888)gtG>gtT	p.V296V	SMG6_ENST00000544865.1_Silent_p.V265V	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	296	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AGGACACAGACACTTGCTTCT	0.522																																					p.V296V	Melanoma(59;28 1088 11621 25887 46638 50814)	Atlas-SNP	.											.	SMG6	97	.	0			c.G888T						.						94.0	84.0	88.0					17																	2203159		2203	4300	6503	SO:0001819	synonymous_variant	23293	exon2			CACAGACACTTGC	AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.888G>T	chr17.hg19:g.2203159C>A		56.0	0.0		65.0	19.0	NM_017575	B7Z874|O94837|Q86VH6|Q9UF60	Silent	SNP	ENST00000263073.6	hg19	CCDS11016.1																																																																																			.	.		0.522	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437826.3		
ZZEF1	23140	hgsc.bcm.edu	37	17	3957431	3957431	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:3957431C>A	ENST00000381638.2	-	34	5478	c.5354G>T	c.(5353-5355)gGg>gTg	p.G1785V	RNA5SP434_ENST00000516647.1_RNA	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	1785							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CTCATCACACCCATCACAAGA	0.438																																					p.G1785V		Atlas-SNP	.											.	ZZEF1	195	.	0			c.G5354T						.						156.0	132.0	140.0					17																	3957431		2203	4300	6503	SO:0001583	missense	23140	exon34			TCACACCCATCAC	BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.5354G>T	chr17.hg19:g.3957431C>A	ENSP00000371051:p.Gly1785Val	42.0	0.0		50.0	16.0	NM_015113	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	ENST00000381638.2	hg19	CCDS11043.1	.	.	.	.	.	.	.	.	.	.	C	33	5.244446	0.95272	.	.	ENSG00000074755	ENST00000381638	D	0.91295	-2.82	6.17	6.17	0.99709	Zinc finger, ZZ-type (3);	0.000000	0.85682	D	0.000000	D	0.93822	0.8024	L	0.41710	1.295	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.995;1.0	D	0.93624	0.6950	10	0.87932	D	0	-19.6938	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1785;1785	O43149-2;O43149	.;ZZEF1_HUMAN	V	1785	ENSP00000371051:G1785V	ENSP00000371051:G1785V	G	-	2	0	ZZEF1	3904180	1.000000	0.71417	0.960000	0.40013	0.990000	0.78478	7.441000	0.80485	2.941000	0.99782	0.655000	0.94253	GGG	.	.		0.438	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207480.1	NM_015113	
MYO18A	399687	hgsc.bcm.edu	37	17	27421740	27421740	+	Silent	SNP	G	G	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr17:27421740G>A	ENST00000527372.1	-	30	4818	c.4638C>T	c.(4636-4638)gaC>gaT	p.D1546D	MYO18A_ENST00000533112.1_Silent_p.D1546D|MYO18A_ENST00000354329.4_Silent_p.D1546D|MYO18A_ENST00000531253.1_Silent_p.D1546D	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1546					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TGGCCTCCAGGTCCCGGAGCT	0.562																																					p.D1546D	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.C4638T						.						158.0	153.0	155.0					17																	27421740		2032	4190	6222	SO:0001819	synonymous_variant	399687	exon30			CTCCAGGTCCCGG	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4638C>T	chr17.hg19:g.27421740G>A		145.0	0.0		108.0	33.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	hg19	CCDS45642.1																																																																																			.	.		0.562	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
AFG3L2	10939	hgsc.bcm.edu	37	18	12329714	12329714	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:12329714T>C	ENST00000269143.3	-	17	2475	c.2244A>G	c.(2242-2244)agA>agG	p.R748R	TUBB6_ENST00000591909.1_3'UTR|TUBB6_ENST00000590967.1_Intron	NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	748					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CCGCAAATGGTCTGGGGCCCA	0.398																																					p.R748R		Atlas-SNP	.											.	AFG3L2	60	.	0			c.A2244G						.						93.0	92.0	92.0					18																	12329714		2203	4300	6503	SO:0001819	synonymous_variant	10939	exon17			AAATGGTCTGGGG	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.2244A>G	chr18.hg19:g.12329714T>C		91.0	0.0		84.0	36.0	NM_006796	Q6P1L0	Silent	SNP	ENST00000269143.3	hg19	CCDS11859.1																																																																																			.	.		0.398	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
ZNF532	55205	hgsc.bcm.edu	37	18	56585829	56585829	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:56585829A>G	ENST00000336078.4	+	4	1086	c.310A>G	c.(310-312)Aaa>Gaa	p.K104E	ZNF532_ENST00000591230.1_Missense_Mutation_p.K104E|ZNF532_ENST00000591083.1_Missense_Mutation_p.K104E|ZNF532_ENST00000589288.1_Missense_Mutation_p.K104E|ZNF532_ENST00000591808.1_Missense_Mutation_p.K104E	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	104					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						CAGTTACAGTAAAGATGGAGC	0.512																																					p.K104E		Atlas-SNP	.											.	ZNF532	108	.	0			c.A310G						.						86.0	71.0	76.0					18																	56585829		2203	4300	6503	SO:0001583	missense	55205	exon4			TACAGTAAAGATG	AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.310A>G	chr18.hg19:g.56585829A>G	ENSP00000338217:p.Lys104Glu	56.0	0.0		73.0	14.0	NM_018181	Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Missense_Mutation	SNP	ENST00000336078.4	hg19	CCDS11969.1	.	.	.	.	.	.	.	.	.	.	A	14.60	2.582931	0.46006	.	.	ENSG00000074657	ENST00000336078	T	0.01838	4.61	5.47	5.47	0.80525	.	0.053528	0.64402	D	0.000001	T	0.08179	0.0204	M	0.72894	2.215	0.50039	D	0.999847	D	0.57899	0.981	P	0.53224	0.721	T	0.04693	-1.0933	10	0.49607	T	0.09	-0.6041	15.2263	0.73354	1.0:0.0:0.0:0.0	.	104	Q9HCE3	ZN532_HUMAN	E	104	ENSP00000338217:K104E	ENSP00000338217:K104E	K	+	1	0	ZNF532	54736809	1.000000	0.71417	0.382000	0.26119	0.135000	0.20990	8.854000	0.92228	2.071000	0.62044	0.454000	0.30748	AAA	.	.		0.512	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256130.1	NM_018181	
PRKD2	25865	hgsc.bcm.edu	37	19	47207834	47207834	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr19:47207834C>T	ENST00000291281.4	-	4	809	c.584G>A	c.(583-585)cGc>cAc	p.R195H	PRKD2_ENST00000600194.1_Missense_Mutation_p.R38H|PRKD2_ENST00000433867.1_Missense_Mutation_p.R195H|PRKD2_ENST00000601806.1_Missense_Mutation_p.R38H|PRKD2_ENST00000595515.1_Missense_Mutation_p.R195H			Q9BZL6	KPCD2_HUMAN	protein kinase D2	195					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		GGATGACAGGCGCCGTTTGCG	0.652											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R195H		Atlas-SNP	.											.	PRKD2	94	.	0			c.G584A						.						38.0	43.0	41.0					19																	47207834		2203	4300	6503	SO:0001583	missense	25865	exon4			GACAGGCGCCGTT	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.584G>A	chr19.hg19:g.47207834C>T	ENSP00000291281:p.Arg195His	31.0	0.0	945	47.0	13.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	hg19	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	32	5.164073	0.94727	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.69040	-0.37;-0.37	5.4	5.4	0.78164	.	0.163832	0.37761	N	0.001948	T	0.77505	0.4140	M	0.61703	1.905	0.54753	D	0.999985	D;D	0.65815	0.995;0.995	P;P	0.58520	0.775;0.84	T	0.78795	-0.2064	10	0.56958	D	0.05	-37.0929	17.9478	0.89044	0.0:1.0:0.0:0.0	.	195;195	E7ER94;Q9BZL6	.;KPCD2_HUMAN	H	195	ENSP00000291281:R195H;ENSP00000393978:R195H	ENSP00000291281:R195H	R	-	2	0	PRKD2	51899674	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	3.778000	0.55371	2.535000	0.85469	0.313000	0.20887	CGC	.	.		0.652	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
XRN2	22803	hgsc.bcm.edu	37	20	21346075	21346075	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr20:21346075C>T	ENST00000377191.3	+	25	2367	c.2272C>T	c.(2272-2274)Cca>Tca	p.P758S	XRN2_ENST00000539513.1_Missense_Mutation_p.P704S|XRN2_ENST00000430571.2_Missense_Mutation_p.P682S	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	758					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TTTTAAAGACCCACAGTTTGC	0.308																																					p.P758S		Atlas-SNP	.											.	XRN2	90	.	0			c.C2272T						.						79.0	79.0	79.0					20																	21346075		2203	4299	6502	SO:0001583	missense	22803	exon25			AAAGACCCACAGT	AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.2272C>T	chr20.hg19:g.21346075C>T	ENSP00000366396:p.Pro758Ser	107.0	0.0		93.0	40.0	NM_012255	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	ENST00000377191.3	hg19	CCDS13144.1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.504704	0.85176	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.57273	0.5;0.41;0.46	5.56	5.56	0.83823	.	0.048216	0.85682	D	0.000000	T	0.77315	0.4112	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80560	-0.1328	10	0.87932	D	0	-8.1355	19.5261	0.95208	0.0:1.0:0.0:0.0	.	758	Q9H0D6	XRN2_HUMAN	S	758;682;704	ENSP00000366396:P758S;ENSP00000413548:P682S;ENSP00000441113:P704S	ENSP00000366396:P758S	P	+	1	0	XRN2	21294075	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.616000	0.74205	2.632000	0.89209	0.655000	0.94253	CCA	.	.		0.308	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078273.2	NM_012255	
FAM47A	158724	hgsc.bcm.edu	37	X	34149594	34149594	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrX:34149594C>A	ENST00000346193.3	-	1	853	c.802G>T	c.(802-804)Gat>Tat	p.D268Y		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	268										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CTCTCAGAATCCAGTTTCAGC	0.587																																					p.D268Y		Atlas-SNP	.											.	FAM47A	249	.	0			c.G802T						.						31.0	32.0	32.0					X																	34149594		2198	4299	6497	SO:0001583	missense	158724	exon1			CAGAATCCAGTTT	BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.802G>T	chrX.hg19:g.34149594C>A	ENSP00000345029:p.Asp268Tyr	66.0	0.0		102.0	56.0	NM_203408	A8K8I9|Q8TAA0	Missense_Mutation	SNP	ENST00000346193.3	hg19	CCDS43926.1	.	.	.	.	.	.	.	.	.	.	c	12.20	1.865190	0.32977	.	.	ENSG00000185448	ENST00000346193	T	0.22336	1.96	0.13	0.13	0.14746	.	.	.	.	.	T	0.27349	0.0671	L	0.39898	1.24	0.09310	N	0.999997	D	0.58268	0.982	P	0.58660	0.843	T	0.12656	-1.0539	8	0.59425	D	0.04	.	.	.	.	.	268	Q5JRC9	FA47A_HUMAN	Y	268	ENSP00000345029:D268Y	ENSP00000345029:D268Y	D	-	1	0	FAM47A	34059515	0.766000	0.28496	0.419000	0.26584	0.420000	0.31355	0.421000	0.21280	0.171000	0.19730	0.173000	0.16961	GAT	.	.		0.587	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056205.1	NM_203408	
MT-CYB	4519	hgsc.bcm.edu	37	M	15461	15461	+	Silent	SNP	T	T	C			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chrM:15461T>C	ENST00000361789.2	+	1	715	c.715T>C	c.(715-717)Tta>Cta	p.L239L	MT-TE_ENST00000387459.1_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	239					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						TCCTTCTCTCCTTAATGACAT	0.483											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.L239L		Atlas-SNP	.											.	.	.	.	0			c.T715C						.																																			SO:0001819	synonymous_variant	0	exon1			CTCTCCTTAATGA			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.715T>C	chrM.hg19:g.15461T>C		186.0	0.0	585	273.0	23.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Silent	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.483	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
TMCC1	23023	hgsc.bcm.edu	37	3	129389772	129389772	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:129389772delC	ENST00000393238.3	-	4	1252	c.912delG	c.(910-912)aggfs	p.R304fs	TMCC1_ENST00000432054.2_5'UTR|TMCC1_ENST00000426664.2_Frame_Shift_Del_p.R190fs|TMCC1_ENST00000329333.5_Frame_Shift_Del_p.R125fs	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	304						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CTCTGAGCTTCCTGTGGTAGT	0.517																																					p.K305fs		Atlas-INDEL	.											.	TMCC1	105	.	0			c.913delA						.						136.0	126.0	129.0					3																	129389772		2203	4300	6503	SO:0001589	frameshift_variant	23023	exon4			.	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.912delG	chr3.hg19:g.129389772delC	ENSP00000376930:p.Arg304fs	154.0	0.0		139.0	11.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Frame_Shift_Del	DEL	ENST00000393238.3	hg19	CCDS33855.1																																																																																			.	.		0.517	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
TMCC1	23023	hgsc.bcm.edu	37	3	129389775	129389787	+	Frame_Shift_Del	DEL	GTGGTAGTGCTCA	GTGGTAGTGCTCA	-	rs147183682		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	GTGGTAGTGCTCA	GTGGTAGTGCTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:129389775_129389787delGTGGTAGTGCTCA	ENST00000393238.3	-	4	1237_1249	c.897_909delTGAGCACTACCAC	c.(895-909)cttgagcactaccacfs	p.LEHYH299fs	TMCC1_ENST00000432054.2_5'UTR|TMCC1_ENST00000426664.2_Frame_Shift_Del_p.LEHYH185fs|TMCC1_ENST00000329333.5_Frame_Shift_Del_p.LEHYH120fs	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	299						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.H301D(1)	PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TGAGCTTCCTGTGGTAGTGCTCAAGTTTCTTTT	0.516																																					p.300_304del		Atlas-INDEL	.											.	TMCC1	105	.	1	Substitution - Missense(1)	skin(1)	c.898_910del						.																																			SO:0001589	frameshift_variant	23023	exon4			.	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.897_909delTGAGCACTACCAC	chr3.hg19:g.129389775_129389787delGTGGTAGTGCTCA	ENSP00000376930:p.Leu299fs	152.0	0.0		137.0	11.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Frame_Shift_Del	DEL	ENST00000393238.3	hg19	CCDS33855.1																																																																																			.	.		0.516	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
AFG3L2	10939	hgsc.bcm.edu	37	18	12329717	12329717	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:12329717delG	ENST00000269143.3	-	17	2472	c.2241delC	c.(2239-2241)cccfs	p.P747fs	TUBB6_ENST00000591909.1_3'UTR|TUBB6_ENST00000590967.1_Intron	NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	747					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CAAATGGTCTGGGGCCCAAAA	0.393																																					p.R748fs		Atlas-INDEL	.											.	AFG3L2	60	.	0			c.2242delA						.						91.0	89.0	90.0					18																	12329717		2203	4300	6503	SO:0001589	frameshift_variant	10939	exon17			.	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.2241delC	chr18.hg19:g.12329717delG	ENSP00000269143:p.Pro747fs	90.0	0.0		85.0	31.0	NM_006796	Q6P1L0	Frame_Shift_Del	DEL	ENST00000269143.3	hg19	CCDS11859.1																																																																																			.	.		0.393	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
AFG3L2	10939	hgsc.bcm.edu	37	18	12329718	12329718	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr18:12329718delG	ENST00000269143.3	-	17	2471	c.2240delC	c.(2239-2241)cccfs	p.P747fs	TUBB6_ENST00000591909.1_3'UTR|TUBB6_ENST00000590967.1_Intron	NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	747					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	AAATGGTCTGGGGCCCAAAAG	0.393																																					p.P747fs		Pindel	.											.	AFG3L2	60	.	0			c.2241delC						.						90.0	89.0	89.0					18																	12329718		2203	4300	6503	SO:0001589	frameshift_variant	10939	exon17			.	Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.2240delC	chr18.hg19:g.12329718delG	ENSP00000269143:p.Pro747fs	90.0	0.0		87.0	25.0	NM_006796	Q6P1L0	Frame_Shift_Del	DEL	ENST00000269143.3	hg19	CCDS11859.1																																																																																			.	.		0.393	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254603.2	NM_006796	
TMCC1	23023	hgsc.bcm.edu	37	3	129389773	129389787	+	In_Frame_Del	DEL	CTGTGGTAGTGCTCA	CTGTGGTAGTGCTCA	-	rs147183682		TCGA-G3-A25T-01A-11D-A16V-10	TCGA-G3-A25T-10A-01D-A16V-10	CTGTGGTAGTGCTCA	CTGTGGTAGTGCTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	41840dc1-5ea2-4f01-a0d4-8b65add641c8	ad831284-a522-4712-b7b4-134b92be8125	g.chr3:129389773_129389787delCTGTGGTAGTGCTCA	ENST00000393238.3	-	4	1237_1251	c.897_911delTGAGCACTACCACAG	c.(895-912)cttgagcactaccacagg>ctg	p.EHYHR300del	TMCC1_ENST00000432054.2_5'UTR|TMCC1_ENST00000426664.2_In_Frame_Del_p.EHYHR186del|TMCC1_ENST00000329333.5_In_Frame_Del_p.EHYHR121del	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	300						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.H301D(1)	PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TCTGAGCTTCCTGTGGTAGTGCTCAAGTTTCTTTT	0.516																																					p.300_304del		Pindel	.											.	TMCC1	105	.	1	Substitution - Missense(1)	skin(1)	c.898_912del						.																																			SO:0001651	inframe_deletion	23023	exon4			.	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.897_911delTGAGCACTACCACAG	chr3.hg19:g.129389773_129389787delCTGTGGTAGTGCTCA	ENSP00000376930:p.Glu300_Arg304del	161.0	0.0		144.0	15.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	In_Frame_Del	DEL	ENST00000393238.3	hg19	CCDS33855.1																																																																																			.	.		0.516	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
