#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIF1B	23095	hgsc.bcm.edu	37	1	10381913	10381913	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:10381913A>C	ENST00000377086.1	+	24	2558	c.2356A>C	c.(2356-2358)Aag>Cag	p.K786Q	KIF1B_ENST00000377081.1_Missense_Mutation_p.K786Q|KIF1B_ENST00000263934.6_Missense_Mutation_p.K740Q			O60333	KIF1B_HUMAN	kinesin family member 1B	786					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		ACTGAAAAAGAAGGTATGGAG	0.502																																					p.K740Q		Atlas-SNP	.											.	KIF1B	242	.	0			c.A2218C						.						54.0	54.0	54.0					1																	10381913		2203	4300	6503	SO:0001583	missense	23095	exon22			AAAAAGAAGGTAT	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2356A>C	chr1.hg19:g.10381913A>C	ENSP00000366290:p.Lys786Gln	63.0	0.0		80.0	19.0	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.63	3.436481	0.62955	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.75050	-0.9;-0.9;-0.9	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.76097	0.3940	L	0.28192	0.835	0.80722	D	1	P;P;D;P;P;D	0.76494	0.87;0.609;0.999;0.609;0.765;0.989	B;B;D;B;B;D	0.75020	0.299;0.298;0.926;0.186;0.287;0.985	T	0.70898	-0.4747	10	0.11485	T	0.65	.	15.5286	0.75932	1.0:0.0:0.0:0.0	.	772;746;786;760;786;740	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	Q	786;740;786;786	ENSP00000263934:K740Q;ENSP00000366290:K786Q;ENSP00000366284:K786Q	ENSP00000263934:K740Q	K	+	1	0	KIF1B	10304500	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	5.782000	0.68973	2.120000	0.65058	0.459000	0.35465	AAG	.	.		0.502	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
ST6GALNAC5	81849	hgsc.bcm.edu	37	1	77528691	77528691	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:77528691T>C	ENST00000477717.1	+	5	1046	c.811T>C	c.(811-813)Tat>Cat	p.Y271H		NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	271					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						ACCTTATCATTATTATGAACC	0.403																																					p.Y271H		Atlas-SNP	.											.	ST6GALNAC5	59	.	0			c.T811C						.						117.0	117.0	117.0					1																	77528691		2203	4300	6503	SO:0001583	missense	81849	exon5			TATCATTATTATG		CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.811T>C	chr1.hg19:g.77528691T>C	ENSP00000417583:p.Tyr271His	89.0	0.0		117.0	12.0	NM_030965	B1AK82	Missense_Mutation	SNP	ENST00000477717.1	hg19	CCDS673.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572262	0.86542	.	.	ENSG00000117069	ENST00000477717;ENST00000438953	T	0.71461	-0.57	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.87071	0.6086	H	0.94734	3.575	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90710	0.4627	10	0.87932	D	0	-24.81	16.3789	0.83431	0.0:0.0:0.0:1.0	.	271	Q9BVH7	SIA7E_HUMAN	H	271;181	ENSP00000417583:Y271H	ENSP00000406658:Y181H	Y	+	1	0	ST6GALNAC5	77301279	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.649000	0.83500	2.267000	0.75376	0.533000	0.62120	TAT	.	.		0.403	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026692.2	NM_030965	
ELTD1	64123	hgsc.bcm.edu	37	1	79356902	79356902	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:79356902C>T	ENST00000370742.3	-	15	2074		c.e15-1			NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CTTCTTGAATCTAAAAATTAA	0.259																																					.		Atlas-SNP	.											.	ELTD1	143	.	0			c.2011-1G>A						.						58.0	53.0	54.0					1																	79356902		1783	4039	5822	SO:0001630	splice_region_variant	64123	exon16			TTGAATCTAAAAA	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.2011-1G>A	chr1.hg19:g.79356902C>T		181.0	0.0		285.0	40.0	NM_022159	B1AR71|Q5KU34	Splice_Site	SNP	ENST00000370742.3	hg19	CCDS41352.1	.	.	.	.	.	.	.	.	.	.	C	13.17	2.155873	0.38021	.	.	ENSG00000162618	ENST00000370742;ENST00000401034	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2948	0.87168	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ELTD1	79129490	1.000000	0.71417	0.997000	0.53966	0.336000	0.28762	6.835000	0.75344	2.516000	0.84829	0.655000	0.94253	.	.	.		0.259	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	Intron
COL11A1	1301	hgsc.bcm.edu	37	1	103343720	103343720	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:103343720G>T	ENST00000370096.3	-	67	5588	c.5276C>A	c.(5275-5277)tCc>tAc	p.S1759Y	COL11A1_ENST00000358392.2_Splice_Site_p.S1771Y|COL11A1_ENST00000512756.1_Splice_Site_p.S1643Y|COL11A1_ENST00000353414.4_Splice_Site_p.S1720Y	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1759	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCCTTTTCTGGACTGTAAAAT	0.308																																					p.S1771Y		Atlas-SNP	.											.	COL11A1	972	.	0			c.C5312A						.						66.0	61.0	62.0					1																	103343720		2203	4300	6503	SO:0001630	splice_region_variant	1301	exon67			TTTCTGGACTGTA	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.5275-1C>A	chr1.hg19:g.103343720G>T		48.0	0.0		103.0	14.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	6.270	0.418019	0.11870	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	5.36	5.36	0.76844	Fibrillar collagen, C-terminal (4);	0.335856	0.32918	N	0.005489	T	0.54415	0.1857	L	0.34521	1.04	0.39274	D	0.964436	P;P;P;P;P	0.48503	0.794;0.846;0.911;0.873;0.755	P;B;B;P;B	0.45998	0.5;0.367;0.367;0.5;0.367	T	0.53005	-0.8499	10	0.16420	T	0.52	.	12.575	0.56359	0.0752:0.0:0.9248:0.0	.	1643;1720;1771;1759;979	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	Y	1759;1771;1720;979;1643	ENSP00000359114:S1759Y;ENSP00000351163:S1771Y;ENSP00000302551:S1720Y;ENSP00000426533:S1643Y	ENSP00000302551:S1720Y	S	-	2	0	COL11A1	103116308	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.779000	0.62375	2.774000	0.95407	0.655000	0.94253	TCC	.	.		0.308	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	Missense_Mutation
ELK4	2005	hgsc.bcm.edu	37	1	205588972	205588972	+	Intron	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:205588972C>T	ENST00000357992.4	-	3	1420				ELK4_ENST00000468523.1_5'Flank|ELK4_ENST00000289703.4_Missense_Mutation_p.C401Y	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)						cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			GACAGTCACACATAACCTTTC	0.318			T	SLC45A3	prostate																																p.C401Y		Atlas-SNP	.		Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	.	ELK4	45	.	0			c.G1202A						.						55.0	55.0	55.0					1																	205588972		2203	4300	6503	SO:0001627	intron_variant	2005	exon3			GTCACACATAACC	M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.1080+121G>A	chr1.hg19:g.205588972C>T		82.0	0.0		103.0	17.0	NM_021795	P28323|Q6GSJ2	Missense_Mutation	SNP	ENST00000357992.4	hg19	CCDS1456.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.670708	0.29693	.	.	ENSG00000158711	ENST00000289703	T	0.32515	1.45	5.42	-9.81	0.00487	.	.	.	.	.	T	0.15478	0.0373	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35500	-0.9786	8	0.87932	D	0	.	3.6076	0.08049	0.3214:0.4379:0.1162:0.1245	.	401	P28324-2	.	Y	401	ENSP00000289703:C401Y	ENSP00000289703:C401Y	C	-	2	0	ELK4	203855595	0.000000	0.05858	0.000000	0.03702	0.083000	0.17756	-0.490000	0.06482	-1.803000	0.01242	-1.261000	0.01458	TGT	.	.		0.318	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090615.1	NM_021795	
PGBD2	267002	hgsc.bcm.edu	37	1	249211485	249211485	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr1:249211485C>T	ENST00000329291.5	+	3	849	c.702C>T	c.(700-702)aaC>aaT	p.N234N	PGBD2_ENST00000355360.4_5'UTR|PGBD2_ENST00000539153.1_Silent_p.N231N|PGBD2_ENST00000462488.1_3'UTR	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	234										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CAGATAACAACGAACTTGATG	0.433																																					p.N234N		Atlas-SNP	.											.	PGBD2	103	.	0			c.C702T						.						109.0	111.0	111.0					1																	249211485		2203	4300	6503	SO:0001819	synonymous_variant	267002	exon3			TAACAACGAACTT	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.702C>T	chr1.hg19:g.249211485C>T		37.0	0.0		42.0	8.0	NM_170725	B3KVR8|Q6MZF8	Silent	SNP	ENST00000329291.5	hg19	CCDS31128.1																																																																																			.	.		0.433	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
RANBP2	5903	hgsc.bcm.edu	37	2	109347859	109347859	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:109347859G>T	ENST00000283195.6	+	4	460	c.334G>T	c.(334-336)Gga>Tga	p.G112*		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	112					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						TGTTACTGATGGAAGAGCAAA	0.338																																					p.G112X		Atlas-SNP	.											.	RANBP2	488	.	0			c.G334T						.						129.0	144.0	139.0					2																	109347859		2203	4299	6502	SO:0001587	stop_gained	5903	exon4			ACTGATGGAAGAG	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.334G>T	chr2.hg19:g.109347859G>T	ENSP00000283195:p.Gly112*	858.0	0.0		841.0	110.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Nonsense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	33	5.273520	0.95459	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	.	.	.	4.97	4.97	0.65823	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-25.9233	18.5845	0.91183	0.0:0.0:1.0:0.0	.	.	.	.	X	112	.	ENSP00000283195:G112X	G	+	1	0	RANBP2	108714291	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.531000	0.67148	2.477000	0.83638	0.573000	0.79308	GGA	.	.		0.338	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SLC9C1	285335	hgsc.bcm.edu	37	3	111996688	111996688	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:111996688G>A	ENST00000305815.5	-	5	590	c.338C>T	c.(337-339)cCc>cTc	p.P113L	SLC9C1_ENST00000487372.1_Missense_Mutation_p.P113L|SLC9C1_ENST00000467397.1_5'Flank	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1	113					cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										CAAAAAGCCGGGAATTGAAAT	0.303																																					p.P113L		Atlas-SNP	.											.	.	.	.	0			c.C338T						.						45.0	52.0	50.0					3																	111996688		2191	4297	6488	SO:0001583	missense	285335	exon5			AAGCCGGGAATTG	AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.338C>T	chr3.hg19:g.111996688G>A	ENSP00000306627:p.Pro113Leu	126.0	0.0		227.0	28.0	NM_183061	Q6ZRP4|Q7RTP2	Missense_Mutation	SNP	ENST00000305815.5	hg19	CCDS33817.1	.	.	.	.	.	.	.	.	.	.	G	10.55	1.381080	0.24944	.	.	ENSG00000172139	ENST00000305815;ENST00000487372;ENST00000486574	T;T;T	0.19532	2.14;2.14;2.14	5.13	5.13	0.70059	Cation/H+ exchanger (1);	0.000000	0.50627	D	0.000118	T	0.38585	0.1046	L	0.55481	1.735	0.48040	D	0.999571	D;D	0.89917	0.967;1.0	P;D	0.91635	0.752;0.999	T	0.05419	-1.0886	10	0.17369	T	0.5	.	14.0939	0.65008	0.0:0.0:1.0:0.0	.	113;113	Q4G0N8-2;Q4G0N8	.;S9A10_HUMAN	L	113;113;40	ENSP00000306627:P113L;ENSP00000420688:P113L;ENSP00000417274:P40L	ENSP00000306627:P113L	P	-	2	0	SLC9A10	113479378	1.000000	0.71417	0.923000	0.36655	0.005000	0.04900	4.760000	0.62235	2.375000	0.81037	0.655000	0.94253	CCC	.	.		0.303	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354066.1	NM_183061	
GCNT2	2651	hgsc.bcm.edu	37	6	10586875	10586875	+	Intron	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:10586875G>T	ENST00000379597.3	+	2	1481				GCNT2_ENST00000410107.1_Intron|GCNT2_ENST00000265012.4_Missense_Mutation_p.G218V|GCNT2_ENST00000316170.3_Intron|GCNT2_ENST00000495262.1_Intron|GCNT2_ENST00000397423.2_Intron			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)						maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		ATCACCCCAGGGGTGCTGCCT	0.413																																					p.G218V		Atlas-SNP	.											.	GCNT2	123	.	0			c.G653T						.						72.0	76.0	75.0					6																	10586875		2203	4300	6503	SO:0001627	intron_variant	2651	exon1			CCCCAGGGGTGCT	L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.926-34709G>T	chr6.hg19:g.10586875G>T		91.0	0.0		88.0	16.0	NM_145655		Missense_Mutation	SNP	ENST00000379597.3	hg19	CCDS34338.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.164504	0.78339	.	.	ENSG00000111846	ENST00000265012	T	0.10960	2.82	5.47	5.47	0.80525	.	.	.	.	.	T	0.23133	0.0559	M	0.83774	2.66	0.80722	D	1	P	0.42649	0.786	P	0.51297	0.665	T	0.01212	-1.1417	9	0.87932	D	0	.	19.3314	0.94291	0.0:0.0:1.0:0.0	.	218	Q8NFS9	GNT2C_HUMAN	V	218	ENSP00000265012:G218V	ENSP00000265012:G218V	G	+	2	0	GCNT2	10694861	1.000000	0.71417	0.994000	0.49952	0.956000	0.61745	6.525000	0.73795	2.552000	0.86080	0.655000	0.94253	GGG	.	.		0.413	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327912.3	NM_145649	
EEF1A1	1915	hgsc.bcm.edu	37	6	74227628	74227628	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:74227628T>A	ENST00000316292.9	-	7	2285	c.1294A>T	c.(1294-1296)Aca>Tca	p.T432S	EEF1A1_ENST00000309268.6_Missense_Mutation_p.T432S|EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Missense_Mutation_p.T432S	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	432					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						ACCGCAACTGTCTGTCTCATA	0.403											OREG0003893	type=REGULATORY REGION|Gene=BC038897|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.T432S		Atlas-SNP	.											.	EEF1A1	56	.	0			c.A1294T						.						42.0	44.0	43.0					6																	74227628		2203	4300	6503	SO:0001583	missense	1915	exon8			CAACTGTCTGTCT	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1294A>T	chr6.hg19:g.74227628T>A	ENSP00000339063:p.Thr432Ser	84.0	0.0	1151	113.0	18.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	T	14.44	2.534829	0.45073	.	.	ENSG00000156508	ENST00000316292;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.56275	0.47;0.47;0.47	4.81	4.81	0.61882	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (2);Translation elongation factor EFTu/EF1A, C-terminal (2);	0.000000	0.85682	U	0.000000	T	0.54663	0.1872	H	0.95079	3.62	0.80722	D	1	B;B;B	0.18166	0.026;0.026;0.026	B;B;B	0.24541	0.054;0.054;0.054	T	0.66929	-0.5799	10	0.87932	D	0	.	11.932	0.52851	0.0:0.0:0.1449:0.8551	.	432;432;432	P68104;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;EF1A3_HUMAN	S	432;432;432;411	ENSP00000339063:T432S;ENSP00000339053:T432S;ENSP00000330054:T432S	ENSP00000339053:T432S	T	-	1	0	EEF1A1	74284349	1.000000	0.71417	0.997000	0.53966	0.894000	0.52154	7.617000	0.83032	1.929000	0.55896	0.454000	0.30748	ACA	.	.		0.403	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
NUP205	23165	hgsc.bcm.edu	37	7	135330244	135330244	+	Silent	SNP	T	T	G			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:135330244T>G	ENST00000285968.6	+	41	5738	c.5712T>G	c.(5710-5712)ctT>ctG	p.L1904L		NM_015135.2	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1904					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(4)|central_nervous_system(2)|endometrium(9)|kidney(7)|large_intestine(17)|liver(4)|lung(36)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	93						TATTTATTCTTTGGCGCCATC	0.403											OREG0018343	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L1904L		Atlas-SNP	.											.	NUP205	198	.	0			c.T5712G						.						212.0	214.0	213.0					7																	135330244		2203	4300	6503	SO:0001819	synonymous_variant	23165	exon41			TATTCTTTGGCGC	D86978	CCDS34759.1	7q31.32	2007-03-26	2004-01-06	2004-01-07	ENSG00000155561	ENSG00000155561			18658	protein-coding gene	gene with protein product		614352	"""chromosome 7 open reading frame 14"""	C7orf14		9039502, 9348540	Standard	NM_015135		Approved	KIAA0225	uc003vsw.3	Q92621	OTTHUMG00000155497	ENST00000285968.6:c.5712T>G	chr7.hg19:g.135330244T>G		125.0	0.0	1617	184.0	23.0	NM_015135	A6H8X3|Q86YC1	Silent	SNP	ENST00000285968.6	hg19	CCDS34759.1																																																																																			.	.		0.403	NUP205-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340358.1		
DPP6	1804	hgsc.bcm.edu	37	7	154645528	154645528	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr7:154645528G>T	ENST00000377770.3	+	17	1846	c.1705G>T	c.(1705-1707)Gat>Tat	p.D569Y	RP11-476H24.1_ENST00000448767.1_RNA|DPP6_ENST00000332007.3_Missense_Mutation_p.D507Y|DPP6_ENST00000404039.1_Missense_Mutation_p.D505Y|DPP6_ENST00000427557.1_Missense_Mutation_p.D462Y			P42658	DPP6_HUMAN	dipeptidyl-peptidase 6	569					cell death (GO:0008219)|neuronal action potential (GO:0019228)|positive regulation of potassium ion transmembrane transport (GO:1901381)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			NS(3)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(35)|pancreas(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	71	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CAACACAACAGATAAGAAAAG	0.428																																					p.D569Y	NSCLC(125;1384 1783 2490 7422 34254)	Atlas-SNP	.											.	DPP6	383	.	0			c.G1705T						.						170.0	152.0	158.0					7																	154645528		1876	4110	5986	SO:0001583	missense	1804	exon17			ACAACAGATAAGA	M96859	CCDS75682.1, CCDS75683.1, CCDS75684.1	7q36.2	2006-08-07	2006-01-12		ENSG00000130226	ENSG00000130226			3010	protein-coding gene	gene with protein product		126141	"""dipeptidylpeptidase VI"", ""dipeptidylpeptidase 6"""			1729689	Standard	XM_006715871		Approved	DPPX	uc003wlk.3	P42658	OTTHUMG00000151511	ENST00000377770.3:c.1705G>T	chr7.hg19:g.154645528G>T	ENSP00000367001:p.Asp569Tyr	145.0	0.0		154.0	41.0	NM_130797		Missense_Mutation	SNP	ENST00000377770.3	hg19		.	.	.	.	.	.	.	.	.	.	G	8.809	0.934762	0.18206	.	.	ENSG00000130226	ENST00000404039;ENST00000377770;ENST00000332007;ENST00000427557	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.47	4.47	0.54385	.	0.540503	0.21329	N	0.076326	T	0.32436	0.0829	L	0.59436	1.845	0.48830	D	0.999715	B;B;B;B	0.18013	0.025;0.005;0.002;0.003	B;B;B;B	0.21151	0.033;0.006;0.004;0.003	T	0.12708	-1.0537	10	0.45353	T	0.12	-7.4579	14.1935	0.65654	0.0:0.0:1.0:0.0	.	462;507;569;505	E9PDL2;P42658-2;P42658;E9PF59	.;.;DPP6_HUMAN;.	Y	505;569;507;462	ENSP00000385578:D505Y;ENSP00000367001:D569Y;ENSP00000328226:D507Y;ENSP00000397303:D462Y	ENSP00000328226:D507Y	D	+	1	0	DPP6	154276461	0.971000	0.33674	0.830000	0.32933	0.141000	0.21300	4.143000	0.58051	2.158000	0.67659	0.655000	0.94253	GAT	.	.		0.428	DPP6-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000322932.1	NM_130797	
PTPDC1	138639	hgsc.bcm.edu	37	9	96870207	96870207	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:96870207G>A	ENST00000375360.3	+	10	2586	c.2246G>A	c.(2245-2247)gGc>gAc	p.G749D	PTPDC1_ENST00000288976.3_Missense_Mutation_p.G801D	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	749					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						ACAAAAGATGGCCCTAAGCCT	0.378																																					p.G803D		Atlas-SNP	.											.	PTPDC1	134	.	0			c.G2408A						.						26.0	27.0	27.0					9																	96870207		2201	4298	6499	SO:0001583	missense	138639	exon9			AAGATGGCCCTAA	BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.2246G>A	chr9.hg19:g.96870207G>A	ENSP00000364509:p.Gly749Asp	78.0	0.0		131.0	11.0	NM_001253829	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Missense_Mutation	SNP	ENST00000375360.3	hg19	CCDS6707.1	.	.	.	.	.	.	.	.	.	.	G	12.27	1.888815	0.33348	.	.	ENSG00000158079	ENST00000375360;ENST00000288976	T;T	0.16073	2.39;2.37	5.71	1.92	0.25849	.	0.604103	0.18814	N	0.130440	T	0.18215	0.0437	L	0.57536	1.79	0.09310	N	1	B;B;B;B	0.31680	0.335;0.328;0.335;0.083	B;B;B;B	0.34242	0.086;0.178;0.086;0.025	T	0.12426	-1.0548	10	0.59425	D	0.04	-0.8526	9.0699	0.36486	0.2712:0.0:0.7288:0.0	.	803;801;803;749	E7EN59;A2A3K4-2;A8K0X7;A2A3K4	.;.;.;PTPC1_HUMAN	D	749;801	ENSP00000364509:G749D;ENSP00000288976:G801D	ENSP00000288976:G801D	G	+	2	0	PTPDC1	95910028	0.007000	0.16637	0.000000	0.03702	0.682000	0.39822	1.565000	0.36386	0.105000	0.17753	0.650000	0.86243	GGC	.	.		0.378	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000215007.1	NM_177995, NM_152422	
C9orf152	401546	hgsc.bcm.edu	37	9	112963511	112963511	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr9:112963511C>T	ENST00000400613.4	-	2	1046	c.437G>A	c.(436-438)gGa>gAa	p.G146E	C9orf152_ENST00000473442.1_Intron	NM_001012993.2	NP_001013011.2	Q5JTZ5	CI152_HUMAN	chromosome 9 open reading frame 152	146										NS(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						TTGATCAGATCCCACAAGCTT	0.532																																					p.G146E		Atlas-SNP	.											.	C9orf152	20	.	0			c.G437A						.						206.0	187.0	193.0					9																	112963511		2203	4300	6503	SO:0001583	missense	401546	exon2			TCAGATCCCACAA	BX648620	CCDS35102.2	9q31.3	2012-04-03			ENSG00000188959	ENSG00000188959			31455	protein-coding gene	gene with protein product							Standard	NM_001012993		Approved	bA470J20.2	uc011lwk.2	Q5JTZ5	OTTHUMG00000020478	ENST00000400613.4:c.437G>A	chr9.hg19:g.112963511C>T	ENSP00000383456:p.Gly146Glu	141.0	0.0		106.0	18.0	NM_001012993	A8MWT6	Missense_Mutation	SNP	ENST00000400613.4	hg19	CCDS35102.2	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.594336	0.00857	.	.	ENSG00000188959	ENST00000400613	.	.	.	4.38	-3.56	0.04626	.	0.637853	0.14603	N	0.309514	T	0.12732	0.0309	N	0.12746	0.255	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.20009	-1.0288	9	0.16420	T	0.52	-2.9295	1.55	0.02573	0.1234:0.2292:0.2425:0.4049	.	146	Q5JTZ5	CI152_HUMAN	E	146	.	ENSP00000383456:G146E	G	-	2	0	C9orf152	112003332	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.214000	0.09292	-0.726000	0.04895	-1.845000	0.00574	GGA	.	.		0.532	C9orf152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053602.2	NM_001012993	
OR4A5	81318	hgsc.bcm.edu	37	11	51411592	51411592	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:51411592C>A	ENST00000319760.6	-	1	856	c.804G>T	c.(802-804)atG>atT	p.M268I		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	268						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AAAACACAGTCATGAACTTAT	0.363																																					p.M268I		Atlas-SNP	.											.	OR4A5	116	.	0			c.G804T						.						50.0	49.0	49.0					11																	51411592		2201	4296	6497	SO:0001583	missense	81318	exon1			CACAGTCATGAAC	AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.804G>T	chr11.hg19:g.51411592C>A	ENSP00000367664:p.Met268Ile	71.0	0.0		87.0	16.0	NM_001005272	Q6IF84	Missense_Mutation	SNP	ENST00000319760.6	hg19	CCDS31497.1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.457979	0.00173	.	.	ENSG00000221840	ENST00000319760	T	0.32753	1.44	2.2	-4.39	0.03611	GPCR, rhodopsin-like superfamily (1);	2.164420	0.02455	N	0.085995	T	0.11495	0.0280	N	0.02181	-0.65	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.20306	-1.0279	10	0.31617	T	0.26	.	4.7661	0.13132	0.5323:0.1613:0.0:0.3064	.	268	Q8NH83	OR4A5_HUMAN	I	268	ENSP00000367664:M268I	ENSP00000367664:M268I	M	-	3	0	OR4A5	51268168	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-3.282000	0.00528	-2.867000	0.00324	0.162000	0.16502	ATG	.	.		0.363	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391399.1	NM_001005272	
GRIA4	2893	hgsc.bcm.edu	37	11	105623945	105623945	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr11:105623945G>T	ENST00000530497.1	+	3	486	c.486G>T	c.(484-486)agG>agT	p.R162S	GRIA4_ENST00000393125.2_Splice_Site_p.R162S|GRIA4_ENST00000393127.2_Splice_Site_p.R162S|GRIA4_ENST00000525187.1_Splice_Site_p.R162S|GRIA4_ENST00000428631.2_Splice_Site_p.R162S|GRIA4_ENST00000282499.5_Splice_Site_p.R162S			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	162					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		ACACAGACAGGGGTAAGTCCA	0.393																																					p.R162S		Atlas-SNP	.											.	GRIA4	380	.	0			c.G486T						.						117.0	106.0	110.0					11																	105623945		2202	4299	6501	SO:0001630	splice_region_variant	2893	exon4			AGACAGGGGTAAG	U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.487+1G>T	chr11.hg19:g.105623945G>T		58.0	0.0		59.0	10.0	NM_001077244	Q86XE8	Missense_Mutation	SNP	ENST00000530497.1	hg19	CCDS8333.1	.	.	.	.	.	.	.	.	.	.	G	16.50	3.141628	0.57044	.	.	ENSG00000152578	ENST00000393125;ENST00000282499;ENST00000393127;ENST00000428631;ENST00000531011;ENST00000530497;ENST00000525187	T;T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	5.75	2.9	0.33743	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.82972	0.5153	L	0.41824	1.3	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;1.0;0.98	D;D;D;P	0.91635	0.944;0.999;0.999;0.609	T	0.78974	-0.1992	10	0.36615	T	0.2	.	10.0649	0.42297	0.29:0.0:0.71:0.0	.	162;162;192;162	P48058;G3V164;Q59GL7;Q86XE8	GRIA4_HUMAN;.;.;.	S	162	ENSP00000376833:R162S;ENSP00000282499:R162S;ENSP00000376835:R162S;ENSP00000415551:R162S;ENSP00000432443:R162S;ENSP00000435775:R162S;ENSP00000432180:R162S	ENSP00000282499:R162S	R	+	3	2	GRIA4	105129155	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	1.879000	0.39618	0.370000	0.24538	-0.150000	0.13652	AGG	.	.		0.393	GRIA4-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388593.1		Missense_Mutation
STYK1	55359	hgsc.bcm.edu	37	12	10775259	10775259	+	Silent	SNP	C	C	A			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:10775259C>A	ENST00000075503.3	-	9	1465	c.945G>T	c.(943-945)ctG>ctT	p.L315L		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	315	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						TCTCATAGAGCAGGATCCCAA	0.378										HNSCC(73;0.22)																											p.L315L		Atlas-SNP	.											.	STYK1	55	.	0			c.G945T						.						153.0	142.0	146.0					12																	10775259		2203	4300	6503	SO:0001819	synonymous_variant	55359	exon9			ATAGAGCAGGATC	AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.945G>T	chr12.hg19:g.10775259C>A		89.0	0.0		132.0	15.0	NM_018423	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Silent	SNP	ENST00000075503.3	hg19	CCDS8629.1																																																																																			.	.		0.378	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399622.1	NM_018423	
CAPS2	84698	hgsc.bcm.edu	37	12	75692559	75692559	+	Splice_Site	SNP	T	T	C	rs372993486		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr12:75692559T>C	ENST00000409445.3	-	12	1205	c.1009A>G	c.(1009-1011)Aca>Gca	p.T337A	RP11-560G2.1_ENST00000534648.2_RNA|CAPS2_ENST00000393284.3_Splice_Site_p.T105A|CAPS2_ENST00000442339.2_Intron|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000409799.1_Splice_Site_p.T255A	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	337							calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						AGCACATTTGTTCTAGAAAGT	0.323																																					p.T337A		Atlas-SNP	.											.	CAPS2	96	.	0			c.A1009G						.						99.0	97.0	98.0					12																	75692559		2203	4299	6502	SO:0001630	splice_region_variant	84698	exon12			CATTTGTTCTAGA	AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.1008-1A>G	chr12.hg19:g.75692559T>C		76.0	0.0		95.0	12.0	NM_032606	Q6PH84|Q8N242|Q8NAY5	Missense_Mutation	SNP	ENST00000409445.3	hg19	CCDS9008.2	.	.	.	.	.	.	.	.	.	.	T	12.75	2.031379	0.35797	.	.	ENSG00000180881	ENST00000409799;ENST00000409445;ENST00000378703;ENST00000393284	D;T;T	0.82619	-1.63;1.87;1.91	5.45	5.45	0.79879	.	0.143817	0.49305	D	0.000152	T	0.79399	0.4439	M	0.65320	2	0.80722	D	1	B;B;B;B	0.34290	0.447;0.019;0.058;0.011	B;B;B;B	0.26202	0.067;0.019;0.013;0.014	T	0.78360	-0.2234	10	0.34782	T	0.22	-14.7626	15.5603	0.76240	0.0:0.0:0.0:1.0	.	105;73;337;255	Q9BXY5-2;Q9BXY5-3;Q9BXY5;B9A061	.;.;CAYP2_HUMAN;.	A	255;337;73;105	ENSP00000386977:T255A;ENSP00000386959:T337A;ENSP00000376963:T105A	ENSP00000367975:T73A	T	-	1	0	CAPS2	73978826	1.000000	0.71417	1.000000	0.80357	0.461000	0.32589	1.392000	0.34486	2.091000	0.63221	0.439000	0.28862	ACA	.	.		0.323	CAPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000327880.2		Missense_Mutation
OR4L1	122742	hgsc.bcm.edu	37	14	20528668	20528668	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr14:20528668C>T	ENST00000315683.1	+	1	465	c.465C>T	c.(463-465)caC>caT	p.H155H		NM_001004717.1	NP_001004717.1	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L, member 1	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(16)|ovary(2)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GTTTTTTACACTCCATAAGCC	0.398																																					p.H155H		Atlas-SNP	.											.	OR4L1	98	.	0			c.C465T						.						148.0	138.0	141.0					14																	20528668		2203	4300	6503	SO:0001819	synonymous_variant	122742	exon1			TTTACACTCCATA		CCDS32029.1	14q11.2	2013-09-23			ENSG00000176246	ENSG00000176246		"""GPCR / Class A : Olfactory receptors"""	15356	protein-coding gene	gene with protein product				OR4L2P			Standard	NM_001004717		Approved		uc001vwn.1	Q8NH43	OTTHUMG00000169492	ENST00000315683.1:c.465C>T	chr14.hg19:g.20528668C>T		53.0	0.0		103.0	14.0	NM_001004717	Q6IEZ5	Silent	SNP	ENST00000315683.1	hg19	CCDS32029.1																																																																																			.	.		0.398	OR4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404381.1		
TM4SF5	9032	hgsc.bcm.edu	37	17	4686278	4686278	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:4686278C>T	ENST00000270560.3	+	4	556	c.525C>T	c.(523-525)atC>atT	p.I175I		NM_003963.2	NP_003954.2	O14894	T4S5_HUMAN	transmembrane 4 L six family member 5	175						integral component of plasma membrane (GO:0005887)				large_intestine(2)|lung(3)|ovary(1)	6						TGTGTGGGATCCAGCTGGTGA	0.597																																					p.I175I		Atlas-SNP	.											.	TM4SF5	26	.	0			c.C525T						.						123.0	104.0	110.0					17																	4686278		2203	4300	6503	SO:0001819	synonymous_variant	9032	exon4			TGGGATCCAGCTG	AF027204	CCDS11054.1	17p13.3	2007-01-06	2005-03-21		ENSG00000142484	ENSG00000142484			11857	protein-coding gene	gene with protein product		604657	"""transmembrane 4 superfamily member 5"""			9479038	Standard	NM_003963		Approved		uc002fyw.1	O14894	OTTHUMG00000090776	ENST00000270560.3:c.525C>T	chr17.hg19:g.4686278C>T		106.0	0.0		73.0	20.0	NM_003963	Q17RW9|Q6IB79	Silent	SNP	ENST00000270560.3	hg19	CCDS11054.1																																																																																			.	.		0.597	TM4SF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207558.2		
DSC2	1824	hgsc.bcm.edu	37	18	28648117	28648117	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr18:28648117T>C	ENST00000280904.6	-	16	3013	c.2570A>G	c.(2569-2571)tAt>tGt	p.Y857C	DSC2_ENST00000251081.6_3'UTR	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	857					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			TTCATAGTTATATGTCAGGAC	0.393																																					p.Y857C		Atlas-SNP	.											.	DSC2	168	.	0			c.A2570G						.						96.0	85.0	89.0					18																	28648117		2203	4300	6503	SO:0001583	missense	1824	exon16			TAGTTATATGTCA	X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2570A>G	chr18.hg19:g.28648117T>C	ENSP00000280904:p.Tyr857Cys	93.0	0.0		133.0	30.0	NM_024422		Missense_Mutation	SNP	ENST00000280904.6	hg19	CCDS11892.1	.	.	.	.	.	.	.	.	.	.	T	14.40	2.525070	0.44969	.	.	ENSG00000134755	ENST00000280904;ENST00000438199;ENST00000399347	D	0.87809	-2.3	5.87	5.87	0.94306	Cadherin, cytoplasmic domain (1);	0.000000	0.29838	N	0.011069	D	0.95127	0.8421	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96037	0.9021	10	0.87932	D	0	.	16.5764	0.84681	0.0:0.0:0.0:1.0	.	857	Q02487	DSC2_HUMAN	C	857;623;870	ENSP00000280904:Y857C	ENSP00000280904:Y857C	Y	-	2	0	DSC2	26902115	1.000000	0.71417	0.061000	0.19648	0.028000	0.11728	3.815000	0.55651	2.371000	0.80710	0.533000	0.62120	TAT	.	.		0.393	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254943.1	NM_004949	
KDM5D	8284	hgsc.bcm.edu	37	Y	21897301	21897301	+	Silent	SNP	C	C	T			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chrY:21897301C>T	ENST00000317961.4	-	8	1141	c.870G>A	c.(868-870)ttG>ttA	p.L290L	KDM5D_ENST00000541639.1_Silent_p.L290L|KDM5D_ENST00000382806.2_Silent_p.L233L	NM_004653.4	NP_004644.2	Q9BY66	KDM5D_HUMAN	lysine (K)-specific demethylase 5D	290					histone H3-K4 demethylation (GO:0034720)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(9)|lung(6)|skin(1)	17					Vitamin C(DB00126)	GCTCTAGGCTCAAGTGCTGCT	0.453																																					p.L290L		Atlas-SNP	.											.	KDM5D	40	.	0			c.G870A						.						119.0	117.0	118.0					Y																	21897301		624	1956	2580	SO:0001819	synonymous_variant	8284	exon8			TAGGCTCAAGTGC	U52191	CCDS14794.1, CCDS55554.1, CCDS55555.1	Yq11	2013-01-28	2009-04-06	2009-04-06	ENSG00000012817	ENSG00000012817		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11115	protein-coding gene	gene with protein product		426000	"""Jumonji, AT rich interactive domain 1D (RBP2-like)"", ""Smcy homolog, Y-linked (mouse)"", ""jumonji, AT rich interactive domain 1D"""	HYA, HY, SMCY, JARID1D		795123, 8841177	Standard	NM_001146705		Approved	KIAA0234	uc011naz.2	Q9BY66	OTTHUMG00000036508	ENST00000317961.4:c.870G>A	chrY.hg19:g.21897301C>T		39.0	0.0		74.0	21.0	NM_001146705	A2RU19|A6H8V7|B7ZLX1|Q92509|Q92809|Q9HCU1	Silent	SNP	ENST00000317961.4	hg19	CCDS14794.1																																																																																			.	.		0.453	KDM5D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088790.1	NM_004653	
CSNK1A1L	122011	hgsc.bcm.edu	37	13	37678905	37678906	+	Frame_Shift_Ins	INS	-	-	T	rs568346753		TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr13:37678905_37678906insT	ENST00000379800.3	-	1	897_898	c.488_489insA	c.(487-489)aagfs	p.K163fs		NM_145203.5	NP_660204.2	Q8N752	KC1AL_HUMAN	casein kinase 1, alpha 1-like	163	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell morphogenesis (GO:0000902)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	37		Lung NSC(96;7.97e-05)|Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.109)		all cancers(112;3.58e-07)|Epithelial(112;1.29e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00695)|BRCA - Breast invasive adenocarcinoma(63;0.0117)|GBM - Glioblastoma multiforme(144;0.0407)		TGTCTCTGTACTTTTTGGCCAA	0.421																																					p.K163fs		Atlas-INDEL	.											.	CSNK1A1L	69	.	0			c.489_490insA						.																																			SO:0001589	frameshift_variant	122011	exon1			.	BC028723	CCDS9363.1	13q13.2	2008-02-05			ENSG00000180138	ENSG00000180138			20289	protein-coding gene	gene with protein product							Standard	NM_145203		Approved	MGC33182	uc001uwm.1	Q8N752	OTTHUMG00000016748	ENST00000379800.3:c.489dupA	chr13.hg19:g.37678910_37678910dupT	ENSP00000369126:p.Lys163fs	323.0	0.0		286.0	43.0	NM_145203	Q5T2N2	Frame_Shift_Ins	INS	ENST00000379800.3	hg19	CCDS9363.1																																																																																			.	.		0.421	CSNK1A1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044563.1	NM_145203	
KBTBD12	166348	hgsc.bcm.edu	37	3	127642837	127642838	+	In_Frame_Ins	INS	-	-	TCA			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr3:127642837_127642838insTCA	ENST00000405109.1	+	2	1400_1401	c.933_934insTCA	c.(934-936)tca>TCAtca	p.312_312S>SS	KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000405256.1_In_Frame_Ins_p.312_312S>SS|KBTBD12_ENST00000343941.4_Intron			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	312										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CCTATTTCATCTCATCTCCCAA	0.411																																					p.I311delinsIS		Atlas-INDEL	.											.	KBTBD12	41	.	0			c.933_934insTCA						.																																			SO:0001652	inframe_insertion	166348	exon1			.		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.934_936dupTCA	chr3.hg19:g.127642838_127642840dupTCA	ENSP00000385957:p.Ser313dup	127.0	0.0		176.0	24.0	NM_207335	B5MCC6|Q6ZRK1	In_Frame_Ins	INS	ENST00000405109.1	hg19	CCDS33848.2																																																																																			.	.		0.411	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
TP53	7157	hgsc.bcm.edu	37	17	7577531	7577531	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:7577531delG	ENST00000269305.4	-	7	939	c.750delC	c.(748-750)cccfs	p.P250fs	TP53_ENST00000455263.2_Frame_Shift_Del_p.P250fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.P250fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.P250fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.P250fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Frame_Shift_Del_p.P250fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	250	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		P -> A (in sporadic cancers; somatic mutation).|P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> H (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> N (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> Q (in sporadic cancers; somatic mutation).|P -> S (in sporadic cancers; somatic mutation).|P -> T (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.?(5)|p.P250P(4)|p.P250L(2)|p.M246_P250delMNRRP(2)|p.P250_L252delPIL(2)|p.P250Q(2)|p.N247_P250delNRRP(1)|p.R248_P250delRRP(1)|p.P250_T253delPILT(1)|p.P250_I251insXXXXXX(1)|p.P250_I251insXXXXXXX(1)|p.R249_P250delRP(1)|p.P250_I251insX(1)|p.I251fs*96(1)|p.R249_T256delRPILTIIT(1)|p.R249_I251delRPI(1)|p.I251fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGATGGGCCTCCGGT	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.I251fs	Pancreas(47;798 1329 9957 10801)	Atlas-Indel,Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,malignant_melanoma,+1,4	TP53	33396	.	36	Deletion - In frame(10)|Whole gene deletion(8)|Unknown(5)|Substitution - Missense(4)|Substitution - coding silent(4)|Insertion - In frame(3)|Insertion - Frameshift(2)	biliary_tract(5)|breast(4)|bone(4)|upper_aerodigestive_tract(3)|large_intestine(3)|stomach(3)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|skin(3)|genital_tract(1)|peritoneum(1)|oesophagus(1)|lung(1)|ovary(1)	c.751delA						.						154.0	112.0	126.0					17																	7577531		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.750delC	chr17.hg19:g.7577531delG	ENSP00000269305:p.Pro250fs	106.0	0.0		352.0	91.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PMS1	5378	hgsc.bcm.edu	37	2	190719433	190719433	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr2:190719433delG	ENST00000441310.2	+	9	1668	c.1435delG	c.(1435-1437)gggfs	p.G479fs	PMS1_ENST00000432292.3_Frame_Shift_Del_p.G303fs|PMS1_ENST00000447232.2_Frame_Shift_Del_p.G479fs|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000409823.3_Frame_Shift_Del_p.G440fs|PMS1_ENST00000418224.3_Frame_Shift_Del_p.G303fs	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	479					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AGATGAGAGTGGGGAAAATGA	0.388			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																													p.S478fs		Atlas-Indel,Pindel	.	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	.	PMS1	78	.	0			c.1434delT						.						48.0	52.0	51.0					2																	190719433		2196	4298	6494	SO:0001589	frameshift_variant	5378	exon9			.		CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.1435delG	chr2.hg19:g.190719433delG	ENSP00000406490:p.Gly479fs	87.0	0.0		130.0	14.0	NM_001128144	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Frame_Shift_Del	DEL	ENST00000441310.2	hg19	CCDS2302.1																																																																																			.	.		0.388	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255918.2		
MAP2K4	6416	hgsc.bcm.edu	37	17	11998923	11998923	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr17:11998923delA	ENST00000353533.5	+	4	488	c.425delA	c.(424-426)caafs	p.Q142fs	MAP2K4_ENST00000415385.3_Frame_Shift_Del_p.Q153fs|MAP2K4_ENST00000581941.1_3'UTR	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	142	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		Q -> L (in a lung squamous cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.Q142L(1)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		GAAAAAGAACAAAAACAACTT	0.333			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																p.Q142fs		Atlas-INDEL	.		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	.	MAP2K4	176	.	12	Whole gene deletion(10)|Substitution - Missense(1)|Unknown(1)	breast(4)|ovary(4)|biliary_tract(1)|large_intestine(1)|lung(1)|pancreas(1)	c.424delC						.						154.0	146.0	149.0					17																	11998923		2203	4300	6503	SO:0001589	frameshift_variant	6416	exon4			.	L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.425delA	chr17.hg19:g.11998923delA	ENSP00000262445:p.Gln142fs	78.0	0.0		82.0	13.0	NM_003010	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Frame_Shift_Del	DEL	ENST00000353533.5	hg19	CCDS11162.1																																																																																			.	.		0.333	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000441226.1		
GPR116	221395	hgsc.bcm.edu	37	6	46847716	46847716	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr6:46847716delA	ENST00000283296.7	-	9	1163	c.875delT	c.(874-876)gtgfs	p.V292fs	GPR116_ENST00000456426.2_Intron|GPR116_ENST00000265417.7_Frame_Shift_Del_p.V292fs|GPR116_ENST00000362015.4_Frame_Shift_Del_p.V292fs	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	292	Ig-like 1.				energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			CTTTTCACACACCAGACTGAC	0.418																																					p.V292fs	NSCLC(59;410 1274 8751 36715 50546)	Atlas-INDEL	.											.	GPR116	133	.	0			c.876delG						.						149.0	128.0	135.0					6																	46847716		2203	4300	6503	SO:0001589	frameshift_variant	221395	exon9			.	AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.875delT	chr6.hg19:g.46847716delA	ENSP00000283296:p.Val292fs	81.0	0.0		90.0	15.0	NM_015234	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Frame_Shift_Del	DEL	ENST00000283296.7	hg19	CCDS4919.1																																																																																			.	.		0.418	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040806.2	NM_015234	
CHD9	80205	hgsc.bcm.edu	37	16	53340280	53340280	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A25V-01A-11D-A16V-10	TCGA-G3-A25V-10A-01D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4624fd20-e2ad-4826-b606-a694b04e1076	eac002f0-7695-4df1-8ff0-2c5c976279df	g.chr16:53340280delT	ENST00000398510.3	+	31	6838	c.6751delT	c.(6751-6753)tatfs	p.Y2251fs	CHD9_ENST00000447540.1_Frame_Shift_Del_p.Y2252fs|CHD9_ENST00000564845.1_Frame_Shift_Del_p.Y2251fs|CHD9_ENST00000566029.1_Frame_Shift_Del_p.Y2251fs			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2251					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				ACAAGGTGGATATATGCTGGC	0.393																																					p.G2250fs		Atlas-Indel,Pindel	.											.	CHD9	203	.	0			c.6750delA						.						79.0	78.0	79.0					16																	53340280		1880	4108	5988	SO:0001589	frameshift_variant	80205	exon32			.	AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.6751delT	chr16.hg19:g.53340280delT	ENSP00000381522:p.Tyr2251fs	89.0	0.0		97.0	15.0	NM_025134	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Frame_Shift_Del	DEL	ENST00000398510.3	hg19																																																																																				.	.		0.393	CHD9-020	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000422345.1	NM_025134	
