#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
HFE2	148738	hgsc.bcm.edu	37	1	145414811	145414811	+	Silent	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:145414811C>T	ENST00000336751.5	+	2	268	c.30C>T	c.(28-30)ccC>ccT	p.P10P	HFE2_ENST00000475797.1_Intron|HFE2_ENST00000357836.5_Intron|HFE2_ENST00000497365.1_Intron	NM_213653.3	NP_998818.1	Q6ZVN8	RGMC_HUMAN	hemochromatosis type 2 (juvenile)	10					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|iron ion homeostasis (GO:0055072)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)	14	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CCCCTAGTCCCAGGTCCTCCC	0.582																																					p.P10P		Atlas-SNP	.											.	HFE2	48	.	0			c.C30T						.						96.0	83.0	88.0					1																	145414811		2203	4300	6503	SO:0001819	synonymous_variant	148738	exon2			TAGTCCCAGGTCC	AY372521	CCDS72877.1, CCDS72878.1, CCDS72879.1	1q21.2	2014-06-26			ENSG00000168509	ENSG00000168509			4887	protein-coding gene	gene with protein product	"""repulsive guidance molecule c"""	608374				10205270, 14647275	Standard	NM_213653		Approved	JH, HFE2A, RGMC, HJV, hemojuvelin, haemojuvelin	uc001eni.2	Q6ZVN8	OTTHUMG00000013748	ENST00000336751.5:c.30C>T	chr1.hg19:g.145414811C>T		60.0	0.0		80.0	22.0	NM_213653	B1ALI7|Q2PQ63|Q6IMF6|Q8NAH2|Q8WVJ5	Silent	SNP	ENST00000336751.5	hg19	CCDS910.1																																																																																			.	.		0.582	HFE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038527.1	NM_145277	
CKS1B	1163	hgsc.bcm.edu	37	1	154947279	154947279	+	Splice_Site	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:154947279C>T	ENST00000308987.5	+	1	105	c.58C>T	c.(58-60)Cga>Tga	p.R20*	CKS1B_ENST00000368436.1_Splice_Site_p.R20*|SHC1_ENST00000368450.1_5'Flank|CKS1B_ENST00000368439.1_5'UTR|MIR4258_ENST00000580920.1_RNA|SHC1_ENST00000368453.4_5'Flank	NM_001826.2	NP_001817.1	P61024	CKS1_HUMAN	CDC28 protein kinase regulatory subunit 1B	20					cell division (GO:0051301)|cell proliferation (GO:0008283)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	nucleoplasm (GO:0005654)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)			breast(1)|large_intestine(1)|lung(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GTTTGAGTATCGGTTAGTGCT	0.537																																					p.R20X		Atlas-SNP	.											.	CKS1B	5	.	0			c.C58T						.						58.0	50.0	52.0					1																	154947279		2203	4300	6503	SO:0001630	splice_region_variant	1163	exon1			GAGTATCGGTTAG	BC007751	CCDS1077.1	1q21.2	2011-04-28	2002-10-07		ENSG00000173207	ENSG00000173207			19083	protein-coding gene	gene with protein product		116900	"""CDC28 protein kinase 1B"""			2227411	Standard	NM_001826		Approved	ckshs1, CKS1	uc001fgb.3	P61024	OTTHUMG00000037413	ENST00000308987.5:c.59+1C>T	chr1.hg19:g.154947279C>T		133.0	0.0		185.0	53.0	NM_001826	P33551	Nonsense_Mutation	SNP	ENST00000308987.5	hg19	CCDS1077.1	.	.	.	.	.	.	.	.	.	.	C	32	5.191087	0.94923	.	.	ENSG00000173207	ENST00000368436;ENST00000308987	.	.	.	5.26	2.21	0.28008	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.2945	0.60288	0.3965:0.6035:0.0:0.0	.	.	.	.	X	20	.	ENSP00000311083:R20X	R	+	1	2	CKS1B	153213903	1.000000	0.71417	1.000000	0.80357	0.887000	0.51463	2.771000	0.47670	0.305000	0.22832	0.591000	0.81541	CGA	.	.		0.537	CKS1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091078.1	NM_001826	Nonsense_Mutation
IFI16	3428	hgsc.bcm.edu	37	1	158984635	158984635	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:158984635G>C	ENST00000295809.7	+	2	420	c.165G>C	c.(163-165)aaG>aaC	p.K55N	IFI16_ENST00000430894.2_Missense_Mutation_p.K59N|IFI16_ENST00000448393.2_Missense_Mutation_p.K55N|IFI16_ENST00000368131.4_Missense_Mutation_p.K55N|IFI16_ENST00000340979.6_Missense_Mutation_p.K55N|IFI16_ENST00000368132.3_Missense_Mutation_p.K55N|IFI16_ENST00000359709.3_Missense_Mutation_p.K55N			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	55	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.|Lys-rich.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TGGAAGAAAAGTTCCGAGGTG	0.333																																					p.K55N		Atlas-SNP	.											.	IFI16	111	.	0			c.G165C						.						80.0	85.0	84.0					1																	158984635		2203	4300	6503	SO:0001583	missense	3428	exon2			AGAAAAGTTCCGA	M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.165G>C	chr1.hg19:g.158984635G>C	ENSP00000295809:p.Lys55Asn	258.0	0.0		271.0	64.0	NM_001206567	B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	ENST00000295809.7	hg19		.	.	.	.	.	.	.	.	.	.	.	13.48	2.250355	0.39797	.	.	ENSG00000163565	ENST00000359709;ENST00000426592;ENST00000447473;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	3.27	2.34	0.29019	Pyrin (2);DEATH-like (1);	.	.	.	.	T	0.47673	0.1458	M	0.71206	2.165	0.09310	N	1	D;P;D	0.67145	0.992;0.713;0.996	P;B;P	0.62491	0.903;0.223;0.903	T	0.23833	-1.0177	9	0.62326	D	0.03	.	8.4964	0.33130	0.0:0.2393:0.7607:0.0	.	59;55;55	E7EPR3;Q16666-2;Q16666	.;.;IF16_HUMAN	N	55;55;55;55;55;55;55;59	ENSP00000352740:K55N;ENSP00000406406:K55N;ENSP00000407052:K55N;ENSP00000295809:K55N;ENSP00000342741:K55N;ENSP00000357113:K55N;ENSP00000357114:K55N;ENSP00000394935:K59N	ENSP00000295809:K55N	K	+	3	2	IFI16	157251259	0.020000	0.18652	0.019000	0.16419	0.001000	0.01503	-0.027000	0.12371	0.916000	0.36871	0.555000	0.69702	AAG	.	.		0.333	IFI16-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000421720.1	NM_005531	
RASAL2	9462	hgsc.bcm.edu	37	1	178420786	178420786	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr1:178420786G>A	ENST00000462775.1	+	8	1389	c.1264G>A	c.(1264-1266)Gac>Aac	p.D422N	RASAL2_ENST00000448150.3_Missense_Mutation_p.D552N|RASAL2_ENST00000367649.3_Missense_Mutation_p.D570N	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	422	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TGAACTGATAGACCATCAGAG	0.408																																					p.D570N		Atlas-SNP	.											.	RASAL2	334	.	0			c.G1708A						.						180.0	170.0	173.0					1																	178420786		2203	4300	6503	SO:0001583	missense	9462	exon10			CTGATAGACCATC	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.1264G>A	chr1.hg19:g.178420786G>A	ENSP00000420558:p.Asp422Asn	66.0	0.0		54.0	19.0	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	ENST00000462775.1	hg19	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875079	0.91664	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	D;T;D	0.81739	-1.53;2.33;-1.53	5.84	5.84	0.93424	Rho GTPase activation protein (1);Ras GTPase-activating protein (4);	0.109437	0.64402	D	0.000009	T	0.81380	0.4810	N	0.25380	0.74	0.80722	D	1	P;B	0.38863	0.65;0.241	P;B	0.49140	0.601;0.148	T	0.82345	-0.0503	10	0.87932	D	0	.	20.1551	0.98106	0.0:0.0:1.0:0.0	.	422;570	Q9UJF2;F8W755	NGAP_HUMAN;.	N	552;570;422	ENSP00000407768:D552N;ENSP00000356621:D570N;ENSP00000420558:D422N	ENSP00000356621:D570N	D	+	1	0	RASAL2	176687409	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	9.731000	0.98807	2.760000	0.94817	0.655000	0.94253	GAC	.	.		0.408	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	
APOB	338	hgsc.bcm.edu	37	2	21235442	21235442	+	Nonsense_Mutation	SNP	G	G	T	rs200708197		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:21235442G>T	ENST00000233242.1	-	26	4425	c.4298C>A	c.(4297-4299)tCg>tAg	p.S1433*		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	1433					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)	p.S1433L(1)		NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTGATATTCGAATCTAGAAA	0.368																																					p.S1433X		Atlas-SNP	.											APOB,NS,carcinoma,0,2	APOB	761	.	1	Substitution - Missense(1)	large_intestine(1)	c.C4298A						.						83.0	88.0	86.0					2																	21235442		2202	4300	6502	SO:0001587	stop_gained	338	exon26			ATATTCGAATCTA	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.4298C>A	chr2.hg19:g.21235442G>T	ENSP00000233242:p.Ser1433*	73.0	0.0		73.0	20.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	45	11.530493	0.99572	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	.	.	.	5.88	5.88	0.94601	.	0.000000	0.56097	D	0.000037	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	.	.	.	X	1433	.	ENSP00000233242:S1433X	S	-	2	0	APOB	21088947	1.000000	0.71417	0.987000	0.45799	0.931000	0.56810	8.712000	0.91403	2.782000	0.95742	0.655000	0.94253	TCG	.	G|0.999;A|0.001		0.368	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
MARCO	8685	hgsc.bcm.edu	37	2	119739211	119739211	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:119739211C>T	ENST00000327097.4	+	10	1015	c.880C>T	c.(880-882)Cct>Tct	p.P294S	MARCO_ENST00000541757.1_Missense_Mutation_p.P216S	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	294	Collagen-like.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						GGCTGGTTTTCCTGGAGCTAA	0.443																																					p.P294S	GBM(8;18 374 7467 11269 32796)	Atlas-SNP	.											.	MARCO	120	.	0			c.C880T						.						75.0	79.0	78.0					2																	119739211		2202	4298	6500	SO:0001583	missense	8685	exon10			GGTTTTCCTGGAG	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.880C>T	chr2.hg19:g.119739211C>T	ENSP00000318916:p.Pro294Ser	84.0	0.0		89.0	27.0	NM_006770	B4DW79|Q9Y5S3	Missense_Mutation	SNP	ENST00000327097.4	hg19	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	C	9.481	1.098186	0.20552	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	D;D	0.93133	-3.17;-3.17	5.2	3.36	0.38483	.	0.329727	0.29692	N	0.011451	D	0.91068	0.7189	M	0.74467	2.265	0.32272	N	0.568704	P	0.36162	0.54	B	0.37346	0.247	D	0.89187	0.3548	9	.	.	.	.	6.1027	0.20057	0.1856:0.7205:0.0:0.0939	.	294	Q9UEW3	MARCO_HUMAN	S	294;294;216	ENSP00000318916:P294S;ENSP00000441769:P216S	.	P	+	1	0	MARCO	119455681	0.868000	0.29978	0.428000	0.26697	0.969000	0.65631	0.880000	0.28159	0.730000	0.32425	0.561000	0.74099	CCT	.	.		0.443	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
TTN	7273	hgsc.bcm.edu	37	2	179407524	179407524	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:179407524C>T	ENST00000591111.1	-	298	92358	c.92134G>A	c.(92134-92136)Gtc>Atc	p.V30712I	TTN-AS1_ENST00000586452.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V32353I|TTN_ENST00000342992.6_Missense_Mutation_p.V29785I|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V23413I|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V23480I|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V23288I|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30712	Ig-like 138.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAACTGTGACACGCTCTGAT	0.458																																					p.V32353I		Atlas-SNP	.											.	TTN	18412	.	0			c.G97057A						.						209.0	199.0	202.0					2																	179407524		1965	4156	6121	SO:0001583	missense	7273	exon348			CTGTGACACGCTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.92134G>A	chr2.hg19:g.179407524C>T	ENSP00000465570:p.Val30712Ile	104.0	0.0		122.0	20.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.76	2.035655	0.35893	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.67	3.87	0.44632	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46092	0.1375	N	0.10618	0.005	0.34369	D	0.691823	B;B;B;B	0.10296	0.003;0.003;0.003;0.003	B;B;B;B	0.10450	0.005;0.005;0.005;0.005	T	0.55289	-0.8164	9	0.87932	D	0	.	10.0264	0.42074	0.0:0.7803:0.0:0.2197	.	23288;23413;23480;30712	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	I	29785;23288;23480;23413;23285	ENSP00000343764:V29785I;ENSP00000434586:V23288I;ENSP00000340554:V23480I;ENSP00000352154:V23413I	ENSP00000340554:V23480I	V	-	1	0	TTN	179115770	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.541000	0.36126	1.402000	0.46780	0.655000	0.94253	GTC	.	.		0.458	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
MLPH	79083	hgsc.bcm.edu	37	2	238434305	238434305	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:238434305A>T	ENST00000264605.3	+	7	1031	c.737A>T	c.(736-738)gAg>gTg	p.E246V	MLPH_ENST00000338530.4_Missense_Mutation_p.E246V|MLPH_ENST00000409373.1_Missense_Mutation_p.E206V|MLPH_ENST00000410032.1_Intron|MLPH_ENST00000445024.2_Missense_Mutation_p.E246V|MLPH_ENST00000468178.1_3'UTR	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	246					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		GGCCTGGAGGAGGCTGATACT	0.632																																					p.E246V		Atlas-SNP	.											.	MLPH	41	.	0			c.A737T						.						50.0	52.0	51.0					2																	238434305		2203	4300	6503	SO:0001583	missense	79083	exon7			TGGAGGAGGCTGA	AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.737A>T	chr2.hg19:g.238434305A>T	ENSP00000264605:p.Glu246Val	40.0	0.0		52.0	14.0	NM_001042467	B3KSS2|B4DKW7|G5E9G5|Q9HA71	Missense_Mutation	SNP	ENST00000264605.3	hg19	CCDS2518.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.803|9.803	1.180978|1.180978	0.21787|0.21787	.|.	.|.	ENSG00000115648|ENSG00000115648	ENST00000264605;ENST00000445024;ENST00000338530;ENST00000409373|ENST00000437893	T;T;T;T|T	0.33865|0.31247	1.89;1.88;1.68;1.39|1.5	3.24|3.24	2.07|2.07	0.26955|0.26955	.|.	0.533147|.	0.13871|.	U|.	0.357000|.	T|T	0.32224|0.32224	0.0822|0.0822	L|L	0.47190|0.47190	1.495|1.495	0.09310|0.09310	N|N	1|1	D;D;D;D;D;D|.	0.63046|.	0.98;0.966;0.992;0.985;0.981;0.967|.	P;P;P;P;P;P|.	0.57324|.	0.578;0.543;0.818;0.587;0.793;0.547|.	T|T	0.22871|0.22871	-1.0204|-1.0204	10|7	0.66056|0.87932	D|D	0.02|0	-10.8271|-10.8271	7.5003|7.5003	0.27513|0.27513	0.8826:0.0:0.1174:0.0|0.8826:0.0:0.1174:0.0	.|.	246;130;246;206;246;246|.	B4DKW7;Q6UWC1;A8KA64;B8ZZ97;Q9BV36-2;Q9BV36|.	.;.;.;.;.;MELPH_HUMAN|.	V|W	246;246;246;206|53	ENSP00000264605:E246V;ENSP00000414849:E246V;ENSP00000341845:E246V;ENSP00000386780:E206V|ENSP00000412438:R53W	ENSP00000264605:E246V|ENSP00000412438:R53W	E|R	+|+	2|1	0|2	MLPH|MLPH	238099044|238099044	0.015000|0.015000	0.18098|0.18098	0.003000|0.003000	0.11579|0.11579	0.001000|0.001000	0.01503|0.01503	0.929000|0.929000	0.28844|0.28844	0.159000|0.159000	0.19401|0.19401	-1.450000|-1.450000	0.01041|0.01041	GAG|AGG	.	.		0.632	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257083.2	NM_024101	
UCN2	90226	hgsc.bcm.edu	37	3	48600437	48600437	+	Nonsense_Mutation	SNP	G	G	A	rs149022309		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:48600437G>A	ENST00000273610.3	-	2	203	c.121C>T	c.(121-123)Cga>Tga	p.R41*	PFKFB4_ENST00000536104.1_5'Flank|COL7A1_ENST00000470076.1_5'Flank	NM_033199.3	NP_149976.1	Q96RP3	UCN2_HUMAN	urocortin 2	41					cAMP biosynthetic process (GO:0006171)|cell proliferation (GO:0008283)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hypoxia (GO:0071456)|digestion (GO:0007586)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of gene expression (GO:0010629)|negative regulation of luteinizing hormone secretion (GO:0033685)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone binding (GO:0042562)|receptor binding (GO:0005102)								BRCA - Breast invasive adenocarcinoma(193;0.000288)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GCCGCAGGTCGGGGAGTGGTC	0.652																																					p.R41X		Atlas-SNP	.											.	UCN2	4	.	0			c.C121T						.	A	stop/ARG	0,4406		0,0,2203	30.0	32.0	32.0		121	-10.6	0.0	3	dbSNP_134	32	1,8599	1.2+/-3.3	0,1,4299	yes	stop-gained	UCN2	NM_033199.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		41/113	48600437	1,13005	2203	4300	6503	SO:0001587	stop_gained	90226	exon2			CAGGTCGGGGAGT	AF320560	CCDS2772.1	3p21.3	2013-02-28			ENSG00000145040	ENSG00000145040		"""Endogenous ligands"""	18414	protein-coding gene	gene with protein product	"""prepro-urocortin 2"""	605902				11329063	Standard	NM_033199		Approved	UCNI, SRP, URP, UCN-II	uc003cty.1	Q96RP3	OTTHUMG00000133533	ENST00000273610.3:c.121C>T	chr3.hg19:g.48600437G>A	ENSP00000273610:p.Arg41*	74.0	0.0		71.0	17.0	NM_033199	Q9BUG0	Nonsense_Mutation	SNP	ENST00000273610.3	hg19	CCDS2772.1	.	.	.	.	.	.	.	.	.	.	g	8.413	0.844566	0.16963	0.0	1.16E-4	ENSG00000145040	ENST00000273610	.	.	.	5.28	-10.6	0.00265	.	2.567240	0.01439	N	0.015013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-3.5288	0.3326	0.00321	0.2654:0.158:0.2353:0.3414	.	.	.	.	X	41	.	ENSP00000273610:R41X	R	-	1	2	UCN2	48575441	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.503000	0.00449	-3.150000	0.00231	-5.056000	0.00002	CGA	.	G|1.000;A|0.000		0.652	UCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257510.1	NM_033199	
RNF123	63891	hgsc.bcm.edu	37	3	49738928	49738928	+	Missense_Mutation	SNP	G	G	T	rs369164501		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:49738928G>T	ENST00000327697.6	+	16	1426	c.1282G>T	c.(1282-1284)Gac>Tac	p.D428Y	RNF123_ENST00000432042.1_Missense_Mutation_p.D282Y	NM_022064.3	NP_071347.2	Q5XPI4	RN123_HUMAN	ring finger protein 123	428					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38				BRCA - Breast invasive adenocarcinoma(193;4.71e-05)|Kidney(197;0.00227)|KIRC - Kidney renal clear cell carcinoma(197;0.00255)		CGCCAGCTTCGACGTGCTCCG	0.632											OREG0015570	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D428Y		Atlas-SNP	.											.	RNF123	100	.	0			c.G1282T						.						52.0	56.0	54.0					3																	49738928		2203	4300	6503	SO:0001583	missense	63891	exon16			AGCTTCGACGTGC	AK022627	CCDS33758.1	3p24.3	2008-02-05			ENSG00000164068	ENSG00000164068		"""RING-type (C3HC4) zinc fingers"""	21148	protein-coding gene	gene with protein product		614472					Standard	NM_022064		Approved	FLJ12565	uc003cxh.4	Q5XPI4	OTTHUMG00000156891	ENST00000327697.6:c.1282G>T	chr3.hg19:g.49738928G>T	ENSP00000328287:p.Asp428Tyr	32.0	0.0	964	37.0	12.0	NM_022064	A1L4Q3|A6NLS5|Q5I022|Q6PFW4|Q71RH0|Q8IW18|Q9H0M8|Q9H5L8|Q9H9T2	Missense_Mutation	SNP	ENST00000327697.6	hg19	CCDS33758.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119186	0.77323	.	.	ENSG00000164068	ENST00000327697;ENST00000389066;ENST00000432042	T;T	0.79033	-0.91;-1.23	5.71	5.71	0.89125	.	0.176658	0.47852	D	0.000204	T	0.81744	0.4887	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.84283	0.0495	10	0.87932	D	0	-32.0212	18.8457	0.92205	0.0:0.0:1.0:0.0	.	282;428	C9J266;Q5XPI4	.;RN123_HUMAN	Y	428;428;282	ENSP00000328287:D428Y;ENSP00000392443:D282Y	ENSP00000328287:D428Y	D	+	1	0	RNF123	49713932	1.000000	0.71417	0.991000	0.47740	0.200000	0.23975	9.153000	0.94687	2.698000	0.92095	0.561000	0.74099	GAC	.	.		0.632	RNF123-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346475.2	NM_022064	
C4orf51	646603	hgsc.bcm.edu	37	4	146650321	146650321	+	Splice_Site	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr4:146650321G>T	ENST00000438731.1	+	4	367	c.367G>T	c.(367-369)Gca>Tca	p.A123S		NM_001080531.1	NP_001074000.1	C9J302	CD051_HUMAN	chromosome 4 open reading frame 51	123										haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)	6						CTTTTTATAGGCACATCAAAT	0.343																																					p.A123S		Atlas-SNP	.											.	C4orf51	18	.	0			c.G367T						.						109.0	99.0	102.0					4																	146650321		1823	4079	5902	SO:0001630	splice_region_variant	646603	exon4			TTATAGGCACATC		CCDS47140.1	4q31.21	2009-09-09			ENSG00000237136	ENSG00000237136			37264	protein-coding gene	gene with protein product							Standard	NM_001080531		Approved		uc003ikk.3	C9J302	OTTHUMG00000161367	ENST00000438731.1:c.367-1G>T	chr4.hg19:g.146650321G>T		184.0	0.0		199.0	20.0	NM_001080531		Missense_Mutation	SNP	ENST00000438731.1	hg19	CCDS47140.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.10|19.10	3.762600|3.762600	0.69763|0.69763	.|.	.|.	ENSG00000237136|ENSG00000237136	ENST00000438731|ENST00000511965	.|.	.|.	.|.	3.48|3.48	3.48|3.48	0.39840|0.39840	.|.	.|.	.|.	.|.	.|.	T|T	0.32734|0.32734	0.0839|0.0839	N|N	0.24115|0.24115	0.695|0.695	0.28406|0.28406	N|N	0.918429|0.918429	D|.	0.89917|.	1.0|.	D|.	0.72338|.	0.977|.	T|T	0.14699|0.14699	-1.0463|-1.0463	7|5	.|.	.|.	.|.	.|.	10.7797|10.7797	0.46371|0.46371	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	123|.	C9J302|.	CD051_HUMAN|.	S|C	123|82	.|.	.|.	A|W	+|+	1|3	0|0	C4orf51|C4orf51	146869771|146869771	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.371000|0.371000	0.29859|0.29859	1.323000|1.323000	0.33701|0.33701	2.251000|2.251000	0.74343|0.74343	0.585000|0.585000	0.79938|0.79938	GCA|TGG	.	.		0.343	C4orf51-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080531	Missense_Mutation
DAB2	1601	hgsc.bcm.edu	37	5	39376177	39376177	+	Silent	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:39376177G>T	ENST00000320816.6	-	13	2636	c.2169C>A	c.(2167-2169)tcC>tcA	p.S723S	DAB2_ENST00000339788.6_Silent_p.S505S|DAB2_ENST00000509337.1_Silent_p.S702S|DAB2_ENST00000545653.1_Silent_p.S702S	NM_001343.3	NP_001334.2	P98082	DAB2_HUMAN	Dab, mitogen-responsive phosphoprotein, homolog 2 (Drosophila)	723	Required for interaction with MYO6. {ECO:0000250}.|Sufficient for interaction with GRB2. {ECO:0000250}.|Sufficient for interaction with SH3KBP1 SH3 domain. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|cell morphogenesis involved in differentiation (GO:0000904)|cell proliferation (GO:0008283)|cellular response to transforming growth factor beta stimulus (GO:0071560)|clathrin coat assembly (GO:0048268)|endoderm development (GO:0007492)|excretion (GO:0007588)|in utero embryonic development (GO:0001701)|leading edge cell differentiation (GO:0035026)|membrane organization (GO:0061024)|myeloid cell differentiation (GO:0030099)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein binding (GO:0032091)|negative regulation of protein localization to plasma membrane (GO:1903077)|negative regulation of transcription, DNA-templated (GO:0045892)|pinocytosis (GO:0006907)|positive regulation of cell migration (GO:0030335)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of endocytosis (GO:0045807)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of receptor recycling (GO:0001921)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|clathrin coat of coated pit (GO:0030132)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	cargo receptor activity (GO:0038024)|clathrin adaptor activity (GO:0035615)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein C-terminus binding (GO:0008022)|SMAD binding (GO:0046332)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(5)|large_intestine(9)|lung(19)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	47	all_lung(31;0.000197)		Epithelial(62;0.137)			TAACTGGCAGGGAAACTTGTC	0.433																																					p.S723S		Atlas-SNP	.											.	DAB2	124	.	0			c.C2169A						.						100.0	102.0	101.0					5																	39376177		2203	4300	6503	SO:0001819	synonymous_variant	1601	exon13			TGGCAGGGAAACT	U53446	CCDS34149.1, CCDS58946.1	5p13.1	2013-10-03	2013-03-08		ENSG00000153071	ENSG00000153071			2662	protein-coding gene	gene with protein product		601236	"""disabled (Drosophila) homolog 2 (mitogen-responsive phosphoprotein)"", ""disabled homolog 2, mitogen-responsive phosphoprotein (Drosophila)"""			8660969, 9620555	Standard	NM_001343		Approved	DOC-2	uc003jlx.3	P98082	OTTHUMG00000162043	ENST00000320816.6:c.2169C>A	chr5.hg19:g.39376177G>T		66.0	0.0		77.0	34.0	NM_001343	A6NES5|Q13598|Q9BTY0|Q9UK04	Silent	SNP	ENST00000320816.6	hg19	CCDS34149.1																																																																																			.	.		0.433	DAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367014.1	NM_001343	
TMEM232	642987	hgsc.bcm.edu	37	5	109941886	109941886	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:109941886G>T	ENST00000455884.2	-	9	1055	c.1005C>A	c.(1003-1005)agC>agA	p.S335R	TMEM232_ENST00000515518.2_5'UTR|TMEM232_ENST00000429839.2_Missense_Mutation_p.S335R			C9JQI7	TM232_HUMAN	transmembrane protein 232	335						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						CAGACATAATGCTTGAAACAA	0.358																																					p.S335R		Atlas-SNP	.											.	TMEM232	57	.	0			c.C1005A						.						69.0	58.0	61.0					5																	109941886		692	1591	2283	SO:0001583	missense	642987	exon9			CATAATGCTTGAA	AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.1005C>A	chr5.hg19:g.109941886G>T	ENSP00000401477:p.Ser335Arg	129.0	0.0		143.0	22.0	NM_001039763	B4DKF4	Missense_Mutation	SNP	ENST00000455884.2	hg19	CCDS47253.2	.	.	.	.	.	.	.	.	.	.	G	14.88	2.668349	0.47677	.	.	ENSG00000186952	ENST00000429839;ENST00000455884	.	.	.	5.45	3.58	0.41010	.	0.756414	0.13148	N	0.410099	T	0.54919	0.1888	L	0.59436	1.845	0.09310	N	1	D;P;D	0.63046	0.992;0.904;0.977	P;P;P	0.58873	0.847;0.571;0.803	T	0.43261	-0.9402	8	.	.	.	-1.5952	12.1974	0.54305	0.0:0.0:0.6919:0.3081	.	335;335;217	C9JQI7;C9JQI7-2;E9PFK0	TM232_HUMAN;.;.	R	335	.	.	S	-	3	2	TMEM232	109969785	0.000000	0.05858	0.510000	0.27712	0.573000	0.36030	-0.047000	0.11963	1.283000	0.44513	-0.324000	0.08512	AGC	.	.		0.358	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372488.2	NM_001039763	
RAPGEF6	51735	hgsc.bcm.edu	37	5	130841171	130841171	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:130841171A>T	ENST00000509018.1	-	10	1192	c.987T>A	c.(985-987)agT>agA	p.S329R	RAPGEF6_ENST00000296859.6_Missense_Mutation_p.S329R|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.S329R|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.S329R|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.S379R|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.S329R|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.S329R|RAPGEF6_ENST00000512052.1_Missense_Mutation_p.S44R	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	329					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CATCTGGATGACTGATTTCCA	0.333																																					p.S329R	Melanoma(168;435 1955 13113 13877 23213)	Atlas-SNP	.											.	RAPGEF6	361	.	0			c.T987A						.						80.0	77.0	78.0					5																	130841171		2203	4300	6503	SO:0001583	missense	51735	exon10			TGGATGACTGATT	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.987T>A	chr5.hg19:g.130841171A>T	ENSP00000421684:p.Ser329Arg	70.0	0.0		114.0	20.0	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	hg19	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	A	18.34	3.603150	0.66445	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000510071;ENST00000514667	D;D;D;D;D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13;-3.13;-3.13;-3.13	5.67	3.22	0.36961	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.047074	0.85682	D	0.000000	D	0.93200	0.7834	L	0.54323	1.7	0.80722	D	1	B;B;P;D;B;B;B	0.54772	0.145;0.145;0.689;0.968;0.38;0.119;0.227	P;B;P;D;P;B;B	0.67382	0.489;0.18;0.677;0.951;0.687;0.357;0.416	D	0.90978	0.4825	10	0.54805	T	0.06	.	7.4174	0.27053	0.6307:0.0:0.3693:0.0	.	329;329;329;44;379;329;329	A3KN82;B7ZML2;Q8TEU7-2;D6RE77;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;.;RPGF6_HUMAN	R	329;329;329;329;329;44;329;329;379	ENSP00000421684:S329R;ENSP00000309298:S329R;ENSP00000426081:S329R;ENSP00000296859:S329R;ENSP00000426910:S44R;ENSP00000311419:S329R;ENSP00000425389:S329R;ENSP00000426948:S379R	ENSP00000426948:S379R	S	-	3	2	RAPGEF6;FNIP1	130869070	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	1.444000	0.35068	0.397000	0.25310	0.383000	0.25322	AGT	.	.		0.333	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
GRXCR2	643226	hgsc.bcm.edu	37	5	145246178	145246178	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr5:145246178C>G	ENST00000377976.1	-	2	449	c.450G>C	c.(448-450)gaG>gaC	p.E150D		NM_001080516.1	NP_001073985.1	A6NFK2	GRCR2_HUMAN	glutaredoxin, cysteine rich 2	150						cell projection (GO:0042995)				breast(1)|endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(2)	7						CCTCAGCCTCCTCTTCCTTCT	0.428																																					p.E150D		Atlas-SNP	.											.	GRXCR2	32	.	0			c.G450C						.						144.0	140.0	141.0					5																	145246178		2203	4300	6503	SO:0001583	missense	643226	exon2			AGCCTCCTCTTCC		CCDS34263.1	5q32	2014-03-14			ENSG00000204928	ENSG00000204928			33862	protein-coding gene	gene with protein product		615762				24619944	Standard	NM_001080516		Approved	DFNB101	uc003lns.1	A6NFK2	OTTHUMG00000163417	ENST00000377976.1:c.450G>C	chr5.hg19:g.145246178C>G	ENSP00000367214:p.Glu150Asp	91.0	0.0		131.0	30.0	NM_001080516		Missense_Mutation	SNP	ENST00000377976.1	hg19	CCDS34263.1	.	.	.	.	.	.	.	.	.	.	C	1.138	-0.650427	0.03506	.	.	ENSG00000204928	ENST00000377976	T	0.24723	1.84	5.43	-0.984	0.10259	.	0.455549	0.24748	N	0.035933	T	0.13372	0.0324	L	0.33485	1.01	0.09310	N	0.999998	B	0.12630	0.006	B	0.13407	0.009	T	0.29027	-1.0025	10	0.15952	T	0.53	-7.8332	4.8326	0.13449	0.0891:0.4514:0.088:0.3715	.	150	A6NFK2	GRCR2_HUMAN	D	150	ENSP00000367214:E150D	ENSP00000367214:E150D	E	-	3	2	GRXCR2	145226371	0.004000	0.15560	0.932000	0.37286	0.162000	0.22319	-0.664000	0.05292	-0.532000	0.06332	-1.587000	0.00848	GAG	.	.		0.428	GRXCR2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373289.2		
EYS	346007	hgsc.bcm.edu	37	6	65300537	65300537	+	Silent	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:65300537A>G	ENST00000370621.3	-	26	5749	c.5223T>C	c.(5221-5223)gaT>gaC	p.D1741D	EYS_ENST00000503581.1_Silent_p.D1741D|EYS_ENST00000370616.2_Silent_p.D1741D			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	1741					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CCAGAGAACTATCACTTGGGT	0.343																																					p.D1741D		Atlas-SNP	.											.	EYS	527	.	0			c.T5223C						.						36.0	33.0	34.0					6																	65300537		692	1590	2282	SO:0001819	synonymous_variant	346007	exon26			AGAACTATCACTT		CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.5223T>C	chr6.hg19:g.65300537A>G		128.0	0.0		125.0	21.0	NM_001142800	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	ENST00000370621.3	hg19																																																																																				.	.		0.343	EYS-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351351.3	XM_294050	
UTRN	7402	hgsc.bcm.edu	37	6	144783916	144783916	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr6:144783916C>T	ENST00000367545.3	+	22	2980	c.2980C>T	c.(2980-2982)Caa>Taa	p.Q994*		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	994					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TGATGATGTGCAAGGAAAGTG	0.378																																					p.Q994X		Atlas-SNP	.											.	UTRN	327	.	0			c.C2980T						.						104.0	119.0	114.0					6																	144783916		2203	4300	6503	SO:0001587	stop_gained	7402	exon22			GATGTGCAAGGAA	AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2980C>T	chr6.hg19:g.144783916C>T	ENSP00000356515:p.Gln994*	81.0	0.0		86.0	22.0	NM_007124	Q5SYY1|Q5SZ57|Q9UJ40	Nonsense_Mutation	SNP	ENST00000367545.3	hg19	CCDS34547.1	.	.	.	.	.	.	.	.	.	.	C	38	7.192009	0.98125	.	.	ENSG00000152818	ENST00000367529;ENST00000367545	.	.	.	5.47	3.54	0.40534	.	0.131201	0.34828	N	0.003641	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	10.7754	0.46346	0.1319:0.5824:0.2857:0.0	.	.	.	.	X	994	.	ENSP00000356499:Q994X	Q	+	1	0	UTRN	144825609	0.998000	0.40836	0.963000	0.40424	0.403000	0.30841	1.301000	0.33447	1.237000	0.43756	0.655000	0.94253	CAA	.	.		0.378	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042551.1		
FSCN1	6624	hgsc.bcm.edu	37	7	5645021	5645021	+	Silent	SNP	C	C	T	rs568861608		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:5645021C>T	ENST00000382361.3	+	5	1512	c.1398C>T	c.(1396-1398)ggC>ggT	p.G466G	FSCN1_ENST00000340250.6_Silent_p.G445G	NM_003088.3	NP_003079.1	Q16658	FSCN1_HUMAN	fascin actin-bundling protein 1	466					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|cell motility (GO:0048870)|cell proliferation (GO:0008283)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|invadopodium (GO:0071437)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|drug binding (GO:0008144)|poly(A) RNA binding (GO:0044822)	p.G466G(1)		central_nervous_system(1)|kidney(3)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;1.21e-13)		TCAAGGTGGGCGGGCGCTACC	0.657													C|||	1	0.000199681	0.0	0.0	5008	,	,		16633	0.0		0.0	False		,,,				2504	0.001				p.G466G		Atlas-SNP	.											FSCN1,caecum,carcinoma,0,1	FSCN1	29	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1398T						.						52.0	45.0	48.0					7																	5645021		2203	4300	6503	SO:0001819	synonymous_variant	6624	exon5			GGTGGGCGGGCGC	U03057	CCDS5342.1	7p22	2014-02-03	2014-02-03	2002-09-20	ENSG00000075618	ENSG00000075618		"""Fascins"""	11148	protein-coding gene	gene with protein product	"""Singed, drosophila, homolog-like"", ""actin bundling protein"""	602689	"""singed (Drosophila)-like (sea urchin fascin homolog like)"", ""fascin homolog 1, actin-bundling protein (Strongylocentrotus purpuratus)"""	SNL		8068206, 10783262	Standard	NM_003088		Approved	p55, FLJ38511	uc003sou.3	Q16658	OTTHUMG00000090599	ENST00000382361.3:c.1398C>T	chr7.hg19:g.5645021C>T		55.0	0.0		50.0	12.0	NM_003088	A6NI89|B2RE97|Q96IC5|Q96IH1|Q9BRF1	Silent	SNP	ENST00000382361.3	hg19	CCDS5342.1																																																																																			.	.		0.657	FSCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207153.3	NM_003088	
METTL2B	55798	hgsc.bcm.edu	37	7	128119304	128119304	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr7:128119304G>A	ENST00000262432.8	+	3	332	c.295G>A	c.(295-297)Gaa>Aaa	p.E99K	METTL2B_ENST00000480046.1_Missense_Mutation_p.E34K|RP11-212P7.3_ENST00000462662.1_RNA	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	99					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						GCTTTTTACCGAATTCCCTGA	0.378																																					p.E99K		Atlas-SNP	.											.	METTL2B	34	.	0			c.G295A						.						55.0	57.0	56.0					7																	128119304		2202	4297	6499	SO:0001583	missense	55798	exon3			TTTACCGAATTCC	AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.295G>A	chr7.hg19:g.128119304G>A	ENSP00000262432:p.Glu99Lys	238.0	0.0		250.0	41.0	NM_018396	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	ENST00000262432.8	hg19	CCDS5803.2	.	.	.	.	.	.	.	.	.	.	G	16.89	3.248049	0.59103	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;T;T	0.03951	3.75;3.75;3.75	2.86	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.24624	0.0597	M	0.93854	3.465	0.52501	D	0.999959	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.01583	-1.1319	10	0.87932	D	0	0.0553	7.7593	0.28942	0.1338:0.0:0.8662:0.0	.	34;99	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	K	93;99;34	ENSP00000418634:E93K;ENSP00000262432:E99K;ENSP00000418402:E34K	ENSP00000262432:E99K	E	+	1	0	METTL2B	127906540	1.000000	0.71417	0.801000	0.32222	0.494000	0.33585	9.445000	0.97587	0.540000	0.28808	-0.491000	0.04670	GAA	.	.		0.378	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289817.1	NM_018396	
TRAM1	23471	hgsc.bcm.edu	37	8	71499196	71499196	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr8:71499196T>C	ENST00000262213.2	-	8	849	c.680A>G	c.(679-681)tAt>tGt	p.Y227C	TRAM1_ENST00000521425.1_Missense_Mutation_p.Y141C|TRAM1_ENST00000536748.1_Missense_Mutation_p.Y196C|TRAM1_ENST00000521049.1_5'UTR	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	227	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			TTCAACAAAATAATGTAGCAC	0.323																																					p.Y227C	Ovarian(85;984 1334 5116 12432 40638)	Atlas-SNP	.											.	TRAM1	33	.	0			c.A680G						.						98.0	93.0	95.0					8																	71499196		2203	4300	6503	SO:0001583	missense	23471	exon8			ACAAAATAATGTA	X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.680A>G	chr8.hg19:g.71499196T>C	ENSP00000262213:p.Tyr227Cys	102.0	0.0		114.0	22.0	NM_014294	B4E0K2	Missense_Mutation	SNP	ENST00000262213.2	hg19	CCDS6207.1	.	.	.	.	.	.	.	.	.	.	T	17.64	3.438708	0.62955	.	.	ENSG00000067167	ENST00000521425;ENST00000262213;ENST00000536748	D;D;D	0.85171	-1.95;-1.95;-1.95	5.66	5.66	0.87406	TRAM/LAG1/CLN8 homology domain (3);	0.116921	0.64402	D	0.000011	D	0.89856	0.6836	M	0.89601	3.045	0.80722	D	1	B	0.30563	0.285	B	0.38378	0.272	D	0.89377	0.3679	10	0.49607	T	0.09	-4.0819	15.8852	0.79241	0.0:0.0:0.0:1.0	.	227	Q15629	TRAM1_HUMAN	C	141;227;196	ENSP00000428052:Y141C;ENSP00000262213:Y227C;ENSP00000439359:Y196C	ENSP00000262213:Y227C	Y	-	2	0	TRAM1	71661750	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.163000	0.71880	2.146000	0.66826	0.477000	0.44152	TAT	.	.		0.323	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378738.1	NM_014294	
ALDOB	229	hgsc.bcm.edu	37	9	104192169	104192169	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr9:104192169G>T	ENST00000374855.4	-	3	316	c.192C>A	c.(190-192)ttC>ttA	p.F64L	ALDOB_ENST00000468981.3_5'Flank	NM_000035.3	NP_000026.2	P05062	ALDOB_HUMAN	aldolase B, fructose-bisphosphate	64					carbohydrate metabolic process (GO:0005975)|fructose 1,6-bisphosphate metabolic process (GO:0030388)|fructose catabolic process (GO:0006001)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|NADH oxidation (GO:0006116)|positive regulation of ATPase activity (GO:0032781)|small molecule metabolic process (GO:0044281)|vacuolar proton-transporting V-type ATPase complex assembly (GO:0070072)	centriolar satellite (GO:0034451)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)	ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)|fructose binding (GO:0070061)|fructose-1-phosphate aldolase activity (GO:0061609)|fructose-bisphosphate aldolase activity (GO:0004332)|identical protein binding (GO:0042802)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(5)|prostate(2)|skin(4)|urinary_tract(1)	24		Acute lymphoblastic leukemia(62;0.0559)				TGTCCACAGAGAAGAGGATTT	0.552																																					p.F64L		Atlas-SNP	.											.	ALDOB	69	.	0			c.C192A						.						148.0	143.0	145.0					9																	104192169		2203	4300	6503	SO:0001583	missense	229	exon3			CACAGAGAAGAGG	X01098	CCDS6756.1	9q21.3-q22.2	2008-02-05			ENSG00000136872	ENSG00000136872	4.1.2.13		417	protein-coding gene	gene with protein product		612724					Standard	NM_000035		Approved		uc004bbk.2	P05062	OTTHUMG00000020378	ENST00000374855.4:c.192C>A	chr9.hg19:g.104192169G>T	ENSP00000363988:p.Phe64Leu	126.0	0.0		134.0	33.0	NM_000035	Q13741|Q13742|Q5T7D6	Missense_Mutation	SNP	ENST00000374855.4	hg19	CCDS6756.1	.	.	.	.	.	.	.	.	.	.	G	17.60	3.429806	0.62844	.	.	ENSG00000136872	ENST00000374855;ENST00000430164	D	0.86694	-2.16	5.94	3.1	0.35709	Aldolase-type TIM barrel (1);	0.000000	0.85682	D	0.000000	T	0.81823	0.4904	L	0.39397	1.21	0.80722	D	1	B	0.21688	0.059	B	0.30401	0.115	T	0.75991	-0.3122	10	0.42905	T	0.14	-16.4465	9.6782	0.40054	0.2252:0.0:0.7748:0.0	.	64	P05062	ALDOB_HUMAN	L	64	ENSP00000363988:F64L	ENSP00000363988:F64L	F	-	3	2	ALDOB	103231990	1.000000	0.71417	0.878000	0.34440	0.935000	0.57460	4.157000	0.58144	0.832000	0.34804	0.650000	0.86243	TTC	.	.		0.552	ALDOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053434.2		
HERC4	26091	hgsc.bcm.edu	37	10	69726472	69726472	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr10:69726472T>C	ENST00000395198.3	-	16	2141	c.1894A>G	c.(1894-1896)Atc>Gtc	p.I632V	HERC4_ENST00000373700.4_Missense_Mutation_p.I632V|HERC4_ENST00000277817.6_Missense_Mutation_p.I522V|HERC4_ENST00000395187.2_3'UTR|HERC4_ENST00000412272.2_Missense_Mutation_p.I632V	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4	632					cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						ACCCAGTTGATATAATCATTT	0.284																																					p.I632V		Atlas-SNP	.											.	HERC4	78	.	0			c.A1894G						.						97.0	91.0	93.0					10																	69726472		2203	4300	6503	SO:0001583	missense	26091	exon16			AGTTGATATAATC	AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.1894A>G	chr10.hg19:g.69726472T>C	ENSP00000378624:p.Ile632Val	120.0	0.0		100.0	17.0	NM_022079	Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	Missense_Mutation	SNP	ENST00000395198.3	hg19	CCDS41533.1	.	.	.	.	.	.	.	.	.	.	T	2.943	-0.218442	0.06101	.	.	ENSG00000148634	ENST00000277817;ENST00000412272;ENST00000395198;ENST00000373700	T;T;T;T	0.76060	1.19;0.93;0.94;-0.99	5.16	5.16	0.70880	.	0.218250	0.47852	D	0.000217	T	0.44623	0.1302	N	0.04116	-0.275	0.80722	D	1	B;B;B;B;B;B	0.13594	0.008;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.10450	0.005;0.003;0.0;0.001;0.001;0.001	T	0.45963	-0.9225	10	0.05525	T	0.97	.	6.2043	0.20593	0.1445:0.0795:0.0:0.776	.	632;522;632;482;632;632	Q5GLZ8-3;Q5GLZ8-6;A8K9U4;Q5VXS9;Q5GLZ8-2;Q5GLZ8	.;.;.;.;.;HERC4_HUMAN	V	522;632;632;632	ENSP00000277817:I522V;ENSP00000416504:I632V;ENSP00000378624:I632V;ENSP00000362804:I632V	ENSP00000277817:I522V	I	-	1	0	HERC4	69396478	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.237000	0.43061	2.086000	0.62901	0.374000	0.22700	ATC	.	.		0.284	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359262.1	NM_015601	
LRMP	4033	hgsc.bcm.edu	37	12	25232338	25232338	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:25232338T>A	ENST00000354454.3	+	7	907	c.78T>A	c.(76-78)taT>taA	p.Y26*	LRMP_ENST00000547044.1_Nonsense_Mutation_p.Y26*|LRMP_ENST00000548766.1_Nonsense_Mutation_p.Y26*	NM_006152.3	NP_006143.2	Q12912	LRMP_HUMAN	lymphoid-restricted membrane protein	82					immune system process (GO:0002376)|single fertilization (GO:0007338)|vesicle fusion (GO:0006906)|vesicle targeting (GO:0006903)	chromosome (GO:0005694)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)		p.Y26*(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Colorectal(261;0.11)					GCAGGGAATATTCCTCACTAC	0.343																																					p.Y26X		Atlas-SNP	.											LRMP,NS,carcinoma,0,1	LRMP	51	.	1	Substitution - Nonsense(1)	kidney(1)	c.T78A						.						194.0	184.0	187.0					12																	25232338		2203	4300	6503	SO:0001587	stop_gained	4033	exon6			GGAATATTCCTCA		CCDS8701.1	12p12.1	2012-05-16			ENSG00000118308	ENSG00000118308			6690	protein-coding gene	gene with protein product		602003				8021504	Standard	NM_006152		Approved	JAW1	uc010sja.2	Q12912	OTTHUMG00000170192	ENST00000354454.3:c.78T>A	chr12.hg19:g.25232338T>A	ENSP00000346442:p.Tyr26*	109.0	0.0		123.0	22.0	NM_001204126	A0AVM2|B4E077|Q8N301	Nonsense_Mutation	SNP	ENST00000354454.3	hg19	CCDS8701.1	.	.	.	.	.	.	.	.	.	.	T	18.41	3.616908	0.66672	.	.	ENSG00000118308	ENST00000550945;ENST00000557489;ENST00000354454;ENST00000548766;ENST00000554942;ENST00000547044	.	.	.	4.82	-1.46	0.08800	.	1.274630	0.05414	N	0.542971	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	1.4078	8.6515	0.34038	0.0:0.48:0.0:0.52	.	.	.	.	X	26	.	ENSP00000346442:Y26X	Y	+	3	2	LRMP	25123605	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.194000	0.17135	-0.333000	0.08476	-0.353000	0.07706	TAT	.	.		0.343	LRMP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407870.1	NM_006152	
KIAA1551	55196	hgsc.bcm.edu	37	12	32135645	32135645	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:32135645G>A	ENST00000312561.4	+	4	2170	c.1756G>A	c.(1756-1758)Gct>Act	p.A586T	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	586																	GCTACTTCTCGCTTTGCTTTC	0.353																																					p.A586T		Atlas-SNP	.											.	.	.	.	0			c.G1756A						.						38.0	39.0	38.0					12																	32135645		2203	4299	6502	SO:0001583	missense	55196	exon4			CTTCTCGCTTTGC	AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1756G>A	chr12.hg19:g.32135645G>A	ENSP00000310338:p.Ala586Thr	51.0	0.0		51.0	9.0	NM_018169	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	ENST00000312561.4	hg19	CCDS8725.2	.	.	.	.	.	.	.	.	.	.	G	9.285	1.049138	0.19827	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.05925	4.0;3.37	4.46	-2.73	0.05950	.	5.264380	0.00496	N	0.000142	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B	0.20780	0.048	B	0.17098	0.017	T	0.33904	-0.9850	9	.	.	.	.	1.4483	0.02369	0.2113:0.397:0.1678:0.2239	.	586	Q9HCM1	CL035_HUMAN	T	586	ENSP00000310338:A586T;ENSP00000370442:A586T	.	A	+	1	0	C12orf35	32026912	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.370000	0.07523	-0.928000	0.03761	-1.339000	0.01253	GCT	.	.		0.353	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250307.2	NM_018169	
MAPKAPK5	8550	hgsc.bcm.edu	37	12	112308091	112308091	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:112308091G>A	ENST00000551404.2	+	6	518	c.410G>A	c.(409-411)cGg>cAg	p.R137Q	MAPKAPK5_ENST00000546394.1_3'UTR|MAPKAPK5_ENST00000550735.2_Missense_Mutation_p.R137Q			Q8IW41	MAPK5_HUMAN	mitogen-activated protein kinase-activated protein kinase 5	137	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|MAPK cascade (GO:0000165)|negative regulation of TOR signaling (GO:0032007)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of translation (GO:0006417)|signal transduction (GO:0007165)|stress-induced premature senescence (GO:0090400)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(11)|ovary(1)	13						TTGGCTCTGCGGCACTGTCAC	0.403																																					p.R137Q		Atlas-SNP	.											.	MAPKAPK5	56	.	0			c.G410A						.						127.0	113.0	117.0					12																	112308091		1873	4102	5975	SO:0001583	missense	8550	exon6			CTCTGCGGCACTG	AF032437	CCDS44975.1, CCDS44976.1	12q24.13	2012-05-30			ENSG00000089022	ENSG00000089022			6889	protein-coding gene	gene with protein product		606723				9628874	Standard	NM_003668		Approved	PRAK	uc001tta.4	Q8IW41	OTTHUMG00000169605	ENST00000551404.2:c.410G>A	chr12.hg19:g.112308091G>A	ENSP00000449381:p.Arg137Gln	149.0	0.0		151.0	27.0	NM_139078	B3KVA5|O60491|Q86X46|Q9BVX9|Q9UG86	Missense_Mutation	SNP	ENST00000551404.2	hg19	CCDS44975.1	.	.	.	.	.	.	.	.	.	.	G	8.256	0.810106	0.16537	.	.	ENSG00000089022	ENST00000550735;ENST00000202788;ENST00000428907;ENST00000551404	T;T	0.64618	-0.11;-0.11	5.6	4.47	0.54385	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.234953	0.44097	N	0.000486	T	0.32346	0.0826	N	0.03891	-0.335	0.28693	N	0.90448	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.004;0.0;0.0	T	0.22941	-1.0202	10	0.02654	T	1	.	10.837	0.46694	0.9248:0.0:0.0752:0.0	.	131;137;137	C9J458;Q8IW41;Q8IW41-2	.;MAPK5_HUMAN;.	Q	137	ENSP00000449667:R137Q;ENSP00000449381:R137Q	ENSP00000202788:R137Q	R	+	2	0	MAPKAPK5	110792474	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.081000	0.64444	0.965000	0.38133	-0.469000	0.05056	CGG	.	.		0.403	MAPKAPK5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405019.2	NM_139078	
NCOR2	9612	hgsc.bcm.edu	37	12	124835268	124835268	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr12:124835268C>T	ENST00000405201.1	-	28	3709	c.3709G>A	c.(3709-3711)Gtc>Atc	p.V1237I	NCOR2_ENST00000429285.2_Missense_Mutation_p.V1227I|NCOR2_ENST00000356219.3_Missense_Mutation_p.V1244I|NCOR2_ENST00000404121.2_Missense_Mutation_p.V798I|NCOR2_ENST00000404621.1_Missense_Mutation_p.V1227I|NCOR2_ENST00000397355.1_Missense_Mutation_p.V1228I			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	1245					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TTGTACAGGACGTCAGCTGGC	0.637																																					p.V1237I		Atlas-SNP	.											.	NCOR2	475	.	0			c.G3709A						.						55.0	60.0	58.0					12																	124835268		2193	4280	6473	SO:0001583	missense	9612	exon30			ACAGGACGTCAGC	U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.3709G>A	chr12.hg19:g.124835268C>T	ENSP00000384018:p.Val1237Ile	14.0	0.0		32.0	10.0	NM_006312	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Missense_Mutation	SNP	ENST00000405201.1	hg19	CCDS41858.2	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672057	0.67928	.	.	ENSG00000196498	ENST00000405201;ENST00000404621;ENST00000356219;ENST00000397355;ENST00000447011;ENST00000404121;ENST00000429285;ENST00000458234	T;T;T;T;T;T;T	0.35789	2.06;2.33;2.07;2.33;2.07;2.33;1.29	4.99	4.99	0.66335	.	0.000000	0.64402	D	0.000001	T	0.59046	0.2165	M	0.64997	1.995	0.58432	D	0.999997	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.76071	0.986;0.979;0.987	T	0.62134	-0.6918	10	0.62326	D	0.03	-42.5425	18.2573	0.90023	0.0:1.0:0.0:0.0	.	1227;1228;1237	C9J0Q5;C9J239;C9JFD3	.;.;.	I	1237;1227;1244;1228;1236;798;1227;1245	ENSP00000384018:V1237I;ENSP00000384202:V1227I;ENSP00000348551:V1244I;ENSP00000380513:V1228I;ENSP00000385618:V798I;ENSP00000400281:V1227I;ENSP00000402808:V1245I	ENSP00000348551:V1244I	V	-	1	0	NCOR2	123401221	1.000000	0.71417	0.719000	0.30619	0.656000	0.38851	5.703000	0.68340	2.315000	0.78130	0.478000	0.44815	GTC	.	.		0.637	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318173.2	NM_006312	
ZIC5	85416	hgsc.bcm.edu	37	13	100617641	100617641	+	Missense_Mutation	SNP	G	G	A	rs146570814		TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr13:100617641G>A	ENST00000267294.4	-	2	2215	c.1982C>T	c.(1981-1983)aCg>aTg	p.T661M		NM_033132.3	NP_149123.2	Q96T25	ZIC5_HUMAN	Zic family member 5	661					cell differentiation (GO:0030154)|forebrain development (GO:0030900)|neural tube closure (GO:0001843)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.T661M(1)		endometrium(3)|kidney(1)|lung(2)|prostate(1)|skin(2)	9	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTAATGTATCGTCCGCACAAC	0.478																																					p.T661M		Atlas-SNP	.											ZIC5,NS,carcinoma,0,2	ZIC5	38	.	1	Substitution - Missense(1)	prostate(1)	c.C1982T						.	G	MET/THR	0,4406		0,0,2203	60.0	60.0	60.0		1982	6.1	1.0	13	dbSNP_134	60	2,8598	2.2+/-6.3	0,2,4298	yes	missense	ZIC5	NM_033132.3	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	661/664	100617641	2,13004	2203	4300	6503	SO:0001583	missense	85416	exon2			TGTATCGTCCGCA	AF378304	CCDS9494.2	13q32.2	2013-01-08	2011-05-19		ENSG00000139800	ENSG00000139800		"""Zinc fingers, C2H2-type"""	20322	protein-coding gene	gene with protein product			"""Zic family member 5 (odd-paired homolog, Drosophila)"""				Standard	NM_033132		Approved		uc001vom.1	Q96T25	OTTHUMG00000017280	ENST00000267294.4:c.1982C>T	chr13.hg19:g.100617641G>A	ENSP00000267294:p.Thr661Met	60.0	0.0		63.0	13.0	NM_033132	Q5VYB0	Missense_Mutation	SNP	ENST00000267294.4	hg19	CCDS9494.2	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619827	0.66787	0.0	2.33E-4	ENSG00000139800	ENST00000267294	T	0.15718	2.4	6.06	6.06	0.98353	.	.	.	.	.	T	0.18341	0.0440	L	0.36672	1.1	0.40278	D	0.978365	P	0.52577	0.954	B	0.40659	0.336	T	0.00778	-1.1570	9	0.87932	D	0	.	19.3997	0.94623	0.0:0.0:1.0:0.0	.	661	Q96T25	ZIC5_HUMAN	M	661	ENSP00000267294:T661M	ENSP00000267294:T661M	T	-	2	0	ZIC5	99415642	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.533000	0.67160	2.871000	0.98454	0.655000	0.94253	ACG	.	G|1.000;A|0.000		0.478	ZIC5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000045623.3	NM_033132	
SEC23A	10484	hgsc.bcm.edu	37	14	39524374	39524374	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:39524374C>A	ENST00000307712.6	-	14	2149	c.1632G>T	c.(1630-1632)agG>agT	p.R544S	SEC23A_ENST00000536508.1_Missense_Mutation_p.R418S|SEC23A_ENST00000537403.1_Missense_Mutation_p.R342S|SEC23A_ENST00000545328.2_Missense_Mutation_p.R515S	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	544					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		TGTCCAGCCACCTAAGCACAT	0.413																																					p.R544S		Atlas-SNP	.											.	SEC23A	73	.	0			c.G1632T						.						137.0	129.0	132.0					14																	39524374		2203	4300	6503	SO:0001583	missense	10484	exon14			CAGCCACCTAAGC	X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1632G>T	chr14.hg19:g.39524374C>A	ENSP00000306881:p.Arg544Ser	83.0	0.0		96.0	21.0	NM_006364	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	ENST00000307712.6	hg19	CCDS9668.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.095346	0.76870	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.89681	-2.55;-2.55;-2.55;-2.55	5.81	-0.68	0.11346	Sec23/Sec24, helical domain (2);	0.180500	0.49305	D	0.000154	D	0.94873	0.8343	H	0.94503	3.545	0.80722	D	1	D;D;D	0.89917	1.0;0.957;0.97	D;P;P	0.80764	0.994;0.877;0.892	D	0.93921	0.7206	10	0.87932	D	0	-19.4958	11.2054	0.48767	0.0:0.5516:0.0:0.4484	.	515;418;544	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	S	342;544;418;515	ENSP00000444193:R342S;ENSP00000306881:R544S;ENSP00000437715:R418S;ENSP00000445393:R515S	ENSP00000306881:R544S	R	-	3	2	SEC23A	38594125	0.266000	0.24112	0.994000	0.49952	0.998000	0.95712	-0.655000	0.05348	-0.116000	0.11893	0.551000	0.68910	AGG	.	.		0.413	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276728.2		
NEMF	9147	hgsc.bcm.edu	37	14	50269987	50269987	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr14:50269987T>C	ENST00000298310.5	-	20	2332	c.1883A>G	c.(1882-1884)gAa>gGa	p.E628G	NEMF_ENST00000556925.1_5'UTR|NEMF_ENST00000546046.1_Missense_Mutation_p.E607G|NEMF_ENST00000545773.1_Missense_Mutation_p.E586G			O60524	NEMF_HUMAN	nuclear export mediator factor	628					nuclear export (GO:0051168)	nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(13)|liver(1)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	36						TGTCAAATATTCTCCAGTTGG	0.328																																					p.E628G		Atlas-SNP	.											.	NEMF	79	.	0			c.A1883G						.						130.0	116.0	121.0					14																	50269987		2202	4299	6501	SO:0001583	missense	9147	exon20			AAATATTCTCCAG	AF039687	CCDS9694.1	14q21.3	2012-11-19	2011-01-31	2011-01-31	ENSG00000165525	ENSG00000165525			10663	protein-coding gene	gene with protein product		608378	"""serologically defined colon cancer antigen 1"""	SDCCAG1		9610721, 10575219	Standard	XR_429334		Approved	NY-CO-1, FLJ10051	uc001wxc.3	O60524	OTTHUMG00000170857	ENST00000298310.5:c.1883A>G	chr14.hg19:g.50269987T>C	ENSP00000298310:p.Glu628Gly	105.0	0.0		105.0	32.0	NM_004713	A0JLQ3|B3KSK1|B4DDL3|B4DHA9|B4E3F3|Q32Q66|Q8WW70|Q9NWG1	Missense_Mutation	SNP	ENST00000298310.5	hg19	CCDS9694.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.748169	0.89663	.	.	ENSG00000165525	ENST00000298310;ENST00000545773;ENST00000546046;ENST00000534912;ENST00000555970	T;T;T;T	0.59364	0.38;0.37;0.27;0.36	5.79	5.79	0.91817	Domain of unknown function DUF814 (1);	0.000000	0.85682	D	0.000000	T	0.80549	0.4644	M	0.90483	3.12	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.87578	0.986;0.996;0.996;0.998	D	0.83900	0.0289	10	0.54805	T	0.06	-27.6727	15.8372	0.78808	0.0:0.0:0.0:1.0	.	607;603;586;628	O60524-3;O60524-5;O60524-4;O60524	.;.;.;NEMF_HUMAN	G	628;586;607;400;586	ENSP00000298310:E628G;ENSP00000438309:E586G;ENSP00000441016:E607G;ENSP00000452540:E586G	ENSP00000298310:E628G	E	-	2	0	NEMF	49339737	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.913000	0.75759	2.225000	0.72522	0.477000	0.44152	GAA	.	.		0.328	NEMF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410798.1	NM_004713	
TNRC6A	27327	hgsc.bcm.edu	37	16	24802369	24802369	+	Silent	SNP	G	G	A	rs113829020	byFrequency	TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:24802369G>A	ENST00000395799.3	+	6	2535	c.2406G>A	c.(2404-2406)ggG>ggA	p.G802G	TNRC6A_ENST00000315183.7_Silent_p.G802G	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	802	Interaction with argonaute family proteins.|Sufficient for interaction with AGO1 and AGO4.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		ACTGCCAGGGGGGGTGGGAAG	0.507																																					p.G802G		Atlas-SNP	.											.	TNRC6A	171	.	0			c.G2406A						.						31.0	33.0	32.0					16																	24802369		2196	4298	6494	SO:0001819	synonymous_variant	27327	exon6			CCAGGGGGGGTGG	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.2406G>A	chr16.hg19:g.24802369G>A		27.0	0.0		24.0	12.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Silent	SNP	ENST00000395799.3	hg19	CCDS10624.2																																																																																			.	G|0.997;C|0.003		0.507	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
RAB34	83871	hgsc.bcm.edu	37	17	27041897	27041897	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr17:27041897A>G	ENST00000395245.3	-	9	1252	c.626T>C	c.(625-627)tTc>tCc	p.F209S	RAB34_ENST00000447716.1_Missense_Mutation_p.F266S|RAB34_ENST00000395243.3_Missense_Mutation_p.F201S|RAB34_ENST00000415040.2_Missense_Mutation_p.F187S|RAB34_ENST00000450529.1_Missense_Mutation_p.F201S|RAB34_ENST00000453384.3_Intron|RAB34_ENST00000395242.2_Missense_Mutation_p.F210S|RAB34_ENST00000301043.6_Missense_Mutation_p.F209S|RAB34_ENST00000436730.3_Missense_Mutation_p.F209S	NM_001256281.1|NM_031934.5	NP_001243210.1|NP_114140.4	Q9BZG1	RAB34_HUMAN	RAB34, member RAS oncogene family	209					antigen processing and presentation (GO:0019882)|Golgi to plasma membrane protein transport (GO:0043001)|lysosome localization (GO:0032418)|phagosome maturation (GO:0090382)|phagosome-lysosome fusion (GO:0090385)|protein localization to plasma membrane (GO:0072659)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|vesicle (GO:0031982)	GTP binding (GO:0005525)			endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(8)|skin(2)	14	Lung NSC(42;0.00431)					CACACGGAAGAAGAATTCTCG	0.577																																					p.F266S	Pancreas(175;216 2049 29940 32498 41589)	Atlas-SNP	.											.	RAB34	44	.	0			c.T797C						.						64.0	56.0	59.0					17																	27041897		2203	4300	6503	SO:0001583	missense	83871	exon10			CGGAAGAAGAATT	AF322067	CCDS11240.1, CCDS45636.1, CCDS54101.1, CCDS58536.1	17q11.2	2008-07-18			ENSG00000109113	ENSG00000109113		"""RAB, member RAS oncogene"""	16519	protein-coding gene	gene with protein product		610917				12446704	Standard	NM_031934		Approved	RAB39, RAH	uc010was.1	P0DI83	OTTHUMG00000132680	ENST00000395245.3:c.626T>C	chr17.hg19:g.27041897A>G	ENSP00000378666:p.Phe209Ser	26.0	0.0		41.0	12.0	NM_001144943	B4E3A0|E9PEJ9|Q5BJE6|Q8NCJ8|Q96AR4	Missense_Mutation	SNP	ENST00000395245.3	hg19	CCDS11240.1	.	.	.	.	.	.	.	.	.	.	A	14.86	2.661743	0.47572	.	.	ENSG00000109113	ENST00000447716;ENST00000301043;ENST00000395243;ENST00000415040;ENST00000450529;ENST00000395242;ENST00000395245;ENST00000436730;ENST00000430132;ENST00000412625;ENST00000353676	D;D;D;D;D;D;T;D;D	0.84070	-1.8;-1.8;-1.8;-1.8;-1.8;-1.8;-1.24;-1.8;-1.8	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.93812	0.8021	H	0.96547	3.84	0.48632	D	0.999683	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999;0.999	D	0.95526	0.8599	9	0.87932	D	0	-20.8825	14.437	0.67287	1.0:0.0:0.0:0.0	.	187;201;232;224;210;209	E9PEJ9;Q9BZG1-2;C9JI96;B4DNC0;A8MYQ9;Q9BZG1	.;.;.;.;.;RAB34_HUMAN	S	266;209;201;187;224;210;209;232;210;209;209	ENSP00000410403:F266S;ENSP00000301043:F209S;ENSP00000378664:F201S;ENSP00000410279:F187S;ENSP00000378663:F210S;ENSP00000378666:F209S;ENSP00000407953:F210S;ENSP00000398706:F209S;ENSP00000226259:F209S	ENSP00000301043:F209S	F	-	2	0	RAB34	24066024	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.953000	0.93041	2.087000	0.62958	0.460000	0.39030	TTC	.	.		0.577	RAB34-018	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345906.1	NM_031934	
WDR7	23335	hgsc.bcm.edu	37	18	54362254	54362254	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr18:54362254A>G	ENST00000254442.3	+	11	1393	c.1182A>G	c.(1180-1182)atA>atG	p.I394M	WDR7_ENST00000589935.1_Intron|WDR7_ENST00000357574.3_Missense_Mutation_p.I394M	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	394					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		CTGGAATTATAGATCAGCTGA	0.403																																					p.I394M		Atlas-SNP	.											.	WDR7	166	.	0			c.A1182G						.						109.0	102.0	104.0					18																	54362254		2203	4300	6503	SO:0001583	missense	23335	exon11			AATTATAGATCAG	AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.1182A>G	chr18.hg19:g.54362254A>G	ENSP00000254442:p.Ile394Met	130.0	0.0		130.0	29.0	NM_052834	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Missense_Mutation	SNP	ENST00000254442.3	hg19	CCDS11962.1	.	.	.	.	.	.	.	.	.	.	A	15.86	2.958476	0.53400	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000398311	T;T	0.69175	-0.38;-0.37	5.68	0.0866	0.14447	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);	0.000000	0.85682	D	0.000000	T	0.74861	0.3772	M	0.68593	2.085	0.53688	D	0.99997	D;D	0.71674	0.995;0.998	D;D	0.78314	0.954;0.991	T	0.70299	-0.4910	10	0.44086	T	0.13	.	9.028	0.36241	0.5044:0.3799:0.0:0.1157	.	394;394	Q9Y4E6-2;Q9Y4E6	.;WDR7_HUMAN	M	394	ENSP00000254442:I394M;ENSP00000350187:I394M	ENSP00000254442:I394M	I	+	3	3	WDR7	52513252	0.996000	0.38824	0.996000	0.52242	0.970000	0.65996	0.497000	0.22514	-0.201000	0.10284	0.477000	0.44152	ATA	.	.		0.403	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256062.1		
SSC5D	284297	hgsc.bcm.edu	37	19	56029520	56029520	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr19:56029520C>T	ENST00000389623.6	+	14	3900	c.3877C>T	c.(3877-3879)Cct>Tct	p.P1293S		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1293	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						caccacaacccctcaccccac	0.647																																					p.P1293S		Atlas-SNP	.											.	SSC5D	65	.	0			c.C3877T						.						270.0	262.0	265.0					19																	56029520		692	1591	2283	SO:0001583	missense	284297	exon14			ACAACCCCTCACC		CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3877C>T	chr19.hg19:g.56029520C>T	ENSP00000374274:p.Pro1293Ser	287.0	0.0		245.0	33.0	NM_001144950	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	ENST00000389623.6	hg19	CCDS46196.1	.	.	.	.	.	.	.	.	.	.	-	12.20	1.867952	0.32977	.	.	ENSG00000179954	ENST00000389623	T	0.01455	4.87	2.04	0.915	0.19366	.	.	.	.	.	T	0.01835	0.0058	L	0.40543	1.245	0.09310	N	0.999998	B	0.19331	0.035	B	0.13407	0.009	T	0.44590	-0.9318	9	0.51188	T	0.08	.	4.8401	0.13485	0.0:0.7771:0.0:0.2229	.	1293	A1L4H1	SRCRL_HUMAN	S	1293	ENSP00000374274:P1293S	ENSP00000374274:P1293S	P	+	1	0	SSC5D	60721332	0.000000	0.05858	0.155000	0.22561	0.350000	0.29205	-0.411000	0.07142	0.122000	0.18314	0.165000	0.16767	CCT	.	.		0.647	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000453345.2	XM_001718392	
FLRT3	23767	hgsc.bcm.edu	37	20	14306475	14306475	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr20:14306475A>T	ENST00000378053.3	-	2	1934	c.1678T>A	c.(1678-1680)Tca>Aca	p.S560T	FLRT3_ENST00000341420.4_Missense_Mutation_p.S560T|MACROD2_ENST00000217246.4_Intron|MACROD2_ENST00000310348.4_Intron	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	560					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		CAGTTCCTTGAGAAGAGCGAT	0.468																																					p.S560T		Atlas-SNP	.											.	FLRT3	67	.	0			c.T1678A						.						149.0	137.0	141.0					20																	14306475		2203	4300	6503	SO:0001583	missense	23767	exon2			TCCTTGAGAAGAG	AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.1678T>A	chr20.hg19:g.14306475A>T	ENSP00000367292:p.Ser560Thr	145.0	0.0		154.0	31.0	NM_013281	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	ENST00000378053.3	hg19	CCDS13121.1	.	.	.	.	.	.	.	.	.	.	A	10.34	1.321824	0.23994	.	.	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.62364	0.03;0.03	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.45337	0.1337	N	0.05351	-0.065	0.80722	D	1	B	0.21147	0.052	B	0.27796	0.083	T	0.38714	-0.9648	10	0.22706	T	0.39	-10.4485	16.4781	0.84144	1.0:0.0:0.0:0.0	.	560	Q9NZU0	FLRT3_HUMAN	T	560	ENSP00000367292:S560T;ENSP00000339912:S560T	ENSP00000339912:S560T	S	-	1	0	FLRT3	14254475	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	9.339000	0.96797	2.288000	0.76882	0.528000	0.53228	TCA	.	.		0.468	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078075.1	NM_013281	
PASD1	139135	hgsc.bcm.edu	37	X	150839639	150839639	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrX:150839639G>T	ENST00000370357.4	+	12	1446	c.1201G>T	c.(1201-1203)Gca>Tca	p.A401S		NM_173493.2	NP_775764.2	Q8IV76	PASD1_HUMAN	PAS domain containing 1	401						nucleus (GO:0005634)	signal transducer activity (GO:0004871)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(3)|liver(1)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGCAGAATGCATTGGAATT	0.463																																					p.A401S		Atlas-SNP	.											.	PASD1	286	.	0			c.G1201T						.						195.0	161.0	172.0					X																	150839639		2203	4300	6503	SO:0001583	missense	139135	exon12			CAGAATGCATTGG	AY270020	CCDS35431.1	Xq28	2009-08-06			ENSG00000166049	ENSG00000166049			20686	protein-coding gene	gene with protein product	"""cancer/testis antigen 63"""					15122589, 15162151	Standard	NM_173493		Approved	CT63	uc004fev.4	Q8IV76	OTTHUMG00000024169	ENST00000370357.4:c.1201G>T	chrX.hg19:g.150839639G>T	ENSP00000359382:p.Ala401Ser	94.0	0.0		109.0	21.0	NM_173493	Q3MNE0|Q69HD7|Q8N7X9	Missense_Mutation	SNP	ENST00000370357.4	hg19	CCDS35431.1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707719	0.30322	.	.	ENSG00000166049	ENST00000370357	T	0.17370	2.28	3.78	-2.68	0.06041	.	.	.	.	.	T	0.09335	0.0230	L	0.27053	0.805	0.09310	N	1	P	0.37101	0.582	B	0.35688	0.208	T	0.18053	-1.0349	9	0.49607	T	0.09	-35.6315	3.2783	0.06906	0.314:0.0:0.2256:0.4603	.	401	Q8IV76	PASD1_HUMAN	S	401	ENSP00000359382:A401S	ENSP00000359382:A401S	A	+	1	0	PASD1	150590295	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.227000	0.17795	-0.877000	0.04012	0.529000	0.55759	GCA	.	.		0.463	PASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060879.2	NM_173493	
MT-CO1	4512	hgsc.bcm.edu	37	M	6951	6951	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chrM:6951G>A	ENST00000361624.2	+	1	1048	c.1048G>A	c.(1048-1050)Gta>Ata	p.V350I	MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-CO2_ENST00000361739.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-CO3_ENST00000362079.2_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	350					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTCTTTTCACCGTAGGTGGCC	0.468																																					p.V350M		Atlas-SNP	.											.	.	.	.	0			c.G1048A						.																																			SO:0001583	missense	5742	exon1			TTCACCGTAGGTG			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1048G>A	chrM.hg19:g.6951G>A	ENSP00000354499:p.Val350Ile	391.0	0.0		205.0	179.0	ENST00000361624	Q34770	Missense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.468	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
GSE1	23199	hgsc.bcm.edu	37	16	85689985	85689997	+	Frame_Shift_Del	DEL	GCGCGAGCGCGAG	GCGCGAGCGCGAG	-	rs376448790|rs555079607|rs374136142|rs369286648|rs372901919	byFrequency	TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	GCGCGAGCGCGAG	GCGCGAGCGCGAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr16:85689985_85689997delGCGCGAGCGCGAG	ENST00000253458.7	+	7	1202_1214	c.1026_1038delGCGCGAGCGCGAG	c.(1024-1038)gagcgcgagcgcgagfs	p.ERERE342fs	RN7SL381P_ENST00000577658.1_RNA|GSE1_ENST00000393243.1_Frame_Shift_Del_p.ERERE269fs|GSE1_ENST00000405402.2_Frame_Shift_Del_p.ERERE238fs	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	342																	gggagagggagcgcgagcgcgagcgcgagcgtg	0.653																																					p.342_346del		Atlas-INDEL	.											.	.	.	.	0			c.1025_1037del						.																																			SO:0001589	frameshift_variant	23199	exon7			.	D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.1026_1038delGCGCGAGCGCGAG	chr16.hg19:g.85689985_85689997delGCGCGAGCGCGAG	ENSP00000253458:p.Glu342fs	21.0	0.0		39.0	13.0	NM_014615	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Frame_Shift_Del	DEL	ENST00000253458.7	hg19	CCDS10952.1																																																																																			.	.		0.653	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325527.1	NM_014615	
BEST1	7439	hgsc.bcm.edu	37	11	61723374	61723376	+	In_Frame_Del	DEL	CAC	CAC	-			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	CAC	CAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr11:61723374_61723376delCAC	ENST00000378043.4	+	4	1075_1077	c.432_434delCAC	c.(430-435)agcacc>agc	p.T145del	BEST1_ENST00000378042.3_In_Frame_Del_p.T85del|BEST1_ENST00000534553.1_In_Frame_Del_p.T39del|BEST1_ENST00000435278.2_In_Frame_Del_p.T145del|BEST1_ENST00000301774.9_5'UTR|BEST1_ENST00000449131.2_In_Frame_Del_p.T85del|BEST1_ENST00000526988.1_In_Frame_Del_p.T39del	NM_004183.3	NP_004174.1	O76090	BEST1_HUMAN	bestrophin 1	145					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|detection of light stimulus involved in visual perception (GO:0050908)|ion transmembrane transport (GO:0034220)|regulation of calcium ion transport (GO:0051924)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	basolateral plasma membrane (GO:0016323)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|urinary_tract(2)	25						GCAGCGTCAGCACCGCAGTCTAC	0.695																																					p.144_145del		Atlas-INDEL	.											.	BEST1	85	.	0			c.431_433del						.																																			SO:0001651	inframe_deletion	7439	exon4			.	AF057170	CCDS31580.1, CCDS44623.1	11q12	2013-02-14	2006-10-18	2006-10-18	ENSG00000167995	ENSG00000167995		"""Ion channels / Chloride channels : Calcium activated : Bestrophins"""	12703	protein-coding gene	gene with protein product	"""Best disease"""	607854	"""vitelliform macular dystrophy 2"""	VMD2		1302019, 17003041	Standard	NM_004183		Approved	BMD, BEST, RP50	uc001nsr.2	O76090	OTTHUMG00000167469	ENST00000378043.4:c.432_434delCAC	chr11.hg19:g.61723374_61723376delCAC	ENSP00000367282:p.Thr145del	24.0	0.0		35.0	13.0	NM_004183	A8K0W6|B7Z3J8|B7Z736|O75904|Q53YQ9|Q8IUR9|Q8IZ80	In_Frame_Del	DEL	ENST00000378043.4	hg19	CCDS31580.1																																																																																			.	.		0.695	BEST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394715.1	NM_004183	
REV1	51455	hgsc.bcm.edu	37	2	100019252	100019253	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr2:100019252_100019253delAG	ENST00000258428.3	-	21	3623_3624	c.3395_3396delCT	c.(3394-3396)tctfs	p.S1132fs	REV1_ENST00000465835.1_5'Flank|REV1_ENST00000393445.3_Frame_Shift_Del_p.S1131fs|RP11-527J8.1_ENST00000608144.1_RNA	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	1132					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AAGTAGAAGCAGAGAGTTCTTC	0.416								Direct reversal of damage																													p.1132_1133del		Atlas-Indel,Pindel	.											.	REV1	100	.	0			c.3396_3397del						.																																			SO:0001589	frameshift_variant	51455	exon21			.	AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.3395_3396delCT	chr2.hg19:g.100019256_100019257delAG	ENSP00000258428:p.Ser1132fs	31.0	0.0		63.0	21.0	NM_016316	O95941|Q53SI7|Q9C0J4|Q9NUP2	Frame_Shift_Del	DEL	ENST00000258428.3	hg19	CCDS2045.1																																																																																			.	.		0.416	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253123.2	NM_016316	
GBE1	2632	hgsc.bcm.edu	37	3	81548302	81548302	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-A25W-01A-11D-A16V-10	TCGA-G3-A25W-11A-12D-A16V-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	36e1d9cc-32ec-4a0a-8fb1-c46f058a6fb8	fdc8e770-343e-4c4e-bc1d-99375ea94de4	g.chr3:81548302delA	ENST00000429644.2	-	15	2654	c.2011delT	c.(2011-2013)tctfs	p.S671fs	GBE1_ENST00000489715.1_Frame_Shift_Del_p.S630fs	NM_000158.3	NP_000149	Q04446	GLGB_HUMAN	glucan (1,4-alpha-), branching enzyme 1	671					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	1,4-alpha-glucan branching enzyme activity (GO:0003844)|cation binding (GO:0043169)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(5)|large_intestine(2)|lung(4)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Lung NSC(201;0.0117)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0654)|Epithelial(33;0.00305)|LUSC - Lung squamous cell carcinoma(29;0.00646)|BRCA - Breast invasive adenocarcinoma(55;0.00813)|Lung(72;0.0129)|KIRC - Kidney renal clear cell carcinoma(39;0.212)|Kidney(39;0.247)		AAAGCCTCAGAAAAAAAGTCA	0.363									Glycogen Storage Disease, type IV																												p.S671fs		Pindel	.											.	GBE1	111	.	0			c.2012delC						.						90.0	85.0	86.0					3																	81548302		1835	4094	5929	SO:0001589	frameshift_variant	2632	exon15	Familial Cancer Database	Andersen Disease, Brancher deficiency	.		CCDS54612.1	3p12.2	2013-09-20	2008-08-01		ENSG00000114480	ENSG00000114480	2.4.1.18		4180	protein-coding gene	gene with protein product	"""glycogen branching enzyme"", ""Andersen disease"", ""glycogen storage disease type IV"""	607839				8463281	Standard	NM_000158		Approved		uc021xav.1	Q04446	OTTHUMG00000158978	ENST00000429644.2:c.2011delT	chr3.hg19:g.81548302delA	ENSP00000410833:p.Ser671fs	166.0	0.0		148.0	16.0	NM_000158	B3KWV3|Q96EN0	Frame_Shift_Del	DEL	ENST00000429644.2	hg19	CCDS54612.1																																																																																			.	.		0.363	GBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352760.2		
