#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
LCK	3932	hgsc.bcm.edu	37	1	32740006	32740006	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:32740006C>G	ENST00000336890.5	+	2	214	c.76C>G	c.(76-78)Ccc>Gcc	p.P26A	LCK_ENST00000333070.4_Missense_Mutation_p.P26A|LCK_ENST00000373564.3_Missense_Mutation_p.P26A	NM_005356.3	NP_005347.3	P06239	LCK_HUMAN	LCK proto-oncogene, Src family tyrosine kinase	26	Interactions with CD4 and CD8. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aging (GO:0007568)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular zinc ion homeostasis (GO:0006882)|dephosphorylation (GO:0016311)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hemopoiesis (GO:0030097)|innate immune response (GO:0045087)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|positive regulation of uterine smooth muscle contraction (GO:0070474)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of defense response to virus by virus (GO:0050690)|regulation of lymphocyte activation (GO:0051249)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to zinc ion (GO:0010043)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|pericentriolar material (GO:0000242)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|ATP binding (GO:0005524)|ATPase binding (GO:0051117)|CD4 receptor binding (GO:0042609)|CD8 receptor binding (GO:0042610)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine kinase activity (GO:0004713)|SH2 domain binding (GO:0042169)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)			Dasatinib(DB01254)|Ponatinib(DB08901)	CTGCCATTATCCCATAGTCCC	0.552			T	TRB@	T-ALL																																p.P26A		Atlas-SNP	.		Dom	yes		1	1p35-p34.3	3932	lymphocyte-specific protein tyrosine kinase		L	.	LCK	124	.	0			c.C76G						.						109.0	94.0	99.0					1																	32740006		2203	4300	6503	SO:0001583	missense	3932	exon2			CATTATCCCATAG	M36881	CCDS359.1	1p34.3	2014-09-17	2014-06-25		ENSG00000182866	ENSG00000182866	2.7.10.1	"""SH2 domain containing"""	6524	protein-coding gene	gene with protein product		153390	"""lymphocyte-specific protein tyrosine kinase"""			2787474	Standard	XM_005270862		Approved		uc001buy.3	P06239	OTTHUMG00000007463	ENST00000336890.5:c.76C>G	chr1.hg19:g.32740006C>G	ENSP00000337825:p.Pro26Ala	79.0	0.0		95.0	46.0	NM_005356	D3DPP8|P07100|Q12850|Q13152|Q5TDH8|Q5TDH9|Q7RTZ3|Q96DW4|Q9NYT8	Missense_Mutation	SNP	ENST00000336890.5	hg19	CCDS359.1	.	.	.	.	.	.	.	.	.	.	c	28.0	4.878279	0.91664	.	.	ENSG00000182866	ENST00000336890;ENST00000482949;ENST00000495610;ENST00000461712;ENST00000373562;ENST00000477031;ENST00000373557;ENST00000333070;ENST00000436824;ENST00000373564	T;T;T;T;T;T;T;T;T	0.54479	0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57;0.57	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000009	T	0.71213	0.3313	M	0.68593	2.085	0.49687	D	0.999815	D;D;D;D	0.89917	0.966;1.0;0.988;0.987	P;D;P;P	0.83275	0.577;0.996;0.876;0.808	T	0.72557	-0.4257	10	0.52906	T	0.07	.	17.3642	0.87359	0.0:1.0:0.0:0.0	.	70;26;26;26	E7EN21;Q573B4;P06239-3;P06239	.;.;.;LCK_HUMAN	A	26;26;26;26;26;70;70;26;70;26	ENSP00000337825:P26A;ENSP00000431517:P26A;ENSP00000435605:P26A;ENSP00000434525:P26A;ENSP00000362663:P26A;ENSP00000436554:P70A;ENSP00000362658:P70A;ENSP00000328213:P26A;ENSP00000362665:P26A	ENSP00000328213:P26A	P	+	1	0	LCK	32512593	1.000000	0.71417	0.998000	0.56505	0.972000	0.66771	5.815000	0.69215	2.519000	0.84933	0.487000	0.48397	CCC	.	.		0.552	LCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019616.4	NM_005356	
GTF2B	2959	hgsc.bcm.edu	37	1	89325566	89325566	+	Splice_Site	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:89325566T>C	ENST00000370500.5	-	5	652	c.534A>G	c.(532-534)aaA>aaG	p.K178K	GTF2B_ENST00000494819.1_5'UTR	NM_001514.5	NP_001505.1	Q00403	TF2B_HUMAN	general transcription factor IIB	178					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)	core promoter binding (GO:0001047)|thyroid hormone receptor binding (GO:0046966)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10		Lung NSC(277;0.123)		all cancers(265;0.0131)|Epithelial(280;0.0255)		AAAACTTACCTTTAAATGTCC	0.413																																					p.K178K		Atlas-SNP	.											.	GTF2B	32	.	0			c.A534G						.						116.0	122.0	120.0					1																	89325566		2203	4300	6503	SO:0001630	splice_region_variant	2959	exon5			CTTACCTTTAAAT	M76766	CCDS715.1	1p22-p21	2010-03-23			ENSG00000137947	ENSG00000137947		"""General transcription factors"""	4648	protein-coding gene	gene with protein product		189963				1876184, 8162052	Standard	NM_001514		Approved	TFIIB	uc001dmo.4	Q00403	OTTHUMG00000010611	ENST00000370500.5:c.535+1A>G	chr1.hg19:g.89325566T>C		50.0	0.0		68.0	28.0	NM_001514	A8K1A7|Q5JS30	Silent	SNP	ENST00000370500.5	hg19	CCDS715.1																																																																																			.	.		0.413	GTF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029279.1	NM_001514	Silent
COL11A1	1301	hgsc.bcm.edu	37	1	103548452	103548452	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:103548452G>C	ENST00000370096.3	-	2	495	c.183C>G	c.(181-183)tgC>tgG	p.C61W	COL11A1_ENST00000512756.1_Missense_Mutation_p.C61W|COL11A1_ENST00000358392.2_Missense_Mutation_p.C61W|COL11A1_ENST00000353414.4_Missense_Mutation_p.C61W	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	61					cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)	p.C61*(2)		NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTCTGTTTGTGCAAAATCCCG	0.363																																					p.C61W		Atlas-SNP	.											COL11A1_ENST00000370096,NS,carcinoma,0,2	COL11A1	972	.	2	Substitution - Nonsense(2)	lung(2)	c.C183G						.						128.0	130.0	129.0					1																	103548452		2203	4300	6503	SO:0001583	missense	1301	exon2			GTTTGTGCAAAAT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.183C>G	chr1.hg19:g.103548452G>C	ENSP00000359114:p.Cys61Trp	47.0	0.0		62.0	25.0	NM_001190709	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	hg19	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	15.18	2.755733	0.49362	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756;ENST00000427239	T;T;T;T;T	0.02301	4.35;4.35;4.35;4.35;4.35	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.12646	0.0307	M	0.88704	2.975	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;0.999	D;D;D;D	0.85130	0.993;0.997;0.997;0.993	T	0.01276	-1.1398	10	0.87932	D	0	.	19.8365	0.96659	0.0:0.0:1.0:0.0	.	61;61;61;61	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	W	61	ENSP00000359114:C61W;ENSP00000351163:C61W;ENSP00000302551:C61W;ENSP00000426533:C61W;ENSP00000408640:C61W	ENSP00000302551:C61W	C	-	3	2	COL11A1	103321040	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	3.383000	0.52471	2.694000	0.91930	0.467000	0.42956	TGC	.	.		0.363	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
PHGDH	26227	hgsc.bcm.edu	37	1	120284487	120284487	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:120284487C>A	ENST00000369409.4	+	10	1312	c.1176C>A	c.(1174-1176)aaC>aaA	p.N392K	PHGDH_ENST00000482968.1_3'UTR|PHGDH_ENST00000369407.3_Missense_Mutation_p.N358K	NM_006623.3	NP_006614.2	O43175	SERA_HUMAN	phosphoglycerate dehydrogenase	392					brain development (GO:0007420)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|G1 to G0 transition (GO:0070314)|gamma-aminobutyric acid metabolic process (GO:0009448)|glial cell development (GO:0021782)|glutamine metabolic process (GO:0006541)|glycine metabolic process (GO:0006544)|L-serine biosynthetic process (GO:0006564)|neural tube development (GO:0021915)|neuron projection development (GO:0031175)|regulation of gene expression (GO:0010468)|small molecule metabolic process (GO:0044281)|spinal cord development (GO:0021510)|taurine metabolic process (GO:0019530)|threonine metabolic process (GO:0006566)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|NAD binding (GO:0051287)|phosphoglycerate dehydrogenase activity (GO:0004617)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	18	all_cancers(5;1.18e-09)|all_epithelial(5;2.16e-10)|Melanoma(3;1.93e-05)|all_neural(166;0.219)	all_lung(203;3.66e-05)|Lung NSC(69;0.000202)|all_epithelial(167;0.0347)		Lung(183;0.0111)|LUSC - Lung squamous cell carcinoma(189;0.0593)		ACTTGGTGAACGCTAAGCTGC	0.582																																					p.N392K		Atlas-SNP	.											.	PHGDH	51	.	0			c.C1176A						.						87.0	74.0	79.0					1																	120284487		2203	4300	6503	SO:0001583	missense	26227	exon10			GGTGAACGCTAAG	BC011262	CCDS904.1	1p12	2008-02-05			ENSG00000092621	ENSG00000092621	1.1.1.95		8923	protein-coding gene	gene with protein product		606879					Standard	NM_006623		Approved	SERA, PGDH, PDG	uc001ehz.3	O43175	OTTHUMG00000012100	ENST00000369409.4:c.1176C>A	chr1.hg19:g.120284487C>A	ENSP00000358417:p.Asn392Lys	50.0	0.0		43.0	15.0	NM_006623	B2RD08|Q5SZU3|Q9BQ01	Missense_Mutation	SNP	ENST00000369409.4	hg19	CCDS904.1	.	.	.	.	.	.	.	.	.	.	.	14.32	2.501598	0.44455	.	.	ENSG00000092621	ENST00000369409;ENST00000537497;ENST00000369407	D;D	0.90504	-2.68;-2.68	5.54	-3.06	0.05379	.	0.085714	0.85682	D	0.000000	D	0.90253	0.6952	M	0.70275	2.135	0.38969	D	0.958714	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.81914	0.973;0.973;0.995;0.985	D	0.88158	0.2855	10	0.87932	D	0	-24.6842	7.549	0.27783	0.0:0.345:0.1181:0.5368	.	358;358;265;392	B3KSC3;Q5SZU1;F5H634;O43175	.;.;.;SERA_HUMAN	K	392;265;358	ENSP00000358417:N392K;ENSP00000358415:N358K	ENSP00000358415:N358K	N	+	3	2	PHGDH	120086010	0.842000	0.29525	0.887000	0.34795	0.011000	0.07611	-0.254000	0.08781	-0.444000	0.07170	-0.140000	0.14226	AAC	.	.		0.582	PHGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033464.1	NM_006623	
PDZK1	5174	hgsc.bcm.edu	37	1	145748546	145748546	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:145748546A>G	ENST00000344770.2	+	3	492	c.419A>G	c.(418-420)aAg>aGg	p.K140R	PDZK1_ENST00000451928.2_Missense_Mutation_p.K140R|PDZK1_ENST00000417171.1_Missense_Mutation_p.K140R	NM_002614.4	NP_002605.2	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	140	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				carnitine transport (GO:0015879)|cell proliferation (GO:0008283)|drug transport (GO:0015893)|establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of ion transmembrane transport (GO:0034767)|positive regulation of protein targeting to membrane (GO:0090314)|regulation of anion transport (GO:0044070)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|transporter activity (GO:0005215)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			TATCTCGTGAAGGAAGGAGGC	0.522																																					p.K140R		Atlas-SNP	.											.	PDZK1	15	.	0			c.A419G						.						80.0	84.0	83.0					1																	145748546		2203	4300	6503	SO:0001583	missense	5174	exon4			TCGTGAAGGAAGG	AF012281	CCDS72859.1, CCDS72860.1	1q21	2009-08-21			ENSG00000174827	ENSG00000174827			8821	protein-coding gene	gene with protein product		603831				9461128	Standard	NM_002614		Approved	PDZD1, NHERF3	uc001eoo.2	Q5T2W1	OTTHUMG00000013735	ENST00000344770.2:c.419A>G	chr1.hg19:g.145748546A>G	ENSP00000342143:p.Lys140Arg	284.0	0.0		467.0	268.0	NM_002614	B4DPB9|E7EU02|O60450|Q5T5P6|Q9BQ41	Missense_Mutation	SNP	ENST00000344770.2	hg19	CCDS924.1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.994037	0.54041	.	.	ENSG00000174827	ENST00000443667;ENST00000417171;ENST00000451928;ENST00000344770	T;T;T;T	0.32753	1.64;1.64;1.44;1.64	5.84	5.84	0.93424	PDZ/DHR/GLGF (3);	0.050633	0.85682	D	0.000000	T	0.32315	0.0825	L	0.52011	1.625	0.47905	D	0.999542	P;D	0.89917	0.924;1.0	P;D	0.85130	0.791;0.997	T	0.18178	-1.0345	10	0.07813	T	0.8	-12.1142	14.1607	0.65446	1.0:0.0:0.0:0.0	.	140;140	E7EU02;Q5T2W1	.;NHRF3_HUMAN	R	140	ENSP00000409291:K140R;ENSP00000394485:K140R;ENSP00000403422:K140R;ENSP00000342143:K140R	ENSP00000342143:K140R	K	+	2	0	PDZK1	144459903	1.000000	0.71417	1.000000	0.80357	0.003000	0.03518	7.578000	0.82498	2.233000	0.73108	0.482000	0.46254	AAG	.	.		0.522	PDZK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038502.2	NM_002614	
HIST2H2BE	8349	hgsc.bcm.edu	37	1	149858163	149858163	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:149858163C>A	ENST00000369155.2	-	1	69	c.28G>T	c.(28-30)Gcc>Tcc	p.A10S	HIST2H2AC_ENST00000331380.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003528.2	NP_003519.1	Q16778	H2B2E_HUMAN	histone cluster 2, H2be	10					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	14	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			TTTTTAGGGGCCGGAGCGGAT	0.512																																					p.A10S		Atlas-SNP	.											HIST2H2BE,NS,carcinoma,0,1	HIST2H2BE	33	.	0			c.G28T						.						67.0	69.0	68.0					1																	149858163		2203	4300	6503	SO:0001583	missense	8349	exon1			TAGGGGCCGGAGC	AY131979	CCDS936.1	1q21.2	2011-01-27	2006-10-11	2003-03-07	ENSG00000184678	ENSG00000184678		"""Histones / Replication-dependent"""	4760	protein-coding gene	gene with protein product		601831	"""H2B histone family, member Q"", ""histone 2, H2be"""	H2B, H2BFQ		1469070, 12408966	Standard	NM_003528		Approved	H2B/q, H2B.1	uc001etc.3	Q16778	OTTHUMG00000012095	ENST00000369155.2:c.28G>T	chr1.hg19:g.149858163C>A	ENSP00000358151:p.Ala10Ser	125.0	1.0		192.0	59.0	NM_003528	A3KMC7|A8K110|Q4KMY1|Q5QNX0|Q9UE88	Missense_Mutation	SNP	ENST00000369155.2	hg19	CCDS936.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.099168	0.76983	.	.	ENSG00000184678	ENST00000369155	T	0.22539	1.95	5.99	5.99	0.97316	Histone-fold (2);	0.000000	0.85682	D	0.000000	T	0.19127	0.0459	M	0.76433	2.335	0.41464	D	0.988064	B	0.09022	0.002	B	0.04013	0.001	T	0.01444	-1.1353	10	0.48119	T	0.1	.	19.1154	0.93336	0.0:1.0:0.0:0.0	.	10	Q16778	H2B2E_HUMAN	S	10	ENSP00000358151:A10S	ENSP00000358151:A10S	A	-	1	0	HIST2H2BE	148124787	1.000000	0.71417	0.944000	0.38274	0.907000	0.53573	6.253000	0.72453	2.857000	0.98124	0.650000	0.86243	GCC	.	.		0.512	HIST2H2BE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033455.1	NM_003528	
FLG	2312	hgsc.bcm.edu	37	1	152282595	152282595	+	Silent	SNP	G	G	T	rs368218057		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:152282595G>T	ENST00000368799.1	-	3	4802	c.4767C>A	c.(4765-4767)cgC>cgA	p.R1589R	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1589	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGGATCCCTGGCGCCTGCTTG	0.582									Ichthyosis																												p.R1589R		Atlas-SNP	.											.	FLG	900	.	0			c.C4767A						.	G		0,4406		0,0,2203	152.0	164.0	160.0		4767	-4.6	0.0	1		160	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	FLG	NM_002016.1		0,1,6502	TT,TG,GG		0.0116,0.0,0.0077		1589/4062	152282595	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCCCTGGCGCCTG	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4767C>A	chr1.hg19:g.152282595G>T		136.0	0.0		142.0	39.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	hg19	CCDS30860.1																																																																																			.	.		0.582	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
LAMC1	3915	hgsc.bcm.edu	37	1	183111767	183111767	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:183111767G>A	ENST00000258341.4	+	28	4929	c.4672G>A	c.(4672-4674)Gtg>Atg	p.V1558M	RP11-181K3.4_ENST00000457852.3_RNA	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	1558	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						TGATAGGAAAGTGTCTGACCT	0.468																																					p.V1558M		Atlas-SNP	.											.	LAMC1	176	.	0			c.G4672A						.						111.0	90.0	97.0					1																	183111767		2203	4300	6503	SO:0001583	missense	3915	exon28			AGGAAAGTGTCTG	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.4672G>A	chr1.hg19:g.183111767G>A	ENSP00000258341:p.Val1558Met	71.0	0.0		125.0	37.0	NM_002293	Q5VYE7	Missense_Mutation	SNP	ENST00000258341.4	hg19	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778657	0.49786	.	.	ENSG00000135862	ENST00000258341	T	0.31247	1.5	5.57	5.57	0.84162	.	0.065064	0.64402	D	0.000006	T	0.23054	0.0557	N	0.25426	0.745	0.53005	D	0.999969	B	0.26195	0.144	B	0.19148	0.024	T	0.02821	-1.1106	10	0.36615	T	0.2	.	15.0699	0.72026	0.0:0.1415:0.8585:0.0	.	1558	P11047	LAMC1_HUMAN	M	1558	ENSP00000258341:V1558M	ENSP00000258341:V1558M	V	+	1	0	LAMC1	181378390	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.364000	0.73086	2.611000	0.88343	0.655000	0.94253	GTG	.	.		0.468	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	
PLA2G4A	5321	hgsc.bcm.edu	37	1	186839647	186839648	+	Splice_Site	DNP	GC	GC	AA			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:186839647_186839648GC>AA	ENST00000367466.3	+	3	266_267	c.114_115GC>AA	c.(112-117)atGCtt>atAAtt	p.38_39ML>II	PLA2G4A_ENST00000442353.2_Splice_Site_p.38_39ML>II|PLA2G4A_ENST00000466600.1_3'UTR	NM_024420.2	NP_077734	P47712	PA24A_HUMAN	phospholipase A2, group IVA (cytosolic, calcium-dependent)	38	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Phospholipid binding. {ECO:0000305}.				arachidonic acid metabolic process (GO:0019369)|arachidonic acid secretion (GO:0050482)|blood coagulation (GO:0007596)|cardiolipin acyl-chain remodeling (GO:0035965)|cellular response to antibiotic (GO:0071236)|glycerophospholipid biosynthetic process (GO:0046474)|icosanoid biosynthetic process (GO:0046456)|icosanoid metabolic process (GO:0006690)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|platelet activating factor biosynthetic process (GO:0006663)|platelet activation (GO:0030168)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|calcium-dependent phospholipid binding (GO:0005544)|lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|prostate(3)|skin(4)|stomach(1)	53					Aldesleukin(DB00041)|Carbachol(DB00411)|Carbenicillin(DB00578)|Epirubicin(DB00445)|Fluocinolone Acetonide(DB00591)|Fluticasone Propionate(DB00588)|Niflumic Acid(DB04552)|Orlistat(DB01083)|Quinacrine(DB01103)|Streptokinase(DB00086)|Suramin(DB04786)	TTGGTGACATGCGTAAGTGCCC	0.426																																					p.M38I|p.L39I		Atlas-SNP	.											.	PLA2G4A	125	.	0			c.G114A|c.C115A						.																																			SO:0001630	splice_region_variant	5321	exon3			TGACATGCGTAAG|GACATGCGTAAGT	M72393	CCDS1372.1	1q25	2014-09-17			ENSG00000116711	ENSG00000116711	3.1.1.4, 3.1.1.5		9035	protein-coding gene	gene with protein product		600522		PLA2G4		8175726	Standard	NM_024420		Approved	cPLA2-alpha	uc001gsc.3	P47712	OTTHUMG00000035512	Exception_encountered	chr1.hg19:g.186839647_186839648delinsAA		57.0|55.0	0.0		113.0|112.0	30.0	NM_024420	B1AKG4|Q29R80	Missense_Mutation	SNP	ENST00000367466.3	hg19	CCDS1372.1																																																																																			.	.		0.426	PLA2G4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086236.1	NM_024420	Missense_Mutation
BRINP3	339479	hgsc.bcm.edu	37	1	190067609	190067609	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:190067609G>T	ENST00000367462.3	-	8	2071	c.1840C>A	c.(1840-1842)Ctg>Atg	p.L614M	BRINP3_ENST00000534846.1_Missense_Mutation_p.L512M	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	614					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											TTGTTCCCCAGAGTTAATGTC	0.443																																					p.L614M		Atlas-SNP	.											.	FAM5C	343	.	0			c.C1840A						.						244.0	256.0	252.0					1																	190067609		2203	4300	6503	SO:0001583	missense	339479	exon8			TCCCCAGAGTTAA	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1840C>A	chr1.hg19:g.190067609G>T	ENSP00000356432:p.Leu614Met	67.0	0.0		73.0	21.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	hg19	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122327	0.37436	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	T;T	0.32272	1.7;1.46	5.61	2.65	0.31530	.	0.078660	0.51477	D	0.000082	T	0.39332	0.1074	M	0.69823	2.125	0.38339	D	0.944007	P;P	0.52061	0.95;0.917	P;P	0.52424	0.698;0.502	T	0.39272	-0.9622	10	0.87932	D	0	.	5.3923	0.16251	0.2414:0.1484:0.6102:0.0	.	512;614	B7Z260;Q76B58	.;FAM5C_HUMAN	M	614;512	ENSP00000356432:L614M;ENSP00000438022:L512M	ENSP00000356432:L614M	L	-	1	2	FAM5C	188334232	0.996000	0.38824	0.921000	0.36526	0.972000	0.66771	1.772000	0.38552	0.706000	0.31912	0.585000	0.79938	CTG	.	.		0.443	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
TTC13	79573	hgsc.bcm.edu	37	1	231096999	231096999	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:231096999A>C	ENST00000366661.4	-	2	329	c.322T>G	c.(322-324)Tca>Gca	p.S108A	TTC13_ENST00000414259.1_Missense_Mutation_p.S108A|TTC13_ENST00000366662.4_Missense_Mutation_p.S108A	NM_024525.4	NP_078801.3	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13	108										central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	39	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		TCACAGGGTGATGATCCCTTG	0.423																																					p.S108A		Atlas-SNP	.											.	TTC13	74	.	0			c.T322G						.						124.0	113.0	117.0					1																	231096999		2203	4300	6503	SO:0001583	missense	79573	exon2			AGGGTGATGATCC		CCDS1588.1, CCDS44332.1, CCDS44332.2	1q42.2	2013-01-10			ENSG00000143643	ENSG00000143643		"""Tetratricopeptide (TTC) repeat domain containing"""	26204	protein-coding gene	gene with protein product							Standard	NM_024525		Approved	FLJ22584	uc001huf.4	Q8NBP0	OTTHUMG00000037788	ENST00000366661.4:c.322T>G	chr1.hg19:g.231096999A>C	ENSP00000355621:p.Ser108Ala	67.0	0.0		106.0	27.0	NM_001122835	B1AQI1|B1AQI2|Q8IVP8|Q8NBI0|Q8ND20	Missense_Mutation	SNP	ENST00000366661.4	hg19	CCDS1588.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.583|0.583	-0.836257|-0.836257	0.02692|0.02692	.|.	.|.	ENSG00000143643|ENSG00000143643	ENST00000522821|ENST00000366661;ENST00000366662;ENST00000414259	.|T;T;T	.|0.42900	.|1.02;0.96;0.96	5.27|5.27	2.28|2.28	0.28536|0.28536	.|.	.|0.371098	.|0.30714	.|N	.|0.009033	T|T	0.16428|0.16428	0.0395|0.0395	N|N	0.03608|0.03608	-0.345|-0.345	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.06786	.|0.0;0.001;0.0	.|B;B;B	.|0.06405	.|0.0;0.001;0.002	T|T	0.28138|0.28138	-1.0053|-1.0053	5|10	.|0.08837	.|T	.|0.75	-0.9707|-0.9707	9.4866|9.4866	0.38933|0.38933	0.0769:0.2799:0.6433:0.0|0.0769:0.2799:0.6433:0.0	.|.	.|108;108;108	.|E9PGV4;Q8NBP0-2;Q8NBP0	.|.;.;TTC13_HUMAN	Q|A	96|108	.|ENSP00000355621:S108A;ENSP00000355622:S108A;ENSP00000416631:S108A	.|ENSP00000355621:S108A	H|S	-|-	3|1	2|0	TTC13|TTC13	229163622|229163622	0.547000|0.547000	0.26465|0.26465	0.120000|0.120000	0.21714|0.21714	0.811000|0.811000	0.45836|0.45836	0.535000|0.535000	0.23114|0.23114	0.197000|0.197000	0.20387|0.20387	-0.237000|-0.237000	0.12165|0.12165	CAT|TCA	.	.		0.423	TTC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092229.2	NM_024525	
OR6F1	343169	hgsc.bcm.edu	37	1	247875237	247875237	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:247875237A>G	ENST00000302084.2	-	1	868	c.821T>C	c.(820-822)gTc>gCc	p.V274A	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	274						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			CAGGACGTGGACAGCTTTGAT	0.478																																					p.V274A		Atlas-SNP	.											.	OR6F1	88	.	0			c.T821C						.						116.0	113.0	114.0					1																	247875237		2203	4300	6503	SO:0001583	missense	343169	exon1			ACGTGGACAGCTT	BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.821T>C	chr1.hg19:g.247875237A>G	ENSP00000305640:p.Val274Ala	69.0	0.0		93.0	30.0	NM_001005286	B2RNV6|Q6IF02|Q96R39	Missense_Mutation	SNP	ENST00000302084.2	hg19	CCDS31095.1	.	.	.	.	.	.	.	.	.	.	A	11.49	1.652864	0.29336	.	.	ENSG00000169214	ENST00000302084	T	0.39406	1.08	3.49	3.49	0.39957	GPCR, rhodopsin-like superfamily (1);	0.657383	0.12629	N	0.452358	T	0.27169	0.0666	N	0.12853	0.265	0.09310	N	1	P	0.38745	0.645	B	0.41946	0.371	T	0.08472	-1.0720	10	0.51188	T	0.08	-34.2103	6.4793	0.22053	0.8855:0.0:0.1145:0.0	.	274	Q8NGZ6	OR6F1_HUMAN	A	274	ENSP00000305640:V274A	ENSP00000305640:V274A	V	-	2	0	OR6F1	245941860	0.002000	0.14202	0.002000	0.10522	0.059000	0.15707	1.722000	0.38042	1.574000	0.49760	0.482000	0.46254	GTC	.	.		0.478	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096870.1	NM_001005286	
ROCK2	9475	hgsc.bcm.edu	37	2	11348447	11348447	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:11348447T>A	ENST00000315872.6	-	19	2778	c.2330A>T	c.(2329-2331)gAg>gTg	p.E777V	ROCK2_ENST00000401753.1_Missense_Mutation_p.E534V	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	777	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTTAAGGAGCTCATTTATTTT	0.318																																					p.E777V		Atlas-SNP	.											.	ROCK2	224	.	0			c.A2330T						.						85.0	78.0	81.0					2																	11348447		1811	4069	5880	SO:0001583	missense	9475	exon19			AGGAGCTCATTTA	D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.2330A>T	chr2.hg19:g.11348447T>A	ENSP00000317985:p.Glu777Val	38.0	0.0		49.0	18.0	NM_004850	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	ENST00000315872.6	hg19	CCDS42654.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.254813	0.80135	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.64438	-0.1;0.95	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.65863	0.2732	L	0.57536	1.79	0.58432	D	0.999995	P	0.46859	0.885	P	0.46885	0.53	T	0.68236	-0.5462	10	0.49607	T	0.09	.	15.7982	0.78428	0.0:0.0:0.0:1.0	.	777	O75116	ROCK2_HUMAN	V	777;534;135	ENSP00000317985:E777V;ENSP00000385509:E534V	ENSP00000317985:E777V	E	-	2	0	ROCK2	11265898	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	5.952000	0.70282	2.132000	0.65825	0.533000	0.62120	GAG	.	.		0.318	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313886.3		
ADCY3	109	hgsc.bcm.edu	37	2	25141567	25141567	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:25141567G>T	ENST00000260600.5	-	1	1141	c.290C>A	c.(289-291)gCt>gAt	p.A97D		NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	97					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					GAAGACCACAGCACACATGAC	0.567																																					p.A97D		Atlas-SNP	.											.	ADCY3	114	.	0			c.C290A						.						109.0	114.0	112.0					2																	25141567		2203	4300	6503	SO:0001583	missense	109	exon1			ACCACAGCACACA	AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.290C>A	chr2.hg19:g.25141567G>T	ENSP00000260600:p.Ala97Asp	147.0	0.0		138.0	52.0	NM_004036	B3KT86|Q53T54|Q9UDB1	Missense_Mutation	SNP	ENST00000260600.5	hg19	CCDS1715.1	.	.	.	.	.	.	.	.	.	.	G	18.42	3.620799	0.66787	.	.	ENSG00000138031	ENST00000260600;ENST00000415879;ENST00000435135;ENST00000438445	T;T;T	0.81163	-1.46;-1.08;0.44	4.8	3.85	0.44370	.	0.000000	0.85682	D	0.000000	T	0.75715	0.3887	M	0.67953	2.075	0.80722	D	1	B;B	0.31318	0.139;0.319	B;B	0.24006	0.03;0.05	T	0.75326	-0.3357	10	0.33940	T	0.23	.	13.1935	0.59726	0.0:0.1611:0.8389:0.0	.	97;97	B7ZLX9;O60266	.;ADCY3_HUMAN	D	97;72;97;97	ENSP00000260600:A97D;ENSP00000389799:A97D;ENSP00000406153:A97D	ENSP00000260600:A97D	A	-	2	0	ADCY3	24995071	0.999000	0.42202	0.939000	0.37840	0.987000	0.75469	7.429000	0.80309	2.211000	0.71520	0.563000	0.77884	GCT	.	.		0.567	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211574.2		
PEX13	5194	hgsc.bcm.edu	37	2	61258660	61258660	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:61258660A>G	ENST00000295030.5	+	2	237	c.199A>G	c.(199-201)Agt>Ggt	p.S67G	PEX13_ENST00000472678.1_3'UTR	NM_002618.3	NP_002609.1	Q92968	PEX13_HUMAN	peroxisomal biogenesis factor 13	67					cerebral cortex cell migration (GO:0021795)|fatty acid alpha-oxidation (GO:0001561)|locomotory behavior (GO:0007626)|microtubule-based peroxisome localization (GO:0060152)|neuron migration (GO:0001764)|protein import into peroxisome matrix, docking (GO:0016560)|suckling behavior (GO:0001967)	integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)				endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10			LUSC - Lung squamous cell carcinoma(5;2.05e-06)|Lung(5;3.13e-05)|Epithelial(17;0.114)			AGGAAGTAGCAGTGTGAACAC	0.428																																					p.S67G		Atlas-SNP	.											.	PEX13	27	.	0			c.A199G						.						122.0	120.0	121.0					2																	61258660		2203	4300	6503	SO:0001583	missense	5194	exon2			AGTAGCAGTGTGA	U71374	CCDS1866.1	2p16.1	2008-08-26	2008-08-26		ENSG00000162928	ENSG00000162928			8855	protein-coding gene	gene with protein product		601789	"""peroxisome biogenesis factor 13"""			9878256	Standard	NM_002618		Approved		uc002sau.4	Q92968	OTTHUMG00000129422	ENST00000295030.5:c.199A>G	chr2.hg19:g.61258660A>G	ENSP00000295030:p.Ser67Gly	78.0	0.0		92.0	31.0	NM_002618	B2RCS1	Missense_Mutation	SNP	ENST00000295030.5	hg19	CCDS1866.1	.	.	.	.	.	.	.	.	.	.	A	10.98	1.503485	0.26949	.	.	ENSG00000162928	ENST00000295030	T	0.76578	-1.03	5.85	5.85	0.93711	.	0.792914	0.12121	N	0.497700	T	0.58104	0.2099	N	0.08118	0	0.54753	D	0.999982	B	0.02656	0.0	B	0.01281	0.0	T	0.53408	-0.8443	10	0.22109	T	0.4	-3.5224	8.567	0.33545	0.8572:0.0:0.1428:0.0	.	67	Q92968	PEX13_HUMAN	G	67	ENSP00000295030:S67G	ENSP00000295030:S67G	S	+	1	0	PEX13	61112164	0.638000	0.27225	0.865000	0.33974	0.986000	0.74619	2.334000	0.43920	2.222000	0.72286	0.533000	0.62120	AGT	.	.		0.428	PEX13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251581.3	NM_002618	
CNGA3	1261	hgsc.bcm.edu	37	2	98996755	98996755	+	Silent	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:98996755C>A	ENST00000272602.2	+	3	372	c.333C>A	c.(331-333)tcC>tcA	p.S111S	CNGA3_ENST00000436404.2_Silent_p.S111S|CNGA3_ENST00000393504.1_Silent_p.S111S|CNGA3_ENST00000409937.1_Silent_p.S115S			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	111					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						AGGAGGTGTCCAGCCAAGAAA	0.592																																					p.S111S		Atlas-SNP	.											.	CNGA3	118	.	0			c.C333A						.						71.0	67.0	69.0					2																	98996755		2203	4300	6503	SO:0001819	synonymous_variant	1261	exon4			GGTGTCCAGCCAA	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.333C>A	chr2.hg19:g.98996755C>A		115.0	0.0		90.0	38.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Silent	SNP	ENST00000272602.2	hg19	CCDS2034.1																																																																																			.	.		0.592	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
CCDC74A	90557	hgsc.bcm.edu	37	2	132290493	132290493	+	Silent	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:132290493G>A	ENST00000295171.6	+	6	1071	c.933G>A	c.(931-933)gaG>gaA	p.E311E	CCDC74A_ENST00000467992.2_3'UTR|CCDC74A_ENST00000409856.3_Silent_p.E245E	NM_001258304.1|NM_001258305.1|NM_138770.2	NP_001245233.1|NP_001245234.1|NP_620125.1	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	311										endometrium(4)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						CAGCCCCGGAGGAAGCTAGCT	0.667																																					p.R247K		Atlas-SNP	.											.	CCDC74A	44	.	0			c.G740A						.						58.0	68.0	65.0					2																	132290493		2203	4300	6503	SO:0001819	synonymous_variant	90557	exon5			CCCGGAGGAAGCT		CCDS2167.1, CCDS58732.1, CCDS74578.1	2q21.1	2008-02-05		2006-02-16	ENSG00000163040	ENSG00000163040			25197	protein-coding gene	gene with protein product						12477932	Standard	NM_138770		Approved	FLJ40345	uc002ttb.4	Q96AQ1	OTTHUMG00000131667	ENST00000295171.6:c.933G>A	chr2.hg19:g.132290493G>A		260.0	0.0		218.0	42.0	NM_001258305	Q6P4I5	Missense_Mutation	SNP	ENST00000295171.6	hg19	CCDS2167.1	.	.	.	.	.	.	.	.	.	.	.	13.86	2.362848	0.41902	.	.	ENSG00000163040	ENST00000434330	T	0.51325	0.71	3.35	3.35	0.38373	.	.	.	.	.	T	0.56016	0.1957	.	.	.	0.35196	D	0.773865	.	.	.	.	.	.	T	0.69235	-0.5198	6	0.87932	D	0	.	10.5645	0.45165	0.0:0.0:1.0:0.0	.	.	.	.	K	200	ENSP00000406839:R200K	ENSP00000406839:R200K	R	+	2	0	CCDC74A	132006963	0.295000	0.24389	0.294000	0.24946	0.011000	0.07611	0.925000	0.28791	1.586000	0.49944	0.430000	0.28490	AGG	.	.		0.667	CCDC74A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254570.2	NM_138770	
PKP4	8502	hgsc.bcm.edu	37	2	159526271	159526271	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:159526271G>A	ENST00000389759.3	+	17	2880	c.2768G>A	c.(2767-2769)gGc>gAc	p.G923D	PKP4_ENST00000389757.3_Missense_Mutation_p.G923D|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	923					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CGGCTCCCCGGCGGCAATGGC	0.522										HNSCC(62;0.18)																											p.G923D		Atlas-SNP	.											.	PKP4	133	.	0			c.G2768A						.						50.0	53.0	52.0					2																	159526271		2203	4300	6503	SO:0001583	missense	8502	exon17			TCCCCGGCGGCAA	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.2768G>A	chr2.hg19:g.159526271G>A	ENSP00000374409:p.Gly923Asp	224.0	0.0		186.0	83.0	NM_001005476	Q86W91	Missense_Mutation	SNP	ENST00000389759.3	hg19	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	G	27.2	4.812128	0.90707	.	.	ENSG00000144283	ENST00000389757;ENST00000389759	T;T	0.38887	1.11;1.11	5.82	5.82	0.92795	Armadillo-like helical (1);Armadillo-type fold (1);	0.051797	0.85682	D	0.000000	T	0.61413	0.2345	L	0.46819	1.47	0.80722	D	1	D;D;D	0.89917	0.995;1.0;0.997	D;D;D	0.97110	0.949;1.0;0.953	T	0.60454	-0.7260	10	0.66056	D	0.02	-11.2665	20.0989	0.97860	0.0:0.0:1.0:0.0	.	878;923;923	Q4W5T8;Q99569-2;Q99569	.;.;PKP4_HUMAN	D	923	ENSP00000374407:G923D;ENSP00000374409:G923D	ENSP00000374407:G923D	G	+	2	0	PKP4	159234517	1.000000	0.71417	0.083000	0.20561	0.927000	0.56198	9.756000	0.98918	2.764000	0.94973	0.650000	0.86243	GGC	.	.		0.522	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
TTN	7273	hgsc.bcm.edu	37	2	179484523	179484523	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:179484523C>A	ENST00000591111.1	-	200	41822	c.41598G>T	c.(41596-41598)aaG>aaT	p.K13866N	TTN-AS1_ENST00000604956.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.K15507N|TTN_ENST00000342992.6_Missense_Mutation_p.K12939N|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000342175.6_Missense_Mutation_p.K6634N|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.K6567N|TTN_ENST00000460472.2_Missense_Mutation_p.K6442N|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13866					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGACTTCCACCTTATCTTTAT	0.403																																					p.K15507N		Atlas-SNP	.											.	TTN	18412	.	0			c.G46521T						.						177.0	169.0	171.0					2																	179484523		1862	4093	5955	SO:0001583	missense	7273	exon250			TTCCACCTTATCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41598G>T	chr2.hg19:g.179484523C>A	ENSP00000465570:p.Lys13866Asn	62.0	0.0		77.0	40.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	11.73	1.724819	0.30593	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.68025	-0.3;-0.3;-0.3;-0.3	5.82	1.97	0.26223	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46444	0.1393	N	0.05351	-0.065	0.35338	D	0.78619	P;P;P;P	0.36354	0.549;0.549;0.549;0.549	B;B;B;B	0.43623	0.258;0.258;0.425;0.258	T	0.52668	-0.8545	9	0.87932	D	0	.	2.2597	0.04064	0.1204:0.3516:0.1177:0.4103	.	6442;6567;6634;13866	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	12939;6442;6634;6567;6442	ENSP00000343764:K12939N;ENSP00000434586:K6442N;ENSP00000340554:K6634N;ENSP00000352154:K6567N	ENSP00000340554:K6634N	K	-	3	2	TTN	179192768	0.001000	0.12720	1.000000	0.80357	0.998000	0.95712	-1.524000	0.02233	0.373000	0.24621	0.655000	0.94253	AAG	.	.		0.403	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
AOX1	316	hgsc.bcm.edu	37	2	201531449	201531449	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:201531449A>G	ENST00000374700.2	+	32	3824	c.3583A>G	c.(3583-3585)Ata>Gta	p.I1195V	AOX1_ENST00000485106.1_3'UTR	NM_001159.3	NP_001150.3	Q06278	AOXA_HUMAN	aldehyde oxidase 1	1195					inflammatory response (GO:0006954)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	2 iron, 2 sulfur cluster binding (GO:0051537)|aldehyde oxidase activity (GO:0004031)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|NAD binding (GO:0051287)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)			breast(5)|endometrium(3)|kidney(4)|large_intestine(13)|lung(38)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	81					Allopurinol(DB00437)|Aminocaproic Acid(DB00513)|Brimonidine(DB00484)|Famciclovir(DB00426)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Pyrazinamide(DB00339)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TGGCTGCAGTATAAATCCAGC	0.383																																					p.I1195V		Atlas-SNP	.											.	AOX1	152	.	0			c.A3583G						.						113.0	105.0	108.0					2																	201531449		2203	4300	6503	SO:0001583	missense	316	exon32			TGCAGTATAAATC	AF017060	CCDS33360.1	2q33	2008-05-20			ENSG00000138356	ENSG00000138356			553	protein-coding gene	gene with protein product		602841				7570184	Standard	NM_001159		Approved	AO, AOH1	uc002uvx.3	Q06278	OTTHUMG00000154536	ENST00000374700.2:c.3583A>G	chr2.hg19:g.201531449A>G	ENSP00000363832:p.Ile1195Val	73.0	0.0		83.0	39.0	NM_001159	O14765|Q53RR8|Q53TV3|Q9BYF0|Q9UPG6	Missense_Mutation	SNP	ENST00000374700.2	hg19	CCDS33360.1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.550506	0.45383	.	.	ENSG00000138356	ENST00000374700;ENST00000260930;ENST00000439380	T;T;T	0.39787	1.06;1.06;1.06	5.09	2.6	0.31112	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.220508	0.44902	D	0.000401	T	0.53802	0.1819	M	0.87682	2.9	0.46167	D	0.998901	B	0.32382	0.368	B	0.40444	0.329	T	0.58719	-0.7587	10	0.66056	D	0.02	-31.141	12.137	0.53977	0.6741:0.3259:0.0:0.0	.	1195	Q06278	ADO_HUMAN	V	1195;81;35	ENSP00000363832:I1195V;ENSP00000260930:I81V;ENSP00000413326:I35V	ENSP00000260930:I81V	I	+	1	0	AOX1	201239694	0.791000	0.28800	0.992000	0.48379	0.976000	0.68499	0.659000	0.24994	0.423000	0.26033	0.383000	0.25322	ATA	.	.		0.383	AOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335844.1	NM_001159	
ABCA12	26154	hgsc.bcm.edu	37	2	215813394	215813394	+	Missense_Mutation	SNP	C	C	T	rs373723120		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:215813394C>T	ENST00000272895.7	-	47	7249	c.7030G>A	c.(7030-7032)Gac>Aac	p.D2344N	ABCA12_ENST00000389661.4_Missense_Mutation_p.D2026N|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2344	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTTACCAGGTCATCTAAGGCA	0.383																																					p.D2344N	Ovarian(66;664 1488 5121 34295)	Atlas-SNP	.											.	ABCA12	368	.	0			c.G7030A						.	C	ASN/ASP,ASN/ASP	0,4406		0,0,2203	102.0	94.0	97.0		6076,7030	5.5	1.0	2		97	1,8599		0,1,4299	no	missense,missense	ABCA12	NM_015657.3,NM_173076.2	23,23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	2026/2278,2344/2596	215813394	1,13005	2203	4300	6503	SO:0001583	missense	26154	exon47			CCAGGTCATCTAA	AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7030G>A	chr2.hg19:g.215813394C>T	ENSP00000272895:p.Asp2344Asn	140.0	0.0		159.0	59.0	NM_173076	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	ENST00000272895.7	hg19	CCDS33372.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.282329	0.80692	0.0	1.16E-4	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.93763	-3.28;-3.28	5.48	5.48	0.80851	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000004	D	0.92100	0.7496	L	0.39147	1.195	0.80722	D	1	B;P	0.40794	0.437;0.729	B;B	0.43251	0.241;0.413	D	0.92755	0.6219	10	0.72032	D	0.01	.	19.387	0.94560	0.0:1.0:0.0:0.0	.	2344;2026	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	2344;2026	ENSP00000272895:D2344N;ENSP00000374312:D2026N	ENSP00000272895:D2344N	D	-	1	0	ABCA12	215521639	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.521000	0.45563	2.572000	0.86782	0.655000	0.94253	GAC	.	.		0.383	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337111.1	NM_173076	
SP140	11262	hgsc.bcm.edu	37	2	231090583	231090583	+	Silent	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:231090583G>A	ENST00000392045.3	+	1	138	c.24G>A	c.(22-24)ggG>ggA	p.G8G	SP110_ENST00000540870.1_5'Flank|SP140_ENST00000343805.6_Silent_p.G8G|SP140_ENST00000420434.3_Silent_p.G8G|SP140_ENST00000350136.5_5'UTR|SP140_ENST00000417495.3_Silent_p.G8G|SP140_ENST00000373645.3_Silent_p.G8G|SP140_ENST00000486687.2_Silent_p.G8G	NM_007237.4	NP_009168.4	Q13342	SP140_HUMAN	SP140 nuclear body protein	8					defense response (GO:0006952)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.G8G(2)		NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	12		Renal(207;0.0112)|all_lung(227;0.0221)|Lung NSC(271;0.0977)|all_hematologic(139;0.103)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.13e-12)|all cancers(144;2.71e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)		GCCAGCAGGGGCAGATGGCAA	0.547																																					p.G8G		Atlas-SNP	.											SP140_ENST00000392045,NS,carcinoma,+1,2	SP140	121	.	2	Substitution - coding silent(2)	lung(2)	c.G24A						.						160.0	130.0	140.0					2																	231090583		2203	4300	6503	SO:0001819	synonymous_variant	11262	exon1			GCAGGGGCAGATG	U63420	CCDS33392.1, CCDS42831.1, CCDS63149.1, CCDS63150.1, CCDS63151.1	2q37.1	2013-01-28			ENSG00000079263	ENSG00000079263		"""Zinc fingers, PHD-type"""	17133	protein-coding gene	gene with protein product		608602				8695863, 8910577, 12368356	Standard	NM_001005176		Approved	LYSP100-B, LYSP100-A	uc002vql.3	Q13342	OTTHUMG00000153670	ENST00000392045.3:c.24G>A	chr2.hg19:g.231090583G>A		72.0	1.0		100.0	38.0	NM_007237	E7ESH9|E7EUR5|E9PFJ6|Q0VGE5|Q13341|Q3KR17|Q4ZG66|Q53TG1|Q6NSG4|Q92881|Q96TG3	Silent	SNP	ENST00000392045.3	hg19	CCDS42831.1																																																																																			.	.		0.547	SP140-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000332015.1	NM_007237	
CNTN6	27255	hgsc.bcm.edu	37	3	1189706	1189706	+	Nonsense_Mutation	SNP	G	G	A	rs144055237		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:1189706G>A	ENST00000446702.2	+	2	641	c.14G>A	c.(13-15)tGg>tAg	p.W5*	CNTN6_ENST00000539053.1_Intron|CNTN6_ENST00000350110.2_Nonsense_Mutation_p.W5*			Q9UQ52	CNTN6_HUMAN	contactin 6	5					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AGGTTGCTATGGAAACTGGTA	0.343																																					p.W5X		Atlas-SNP	.											.	CNTN6	245	.	0			c.G14A						.						117.0	122.0	120.0					3																	1189706		2203	4300	6503	SO:0001587	stop_gained	27255	exon2			TGCTATGGAAACT	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.14G>A	chr3.hg19:g.1189706G>A	ENSP00000407822:p.Trp5*	122.0	0.0		171.0	62.0	NM_014461	Q2KHM2	Nonsense_Mutation	SNP	ENST00000446702.2	hg19	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	G	40	8.466839	0.98825	.	.	ENSG00000134115	ENST00000446702;ENST00000350110	.	.	.	5.49	5.49	0.81192	.	0.484634	0.19560	N	0.111341	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.5615	0.87909	0.0:0.0:1.0:0.0	.	.	.	.	X	5	.	ENSP00000341882:W5X	W	+	2	0	CNTN6	1164706	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.679000	0.68160	2.571000	0.86741	0.655000	0.94253	TGG	.	G|1.000;C|0.000		0.343	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
FANCD2	2177	hgsc.bcm.edu	37	3	10136948	10136948	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:10136948G>A	ENST00000419585.1	+	41	4189	c.4028G>A	c.(4027-4029)gGg>gAg	p.G1343E	FANCD2_ENST00000287647.3_Missense_Mutation_p.G1343E|FANCD2_ENST00000383807.1_Missense_Mutation_p.G1343E|FANCD2OS_ENST00000524279.1_Intron|FANCD2OS_ENST00000436517.1_5'UTR|FANCD2_ENST00000383806.1_3'UTR			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	1343					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		CACCTGTGTGGGCATTCCAAG	0.463			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.G1343E		Atlas-SNP	.	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	.	FANCD2	253	.	0			c.G4028A						.						79.0	74.0	76.0					3																	10136948		2203	4300	6503	SO:0001583	missense	2177	exon41	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TGTGTGGGCATTC	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.4028G>A	chr3.hg19:g.10136948G>A	ENSP00000398754:p.Gly1343Glu	110.0	0.0		117.0	58.0	NM_001018115	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Missense_Mutation	SNP	ENST00000419585.1	hg19	CCDS33696.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.041157	0.93685	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000419585	T;T;T	0.65178	-0.14;-0.14;-0.14	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.81054	0.4743	M	0.80982	2.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.81974	-0.0687	10	0.66056	D	0.02	.	17.9953	0.89181	0.0:0.0:1.0:0.0	.	1343;1343	Q9BXW9-2;Q9BXW9	.;FACD2_HUMAN	E	1343	ENSP00000287647:G1343E;ENSP00000373318:G1343E;ENSP00000398754:G1343E	ENSP00000287647:G1343E	G	+	2	0	FANCD2	10111948	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.409000	0.97331	2.856000	0.98102	0.644000	0.83932	GGG	.	.		0.463	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339873.1		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266100	41266100	+	Missense_Mutation	SNP	T	T	C	rs121913416		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:41266100T>C	ENST00000349496.5	+	3	377	c.97T>C	c.(97-99)Tct>Cct	p.S33P	CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCA	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1,1	CTNNB1	4904	.	212	Deletion - In frame(115)|Substitution - Missense(70)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	liver(130)|large_intestine(20)|endometrium(14)|stomach(10)|pituitary(9)|pancreas(9)|central_nervous_system(8)|adrenal_gland(2)|small_intestine(2)|biliary_tract(2)|skin(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|breast(1)	c.T97C						.						93.0	77.0	82.0					3																	41266100		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGACTCTGGAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.97T>C	chr3.hg19:g.41266100T>C	ENSP00000344456:p.Ser33Pro	183.0	0.0		154.0	70.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395782	0.83011	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74509	-0.3642	10	0.87932	D	0	-10.7796	16.0677	0.80897	0.0:0.0:0.0:1.0	.	33	P35222	CTNB1_HUMAN	P	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26P;ENSP00000385604:S33P;ENSP00000412219:S33P;ENSP00000379486:S33P;ENSP00000344456:S33P;ENSP00000411226:S26P;ENSP00000379488:S33P;ENSP00000409302:S33P;ENSP00000401599:S33P	ENSP00000344456:S33P	S	+	1	0	CTNNB1	41241104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DNAH1	25981	hgsc.bcm.edu	37	3	52434364	52434364	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:52434364T>A	ENST00000420323.2	+	78	12961	c.12700T>A	c.(12700-12702)Tct>Act	p.S4234T		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	4299					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CACAGGACACTCTACCAACTA	0.557																																					p.S4234T		Atlas-SNP	.											.	DNAH1	534	.	0			c.T12700A						.						211.0	219.0	217.0					3																	52434364		2111	4254	6365	SO:0001583	missense	25981	exon78			GGACACTCTACCA	U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.12700T>A	chr3.hg19:g.52434364T>A	ENSP00000401514:p.Ser4234Thr	87.0	0.0		78.0	34.0	NM_015512	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	ENST00000420323.2	hg19	CCDS46842.1	.	.	.	.	.	.	.	.	.	.	T	34	5.324886	0.95708	.	.	ENSG00000114841	ENST00000420323	T	0.62639	0.01	5.73	5.73	0.89815	.	0.000000	0.49916	D	0.000137	D	0.86251	0.5888	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90918	0.4781	10	0.87932	D	0	.	16.0101	0.80396	0.0:0.0:0.0:1.0	.	4234	C9JXH6	.	T	4234	ENSP00000401514:S4234T	ENSP00000401514:S4234T	S	+	1	0	DNAH1	52409404	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.010000	0.88615	2.185000	0.69588	0.533000	0.62120	TCT	.	.		0.557	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350816.1	NM_015512	
PBRM1	55193	hgsc.bcm.edu	37	3	52598201	52598201	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:52598201G>A	ENST00000296302.7	-	23	3741	c.3740C>T	c.(3739-3741)aCt>aTt	p.T1247I	PBRM1_ENST00000409767.1_Missense_Mutation_p.T1262I|SMIM4_ENST00000476842.1_Intron|PBRM1_ENST00000409057.1_Missense_Mutation_p.T1247I|PBRM1_ENST00000409114.3_Missense_Mutation_p.T1262I|PBRM1_ENST00000337303.4_Missense_Mutation_p.T1247I|PBRM1_ENST00000394830.3_Missense_Mutation_p.T1222I|PBRM1_ENST00000356770.4_Missense_Mutation_p.T1215I|PBRM1_ENST00000410007.1_Missense_Mutation_p.T1222I			Q86U86	PB1_HUMAN	polybromo 1	1247	BAH 2. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|heart development (GO:0007507)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	kinetochore (GO:0000776)|nuclear chromosome (GO:0000228)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(5)|endometrium(5)|kidney(301)|liver(1)|lung(22)|pancreas(1)	335				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TGGTATTTCAGTTGGCCTGCA	0.398			"""Mis, N, F, S, D, O"""		"""clear cell renal carcinoma, breast"""																																p.T1222I		Atlas-SNP	.		Rec	yes		3	3p21	55193	polybromo 1		E	.	PBRM1	1252	.	0			c.C3665T						.						96.0	95.0	95.0					3																	52598201		2203	4300	6503	SO:0001583	missense	55193	exon24			ATTTCAGTTGGCC	BC015323	CCDS43099.1	3p21	2007-03-29			ENSG00000163939	ENSG00000163939			30064	protein-coding gene	gene with protein product		606083				11078522, 11483580	Standard	NM_018313		Approved	BAF180, PB1	uc003der.2	Q86U86	OTTHUMG00000152663	ENST00000296302.7:c.3740C>T	chr3.hg19:g.52598201G>A	ENSP00000296302:p.Thr1247Ile	79.0	0.0		70.0	31.0	NM_018313	A1L381|A1L382|A4FUJ7|Q1RMD1|Q1RMD2|Q96MS2|Q9H2T3|Q9H2T4|Q9H2T5|Q9H301|Q9H314	Missense_Mutation	SNP	ENST00000296302.7	hg19		.	.	.	.	.	.	.	.	.	.	G	27.6	4.846718	0.91277	.	.	ENSG00000163939	ENST00000356770;ENST00000394830;ENST00000296302;ENST00000337303;ENST00000409057;ENST00000410007;ENST00000409114;ENST00000409767;ENST00000423351	D;D;D;D;D;D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99;-1.99	5.43	5.43	0.79202	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	D	0.000000	D	0.91382	0.7281	L	0.56769	1.78	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.998;0.994;0.997;0.994;0.999;1.0;0.997;0.996	D	0.91831	0.5475	10	0.72032	D	0.01	-11.6219	19.2735	0.94021	0.0:0.0:1.0:0.0	.	1222;1222;1247;1262;1262;1247;1215;1247	Q86U86-9;Q86U86-4;Q86U86-2;Q86U86-8;Q86U86-7;Q86U86;Q86U86-3;Q86U86-5	.;.;.;.;.;PB1_HUMAN;.;.	I	1215;1222;1247;1247;1247;1222;1262;1262;1246	ENSP00000349213:T1215I;ENSP00000378307:T1222I;ENSP00000296302:T1247I;ENSP00000338302:T1247I;ENSP00000386593:T1247I;ENSP00000386529:T1222I;ENSP00000386643:T1262I;ENSP00000386601:T1262I;ENSP00000387775:T1246I	ENSP00000296302:T1247I	T	-	2	0	PBRM1	52573241	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.549000	0.85964	0.655000	0.94253	ACT	.	.		0.398	PBRM1-008	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000327232.1	NM_018165	
NSUN3	63899	hgsc.bcm.edu	37	3	93802963	93802963	+	Silent	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:93802963A>G	ENST00000314622.4	+	3	346	c.135A>G	c.(133-135)acA>acG	p.T45T		NM_022072.3	NP_071355.1	Q9H649	NSUN3_HUMAN	NOP2/Sun domain family, member 3	45							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|skin(1)	18						AGATACTAACATCTCCATCAT	0.343																																					p.T45T		Atlas-SNP	.											.	NSUN3	33	.	0			c.A135G						.						41.0	42.0	41.0					3																	93802963		2202	4300	6502	SO:0001819	synonymous_variant	63899	exon3			ACTAACATCTCCA	BC020602	CCDS2927.1	3q11.2	2009-11-23	2009-11-23		ENSG00000178694	ENSG00000178694		"""NOP2/Sun domain containing"""	26208	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 3"", ""NOL1/NOP2/Sun domain family, member 3"""			12477932	Standard	NM_022072		Approved	FLJ22609	uc003drl.1	Q9H649	OTTHUMG00000159025	ENST00000314622.4:c.135A>G	chr3.hg19:g.93802963A>G		126.0	0.0		117.0	48.0	NM_022072	Q6PG41|Q8IXG9|Q9H6M2	Silent	SNP	ENST00000314622.4	hg19	CCDS2927.1																																																																																			.	.		0.343	NSUN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352934.1	NM_022072	
SENP7	57337	hgsc.bcm.edu	37	3	101058948	101058948	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:101058948A>T	ENST00000394095.2	-	16	2401	c.2348T>A	c.(2347-2349)tTt>tAt	p.F783Y	SENP7_ENST00000314261.7_Missense_Mutation_p.F717Y|SENP7_ENST00000394094.2_Missense_Mutation_p.F718Y|SENP7_ENST00000348610.3_Missense_Mutation_p.F750Y|SENP7_ENST00000358203.3_Missense_Mutation_p.F619Y|SENP7_ENST00000394091.1_Missense_Mutation_p.F619Y	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	783	Protease.					intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CTTAAGGTAAAAATCAATGAT	0.299																																					p.F783Y		Atlas-SNP	.											.	SENP7	170	.	0			c.T2348A						.						44.0	42.0	43.0					3																	101058948		2201	4285	6486	SO:0001583	missense	57337	exon16			AGGTAAAAATCAA		CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.2348T>A	chr3.hg19:g.101058948A>T	ENSP00000377655:p.Phe783Tyr	258.0	0.0		293.0	116.0	NM_020654	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	ENST00000394095.2	hg19	CCDS2941.2	.	.	.	.	.	.	.	.	.	.	A	25.7	4.666480	0.88251	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	M	0.87328	2.875	0.80722	D	1	D;D;D;P	0.89917	1.0;1.0;1.0;0.886	D;D;D;P	0.97110	0.997;1.0;0.999;0.863	T	0.75852	-0.3171	10	0.87932	D	0	-14.6007	15.1096	0.72346	1.0:0.0:0.0:0.0	.	619;717;750;783	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	Y	783;718;717;619;619;750	ENSP00000377655:F783Y;ENSP00000377654:F718Y;ENSP00000313624:F717Y;ENSP00000377651:F619Y;ENSP00000350936:F619Y;ENSP00000342159:F750Y	ENSP00000313624:F717Y	F	-	2	0	SENP7	102541638	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.215000	0.89762	2.106000	0.64143	0.460000	0.39030	TTT	.	.		0.299	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313957.2	NM_020654	
ZDHHC23	254887	hgsc.bcm.edu	37	3	113667674	113667674	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:113667674C>T	ENST00000330212.3	+	2	324	c.25C>T	c.(25-27)Cct>Tct	p.P9S	ZDHHC23_ENST00000498275.1_Missense_Mutation_p.P3S|RP11-255E6.6_ENST00000609657.1_RNA	NM_173570.3	NP_775841.2	Q8IYP9	ZDH23_HUMAN	zinc finger, DHHC-type containing 23	9					protein localization to plasma membrane (GO:0072659)|protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(2)|urinary_tract(2)	16						CAGTATGAAGCCTGTGAAGAA	0.468																																					p.P9S		Atlas-SNP	.											.	ZDHHC23	38	.	0			c.C25T						.						128.0	128.0	128.0					3																	113667674		2203	4300	6503	SO:0001583	missense	254887	exon2			ATGAAGCCTGTGA	AK127025	CCDS33827.1	3q13.31	2008-05-02			ENSG00000184307	ENSG00000184307		"""Zinc fingers, DHHC-type"""	28654	protein-coding gene	gene with protein product						12477932	Standard	NM_173570		Approved	MGC42530	uc003eau.3	Q8IYP9	OTTHUMG00000159335	ENST00000330212.3:c.25C>T	chr3.hg19:g.113667674C>T	ENSP00000330485:p.Pro9Ser	48.0	0.0		65.0	29.0	NM_173570	D3DN76	Missense_Mutation	SNP	ENST00000330212.3	hg19	CCDS33827.1	.	.	.	.	.	.	.	.	.	.	C	14.87	2.663884	0.47572	.	.	ENSG00000184307	ENST00000330212;ENST00000498275;ENST00000491556	T;T;T	0.41400	1.01;1.02;1.0	4.86	1.83	0.25207	.	0.667620	0.14416	N	0.320967	T	0.20373	0.0490	N	0.08118	0	0.29581	N	0.84919	B	0.02656	0.0	B	0.04013	0.001	T	0.12319	-1.0552	10	0.49607	T	0.09	-2.555	5.7672	0.18233	0.1978:0.6182:0.0:0.184	.	9	Q8IYP9	ZDH23_HUMAN	S	9;3;9	ENSP00000330485:P9S;ENSP00000417840:P3S;ENSP00000420292:P9S	ENSP00000330485:P9S	P	+	1	0	ZDHHC23	115150364	0.695000	0.27747	0.945000	0.38365	0.632000	0.37999	0.490000	0.22403	0.650000	0.30769	0.591000	0.81541	CCT	.	.		0.468	ZDHHC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354702.1	NM_173570	
QTRTD1	79691	hgsc.bcm.edu	37	3	113785076	113785076	+	Splice_Site	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:113785076G>A	ENST00000281273.4	+	4	459	c.202G>A	c.(202-204)Gca>Aca	p.A68T	QTRTD1_ENST00000479882.1_5'UTR|QTRTD1_ENST00000493014.1_Intron|QTRTD1_ENST00000485050.1_Splice_Site_p.A80T|QTRTD1_ENST00000466050.1_3'UTR	NM_024638.3	NP_078914.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						TGCTTACAGAGCAGAACATCA	0.328																																					p.A80T		Atlas-SNP	.											.	QTRTD1	29	.	0			c.G238A						.						121.0	122.0	122.0					3																	113785076		2203	4300	6503	SO:0001630	splice_region_variant	79691	exon3			TACAGAGCAGAAC	AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000281273.4:c.201-1G>A	chr3.hg19:g.113785076G>A		50.0	0.0		59.0	27.0	NM_001256835		Missense_Mutation	SNP	ENST00000281273.4	hg19	CCDS33828.1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414500	0.62511	.	.	ENSG00000151576	ENST00000472599;ENST00000485050;ENST00000281273;ENST00000482307	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.61887	0.2383	L	0.58302	1.8	0.80722	D	1	P;B	0.45986	0.87;0.23	P;B	0.44561	0.453;0.082	T	0.62393	-0.6864	9	0.45353	T	0.12	-15.1412	19.9595	0.97236	0.0:0.0:1.0:0.0	.	82;68	C9JJ71;Q9H974	.;QTRD1_HUMAN	T	82;80;68;68	.	ENSP00000281273:A68T	A	+	1	0	QTRTD1	115267766	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	8.486000	0.90451	2.706000	0.92434	0.563000	0.77884	GCA	.	.		0.328	QTRTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354708.2	NM_024638	Missense_Mutation
COL6A5	256076	hgsc.bcm.edu	37	3	130129336	130129336	+	Missense_Mutation	SNP	G	G	T	rs371782483		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:130129336G>T	ENST00000432398.2	+	20	5124	c.4630G>T	c.(4630-4632)Gtg>Ttg	p.V1544L	COL6A5_ENST00000265379.6_Missense_Mutation_p.V1544L	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1544	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						ACAGAAAGGGGTGCAAGGCAG	0.398																																					p.V1544L		Atlas-SNP	.											.	COL6A5	205	.	0			c.G4630T						.						106.0	86.0	92.0					3																	130129336		692	1591	2283	SO:0001583	missense	256076	exon20			AAAGGGGTGCAAG	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4630G>T	chr3.hg19:g.130129336G>T	ENSP00000390895:p.Val1544Leu	98.0	0.0		129.0	57.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	hg19		.	.	.	.	.	.	.	.	.	.	G	2.169	-0.390423	0.04932	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.93763	-3.22;-3.28	5.73	-8.29	0.01009	.	.	.	.	.	T	0.80717	0.4676	N	0.05158	-0.105	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.67473	-0.5662	9	0.25106	T	0.35	.	9.7336	0.40376	0.189:0.1004:0.6119:0.0987	.	1544	A8TX70-2	.	L	1544	ENSP00000390895:V1544L;ENSP00000265379:V1544L	ENSP00000265379:V1544L	V	+	1	0	COL6A5	131612026	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.003000	0.03682	-1.514000	0.01786	-0.806000	0.03193	GTG	.	.		0.398	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
CLSTN2	64084	hgsc.bcm.edu	37	3	140281700	140281700	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:140281700T>G	ENST00000458420.3	+	14	2450	c.2260T>G	c.(2260-2262)Tac>Gac	p.Y754D		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	754					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						TCACATCCGCTACCGCAACTG	0.557										HNSCC(16;0.037)																											p.Y754D	GBM(45;858 913 3709 36904 37282)	Atlas-SNP	.											.	CLSTN2	190	.	0			c.T2260G						.						58.0	55.0	56.0					3																	140281700		2203	4300	6503	SO:0001583	missense	64084	exon14			ATCCGCTACCGCA	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2260T>G	chr3.hg19:g.140281700T>G	ENSP00000402460:p.Tyr754Asp	116.0	0.0		121.0	47.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	hg19	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.172363	0.57584	.	.	ENSG00000158258	ENST00000458420	T	0.34859	1.34	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.62612	0.2442	M	0.86097	2.795	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.67979	-0.5530	9	.	.	.	-29.2093	12.6334	0.56669	0.0:0.0:0.0:1.0	.	754	Q9H4D0	CSTN2_HUMAN	D	754	ENSP00000402460:Y754D	.	Y	+	1	0	CLSTN2	141764390	1.000000	0.71417	0.994000	0.49952	0.177000	0.22998	7.997000	0.88414	1.926000	0.55796	0.460000	0.39030	TAC	.	.		0.557	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
CCDC39	339829	hgsc.bcm.edu	37	3	180359906	180359906	+	Silent	SNP	A	A	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:180359906A>T	ENST00000442201.2	-	13	1868	c.1749T>A	c.(1747-1749)ctT>ctA	p.L583L	CCDC39_ENST00000273654.4_Silent_p.L667L	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	583					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTTCTAGGGAAAGAACTTCTT	0.348																																					p.L583L		Atlas-SNP	.											.	CCDC39	242	.	0			c.T1749A						.						143.0	126.0	132.0					3																	180359906		1836	4087	5923	SO:0001819	synonymous_variant	339829	exon13			TAGGGAAAGAACT	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1749T>A	chr3.hg19:g.180359906A>T		83.0	0.0		102.0	42.0	NM_181426	B4E2H1	Silent	SNP	ENST00000442201.2	hg19	CCDS46964.1																																																																																			.	.		0.348	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
MAP6D1	79929	hgsc.bcm.edu	37	3	183543020	183543020	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:183543020C>T	ENST00000318631.3	-	1	346	c.316G>A	c.(316-318)Gcg>Acg	p.A106T	MAP6D1_ENST00000431348.1_Missense_Mutation_p.A106T|MAP6D1_ENST00000463801.1_5'Flank	NM_024871.2	NP_079147.1	Q9H9H5	MA6D1_HUMAN	MAP6 domain containing 1	106					dendrite morphogenesis (GO:0048813)|lysosome localization (GO:0032418)|microtubule cytoskeleton organization (GO:0000226)|N-terminal peptidyl-L-cysteine N-palmitoylation (GO:0018009)|negative regulation of microtubule depolymerization (GO:0007026)	cis-Golgi network (GO:0005801)|Golgi-associated vesicle (GO:0005798)|microtubule (GO:0005874)				endometrium(1)|lung(1)	2	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;5.15e-42)|Epithelial(37;4.29e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			GCAGGTGGCGCGGAGGACTGC	0.761																																					p.A106T		Atlas-SNP	.											.	MAP6D1	2	.	0			c.G316A						.						2.0	3.0	3.0					3																	183543020		1478	3110	4588	SO:0001583	missense	79929	exon1			GTGGCGCGGAGGA	BC006434	CCDS3247.1	3q27.1	2005-12-22			ENSG00000180834	ENSG00000180834			25753	protein-coding gene	gene with protein product		610593				12477932	Standard	NM_024871		Approved	FLJ12748	uc003fmc.2	Q9H9H5	OTTHUMG00000156900	ENST00000318631.3:c.316G>A	chr3.hg19:g.183543020C>T	ENSP00000314560:p.Ala106Thr	30.0	0.0		23.0	10.0	NM_024871		Missense_Mutation	SNP	ENST00000318631.3	hg19	CCDS3247.1	.	.	.	.	.	.	.	.	.	.	C	12.11	1.841073	0.32513	.	.	ENSG00000180834	ENST00000318631;ENST00000431348	T;T	0.17370	2.28;2.28	2.46	2.46	0.29980	.	.	.	.	.	T	0.20047	0.0482	N	0.17082	0.46	0.24707	N	0.993226	D	0.71674	0.998	D	0.64410	0.925	T	0.09100	-1.0690	9	0.41790	T	0.15	.	7.2828	0.26320	0.0:0.7231:0.2769:0.0	.	106	Q9H9H5	MA6D1_HUMAN	T	106	ENSP00000314560:A106T;ENSP00000388945:A106T	ENSP00000314560:A106T	A	-	1	0	MAP6D1	185025714	.	.	0.017000	0.16124	0.053000	0.15095	.	.	1.684000	0.51022	0.455000	0.32223	GCG	.	.		0.761	MAP6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346516.1	NM_024871	
HTT	3064	hgsc.bcm.edu	37	4	3241784	3241784	+	Nonstop_Mutation	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr4:3241784T>A	ENST00000355072.5	+	67	9572	c.9427T>A	c.(9427-9429)Tga>Aga	p.*3143R		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	0					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CACCACCTGCTGAGCGCCATG	0.622																																					p.X3143R		Atlas-SNP	.											.	HTT	221	.	0			c.T9427A						.						27.0	29.0	28.0					4																	3241784		2042	4182	6224	SO:0001578	stop_lost	3064	exon67			ACCTGCTGAGCGC	L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.9427T>A	chr4.hg19:g.3241784T>A	ENSP00000347184:p.*3143Argext*8	88.0	0.0		81.0	44.0	NM_002111	Q9UQB7	Missense_Mutation	SNP	ENST00000355072.5	hg19	CCDS43206.1	.	.	.	.	.	.	.	.	.	.	T	11.71	1.720000	0.30503	.	.	ENSG00000197386	ENST00000355072	.	.	.	5.32	4.06	0.47325	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.2101	0.48793	0.0:0.0:0.1534:0.8466	.	.	.	.	R	3143	.	.	X	+	1	0	HTT	3211582	1.000000	0.71417	0.980000	0.43619	0.329000	0.28539	5.982000	0.70532	1.984000	0.57885	0.533000	0.62120	TGA	.	.		0.622	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358234.2	NM_002111	
FRAS1	80144	hgsc.bcm.edu	37	4	79373018	79373018	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr4:79373018G>C	ENST00000264895.6	+	46	6996	c.6556G>C	c.(6556-6558)Gac>Cac	p.D2186H		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	2186					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						CAGATTGATTGACAAGTCATT	0.348																																					p.D2186H		Atlas-SNP	.											.	FRAS1	779	.	0			c.G6556C						.						115.0	108.0	110.0					4																	79373018		1841	4095	5936	SO:0001583	missense	80144	exon46			TTGATTGACAAGT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.6556G>C	chr4.hg19:g.79373018G>C	ENSP00000264895:p.Asp2186His	56.0	0.0		55.0	20.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	hg19	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.2|20.2	3.943607|3.943607	0.73672|0.73672	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.56776|.	0.44|.	5.65|5.65	4.81|4.81	0.61882|0.61882	.|.	0.280610|.	0.38272|.	N|.	0.001743|.	T|.	0.74884|.	0.3775|.	M|M	0.78916|0.78916	2.43|2.43	0.80722|0.80722	D|D	1|1	B|.	0.25955|.	0.138|.	B|.	0.14578|.	0.011|.	T|.	0.76350|.	-0.2991|.	10|.	0.72032|.	D|.	0.01|.	.|.	14.5744|14.5744	0.68235|0.68235	0.0706:0.0:0.9294:0.0|0.0706:0.0:0.9294:0.0	.|.	2186|.	E9PHH6|.	.|.	H|S	2186|414	ENSP00000264895:D2186H|.	ENSP00000264895:D2186H|.	D|X	+|+	1|2	0|2	FRAS1|FRAS1	79592042|79592042	1.000000|1.000000	0.71417|0.71417	0.060000|0.060000	0.19600|0.19600	0.886000|0.886000	0.51366|0.51366	5.672000|5.672000	0.68102|0.68102	1.390000|1.390000	0.46547|0.46547	0.591000|0.591000	0.81541|0.81541	GAC|TGA	.	.		0.348	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PRDM8	56978	hgsc.bcm.edu	37	4	81123282	81123282	+	Silent	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr4:81123282C>A	ENST00000504452.1	+	8	1505	c.666C>A	c.(664-666)ggC>ggA	p.G222G	PRDM8_ENST00000415738.2_Silent_p.G222G|PRDM8_ENST00000339711.4_Silent_p.G222G			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	222	Gly-rich.				corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						CACCTTTAGGCCCGGGTCCCA	0.701											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G222G		Atlas-SNP	.											.	PRDM8	44	.	0			c.C666A						.						16.0	22.0	20.0					4																	81123282		2003	4165	6168	SO:0001819	synonymous_variant	56978	exon4			TTTAGGCCCGGGT	AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.666C>A	chr4.hg19:g.81123282C>A		213.0	0.0	1203	154.0	67.0	NM_001099403	A8K7X2|Q6IQ36	Silent	SNP	ENST00000504452.1	hg19	CCDS43243.1																																																																																			.	.		0.701	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362793.1		
PPAP2A	8611	hgsc.bcm.edu	37	5	54763785	54763785	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr5:54763785C>T	ENST00000307259.8	-	3	823	c.403G>A	c.(403-405)Gat>Aat	p.D135N	PPAP2A_ENST00000264775.5_Missense_Mutation_p.D136N|PPAP2A_ENST00000515132.1_5'UTR	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	135					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				CAATCTGGATCACAAACATCC	0.433																																					p.D136N		Atlas-SNP	.											.	PPAP2A	42	.	0			c.G406A						.						148.0	144.0	145.0					5																	54763785		2203	4300	6503	SO:0001583	missense	8611	exon3			CTGGATCACAAAC	AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.403G>A	chr5.hg19:g.54763785C>T	ENSP00000302229:p.Asp135Asn	83.0	0.0		76.0	31.0	NM_176895	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	Missense_Mutation	SNP	ENST00000307259.8	hg19	CCDS34159.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530184	0.27387	.	.	ENSG00000067113	ENST00000264775;ENST00000307259	T;T	0.74737	-0.87;-0.87	5.58	1.53	0.23141	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.388937	0.31976	N	0.006774	T	0.50565	0.1623	N	0.17723	0.515	0.26385	N	0.97668	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.006	T	0.23261	-1.0193	10	0.10902	T	0.67	-10.4161	5.3051	0.15799	0.0:0.3753:0.2239:0.4009	.	135;136	O14494;G3XA95	LPP1_HUMAN;.	N	136;135	ENSP00000264775:D136N;ENSP00000302229:D135N	ENSP00000264775:D136N	D	-	1	0	PPAP2A	54799542	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	2.492000	0.45311	0.395000	0.25257	0.573000	0.79308	GAT	.	.		0.433	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368073.1		
ANKRD55	79722	hgsc.bcm.edu	37	5	55472050	55472050	+	Silent	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr5:55472050A>G	ENST00000341048.4	-	4	392	c.241T>C	c.(241-243)Ttg>Ctg	p.L81L	ANKRD55_ENST00000504958.2_Silent_p.L81L|ANKRD55_ENST00000513241.2_Silent_p.L52L	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	81										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				CCCATCTTCAACAGCAGCTTC	0.507																																					p.L81L		Atlas-SNP	.											.	ANKRD55	70	.	0			c.T241C						.						180.0	152.0	161.0					5																	55472050		2203	4300	6503	SO:0001819	synonymous_variant	79722	exon4			TCTTCAACAGCAG	AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.241T>C	chr5.hg19:g.55472050A>G		76.0	0.0		100.0	41.0	NM_024669	B3KVT8|Q3KP45|Q9HAD3	Silent	SNP	ENST00000341048.4	hg19	CCDS34161.1																																																																																			.	.		0.507	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368510.4	NM_024669	
ALDH7A1	501	hgsc.bcm.edu	37	5	125896800	125896800	+	Silent	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr5:125896800T>C	ENST00000409134.3	-	10	1107	c.888A>G	c.(886-888)gaA>gaG	p.E296E	ALDH7A1_ENST00000447989.2_Silent_p.E323E|ALDH7A1_ENST00000553117.1_Silent_p.E296E	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	296					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		TTCCTCCAAGTTCCAACAGAC	0.353																																					p.E323E		Atlas-SNP	.											.	ALDH7A1	57	.	0			c.A969G						.						116.0	111.0	113.0					5																	125896800		2203	4300	6503	SO:0001819	synonymous_variant	501	exon10			TCCAAGTTCCAAC	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.888A>G	chr5.hg19:g.125896800T>C		473.0	0.0		505.0	172.0	NM_001202404	B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Silent	SNP	ENST00000409134.3	hg19	CCDS4137.2																																																																																			.	.		0.353	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182	
PRSS16	10279	hgsc.bcm.edu	37	6	27222637	27222637	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr6:27222637T>C	ENST00000230582.3	+	10	1331	c.1316T>C	c.(1315-1317)gTg>gCg	p.V439A	PRSS16_ENST00000377456.2_Intron|PRSS16_ENST00000421826.2_Missense_Mutation_p.V182A	NM_005865.3	NP_005856.1	Q9NQE7	TSSP_HUMAN	protease, serine, 16 (thymus)	439					protein catabolic process (GO:0030163)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|lysosome (GO:0005764)	serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						GCTAACAAAGTGCTGTTTGTT	0.552																																					p.V439A	NSCLC(178;1118 2105 17078 23587 44429)	Atlas-SNP	.											.	PRSS16	66	.	0			c.T1316C						.						90.0	85.0	87.0					6																	27222637		2203	4300	6503	SO:0001583	missense	10279	exon10			ACAAAGTGCTGTT	AF052514	CCDS4623.1	6p21	2010-05-07			ENSG00000112812	ENSG00000112812		"""Serine peptidases / Serine peptidases"""	9480	protein-coding gene	gene with protein product		607169				10527559	Standard	NM_005865		Approved	TSSP	uc003nja.3	Q9NQE7	OTTHUMG00000016167	ENST00000230582.3:c.1316T>C	chr6.hg19:g.27222637T>C	ENSP00000230582:p.Val439Ala	55.0	0.0		181.0	63.0	NM_005865	O75416	Missense_Mutation	SNP	ENST00000230582.3	hg19	CCDS4623.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.616447	0.66672	.	.	ENSG00000112812	ENST00000421826;ENST00000230582	T;T	0.22336	1.96;1.96	4.68	4.68	0.58851	.	0.353251	0.29908	N	0.010891	T	0.39462	0.1079	M	0.88979	2.995	0.34944	D	0.750551	D;P	0.67145	0.996;0.926	D;P	0.66847	0.947;0.56	T	0.52909	-0.8512	10	0.87932	D	0	-25.4079	10.7158	0.46011	0.0:0.0:0.0:1.0	.	182;439	F2Z2N5;Q9NQE7	.;TSSP_HUMAN	A	182;439	ENSP00000404349:V182A;ENSP00000230582:V439A	ENSP00000230582:V439A	V	+	2	0	PRSS16	27330616	0.997000	0.39634	0.622000	0.29159	0.875000	0.50365	3.619000	0.54196	2.106000	0.64143	0.455000	0.32223	GTG	.	.		0.552	PRSS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043418.2		
ATF6B	1388	hgsc.bcm.edu	37	6	32084267	32084267	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr6:32084267C>T	ENST00000375203.3	-	17	1904	c.1872G>A	c.(1870-1872)atG>atA	p.M624I	ATF6B_ENST00000375201.4_Missense_Mutation_p.M621I	NM_001136153.1|NM_004381.4	NP_001129625.1|NP_004372.3	Q99941	ATF6B_HUMAN	activating transcription factor 6 beta	624					response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M624I(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(1)|urinary_tract(1)	22						CATTGGGGGCCATGGCAGGCA	0.632																																					p.M624I		Atlas-SNP	.											ATF6B,NS,carcinoma,0,1	ATF6B	40	.	1	Substitution - Missense(1)	kidney(1)	c.G1872A						.						114.0	92.0	100.0					6																	32084267		2203	4300	6503	SO:0001583	missense	1388	exon17			GGGGGCCATGGCA		CCDS47408.1, CCDS4737.1	6p21.3	2013-01-10	2008-10-21	2008-10-21	ENSG00000213676	ENSG00000213676		"""basic leucine zipper proteins"""	2349	protein-coding gene	gene with protein product		600984	"""cAMP responsive element binding protein-like 1"""	CREBL1		11256944, 14973138	Standard	NM_004381		Approved	G13	uc003nzn.3	Q99941	OTTHUMG00000031296	ENST00000375203.3:c.1872G>A	chr6.hg19:g.32084267C>T	ENSP00000364349:p.Met624Ile	61.0	0.0		175.0	54.0	NM_004381	B0UYX6|Q13269|Q14343|Q14345|Q5SSW7|Q99635|Q99637|Q9H3V9|Q9H3W1|Q9NPL0	Missense_Mutation	SNP	ENST00000375203.3	hg19	CCDS4737.1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.898994	0.52227	.	.	ENSG00000213676	ENST00000375203;ENST00000375201	T;T	0.56611	0.45;1.2	5.45	5.45	0.79879	.	0.000000	0.85682	U	0.000000	T	0.46983	0.1421	N	0.25485	0.75	0.51482	D	0.999929	D;P;D	0.58268	0.982;0.533;0.969	D;B;D	0.68943	0.961;0.186;0.914	T	0.32052	-0.9921	10	0.13853	T	0.58	-14.2841	16.7853	0.85573	0.0:1.0:0.0:0.0	.	621;624;624	Q99941-2;Q99941;Q6AZW6	.;ATF6B_HUMAN;.	I	624;621	ENSP00000364349:M624I;ENSP00000364347:M621I	ENSP00000364347:M621I	M	-	3	0	ATF6B	32192245	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.646000	0.46630	2.574000	0.86865	0.467000	0.42956	ATG	.	.		0.632	ATF6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076638.2		
NOTCH4	4855	hgsc.bcm.edu	37	6	32166274	32166274	+	Silent	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr6:32166274C>A	ENST00000375023.3	-	26	4818	c.4680G>T	c.(4678-4680)gcG>gcT	p.A1560A	NOTCH4_ENST00000443903.2_5'Flank|GPSM3_ENST00000375043.3_5'Flank	NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1560					cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						CCTGAGGGAGCGCCCCACAGC	0.582																																					p.A1560A		Atlas-SNP	.											.	NOTCH4	201	.	0			c.G4680T						.						64.0	54.0	58.0					6																	32166274		1511	2709	4220	SO:0001819	synonymous_variant	4855	exon26			AGGGAGCGCCCCA		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.4680G>T	chr6.hg19:g.32166274C>A		99.0	0.0		176.0	67.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	hg19	CCDS34420.1																																																																																			.	.		0.582	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
ZNF318	24149	hgsc.bcm.edu	37	6	43306248	43306248	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr6:43306248T>G	ENST00000361428.2	-	10	5565	c.5488A>C	c.(5488-5490)Atg>Ctg	p.M1830L	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1830					meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			TTGTCAATCATTAGCAAGTTG	0.413																																					p.M1830L		Atlas-SNP	.											.	ZNF318	175	.	0			c.A5488C						.						152.0	139.0	143.0					6																	43306248		2203	4300	6503	SO:0001583	missense	24149	exon10			CAATCATTAGCAA	AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.5488A>C	chr6.hg19:g.43306248T>G	ENSP00000354964:p.Met1830Leu	136.0	0.0		272.0	61.0	NM_014345	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Missense_Mutation	SNP	ENST00000361428.2	hg19	CCDS4895.2	.	.	.	.	.	.	.	.	.	.	T	7.537	0.659805	0.14645	.	.	ENSG00000171467	ENST00000361428	T	0.11277	2.79	5.3	1.44	0.22558	.	0.595915	0.16372	N	0.217300	T	0.01765	0.0056	N	0.24115	0.695	0.09310	N	0.999993	B	0.12630	0.006	B	0.08055	0.003	T	0.45234	-0.9275	10	0.46703	T	0.11	0.3088	2.6744	0.05077	0.1478:0.0808:0.1544:0.617	.	1830	Q5VUA4	ZN318_HUMAN	L	1830	ENSP00000354964:M1830L	ENSP00000354964:M1830L	M	-	1	0	ZNF318	43414226	0.000000	0.05858	0.017000	0.16124	0.497000	0.33675	-0.005000	0.12855	0.073000	0.16731	0.455000	0.32223	ATG	.	.		0.413	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040601.2	NM_014345	
ZUFSP	221302	hgsc.bcm.edu	37	6	116972883	116972883	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr6:116972883T>A	ENST00000368576.3	-	7	1411	c.1168A>T	c.(1168-1170)Att>Ttt	p.I390F	ZUFSP_ENST00000471919.1_5'Flank	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	390							metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		ATTTTTGGAATGCAAGGAATC	0.368																																					p.I390F		Atlas-SNP	.											.	ZUFSP	46	.	0			c.A1168T						.						64.0	62.0	62.0					6																	116972883		2203	4300	6503	SO:0001583	missense	221302	exon7			TTGGAATGCAAGG	AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.1168A>T	chr6.hg19:g.116972883T>A	ENSP00000357565:p.Ile390Phe	29.0	0.0		51.0	46.0	NM_145062	Q5TD92|Q6PJH7|Q96NV6	Missense_Mutation	SNP	ENST00000368576.3	hg19	CCDS5110.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.725083	0.89298	.	.	ENSG00000153975	ENST00000368576	T	0.42900	0.96	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.66228	0.2768	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.73883	-0.3842	10	0.52906	T	0.07	-17.8576	15.8443	0.78876	0.0:0.0:0.0:1.0	.	390	Q96AP4	ZUFSP_HUMAN	F	390	ENSP00000357565:I390F	ENSP00000357565:I390F	I	-	1	0	ZUFSP	117079576	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	4.601000	0.61090	2.194000	0.70268	0.528000	0.53228	ATT	.	.		0.368	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041961.1	NM_145062	
ZBTB2	57621	hgsc.bcm.edu	37	6	151687721	151687722	+	Missense_Mutation	DNP	CC	CC	TA			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr6:151687721_151687722CC>TA	ENST00000325144.4	-	3	619_620	c.479_480GG>TA	c.(478-480)cGG>cTA	p.R160L		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	160					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		AGGTCTGTGGCCGTGGATCTCG	0.525																																					p.R160R|p.R160L		Atlas-SNP	.											.	ZBTB2	30	.	0			c.G480A|c.G479T						.																																			SO:0001583	missense	57621	exon3			CTGTGGCCGTGGA|TGTGGCCGTGGAT	BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.479_480delinsTA	chr6.hg19:g.151687721_151687722delinsTA	ENSP00000323183:p.Arg160Leu	95.0|96.0	0.0		54.0	46.0	NM_020861	A8K7C7|Q5SZ81|Q9P245	Silent|Missense_Mutation	SNP	ENST00000325144.4	hg19	CCDS5231.1																																																																																			.	.		0.525	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042715.1	NM_020861	
TNRC18	84629	hgsc.bcm.edu	37	7	5352548	5352548	+	Silent	SNP	T	T	G	rs112615228		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr7:5352548T>G	ENST00000430969.1	-	27	8322	c.7974A>C	c.(7972-7974)tcA>tcC	p.S2658S	TNRC18_ENST00000399537.4_Silent_p.S2658S	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2658	Ser-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		aggaggaggatgaggacgagg	0.617																																					p.S2658S		Atlas-SNP	.											.	TNRC18	311	.	0			c.A7974C						.						7.0	7.0	7.0					7																	5352548		1528	3528	5056	SO:0001819	synonymous_variant	84629	exon27			GGAGGATGAGGAC	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7974A>C	chr7.hg19:g.5352548T>G		32.0	0.0		28.0	14.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Silent	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	N	0.011	-1.737644	0.00681	.	.	ENSG00000182095	ENST00000399544	.	.	.	.	.	.	.	.	.	.	.	T	0.63379	0.2506	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.63655	-0.6588	3	0.87932	D	0	.	.	.	.	.	.	.	.	P	1171	.	ENSP00000382459:H1171P	H	-	2	0	TNRC18	5319074	0.757000	0.28394	0.042000	0.18584	0.026000	0.11368	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	CAT	.	T|0.500;A|0.500		0.617	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
TRA2A	29896	hgsc.bcm.edu	37	7	23545860	23545860	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr7:23545860C>G	ENST00000297071.4	-	6	883	c.667G>C	c.(667-669)Ggc>Cgc	p.G223R	TRA2A_ENST00000474586.1_5'Flank|TRA2A_ENST00000538367.1_Missense_Mutation_p.G122R|TRA2A_ENST00000392502.4_Missense_Mutation_p.G122R	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	223	Linker.				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						ccaccgccgccgcctcctcca	0.448																																					p.G223R	Pancreas(121;2137 2973 46590)	Atlas-SNP	.											TRA2A,NS,carcinoma,0,1	TRA2A	29	.	0			c.G667C						.						40.0	40.0	40.0					7																	23545860		2203	4300	6503	SO:0001583	missense	29896	exon6			CGCCGCCGCCTCC	U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.667G>C	chr7.hg19:g.23545860C>G	ENSP00000297071:p.Gly223Arg	76.0	0.0		116.0	40.0	NM_013293	B4DUA9	Missense_Mutation	SNP	ENST00000297071.4	hg19	CCDS5383.1	.	.	.	.	.	.	.	.	.	.	C	12.48	1.951265	0.34471	.	.	ENSG00000164548	ENST00000297071;ENST00000392502;ENST00000538367	T;T;T	0.75050	-0.9;-0.9;-0.9	5.33	5.33	0.75918	.	0.289069	0.37095	N	0.002242	T	0.75568	0.3867	N	0.17474	0.49	0.80722	D	1	D	0.71674	0.998	D	0.71656	0.974	T	0.71384	-0.4609	10	0.15952	T	0.53	-4.9705	18.6991	0.91614	0.0:1.0:0.0:0.0	.	223	Q13595	TRA2A_HUMAN	R	223;122;122	ENSP00000297071:G223R;ENSP00000376290:G122R;ENSP00000441116:G122R	ENSP00000297071:G223R	G	-	1	0	TRA2A	23512385	0.964000	0.33143	0.502000	0.27614	0.046000	0.14306	2.321000	0.43805	2.499000	0.84300	0.585000	0.79938	GGC	.	.		0.448	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250257.1	NM_013293	
BLVRA	644	hgsc.bcm.edu	37	7	43846653	43846653	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr7:43846653C>G	ENST00000402924.1	+	9	873	c.710C>G	c.(709-711)tCc>tGc	p.S237C	BLVRA_ENST00000265523.4_Missense_Mutation_p.S237C	NM_001253823.1	NP_001240752.1	P53004	BIEA_HUMAN	biliverdin reductase A	237					heme catabolic process (GO:0042167)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	biliverdin reductase activity (GO:0004074)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(2)	12						AAGTCTGGGTCCTTGGAGAAT	0.378																																					p.S237C		Atlas-SNP	.											.	BLVRA	26	.	0			c.C710G						.						63.0	62.0	62.0					7																	43846653		2203	4300	6503	SO:0001583	missense	644	exon9			CTGGGTCCTTGGA	BC008456	CCDS5472.1	7p13	2012-10-02			ENSG00000106605	ENSG00000106605	1.3.1.24		1062	protein-coding gene	gene with protein product		109750		BLVR			Standard	NM_001253823		Approved		uc003tir.3	P53004	OTTHUMG00000128953	ENST00000402924.1:c.710C>G	chr7.hg19:g.43846653C>G	ENSP00000385757:p.Ser237Cys	56.0	0.0		72.0	26.0	NM_001253823	A8K747|O95019|Q86UX0|Q96QL4|Q9BRW8	Missense_Mutation	SNP	ENST00000402924.1	hg19	CCDS5472.1	.	.	.	.	.	.	.	.	.	.	C	9.002	0.980396	0.18812	.	.	ENSG00000106605	ENST00000265523;ENST00000402924	T;T	0.24350	1.86;1.86	4.25	3.29	0.37713	Biliverdin reductase, catalytic (2);	0.405752	0.28847	N	0.013951	T	0.14442	0.0349	N	0.24115	0.695	0.24634	N	0.9936	B	0.11235	0.004	B	0.08055	0.003	T	0.07849	-1.0751	10	0.45353	T	0.12	.	5.3361	0.15959	0.0:0.6038:0.2765:0.1197	.	237	P53004	BIEA_HUMAN	C	237	ENSP00000265523:S237C;ENSP00000385757:S237C	ENSP00000265523:S237C	S	+	2	0	BLVRA	43813178	0.309000	0.24518	0.998000	0.56505	0.985000	0.73830	1.394000	0.34509	2.076000	0.62316	0.462000	0.41574	TCC	.	.		0.378	BLVRA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339006.1	NM_000712	
ZNF716	441234	hgsc.bcm.edu	37	7	57529339	57529339	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr7:57529339T>A	ENST00000420713.1	+	4	1284	c.1172T>A	c.(1171-1173)tTa>tAa	p.L391*		NM_001159279.1	NP_001152751.1	A6NP11	ZN716_HUMAN	zinc finger protein 716	391					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|lung(20)|ovary(2)	24						GCCTTTAGCTTACCCTCAACC	0.428																																					p.L391X		Atlas-SNP	.											.	ZNF716	207	.	0			c.T1172A						.						41.0	40.0	41.0					7																	57529339		692	1591	2283	SO:0001587	stop_gained	441234	exon4			TTAGCTTACCCTC	AK131575	CCDS55112.1	7p11.1	2013-01-08			ENSG00000182111	ENSG00000182111		"""Zinc fingers, C2H2-type"", ""-"""	32458	protein-coding gene	gene with protein product							Standard	NM_001159279		Approved	FLJ46189	uc011kdi.1	A6NP11	OTTHUMG00000156689	ENST00000420713.1:c.1172T>A	chr7.hg19:g.57529339T>A	ENSP00000394248:p.Leu391*	78.0	0.0		73.0	33.0	NM_001159279		Nonsense_Mutation	SNP	ENST00000420713.1	hg19	CCDS55112.1	.	.	.	.	.	.	.	.	.	.	T	10.73	1.432343	0.25813	.	.	ENSG00000182111	ENST00000420713;ENST00000418732	.	.	.	0.195	-0.39	0.12450	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	2.9185	0.05761	0.2385:0.0:0.4737:0.2877	.	.	.	.	X	391;379	.	ENSP00000387687:L379X	L	+	2	0	ZNF716	57533281	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.090000	0.03372	-3.452000	0.00160	-3.579000	0.00029	TTA	.	.		0.428	ZNF716-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345309.1	NM_001159279	
COL1A2	1278	hgsc.bcm.edu	37	7	94027070	94027070	+	Splice_Site	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr7:94027070G>A	ENST00000297268.6	+	2	552	c.81G>A	c.(79-81)gaG>gaA	p.E27E		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	27					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	CTTTACAAGAGGTGAGTAAAA	0.284										HNSCC(75;0.22)																											p.E27E		Atlas-SNP	.											.	COL1A2	240	.	0			c.G81A						.						31.0	33.0	32.0					7																	94027070		2111	4194	6305	SO:0001630	splice_region_variant	1278	exon2			ACAAGAGGTGAGT	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.81+1G>A	chr7.hg19:g.94027070G>A		148.0	0.0		301.0	83.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	hg19	CCDS34682.1																																																																																			.	.		0.284	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	Silent
PPP1R3A	5506	hgsc.bcm.edu	37	7	113558467	113558467	+	Silent	SNP	A	A	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr7:113558467A>T	ENST00000284601.3	-	1	653	c.585T>A	c.(583-585)gtT>gtA	p.V195V		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	195	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GATAAGGAGGAACCAATACAA	0.333																																					p.V195V		Atlas-SNP	.											.	PPP1R3A	317	.	0			c.T585A						.						100.0	94.0	96.0					7																	113558467		2203	4299	6502	SO:0001819	synonymous_variant	5506	exon1			AGGAGGAACCAAT	AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.585T>A	chr7.hg19:g.113558467A>T		75.0	0.0		126.0	39.0	NM_002711	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	ENST00000284601.3	hg19	CCDS5759.1																																																																																			.	.		0.333	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346724.1	NM_002711	
PLXNA4	91584	hgsc.bcm.edu	37	7	131829964	131829964	+	Silent	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr7:131829964G>T	ENST00000359827.3	-	29	6101	c.5139C>A	c.(5137-5139)atC>atA	p.I1713I	PLXNA4_ENST00000321063.4_Silent_p.I1713I			Q9HCM2	PLXA4_HUMAN	plexin A4	1713					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						ACATGTACTTGATGGCCAGGG	0.547																																					p.I1713I		Atlas-SNP	.											.	PLXNA4	873	.	0			c.C5139A						.						102.0	101.0	102.0					7																	131829964		2203	4300	6503	SO:0001819	synonymous_variant	91584	exon29			GTACTTGATGGCC	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.5139C>A	chr7.hg19:g.131829964G>T		136.0	0.0		195.0	44.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	ENST00000359827.3	hg19	CCDS43646.1																																																																																			.	.		0.547	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
TTI2	80185	hgsc.bcm.edu	37	8	33361419	33361419	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr8:33361419A>T	ENST00000431156.2	-	5	1580	c.962T>A	c.(961-963)aTc>aAc	p.I321N	TTI2_ENST00000360742.5_Missense_Mutation_p.I321N|TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000520636.1_Missense_Mutation_p.I290N	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	321																	TTTCTCCAGGATGGGGAATAA	0.522																																					p.I321N		Atlas-SNP	.											.	.	.	.	0			c.T962A						.						76.0	69.0	72.0					8																	33361419		2203	4300	6503	SO:0001583	missense	80185	exon5			TCCAGGATGGGGA	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.962T>A	chr8.hg19:g.33361419A>T	ENSP00000411169:p.Ile321Asn	87.0	0.0		47.0	39.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	A	17.21	3.332123	0.60853	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636	T;T;T	0.77229	-1.08;-1.08;-1.08	5.78	4.62	0.57501	.	0.726885	0.12391	N	0.473009	D	0.83487	0.5265	L	0.54323	1.7	0.80722	D	1	D;D	0.65815	0.995;0.989	P;P	0.60541	0.876;0.691	T	0.80924	-0.1165	10	0.87932	D	0	-2.6669	11.5253	0.50576	0.9295:0.0:0.0705:0.0	.	321;290	Q6NXR4;E5RIH5	TTI2_HUMAN;.	N	321;321;321;290	ENSP00000353971:I321N;ENSP00000411169:I321N;ENSP00000428401:I290N	ENSP00000353971:I321N	I	-	2	0	C8orf41	33480961	1.000000	0.71417	0.563000	0.28383	0.250000	0.25880	7.703000	0.84585	1.018000	0.39521	0.528000	0.53228	ATC	.	.		0.522	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
C8orf86	389649	hgsc.bcm.edu	37	8	38386043	38386043	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr8:38386043T>C	ENST00000358138.1	-	1	137	c.113A>G	c.(112-114)gAg>gGg	p.E38G	C8orf86_ENST00000437935.2_Missense_Mutation_p.E38G	NM_207412.1	NP_997295.1	Q6ZUL3	CH086_HUMAN	chromosome 8 open reading frame 86	38										breast(1)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	5						GCTCCCAAGCTCCTCAGCCAG	0.537																																					p.E38G		Atlas-SNP	.											.	C8orf86	17	.	0			c.A113G						.						124.0	109.0	114.0					8																	38386043		2203	4300	6503	SO:0001583	missense	389649	exon1			CCAAGCTCCTCAG	BC137511	CCDS6108.1	8p12-p11.23	2009-03-03			ENSG00000196166	ENSG00000196166			33774	protein-coding gene	gene with protein product							Standard	NM_207412		Approved	FLJ43582	uc003xlx.1	Q6ZUL3	OTTHUMG00000163992	ENST00000358138.1:c.113A>G	chr8.hg19:g.38386043T>C	ENSP00000350856:p.Glu38Gly	74.0	0.0		47.0	32.0	NM_207412	A4QPB7	Missense_Mutation	SNP	ENST00000358138.1	hg19	CCDS6108.1	.	.	.	.	.	.	.	.	.	.	T	6.908	0.537031	0.13188	.	.	ENSG00000196166	ENST00000358138;ENST00000437935	T;T	0.56275	0.52;0.47	4.81	-0.392	0.12442	.	.	.	.	.	T	0.27731	0.0682	N	0.08118	0	0.09310	N	1	B	0.20550	0.046	B	0.18871	0.023	T	0.19516	-1.0303	9	0.87932	D	0	.	4.1761	0.10353	0.0:0.2906:0.1737:0.5357	.	38	Q6ZUL3	CH086_HUMAN	G	38	ENSP00000350856:E38G;ENSP00000389615:E38G	ENSP00000350856:E38G	E	-	2	0	C8orf86	38505200	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	0.034000	0.13776	-0.127000	0.11661	-0.290000	0.09829	GAG	.	.		0.537	C8orf86-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000376668.1	NM_207412	
ZNF7	7553	hgsc.bcm.edu	37	8	146067786	146067786	+	Nonsense_Mutation	SNP	C	C	T	rs370205689		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr8:146067786C>T	ENST00000528372.1	+	5	1534	c.1294C>T	c.(1294-1296)Cag>Tag	p.Q432*	ZNF7_ENST00000525266.1_Intron|ZNF7_ENST00000544249.1_Nonsense_Mutation_p.Q336*|ZNF7_ENST00000446747.2_Nonsense_Mutation_p.Q443*|ZNF7_ENST00000325241.6_Nonsense_Mutation_p.Q432*|ZNF7_ENST00000325217.5_Intron			P17097	ZNF7_HUMAN	zinc finger protein 7	432					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(7)|lung(6)|ovary(5)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)		GAGTCAGCATCAGCTGATTCA	0.448																																					p.Q432X		Atlas-SNP	.											.	ZNF7	62	.	0			c.C1294T						.						70.0	74.0	73.0					8																	146067786		2203	4299	6502	SO:0001587	stop_gained	7553	exon5			CAGCATCAGCTGA	AB209619	CCDS6435.1, CCDS64996.1, CCDS64998.1, CCDS64999.1	8q24	2013-01-08	2006-05-09		ENSG00000147789	ENSG00000147789		"""Zinc fingers, C2H2-type"", ""-"""	13139	protein-coding gene	gene with protein product		194531	"""zinc finger protein 7 (KOX 4, clone HF.16)"""			2106481, 1946370	Standard	NM_003416		Approved	KOX4, HF.16	uc003zeg.4	P17097	OTTHUMG00000165200	ENST00000528372.1:c.1294C>T	chr8.hg19:g.146067786C>T	ENSP00000432724:p.Gln432*	36.0	0.0		59.0	20.0	NM_003416	B4DT08|D3DWN6|P17015|Q8N8Y4	Nonsense_Mutation	SNP	ENST00000528372.1	hg19	CCDS6435.1	.	.	.	.	.	.	.	.	.	.	C	36	5.917306	0.97105	.	.	ENSG00000147789	ENST00000325241;ENST00000446747;ENST00000544249;ENST00000528372	.	.	.	4.9	4.9	0.64082	.	0.000000	0.44483	D	0.000457	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.5174	17.0043	0.86388	0.0:1.0:0.0:0.0	.	.	.	.	X	432;443;336;432	.	.	Q	+	1	0	ZNF7	146038590	0.006000	0.16342	0.382000	0.26119	0.968000	0.65278	1.568000	0.36418	2.553000	0.86117	0.561000	0.74099	CAG	.	.		0.448	ZNF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382660.1	NM_003416	
SLC1A1	6505	hgsc.bcm.edu	37	9	4544613	4544613	+	Silent	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr9:4544613T>C	ENST00000262352.3	+	2	374	c.138T>C	c.(136-138)acT>acC	p.T46T		NM_004170.5	NP_004161.4	P43005	EAA3_HUMAN	solute carrier family 1 (neuronal/epithelial high affinity glutamate transporter, system Xag), member 1	46					D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate binding (GO:0016595)|glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|pancreas(1)|skin(1)	15		Acute lymphoblastic leukemia(2;0.0359)|Breast(48;0.0457)		GBM - Glioblastoma multiforme(50;0.0124)|Lung(218;0.183)	L-Aspartic Acid(DB00128)|Pregabalin(DB00230)	ACCTCTCAACTCTAGAGAAAT	0.398																																					p.T46T		Atlas-SNP	.											SLC1A1,caecum,carcinoma,0,1	SLC1A1	43	.	0			c.T138C						.						150.0	148.0	149.0					9																	4544613		2203	4300	6503	SO:0001819	synonymous_variant	6505	exon2			CTCAACTCTAGAG		CCDS6452.1	9p24	2013-05-22			ENSG00000106688	ENSG00000106688		"""Solute carriers"""	10939	protein-coding gene	gene with protein product		133550				8020993	Standard	NM_004170		Approved	EAAC1, EAAT3	uc003zij.2	P43005	OTTHUMG00000019468	ENST00000262352.3:c.138T>C	chr9.hg19:g.4544613T>C		137.0	0.0		204.0	51.0	NM_004170	O75587|Q5VZ24|Q8N199|Q9UEW2	Silent	SNP	ENST00000262352.3	hg19	CCDS6452.1																																																																																			.	.		0.398	SLC1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051571.1		
KDM4C	23081	hgsc.bcm.edu	37	9	7103697	7103698	+	Missense_Mutation	DNP	TG	TG	GA			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr9:7103697_7103698TG>GA	ENST00000381309.3	+	18	3002_3003	c.2437_2438TG>GA	c.(2437-2439)TGc>GAc	p.C813D	KDM4C_ENST00000536108.1_Missense_Mutation_p.A596T|KDM4C_ENST00000442236.2_Missense_Mutation_p.C558D|KDM4C_ENST00000381306.3_Missense_Mutation_p.C813D|KDM4C_ENST00000428870.2_Missense_Mutation_p.C500D	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	813					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						ATGCATCTTCTGCAGACACCGG	0.49																																					p.C813G|p.C813Y		Atlas-SNP	.											.	KDM4C	186	.	0			c.T2437G|c.G2438A						.																																			SO:0001583	missense	23081	exon18			ATCTTCTGCAGAC|TCTTCTGCAGACA	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	Exception_encountered	chr9.hg19:g.7103697_7103698delinsGA	ENSP00000370710:p.Cys813Asp	63.0|60.0	0.0		106.0|105.0	15.0|14.0	NM_001146694	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	hg19	CCDS6471.1																																																																																			.	.		0.490	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
KLHL9	55958	hgsc.bcm.edu	37	9	21334479	21334479	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr9:21334479T>C	ENST00000359039.4	-	1	900	c.380A>G	c.(379-381)gAa>gGa	p.E127G	KLHL9_ENST00000537938.1_Missense_Mutation_p.E59G			Q9P2J3	KLHL9_HUMAN	kelch-like family member 9	127					cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|midbody (GO:0030496)				endometrium(9)|large_intestine(7)|lung(10)|ovary(4)|skin(2)	32				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		GCTAGCAGCTTCAAGTGTGTC	0.348																																					p.E127G		Atlas-SNP	.											.	KLHL9	61	.	0			c.A380G						.						51.0	56.0	54.0					9																	21334479		2203	4300	6503	SO:0001583	missense	55958	exon1			GCAGCTTCAAGTG	AB037775	CCDS6503.1	9p22	2013-01-30	2013-01-30		ENSG00000198642	ENSG00000198642		"""Kelch-like"", ""BTB/POZ domain containing"""	18732	protein-coding gene	gene with protein product		611201	"""kelch-like 9 (Drosophila)"""				Standard	NM_018847		Approved	KIAA1354, FLJ13568	uc003zoy.3	Q9P2J3	OTTHUMG00000019669	ENST00000359039.4:c.380A>G	chr9.hg19:g.21334479T>C	ENSP00000351933:p.Glu127Gly	107.0	0.0		116.0	46.0	NM_018847	Q8TCQ2	Missense_Mutation	SNP	ENST00000359039.4	hg19	CCDS6503.1	.	.	.	.	.	.	.	.	.	.	T	10.85	1.467979	0.26335	.	.	ENSG00000198642	ENST00000359039;ENST00000537938	T;T	0.69175	-0.38;-0.38	5.22	5.22	0.72569	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.73705	0.3621	M	0.70787	2.145	0.80722	D	1	P	0.34909	0.475	P	0.47251	0.542	T	0.71869	-0.4462	10	0.31617	T	0.26	.	13.3655	0.60680	0.0:0.0:0.0:1.0	.	127	Q9P2J3	KLHL9_HUMAN	G	127;59	ENSP00000351933:E127G;ENSP00000437733:E59G	ENSP00000351933:E127G	E	-	2	0	KLHL9	21324479	1.000000	0.71417	0.997000	0.53966	0.949000	0.60115	7.959000	0.87885	2.114000	0.64651	0.533000	0.62120	GAA	.	.		0.348	KLHL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051898.2	NM_018847	
ZBTB5	9925	hgsc.bcm.edu	37	9	37440805	37440805	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr9:37440805G>T	ENST00000307750.4	-	2	1932	c.1744C>A	c.(1744-1746)Cca>Aca	p.P582T		NM_014872.2	NP_055687.1	O15062	ZBTB5_HUMAN	zinc finger and BTB domain containing 5	582					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	8				GBM - Glioblastoma multiforme(29;0.00733)|Lung(182;0.226)		GTCAACTGTGGAGGGCCAGGC	0.498																																					p.P582T		Atlas-SNP	.											.	ZBTB5	43	.	0			c.C1744A						.						73.0	70.0	71.0					9																	37440805		2203	4300	6503	SO:0001583	missense	9925	exon2			ACTGTGGAGGGCC	AB002352	CCDS6610.1	9p13.1	2013-01-09			ENSG00000168795	ENSG00000168795		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23836	protein-coding gene	gene with protein product						9205841	Standard	NM_014872		Approved	KIAA0354	uc003zzx.3	O15062	OTTHUMG00000019918	ENST00000307750.4:c.1744C>A	chr9.hg19:g.37440805G>T	ENSP00000307604:p.Pro582Thr	70.0	0.0		71.0	36.0	NM_014872		Missense_Mutation	SNP	ENST00000307750.4	hg19	CCDS6610.1	.	.	.	.	.	.	.	.	.	.	G	17.50	3.406198	0.62288	.	.	ENSG00000168795	ENST00000307750	T	0.10860	2.83	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.19565	0.0470	L	0.27053	0.805	0.80722	D	1	D	0.59357	0.985	D	0.66196	0.942	T	0.06110	-1.0845	10	0.14252	T	0.57	.	18.8456	0.92205	0.0:0.0:1.0:0.0	.	582	O15062	ZBTB5_HUMAN	T	582	ENSP00000307604:P582T	ENSP00000307604:P582T	P	-	1	0	ZBTB5	37430805	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	9.137000	0.94496	2.785000	0.95823	0.655000	0.94253	CCA	.	.		0.498	ZBTB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052462.1	NM_014872	
PSMB7	5695	hgsc.bcm.edu	37	9	127174695	127174695	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr9:127174695G>C	ENST00000259457.3	-	4	344	c.331C>G	c.(331-333)Ctc>Gtc	p.L111V	PSMB7_ENST00000498485.1_5'UTR|PSMB7_ENST00000536392.1_Missense_Mutation_p.L111V	NM_002799.3	NP_002790.1	Q99436	PSB7_HUMAN	proteasome (prosome, macropain) subunit, beta type, 7	111					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	threonine-type endopeptidase activity (GO:0004298)			breast(1)|endometrium(1)|kidney(1)|lung(1)|pancreas(1)	5						CCAGTGGAGAGGGAGTGGAGC	0.478																																					p.L111V		Atlas-SNP	.											.	PSMB7	11	.	0			c.C331G						.						160.0	163.0	162.0					9																	127174695		2203	4300	6503	SO:0001583	missense	5695	exon4			TGGAGAGGGAGTG	AJ420455	CCDS6855.1	9q34.11-q34.12	2008-02-05			ENSG00000136930	ENSG00000136930		"""Proteasome (prosome, macropain) subunits"""	9544	protein-coding gene	gene with protein product		604030				8811196	Standard	NM_002799		Approved	Z	uc004boj.4	Q99436	OTTHUMG00000021042	ENST00000259457.3:c.331C>G	chr9.hg19:g.127174695G>C	ENSP00000259457:p.Leu111Val	85.0	0.0		109.0	54.0	NM_002799	B4E0P1|Q5TBG6|Q96AG8|Q9BWA7	Missense_Mutation	SNP	ENST00000259457.3	hg19	CCDS6855.1	.	.	.	.	.	.	.	.	.	.	G	31	5.069081	0.93950	.	.	ENSG00000136930	ENST00000259457;ENST00000536392;ENST00000441097	T;T;T	0.26373	1.74;1.74;1.74	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.49779	0.1577	M	0.84433	2.695	0.80722	D	1	P;P	0.38745	0.645;0.526	P;B	0.50537	0.643;0.431	T	0.54262	-0.8320	10	0.59425	D	0.04	-11.6855	17.5569	0.87894	0.0:0.0:1.0:0.0	.	111;111	B4E0P1;Q99436	.;PSB7_HUMAN	V	111	ENSP00000259457:L111V;ENSP00000440247:L111V;ENSP00000393157:L111V	ENSP00000259457:L111V	L	-	1	0	PSMB7	126214516	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	5.506000	0.66993	2.688000	0.91661	0.655000	0.94253	CTC	.	.		0.478	PSMB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055525.1	NM_002799	
ZBTB43	23099	hgsc.bcm.edu	37	9	129595723	129595723	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr9:129595723A>T	ENST00000373464.4	+	3	1199	c.935A>T	c.(934-936)gAt>gTt	p.D312V	ZBTB43_ENST00000373457.1_Missense_Mutation_p.D312V|ZBTB43_ENST00000449886.1_Missense_Mutation_p.D312V	NM_014007.3	NP_054726.1	O43298	ZBT43_HUMAN	zinc finger and BTB domain containing 43	312					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						AGCAATTATGATGAGCAGGTG	0.522																																					p.D312V		Atlas-SNP	.											.	ZBTB43	25	.	0			c.A935T						.						71.0	74.0	73.0					9																	129595723		2203	4300	6503	SO:0001583	missense	23099	exon2			ATTATGATGAGCA	AF049907	CCDS6867.1	9q33.3	2013-01-09	2006-04-12	2006-04-12	ENSG00000169155	ENSG00000169155		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	17908	protein-coding gene	gene with protein product			"""zinc finger protein 297B"""	ZNF297B			Standard	NM_014007		Approved	KIAA0414, ZNF-X, FLJ22470, ZBTB22B	uc010mxf.3	O43298	OTTHUMG00000020693	ENST00000373464.4:c.935A>T	chr9.hg19:g.129595723A>T	ENSP00000362563:p.Asp312Val	51.0	0.0		56.0	18.0	NM_001135776	Q5JU96	Missense_Mutation	SNP	ENST00000373464.4	hg19	CCDS6867.1	.	.	.	.	.	.	.	.	.	.	A	9.432	1.085873	0.20390	.	.	ENSG00000169155	ENST00000449886;ENST00000373464;ENST00000373457	T;T;T	0.11063	2.81;2.81;2.81	5.51	4.35	0.52113	.	0.058394	0.64402	D	0.000003	T	0.08358	0.0208	L	0.27053	0.805	0.51482	D	0.999929	B	0.28933	0.228	B	0.27608	0.081	T	0.27191	-1.0081	10	0.30078	T	0.28	.	12.1389	0.53986	0.8715:0.0:0.0:0.1285	.	312	O43298	ZBT43_HUMAN	V	312	ENSP00000390344:D312V;ENSP00000362563:D312V;ENSP00000362556:D312V	ENSP00000362556:D312V	D	+	2	0	ZBTB43	128635544	1.000000	0.71417	0.403000	0.26384	0.845000	0.48019	7.082000	0.76851	1.004000	0.39156	0.379000	0.24179	GAT	.	.		0.522	ZBTB43-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054124.1	NM_001135776	
ASS1	445	hgsc.bcm.edu	37	9	133327679	133327679	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr9:133327679G>T	ENST00000372394.1	+	3	545	c.64G>T	c.(64-66)Gtg>Ttg	p.V22L	snoU13_ENST00000458976.1_RNA|ASS1_ENST00000372393.3_Missense_Mutation_p.V22L|ASS1_ENST00000352480.5_Missense_Mutation_p.V22L			P00966	ASSY_HUMAN	argininosuccinate synthase 1	22					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GTGCATCCTCGTGTGGCTGAA	0.597																																					p.V22L		Atlas-SNP	.											.	ASS1	37	.	0			c.G64T						.						142.0	124.0	130.0					9																	133327679		2203	4300	6503	SO:0001583	missense	445	exon2			ATCCTCGTGTGGC	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.64G>T	chr9.hg19:g.133327679G>T	ENSP00000361471:p.Val22Leu	68.0	0.0		53.0	26.0	NM_054012	Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	ENST00000372394.1	hg19	CCDS6933.1	.	.	.	.	.	.	.	.	.	.	G	14.21	2.468813	0.43839	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393;ENST00000422569;ENST00000443588	D;D;D;D;D	0.94613	-3.47;-3.47;-3.47;-3.47;-3.47	4.95	4.04	0.47022	Rossmann-like alpha/beta/alpha sandwich fold (1);	0.000000	0.64402	U	0.000004	D	0.92110	0.7499	L	0.52206	1.635	0.58432	D	0.999996	B;B;B	0.14012	0.004;0.009;0.009	B;B;B	0.16289	0.01;0.015;0.015	D	0.89284	0.3614	10	0.66056	D	0.02	.	14.6152	0.68544	0.0:0.1467:0.8533:0.0	.	22;22;22	A8KAP9;Q5T6L4;P00966	.;.;ASSY_HUMAN	L	22	ENSP00000253004:V22L;ENSP00000361471:V22L;ENSP00000361469:V22L;ENSP00000394212:V22L;ENSP00000397785:V22L	ENSP00000361470:V22L	V	+	1	0	ASS1	132317500	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	7.162000	0.77515	1.170000	0.42753	0.462000	0.41574	GTG	.	.		0.597	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	NM_000050	
USP54	159195	hgsc.bcm.edu	37	10	75276369	75276369	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr10:75276369G>C	ENST00000339859.4	-	19	3915	c.3815C>G	c.(3814-3816)tCt>tGt	p.S1272C	USP54_ENST00000428547.1_Missense_Mutation_p.S1122C|RP11-137L10.6_ENST00000595069.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|USP54_ENST00000497106.1_5'UTR|RP11-137L10.6_ENST00000593790.1_RNA|USP54_ENST00000422491.2_Missense_Mutation_p.S454C|USP54_ENST00000408019.1_Missense_Mutation_p.S1272C|RP11-137L10.6_ENST00000597958.1_RNA|USP54_ENST00000394811.2_Missense_Mutation_p.S360C			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1272					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					CTTAAGCTGAGAATCACAGAA	0.478																																					p.S1272C	Colon(195;880 2046 8854 25025 38456)	Atlas-SNP	.											.	USP54	178	.	0			c.C3815G						.						99.0	101.0	101.0					10																	75276369		2203	4300	6503	SO:0001583	missense	159195	exon18			AGCTGAGAATCAC	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.3815C>G	chr10.hg19:g.75276369G>C	ENSP00000345216:p.Ser1272Cys	57.0	0.0		70.0	24.0	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Missense_Mutation	SNP	ENST00000339859.4	hg19	CCDS7329.2	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491503	0.44249	.	.	ENSG00000166348	ENST00000339859;ENST00000408019;ENST00000428547;ENST00000394811;ENST00000422491	T;T;T;T;T	0.33654	1.57;1.57;1.54;1.4;1.44	6.03	5.12	0.69794	.	.	.	.	.	T	0.44829	0.1312	L	0.34521	1.04	0.80722	D	1	D;D	0.89917	1.0;0.997	D;P	0.68943	0.961;0.819	T	0.32929	-0.9888	9	0.39692	T	0.17	-9.0972	10.2685	0.43468	0.0676:0.0:0.7979:0.1346	.	454;1272	E7EW90;Q70EL1	.;UBP54_HUMAN	C	1272;1272;1122;360;454	ENSP00000345216:S1272C;ENSP00000386080:S1272C;ENSP00000408714:S1122C;ENSP00000378290:S360C;ENSP00000407368:S454C	ENSP00000345216:S1272C	S	-	2	0	USP54	74946375	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	4.943000	0.63554	1.560000	0.49568	-0.150000	0.13652	TCT	.	.		0.478	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
WNT8B	7479	hgsc.bcm.edu	37	10	102239757	102239757	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr10:102239757G>A	ENST00000343737.5	+	3	357	c.229G>A	c.(229-231)Ggg>Agg	p.G77R		NM_003393.3	NP_003384.2	Q93098	WNT8B_HUMAN	wingless-type MMTV integration site family, member 8B	77					cell fate commitment (GO:0045165)|cellular response to retinoic acid (GO:0071300)|determination of dorsal identity (GO:0048263)|gastrulation (GO:0007369)|negative regulation of gene expression (GO:0010629)|nervous system development (GO:0007399)|neuron differentiation (GO:0030182)|positive regulation of gene expression (GO:0010628)|response to estradiol (GO:0032355)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4		Colorectal(252;0.117)		Epithelial(162;1.87e-10)|all cancers(201;1.64e-08)		CAGCCATGGTGGGCTTCGCAG	0.587																																					p.G77R		Atlas-SNP	.											.	WNT8B	31	.	0			c.G229A						.						54.0	49.0	51.0					10																	102239757		2203	4300	6503	SO:0001583	missense	7479	exon3			CATGGTGGGCTTC	X91940	CCDS7494.1	10q24	2003-11-12			ENSG00000075290	ENSG00000075290		"""Wingless-type MMTV integration sites"""	12789	protein-coding gene	gene with protein product		601396				8661156	Standard	NM_003393		Approved		uc001krb.3	Q93098	OTTHUMG00000018912	ENST00000343737.5:c.229G>A	chr10.hg19:g.102239757G>A	ENSP00000340677:p.Gly77Arg	41.0	0.0		36.0	16.0	NM_003393	O00771|Q5VX55|Q8WYK9	Missense_Mutation	SNP	ENST00000343737.5	hg19	CCDS7494.1	.	.	.	.	.	.	.	.	.	.	G	11.35	1.612903	0.28712	.	.	ENSG00000075290	ENST00000343737	T	0.75367	-0.93	5.7	5.7	0.88788	.	1.622190	0.03427	N	0.207152	T	0.64516	0.2605	N	0.10733	0.035	0.50467	D	0.999878	B	0.14805	0.011	B	0.20577	0.03	T	0.13764	-1.0497	10	0.12103	T	0.63	.	19.8354	0.96655	0.0:0.0:1.0:0.0	.	77	Q93098	WNT8B_HUMAN	R	77	ENSP00000340677:G77R	ENSP00000340677:G77R	G	+	1	0	WNT8B	102229747	1.000000	0.71417	0.969000	0.41365	0.762000	0.43233	6.062000	0.71155	2.686000	0.91538	0.555000	0.69702	GGG	.	.		0.587	WNT8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049867.1	NM_003393	
SPI1	6688	hgsc.bcm.edu	37	11	47381480	47381480	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr11:47381480T>C	ENST00000378538.3	-	3	476	c.254A>G	c.(253-255)tAc>tGc	p.Y85C	SPI1_ENST00000227163.4_Missense_Mutation_p.Y86C|SPI1_ENST00000533030.1_Intron|SPI1_ENST00000533968.1_Missense_Mutation_p.Y85C	NM_001080547.1|NM_003120.2	NP_001074016.1|NP_003111.2	P17947	SPI1_HUMAN	Spi-1 proto-oncogene	85					anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|histone H3 acetylation (GO:0043966)|hypermethylation of CpG island (GO:0044027)|lymphocyte differentiation (GO:0030098)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of erythrocyte differentiation (GO:0045646)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somatic stem cell maintenance (GO:0035019)	nuclear chromatin (GO:0000790)	core promoter binding (GO:0001047)|NFAT protein binding (GO:0051525)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(4)|ovary(1)	8				Lung(87;0.0967)		CATGTGGCGGTAGAGCTGCTG	0.652																																					p.Y86C		Atlas-SNP	.											.	SPI1	21	.	0			c.A257G						.						55.0	47.0	50.0					11																	47381480		2200	4297	6497	SO:0001583	missense	6688	exon3			TGGCGGTAGAGCT	X52056	CCDS7933.2, CCDS44591.1	11p12-p11.22	2014-06-25	2014-06-25		ENSG00000066336	ENSG00000066336			11241	protein-coding gene	gene with protein product	"""hematopoietic transcription factor PU.1"", ""31 kDa transforming protein"""	165170	"""spleen focus forming virus (SFFV) proviral integration oncogene"""			1693183	Standard	NM_003120		Approved	PU.1, SPI-A, OF, SFPI1, SPI-1	uc001nfb.1	P17947	OTTHUMG00000150150	ENST00000378538.3:c.254A>G	chr11.hg19:g.47381480T>C	ENSP00000367799:p.Tyr85Cys	25.0	0.0		28.0	11.0	NM_001080547		Missense_Mutation	SNP	ENST00000378538.3	hg19	CCDS7933.2	.	.	.	.	.	.	.	.	.	.	T	17.58	3.424117	0.62733	.	.	ENSG00000066336	ENST00000378538;ENST00000227163;ENST00000533968	T;T;T	0.32515	1.45;1.45;1.45	3.59	3.59	0.41128	.	0.502444	0.20700	N	0.087289	T	0.52709	0.1751	M	0.73962	2.25	0.44024	D	0.996741	D;D;D	0.89917	1.0;0.977;0.991	D;P;P	0.69479	0.964;0.764;0.849	T	0.58470	-0.7631	10	0.72032	D	0.01	-22.9164	12.6475	0.56744	0.0:0.0:0.0:1.0	.	85;85;86	F5H3K6;P17947;P17947-2	.;SPI1_HUMAN;.	C	85;86;85	ENSP00000367799:Y85C;ENSP00000227163:Y86C;ENSP00000438846:Y85C	ENSP00000227163:Y86C	Y	-	2	0	SPI1	47338056	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.984000	0.40658	1.617000	0.50277	0.533000	0.62120	TAC	.	.		0.652	SPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316571.1	NM_003120	
BTBD18	643376	hgsc.bcm.edu	37	11	57513362	57513362	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr11:57513362C>T	ENST00000436147.3	-	2	570	c.383G>A	c.(382-384)gGa>gAa	p.G128E	BTBD18_ENST00000422652.1_Missense_Mutation_p.G128E|RP11-691N7.6_ENST00000531074.1_Intron|TMX2-CTNND1_ENST00000528395.1_Intron			B2RXH4	BTBDI_HUMAN	BTB (POZ) domain containing 18	128										endometrium(3)|kidney(1)	4						CACCAACTTTCCACCCTCAAG	0.552																																					p.G128E		Atlas-SNP	.											.	BTBD18	26	.	0			c.G383A						.						38.0	34.0	35.0					11																	57513362		692	1591	2283	SO:0001583	missense	643376	exon3			AACTTTCCACCCT		CCDS44603.1	11q12.1	2013-01-08			ENSG00000233436	ENSG00000233436		"""BTB/POZ domain containing"""	37214	protein-coding gene	gene with protein product							Standard	NM_001145101		Approved		uc010rjy.2	B2RXH4	OTTHUMG00000167203	ENST00000436147.3:c.383G>A	chr11.hg19:g.57513362C>T	ENSP00000397020:p.Gly128Glu	100.0	0.0		108.0	43.0	NM_001145101		Missense_Mutation	SNP	ENST00000436147.3	hg19	CCDS44603.1	.	.	.	.	.	.	.	.	.	.	C	17.41	3.382929	0.61845	.	.	ENSG00000233436	ENST00000422652;ENST00000436147	T;T	0.78595	-1.19;-1.19	5.19	4.28	0.50868	BTB/POZ-like (1);	.	.	.	.	T	0.60932	0.2307	N	0.08118	0	0.25734	N	0.985233	B	0.24882	0.113	B	0.25506	0.061	T	0.56105	-0.8034	9	0.56958	D	0.05	.	11.2071	0.48775	0.0:0.9121:0.0:0.0879	.	128	B2RXH4	BTBDI_HUMAN	E	128	ENSP00000394472:G128E;ENSP00000397020:G128E	ENSP00000394472:G128E	G	-	2	0	BTBD18	57269938	0.564000	0.26602	0.991000	0.47740	0.977000	0.68977	2.398000	0.44486	1.320000	0.45209	0.561000	0.74099	GGA	.	.		0.552	BTBD18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393718.2	NM_001145101	
OR9Q2	219957	hgsc.bcm.edu	37	11	57958110	57958110	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr11:57958110C>T	ENST00000311591.3	+	1	205	c.148C>T	c.(148-150)Cgt>Tgt	p.R50C		NM_001005283.2	NP_001005283.1	Q8NGE9	OR9Q2_HUMAN	olfactory receptor, family 9, subfamily Q, member 2	50						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(2)|endometrium(1)|large_intestine(3)|lung(24)|ovary(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41		Breast(21;0.0589)				CCTCCTGATCCGTGGCGATCG	0.512																																					p.R50C		Atlas-SNP	.											.	OR9Q2	78	.	0			c.C148T						.						116.0	88.0	97.0					11																	57958110		2201	4296	6497	SO:0001583	missense	219957	exon1			CTGATCCGTGGCG	AB065859	CCDS31544.1	11q12.1	2012-08-09		2004-03-10	ENSG00000186513	ENSG00000186513		"""GPCR / Class A : Olfactory receptors"""	15328	protein-coding gene	gene with protein product				OR9Q2P			Standard	NM_001005283		Approved		uc010rka.2	Q8NGE9	OTTHUMG00000167414	ENST00000311591.3:c.148C>T	chr11.hg19:g.57958110C>T	ENSP00000308714:p.Arg50Cys	126.0	0.0		91.0	44.0	NM_001005283		Missense_Mutation	SNP	ENST00000311591.3	hg19	CCDS31544.1	.	.	.	.	.	.	.	.	.	.	C	3.282	-0.146763	0.06627	.	.	ENSG00000186513	ENST00000311591	T	0.01084	5.36	5.43	-1.2	0.09554	GPCR, rhodopsin-like superfamily (1);	0.896444	0.09421	N	0.804391	T	0.00875	0.0029	L	0.28274	0.84	0.20403	N	0.999908	B	0.12630	0.006	B	0.04013	0.001	T	0.48364	-0.9042	10	0.38643	T	0.18	-0.0824	1.4131	0.02295	0.129:0.2122:0.2527:0.4061	.	50	Q8NGE9	OR9Q2_HUMAN	C	50	ENSP00000308714:R50C	ENSP00000308714:R50C	R	+	1	0	OR9Q2	57714686	0.000000	0.05858	0.153000	0.22517	0.060000	0.15804	-1.258000	0.02863	0.080000	0.16959	0.655000	0.94253	CGT	.	.		0.512	OR9Q2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394540.1	NM_001005283	
SUV420H1	51111	hgsc.bcm.edu	37	11	67953257	67953257	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr11:67953257A>C	ENST00000304363.4	-	3	652	c.299T>G	c.(298-300)aTg>aGg	p.M100R	SUV420H1_ENST00000405515.1_Missense_Mutation_p.M100R|SUV420H1_ENST00000402789.1_Missense_Mutation_p.M100R|SUV420H1_ENST00000402185.2_Missense_Mutation_p.M100R|SUV420H1_ENST00000401547.2_Missense_Mutation_p.M100R	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	100					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						CCTAGTATTCATTTTGTGTGT	0.348																																					p.M100R		Atlas-SNP	.											.	SUV420H1	125	.	0			c.T299G						.						88.0	90.0	89.0					11																	67953257		2200	4294	6494	SO:0001583	missense	51111	exon3			GTATTCATTTTGT	AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.299T>G	chr11.hg19:g.67953257A>C	ENSP00000305899:p.Met100Arg	70.0	0.0		98.0	38.0	NM_017635	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	ENST00000304363.4	hg19	CCDS31623.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.217173	0.79352	.	.	ENSG00000110066	ENST00000304363;ENST00000401547;ENST00000405515;ENST00000402789;ENST00000402185;ENST00000453170;ENST00000458496;ENST00000434573	T;T;T;T;T;T;T;T	0.54479	0.92;0.92;0.92;0.92;0.57;0.92;0.92;0.92	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.59905	0.2228	N	0.19112	0.55	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.96;0.999	D;D;D;D	0.91635	0.987;0.999;0.962;0.996	T	0.64884	-0.6302	10	0.66056	D	0.02	-39.6175	16.0399	0.80667	1.0:0.0:0.0:0.0	.	100;100;100;100	B7WNX0;B5MCB3;Q4FZB7-2;Q4FZB7	.;.;.;SV421_HUMAN	R	100;100;100;100;100;29;29;100	ENSP00000305899:M100R;ENSP00000385965:M100R;ENSP00000385640:M100R;ENSP00000385005:M100R;ENSP00000384724:M100R;ENSP00000406377:M29R;ENSP00000403233:M29R;ENSP00000402921:M100R	ENSP00000305899:M100R	M	-	2	0	SUV420H1	67709833	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.139000	0.94554	2.371000	0.80710	0.533000	0.62120	ATG	.	.		0.348	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318319.1	NM_017635	
FAT3	120114	hgsc.bcm.edu	37	11	92531036	92531036	+	Silent	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr11:92531036C>T	ENST00000298047.6	+	9	4874	c.4857C>T	c.(4855-4857)gtC>gtT	p.V1619V	FAT3_ENST00000409404.2_Silent_p.V1619V|FAT3_ENST00000525166.1_Silent_p.V1469V			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1619	Cadherin 15. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCGAACCGGTCCTAGGCATCA	0.433										TCGA Ovarian(4;0.039)																											p.V1619V		Atlas-SNP	.											.	FAT3	1822	.	0			c.C4857T						.						116.0	111.0	113.0					11																	92531036		1984	4160	6144	SO:0001819	synonymous_variant	120114	exon9			ACCGGTCCTAGGC	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.4857C>T	chr11.hg19:g.92531036C>T		182.0	0.0		174.0	75.0	NM_001008781	B5MDB0|Q96AU6	Silent	SNP	ENST00000298047.6	hg19																																																																																				.	.		0.433	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
EXPH5	23086	hgsc.bcm.edu	37	11	108381599	108381599	+	Silent	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr11:108381599C>T	ENST00000265843.4	-	6	4745	c.4635G>A	c.(4633-4635)caG>caA	p.Q1545Q	EXPH5_ENST00000525344.1_Silent_p.Q1538Q|EXPH5_ENST00000428840.1_Silent_p.Q1469Q|EXPH5_ENST00000443411.1_Silent_p.Q1357Q|EXPH5_ENST00000524840.1_5'Flank	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1545					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TATTTGCCTCCTGACTTCTTT	0.428																																					p.Q1545Q		Atlas-SNP	.											.	EXPH5	193	.	0			c.G4635A						.						82.0	77.0	79.0					11																	108381599		2201	4298	6499	SO:0001819	synonymous_variant	23086	exon6			TGCCTCCTGACTT		CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.4635G>A	chr11.hg19:g.108381599C>T		89.0	0.0		89.0	43.0	NM_015065	Q2KHM1|Q9Y4D6	Silent	SNP	ENST00000265843.4	hg19	CCDS8341.1																																																																																			.	.		0.428	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390279.1	NM_015065	
UBE4A	9354	hgsc.bcm.edu	37	11	118245829	118245829	+	Silent	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr11:118245829A>G	ENST00000431736.2	+	9	1428	c.1356A>G	c.(1354-1356)ctA>ctG	p.L452L	UBE4A_ENST00000252108.3_Silent_p.L445L					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TCCTGAAGCTATGCCAGCCAT	0.453																																					p.L452L		Atlas-SNP	.											.	UBE4A	97	.	0			c.A1356G						.						92.0	86.0	88.0					11																	118245829		2200	4296	6496	SO:0001819	synonymous_variant	9354	exon9			GAAGCTATGCCAG	D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.1356A>G	chr11.hg19:g.118245829A>G		91.0	0.0		111.0	53.0	NM_004788		Silent	SNP	ENST00000431736.2	hg19	CCDS8396.1																																																																																			.	.		0.453	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398143.1	NM_004788	
PDZRN4	29951	hgsc.bcm.edu	37	12	41949558	41949558	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr12:41949558T>A	ENST00000402685.2	+	7	1369	c.1361T>A	c.(1360-1362)tTg>tAg	p.L454*	PDZRN4_ENST00000298919.7_Nonsense_Mutation_p.L194*|PDZRN4_ENST00000539469.2_Nonsense_Mutation_p.L196*	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	454	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.						ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GATCGGATTTTGCAAGTAGGT	0.398																																					p.L454X		Atlas-SNP	.											.	PDZRN4	346	.	0			c.T1361A						.						158.0	153.0	155.0					12																	41949558		2203	4300	6503	SO:0001587	stop_gained	29951	exon7			GGATTTTGCAAGT	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1361T>A	chr12.hg19:g.41949558T>A	ENSP00000384197:p.Leu454*	72.0	0.0		71.0	31.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Nonsense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	T	41	8.607313	0.98884	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	.	.	.	5.25	4.09	0.47781	.	0.101520	0.42964	D	0.000623	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.0601	12.8531	0.57869	0.0:0.0:0.1365:0.8635	.	.	.	.	X	454;196;194	.	ENSP00000298919:L194X	L	+	2	0	PDZRN4	40235825	1.000000	0.71417	0.999000	0.59377	0.979000	0.70002	7.932000	0.87634	1.062000	0.40625	0.528000	0.53228	TTG	.	.		0.398	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
PRICKLE1	144165	hgsc.bcm.edu	37	12	42858275	42858275	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr12:42858275G>C	ENST00000455697.1	-	7	1846	c.1561C>G	c.(1561-1563)Ctg>Gtg	p.L521V	PRICKLE1_ENST00000552240.1_Missense_Mutation_p.L521V|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.L521V|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.L521V|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.L521V	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	521					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		AGACACTCCAGGGAATCTTCA	0.478																																					p.L521V		Atlas-SNP	.											.	PRICKLE1	105	.	0			c.C1561G						.						122.0	117.0	119.0					12																	42858275		2203	4300	6503	SO:0001583	missense	144165	exon7			ACTCCAGGGAATC	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.1561C>G	chr12.hg19:g.42858275G>C	ENSP00000401060:p.Leu521Val	89.0	0.0		108.0	47.0	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	hg19	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.146368	0.37923	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16	5.76	1.75	0.24633	.	0.133960	0.49916	D	0.000129	T	0.55386	0.1917	M	0.70275	2.135	0.48236	D	0.999616	B	0.13145	0.007	B	0.08055	0.003	T	0.57723	-0.7762	10	0.87932	D	0	-9.1716	6.1408	0.20259	0.2769:0.1284:0.5947:0.0	.	521	Q96MT3	PRIC1_HUMAN	V	521	ENSP00000401060:L521V;ENSP00000398947:L521V;ENSP00000448359:L521V;ENSP00000345064:L521V;ENSP00000449819:L521V	ENSP00000345064:L521V	L	-	1	2	PRICKLE1	41144542	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.470000	0.35354	0.898000	0.36418	0.650000	0.86243	CTG	.	.		0.478	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
CCDC184	387856	hgsc.bcm.edu	37	12	48578199	48578200	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr12:48578199_48578200CC>AA	ENST00000316554.3	+	1	834_835	c.294_295CC>AA	c.(292-297)cgCCag>cgAAag	p.Q99K		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		99						cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						CTGCGCCCCGCCAGGGCGGCTT	0.678																																					p.R98R|p.Q99K		Atlas-SNP	.											.|C12orf68,NS,carcinoma,0,1	C12orf68	11	.	0			c.C294A|c.C295A						.																																			SO:0001583	missense	387856	exon1			GCCCCGCCAGGGC|CCCCGCCAGGGCG																												Exception_encountered	chr12.hg19:g.48578199_48578200delinsAA	ENSP00000320849:p.Gln99Lys	19.0	0.0		25.0	13.0	NM_001013635	Q96MK5|Q96N39	Silent|Missense_Mutation	SNP	ENST00000316554.3	hg19	CCDS31785.1																																																																																			.	.		0.678	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406514.1		
CAND1	55832	hgsc.bcm.edu	37	12	67699851	67699851	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr12:67699851A>C	ENST00000545606.1	+	10	2840	c.2403A>C	c.(2401-2403)aaA>aaC	p.K801N		NM_018448.3	NP_060918.2	Q86VP6	CAND1_HUMAN	cullin-associated and neddylation-dissociated 1	801					cell differentiation (GO:0030154)|negative regulation of catalytic activity (GO:0043086)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|protein ubiquitination (GO:0016567)|SCF complex assembly (GO:0010265)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(12)|prostate(1)|skin(2)|stomach(1)	35			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CCATTGCCAAATGTGTAGCTG	0.428																																					p.K801N		Atlas-SNP	.											.	CAND1	100	.	0			c.A2403C						.						98.0	89.0	92.0					12																	67699851		2203	4300	6503	SO:0001583	missense	55832	exon10			TGCCAAATGTGTA		CCDS8977.1	12q14	2008-02-05			ENSG00000111530	ENSG00000111530			30688	protein-coding gene	gene with protein product	"""TBP interacting protein"""	607727				10048485, 8954946	Standard	NM_018448		Approved	TIP120A, DKFZp434M1414, KIAA0829, TIP120	uc001stn.2	Q86VP6	OTTHUMG00000169060	ENST00000545606.1:c.2403A>C	chr12.hg19:g.67699851A>C	ENSP00000442318:p.Lys801Asn	63.0	0.0		80.0	38.0	NM_018448	B2RAU3|O94918|Q6PIY4|Q8NDJ4|Q96JZ9|Q96T19|Q9BTC4|Q9H0G2|Q9P0H7|Q9UF85	Missense_Mutation	SNP	ENST00000545606.1	hg19	CCDS8977.1	.	.	.	.	.	.	.	.	.	.	A	15.34	2.805411	0.50315	.	.	ENSG00000111530	ENST00000545606;ENST00000299218;ENST00000544619	T;T	0.66815	-0.23;-0.23	5.62	3.29	0.37713	Armadillo-like helical (1);Armadillo-type fold (1);	0.094546	0.64402	D	0.000001	T	0.81856	0.4911	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;0.992	D;P	0.68039	0.955;0.776	T	0.81885	-0.0727	9	.	.	.	-18.8306	9.7089	0.40233	0.8602:0.0:0.1398:0.0	.	633;801	Q86VP6-2;Q86VP6	.;CAND1_HUMAN	N	801;801;341	ENSP00000442318:K801N;ENSP00000444089:K341N	.	K	+	3	2	CAND1	65986118	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	2.591000	0.46163	0.432000	0.26286	-0.256000	0.11100	AAA	.	.		0.428	CAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402105.1	NM_018448	
ZFC3H1	196441	hgsc.bcm.edu	37	12	72017346	72017346	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr12:72017346A>C	ENST00000378743.3	-	24	4896	c.4538T>G	c.(4537-4539)gTa>gGa	p.V1513G		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1513					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GTATTCAGCTACTATTCCATC	0.303																																					p.V1513G		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.T4538G						.						87.0	80.0	82.0					12																	72017346		1833	4079	5912	SO:0001583	missense	196441	exon24			TCAGCTACTATTC	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4538T>G	chr12.hg19:g.72017346A>C	ENSP00000368017:p.Val1513Gly	61.0	0.0		96.0	48.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	hg19	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.108600	0.77096	.	.	ENSG00000133858	ENST00000378743	T	0.33654	1.4	5.11	5.11	0.69529	.	0.596788	0.16463	N	0.213326	T	0.35278	0.0926	L	0.27053	0.805	0.80722	D	1	D	0.56521	0.976	P	0.47864	0.559	T	0.24154	-1.0168	10	0.87932	D	0	.	14.905	0.70711	1.0:0.0:0.0:0.0	.	1513	O60293	ZC3H1_HUMAN	G	1513	ENSP00000368017:V1513G	ENSP00000368017:V1513G	V	-	2	0	ZFC3H1	70303613	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.267000	0.72546	1.924000	0.55735	0.533000	0.62120	GTA	.	.		0.303	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
P2RX2	22953	hgsc.bcm.edu	37	12	133197658	133197658	+	Silent	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr12:133197658G>A	ENST00000389110.3	+	8	883	c.846G>A	c.(844-846)aaG>aaA	p.K282K	P2RX2_ENST00000343948.4_Silent_p.K282K|P2RX2_ENST00000352418.4_Silent_p.K210K|P2RX2_ENST00000348800.5_Silent_p.K282K|P2RX2_ENST00000351222.4_Silent_p.K190K|P2RX2_ENST00000350048.5_Silent_p.K258K|P2RX2_ENST00000449132.2_Silent_p.K248K	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	282					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		GCAACCCCAAGTACTCCTTCC	0.592																																					p.K282K		Atlas-SNP	.											.	P2RX2	49	.	0			c.G846A						.						123.0	99.0	107.0					12																	133197658		2203	4300	6503	SO:0001819	synonymous_variant	22953	exon8			CCCCAAGTACTCC	AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.846G>A	chr12.hg19:g.133197658G>A		50.0	0.0		42.0	24.0	NM_170683	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Silent	SNP	ENST00000389110.3	hg19	CCDS31931.1																																																																																			.	.		0.592	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397542.1		
ATP8A2	51761	hgsc.bcm.edu	37	13	26273415	26273416	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr13:26273415_26273416GC>TT	ENST00000381655.2	+	25	2458_2459	c.2316_2317GC>TT	c.(2314-2319)gcGCtc>gcTTtc	p.L773F	ATP8A2_ENST00000255283.8_Missense_Mutation_p.L733F|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	733					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TGAAGTACGCGCTCTCCTTCGA	0.55																																					p.A772A|p.L773F		Atlas-SNP	.											.	ATP8A2	181	.	0			c.G2316T|c.C2317T						.																																			SO:0001583	missense	51761	exon25			GTACGCGCTCTCC|TACGCGCTCTCCT	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	Exception_encountered	chr13.hg19:g.26273415_26273416delinsTT	ENSP00000371070:p.Leu773Phe	68.0|66.0	0.0		57.0	19.0|16.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent|Missense_Mutation	SNP	ENST00000381655.2	hg19	CCDS41873.1																																																																																			.	.		0.550	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
FAM124A	220108	hgsc.bcm.edu	37	13	51854702	51854702	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr13:51854702C>A	ENST00000322475.8	+	4	1086	c.951C>A	c.(949-951)agC>agA	p.S317R	FAM124A_ENST00000280057.6_Missense_Mutation_p.S353R	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	317										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		CACCTGGCAGCAGCCAGCAGT	0.597																																					p.S353R		Atlas-SNP	.											.	FAM124A	61	.	0			c.C1059A						.						63.0	65.0	64.0					13																	51854702		2203	4300	6503	SO:0001583	missense	220108	exon5			TGGCAGCAGCCAG	AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.951C>A	chr13.hg19:g.51854702C>A	ENSP00000324625:p.Ser317Arg	49.0	0.0		44.0	13.0	NM_145019	A2A324|Q8N8P9|Q8NE66|Q96NJ9	Missense_Mutation	SNP	ENST00000322475.8	hg19	CCDS55900.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.531674	0.45073	.	.	ENSG00000150510	ENST00000322475;ENST00000280057	T;T	0.46451	0.87;0.87	4.97	4.12	0.48240	.	0.633137	0.16201	N	0.224936	T	0.34454	0.0898	L	0.50333	1.59	0.09310	N	1	B;B	0.33583	0.418;0.218	B;B	0.33521	0.162;0.165	T	0.15435	-1.0437	10	0.21014	T	0.42	.	8.7056	0.34351	0.0:0.8257:0.0:0.1743	.	317;353	Q86V42;Q86V42-2	F124A_HUMAN;.	R	317;353	ENSP00000324625:S317R;ENSP00000280057:S353R	ENSP00000280057:S353R	S	+	3	2	FAM124A	50752703	0.002000	0.14202	0.003000	0.11579	0.395000	0.30598	1.610000	0.36869	1.081000	0.41110	0.655000	0.94253	AGC	.	.		0.597	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045019.3	NM_145019	
TEP1	7011	hgsc.bcm.edu	37	14	20876328	20876328	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr14:20876328T>G	ENST00000262715.5	-	2	311	c.271A>C	c.(271-273)Atg>Ctg	p.M91L	TEP1_ENST00000556935.1_Missense_Mutation_p.M91L	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	91					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GGTTTCTCCATGGTCTTCAGG	0.537																																					p.M91L		Atlas-SNP	.											.	TEP1	224	.	0			c.A271C						.						114.0	111.0	112.0					14																	20876328		2203	4300	6503	SO:0001583	missense	7011	exon2			TCTCCATGGTCTT		CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.271A>C	chr14.hg19:g.20876328T>G	ENSP00000262715:p.Met91Leu	173.0	0.0		182.0	75.0	NM_007110	A0AUV9	Missense_Mutation	SNP	ENST00000262715.5	hg19	CCDS9548.1	.	.	.	.	.	.	.	.	.	.	T	0.016	-1.526510	0.00959	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000556549	T;T;T	0.33438	1.41;1.41;1.41	4.98	-6.3	0.02007	.	0.991696	0.08208	N	0.981217	T	0.08670	0.0215	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.32719	-0.9896	10	0.02654	T	1	-0.6589	1.1701	0.01823	0.2437:0.1546:0.369:0.2328	.	91;91	G3V5X7;Q99973	.;TEP1_HUMAN	L	91	ENSP00000262715:M91L;ENSP00000452574:M91L;ENSP00000452240:M91L	ENSP00000262715:M91L	M	-	1	0	TEP1	19946168	0.000000	0.05858	0.000000	0.03702	0.343000	0.28985	-0.362000	0.07602	-1.245000	0.02513	-1.437000	0.01076	ATG	.	.		0.537	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073563.2	NM_007110	
YLPM1	56252	hgsc.bcm.edu	37	14	75230510	75230510	+	Silent	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr14:75230510G>T	ENST00000552421.1	+	1	442	c.318G>T	c.(316-318)ccG>ccT	p.P106P	YLPM1_ENST00000325680.7_Silent_p.P106P|YLPM1_ENST00000238571.3_Silent_p.P106P			P49750	YLPM1_HUMAN	YLP motif containing 1	106	Pro-rich.				regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CACCGCCACCGATGCCCCCGC	0.692																																					p.P106P		Atlas-SNP	.											.	YLPM1	298	.	0			c.G318T						.						27.0	34.0	32.0					14																	75230510		1889	4100	5989	SO:0001819	synonymous_variant	56252	exon1			GCCACCGATGCCC	AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000552421.1:c.318G>T	chr14.hg19:g.75230510G>T		38.0	0.0		45.0	15.0	NM_019589	P49752|Q96I64|Q9P1V7	Silent	SNP	ENST00000552421.1	hg19																																																																																				.	.		0.692	YLPM1-008	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404450.1	NM_019589	
NEK9	91754	hgsc.bcm.edu	37	14	75590868	75590868	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr14:75590868C>T	ENST00000238616.5	-	2	436	c.278G>A	c.(277-279)cGt>cAt	p.R93H	RP11-950C14.7_ENST00000556236.1_RNA	NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	93	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		GGCATCACGACGTTCCTTCTC	0.468																																					p.R93H		Atlas-SNP	.											.	NEK9	64	.	0			c.G278A						.						188.0	141.0	157.0					14																	75590868		2203	4300	6503	SO:0001583	missense	91754	exon2			TCACGACGTTCCT	AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.278G>A	chr14.hg19:g.75590868C>T	ENSP00000238616:p.Arg93His	131.0	0.0		134.0	13.0	NM_033116	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	ENST00000238616.5	hg19	CCDS9839.1	.	.	.	.	.	.	.	.	.	.	C	36	5.825949	0.96996	.	.	ENSG00000119638	ENST00000238616;ENST00000540227	T	0.66460	-0.21	6.17	6.17	0.99709	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.097256	0.64402	D	0.000001	T	0.82240	0.4994	M	0.76433	2.335	0.80722	D	1	D	0.76494	0.999	D	0.64506	0.926	T	0.82281	-0.0535	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	93	Q8TD19	NEK9_HUMAN	H	93;75	ENSP00000238616:R93H	ENSP00000238616:R93H	R	-	2	0	NEK9	74660621	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.752000	0.85141	2.941000	0.99782	0.655000	0.94253	CGT	.	.		0.468	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415021.1	NM_033116	
FLRT2	23768	hgsc.bcm.edu	37	14	86089139	86089139	+	Silent	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr14:86089139C>A	ENST00000330753.4	+	2	2048	c.1281C>A	c.(1279-1281)ctC>ctA	p.L427L	FLRT2_ENST00000554746.1_Silent_p.L427L	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	427	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGATCCAGCTCTCTATCCATT	0.488																																					p.L427L		Atlas-SNP	.											.	FLRT2	168	.	0			c.C1281A						.						65.0	64.0	64.0					14																	86089139		2203	4300	6503	SO:0001819	synonymous_variant	23768	exon2			CCAGCTCTCTATC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1281C>A	chr14.hg19:g.86089139C>A		171.0	0.0		137.0	58.0	NM_013231	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	hg19	CCDS9877.1																																																																																			.	.		0.488	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
FMN1	342184	hgsc.bcm.edu	37	15	33359765	33359765	+	Intron	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr15:33359765A>G	ENST00000559047.1	-	3	2043				FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000334528.9_Silent_p.S107S|FMN1_ENST00000558197.1_Silent_p.S107S			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		CTTTTCTCTGACTTCCCTCTG	0.498																																					p.S107S		Atlas-SNP	.											.	FMN1	174	.	0			c.T321C						.						90.0	90.0	90.0					15																	33359765		1945	4156	6101	SO:0001627	intron_variant	342184	exon1			TCTCTGACTTCCC	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2490T>C	chr15.hg19:g.33359765A>G		111.0	0.0		166.0	44.0	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Silent	SNP	ENST00000559047.1	hg19																																																																																				.	.		0.498	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
FMN1	342184	hgsc.bcm.edu	37	15	33359984	33359984	+	Intron	SNP	A	A	T	rs184741064		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr15:33359984A>T	ENST00000559047.1	-	3	2043				FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron|FMN1_ENST00000334528.9_Silent_p.S34S|FMN1_ENST00000558197.1_Silent_p.S34S			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		GGGATTTCATAGAGAACTTAC	0.433																																					p.S34S		Atlas-SNP	.											.	FMN1	174	.	0			c.T102A						.						75.0	71.0	72.0					15																	33359984		1902	4129	6031	SO:0001627	intron_variant	342184	exon1			TTTCATAGAGAAC	AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2709T>A	chr15.hg19:g.33359984A>T		79.0	0.0		127.0	39.0	NM_001103184	Q3B7I6|Q3ZAR4|Q6ZSY1	Silent	SNP	ENST00000559047.1	hg19																																																																																				.	A|1.000;G|0.000		0.433	FMN1-005	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000417414.1	NM_001103184	
CGNL1	84952	hgsc.bcm.edu	37	15	57731023	57731023	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr15:57731023C>T	ENST00000281282.5	+	2	904	c.826C>T	c.(826-828)Ctt>Ttt	p.L276F		NM_001252335.1|NM_032866.4	NP_001239264.1|NP_116255.2	Q0VF96	CGNL1_HUMAN	cingulin-like 1	276	Head.					myosin complex (GO:0016459)|tight junction (GO:0005923)	motor activity (GO:0003774)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(14)|ovary(4)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)	60				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)		GCCAGATGTTCTTCCCTTCCG	0.617																																					p.L276F		Atlas-SNP	.											.	CGNL1	125	.	0			c.C826T						.						55.0	59.0	58.0					15																	57731023		2192	4292	6484	SO:0001583	missense	84952	exon3			GATGTTCTTCCCT	AY274808	CCDS10161.1	15q21.3	2011-06-10			ENSG00000128849	ENSG00000128849			25931	protein-coding gene	gene with protein product		607856				11214970	Standard	NM_001252335		Approved	FLJ14957, JACOP, KIAA1749, paracingulin	uc002aeg.3	Q0VF96	OTTHUMG00000166485	ENST00000281282.5:c.826C>T	chr15.hg19:g.57731023C>T	ENSP00000281282:p.Leu276Phe	196.0	0.0		237.0	58.0	NM_001252335	Q05BZ4|Q52LR0|Q695C7|Q7Z2L3|Q96JV2|Q96MN6|Q9C0B4	Missense_Mutation	SNP	ENST00000281282.5	hg19	CCDS10161.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.631990	0.87660	.	.	ENSG00000128849	ENST00000281282	T	0.55588	0.51	5.27	5.27	0.74061	.	0.000000	0.45606	D	0.000346	T	0.71160	0.3307	M	0.62723	1.935	0.54753	D	0.999985	D	0.89917	1.0	D	0.85130	0.997	T	0.69971	-0.5000	10	0.46703	T	0.11	-15.6301	19.0822	0.93187	0.0:1.0:0.0:0.0	.	276	Q0VF96	CGNL1_HUMAN	F	276	ENSP00000281282:L276F	ENSP00000281282:L276F	L	+	1	0	CGNL1	55518315	1.000000	0.71417	0.878000	0.34440	0.814000	0.46013	6.992000	0.76238	2.722000	0.93159	0.655000	0.94253	CTT	.	.		0.617	CGNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255482.2	NM_032866	
SALL1	6299	hgsc.bcm.edu	37	16	51173435	51173435	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr16:51173435T>C	ENST00000251020.4	-	2	2731	c.2698A>G	c.(2698-2700)Aat>Gat	p.N900D	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.N803D|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	900					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GATGAATCATTGGTCAGGACA	0.547																																					p.N900D	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.A2698G						.						99.0	77.0	85.0					16																	51173435		2198	4300	6498	SO:0001583	missense	6299	exon2			AATCATTGGTCAG	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.2698A>G	chr16.hg19:g.51173435T>C	ENSP00000251020:p.Asn900Asp	67.0	0.0		65.0	25.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	hg19	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	T	13.83	2.354902	0.41700	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.78595	-1.19;-1.19	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.85678	0.5752	M	0.80332	2.49	0.80722	D	1	D	0.63046	0.992	P	0.55785	0.784	D	0.87543	0.2460	10	0.59425	D	0.04	.	15.6025	0.76636	0.0:0.0:0.0:1.0	.	900	Q9NSC2	SALL1_HUMAN	D	900;803;864	ENSP00000251020:N900D;ENSP00000407914:N803D	ENSP00000251020:N900D	N	-	1	0	SALL1	49730936	1.000000	0.71417	0.999000	0.59377	0.089000	0.18198	8.040000	0.89188	2.085000	0.62840	0.455000	0.32223	AAT	.	.		0.547	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
USP6	9098	hgsc.bcm.edu	37	17	5072174	5072174	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr17:5072174A>G	ENST00000574788.1	+	35	5571	c.3341A>G	c.(3340-3342)gAc>gGc	p.D1114G	USP6_ENST00000304328.5_Missense_Mutation_p.D797G|USP6_ENST00000250066.6_Missense_Mutation_p.D1114G|USP6_ENST00000332776.4_3'UTR			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1114	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GTACCACGAGACCCGGCCCTC	0.473			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																p.D1114G		Atlas-SNP	.		Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	.	USP6	213	.	0			c.A3341G						.						108.0	117.0	114.0					17																	5072174		2203	4300	6503	SO:0001583	missense	9098	exon27			CACGAGACCCGGC	X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3341A>G	chr17.hg19:g.5072174A>G	ENSP00000460380:p.Asp1114Gly	218.0	1.0		188.0	88.0	NM_004505	Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	ENST00000574788.1	hg19	CCDS11069.2	.	.	.	.	.	.	.	.	.	.	A	6.157	0.397222	0.11638	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.31769	1.48;1.48	2.35	1.16	0.20824	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.144593	0.64402	D	0.000006	T	0.16385	0.0394	N	0.24115	0.695	0.36649	D	0.877306	B;B	0.14438	0.004;0.01	B;B	0.19666	0.009;0.026	T	0.07693	-1.0759	10	0.51188	T	0.08	.	2.7335	0.05234	0.5608:0.2776:0.1616:0.0	.	797;1114	P35125-2;P35125	.;UBP6_HUMAN	G	1114;797	ENSP00000250066:D1114G;ENSP00000305473:D797G	ENSP00000250066:D1114G	D	+	2	0	USP6	5012898	1.000000	0.71417	0.957000	0.39632	0.072000	0.16883	4.658000	0.61497	0.133000	0.18654	0.155000	0.16302	GAC	.	.		0.473	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438990.1	NM_004505	
MYH1	4619	hgsc.bcm.edu	37	17	10399270	10399270	+	Silent	SNP	G	G	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr17:10399270G>C	ENST00000226207.5	-	35	5260	c.5166C>G	c.(5164-5166)acC>acG	p.T1722T	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1722					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CATGCACCTGGGTGTGCAGGA	0.448																																					p.T1722T		Atlas-SNP	.											.	MYH1	403	.	0			c.C5166G						.						66.0	62.0	63.0					17																	10399270		2203	4300	6503	SO:0001819	synonymous_variant	4619	exon35			CACCTGGGTGTGC		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.5166C>G	chr17.hg19:g.10399270G>C		63.0	0.0		59.0	28.0	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	hg19	CCDS11155.1																																																																																			.	.		0.448	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
MYH1	4619	hgsc.bcm.edu	37	17	10408340	10408340	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr17:10408340C>T	ENST00000226207.5	-	22	2572	c.2478G>A	c.(2476-2478)atG>atA	p.M826I	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	826					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						GCTTCACATTCATGAAGGCAC	0.423																																					p.M826I		Atlas-SNP	.											.	MYH1	403	.	0			c.G2478A						.						98.0	92.0	94.0					17																	10408340		2203	4300	6503	SO:0001583	missense	4619	exon22			CACATTCATGAAG		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2478G>A	chr17.hg19:g.10408340C>T	ENSP00000226207:p.Met826Ile	85.0	0.0		67.0	31.0	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	hg19	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.011166	0.75046	.	.	ENSG00000109061	ENST00000226207	T	0.71103	-0.54	5.47	5.47	0.80525	.	0.000000	0.52532	U	0.000072	T	0.72061	0.3414	M	0.66439	2.03	0.58432	D	0.999999	B	0.13594	0.008	B	0.18263	0.021	T	0.67722	-0.5597	10	0.48119	T	0.1	.	19.6961	0.96026	0.0:1.0:0.0:0.0	.	826	P12882	MYH1_HUMAN	I	826	ENSP00000226207:M826I	ENSP00000226207:M826I	M	-	3	0	MYH1	10349065	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.963000	0.70372	2.745000	0.94114	0.650000	0.86243	ATG	.	.		0.423	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
SLFN13	146857	hgsc.bcm.edu	37	17	33769276	33769276	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr17:33769276C>A	ENST00000285013.6	-	5	1503	c.1228G>T	c.(1228-1230)Gag>Tag	p.E410*	SLFN13_ENST00000542635.1_Nonsense_Mutation_p.E410*|SLFN13_ENST00000533791.1_Nonsense_Mutation_p.E410*|SLFN13_ENST00000534689.1_Nonsense_Mutation_p.E92*|SLFN13_ENST00000526861.1_Nonsense_Mutation_p.E410*|SLFN13_ENST00000360502.2_Nonsense_Mutation_p.E92*	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	410						intracellular (GO:0005622)	ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		CAGAGGGACTCTGGAGTACAT	0.403																																					p.E410X		Atlas-SNP	.											.	SLFN13	79	.	0			c.G1228T						.						58.0	56.0	56.0					17																	33769276		2203	4300	6503	SO:0001587	stop_gained	146857	exon5			GGGACTCTGGAGT	AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.1228G>T	chr17.hg19:g.33769276C>A	ENSP00000285013:p.Glu410*	41.0	0.0		43.0	19.0	NM_144682	E1P645|Q658M1|Q6ZS51|Q96A81	Nonsense_Mutation	SNP	ENST00000285013.6	hg19	CCDS32620.1	.	.	.	.	.	.	.	.	.	.	c	25.7	4.662025	0.88251	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689;ENST00000532210	.	.	.	3.21	-0.296	0.12824	.	0.600105	0.14848	N	0.294891	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	3.469	0.07561	0.0:0.5194:0.2148:0.2657	.	.	.	.	X	410;92;410;410;92;79	.	ENSP00000285013:E410X	E	-	1	0	SLFN13	30793389	0.002000	0.14202	0.000000	0.03702	0.030000	0.12068	0.253000	0.18296	-0.121000	0.11787	0.407000	0.27541	GAG	.	.		0.403	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381883.1	NM_144682	
SOCS7	30837	hgsc.bcm.edu	37	17	36508355	36508355	+	Silent	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr17:36508355C>T	ENST00000577233.1	+	1	228	c.228C>T	c.(226-228)gtC>gtT	p.V76V	SOCS7_ENST00000331159.5_Silent_p.V76V	NM_014598.2	NP_055413.1	O14512	SOCS7_HUMAN	suppressor of cytokine signaling 7	76					fat cell differentiation (GO:0045444)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of signal transduction (GO:0009968)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			central_nervous_system(1)|endometrium(1)|kidney(1)|prostate(1)|skin(5)	9	Breast(7;3.47e-17)					TCAAGACAGTCGGTGGGGGTT	0.766																																					p.V76V		Atlas-SNP	.											.	SOCS7	22	.	0			c.C228T						.						2.0	4.0	3.0					17																	36508355		1355	2657	4012	SO:0001819	synonymous_variant	30837	exon1			GACAGTCGGTGGG	AB005216	CCDS32637.1	17q12	2014-08-12			ENSG00000274211	ENSG00000274211		"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	29846	protein-coding gene	gene with protein product	"""Nck, Ash and phospholipase C binding protein"", ""NCK-associated protein 4"""	608788				9344857, 12076535	Standard	XM_005257264		Approved	NAP4, NCKAP4	uc002hqa.3	O14512	OTTHUMG00000188546	ENST00000577233.1:c.228C>T	chr17.hg19:g.36508355C>T		28.0	0.0		38.0	12.0	NM_014598	A2VCU2|Q0IJ63	Silent	SNP	ENST00000577233.1	hg19	CCDS32637.1																																																																																			.	.		0.766	SOCS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440486.4	XM_371052	
FHOD3	80206	hgsc.bcm.edu	37	18	34156492	34156492	+	Missense_Mutation	SNP	C	C	A	rs147225084		TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr18:34156492C>A	ENST00000359247.4	+	6	590	c.590C>A	c.(589-591)aCt>aAt	p.T197N	FHOD3_ENST00000445677.1_Missense_Mutation_p.T197N|FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000257209.4_Missense_Mutation_p.T197N|FHOD3_ENST00000590592.1_Missense_Mutation_p.T197N	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	197	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TGGCTGTACACTCTCATTGGG	0.393																																					p.T197N		Atlas-SNP	.											.	FHOD3	210	.	0			c.C590A						.						127.0	113.0	118.0					18																	34156492		2203	4300	6503	SO:0001583	missense	80206	exon6			TGTACACTCTCAT	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.590C>A	chr18.hg19:g.34156492C>A	ENSP00000352186:p.Thr197Asn	82.0	0.0		86.0	32.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	ENST00000359247.4	hg19		.	.	.	.	.	.	.	.	.	.	C	20.4	3.981161	0.74474	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.23950	1.88;1.88;1.88	5.73	5.73	0.89815	GTPase-binding/formin homology 3 (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.050173	0.85682	D	0.000000	T	0.44746	0.1308	M	0.68317	2.08	0.32471	N	0.542826	D;D;P	0.59357	0.982;0.985;0.74	P;P;P	0.55260	0.664;0.772;0.583	T	0.56384	-0.7988	10	0.72032	D	0.01	.	17.3817	0.87406	0.0:1.0:0.0:0.0	.	197;197;197	Q2V2M9;Q2V2M9-3;E5F5Q0	FHOD3_HUMAN;.;.	N	197	ENSP00000257209:T197N;ENSP00000352186:T197N;ENSP00000411430:T197N	ENSP00000257209:T197N	T	+	2	0	FHOD3	32410490	1.000000	0.71417	0.981000	0.43875	0.975000	0.68041	4.458000	0.60095	2.694000	0.91930	0.655000	0.94253	ACT	.	C|1.000;T|0.000		0.393	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
TXNL1	9352	hgsc.bcm.edu	37	18	54285333	54285333	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr18:54285333T>C	ENST00000217515.6	-	4	598	c.394A>G	c.(394-396)Aaa>Gaa	p.K132E	TXNL1_ENST00000540155.1_Missense_Mutation_p.K9E|TXNL1_ENST00000590954.1_Missense_Mutation_p.K132E	NM_004786.2	NP_004777.1	O43396	TXNL1_HUMAN	thioredoxin-like 1	132	PITH. {ECO:0000255|PROSITE- ProRule:PRU00864}.				cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		CAACCAGCTTTGTTAATAAAA	0.308																																					p.K132E		Atlas-SNP	.											.	TXNL1	30	.	0			c.A394G						.						102.0	94.0	97.0					18																	54285333		2202	4300	6502	SO:0001583	missense	9352	exon4			CAGCTTTGTTAAT	AF003938	CCDS11961.1	18q21.31	2011-01-17	2004-05-06	2004-05-07	ENSG00000091164	ENSG00000091164			12436	protein-coding gene	gene with protein product	"""thioredoxin-like, 32kD"""	603049	"""thioredoxin-like, 32kDa"""	TXNL		9473519, 9668102	Standard	NM_004786		Approved	Txl, TRP32	uc002lgg.3	O43396	OTTHUMG00000132722	ENST00000217515.6:c.394A>G	chr18.hg19:g.54285333T>C	ENSP00000217515:p.Lys132Glu	47.0	0.0		51.0	23.0	NM_004786		Missense_Mutation	SNP	ENST00000217515.6	hg19	CCDS11961.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.197784	0.79015	.	.	ENSG00000091164	ENST00000217515;ENST00000540155	T	0.18016	2.24	5.69	5.69	0.88448	Proteasome-interacting thioredoxin-like domain, C-terminal (1);Galactose-binding domain-like (1);	0.041576	0.85682	D	0.000000	T	0.35189	0.0923	M	0.84846	2.72	0.80722	D	1	P;P	0.43750	0.816;0.514	P;P	0.48425	0.577;0.502	T	0.16335	-1.0406	10	0.30854	T	0.27	.	15.5967	0.76587	0.0:0.0:0.0:1.0	.	132;132	B2R960;O43396	.;TXNL1_HUMAN	E	132;9	ENSP00000217515:K132E	ENSP00000217515:K132E	K	-	1	0	TXNL1	52436331	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.613000	0.82986	2.160000	0.67779	0.482000	0.46254	AAA	.	.		0.308	TXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256064.2		
TSHZ3	57616	hgsc.bcm.edu	37	19	31768705	31768705	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr19:31768705C>T	ENST00000240587.4	-	2	2321	c.1994G>A	c.(1993-1995)cGc>cAc	p.R665H		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	665					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CTCCTGGCTGCGGAAGCCCCC	0.662																																					p.R665H		Atlas-SNP	.											.	TSHZ3	549	.	0			c.G1994A						.						17.0	19.0	18.0					19																	31768705		2198	4284	6482	SO:0001583	missense	57616	exon2			TGGCTGCGGAAGC	AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1994G>A	chr19.hg19:g.31768705C>T	ENSP00000240587:p.Arg665His	65.0	0.0		44.0	18.0	NM_020856	Q9H0G6|Q9P254	Missense_Mutation	SNP	ENST00000240587.4	hg19	CCDS12421.2	.	.	.	.	.	.	.	.	.	.	C	5.503	0.277747	0.10403	.	.	ENSG00000121297	ENST00000240587	T	0.43294	0.95	5.35	3.16	0.36331	.	0.342599	0.33895	N	0.004445	T	0.21387	0.0515	N	0.14661	0.345	0.21064	N	0.999793	P	0.34892	0.474	B	0.22386	0.039	T	0.08106	-1.0738	10	0.51188	T	0.08	-1.0788	9.744	0.40435	0.0:0.1399:0.0:0.8601	.	665	Q63HK5	TSH3_HUMAN	H	665	ENSP00000240587:R665H	ENSP00000240587:R665H	R	-	2	0	TSHZ3	36460545	0.897000	0.30589	0.792000	0.32020	0.009000	0.06853	1.223000	0.32527	0.321000	0.23259	-1.223000	0.01593	CGC	.	.		0.662	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316743.2	NM_020856	
PRKD2	25865	hgsc.bcm.edu	37	19	47192900	47192900	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr19:47192900T>A	ENST00000291281.4	-	14	2090	c.1865A>T	c.(1864-1866)aAa>aTa	p.K622I	PRKD2_ENST00000600194.1_Missense_Mutation_p.K465I|PRKD2_ENST00000595515.1_Missense_Mutation_p.K622I|RN7SL364P_ENST00000473668.2_RNA|PRKD2_ENST00000433867.1_Missense_Mutation_p.K622I|PRKD2_ENST00000601806.1_Missense_Mutation_p.K465I			Q9BZL6	KPCD2_HUMAN	protein kinase D2	622	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CACAAACACTTTCTCAGGCGT	0.597																																					p.K622I		Atlas-SNP	.											.	PRKD2	94	.	0			c.A1865T						.						160.0	140.0	147.0					19																	47192900		2203	4300	6503	SO:0001583	missense	25865	exon14			AACACTTTCTCAG	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1865A>T	chr19.hg19:g.47192900T>A	ENSP00000291281:p.Lys622Ile	128.0	0.0		103.0	47.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	hg19	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.067811	0.76301	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.67171	-0.25;-0.25	5.06	4.04	0.47022	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.71358	0.3330	L	0.48877	1.53	0.41386	D	0.987585	P;P;P	0.52842	0.769;0.564;0.956	P;P;P	0.62649	0.611;0.515;0.905	T	0.71751	-0.4498	10	0.72032	D	0.01	-31.8831	7.4521	0.27244	0.0:0.1733:0.0:0.8267	.	622;107;622	E7ER94;A0JLT6;Q9BZL6	.;.;KPCD2_HUMAN	I	622	ENSP00000291281:K622I;ENSP00000393978:K622I	ENSP00000291281:K622I	K	-	2	0	PRKD2	51884740	0.997000	0.39634	0.995000	0.50966	0.902000	0.53008	1.628000	0.37060	0.878000	0.35920	0.533000	0.62120	AAA	.	.		0.597	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
ZNF331	55422	hgsc.bcm.edu	37	19	54080362	54080362	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr19:54080362G>T	ENST00000253144.9	+	7	1881	c.548G>T	c.(547-549)gGg>gTg	p.G183V	ZNF331_ENST00000513999.1_Missense_Mutation_p.G183V|ZNF331_ENST00000511593.2_Missense_Mutation_p.G183V|ZNF331_ENST00000449416.1_Missense_Mutation_p.G183V|ZNF331_ENST00000511154.1_Missense_Mutation_p.G183V|ZNF331_ENST00000411977.2_Missense_Mutation_p.G183V|ZNF331_ENST00000512387.1_Missense_Mutation_p.G183V|ZNF331_ENST00000513265.1_Intron	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	183					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		ATTCATACTGGGGAGAAGCCC	0.418			T	?	follicular thyroid adenoma																																p.G183V		Atlas-SNP	.		Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	.	ZNF331	66	.	0			c.G548T						.						75.0	82.0	80.0					19																	54080362		2203	4300	6503	SO:0001583	missense	55422	exon5			ATACTGGGGAGAA	AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.548G>T	chr19.hg19:g.54080362G>T	ENSP00000253144:p.Gly183Val	113.0	0.0		100.0	51.0	NM_001253801	Q96GJ4	Missense_Mutation	SNP	ENST00000253144.9	hg19	CCDS33102.1	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281458	0.59758	.	.	ENSG00000130844	ENST00000253144;ENST00000511593;ENST00000449416;ENST00000411977;ENST00000511154;ENST00000513999;ENST00000512387	T;T;T;T;T;T;T	0.23552	1.9;1.9;1.9;1.9;1.9;1.9;1.9	3.68	3.68	0.42216	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35739	N	0.003019	T	0.51193	0.1660	M	0.79805	2.47	0.47698	D	0.999498	D	0.89917	1.0	D	0.76575	0.988	T	0.59091	-0.7519	10	0.87932	D	0	.	13.245	0.60018	0.0:0.0:1.0:0.0	.	183	Q9NQX6	ZN331_HUMAN	V	183	ENSP00000253144:G183V;ENSP00000427439:G183V;ENSP00000393817:G183V;ENSP00000393336:G183V;ENSP00000421014:G183V;ENSP00000423156:G183V;ENSP00000421728:G183V	ENSP00000253144:G183V	G	+	2	0	ZNF331	58772174	0.782000	0.28689	0.709000	0.30452	0.863000	0.49368	1.991000	0.40727	2.049000	0.60858	0.563000	0.77884	GGG	.	.		0.418	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371366.1	NM_018555	
ZNF543	125919	hgsc.bcm.edu	37	19	57839129	57839129	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr19:57839129A>G	ENST00000321545.4	+	4	644	c.299A>G	c.(298-300)gAg>gGg	p.E100G		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	100					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCCTTGCCTGAGGAAGTCTTA	0.473																																					p.E100G		Atlas-SNP	.											.	ZNF543	61	.	0			c.A299G						.						75.0	76.0	76.0					19																	57839129		2203	4300	6503	SO:0001583	missense	125919	exon4			TGCCTGAGGAAGT	AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.299A>G	chr19.hg19:g.57839129A>G	ENSP00000322545:p.Glu100Gly	239.0	0.0		220.0	46.0	NM_213598	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	ENST00000321545.4	hg19	CCDS33130.1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.431699	0.25813	.	.	ENSG00000178229	ENST00000321545	T	0.27720	1.65	2.87	1.7	0.24286	.	.	.	.	.	T	0.22085	0.0532	L	0.38175	1.15	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.16928	-1.0386	9	0.51188	T	0.08	.	6.4979	0.22152	0.5794:0.4206:0.0:0.0	.	100	Q08ER8	ZN543_HUMAN	G	100	ENSP00000322545:E100G	ENSP00000322545:E100G	E	+	2	0	ZNF543	62530941	0.007000	0.16637	0.013000	0.15412	0.236000	0.25371	1.190000	0.32126	1.320000	0.45209	0.454000	0.30748	GAG	.	.		0.473	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465780.1	XM_064865	
ZSCAN1	284312	hgsc.bcm.edu	37	19	58549467	58549467	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr19:58549467G>A	ENST00000282326.1	+	3	510	c.263G>A	c.(262-264)gGc>gAc	p.G88D	ZSCAN1_ENST00000601162.1_Missense_Mutation_p.G88D|ZSCAN1_ENST00000391700.1_Missense_Mutation_p.G88D	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	88	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CAGTTCCTGGGCGCGCTGCCC	0.697																																					p.G88D		Atlas-SNP	.											.	ZSCAN1	102	.	0			c.G263A						.						18.0	18.0	18.0					19																	58549467		2197	4293	6490	SO:0001583	missense	284312	exon3			TCCTGGGCGCGCT	AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.263G>A	chr19.hg19:g.58549467G>A	ENSP00000282326:p.Gly88Asp	19.0	0.0		37.0	21.0	NM_182572	Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	ENST00000282326.1	hg19	CCDS12969.1	.	.	.	.	.	.	.	.	.	.	G	14.69	2.611798	0.46631	.	.	ENSG00000152467	ENST00000391700;ENST00000282326	T;T	0.04119	3.7;3.7	2.09	0.814	0.18756	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.07007	0.0178	L	0.46157	1.445	0.09310	N	1	P;D	0.56287	0.624;0.975	B;P	0.48815	0.425;0.591	T	0.34054	-0.9844	9	0.56958	D	0.05	.	5.8004	0.18410	0.0:0.3406:0.6594:0.0	.	88;88	Q8NBB4;Q8NBB4-2	ZSCA1_HUMAN;.	D	88	ENSP00000375581:G88D;ENSP00000282326:G88D	ENSP00000282326:G88D	G	+	2	0	ZSCAN1	63241279	0.124000	0.22315	0.574000	0.28523	0.970000	0.65996	0.194000	0.17135	1.170000	0.42753	0.407000	0.27541	GGC	.	.		0.697	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466427.1	NM_182572	
PANK2	80025	hgsc.bcm.edu	37	20	3893207	3893207	+	Silent	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:3893207G>A	ENST00000316562.4	+	4	1344	c.1338G>A	c.(1336-1338)gtG>gtA	p.V446V	PANK2_ENST00000497424.1_Silent_p.V155V|PANK2_ENST00000610179.1_Silent_p.V323V|PANK2_ENST00000464452.1_3'UTR	NM_153638.2	NP_705902.2	Q9BZ23	PANK2_HUMAN	pantothenate kinase 2	446					aerobic respiration (GO:0009060)|cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|mitochondrion morphogenesis (GO:0070584)|pantothenate metabolic process (GO:0015939)|regulation of mitochondrial membrane potential (GO:0051881)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GCACCAAAGTGGATAAACTAG	0.463																																					p.V446V		Atlas-SNP	.											.	PANK2	37	.	0			c.G1338A						.						131.0	138.0	135.0					20																	3893207		2203	4300	6503	SO:0001819	synonymous_variant	80025	exon4			CAAAGTGGATAAA	AK021791	CCDS13071.2, CCDS13072.1	20p13	2008-07-31	2008-07-31	2002-09-06	ENSG00000125779	ENSG00000125779	2.7.1.33		15894	protein-coding gene	gene with protein product	"""Hallervorden-Spatz syndrome"""	606157	"""neurodegeneration with brain iron accumulation 1 (Hallervorden-Spatz syndrome)"""	C20orf48, NBIA1		8944032, 11479594	Standard	XM_005260835		Approved	HSS, FLJ11729, PKAN, HARP	uc002wkc.3	Q9BZ23	OTTHUMG00000031768	ENST00000316562.4:c.1338G>A	chr20.hg19:g.3893207G>A		77.0	0.0		121.0	36.0	NM_153638	B1AK33|B2Z3X0|D3DVZ0|Q5T7I2|Q5T7I4|Q7RTX5|Q8N7Q4|Q8TCR5|Q9BYW5|Q9HAF2	Silent	SNP	ENST00000316562.4	hg19	CCDS13071.2																																																																																			.	.		0.463	PANK2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077793.2	NM_024960	
CEP250	11190	hgsc.bcm.edu	37	20	34057783	34057783	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:34057783A>G	ENST00000397527.1	+	10	1640	c.920A>G	c.(919-921)aAg>aGg	p.K307R	CEP250_ENST00000397524.1_Missense_Mutation_p.K307R|CEP250_ENST00000342580.4_Missense_Mutation_p.K307R	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	307					centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			AAGATGATAAAGGCTCTGAGA	0.468																																					p.K307R		Atlas-SNP	.											.	CEP250	141	.	0			c.A920G						.						97.0	89.0	92.0					20																	34057783		2203	4300	6503	SO:0001583	missense	11190	exon10			TGATAAAGGCTCT	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.920A>G	chr20.hg19:g.34057783A>G	ENSP00000380661:p.Lys307Arg	66.0	0.0		85.0	38.0	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	hg19	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	A	16.21	3.059726	0.55325	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000397524;ENST00000425934	T;T;T;T	0.46063	2.85;2.93;0.88;1.96	5.59	3.2	0.36748	.	2.494980	0.01519	N	0.018286	T	0.42966	0.1226	L	0.55834	1.745	0.27549	N	0.950548	B;P	0.44044	0.302;0.825	B;B	0.41813	0.053;0.367	T	0.23726	-1.0180	10	0.34782	T	0.22	.	6.2298	0.20728	0.7832:0.0:0.0758:0.141	.	307;307	A6PVI9;Q9BV73	.;CP250_HUMAN	R	307	ENSP00000380661:K307R;ENSP00000341541:K307R;ENSP00000380658:K307R;ENSP00000413827:K307R	ENSP00000341541:K307R	K	+	2	0	CEP250	33521197	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	1.601000	0.36773	0.943000	0.37553	0.533000	0.62120	AAG	.	.		0.468	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
PLCG1	5335	hgsc.bcm.edu	37	20	39792440	39792440	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:39792440T>C	ENST00000373271.1	+	10	1382	c.977T>C	c.(976-978)cTt>cCt	p.L326P	PLCG1_ENST00000373272.2_Missense_Mutation_p.L326P|PLCG1_ENST00000244007.3_Missense_Mutation_p.L326P	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	326	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				AACAACCCTCTTTCCCACTAC	0.547																																					p.L326P		Atlas-SNP	.											.	PLCG1	111	.	0			c.T977C						.						143.0	134.0	137.0					20																	39792440		2203	4300	6503	SO:0001583	missense	5335	exon10			ACCCTCTTTCCCA	M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.977T>C	chr20.hg19:g.39792440T>C	ENSP00000362368:p.Leu326Pro	73.0	0.0		82.0	39.0	NM_182811	B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	ENST00000373271.1	hg19	CCDS13314.1	.	.	.	.	.	.	.	.	.	.	T	16.11	3.030122	0.54790	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	T;T;T	0.71579	-0.58;-0.58;-0.58	5.69	4.59	0.56863	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.000000	0.85682	D	0.000000	D	0.89887	0.6845	H	0.98833	4.345	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91999	0.5609	10	0.87932	D	0	.	11.7443	0.51811	0.0:0.069:0.0:0.931	.	326;326	P19174;A2A284	PLCG1_HUMAN;.	P	326	ENSP00000244007:L326P;ENSP00000362368:L326P;ENSP00000362369:L326P	ENSP00000244007:L326P	L	+	2	0	PLCG1	39225854	1.000000	0.71417	0.059000	0.19551	0.513000	0.34164	6.295000	0.72744	0.978000	0.38470	-0.274000	0.10170	CTT	.	.		0.547	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080514.3	NM_182811	
MYBL2	4605	hgsc.bcm.edu	37	20	42338684	42338684	+	Silent	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:42338684C>T	ENST00000217026.4	+	10	1714	c.1587C>T	c.(1585-1587)taC>taT	p.Y529Y	MYBL2_ENST00000396863.4_Silent_p.Y505Y	NM_002466.2	NP_002457.1	P10244	MYBB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 2	529					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|spindle assembly involved in mitosis (GO:0090307)	Myb complex (GO:0031523)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	46		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			TGGAGAAGTACGGACCCCTGA	0.592																																					p.Y529Y		Atlas-SNP	.											.	MYBL2	82	.	0			c.C1587T						.						153.0	151.0	152.0					20																	42338684		2203	4300	6503	SO:0001819	synonymous_variant	4605	exon10			GAAGTACGGACCC		CCDS13322.1, CCDS63276.1	20q13.1	2013-07-09	2013-07-09		ENSG00000101057	ENSG00000101057			7548	protein-coding gene	gene with protein product		601415				8812502	Standard	NM_002466		Approved	BMYB, B-MYB	uc002xlb.1	P10244	OTTHUMG00000033062	ENST00000217026.4:c.1587C>T	chr20.hg19:g.42338684C>T		103.0	0.0		71.0	16.0	NM_002466	B2RBS5|B7Z8D9|F8W6N6|Q53F07	Silent	SNP	ENST00000217026.4	hg19	CCDS13322.1																																																																																			.	.		0.592	MYBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080408.1	NM_002466	
LAMA5	3911	hgsc.bcm.edu	37	20	60892042	60892042	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:60892042T>C	ENST00000252999.3	-	56	7615	c.7549A>G	c.(7549-7551)Agg>Ggg	p.R2517G		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2517	Domain II and I.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TCGATGGCCCTCTGGGTGAGG	0.682																																					p.R2517G		Atlas-SNP	.											.	LAMA5	268	.	0			c.A7549G						.						59.0	53.0	55.0					20																	60892042		2186	4281	6467	SO:0001583	missense	3911	exon56			TGGCCCTCTGGGT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7549A>G	chr20.hg19:g.60892042T>C	ENSP00000252999:p.Arg2517Gly	23.0	0.0		32.0	17.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	hg19	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	-	9.580	1.123238	0.20959	.	.	ENSG00000130702	ENST00000252999	T	0.19394	2.15	4.26	0.783	0.18572	.	0.090855	0.41500	U	0.000878	T	0.28001	0.0690	M	0.61703	1.905	0.80722	D	1	P	0.47762	0.9	P	0.47044	0.535	T	0.05241	-1.0897	10	0.46703	T	0.11	.	14.192	0.65644	0.0:0.0:0.232:0.768	.	2517	O15230	LAMA5_HUMAN	G	2517	ENSP00000252999:R2517G	ENSP00000252999:R2517G	R	-	1	2	LAMA5	60325437	0.965000	0.33210	0.994000	0.49952	0.375000	0.29983	0.386000	0.20702	-0.156000	0.11079	0.235000	0.17854	AGG	.	.		0.682	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
DIDO1	11083	hgsc.bcm.edu	37	20	61525548	61525548	+	Splice_Site	SNP	T	T	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:61525548T>A	ENST00000266070.4	-	12	2898		c.e12-2		DIDO1_ENST00000395343.1_Splice_Site|DIDO1_ENST00000395335.2_Splice_Site|DIDO1_ENST00000395340.1_Splice_Site	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1						apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GAACCTGGCCTGAAGAAGGCG	0.473																																					.	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.2573-2A>T						.						62.0	72.0	69.0					20																	61525548		2161	4265	6426	SO:0001630	splice_region_variant	11083	exon13			CTGGCCTGAAGAA	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.2573-2A>T	chr20.hg19:g.61525548T>A		41.0	0.0		38.0	17.0	NM_001193369	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Splice_Site	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	T	13.26	2.183011	0.38511	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2987	0.82793	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DIDO1	60995993	1.000000	0.71417	0.996000	0.52242	0.171000	0.22731	6.755000	0.74914	2.257000	0.74773	0.459000	0.35465	.	.	.		0.473	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	Intron
ZGPAT	84619	hgsc.bcm.edu	37	20	62340049	62340049	+	Silent	SNP	G	G	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:62340049G>A	ENST00000328969.5	+	2	244	c.117G>A	c.(115-117)ctG>ctA	p.L39L	ARFRP1_ENST00000359715.5_5'Flank|ZGPAT_ENST00000448100.2_Silent_p.L39L|ARFRP1_ENST00000324228.2_5'Flank|RP4-583P15.15_ENST00000490623.2_5'Flank|ZGPAT_ENST00000355969.6_Silent_p.L39L|ARFRP1_ENST00000609142.1_5'Flank|ARFRP1_ENST00000440854.1_5'Flank|ZGPAT_ENST00000357119.4_Silent_p.L39L|ARFRP1_ENST00000607873.1_5'Flank|ZGPAT_ENST00000369967.3_Silent_p.L39L	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	39					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					TGCGCCAGCTGCAGGGGGACC	0.677																																					p.L39L		Atlas-SNP	.											.	ZGPAT	57	.	0			c.G117A						.						35.0	38.0	37.0					20																	62340049		2202	4293	6495	SO:0001819	synonymous_variant	84619	exon2			CCAGCTGCAGGGG	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.117G>A	chr20.hg19:g.62340049G>A		43.0	0.0		41.0	15.0	NM_032527	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Silent	SNP	ENST00000328969.5	hg19	CCDS13534.1																																																																																			.	.		0.677	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
DGCR14	8220	hgsc.bcm.edu	37	22	19124884	19124884	+	Silent	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr22:19124884T>C	ENST00000252137.6	-	8	1030	c.987A>G	c.(985-987)gaA>gaG	p.E329E		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	329					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					TTTCCGACCCTTCAACTCTCA	0.592																																					p.E329E		Atlas-SNP	.											.	DGCR14	43	.	0			c.A987G						.						227.0	197.0	207.0					22																	19124884		2203	4300	6503	SO:0001819	synonymous_variant	8220	exon8			CGACCCTTCAACT	L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.987A>G	chr22.hg19:g.19124884T>C		148.0	0.0		126.0	52.0	NM_022719	Q49AH7|Q9BTZ4	Silent	SNP	ENST00000252137.6	hg19	CCDS13756.1																																																																																			.	.		0.592	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316432.2		
MORC2	22880	hgsc.bcm.edu	37	22	31328358	31328358	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr22:31328358T>C	ENST00000397641.3	-	24	3237	c.2829A>G	c.(2827-2829)atA>atG	p.I943M	MORC2_ENST00000215862.4_Missense_Mutation_p.I881M|MORC2-AS1_ENST00000441558.1_RNA			Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	943						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	21						GAGGAAAAGATATTAGCTCAT	0.468																																					p.I881M		Atlas-SNP	.											.	MORC2	78	.	0			c.A2643G						.						138.0	126.0	130.0					22																	31328358		2203	4300	6503	SO:0001583	missense	22880	exon25			AAAAGATATTAGC	AB020659	CCDS33636.1	22q12.2	2005-06-15	2005-06-15	2005-06-15	ENSG00000133422	ENSG00000133422			23573	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 1"", ""zinc finger, CW type with coiled-coil domain 1"""	ZCWCC1		14607086	Standard	XM_005261391		Approved	ZCW3, KIAA0852, AC004542.C22.1	uc003aje.1	Q9Y6X9	OTTHUMG00000151193	ENST00000397641.3:c.2829A>G	chr22.hg19:g.31328358T>C	ENSP00000380763:p.Ile943Met	69.0	0.0		54.0	30.0	NM_014941	B2RNB1|Q9UF28|Q9Y6V2	Missense_Mutation	SNP	ENST00000397641.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.12|14.12	2.439573|2.439573	0.43326|0.43326	.|.	.|.	ENSG00000133422|ENSG00000133422	ENST00000397641;ENST00000215862|ENST00000445980	T;T|.	0.12569|.	2.67;2.67|.	5.48|5.48	-1.46|-1.46	0.08800|0.08800	.|.	0.235047|0.235047	0.47455|0.47455	D|D	0.000232|0.000232	T|T	0.24851|0.24851	0.0603|0.0603	N|N	0.12182|0.12182	0.205|0.205	0.80722|0.80722	D|D	1|1	B|.	0.26195|.	0.144|.	B|.	0.14023|.	0.01|.	T|T	0.27054|0.27054	-1.0085|-1.0085	10|7	0.45353|0.02654	T|T	0.12|1	.|.	7.8002|7.8002	0.29170|0.29170	0.0:0.1088:0.5719:0.3193|0.0:0.1088:0.5719:0.3193	.|.	943|.	Q9Y6X9|.	MORC2_HUMAN|.	M|V	943;881|105	ENSP00000380763:I943M;ENSP00000215862:I881M|.	ENSP00000215862:I881M|ENSP00000402602:I105V	I|I	-|-	3|1	3|0	MORC2|MORC2	29658358|29658358	0.998000|0.998000	0.40836|0.40836	0.812000|0.812000	0.32479|0.32479	0.977000|0.977000	0.68977|0.68977	0.541000|0.541000	0.23207|0.23207	-0.158000|-0.158000	0.11040|0.11040	0.533000|0.533000	0.62120|0.62120	ATA|ATC	.	.		0.468	MORC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000321710.2	NM_014941	
HDAC10	83933	hgsc.bcm.edu	37	22	50688856	50688856	+	Splice_Site	SNP	C	C	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr22:50688856C>A	ENST00000216271.5	-	3	643	c.291G>T	c.(289-291)ccG>ccT	p.P97P	HDAC10_ENST00000498366.1_Intron|HDAC10_ENST00000448072.1_Splice_Site_p.P97P|HDAC10_ENST00000349505.4_Splice_Site_p.P97P|MAPK12_ENST00000497036.1_5'UTR	NM_001159286.1|NM_032019.5	NP_001152758.1|NP_114408.3	Q969S8	HDA10_HUMAN	histone deacetylase 10	97	Histone deacetylase.				chromatin modification (GO:0016568)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|oligodendrocyte development (GO:0014003)|protein deacetylation (GO:0006476)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)			endometrium(2)|kidney(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	8		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGACACGCACCGGGTGGAAGT	0.637																																					p.P97P		Atlas-SNP	.											.	HDAC10	29	.	0			c.G291T						.						122.0	95.0	104.0					22																	50688856		2201	4300	6501	SO:0001630	splice_region_variant	83933	exon3			ACGCACCGGGTGG	AF393962	CCDS14088.1, CCDS54545.1	22q13.31	2008-06-10			ENSG00000100429	ENSG00000100429			18128	protein-coding gene	gene with protein product		608544				11677242, 11726666	Standard	NM_032019		Approved	DKFZP761B039	uc003bkg.3	Q969S8	OTTHUMG00000044647	ENST00000216271.5:c.291+1G>T	chr22.hg19:g.50688856C>A		68.0	0.0		57.0	36.0	NM_032019	Q08AP4|Q6STF9|Q96P77|Q96P78|Q9H028|Q9UGX1|Q9UGX2	Silent	SNP	ENST00000216271.5	hg19	CCDS14088.1																																																																																			.	.		0.637	HDAC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104141.4	NM_032019	Silent
ITM2A	9452	hgsc.bcm.edu	37	X	78618461	78618461	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chrX:78618461G>C	ENST00000373298.2	-	3	562	c.419C>G	c.(418-420)gCa>gGa	p.A140G	ITM2A_ENST00000469541.1_5'UTR|ITM2A_ENST00000434584.2_Missense_Mutation_p.A96G	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A	140	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.					integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						ATGAATAATTGCTGCAGGGTC	0.408																																					p.A140G		Atlas-SNP	.											.	ITM2A	51	.	0			c.C419G						.						88.0	77.0	80.0					X																	78618461		2203	4300	6503	SO:0001583	missense	9452	exon3			ATAATTGCTGCAG	BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.419C>G	chrX.hg19:g.78618461G>C	ENSP00000362395:p.Ala140Gly	140.0	1.0		157.0	140.0	NM_004867	B2R7X5|B4E062|Q6IBC9	Missense_Mutation	SNP	ENST00000373298.2	hg19	CCDS14444.1	.	.	.	.	.	.	.	.	.	.	g	11.67	1.706964	0.30232	.	.	ENSG00000078596	ENST00000373298;ENST00000434584	T;T	0.79554	-1.28;-1.28	4.38	3.49	0.39957	BRICHOS (2);	0.136419	0.50627	D	0.000116	T	0.82066	0.4956	L	0.41236	1.265	0.42052	D	0.991127	B;D	0.64830	0.182;0.994	B;D	0.64506	0.102;0.926	T	0.77284	-0.2645	10	0.22706	T	0.39	-9.0789	11.5645	0.50796	0.0:0.0:0.8199:0.1801	.	96;140	B4E062;O43736	.;ITM2A_HUMAN	G	140;96	ENSP00000362395:A140G;ENSP00000415533:A96G	ENSP00000362395:A140G	A	-	2	0	ITM2A	78505117	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	4.184000	0.58323	0.634000	0.30469	0.534000	0.68092	GCA	.	.		0.408	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057329.1	NM_004867	
PABPC5	140886	hgsc.bcm.edu	37	X	90690655	90690655	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chrX:90690655C>T	ENST00000312600.3	+	2	293	c.79C>T	c.(79-81)Cca>Tca	p.P27S	PABPC5_ENST00000373105.1_Intron|PABPC5-AS1_ENST00000456187.1_RNA	NM_080832.2	NP_543022.1	Q96DU9	PABP5_HUMAN	poly(A) binding protein, cytoplasmic 5	27	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					mitochondrion (GO:0005739)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(1)|pancreas(1)	42						TGACTTGGACCCAGATGTCAC	0.592																																					p.P27S		Atlas-SNP	.											.	PABPC5	92	.	0			c.C79T						.						70.0	54.0	60.0					X																	90690655		2203	4300	6503	SO:0001583	missense	140886	exon2			TTGGACCCAGATG	AJ278963	CCDS14460.1	Xq21.3	2013-02-12	2001-11-28		ENSG00000174740	ENSG00000174740		"""RNA binding motif (RRM) containing"""	13629	protein-coding gene	gene with protein product		300407	"""poly(A)-binding protein, cytoplasmic 5"""			11374897	Standard	NM_080832		Approved	PABP5	uc004efg.3	Q96DU9	OTTHUMG00000021959	ENST00000312600.3:c.79C>T	chrX.hg19:g.90690655C>T	ENSP00000308012:p.Pro27Ser	61.0	0.0		62.0	15.0	NM_080832	A8K240|Q5JQF4|Q6P529|Q9UFE5	Missense_Mutation	SNP	ENST00000312600.3	hg19	CCDS14460.1	.	.	.	.	.	.	.	.	.	.	C	17.38	3.374970	0.61735	.	.	ENSG00000174740	ENST00000312600	T	0.16897	2.31	4.43	4.43	0.53597	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.050090	0.85682	D	0.000000	T	0.18130	0.0435	L	0.52206	1.635	0.80722	D	1	B	0.22080	0.064	B	0.22880	0.042	T	0.02691	-1.1123	10	0.40728	T	0.16	.	13.8904	0.63736	0.0:1.0:0.0:0.0	.	27	Q96DU9	PABP5_HUMAN	S	27	ENSP00000308012:P27S	ENSP00000308012:P27S	P	+	1	0	PABPC5	90577311	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.485000	0.60279	2.450000	0.82876	0.600000	0.82982	CCA	.	.		0.592	PABPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057429.1	NM_080832	
IRS4	8471	hgsc.bcm.edu	37	X	107977380	107977380	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chrX:107977380T>C	ENST00000372129.2	-	1	2271	c.2195A>G	c.(2194-2196)cAc>cGc	p.H732R	RP6-24A23.6_ENST00000563887.1_5'Flank|RP6-24A23.3_ENST00000436013.1_RNA|RP6-24A23.3_ENST00000608811.1_RNA	NM_003604.2	NP_003595.1	O14654	IRS4_HUMAN	insulin receptor substrate 4	732	CRK-binding.				positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(1)	78						GGATCGAGAGTGGCGCTTTTT	0.502																																					p.H732R		Atlas-SNP	.											.	IRS4	253	.	0			c.A2195G						.						71.0	72.0	72.0					X																	107977380		2203	4300	6503	SO:0001583	missense	8471	exon1			CGAGAGTGGCGCT	AF007567	CCDS14544.1	Xq22.3	2008-08-01			ENSG00000133124	ENSG00000133124			6128	protein-coding gene	gene with protein product		300904				9261155, 9553137	Standard	NM_003604		Approved	PY160, IRS-4	uc004eoc.2	O14654	OTTHUMG00000022181	ENST00000372129.2:c.2195A>G	chrX.hg19:g.107977380T>C	ENSP00000361202:p.His732Arg	115.0	0.0		85.0	78.0	NM_003604		Missense_Mutation	SNP	ENST00000372129.2	hg19	CCDS14544.1	.	.	.	.	.	.	.	.	.	.	T	12.44	1.939889	0.34189	.	.	ENSG00000133124	ENST00000372129	T	0.18174	2.23	5.33	4.16	0.48862	.	0.665344	0.14620	N	0.308478	T	0.27313	0.0670	L	0.57536	1.79	0.09310	N	1	D	0.67145	0.996	P	0.59595	0.86	T	0.07986	-1.0744	10	0.12430	T	0.62	-19.4821	8.3647	0.32380	0.0:0.1562:0.0:0.8438	.	732	O14654	IRS4_HUMAN	R	732	ENSP00000361202:H732R	ENSP00000361202:H732R	H	-	2	0	IRS4	107864036	1.000000	0.71417	0.765000	0.31456	0.970000	0.65996	2.867000	0.48428	1.955000	0.56771	0.486000	0.48141	CAC	.	.		0.502	IRS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057879.1	NM_003604	
MAGEA6	4105	hgsc.bcm.edu	37	X	151870008	151870008	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chrX:151870008G>T	ENST00000329342.5	+	3	923	c.698G>T	c.(697-699)gGg>gTg	p.G233V		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	233	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GTGTTTGAGGGGAGGGAAGAC	0.537																																					p.G233V		Atlas-SNP	.											.	MAGEA6	53	.	0			c.G698T						.						161.0	156.0	158.0					X																	151870008		2202	4300	6502	SO:0001583	missense	4105	exon3			TTGAGGGGAGGGA		CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.698G>T	chrX.hg19:g.151870008G>T	ENSP00000329199:p.Gly233Val	134.0	0.0		222.0	10.0	NM_005363	A8IF93|Q6NW44	Missense_Mutation	SNP	ENST00000329342.5	hg19	CCDS14708.1	.	.	.	.	.	.	.	.	.	.	g	9.860	1.196128	0.22037	.	.	ENSG00000197172	ENST00000329342;ENST00000457643	T;T	0.05513	3.43;3.43	0.605	0.605	0.17553	.	.	.	.	.	T	0.30103	0.0754	H	0.95043	3.615	0.19300	N	0.999979	D	0.55605	0.972	D	0.65987	0.94	T	0.04708	-1.0932	8	0.87932	D	0	.	.	.	.	.	233	P43360	MAGA6_HUMAN	V	233	ENSP00000329199:G233V;ENSP00000401806:G233V	ENSP00000329199:G233V	G	+	2	0	MAGEA6	151620664	0.000000	0.05858	0.007000	0.13788	0.130000	0.20726	-1.239000	0.02916	0.573000	0.29400	0.181000	0.17075	GGG	.	.		0.537	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058747.2	NM_005363	
DSPP	1834	hgsc.bcm.edu	37	4	88537080	88537088	+	In_Frame_Del	DEL	ACAGCAGCA	ACAGCAGCA	-	rs367717407|rs201754564|rs370267258|rs553101049	byFrequency	TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	ACAGCAGCA	ACAGCAGCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr4:88537080_88537088delACAGCAGCA	ENST00000282478.7	+	4	3299_3307	c.3266_3274delACAGCAGCA	c.(3265-3276)gacagcagcaat>gat	p.SSN1090del	DSPP_ENST00000399271.1_In_Frame_Del_p.SSN1090del|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1090	Asp/Ser-rich.			Missing (in Ref. 1; AAF42472 and 3; AAD16120). {ECO:0000305}.	biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gatagcagtgacagcagcaatagcagtga	0.536																																					p.1089_1091del		Atlas-INDEL	.											.	DSPP	174	.	0			c.3265_3273del						.			1444,630		641,162,234						0.5	0.0			23	2259,1617		893,473,572	no	coding	DSPP	NM_014208.3		1534,635,806	A1A1,A1R,RR		41.7183,30.3761,37.7647				3703,2247				SO:0001651	inframe_deletion	1834	exon5			.	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3266_3274delACAGCAGCA	chr4.hg19:g.88537080_88537088delACAGCAGCA	ENSP00000282478:p.Ser1090_Asn1092del	75.0	0.0		84.0	20.0	NM_014208	A8MUI0|O95815	In_Frame_Del	DEL	ENST00000282478.7	hg19	CCDS43248.1																																																																																			.	.		0.536	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
OR2W5	441932	hgsc.bcm.edu	37	1	247655247	247655247	+	RNA	DEL	T	T	-			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr1:247655247delT	ENST00000522351.1	+	0	878							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TCAGGGGAAGTTCCTGACTCT	0.512																																					p.V273fs		Atlas-Indel,Pindel	.											.	OR2W5	97	.	0			c.817delG						.						129.0	115.0	120.0					1																	247655247		2203	4300	6503			441932	exon1			.			1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		chr1.hg19:g.247655247delT		180.0	0.0		301.0	101.0	NM_001004698	B9EH85	Frame_Shift_Del	DEL	ENST00000522351.1	hg19																																																																																				.	.		0.512	OR2W5-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000375789.1	NM_001004698	
NWD2	57495	hgsc.bcm.edu	37	4	37432206	37432207	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr4:37432206_37432207insA	ENST00000309447.5	+	4	1218_1219	c.370_371insA	c.(370-372)gaafs	p.E124fs		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		124										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						ACTATTAGGTGAAAAATATGGG	0.381																																					p.E124fs		Atlas-Indel,Pindel	.											.	KIAA1239	79	.	0			c.370_371insA						.																																			SO:0001589	frameshift_variant	57495	exon4			.																												ENST00000309447.5:c.375dupA	chr4.hg19:g.37432211_37432211dupA	ENSP00000309501:p.Glu124fs	60.0	0.0		64.0	29.0	NM_001144990	A8MRU1	Frame_Shift_Ins	INS	ENST00000309447.5	hg19	CCDS47040.1																																																																																			.	.		0.381	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
PIGW	284098	hgsc.bcm.edu	37	17	34894023	34894034	+	In_Frame_Del	DEL	AAGTAAATGTAG	AAGTAAATGTAG	-	rs138980777|rs551293655	byFrequency	TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	AAGTAAATGTAG	AAGTAAATGTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr17:34894023_34894034delAAGTAAATGTAG	ENST00000592983.1	+	2	1653_1664	c.1073_1084delAAGTAAATGTAG	c.(1072-1086)caagtaaatgtagaa>caa	p.VNVE359del	MYO19_ENST00000590081.1_Intron|PIGW_ENST00000328396.2_In_Frame_Del_p.VNVE359del			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	359					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TACGTAGTTCAAGTAAATGTAGAAGCAGTATC	0.34																																					p.358_361del		Atlas-Indel,Pindel	.											.	PIGW	50	.	0			c.1072_1083del						.																																			SO:0001651	inframe_deletion	284098	exon2			.	AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.1073_1084delAAGTAAATGTAG	chr17.hg19:g.34894023_34894034delAAGTAAATGTAG	ENSP00000468778:p.Val359_Glu362del	53.0	0.0		53.0	12.0	NM_178517	Q8N9G3	In_Frame_Del	DEL	ENST00000592983.1	hg19	CCDS11313.1																																																																																			.	.		0.340	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451318.1	NM_178517	
SP3	6670	hgsc.bcm.edu	37	2	174820558	174820558	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr2:174820558delT	ENST00000310015.6	-	4	1212	c.682delA	c.(682-684)atafs	p.I228fs	SP3_ENST00000455789.2_Frame_Shift_Del_p.I175fs|SP3_ENST00000418194.2_Frame_Shift_Del_p.I160fs|SP3_ENST00000483084.1_5'Flank	NM_001172712.1|NM_003111.4	NP_001166183.1|NP_003102.1	Q02447	SP3_HUMAN	Sp3 transcription factor	228	Transactivation domain (Gln-rich).				B cell differentiation (GO:0030183)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|granulocyte differentiation (GO:0030851)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|monocyte differentiation (GO:0030224)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|T cell differentiation (GO:0030217)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)		EWSR1/SP3(3)	NS(2)|large_intestine(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.185)			GTCTGTGGTATGAGATTCTGG	0.453																																					p.I228fs		Atlas-Indel,Pindel	.											.	SP3	82	.	0			c.683delT						.						141.0	144.0	143.0					2																	174820558		2203	4300	6503	SO:0001589	frameshift_variant	6670	exon4			.	M97191	CCDS2254.1, CCDS46452.1	2q31	2013-01-08			ENSG00000172845	ENSG00000172845		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11208	protein-coding gene	gene with protein product		601804				1341900, 1454515	Standard	NM_003111		Approved	SPR-2	uc002uig.3	Q02447	OTTHUMG00000132333	ENST00000310015.6:c.682delA	chr2.hg19:g.174820558delT	ENSP00000310301:p.Ile228fs	71.0	0.0		63.0	32.0	NM_003111	A0AVL9|B4E2B7|Q69B26|Q69B27|Q8TD56|Q8WWU4|Q9BQR1	Frame_Shift_Del	DEL	ENST00000310015.6	hg19	CCDS2254.1																																																																																			.	.		0.453	SP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255452.1	NM_003111	
UBXN7	26043	hgsc.bcm.edu	37	3	196159225	196159226	+	In_Frame_Ins	INS	-	-	CCC			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr3:196159225_196159226insCCC	ENST00000296328.4	-	1	119_120	c.45_46insGGG	c.(43-48)gggtta>gggGGGtta	p.15_16insG	UBXN7_ENST00000535858.1_5'UTR|UBXN7_ENST00000428095.1_5'UTR|UBXN7-AS1_ENST00000442941.1_RNA|UBXN7-AS1_ENST00000598881.1_RNA	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	15						Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TGTTGAATTAACCCCTTCAGCG	0.668																																					p.L16delinsGL		Atlas-Indel,Pindel	.											.	UBXN7	43	.	0			c.46_47insGGG						.																																			SO:0001652	inframe_insertion	26043	exon1			.	AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.43_45dupGGG	chr3.hg19:g.196159226_196159228dupCCC	ENSP00000296328:p.Gly15_Gly15dup	154.0	0.0		152.0	58.0	NM_015562	D3DXB3|Q6ZP77|Q86X20|Q8N327	In_Frame_Ins	INS	ENST00000296328.4	hg19	CCDS43191.1																																																																																			.	.		0.668	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340938.2	XM_087353	
FAM83D	81610	hgsc.bcm.edu	37	20	37580989	37580998	+	Frame_Shift_Del	DEL	CAAAGAGCGG	CAAAGAGCGG	-	rs147472094|rs545956434	byFrequency	TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	CAAAGAGCGG	CAAAGAGCGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr20:37580989_37580998delCAAAGAGCGG	ENST00000217429.4	+	4	1715_1724	c.1674_1683delCAAAGAGCGG	c.(1672-1683)aacaaagagcggfs	p.NKER558fs		NM_030919.2	NP_112181.2	Q9H4H8	FA83D_HUMAN	family with sequence similarity 83, member D	528					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.R561W(1)		endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)|stomach(1)	28		Myeloproliferative disorder(115;0.00878)				GAAACTTGAACAAAGAGCGGCAATTCCACT	0.505																																					p.558_561del		Atlas-Indel,Pindel	.											FAM83D,NS,carcinoma,0,1	FAM83D	60	.	1	Substitution - Missense(1)	large_intestine(1)	c.1673_1682del						.																																			SO:0001589	frameshift_variant	81610	exon4			.	AL023803	CCDS42872.1	20q11.23	2014-03-13	2006-03-23	2006-03-23	ENSG00000101447	ENSG00000101447			16122	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 129"""	C20orf129		23205133	Standard	NM_030919		Approved	dJ616B8.3	uc002xjg.3	Q9H4H8	OTTHUMG00000032462	ENST00000217429.4:c.1674_1683delCAAAGAGCGG	chr20.hg19:g.37580989_37580998delCAAAGAGCGG	ENSP00000217429:p.Asn558fs	125.0	0.0		89.0	16.0	NM_030919	B4E1I7|Q5THR2|Q68EN1|Q6P457|Q7Z6H0|Q96DF5|Q96N89|Q9BVM8	Frame_Shift_Del	DEL	ENST00000217429.4	hg19	CCDS42872.1																																																																																			.	.		0.505	FAM83D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079211.1		
ZDHHC20	253832	hgsc.bcm.edu	37	13	21974596	21974597	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr13:21974596_21974597insA	ENST00000400590.3	-	7	707_708	c.509_510insT	c.(508-510)ttcfs	p.F170fs	ZDHHC20_ENST00000320220.9_Frame_Shift_Ins_p.F170fs|ZDHHC20_ENST00000494731.1_5'UTR|ZDHHC20_ENST00000382466.3_Frame_Shift_Ins_p.F170fs|ZDHHC20_ENST00000542645.1_Frame_Shift_Ins_p.F107fs|ZDHHC20_ENST00000415724.1_Frame_Shift_Ins_p.F170fs			Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20	170					protein palmitoylation (GO:0018345)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	9		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		ACAGCAGGAAGAATTTGTAATT	0.307																																					p.F170fs		Atlas-Indel,Pindel	.											.	ZDHHC20	36	.	0			c.510_511insT						.																																			SO:0001589	frameshift_variant	253832	exon7			.	AK090979	CCDS45017.1, CCDS73551.1	13q12.11	2008-10-21			ENSG00000180776	ENSG00000180776		"""Zinc fingers, DHHC-type"""	20749	protein-coding gene	gene with protein product							Standard	NM_153251		Approved	FLJ25952	uc001uoa.2	Q5W0Z9	OTTHUMG00000017410	ENST00000400590.3:c.510dupT	chr13.hg19:g.21974598_21974598dupA	ENSP00000383433:p.Phe170fs	332.0	0.0		405.0	177.0	NM_153251	A8MTV9|C9JG20|I6L9D4|Q2TB82|Q6NVU8	Frame_Shift_Ins	INS	ENST00000400590.3	hg19																																																																																				.	.		0.307	ZDHHC20-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000045994.1	NM_153251	
PTEN	5728	hgsc.bcm.edu	37	10	89653856	89653857	+	Frame_Shift_Ins	INS	-	-	ATGTAGTAAGGTAAGAATGCTTTGATTTTCTATTTCAA			TCGA-G3-A6UC-01A-21D-A33K-10	TCGA-G3-A6UC-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	ec3c8a89-d074-4f74-afca-6f67a8fb7ce4	fe550293-61ff-43cb-aace-8ff6e6889a33	g.chr10:89653856_89653857insATGTAGTAAGGTAAGAATGCTTTGATTTTCTATTTCAA	ENST00000371953.3	+	2	1511_1512	c.154_155insATGTAGTAAGGTAAGAATGCTTTGATTTTCTATTTCAA	c.(154-156)gatfs	p.-52fs		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(8)|p.Y27fs*1(2)|p.D52del(2)|p.D52N(1)|p.D52G(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		CAATATTGATGATGTAGTAAGG	0.297		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.D52_V53delinsDVVRX		Pindel	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,caecum,carcinoma,-2,2	PTEN	3652	.	51	Whole gene deletion(37)|Unknown(8)|Substitution - Missense(2)|Deletion - In frame(2)|Deletion - Frameshift(2)	prostate(14)|skin(9)|central_nervous_system(8)|haematopoietic_and_lymphoid_tissue(4)|lung(4)|endometrium(3)|ovary(3)|breast(2)|soft_tissue(1)|urinary_tract(1)|NS(1)|kidney(1)	c.154_155insATGTAGTAAGGTAAGAATGCTTTGATTTTCTATTTCAA	GRCh37	CD075524	PTEN	D		.																																			SO:0001589	frameshift_variant	5728	exon2	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	Exception_encountered	chr10.hg19:g.89653856_89653857insATGTAGTAAGGTAAGAATGCTTTGATTTTCTATTTCAA	ENSP00000361021:p.Asp52fs	51.0	0.0		63.0	10.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Ins	INS	ENST00000371953.3	hg19	CCDS31238.1																																																																																			.	.		0.297	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
