#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EPHA8	2046	hgsc.bcm.edu	37	1	22915685	22915685	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:22915685C>T	ENST00000166244.3	+	5	1373	c.1301C>T	c.(1300-1302)aCc>aTc	p.T434I	EPHA8_ENST00000374644.4_Missense_Mutation_p.T434I|EPHA8_ENST00000538803.1_Missense_Mutation_p.T434I	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	434	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GTCAACATCACCACGAACCAG	0.657																																					p.T434I		Atlas-SNP	.											.	EPHA8	221	.	0			c.C1301T						.						36.0	35.0	35.0					1																	22915685		2203	4300	6503	SO:0001583	missense	2046	exon5			ACATCACCACGAA	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.1301C>T	chr1.hg19:g.22915685C>T	ENSP00000166244:p.Thr434Ile	104.0	0.0		99.0	28.0	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	hg19	CCDS225.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.636454	0.87760	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.55930	0.49;4.89;4.89	4.52	4.52	0.55395	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.75831	0.3903	M	0.86502	2.82	0.80722	D	1	B;D	0.89917	0.28;1.0	B;D	0.78314	0.044;0.991	T	0.81163	-0.1058	10	0.87932	D	0	.	16.3069	0.82852	0.0:1.0:0.0:0.0	.	434;434	P29322;P29322-2	EPHA8_HUMAN;.	I	434	ENSP00000166244:T434I;ENSP00000363775:T434I;ENSP00000440274:T434I	ENSP00000166244:T434I	T	+	2	0	EPHA8	22788272	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	5.756000	0.68757	2.498000	0.84270	0.436000	0.28706	ACC	.	.		0.657	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
C1QC	714	hgsc.bcm.edu	37	1	22970634	22970634	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:22970634G>A	ENST00000374639.3	+	2	236	c.118G>A	c.(118-120)Ggc>Agc	p.G40S	C1QC_ENST00000374637.1_Missense_Mutation_p.G40S|C1QC_ENST00000374640.4_Missense_Mutation_p.G40S	NM_001114101.1	NP_001107573.1	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	40	Collagen-like.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGGGATGCCCGGCCTGCCCGG	0.692																																					p.G40S	Ovarian(26;671 750 8290 29071 43278)	Atlas-SNP	.											.	C1QC	35	.	0			c.G118A						.						15.0	17.0	16.0					1																	22970634		2193	4278	6471	SO:0001583	missense	714	exon2			ATGCCCGGCCTGC	AK057792	CCDS227.1	1p36.11	2014-09-17	2006-02-09	2006-02-09	ENSG00000159189	ENSG00000159189		"""Complement system"""	1245	protein-coding gene	gene with protein product		120575	"""complement component 1, q subcomponent, gamma polypeptide"""	C1QG		1706597	Standard	NM_001114101		Approved		uc001bga.4	P02747	OTTHUMG00000002891	ENST00000374639.3:c.118G>A	chr1.hg19:g.22970634G>A	ENSP00000363770:p.Gly40Ser	115.0	0.0		99.0	37.0	NM_001114101	Q7Z502|Q96DL2|Q96H05	Missense_Mutation	SNP	ENST00000374639.3	hg19	CCDS227.1	.	.	.	.	.	.	.	.	.	.	G	35	5.572044	0.96553	.	.	ENSG00000159189	ENST00000374640;ENST00000374639;ENST00000374637	D;D;D	0.99607	-6.27;-6.27;-6.27	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.99725	0.9893	M	0.94101	3.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97524	1.0075	10	0.59425	D	0.04	.	17.4377	0.87557	0.0:0.0:1.0:0.0	.	40	P02747	C1QC_HUMAN	S	40	ENSP00000363771:G40S;ENSP00000363770:G40S;ENSP00000363768:G40S	ENSP00000363768:G40S	G	+	1	0	C1QC	22843221	1.000000	0.71417	0.980000	0.43619	0.991000	0.79684	8.000000	0.88501	2.460000	0.83146	0.561000	0.74099	GGC	.	.		0.692	C1QC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008083.1	NM_172369	
CSMD2	114784	hgsc.bcm.edu	37	1	34258042	34258042	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:34258042T>C	ENST00000338325.1	-	5	768	c.356A>G	c.(355-357)cAg>cGg	p.Q119R	CSMD2_ENST00000373381.4_Missense_Mutation_p.Q511R			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	471	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AACTGTCTTCTGGTCCCCATC	0.567																																					p.Q471R		Atlas-SNP	.											.	CSMD2	946	.	0			c.A1412G						.						209.0	167.0	181.0					1																	34258042		2203	4300	6503	SO:0001583	missense	114784	exon11			GTCTTCTGGTCCC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.356A>G	chr1.hg19:g.34258042T>C	ENSP00000340311:p.Gln119Arg	151.0	0.0		113.0	38.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	ENST00000338325.1	hg19		.	.	.	.	.	.	.	.	.	.	T	12.47	1.948465	0.34377	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.23950	1.88;3.75	5.2	5.2	0.72013	CUB (5);	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	N	0.21324	0.655	0.80722	D	1	P;P	0.51653	0.947;0.888	P;P	0.57846	0.828;0.762	T	0.03433	-1.1037	10	0.16896	T	0.51	.	13.0709	0.59061	0.0:0.0:0.0:1.0	.	471;511	Q7Z408;E7EUA6	CSMD2_HUMAN;.	R	511;119	ENSP00000362479:Q511R;ENSP00000340311:Q119R	ENSP00000241312:Q471R	Q	-	2	0	CSMD2	34030629	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.676000	0.61627	1.995000	0.58328	0.378000	0.23410	CAG	.	.		0.567	CSMD2-004	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000036404.2	NM_052896	
COL8A2	1296	hgsc.bcm.edu	37	1	36564429	36564429	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:36564429C>T	ENST00000397799.1	-	4	1077	c.853G>A	c.(853-855)Gca>Aca	p.A285T	COL8A2_ENST00000481785.1_Missense_Mutation_p.A220T|COL8A2_ENST00000303143.4_Missense_Mutation_p.A285T			P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2	285	Triple-helical region.				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|collagen catabolic process (GO:0030574)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			NS(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AACCCTGCTGCCCCTGGGACT	0.697																																					p.A285T		Atlas-SNP	.											.	COL8A2	41	.	0			c.G853A						.						15.0	18.0	17.0					1																	36564429		2186	4280	6466	SO:0001583	missense	1296	exon2			CTGCTGCCCCTGG	M60832	CCDS403.1, CCDS72756.1	1p34.2-p32.3	2014-02-14			ENSG00000171812	ENSG00000171812		"""Collagens"""	2216	protein-coding gene	gene with protein product		120252		FECD		11689488	Standard	XM_005270477		Approved	PPCD, FECD1, PPCD2	uc001bzv.2	P25067	OTTHUMG00000007665	ENST00000397799.1:c.853G>A	chr1.hg19:g.36564429C>T	ENSP00000380901:p.Ala285Thr	61.0	0.0		57.0	17.0	NM_005202	Q5JV31|Q8TEJ5	Missense_Mutation	SNP	ENST00000397799.1	hg19	CCDS403.1	.	.	.	.	.	.	.	.	.	.	C	5.834	0.338113	0.11013	.	.	ENSG00000171812	ENST00000303143;ENST00000397799;ENST00000481785	D;D;D	0.97505	-4.41;-4.41;-4.41	3.7	1.66	0.24008	.	0.691089	0.14127	N	0.339654	D	0.92987	0.7768	L	0.33753	1.03	0.32016	N	0.601443	B	0.16396	0.017	B	0.20184	0.028	D	0.86474	0.1787	10	0.15499	T	0.54	.	11.3827	0.49768	0.5109:0.4891:0.0:0.0	.	285	P25067	CO8A2_HUMAN	T	285;285;220	ENSP00000305913:A285T;ENSP00000380901:A285T;ENSP00000436433:A220T	ENSP00000305913:A285T	A	-	1	0	COL8A2	36337016	0.000000	0.05858	0.998000	0.56505	0.917000	0.54804	-0.100000	0.10990	0.172000	0.19760	0.205000	0.17691	GCA	.	.		0.697	COL8A2-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313674.1	NM_005202	
PRPF38B	55119	hgsc.bcm.edu	37	1	109241956	109241956	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:109241956C>G	ENST00000370025.4	+	6	1224	c.955C>G	c.(955-957)Cga>Gga	p.R319G	PRPF38B_ENST00000370021.1_Missense_Mutation_p.R208G	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	319	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		GCGAAGATCCCGAAGTATTGA	0.502																																					p.R319G		Atlas-SNP	.											.	PRPF38B	55	.	0			c.C955G						.						89.0	89.0	89.0					1																	109241956		2203	4300	6503	SO:0001583	missense	55119	exon6			AGATCCCGAAGTA	AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.955C>G	chr1.hg19:g.109241956C>G	ENSP00000359042:p.Arg319Gly	159.0	0.0		238.0	49.0	NM_018061	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Missense_Mutation	SNP	ENST00000370025.4	hg19	CCDS788.1	.	.	.	.	.	.	.	.	.	.	C	5.593	0.294227	0.10567	.	.	ENSG00000134186	ENST00000370025;ENST00000370021	T;T	0.13778	2.56;2.56	5.69	4.75	0.60458	.	0.000000	0.85682	D	0.000000	T	0.15609	0.0376	L	0.34521	1.04	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.02352	-1.1172	10	0.44086	T	0.13	.	13.4404	0.61109	0.3161:0.6839:0.0:0.0	.	319	Q5VTL8	PR38B_HUMAN	G	319;208	ENSP00000359042:R319G;ENSP00000359038:R208G	ENSP00000359038:R208G	R	+	1	2	PRPF38B	109043479	0.999000	0.42202	1.000000	0.80357	0.151000	0.21798	3.189000	0.50965	1.326000	0.45319	0.591000	0.81541	CGA	.	.		0.502	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030231.1	NM_018061	
OR10X1	128367	hgsc.bcm.edu	37	1	158549068	158549068	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:158549068T>C	ENST00000368150.1	-	1	621	c.622A>G	c.(622-624)Agt>Ggt	p.S208G		NM_001004477.1	NP_001004477.1	Q8NGY0	O10X1_HUMAN	olfactory receptor, family 10, subfamily X, member 1 (gene/pseudogene)	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(22)|ovary(2)|skin(2)|urinary_tract(1)	37	all_hematologic(112;0.0378)					GTGTGGTTACTGTCTATACAA	0.428																																					p.S208G		Atlas-SNP	.											.	OR10X1	96	.	0			c.A622G						.						91.0	91.0	91.0					1																	158549068		2203	4300	6503	SO:0001583	missense	128367	exon1			GGTTACTGTCTAT	BK004194	CCDS30900.1	1q23.1	2013-10-10	2013-10-10	2004-03-10	ENSG00000186400	ENSG00000186400		"""GPCR / Class A : Olfactory receptors"""	14995	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily X, member 1"""	OR10X1P			Standard	NM_001004477		Approved		uc010pin.2	Q8NGY0	OTTHUMG00000019635	ENST00000368150.1:c.622A>G	chr1.hg19:g.158549068T>C	ENSP00000357132:p.Ser208Gly	161.0	0.0		273.0	57.0	NM_001004477	Q6IFR8	Missense_Mutation	SNP	ENST00000368150.1	hg19	CCDS30900.1	.	.	.	.	.	.	.	.	.	.	T	4.296	0.054209	0.08291	.	.	ENSG00000186400	ENST00000368150	T	0.00188	8.59	4.8	3.6	0.41247	GPCR, rhodopsin-like superfamily (1);	0.106927	0.42294	D	0.000733	T	0.00073	0.0002	L	0.29908	0.895	0.09310	N	1	B	0.16166	0.016	B	0.17098	0.017	T	0.32268	-0.9913	10	0.87932	D	0	.	10.8539	0.46786	0.0:0.0:0.1574:0.8425	.	208	Q8NGY0	O10X1_HUMAN	G	208	ENSP00000357132:S208G	ENSP00000357132:S208G	S	-	1	0	OR10X1	156815692	0.024000	0.19004	0.750000	0.31169	0.015000	0.08874	1.212000	0.32394	1.998000	0.58463	0.455000	0.32223	AGT	.	.		0.428	OR10X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051850.2	NM_001004477	
XCL2	6846	hgsc.bcm.edu	37	1	168510343	168510343	+	Silent	SNP	A	A	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:168510343A>G	ENST00000367819.2	-	3	224	c.192T>C	c.(190-192)cgT>cgC	p.R64R		NM_003175.3	NP_003166.1	Q9UBD3	XCL2_HUMAN	chemokine (C motif) ligand 2	64					blood circulation (GO:0008015)|cell chemotaxis (GO:0060326)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			large_intestine(1)|lung(6)|ovary(1)	8	all_hematologic(923;0.215)					CTTTTAGGCCACGTTTGGTAA	0.473																																					p.R64R		Atlas-SNP	.											.	XCL2	18	.	0			c.T192C						.						165.0	143.0	150.0					1																	168510343		2203	4300	6503	SO:0001819	synonymous_variant	6846	exon3			TAGGCCACGTTTG	BC070309	CCDS1273.1	1q24.2	2013-02-28	2002-08-22	2002-08-23	ENSG00000143185	ENSG00000143185		"""Endogenous ligands"""	10646	protein-coding gene	gene with protein product		604828	"""small inducible cytokine subfamily C, member 2"""	SCYC2		7875320	Standard	NM_003175		Approved	SCM-1b	uc001gfn.4	Q9UBD3	OTTHUMG00000034549	ENST00000367819.2:c.192T>C	chr1.hg19:g.168510343A>G		107.0	0.0		169.0	22.0	NM_003175		Silent	SNP	ENST00000367819.2	hg19	CCDS1273.1																																																																																			.	.		0.473	XCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083613.1	NM_003175	
GLUL	2752	hgsc.bcm.edu	37	1	182353689	182353689	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:182353689T>C	ENST00000331872.6	-	7	1513	c.973A>G	c.(973-975)Att>Gtt	p.I325V	GLUL_ENST00000491322.1_5'UTR|GLUL_ENST00000417584.2_Missense_Mutation_p.I325V|GLUL_ENST00000339526.4_Missense_Mutation_p.I325V|GLUL_ENST00000311223.5_Missense_Mutation_p.I325V	NM_001033044.2	NP_001028216.1	P15104	GLNA_HUMAN	glutamate-ammonia ligase	325					cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	GTCCGGGGAATGCGTATGCTG	0.557																																					p.I325V		Atlas-SNP	.											.	GLUL	38	.	0			c.A973G						.						100.0	91.0	94.0					1																	182353689		2203	4300	6503	SO:0001583	missense	2752	exon7			GGGGAATGCGTAT	AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000331872.6:c.973A>G	chr1.hg19:g.182353689T>C	ENSP00000356537:p.Ile325Val	83.0	0.0		95.0	41.0	NM_001033056	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	Missense_Mutation	SNP	ENST00000331872.6	hg19	CCDS1344.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.374949	0.61735	.	.	ENSG00000135821	ENST00000331872;ENST00000311223;ENST00000417584;ENST00000339526	D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17	5.34	5.34	0.76211	Glutamine synthetase, catalytic domain (1);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.85239	0.5651	L	0.58583	1.82	0.80722	D	1	B	0.30406	0.278	B	0.36186	0.219	T	0.81236	-0.1024	10	0.15499	T	0.54	-20.0742	14.1051	0.65083	0.0:0.0:0.0:1.0	.	325	P15104	GLNA_HUMAN	V	325	ENSP00000356537:I325V;ENSP00000307900:I325V;ENSP00000398320:I325V;ENSP00000344958:I325V	ENSP00000307900:I325V	I	-	1	0	GLUL	180620312	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.516000	0.81772	2.011000	0.59026	0.460000	0.39030	ATT	.	.		0.557	GLUL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091043.1	NM_002065	
MIA3	375056	hgsc.bcm.edu	37	1	222802341	222802341	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:222802341C>G	ENST00000344922.5	+	4	1804	c.1779C>G	c.(1777-1779)gaC>gaG	p.D593E	MIA3_ENST00000344441.6_Missense_Mutation_p.D593E|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Intron	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	593					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		CATCCAGAGACAGTGTGGAGG	0.473																																					p.D593E		Atlas-SNP	.											.	MIA3	167	.	0			c.C1779G						.						76.0	80.0	78.0					1																	222802341		2042	4183	6225	SO:0001583	missense	375056	exon4			CAGAGACAGTGTG		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.1779C>G	chr1.hg19:g.222802341C>G	ENSP00000340900:p.Asp593Glu	98.0	0.0		131.0	23.0	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	hg19	CCDS41470.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.86|14.86	2.660504|2.660504	0.47572|0.47572	.|.	.|.	ENSG00000154305|ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831|ENST00000354906	T;T|.	0.05139|.	3.49;3.49|.	4.32|4.32	-7.94|-7.94	0.01152|0.01152	.|.	.|.	.|.	.|.	.|.	T|T	0.32315|0.32315	0.0825|0.0825	L|L	0.58101|0.58101	1.795|1.795	0.09310|0.09310	N|N	1|1	B;B|.	0.19200|.	0.002;0.034|.	B;B|.	0.16722|.	0.007;0.016|.	T|T	0.39921|0.39921	-0.9590|-0.9590	9|5	0.49607|.	T|.	0.09|.	.|.	1.3612|1.3612	0.02192|0.02192	0.1357:0.244:0.2721:0.3482|0.1357:0.244:0.2721:0.3482	.|.	593;593|.	Q5JRA6-2;Q5JRA6|.	.;MIA3_HUMAN|.	E|E	593|176	ENSP00000340900:D593E;ENSP00000340587:D593E|.	ENSP00000325973:D593E|.	D|Q	+|+	3|1	2|0	MIA3|MIA3	220868964|220868964	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.285000|0.285000	0.27093|0.27093	-0.418000|-0.418000	0.07080|0.07080	-1.026000|-1.026000	0.03330|0.03330	0.305000|0.305000	0.20034|0.20034	GAC|CAG	.	.		0.473	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
ZNF678	339500	hgsc.bcm.edu	37	1	227843314	227843314	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:227843314C>A	ENST00000343776.5	+	4	1708	c.1363C>A	c.(1363-1365)Cat>Aat	p.H455N	ZNF678_ENST00000397097.3_Missense_Mutation_p.H510N|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				TAAGAGAATTCATACTGAAGA	0.373																																					p.H510N		Atlas-SNP	.											.	ZNF678	137	.	0			c.C1528A						.						39.0	43.0	42.0					1																	227843314		2202	4296	6498	SO:0001583	missense	339500	exon4			AGAATTCATACTG	BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1363C>A	chr1.hg19:g.227843314C>A	ENSP00000344828:p.His455Asn	66.0	0.0		79.0	16.0	NM_178549	Q8IVQ9	Missense_Mutation	SNP	ENST00000343776.5	hg19		.	.	.	.	.	.	.	.	.	.	C	13.25	2.182006	0.38511	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.67345	-0.26;-0.26	1.63	0.606	0.17559	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.80319	0.4601	M	0.87269	2.87	0.30291	N	0.790393	D	0.89917	1.0	D	0.91635	0.999	T	0.73145	-0.4075	9	0.87932	D	0	.	6.2562	0.20876	0.0:0.8068:0.0:0.1932	.	455	Q5SXM1	ZN678_HUMAN	N	455;510	ENSP00000344828:H455N;ENSP00000440403:H510N	ENSP00000344828:H455N	H	+	1	0	ZNF678	225909937	0.999000	0.42202	0.003000	0.11579	0.001000	0.01503	5.623000	0.67757	-0.034000	0.13713	-0.192000	0.12808	CAT	.	.		0.373	ZNF678-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000091976.2	NM_178549	
RYR2	6262	hgsc.bcm.edu	37	1	237875069	237875069	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:237875069T>G	ENST00000366574.2	+	71	10572	c.10255T>G	c.(10255-10257)Ttc>Gtc	p.F3419V	RYR2_ENST00000360064.6_Missense_Mutation_p.F3417V|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.F3403V	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3419					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGAGCAGAACTTCGTTGTACA	0.333																																					p.F3419V		Atlas-SNP	.											.	RYR2	1273	.	0			c.T10255G						.						52.0	51.0	51.0					1																	237875069		1824	4069	5893	SO:0001583	missense	6262	exon71			CAGAACTTCGTTG	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.10255T>G	chr1.hg19:g.237875069T>G	ENSP00000355533:p.Phe3419Val	185.0	0.0		208.0	18.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.503513	0.85176	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.98419	-4.92;-4.9;-4.92	4.97	4.97	0.65823	.	0.000000	0.64402	U	0.000012	D	0.98893	0.9625	M	0.84846	2.72	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	D	0.99782	1.1028	10	0.87932	D	0	.	14.6613	0.68873	0.0:0.0:0.0:1.0	.	3419	Q92736	RYR2_HUMAN	V	3419;3417;3403;374	ENSP00000355533:F3419V;ENSP00000353174:F3417V;ENSP00000443798:F3403V	ENSP00000353174:F3417V	F	+	1	0	RYR2	235941692	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	8.040000	0.89188	1.880000	0.54463	0.482000	0.46254	TTC	.	.		0.333	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
APOB	338	hgsc.bcm.edu	37	2	21252519	21252519	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr2:21252519T>C	ENST00000233242.1	-	12	1736	c.1609A>G	c.(1609-1611)Aaa>Gaa	p.K537E	APOB_ENST00000399256.4_Missense_Mutation_p.K537E	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	537	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCTTGTCTTTAGGCTCCATT	0.423																																					p.K537E		Atlas-SNP	.											.	APOB	761	.	0			c.A1609G						.						179.0	166.0	170.0					2																	21252519		2203	4300	6503	SO:0001583	missense	338	exon12			TGTCTTTAGGCTC	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1609A>G	chr2.hg19:g.21252519T>C	ENSP00000233242:p.Lys537Glu	50.0	0.0		36.0	13.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	T	2.217	-0.379363	0.05000	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	T;T	0.39406	1.08;1.08	5.28	1.63	0.23807	Lipid transport protein, N-terminal (3);Vitellinogen, superhelical (2);	1.061170	0.07360	N	0.883872	T	0.30823	0.0777	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.30327	-0.9982	10	0.02654	T	1	.	8.9237	0.35628	0.0:0.212:0.0:0.788	.	537	P04114	APOB_HUMAN	E	537	ENSP00000233242:K537E;ENSP00000382200:K537E	ENSP00000233242:K537E	K	-	1	0	APOB	21106024	0.003000	0.15002	0.000000	0.03702	0.122000	0.20287	1.433000	0.34947	0.097000	0.17492	-0.411000	0.06167	AAA	.	.		0.423	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
SLC30A6	55676	hgsc.bcm.edu	37	2	32396397	32396397	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr2:32396397T>A	ENST00000282587.5	+	2	82	c.45T>A	c.(43-45)ttT>ttA	p.F15L	SLC30A6_ENST00000357055.3_5'UTR|SLC30A6_ENST00000379343.2_Missense_Mutation_p.F15L|SLC30A6_ENST00000435660.1_Missense_Mutation_p.F15L|SLC30A6_ENST00000538303.1_Intron|SLC30A6_ENST00000406369.1_Intron	NM_017964.3	NP_060434.2	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter), member 6	15					cellular protein metabolic process (GO:0044267)|Golgi to endosome transport (GO:0006895)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(4)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GATCCTTTTTTGGCAAGTTGT	0.333																																					p.F15L		Atlas-SNP	.											.	SLC30A6	37	.	0			c.T45A						.						107.0	106.0	106.0					2																	32396397		2203	4300	6503	SO:0001583	missense	55676	exon2			CTTTTTTGGCAAG	AK055663	CCDS1780.1, CCDS54341.1, CCDS54342.1, CCDS54343.1	2p22.3	2013-05-22			ENSG00000152683	ENSG00000152683		"""Solute carriers"""	19305	protein-coding gene	gene with protein product		611148					Standard	NM_017964		Approved	FLJ31101, ZNT6	uc002rof.2	Q6NXT4	OTTHUMG00000128456	ENST00000282587.5:c.45T>A	chr2.hg19:g.32396397T>A	ENSP00000282587:p.Phe15Leu	100.0	0.0		89.0	33.0	NM_001193513	A5YM45|B7Z901|Q8N5C9|Q96NC3	Missense_Mutation	SNP	ENST00000282587.5	hg19	CCDS1780.1	.	.	.	.	.	.	.	.	.	.	T	13.62	2.290116	0.40494	.	.	ENSG00000152683	ENST00000379343;ENST00000282587;ENST00000435660	T	0.75938	-0.98	5.32	5.32	0.75619	.	0.241870	0.42548	D	0.000690	T	0.50973	0.1647	N	0.08118	0	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.001;0.003;0.001	T	0.48636	-0.9018	10	0.11485	T	0.65	-13.8268	10.4496	0.44513	0.0:0.0:0.1634:0.8366	.	15;15;15	Q6NXT4-3;Q6NXT4-2;Q6NXT4	.;.;ZNT6_HUMAN	L	15	ENSP00000282587:F15L	ENSP00000282587:F15L	F	+	3	2	SLC30A6	32249901	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.392000	0.44433	2.009000	0.58944	0.459000	0.35465	TTT	.	.		0.333	SLC30A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250254.2		
ANAPC1	64682	hgsc.bcm.edu	37	2	112550033	112550033	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr2:112550033G>A	ENST00000341068.3	-	38	5390	c.4618C>T	c.(4618-4620)Cgc>Tgc	p.R1540C		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1540					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						TGTAAGAAGCGACAAAGCTGC	0.483																																					p.R1540C		Atlas-SNP	.											.	ANAPC1	116	.	0			c.C4618T						.						18.0	20.0	19.0					2																	112550033		2183	4261	6444	SO:0001583	missense	64682	exon38			AGAAGCGACAAAG	AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.4618C>T	chr2.hg19:g.112550033G>A	ENSP00000339109:p.Arg1540Cys	521.0	1.0		389.0	125.0	NM_022662	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	ENST00000341068.3	hg19	CCDS2093.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.2|25.2	4.610427|4.610427	0.87258|0.87258	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000341068|ENST00000427997	.|.	.|.	.|.	4.57|4.57	4.57|4.57	0.56435|0.56435	.|.	0.000000|.	0.35870|.	U|.	0.002932|.	D|D	0.85044|0.85044	0.5607|0.5607	M|M	0.91196|0.91196	3.185|3.185	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	D|D	0.88956|0.88956	0.3390|0.3390	9|5	0.87932|.	D|.	0|.	-11.7322|-11.7322	17.698|17.698	0.88286|0.88286	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1540|.	Q9H1A4|.	APC1_HUMAN|.	C|L	1540|1074	.|.	ENSP00000339109:R1540C|.	R|S	-|-	1|2	0|0	ANAPC1|ANAPC1	112266504|112266504	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	6.639000|6.639000	0.74314|0.74314	2.237000|2.237000	0.73441|0.73441	0.585000|0.585000	0.79938|0.79938	CGC|TCG	.	.		0.483	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254045.2	NM_022662	
PSD4	23550	hgsc.bcm.edu	37	2	113949983	113949983	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr2:113949983C>T	ENST00000245796.6	+	6	1850	c.1655C>T	c.(1654-1656)tCt>tTt	p.S552F	PSD4_ENST00000441564.3_Missense_Mutation_p.S524F	NM_012455.2	NP_036587.2	Q8NDX1	PSD4_HUMAN	pleckstrin and Sec7 domain containing 4	552	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			cervix(1)|endometrium(2)|large_intestine(4)|lung(13)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCGATGAACTCTTCTTGGCTT	0.547																																					p.S552F		Atlas-SNP	.											.	PSD4	74	.	0			c.C1655T						.						187.0	192.0	191.0					2																	113949983		2203	4300	6503	SO:0001583	missense	23550	exon6			TGAACTCTTCTTG	U63127	CCDS33276.1	2q13	2013-01-10			ENSG00000125637	ENSG00000125637		"""Pleckstrin homology (PH) domain containing"""	19096	protein-coding gene	gene with protein product		614442				12082148	Standard	XM_005263634		Approved	TIC, EFA6B	uc002tjc.3	Q8NDX1	OTTHUMG00000153339	ENST00000245796.6:c.1655C>T	chr2.hg19:g.113949983C>T	ENSP00000245796:p.Ser552Phe	62.0	0.0		45.0	11.0	NM_012455	A6NEG7|A8K1Y0|O95621|Q4ZG34|Q6GPH8|Q8IYP4	Missense_Mutation	SNP	ENST00000245796.6	hg19	CCDS33276.1	.	.	.	.	.	.	.	.	.	.	c	10.86	1.469554	0.26423	.	.	ENSG00000125637	ENST00000245796;ENST00000441564	T;T	0.11930	2.73;2.82	5.51	-0.711	0.11230	.	0.590962	0.15539	N	0.257041	T	0.04318	0.0119	N	0.02539	-0.55	0.18873	N	0.999989	B;B;B	0.11235	0.0;0.004;0.002	B;B;B	0.08055	0.001;0.003;0.001	T	0.45011	-0.9290	10	0.15066	T	0.55	.	9.063	0.36447	0.0:0.3329:0.0:0.6671	.	210;524;552	Q59HG0;Q8NDX1-2;Q8NDX1	.;.;PSD4_HUMAN	F	552;524	ENSP00000245796:S552F;ENSP00000413997:S524F	ENSP00000245796:S552F	S	+	2	0	PSD4	113666454	0.135000	0.22499	0.002000	0.10522	0.033000	0.12548	-0.159000	0.10056	-0.044000	0.13491	0.553000	0.69018	TCT	.	.		0.547	PSD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330789.1	NM_012455	
TTN	7273	hgsc.bcm.edu	37	2	179615005	179615005	+	Intron	SNP	A	A	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr2:179615005A>T	ENST00000591111.1	-	45	10585				TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.V4041D|TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATGTGCTTTGACATCATGTTT	0.383																																					p.V4041D		Atlas-SNP	.											.	TTN	18412	.	0			c.T12122A						.						207.0	177.0	187.0					2																	179615005		2203	4300	6503	SO:0001627	intron_variant	7273	exon46			GCTTTGACATCAT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+2845T>A	chr2.hg19:g.179615005A>T		110.0	0.0		84.0	31.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.38	1.333636	0.24167	.	.	ENSG00000155657	ENST00000360870	T	0.58940	0.3	5.33	-1.9	0.07665	.	.	.	.	.	T	0.28466	0.0704	N	0.14661	0.345	0.09310	N	1	B	0.27416	0.178	B	0.24541	0.054	T	0.18209	-1.0344	9	0.12103	T	0.63	.	1.9774	0.03418	0.3999:0.1329:0.3378:0.1294	.	4041	Q8WZ42-6	.	D	4041	ENSP00000354117:V4041D	ENSP00000354117:V4041D	V	-	2	0	TTN	179323250	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.471000	0.22100	-0.137000	0.11455	0.533000	0.62120	GTC	.	.		0.383	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
CASP10	843	hgsc.bcm.edu	37	2	202082364	202082364	+	Intron	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr2:202082364G>C	ENST00000272879.5	+	9	1599				CASP10_ENST00000448480.1_Intron|CASP10_ENST00000286186.6_Missense_Mutation_p.R490T|CASP10_ENST00000360132.3_3'UTR|CASP10_ENST00000313728.7_Missense_Mutation_p.R423T|CASP10_ENST00000346817.5_Missense_Mutation_p.R447T|CASP10_ENST00000492363.1_3'UTR	NM_032974.4	NP_116756.2	Q92851	CASPA_HUMAN	caspase 10, apoptosis-related cysteine peptidase						apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|innate immune response (GO:0045087)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|death effector domain binding (GO:0035877)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27						GTGAGTCGAAGAGTGGACAAA	0.418																																					p.R490T		Atlas-SNP	.											.	CASP10	95	.	0			c.G1469C						.						133.0	118.0	123.0					2																	202082364		2203	4300	6503	SO:0001627	intron_variant	843	exon10			GTCGAAGAGTGGA	U60519	CCDS2338.1, CCDS2339.1, CCDS2340.1, CCDS56159.1, CCDS56160.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000003400	ENSG00000003400	3.4.22.63	"""Caspases"""	1500	protein-coding gene	gene with protein product		601762	"""caspase 10, apoptosis-related cysteine protease"""			8755496	Standard	NM_032974		Approved	MCH4	uc002uxj.1	Q92851	OTTHUMG00000132818	ENST00000272879.5:c.1415+8079G>C	chr2.hg19:g.202082364G>C		197.0	0.0		162.0	53.0	NM_032977	Q68HC0|Q6KF62|Q6KF63|Q8IUP5|Q8WYQ8|Q99845|Q9Y2U6|Q9Y2U7	Missense_Mutation	SNP	ENST00000272879.5	hg19	CCDS2338.1	.	.	.	.	.	.	.	.	.	.	G	13.41	2.227754	0.39399	.	.	ENSG00000003400	ENST00000286186;ENST00000346817;ENST00000313728	T;T;T	0.80393	-1.37;-1.37;-1.37	5.3	-5.3	0.02738	.	0.987548	0.08267	N	0.972144	T	0.78541	0.4299	.	.	.	0.09310	N	1	P;D;P	0.56035	0.551;0.974;0.835	B;P;P	0.56916	0.433;0.809;0.466	T	0.69658	-0.5086	9	0.25751	T	0.34	.	7.5148	0.27593	0.3348:0.0:0.4654:0.1998	.	423;447;490	Q92851-6;Q92851-2;Q92851-4	.;.;.	T	490;447;423	ENSP00000286186:R490T;ENSP00000237865:R447T;ENSP00000314599:R423T	ENSP00000286186:R490T	R	+	2	0	CASP10	201790609	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.427000	0.21379	-0.560000	0.06102	-0.302000	0.09304	AGA	.	.		0.418	CASP10-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256273.1	NM_032977	
ATP2B2	491	hgsc.bcm.edu	37	3	10401666	10401666	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr3:10401666T>A	ENST00000352432.4	-	12	1870	c.1801A>T	c.(1801-1803)Acc>Tcc	p.T601S	ATP2B2_ENST00000397077.1_Missense_Mutation_p.T556S|ATP2B2_ENST00000383800.4_Missense_Mutation_p.T556S|ATP2B2_ENST00000360273.2_Missense_Mutation_p.T601S|ATP2B2_ENST00000343816.4_Missense_Mutation_p.T587S			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	601					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GAGTTGAAGGTGTACACTTTG	0.577																																					p.T601S	Ovarian(125;1619 1709 15675 19819 38835)	Atlas-SNP	.											.	ATP2B2	304	.	0			c.A1801T						.						104.0	84.0	91.0					3																	10401666		2203	4300	6503	SO:0001583	missense	491	exon13			TGAAGGTGTACAC	X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.1801A>T	chr3.hg19:g.10401666T>A	ENSP00000324172:p.Thr601Ser	33.0	0.0		30.0	11.0	NM_001001331	O00766|Q12994|Q16818	Missense_Mutation	SNP	ENST00000352432.4	hg19	CCDS33701.1	.	.	.	.	.	.	.	.	.	.	T	29.2	4.986075	0.93044	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	4.93	4.93	0.64822	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.78953	0.4365	M	0.63169	1.94	0.80722	D	1	D;B;D	0.63046	0.992;0.363;0.992	D;B;D	0.74674	0.984;0.386;0.946	T	0.80991	-0.1135	10	0.62326	D	0.03	-43.1335	14.5887	0.68347	0.0:0.0:0.0:1.0	.	536;568;601	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	S	601;556;556;601;587;536;457;601	ENSP00000324172:T601S;ENSP00000373311:T556S;ENSP00000380267:T556S;ENSP00000353414:T601S;ENSP00000344677:T587S;ENSP00000414854:T457S	ENSP00000342954:T601S	T	-	1	0	ATP2B2	10376666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	1.844000	0.53588	0.482000	0.46254	ACC	.	.		0.577	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250576.2	NM_001683	
MST1R	4486	hgsc.bcm.edu	37	3	49933287	49933287	+	Silent	SNP	G	G	A	rs201143544		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr3:49933287G>A	ENST00000296474.3	-	12	2850	c.2823C>T	c.(2821-2823)atC>atT	p.I941I	MST1R_ENST00000344206.4_Silent_p.I892I	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	941					cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)			cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		CTCTACCCAGGATATGACATT	0.632																																					p.I941I		Atlas-SNP	.											.	MST1R	205	.	0			c.C2823T						.						63.0	61.0	62.0					3																	49933287		2203	4299	6502	SO:0001819	synonymous_variant	4486	exon12			ACCCAGGATATGA	X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.2823C>T	chr3.hg19:g.49933287G>A		39.0	0.0		44.0	12.0	NM_002447	B5A944|B5A945|B5A946|B5A947	Silent	SNP	ENST00000296474.3	hg19	CCDS2807.1																																																																																			.	G|0.999;A|0.001		0.632	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345403.1		
DNAH12	201625	hgsc.bcm.edu	37	3	57356458	57356458	+	Silent	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr3:57356458C>T	ENST00000351747.2	-	50	8013	c.7833G>A	c.(7831-7833)acG>acA	p.T2611T	DNAH12_ENST00000344804.4_Silent_p.T244T	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2611	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GCCGAAGACCCGTGGGAGGTT	0.403																																					p.T2611T		Atlas-SNP	.											.	DNAH12	182	.	0			c.G7833A						.						136.0	128.0	130.0					3																	57356458		692	1591	2283	SO:0001819	synonymous_variant	201625	exon50			AAGACCCGTGGGA	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.7833G>A	chr3.hg19:g.57356458C>T		74.0	0.0		67.0	23.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Silent	SNP	ENST00000351747.2	hg19		.	.	.	.	.	.	.	.	.	.	C	8.276	0.814503	0.16607	.	.	ENSG00000174844	ENST00000462199	.	.	.	5.53	-6.61	0.01818	.	.	.	.	.	T	0.47377	0.1442	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49735	-0.8908	4	.	.	.	.	7.3368	0.26615	0.2631:0.1989:0.0:0.538	.	.	.	.	R	302	.	.	G	-	1	0	DNAH12	57331498	0.017000	0.18338	0.791000	0.31998	0.990000	0.78478	-0.900000	0.04097	-1.365000	0.02158	-0.484000	0.04775	GGG	.	.		0.403	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
CD80	941	hgsc.bcm.edu	37	3	119263583	119263583	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr3:119263583A>T	ENST00000264246.3	-	3	594	c.232T>A	c.(232-234)Tct>Act	p.S78T	CD80_ENST00000383669.3_Missense_Mutation_p.S78T|CD80_ENST00000383668.3_Missense_Mutation_p.S78T|CD80_ENST00000478182.1_Missense_Mutation_p.S78T	NM_005191.3	NP_005182.1	P33681	CD80_HUMAN	CD80 molecule	78	Ig-like V-type.				cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of signal transduction (GO:0009967)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|viral process (GO:0016032)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	12					Abatacept(DB01281)|Belatacept(DB06681)	ATGTCCCCAGACATCATAGTC	0.478																																					p.S78T	Melanoma(132;135 1764 1806 5833 14593)	Atlas-SNP	.											.	CD80	35	.	0			c.T232A						.						187.0	164.0	172.0					3																	119263583		2203	4300	6503	SO:0001583	missense	941	exon3			CCCCAGACATCAT		CCDS2989.1	3q13.3-q21	2013-01-11	2006-03-31		ENSG00000121594	ENSG00000121594		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1700	protein-coding gene	gene with protein product	"""B-lymphocyte activation antigen B7"""	112203	"""CD80 antigen (CD28 antigen ligand 1, B7-1 antigen)"", ""CD80 molecule """	CD28LG, CD28LG1		1370389	Standard	NM_005191		Approved	B7.1, B7-1	uc003ecq.3	P33681	OTTHUMG00000159419	ENST00000264246.3:c.232T>A	chr3.hg19:g.119263583A>T	ENSP00000264246:p.Ser78Thr	132.0	0.0		93.0	34.0	NM_005191	Q5DTA9|Q5DTB0	Missense_Mutation	SNP	ENST00000264246.3	hg19	CCDS2989.1	.	.	.	.	.	.	.	.	.	.	A	13.60	2.286632	0.40494	.	.	ENSG00000121594	ENST00000264246;ENST00000478182;ENST00000383669;ENST00000383668	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	5.13	-5.64	0.02466	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.004310	0.08020	N	0.991846	T	0.49474	0.1559	M	0.69358	2.11	0.09310	N	1	P;P;P;P	0.43431	0.807;0.552;0.714;0.714	B;B;B;B	0.41813	0.367;0.183;0.295;0.295	T	0.44711	-0.9310	10	0.25106	T	0.35	-2.6639	0.3927	0.00413	0.2245:0.2618:0.2576:0.2562	.	78;78;78;78	Q5DTA9;Q5DTB0;A0N0P2;P33681	.;.;.;CD80_HUMAN	T	78	ENSP00000264246:S78T;ENSP00000418364:S78T;ENSP00000373165:S78T;ENSP00000373164:S78T	ENSP00000264246:S78T	S	-	1	0	CD80	120746273	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.161000	0.10026	-0.885000	0.03971	-0.297000	0.09499	TCT	.	.		0.478	CD80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355196.1	NM_005191	
MECOM	2122	hgsc.bcm.edu	37	3	168833394	168833394	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr3:168833394G>C	ENST00000464456.1	-	7	2902	c.1702C>G	c.(1702-1704)Cca>Gca	p.P568A	MECOM_ENST00000460814.1_Missense_Mutation_p.P568A|MECOM_ENST00000494292.1_Missense_Mutation_p.P756A|MECOM_ENST00000433243.2_Missense_Mutation_p.P569A|MECOM_ENST00000264674.3_Missense_Mutation_p.P633A|MECOM_ENST00000472280.1_Missense_Mutation_p.P569A|MECOM_ENST00000468789.1_Missense_Mutation_p.P568A|MECOM_ENST00000392736.3_Missense_Mutation_p.P568A	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GAGGGGACTGGAGTCAAGGGC	0.547																																					p.P756A		Atlas-SNP	.											.	MECOM	216	.	0			c.C2266G						.						173.0	160.0	164.0					3																	168833394		2203	4300	6503	SO:0001583	missense	2122	exon8			GGACTGGAGTCAA	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.1702C>G	chr3.hg19:g.168833394G>C	ENSP00000419770:p.Pro568Ala	77.0	0.0		67.0	26.0	NM_004991	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	hg19	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	G	0.088	-1.171858	0.01646	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243;ENST00000492586	T;T;T;T;T;T;T;T;T	0.08984	3.44;3.43;3.32;3.53;3.31;3.43;3.3;3.53;3.03	5.61	3.8	0.43715	.	1.705140	0.03194	N	0.173793	T	0.12092	0.0294	L	0.47190	1.495	0.25726	N	0.985325	B;B;B;B;B	0.26081	0.141;0.015;0.087;0.038;0.009	B;B;B;B;B	0.26693	0.072;0.013;0.033;0.022;0.006	T	0.44711	-0.9310	10	0.27082	T	0.32	0.0208	11.6441	0.51250	0.1458:0.0:0.8542:0.0	.	756;569;756;633;568	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	A	633;568;568;569;756;568;568;569;219	ENSP00000264674:P633A;ENSP00000376493:P568A;ENSP00000419770:P568A;ENSP00000420048:P569A;ENSP00000417899:P756A;ENSP00000419995:P568A;ENSP00000420466:P568A;ENSP00000394302:P569A;ENSP00000417506:P219A	ENSP00000264674:P633A	P	-	1	0	MECOM	170316088	1.000000	0.71417	0.808000	0.32385	0.006000	0.05464	2.867000	0.48428	0.709000	0.31976	0.655000	0.94253	CCA	.	.		0.547	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
TIGD2	166815	hgsc.bcm.edu	37	4	90035650	90035650	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr4:90035650C>T	ENST00000317005.2	+	1	1683	c.1525C>T	c.(1525-1527)Ctt>Ttt	p.L509F	RP11-84C13.1_ENST00000603357.1_lincRNA	NM_145715.2	NP_663761.1	Q4W5G0	TIGD2_HUMAN	tigger transposable element derived 2	509						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	14		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.86e-05)		ATTAAGGAGGCTTCGGACCAT	0.333																																					p.L509F		Atlas-SNP	.											.	TIGD2	36	.	0			c.C1525T						.						65.0	72.0	69.0					4																	90035650		2203	4300	6503	SO:0001583	missense	166815	exon1			AGGAGGCTTCGGA	AK027653	CCDS3633.1	4q21.3	2013-02-21			ENSG00000180346	ENSG00000180346			18333	protein-coding gene	gene with protein product		612973					Standard	NM_145715		Approved		uc003hsk.3	Q4W5G0	OTTHUMG00000130946	ENST00000317005.2:c.1525C>T	chr4.hg19:g.90035650C>T	ENSP00000317170:p.Leu509Phe	110.0	0.0		80.0	34.0	NM_145715		Missense_Mutation	SNP	ENST00000317005.2	hg19	CCDS3633.1	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356143	0.24598	.	.	ENSG00000180346	ENST00000317005	T	0.38401	1.14	4.31	3.46	0.39613	.	0.000000	0.40728	N	0.001021	T	0.30727	0.0774	L	0.54323	1.7	0.25198	N	0.990079	B	0.14012	0.009	B	0.12837	0.008	T	0.19353	-1.0308	10	0.39692	T	0.17	-4.7504	8.0617	0.30638	0.0:0.889:0.0:0.111	.	509	Q4W5G0	TIGD2_HUMAN	F	509	ENSP00000317170:L509F	ENSP00000317170:L509F	L	+	1	0	TIGD2	90254673	1.000000	0.71417	0.916000	0.36221	0.843000	0.47879	2.496000	0.45346	1.019000	0.39547	0.467000	0.42956	CTT	.	.		0.333	TIGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253545.2	NM_145715	
FSTL5	56884	hgsc.bcm.edu	37	4	162431553	162431553	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr4:162431553C>A	ENST00000306100.5	-	11	1772	c.1336G>T	c.(1336-1338)Gaa>Taa	p.E446*	FSTL5_ENST00000427802.2_Intron|FSTL5_ENST00000379164.4_Nonsense_Mutation_p.E445*|FSTL5_ENST00000536695.1_Nonsense_Mutation_p.E445*	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	446						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TTAGTACCTTCTTCTCTCCAT	0.249																																					p.E446X		Atlas-SNP	.											.	FSTL5	207	.	0			c.G1336T						.						46.0	46.0	46.0					4																	162431553		2191	4268	6459	SO:0001587	stop_gained	56884	exon11			TACCTTCTTCTCT	BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.1336G>T	chr4.hg19:g.162431553C>A	ENSP00000305334:p.Glu446*	346.0	0.0		308.0	103.0	NM_020116	E9PCP6|Q9NSW7|Q9ULF7	Nonsense_Mutation	SNP	ENST00000306100.5	hg19	CCDS3802.1	.	.	.	.	.	.	.	.	.	.	C	41	8.663030	0.98905	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000536695	.	.	.	5.4	5.4	0.78164	.	0.048523	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	12.4534	0.55688	0.0:0.8314:0.1686:0.0	.	.	.	.	X	446;445;445	.	ENSP00000305334:E446X	E	-	1	0	FSTL5	162651003	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	3.102000	0.50291	2.522000	0.85027	0.557000	0.71058	GAA	.	.		0.249	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364773.2	NM_020116	
AHRR	57491	hgsc.bcm.edu	37	5	427999	427999	+	Silent	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr5:427999G>A	ENST00000505113.1	+	8	842	c.798G>A	c.(796-798)ccG>ccA	p.P266P	AHRR_ENST00000512529.1_Silent_p.P112P|AHRR_ENST00000316418.5_Silent_p.P284P|AHRR_ENST00000506456.1_Silent_p.P122P	NM_001242412.1	NP_001229341.1	A9YTQ3	AHRR_HUMAN	aryl-hydrocarbon receptor repressor	266					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein sumoylation (GO:0033235)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(2)|endometrium(4)|large_intestine(1)|lung(12)|prostate(1)	20			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			TGCTCCCGCCGCGGCTGTCGC	0.557																																					p.P284P		Atlas-SNP	.											.	AHRR	67	.	0			c.G852A						.						24.0	28.0	27.0					5																	427999		1897	4106	6003	SO:0001819	synonymous_variant	57491	exon9			CCCGCCGCGGCTG	AB033060	CCDS43297.1, CCDS56355.1	5p15.33	2013-05-21	2003-09-11	2003-09-12	ENSG00000063438	ENSG00000063438		"""Basic helix-loop-helix proteins"""	346	protein-coding gene	gene with protein product		606517	"""aryl hydrocarbon receptor regulator"""	AHH, AHHR		1070014, 11423533	Standard	NM_020731		Approved	KIAA1234, bHLHe77	uc003jaw.3	A9YTQ3	OTTHUMG00000162171	ENST00000505113.1:c.798G>A	chr5.hg19:g.427999G>A		93.0	0.0		130.0	20.0	NM_020731	A7MBN5|D6RAZ1|Q9HAZ3|Q9ULI6	Silent	SNP	ENST00000505113.1	hg19	CCDS56355.1																																																																																			.	.		0.557	AHRR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367720.1	NM_020731	
AP3B1	8546	hgsc.bcm.edu	37	5	77298849	77298849	+	Silent	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr5:77298849T>C	ENST00000255194.6	-	27	3337	c.3162A>G	c.(3160-3162)tcA>tcG	p.S1054S	AP3B1_ENST00000519295.1_Silent_p.S1005S	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	1054					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		CTAGCATCAATGACCCACTGT	0.438									Hermansky-Pudlak syndrome																												p.S1054S		Atlas-SNP	.											.	AP3B1	94	.	0			c.A3162G						.						119.0	115.0	116.0					5																	77298849		2203	4300	6503	SO:0001819	synonymous_variant	8546	exon27	Familial Cancer Database	HPS, HPS1-8	CATCAATGACCCA	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.3162A>G	chr5.hg19:g.77298849T>C		39.0	0.0		42.0	17.0	NM_003664	E5RJ68|O00580|Q7Z393|Q9HD66	Silent	SNP	ENST00000255194.6	hg19	CCDS4041.1																																																																																			.	.		0.438	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000225548.2		
PCDHB6	56130	hgsc.bcm.edu	37	5	140530762	140530762	+	Silent	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr5:140530762G>A	ENST00000231136.1	+	1	924	c.924G>A	c.(922-924)gaG>gaA	p.E308E	PCDHB6_ENST00000543635.1_Silent_p.E172E	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	308	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGATTTTGAGGAAATTCAGT	0.458																																					p.E308E		Atlas-SNP	.											.	PCDHB6	161	.	0			c.G924A						.						90.0	98.0	95.0					5																	140530762		2203	4300	6503	SO:0001819	synonymous_variant	56130	exon1			TTTTGAGGAAATT	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.924G>A	chr5.hg19:g.140530762G>A		91.0	0.0		46.0	7.0	NM_018939	B2R8R9	Silent	SNP	ENST00000231136.1	hg19	CCDS4248.1																																																																																			.	.		0.458	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
EBF1	1879	hgsc.bcm.edu	37	5	158135124	158135124	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr5:158135124C>T	ENST00000313708.6	-	15	1889	c.1607G>A	c.(1606-1608)aGc>aAc	p.S536N	EBF1_ENST00000380654.4_Missense_Mutation_p.S505N|EBF1_ENST00000517373.1_Missense_Mutation_p.S468N|EBF1_ENST00000518836.1_5'UTR	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	536	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCCCGAGGAGCTGCTGCAGTT	0.577			T	HMGA2	lipoma																																p.S536N		Atlas-SNP	.		Dom	yes		5	5q34	1879	early B-cell factor 1		M	.	EBF1	110	.	0			c.G1607A						.						70.0	65.0	67.0					5																	158135124		2203	4298	6501	SO:0001583	missense	1879	exon15			GAGGAGCTGCTGC	AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1607G>A	chr5.hg19:g.158135124C>T	ENSP00000322898:p.Ser536Asn	72.0	0.0		25.0	12.0	NM_024007	Q8IW11	Missense_Mutation	SNP	ENST00000313708.6	hg19	CCDS4343.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.322259	0.60634	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654;ENST00000517373	T;T;T	0.45668	0.89;0.89;0.89	5.22	5.22	0.72569	.	0.219909	0.47093	D	0.000259	T	0.42810	0.1219	L	0.50333	1.59	0.37580	D	0.919754	B;B;B;B	0.09022	0.0;0.0;0.001;0.002	B;B;B;B	0.15052	0.001;0.001;0.005;0.012	T	0.43956	-0.9359	10	0.59425	D	0.04	-8.8208	18.8129	0.92065	0.0:1.0:0.0:0.0	.	536;523;536;505	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	N	536;536;505;468	ENSP00000322898:S536N;ENSP00000370029:S505N;ENSP00000428020:S468N	ENSP00000322898:S536N	S	-	2	0	EBF1	158067702	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.265000	0.51561	2.437000	0.82529	0.655000	0.94253	AGC	.	.		0.577	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000252649.1	NM_024007	
SERPINB6	5269	hgsc.bcm.edu	37	6	2954826	2954826	+	Splice_Site	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:2954826C>T	ENST00000380520.1	-	3	2424	c.430G>A	c.(430-432)Ggt>Agt	p.G144S	SERPINB6_ENST00000335686.5_Splice_Site_p.G144S|SERPINB6_ENST00000380539.1_Splice_Site_p.G144S|SERPINB6_ENST00000380546.3_Splice_Site_p.G144S|SERPINB6_ENST00000380529.1_Splice_Site_p.G144S|SERPINB6_ENST00000380524.1_Splice_Site_p.G144S			P35237	SPB6_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 6	144					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|stomach(1)|upper_aerodigestive_tract(2)	17	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	ACATTTTCACCTTCTGTCTTT	0.363																																					p.G163S		Atlas-SNP	.											SERPINB6,colon,carcinoma,0,1	SERPINB6	31	.	0			c.G487A						.						167.0	158.0	161.0					6																	2954826		2203	4300	6503	SO:0001630	splice_region_variant	5269	exon4			TTTCACCTTCTGT	Z22658	CCDS4479.1, CCDS75386.1, CCDS75387.1	6p25.2	2014-02-18	2005-08-18		ENSG00000124570	ENSG00000124570		"""Serine (or cysteine) peptidase inhibitors"""	8950	protein-coding gene	gene with protein product	"""cytoplasmic antiproteinase"""	173321	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 6"", ""deafness, autosomal recessive 91"""	PI6, DFNB91		8415716, 9858835, 20451170, 24172014	Standard	NM_004568		Approved	PTI, CAP	uc031smo.1	P35237	OTTHUMG00000016170	ENST00000380520.1:c.430+1G>A	chr6.hg19:g.2954826C>T		45.0	0.0		43.0	12.0	NM_001271823	B2RBA8|Q59F97|Q5TD06|Q7Z2Y7|Q96J44|Q9UDI7	Missense_Mutation	SNP	ENST00000380520.1	hg19	CCDS4479.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.467576	0.84533	.	.	ENSG00000124570	ENST00000380524;ENST00000380520;ENST00000335686;ENST00000380529;ENST00000380539;ENST00000380546	D;D;D;D;D;D	0.86497	-2.13;-2.13;-2.13;-2.13;-2.13;-2.13	5.22	5.22	0.72569	Serpin domain (3);	0.149558	0.64402	D	0.000014	D	0.92378	0.7581	M	0.77313	2.365	0.47905	D	0.99954	D	0.71674	0.998	D	0.70016	0.967	D	0.91422	0.5159	9	.	.	.	.	18.2123	0.89874	0.0:1.0:0.0:0.0	.	144	P35237	SPB6_HUMAN	S	144	ENSP00000369896:G144S;ENSP00000369891:G144S;ENSP00000338358:G144S;ENSP00000369901:G144S;ENSP00000369912:G144S;ENSP00000369919:G144S	.	G	-	1	0	SERPINB6	2899825	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	3.299000	0.51826	2.820000	0.97059	0.650000	0.86243	GGT	.	.		0.363	SERPINB6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043422.1		Missense_Mutation
DSP	1832	hgsc.bcm.edu	37	6	7576541	7576541	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:7576541A>G	ENST00000379802.3	+	19	2986	c.2645A>G	c.(2644-2646)gAg>gGg	p.E882G	DSP_ENST00000418664.2_Missense_Mutation_p.E882G	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	882	Globular 1.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TGGGACCTGGAGAAACAAATC	0.373																																					p.E882G		Atlas-SNP	.											.	DSP	306	.	0			c.A2645G						.						90.0	92.0	91.0					6																	7576541		2203	4300	6503	SO:0001583	missense	1832	exon19			ACCTGGAGAAACA	J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.2645A>G	chr6.hg19:g.7576541A>G	ENSP00000369129:p.Glu882Gly	103.0	0.0		85.0	30.0	NM_004415	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	ENST00000379802.3	hg19	CCDS4501.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.465892	0.84425	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	T;T	0.41400	1.0;1.0	6.02	6.02	0.97574	.	0.000000	0.64402	D	0.000002	T	0.55433	0.1920	M	0.69823	2.125	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.64144	0.922;0.922	T	0.61068	-0.7137	10	0.87932	D	0	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	929;882	Q4LE79;P15924	.;DESP_HUMAN	G	882;882;687	ENSP00000369129:E882G;ENSP00000396591:E882G	ENSP00000369129:E882G	E	+	2	0	DSP	7521540	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	8.392000	0.90180	2.311000	0.77944	0.533000	0.62120	GAG	.	.		0.373	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039786.2	NM_004415	
JARID2	3720	hgsc.bcm.edu	37	6	15468865	15468865	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:15468865A>C	ENST00000341776.2	+	5	830	c.586A>C	c.(586-588)Aaa>Caa	p.K196Q	JARID2_ENST00000397311.3_Missense_Mutation_p.K24Q|JARID2_ENST00000541660.1_Missense_Mutation_p.K158Q	NM_004973.3	NP_004964.2	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2	196					central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|liver development (GO:0001889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of histone methylation (GO:0031061)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K9 methylation (GO:0051574)|spleen development (GO:0048536)|stem cell differentiation (GO:0048863)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(2)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	59	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				AGAAGACGTCAAAACAGCCAC	0.512																																					p.K196Q		Atlas-SNP	.											.	JARID2	135	.	0			c.A586C						.						155.0	127.0	136.0					6																	15468865		2203	4300	6503	SO:0001583	missense	3720	exon5			GACGTCAAAACAG	U57592	CCDS4533.1, CCDS58996.1	6p24-p23	2008-02-05	2006-10-06	2004-01-30	ENSG00000008083	ENSG00000008083			6196	protein-coding gene	gene with protein product		601594	"""jumonji (mouse) homolog"", ""Jumonji, AT rich interactive domain 2"""	JMJ		8894700	Standard	NM_001267040		Approved		uc003nbj.4	Q92833	OTTHUMG00000014293	ENST00000341776.2:c.586A>C	chr6.hg19:g.15468865A>C	ENSP00000341280:p.Lys196Gln	102.0	0.0		82.0	29.0	NM_004973	A8K9Z6|B7Z5S5|B7Z8L0|Q5U5L5|Q86X63	Missense_Mutation	SNP	ENST00000341776.2	hg19	CCDS4533.1	.	.	.	.	.	.	.	.	.	.	A	19.41	3.822559	0.71028	.	.	ENSG00000008083	ENST00000538175;ENST00000341776;ENST00000397311;ENST00000541660	T;T;T	0.36340	1.26;1.26;1.26	4.89	4.89	0.63831	.	0.285984	0.38005	N	0.001849	T	0.38957	0.1060	L	0.44542	1.39	0.32940	D	0.518328	D;D;D	0.76494	0.999;0.998;0.985	D;P;P	0.66351	0.943;0.852;0.715	T	0.39840	-0.9594	10	0.56958	D	0.05	-6.9403	14.5584	0.68118	1.0:0.0:0.0:0.0	.	158;60;196	F5H590;B7Z7X9;Q92833	.;.;JARD2_HUMAN	Q	60;196;24;158	ENSP00000341280:K196Q;ENSP00000380478:K24Q;ENSP00000444623:K158Q	ENSP00000341280:K196Q	K	+	1	0	JARID2	15576844	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.433000	0.73404	1.842000	0.53543	0.529000	0.55759	AAA	.	.		0.512	JARID2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039926.1	NM_004973	
CFB	629	hgsc.bcm.edu	37	6	31915210	31915210	+	Silent	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:31915210C>T	ENST00000425368.2	+	4	1083	c.570C>T	c.(568-570)caC>caT	p.H190H	CFB_ENST00000456570.1_Silent_p.H692H|CFB_ENST00000556679.1_Silent_p.H692H|CFB_ENST00000477310.1_Silent_p.H541H	NM_001710.5	NP_001701.2	P00751	CFAB_HUMAN	complement factor B	190	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	complement binding (GO:0001848)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|urinary_tract(1)	21						TCACCTACCACTGCAGCCGGG	0.637																																					p.H190H		Atlas-SNP	.											.	CFB	33	.	0			c.C570T						.						112.0	111.0	112.0					6																	31915210		1510	2707	4217	SO:0001819	synonymous_variant	629	exon4			CTACCACTGCAGC	L15702	CCDS4729.1	6p21.33	2014-09-17	2006-02-10	2006-02-10	ENSG00000243649	ENSG00000243649	3.4.21.47	"""Complement system"""	1037	protein-coding gene	gene with protein product		138470	"""B-factor, properdin"""	BFD, BF			Standard	NM_001710		Approved	H2-Bf	uc011dor.2	P00751	OTTHUMG00000031198	ENST00000425368.2:c.570C>T	chr6.hg19:g.31915210C>T		50.0	0.0		35.0	15.0	NM_001710	B0QZQ6|O15006|Q29944|Q53F89|Q5JP67|Q5ST50|Q96HX6|Q9BTF5|Q9BX92	Silent	SNP	ENST00000425368.2	hg19	CCDS4729.1																																																																																			.	.		0.637	CFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000076395.3	NM_001710	
AGPAT1	10554	hgsc.bcm.edu	37	6	32138234	32138234	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:32138234A>G	ENST00000395499.1	-	4	1057	c.478T>C	c.(478-480)Tct>Cct	p.S160P	AGPAT1_ENST00000375107.3_Missense_Mutation_p.S160P|AGPAT1_ENST00000336984.6_Missense_Mutation_p.S160P|AGPAT1_ENST00000395496.1_Missense_Mutation_p.S160P|PPT2-EGFL8_ENST00000422437.1_3'UTR|AGPAT1_ENST00000490711.1_Intron|AGPAT1_ENST00000375104.2_Missense_Mutation_p.S160P|AGPAT1_ENST00000412465.2_Missense_Mutation_p.S48P|AGPAT1_ENST00000395497.1_Missense_Mutation_p.S160P			Q99943	PLCA_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 1	160					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cellular metabolic process (GO:0031325)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			central_nervous_system(1)|large_intestine(3)|lung(6)|ovary(2)	12						GCGACCTCAGACATGACACTG	0.582																																					p.S160P		Atlas-SNP	.											.	AGPAT1	22	.	0			c.T478C						.						81.0	83.0	82.0					6																	32138234		1511	2709	4220	SO:0001583	missense	10554	exon4			CCTCAGACATGAC	U56417	CCDS4744.1	6p21.3	2013-02-05	2013-02-05		ENSG00000204310	ENSG00000204310	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	324	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, alpha"""	603099	"""1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid acyltransferase, alpha)"""			9461603, 9291118	Standard	NM_032741		Approved	LPAAT-alpha	uc003oae.3	Q99943	OTTHUMG00000031210	ENST00000395499.1:c.478T>C	chr6.hg19:g.32138234A>G	ENSP00000378877:p.Ser160Pro	39.0	0.0		37.0	15.0	NM_006411	A2BFI5|Q5BL03	Missense_Mutation	SNP	ENST00000395499.1	hg19	CCDS4744.1	.	.	.	.	.	.	.	.	.	.	A	19.66	3.869730	0.72065	.	.	ENSG00000204310	ENST00000395496;ENST00000375107;ENST00000395499;ENST00000375104;ENST00000395497;ENST00000336984;ENST00000412465;ENST00000538952	D;D;D;D;D;D;D	0.93547	-3.24;-3.24;-3.24;-3.24;-3.24;-3.24;-3.24	5.89	4.78	0.61160	Phospholipid/glycerol acyltransferase (2);1-acyl-sn-glycerol-3-phosphate acyltransferase (1);	0.453294	0.25130	N	0.032911	D	0.90442	0.7007	M	0.68317	2.08	0.44899	D	0.997912	P;P	0.48230	0.907;0.637	P;B	0.51266	0.664;0.435	D	0.88744	0.3245	10	0.30854	T	0.27	-12.0463	5.8796	0.18848	0.6424:0.2161:0.0:0.1415	.	124;160	B4DRH1;Q99943	.;PLCA_HUMAN	P	160;160;160;160;160;160;48;64	ENSP00000378874:S160P;ENSP00000364248:S160P;ENSP00000378877:S160P;ENSP00000364245:S160P;ENSP00000378875:S160P;ENSP00000337463:S160P;ENSP00000410473:S48P	ENSP00000337463:S160P	S	-	1	0	AGPAT1	32246212	0.713000	0.27926	1.000000	0.80357	0.999000	0.98932	-0.000000	0.12993	2.254000	0.74563	0.533000	0.62120	TCT	.	.		0.582	AGPAT1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268941.1	NM_006411	
CAPN11	11131	hgsc.bcm.edu	37	6	44137245	44137245	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:44137245A>G	ENST00000398776.1	+	3	354	c.316A>G	c.(316-318)Aac>Gac	p.N106D	CAPN11_ENST00000542245.1_Missense_Mutation_p.N106D	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	106	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AAATGTGCAGAACATCTCCTG	0.542																																					p.N106D		Atlas-SNP	.											.	CAPN11	66	.	0			c.A316G						.						19.0	21.0	20.0					6																	44137245		1894	4121	6015	SO:0001583	missense	11131	exon3			GTGCAGAACATCT	AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.316A>G	chr6.hg19:g.44137245A>G	ENSP00000381758:p.Asn106Asp	151.0	0.0		118.0	39.0	NM_007058	B2RA64|Q5T3G1|Q8N4R5	Missense_Mutation	SNP	ENST00000398776.1	hg19	CCDS47436.1	.	.	.	.	.	.	.	.	.	.	A	8.632	0.893884	0.17613	.	.	ENSG00000137225	ENST00000398776;ENST00000542245;ENST00000532171	D;D;D	0.87334	-2.24;-2.24;-2.24	4.31	0.57	0.17347	Peptidase C2, calpain, catalytic domain (3);	0.121320	0.37809	N	0.001940	T	0.66268	0.2772	L	0.45228	1.405	0.24481	N	0.994344	B	0.10296	0.003	B	0.12156	0.007	T	0.60895	-0.7172	10	0.46703	T	0.11	.	7.8633	0.29522	0.5116:0.0:0.4884:0.0	.	106	Q9UMQ6	CAN11_HUMAN	D	106;106;136	ENSP00000381758:N106D;ENSP00000441078:N106D;ENSP00000432420:N136D	ENSP00000381758:N106D	N	+	1	0	CAPN11	44245223	0.510000	0.26171	0.736000	0.30914	0.032000	0.12392	1.878000	0.39608	0.098000	0.17522	-0.263000	0.10527	AAC	.	.		0.542	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040714.3		
AIM1	202	hgsc.bcm.edu	37	6	106967133	106967133	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:106967133T>C	ENST00000369066.3	+	2	1313	c.826T>C	c.(826-828)Ttt>Ctt	p.F276L		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AATCTCCTTATTTGAAAACAA	0.433																																					p.F276L		Atlas-SNP	.											.	AIM1	161	.	0			c.T826C						.						56.0	55.0	55.0					6																	106967133		2203	4300	6503	SO:0001583	missense	202	exon2			TCCTTATTTGAAA	U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.826T>C	chr6.hg19:g.106967133T>C	ENSP00000358062:p.Phe276Leu	138.0	0.0		100.0	35.0	NM_001624	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	ENST00000369066.3	hg19	CCDS34506.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.935332	0.92458	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	D	0.83914	-1.78	5.59	5.59	0.84812	.	0.000000	0.44097	D	0.000481	D	0.87442	0.6178	M	0.63843	1.955	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.87929	0.2709	10	0.49607	T	0.09	.	15.7563	0.78030	0.0:0.0:0.0:1.0	.	276	Q9Y4K1	AIM1_HUMAN	L	684;276	ENSP00000358062:F276L	ENSP00000285105:F684L	F	+	1	0	AIM1	107073826	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.503000	0.66962	2.129000	0.65627	0.454000	0.30748	TTT	.	.		0.433	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041669.1		
KIAA1244	57221	hgsc.bcm.edu	37	6	138655844	138655844	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:138655844G>C	ENST00000251691.4	+	33	6027	c.5861G>C	c.(5860-5862)gGc>gCc	p.G1954A		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		TCCACCGGGGGCTTCTCTGGG	0.622																																					p.G1954A		Atlas-SNP	.											.	KIAA1244	236	.	0			c.G5861C						.						24.0	25.0	25.0					6																	138655844		2203	4300	6503	SO:0001583	missense	57221	exon33			CCGGGGGCTTCTC	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.5861G>C	chr6.hg19:g.138655844G>C	ENSP00000251691:p.Gly1954Ala	50.0	0.0		46.0	12.0	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	hg19	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	G	17.60	3.428918	0.62844	.	.	ENSG00000112379	ENST00000251691;ENST00000367706	T	0.21031	2.03	5.87	5.87	0.94306	.	3.981390	0.00397	N	0.000045	T	0.12646	0.0307	L	0.32530	0.975	0.58432	D	0.999992	P	0.37441	0.595	B	0.34931	0.192	T	0.48681	-0.9014	10	0.20046	T	0.44	-24.2261	20.2011	0.98259	0.0:0.0:1.0:0.0	.	1954	Q5TH69	BIG3_HUMAN	A	1954;119	ENSP00000251691:G1954A	ENSP00000251691:G1954A	G	+	2	0	KIAA1244	138697537	1.000000	0.71417	0.999000	0.59377	0.437000	0.31866	7.625000	0.83145	2.780000	0.95670	0.543000	0.68304	GGC	.	.		0.622	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
ACAT2	39	hgsc.bcm.edu	37	6	160197285	160197285	+	Silent	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr6:160197285C>T	ENST00000367048.4	+	6	2498	c.738C>T	c.(736-738)gtC>gtT	p.V246V	ACAT2_ENST00000541436.1_Silent_p.V275V|ACAT2_ENST00000472052.1_3'UTR	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2	246					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CGGGAACAGTCACCCCAGCCA	0.393																																					p.V246V		Atlas-SNP	.											.	ACAT2	32	.	0			c.C738T						.						67.0	66.0	66.0					6																	160197285		2203	4300	6503	SO:0001819	synonymous_variant	39	exon6			AACAGTCACCCCA	AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.738C>T	chr6.hg19:g.160197285C>T		90.0	0.0		62.0	15.0	NM_005891	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	Silent	SNP	ENST00000367048.4	hg19	CCDS5268.1																																																																																			.	.		0.393	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042912.1	NM_005891	
ZNF736	728927	hgsc.bcm.edu	37	7	63796756	63796756	+	Silent	SNP	C	C	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr7:63796756C>G	ENST00000423484.2	+	2	245	c.123C>G	c.(121-123)gtC>gtG	p.V41V	ZNF736_ENST00000355095.4_Silent_p.V41V			B4DX44	ZN736_HUMAN	zinc finger protein 736	41	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						GAAACCTGGTCTCCTTGGGTG	0.383																																					p.V41V		Atlas-SNP	.											.	ZNF736	33	.	0			c.C123G						.						63.0	64.0	64.0					7																	63796756		692	1591	2283	SO:0001819	synonymous_variant	728927	exon3			CCTGGTCTCCTTG		CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.123C>G	chr7.hg19:g.63796756C>G		27.0	0.0		25.0	6.0	NM_001170905		Silent	SNP	ENST00000423484.2	hg19	CCDS55114.1																																																																																			.	.		0.383	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000344559.2	NM_001170905	
ZNF107	51427	hgsc.bcm.edu	37	7	64167242	64167242	+	Missense_Mutation	SNP	C	C	A	rs199803183		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr7:64167242C>A	ENST00000395391.1	+	4	1935	c.560C>A	c.(559-561)cCc>cAc	p.P187H	ZNF107_ENST00000344930.3_Missense_Mutation_p.P187H|ZNF107_ENST00000423627.1_Missense_Mutation_p.P187H			Q9UII5	ZN107_HUMAN	zinc finger protein 107	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(18)|ovary(1)|stomach(1)	37		Lung NSC(55;0.00948)|all_lung(88;0.0249)				GAAGAGAAACCCAACAAATGT	0.368																																					p.P187H		Atlas-SNP	.											.	ZNF107	107	.	0			c.C560A						.						34.0	37.0	36.0					7																	64167242		2200	4299	6499	SO:0001583	missense	51427	exon7			AGAAACCCAACAA	AB027251	CCDS5527.1, CCDS75605.1, CCDS75606.1	7q11.2	2013-01-08	2007-06-26			ENSG00000196247		"""Zinc fingers, C2H2-type"""	12887	protein-coding gene	gene with protein product		603989	"""zinc finger protein 588"", ""zinc finger protein 107 (Y8)"""	ZNF588		8467795	Standard	NM_016220		Approved	ZFD25, smap-7	uc003tte.3	Q9UII5		ENST00000395391.1:c.560C>A	chr7.hg19:g.64167242C>A	ENSP00000378789:p.Pro187His	63.0	0.0		73.0	27.0	NM_016220		Missense_Mutation	SNP	ENST00000395391.1	hg19	CCDS5527.1	.	.	.	.	.	.	.	.	.	.	.	12.13	1.847049	0.32606	.	.	ENSG00000196247	ENST00000344930;ENST00000423627;ENST00000395391	T;T;T	0.29397	1.57;1.57;1.57	1.38	1.38	0.22167	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47097	0.1427	M	0.88310	2.945	0.36086	D	0.843146	D	0.55800	0.973	P	0.52267	0.694	T	0.61078	-0.7135	8	.	.	.	.	8.2014	0.31428	0.0:1.0:0.0:0.0	.	187	Q9UII5	ZN107_HUMAN	H	187	ENSP00000343443:P187H;ENSP00000400037:P187H;ENSP00000378789:P187H	.	P	+	2	0	ZNF107	63804677	0.058000	0.20735	0.010000	0.14722	0.037000	0.13140	1.469000	0.35343	0.712000	0.32039	0.448000	0.29417	CCC	.	C|0.999;T|0.001		0.368	ZNF107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251593.1	NM_016220	
WRN	7486	hgsc.bcm.edu	37	8	31030549	31030549	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr8:31030549G>A	ENST00000298139.5	+	35	4479	c.4230G>A	c.(4228-4230)tgG>tgA	p.W1410*	RP11-363L24.3_ENST00000523365.1_RNA|RP11-363L24.3_ENST00000521252.1_RNA	NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	1410					aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		TACCTGTGTGGTTTGCCAAAG	0.368			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												p.W1410X	Ovarian(18;161 598 2706 14834 27543)	Atlas-SNP	.	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	.	WRN	116	.	0			c.G4230A						.						97.0	92.0	94.0					8																	31030549		2203	4300	6503	SO:0001587	stop_gained	7486	exon35	Familial Cancer Database	WS, Adult Progeria	TGTGTGGTTTGCC		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.4230G>A	chr8.hg19:g.31030549G>A	ENSP00000298139:p.Trp1410*	80.0	0.0		35.0	16.0	NM_000553	A1KYY9	Nonsense_Mutation	SNP	ENST00000298139.5	hg19	CCDS6082.1	.	.	.	.	.	.	.	.	.	.	G	40	8.441325	0.98813	.	.	ENSG00000165392	ENST00000298139	.	.	.	3.96	3.96	0.45880	.	0.000000	0.52532	D	0.000076	.	.	.	.	.	.	0.53005	D	0.999968	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.9772	11.8351	0.52319	0.0:0.0:1.0:0.0	.	.	.	.	X	1410	.	ENSP00000298139:W1410X	W	+	3	0	WRN	31150091	1.000000	0.71417	0.985000	0.45067	0.042000	0.13812	3.470000	0.53100	2.501000	0.84356	0.591000	0.81541	TGG	.	.		0.368	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1		
JPH1	56704	hgsc.bcm.edu	37	8	75227318	75227318	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr8:75227318C>G	ENST00000342232.4	-	2	957	c.917G>C	c.(916-918)gGg>gCg	p.G306A		NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	306					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			TGCCCACTCCCCTTCATACTT	0.522																																					p.G306A		Atlas-SNP	.											.	JPH1	77	.	0			c.G917C						.						132.0	129.0	130.0					8																	75227318		2203	4300	6503	SO:0001583	missense	56704	exon2			CACTCCCCTTCAT	AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.917G>C	chr8.hg19:g.75227318C>G	ENSP00000344488:p.Gly306Ala	133.0	0.0		176.0	34.0	NM_020647	B2RTZ0	Missense_Mutation	SNP	ENST00000342232.4	hg19	CCDS6217.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812911	0.90707	.	.	ENSG00000104369	ENST00000342232	D	0.95482	-3.72	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.98538	0.9512	H	0.95079	3.62	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99349	1.0914	10	0.87932	D	0	.	19.1608	0.93531	0.0:1.0:0.0:0.0	.	306	Q9HDC5	JPH1_HUMAN	A	306	ENSP00000344488:G306A	ENSP00000344488:G306A	G	-	2	0	JPH1	75389873	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.597000	0.82733	2.749000	0.94314	0.655000	0.94253	GGG	.	.		0.522	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379102.1		
CCDC171	203238	hgsc.bcm.edu	37	9	15777776	15777776	+	Silent	SNP	A	A	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr9:15777776A>G	ENST00000380701.3	+	19	3178	c.2850A>G	c.(2848-2850)gtA>gtG	p.V950V	CCDC171_ENST00000297641.3_Silent_p.V950V|RNU6-14P_ENST00000384630.1_RNA	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	950																	TTCATAAAGTAAACACACTGG	0.408																																					p.V950V		Atlas-SNP	.											.	.	.	.	0			c.A2850G						.						77.0	79.0	78.0					9																	15777776		2203	4300	6503	SO:0001819	synonymous_variant	203238	exon19			TAAAGTAAACACA	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2850A>G	chr9.hg19:g.15777776A>G		72.0	0.0		62.0	29.0	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Silent	SNP	ENST00000380701.3	hg19	CCDS6481.1																																																																																			.	.		0.408	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
CNTLN	54875	hgsc.bcm.edu	37	9	17342344	17342344	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr9:17342344G>T	ENST00000380647.3	+	12	1872	c.1788G>T	c.(1786-1788)aaG>aaT	p.K596N	CNTLN_ENST00000262360.5_Missense_Mutation_p.K596N|CNTLN_ENST00000425824.1_Missense_Mutation_p.K596N			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	596					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGAAAATAAAGAGAGCAGATC	0.323																																					p.K596N		Atlas-SNP	.											.	CNTLN	128	.	0			c.G1788T						.						67.0	63.0	64.0					9																	17342344		1828	4076	5904	SO:0001583	missense	54875	exon12			AATAAAGAGAGCA	AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.1788G>T	chr9.hg19:g.17342344G>T	ENSP00000370021:p.Lys596Asn	193.0	0.0		140.0	45.0	NM_017738	A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Missense_Mutation	SNP	ENST00000380647.3	hg19	CCDS43789.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.112371	0.37242	.	.	ENSG00000044459	ENST00000380647;ENST00000425824;ENST00000262360	T;T;T	0.11821	2.74;2.74;2.74	5.45	5.45	0.79879	.	.	.	.	.	T	0.15132	0.0365	L	0.56769	1.78	0.37828	D	0.928632	P;P;P	0.41848	0.634;0.763;0.763	B;B;B	0.36608	0.167;0.229;0.167	T	0.04467	-1.0949	9	0.48119	T	0.1	.	12.6018	0.56501	0.0759:0.0:0.9241:0.0	.	596;596;596	Q9NXG0;C9J1F9;Q9NXG0-2	CNTLN_HUMAN;.;.	N	596	ENSP00000370021:K596N;ENSP00000392798:K596N;ENSP00000262360:K596N	ENSP00000262360:K596N	K	+	3	2	CNTLN	17332344	1.000000	0.71417	0.978000	0.43139	0.495000	0.33615	2.644000	0.46613	2.550000	0.86006	0.563000	0.77884	AAG	.	.		0.323	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051793.3	NM_017738	
HKDC1	80201	hgsc.bcm.edu	37	10	71025434	71025434	+	Silent	SNP	C	C	T	rs373165480		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr10:71025434C>T	ENST00000354624.5	+	17	2599	c.2466C>T	c.(2464-2466)tgC>tgT	p.C822C	RP11-227H15.5_ENST00000413220.1_RNA	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	822	Hexokinase type-2 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						AGGAGGTGTGCGGAGCCGTGT	0.642													C|||	1	0.000199681	0.0	0.0	5008	,	,		16556	0.0		0.0	False		,,,				2504	0.001				p.C822C		Atlas-SNP	.											.	HKDC1	98	.	0			c.C2466T						.						58.0	55.0	56.0					10																	71025434		2203	4299	6502	SO:0001819	synonymous_variant	80201	exon17			GGTGTGCGGAGCC		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.2466C>T	chr10.hg19:g.71025434C>T		87.0	0.0		80.0	38.0	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Silent	SNP	ENST00000354624.5	hg19	CCDS7288.1																																																																																			.	.		0.642	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
ANO9	338440	hgsc.bcm.edu	37	11	428795	428795	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr11:428795G>A	ENST00000332826.6	-	12	1031	c.947C>T	c.(946-948)cCc>cTc	p.P316L		NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	316					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						CTTGTAGTCGGGGCAGTTAAT	0.612																																					p.P316L		Atlas-SNP	.											.	ANO9	61	.	0			c.C947T						.						254.0	185.0	209.0					11																	428795		2198	4296	6494	SO:0001583	missense	338440	exon12			TAGTCGGGGCAGT	U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.947C>T	chr11.hg19:g.428795G>A	ENSP00000332788:p.Pro316Leu	60.0	0.0		42.0	12.0	NM_001012302	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	ENST00000332826.6	hg19	CCDS31326.1	.	.	.	.	.	.	.	.	.	.	G	3.960	-0.010449	0.07727	.	.	ENSG00000185101	ENST00000332826	T	0.62232	0.04	3.62	2.68	0.31781	.	4.560930	0.00622	N	0.000454	T	0.55689	0.1936	L	0.41710	1.295	0.09310	N	1	B;B	0.19200	0.013;0.034	B;B	0.18561	0.009;0.022	T	0.32666	-0.9898	10	0.23891	T	0.37	.	8.9508	0.35788	0.0877:0.15:0.7623:0.0	.	17;316	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	L	316	ENSP00000332788:P316L	ENSP00000332788:P316L	P	-	2	0	ANO9	418795	0.016000	0.18221	0.021000	0.16686	0.037000	0.13140	1.853000	0.39358	0.848000	0.35191	0.462000	0.41574	CCC	.	.		0.612	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384116.1	NM_001012302	
SYT9	143425	hgsc.bcm.edu	37	11	7273526	7273526	+	Silent	SNP	C	C	T	rs146068689		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr11:7273526C>T	ENST00000318881.6	+	1	346	c.109C>T	c.(109-111)Ctg>Ttg	p.L37L	SYT9_ENST00000396716.2_Intron	NM_175733.3	NP_783860.1	Q86SS6	SYT9_HUMAN	synaptotagmin IX	37					positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|integral component of membrane (GO:0016021)|secretory granule membrane (GO:0030667)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	38				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		CATTTACCACCTGCGGGACCG	0.716																																					p.L37L		Atlas-SNP	.											.	SYT9	91	.	0			c.C109T						.						13.0	13.0	13.0					11																	7273526		2156	4206	6362	SO:0001819	synonymous_variant	143425	exon1			TACCACCTGCGGG	AK055003	CCDS7778.1	11p15.4	2013-01-21			ENSG00000170743	ENSG00000170743		"""Synaptotagmins"""	19265	protein-coding gene	gene with protein product		613528				11543631	Standard	NM_175733		Approved		uc001mfe.3	Q86SS6	OTTHUMG00000165499	ENST00000318881.6:c.109C>T	chr11.hg19:g.7273526C>T		52.0	0.0		57.0	23.0	NM_175733		Silent	SNP	ENST00000318881.6	hg19	CCDS7778.1																																																																																			.	C|1.000;G|0.000		0.716	SYT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384483.1	NM_175733	
OR5D18	219438	hgsc.bcm.edu	37	11	55587833	55587833	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr11:55587833C>T	ENST00000333976.4	+	1	748	c.728C>T	c.(727-729)gCc>gTc	p.A243V		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	243						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				TCCACCTGTGCCTCCCACCTG	0.517																																					p.A243V		Atlas-SNP	.											.	OR5D18	121	.	0			c.C728T						.						131.0	112.0	119.0					11																	55587833		2200	4296	6496	SO:0001583	missense	219438	exon1			CCTGTGCCTCCCA	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.728C>T	chr11.hg19:g.55587833C>T	ENSP00000335025:p.Ala243Val	87.0	0.0		70.0	20.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Missense_Mutation	SNP	ENST00000333976.4	hg19	CCDS31510.1	.	.	.	.	.	.	.	.	.	.	.	15.83	2.948752	0.53186	.	.	ENSG00000186119	ENST00000333976	T	0.38560	1.13	4.9	1.92	0.25849	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39210	N	0.001428	T	0.51143	0.1657	M	0.74389	2.26	0.26071	N	0.981222	P	0.37330	0.59	P	0.51079	0.658	T	0.48768	-0.9006	10	0.66056	D	0.02	-12.1998	4.7313	0.12966	0.1443:0.4973:0.2798:0.0786	.	243	Q8NGL1	OR5DI_HUMAN	V	243	ENSP00000335025:A243V	ENSP00000335025:A243V	A	+	2	0	OR5D18	55344409	0.000000	0.05858	0.966000	0.40874	0.964000	0.63967	-0.131000	0.10482	0.211000	0.20683	0.573000	0.79308	GCC	.	.		0.517	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
OR5B12	390191	hgsc.bcm.edu	37	11	58207024	58207025	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr11:58207024_58207025CC>AA	ENST00000302572.2	-	1	621_622	c.600_601GG>TT	c.(598-603)gtGGtg>gtTTtg	p.V201L		NM_001004733.2	NP_001004733.1	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B, member 12	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(6)|liver(1)|lung(28)|ovary(1)|prostate(3)|skin(1)	40	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TTGAATCCCACCACAAAAAAAA	0.396																																					p.V201L|p.V200V		Atlas-SNP	.											.	OR5B12	80	.	0			c.G601T|c.G600T						.																																			SO:0001583	missense	390191	exon1			ATCCCACCACAAA|TCCCACCACAAAA	AB065851	CCDS31551.1	11q12.1	2012-08-09		2004-03-10	ENSG00000172362	ENSG00000172362		"""GPCR / Class A : Olfactory receptors"""	15432	protein-coding gene	gene with protein product				OR5B12P, OR5B16		12213199	Standard	NM_001004733		Approved	OST743	uc010rkh.2	Q96R08	OTTHUMG00000167543	ENST00000302572.2:c.600_601delinsAA	chr11.hg19:g.58207024_58207025delinsAA	ENSP00000306657:p.Val201Leu	106.0|105.0	0.0		94.0|95.0	44.0	NM_001004733	B2RNL2|Q6IEV5	Missense_Mutation|Silent	SNP	ENST00000302572.2	hg19	CCDS31551.1																																																																																			.	.		0.396	OR5B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394987.1	NM_001004733	
VWF	7450	hgsc.bcm.edu	37	12	6125791	6125791	+	Silent	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr12:6125791C>T	ENST00000261405.5	-	30	5456	c.5202G>A	c.(5200-5202)caG>caA	p.Q1734Q		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1734	VWFA 3; main binding site for collagens type I and III. {ECO:0000255|PROSITE- ProRule:PRU00219}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TGCTTCCATACTGCAGCACTG	0.537																																					p.Q1734Q		Atlas-SNP	.											.	VWF	338	.	0			c.G5202A						.						86.0	80.0	82.0					12																	6125791		2203	4300	6503	SO:0001819	synonymous_variant	7450	exon30			TCCATACTGCAGC		CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.5202G>A	chr12.hg19:g.6125791C>T		102.0	0.0		111.0	28.0	NM_000552	Q8TCE8|Q99806	Silent	SNP	ENST00000261405.5	hg19	CCDS8539.1																																																																																			.	.		0.537	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399020.1	NM_000552	
NPAS3	64067	hgsc.bcm.edu	37	14	33684417	33684417	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr14:33684417G>T	ENST00000356141.4	+	3	170	c.170G>T	c.(169-171)cGa>cTa	p.R57L	NPAS3_ENST00000341321.4_Missense_Mutation_p.R57L|NPAS3_ENST00000548645.1_Missense_Mutation_p.R27L|NPAS3_ENST00000547068.1_5'UTR|NPAS3_ENST00000346562.2_Missense_Mutation_p.R27L|NPAS3_ENST00000551008.1_5'Flank|NPAS3_ENST00000357798.5_Missense_Mutation_p.R27L|NPAS3_ENST00000551492.1_Missense_Mutation_p.R64L			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	57	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		GAGAAATCCCGAGATGCTGCT	0.443																																					p.R57L		Atlas-SNP	.											.	NPAS3	266	.	0			c.G170T						.						54.0	61.0	59.0					14																	33684417		2203	4300	6503	SO:0001583	missense	64067	exon3			AATCCCGAGATGC	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.170G>T	chr14.hg19:g.33684417G>T	ENSP00000348460:p.Arg57Leu	93.0	0.0		95.0	26.0	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	hg19	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892889	0.91889	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000341321;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;D;T;T;T	0.97924	3.19;2.0;3.14;-4.61;3.13;2.0;2.98	5.96	5.96	0.96718	Helix-loop-helix DNA-binding (4);	0.000000	0.56097	D	0.000025	D	0.98617	0.9537	M	0.71871	2.18	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.999;0.999	D;D;D;D	0.79108	0.992;0.981;0.992;0.992	D	0.99486	1.0949	10	0.87932	D	0	.	20.4008	0.98991	0.0:0.0:1.0:0.0	.	27;57;27;27	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	L	34;64;27;57;27;57;27	ENSP00000448373:R34L;ENSP00000450392:R64L;ENSP00000319610:R27L;ENSP00000344158:R57L;ENSP00000448916:R27L;ENSP00000348460:R57L;ENSP00000350446:R27L	ENSP00000344158:R57L	R	+	2	0	NPAS3	32754168	1.000000	0.71417	1.000000	0.80357	0.833000	0.47200	9.845000	0.99498	2.826000	0.97356	0.655000	0.94253	CGA	.	.		0.443	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
OTX2	5015	hgsc.bcm.edu	37	14	57268479	57268479	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr14:57268479A>T	ENST00000555006.1	-	4	1252	c.844T>A	c.(844-846)Tcc>Acc	p.S282T	RP11-1085N6.6_ENST00000602485.1_lincRNA|OTX2_ENST00000408990.3_Missense_Mutation_p.S282T|OTX2_ENST00000339475.5_Missense_Mutation_p.S290T			P32243	OTX2_HUMAN	orthodenticle homeobox 2	282					axon guidance (GO:0007411)|cell fate specification (GO:0001708)|diencephalon morphogenesis (GO:0048852)|dorsal/ventral pattern formation (GO:0009953)|endoderm development (GO:0007492)|eye photoreceptor cell fate commitment (GO:0042706)|forebrain development (GO:0030900)|inner ear morphogenesis (GO:0042472)|metencephalon development (GO:0022037)|midbrain development (GO:0030901)|neuron fate determination (GO:0048664)|positive regulation of embryonic development (GO:0040019)|positive regulation of gastrulation (GO:2000543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|primitive streak formation (GO:0090009)|protein complex assembly (GO:0006461)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of smoothened signaling pathway (GO:0008589)|somite rostral/caudal axis specification (GO:0032525)	cytoplasm (GO:0005737)|growth cone (GO:0030426)|nucleus (GO:0005634)|protein complex (GO:0043234)	eukaryotic initiation factor 4E binding (GO:0008190)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	19	Medulloblastoma(1;0.00184)|all_neural(1;0.00414)					TTCCACGAGGATGTCTGATCT	0.413																																					p.S290T		Atlas-SNP	.											.	OTX2	47	.	0			c.T868A						.						64.0	68.0	67.0					14																	57268479		2203	4300	6503	SO:0001583	missense	5015	exon3			ACGAGGATGTCTG	AF298117	CCDS9728.1, CCDS41960.1	14q22.3	2014-09-17	2007-02-15		ENSG00000165588	ENSG00000165588		"""Homeoboxes / PRD class"""	8522	protein-coding gene	gene with protein product		600037	"""orthodenticle homolog 2 (Drosophila)"""			7959790	Standard	NM_021728		Approved		uc031qor.1	P32243	OTTHUMG00000152338	ENST00000555006.1:c.844T>A	chr14.hg19:g.57268479A>T	ENSP00000452336:p.Ser282Thr	101.0	0.0		72.0	33.0	NM_001270525	B2RAN5|Q6GTV3|Q9HAW3|Q9P2R1	Missense_Mutation	SNP	ENST00000555006.1	hg19	CCDS41960.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.901855	0.33535	.	.	ENSG00000165588	ENST00000339475;ENST00000408990;ENST00000555006	D;D;D	0.90444	-2.67;-2.65;-2.65	5.65	5.65	0.86999	.	0.312780	0.23272	N	0.050008	D	0.82788	0.5113	N	0.11560	0.145	0.35723	D	0.81732	B;B	0.12013	0.005;0.001	B;B	0.10450	0.004;0.005	T	0.82592	-0.0381	10	0.72032	D	0.01	.	15.2098	0.73214	1.0:0.0:0.0:0.0	.	290;282	F1T0D1;P32243	.;OTX2_HUMAN	T	290;282;282	ENSP00000343819:S290T;ENSP00000386185:S282T;ENSP00000452336:S282T	ENSP00000343819:S290T	S	-	1	0	OTX2	56338232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.231000	0.78106	2.371000	0.80710	0.533000	0.62120	TCC	.	.		0.413	OTX2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411522.1	NM_021728.	
UBE3A	7337	hgsc.bcm.edu	37	15	25616615	25616615	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr15:25616615T>C	ENST00000397954.2	-	4	714	c.715A>G	c.(715-717)Att>Gtt	p.I239V	UBE3A_ENST00000566215.1_Missense_Mutation_p.I216V|UBE3A_ENST00000428984.2_Missense_Mutation_p.I216V|UBE3A_ENST00000232165.3_Missense_Mutation_p.I236V|SNHG14_ENST00000554726.1_RNA|UBE3A_ENST00000438097.1_Missense_Mutation_p.I216V			Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A	239					androgen receptor signaling pathway (GO:0030521)|brain development (GO:0007420)|ovarian follicle development (GO:0001541)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland growth (GO:0060736)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|proteolysis (GO:0006508)|sperm entry (GO:0035037)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(13)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	38		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		ACCCTTCTAATGGCATCAATA	0.408																																					p.I239V		Atlas-SNP	.											.	UBE3A	109	.	0			c.A715G						.						148.0	147.0	147.0					15																	25616615		2203	4300	6503	SO:0001583	missense	7337	exon7			TTCTAATGGCATC	AF002224	CCDS32177.1, CCDS45191.1, CCDS45192.1	15q11.2	2014-09-17	2008-07-31		ENSG00000114062	ENSG00000114062	6.3.2.19		12496	protein-coding gene	gene with protein product	"""Angelman syndrome"""	601623	"""human papilloma virus E6-associated protein"""	EPVE6AP, HPVE6A		8221889	Standard	NM_130838		Approved	AS, ANCR, E6-AP, FLJ26981	uc001zas.3	Q05086		ENST00000397954.2:c.715A>G	chr15.hg19:g.25616615T>C	ENSP00000381045:p.Ile239Val	59.0	0.0		69.0	29.0	NM_000462	A8K8Z9|P78355|Q93066|Q9UEP4|Q9UEP5|Q9UEP6|Q9UEP7|Q9UEP8|Q9UEP9	Missense_Mutation	SNP	ENST00000397954.2	hg19	CCDS45192.1	.	.	.	.	.	.	.	.	.	.	T	1.304	-0.604168	0.03717	.	.	ENSG00000114062	ENST00000232165;ENST00000356465;ENST00000397954;ENST00000438097;ENST00000428984	T;T;T;T	0.15487	2.42;2.42;2.42;2.42	5.8	0.901	0.19284	.	0.161068	0.56097	N	0.000036	T	0.02688	0.0081	N	0.00210	-1.845	0.32995	D	0.525486	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44907	-0.9297	10	0.02654	T	1	.	8.6434	0.33991	0.0:0.515:0.0:0.485	.	236;239	Q05086-3;Q05086	.;UBE3A_HUMAN	V	236;236;239;216;216	ENSP00000232165:I236V;ENSP00000381045:I239V;ENSP00000411258:I216V;ENSP00000401265:I216V	ENSP00000232165:I236V	I	-	1	0	UBE3A	23167708	0.998000	0.40836	0.761000	0.31378	0.991000	0.79684	2.105000	0.41825	0.121000	0.18284	0.477000	0.44152	ATT	.	.		0.408	UBE3A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000434203.1	NM_000462	
MGA	23269	hgsc.bcm.edu	37	15	41961695	41961695	+	Silent	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr15:41961695G>A	ENST00000570161.1	+	1	603	c.603G>A	c.(601-603)ctG>ctA	p.L201L	MGA_ENST00000219905.7_Silent_p.L201L|MGA_ENST00000568630.1_Intron|MGA_ENST00000566586.1_Silent_p.L201L|MGA_ENST00000389936.4_Silent_p.L201L|MGA_ENST00000545763.1_Silent_p.L201L			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATCGTTACCTGCCGAGGCTTC	0.438																																					p.L201L		Atlas-SNP	.											.	MGA	264	.	0			c.G603A						.						135.0	133.0	134.0					15																	41961695		1979	4159	6138	SO:0001819	synonymous_variant	23269	exon2			TTACCTGCCGAGG	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.603G>A	chr15.hg19:g.41961695G>A		92.0	0.0		90.0	23.0	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	hg19	CCDS55959.1																																																																																			.	.		0.438	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
MYO5C	55930	hgsc.bcm.edu	37	15	52521421	52521421	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr15:52521421T>C	ENST00000261839.7	-	25	3277	c.3116A>G	c.(3115-3117)gAg>gGg	p.E1039G		NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	1039						extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TTGCATCTTCTCATCCTTGAG	0.478																																					p.E1039G		Atlas-SNP	.											.	MYO5C	162	.	0			c.A3116G						.						134.0	128.0	130.0					15																	52521421		1905	4114	6019	SO:0001583	missense	55930	exon25			ATCTTCTCATCCT	AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.3116A>G	chr15.hg19:g.52521421T>C	ENSP00000261839:p.Glu1039Gly	62.0	0.0		37.0	14.0	NM_018728	Q6P1W8	Missense_Mutation	SNP	ENST00000261839.7	hg19	CCDS42036.1	.	.	.	.	.	.	.	.	.	.	T	18.14	3.558584	0.65538	.	.	ENSG00000128833	ENST00000261839	T	0.18657	2.2	5.88	5.88	0.94601	.	0.058580	0.64402	D	0.000002	T	0.22859	0.0552	N	0.19112	0.55	0.80722	D	1	D	0.56968	0.978	P	0.54499	0.754	T	0.02450	-1.1157	10	0.66056	D	0.02	.	9.8877	0.41272	0.0:0.0754:0.0:0.9246	.	1039	Q9NQX4	MYO5C_HUMAN	G	1039	ENSP00000261839:E1039G	ENSP00000261839:E1039G	E	-	2	0	MYO5C	50308713	1.000000	0.71417	0.963000	0.40424	0.528000	0.34623	4.697000	0.61782	2.243000	0.73865	0.528000	0.53228	GAG	.	.		0.478	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419562.1	NM_018728	
SCAPER	49855	hgsc.bcm.edu	37	15	77057677	77057677	+	Splice_Site	SNP	C	C	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr15:77057677C>A	ENST00000563290.1	-	13	1709		c.e13+1		SCAPER_ENST00000324767.7_Splice_Site|SCAPER_ENST00000538941.2_Splice_Site			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER							endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						AAATGCCAGACCTTTTACGAG	0.398																																					.		Atlas-SNP	.											.	SCAPER	160	.	0			c.1613+1G>T						.						73.0	65.0	68.0					15																	77057677		1838	4085	5923	SO:0001630	splice_region_variant	49855	exon13			GCCAGACCTTTTA	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.1613+1G>T	chr15.hg19:g.77057677C>A		125.0	0.0		95.0	26.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Splice_Site	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.530342	0.85706	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6939	0.96016	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCAPER	74844732	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.487000	0.81328	2.660000	0.90430	0.455000	0.32223	.	.	.		0.398	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	Intron
TRPV3	162514	hgsc.bcm.edu	37	17	3446875	3446875	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr17:3446875T>G	ENST00000576742.1	-	5	680	c.359A>C	c.(358-360)aAg>aCg	p.K120T	TRPV3_ENST00000301365.4_Missense_Mutation_p.K120T|TRPV3_ENST00000572519.1_Missense_Mutation_p.K120T	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	120					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GATGCGCTTCTTCAGCCGCCT	0.547																																					p.K120T		Atlas-SNP	.											.	TRPV3	85	.	0			c.A359C						.						110.0	106.0	108.0					17																	3446875		2203	4300	6503	SO:0001583	missense	162514	exon5			CGCTTCTTCAGCC	AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.359A>C	chr17.hg19:g.3446875T>G	ENSP00000461518:p.Lys120Thr	60.0	0.0		26.0	20.0	NM_001258205	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	ENST00000576742.1	hg19	CCDS11029.1	.	.	.	.	.	.	.	.	.	.	T	13.59	2.283203	0.40394	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.88509	-2.39	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.92802	0.7711	M	0.64170	1.965	0.35700	D	0.815542	D;B;P;B;D;P;P	0.76494	0.999;0.215;0.946;0.215;0.999;0.713;0.665	D;B;P;B;D;P;B	0.80764	0.994;0.135;0.809;0.135;0.994;0.518;0.384	D	0.95196	0.8312	10	0.59425	D	0.04	-5.1433	12.9536	0.58415	0.0:0.0:0.0:1.0	.	104;104;120;104;120;120;120	E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;TRPV3_HUMAN;.	T	120;120;104	ENSP00000301365:K120T	ENSP00000301365:K120T	K	-	2	0	TRPV3	3393625	1.000000	0.71417	1.000000	0.80357	0.101000	0.19017	4.411000	0.59781	2.060000	0.61445	0.459000	0.35465	AAG	.	.		0.547	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207379.2	NM_145068	
TP53	7157	hgsc.bcm.edu	37	17	7578205	7578205	+	Missense_Mutation	SNP	C	C	T	rs587782177		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr17:7578205C>T	ENST00000269305.4	-	6	833	c.644G>A	c.(643-645)aGt>aAt	p.S215N	TP53_ENST00000420246.2_Missense_Mutation_p.S215N|TP53_ENST00000445888.2_Missense_Mutation_p.S215N|TP53_ENST00000413465.2_Missense_Mutation_p.S215N|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.S215N|TP53_ENST00000455263.2_Missense_Mutation_p.S215N	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	215	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		S -> C (in sporadic cancers; somatic mutation).|S -> G (in sporadic cancers; somatic mutation).|S -> I (in sporadic cancers; somatic mutation).|S -> K (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|S -> N (in sporadic cancers; somatic mutation).|S -> R (in sporadic cancers; somatic mutation).|S -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.S215I(18)|p.S215N(9)|p.0?(8)|p.?(5)|p.S215T(3)|p.S215fs*32(3)|p.H214fs*5(2)|p.S122N(1)|p.S215fs*27(1)|p.S215del(1)|p.S215fs*29(1)|p.D208_V216delDRNTFRHSV(1)|p.S83I(1)|p.S83N(1)|p.T211_S215delTFRHS(1)|p.D208fs*1(1)|p.S215fs*31(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.S122I(1)|p.D207_V216del10(1)|p.S215_V218>M(1)|p.R209fs*6(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CACCACCACACTATGTCGAAA	0.537		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.S215N	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,lymphoid_neoplasm,+1,1	TP53	33396	.	64	Substitution - Missense(34)|Deletion - Frameshift(10)|Whole gene deletion(8)|Unknown(5)|Deletion - In frame(4)|Complex - deletion inframe(2)|Complex - frameshift(1)	biliary_tract(10)|oesophagus(10)|lung(9)|large_intestine(6)|ovary(6)|bone(5)|upper_aerodigestive_tract(4)|haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|liver(2)|breast(2)|stomach(1)|kidney(1)|skin(1)	c.G644A						.						125.0	112.0	116.0					17																	7578205		2203	4300	6503	SO:0001583	missense	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACCACACTATGTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.644G>A	chr17.hg19:g.7578205C>T	ENSP00000269305:p.Ser215Asn	108.0	1.0		51.0	29.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	29.3	4.996533	0.93167	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99854	-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19;-7.19	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.73598	2.24	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.996;0.999;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	0.993;1.0;0.973;0.992;1.0;1.0;0.999	D	0.96641	0.9474	10	0.87932	D	0	-18.3023	16.7921	0.85592	0.0:1.0:0.0:0.0	.	176;215;215;122;215;215;215	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	N	215;215;215;215;215;215;204;122;83;122;83	ENSP00000410739:S215N;ENSP00000352610:S215N;ENSP00000269305:S215N;ENSP00000398846:S215N;ENSP00000391127:S215N;ENSP00000391478:S215N;ENSP00000425104:S83N;ENSP00000423862:S122N	ENSP00000269305:S215N	S	-	2	0	TP53	7518930	1.000000	0.71417	0.567000	0.28434	0.964000	0.63967	6.042000	0.70996	2.634000	0.89283	0.563000	0.77884	AGT	.	.		0.537	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
KRTAP16-1	100505753	hgsc.bcm.edu	37	17	39464367	39464367	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr17:39464367G>C	ENST00000391352.1	-	1	1138	c.1139C>G	c.(1138-1140)cCc>cGc	p.P380R		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	380						keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						GCTGGAACTGGGTATGTAGAA	0.572																																					p.P380R		Atlas-SNP	.											.	KRTAP16-1	12	.	0			c.C1139G						.																																			SO:0001583	missense	100505753	exon1			GAACTGGGTATGT	AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.1139C>G	chr17.hg19:g.39464367G>C	ENSP00000375147:p.Pro380Arg	119.0	0.0		115.0	24.0	NM_001146182		Missense_Mutation	SNP	ENST00000391352.1	hg19	CCDS56032.1	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789663	0.31685	.	.	ENSG00000212657	ENST00000391352	T	0.00912	5.55	5.08	5.08	0.68730	.	.	.	.	.	T	0.01353	0.0044	N	0.24115	0.695	0.31313	N	0.686897	.	.	.	.	.	.	T	0.57093	-0.7870	7	0.27082	T	0.32	.	13.8508	0.63496	0.0:0.0:1.0:0.0	.	.	.	.	R	380	ENSP00000375147:P380R	ENSP00000375147:P380R	P	-	2	0	KRTAP16-1	36717893	1.000000	0.71417	1.000000	0.80357	0.120000	0.20174	3.573000	0.53856	2.642000	0.89623	0.561000	0.74099	CCC	.	.		0.572	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257785.1	NM_001146182	
AATK	9625	hgsc.bcm.edu	37	17	79094718	79094718	+	Missense_Mutation	SNP	C	C	G	rs546580102		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr17:79094718C>G	ENST00000326724.4	-	11	3042	c.3018G>C	c.(3016-3018)gaG>gaC	p.E1006D	AATK_ENST00000417379.1_Missense_Mutation_p.E903D	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1006					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			CTGAGGTGGCCTCGGCCTCAG	0.672																																					p.E1006D		Atlas-SNP	.											.	AATK	102	.	0			c.G3018C						.						17.0	19.0	18.0					17																	79094718		1875	4098	5973	SO:0001583	missense	9625	exon11			GGTGGCCTCGGCC	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3018G>C	chr17.hg19:g.79094718C>G	ENSP00000324196:p.Glu1006Asp	64.0	0.0		71.0	21.0	NM_001080395	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	hg19	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.64|10.64	1.407952|1.407952	0.25378|0.25378	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000326724|ENST00000417379	T|.	0.11063|.	2.81|.	5.2|5.2	-0.0483|-0.0483	0.13839|0.13839	.|.	28.962000|.	0.00166|.	N|.	0.000005|.	T|T	0.21387|0.21387	0.0515|0.0515	N|N	0.21142|0.21142	0.635|0.635	0.22017|0.22017	N|N	0.999411|0.999411	B|.	0.30664|.	0.289|.	B|.	0.23275|.	0.045|.	T|T	0.26326|0.26326	-1.0106|-1.0106	10|5	0.15066|.	T|.	0.55|.	.|.	4.7113|4.7113	0.12873|0.12873	0.0:0.4439:0.3194:0.2367|0.0:0.4439:0.3194:0.2367	.|.	1006|.	Q6ZMQ8|.	LMTK1_HUMAN|.	D|T	1006|959	ENSP00000324196:E1006D|.	ENSP00000324196:E1006D|.	E|R	-|-	3|2	2|0	AATK|AATK	76709313|76709313	0.011000|0.011000	0.17503|0.17503	0.007000|0.007000	0.13788|0.13788	0.009000|0.009000	0.06853|0.06853	-0.040000|-0.040000	0.12104|0.12104	0.003000|0.003000	0.14656|0.14656	0.462000|0.462000	0.41574|0.41574	GAG|AGG	.	.		0.672	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
EMILIN2	84034	hgsc.bcm.edu	37	18	2885054	2885054	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr18:2885054A>G	ENST00000254528.3	+	3	509	c.350A>G	c.(349-351)gAt>gGt	p.D117G		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	117	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.				cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		AGAGGGGGAGATTGCCAAGAA	0.522																																					p.D117G		Atlas-SNP	.											.	EMILIN2	97	.	0			c.A350G						.						101.0	92.0	95.0					18																	2885054		2203	4300	6503	SO:0001583	missense	84034	exon3			GGGGAGATTGCCA	AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.350A>G	chr18.hg19:g.2885054A>G	ENSP00000254528:p.Asp117Gly	76.0	0.0		59.0	22.0	NM_032048	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	ENST00000254528.3	hg19	CCDS11828.1	.	.	.	.	.	.	.	.	.	.	A	27.5	4.833821	0.91036	.	.	ENSG00000132205	ENST00000254528	T	0.37752	1.18	5.83	5.83	0.93111	EMI domain (1);	0.217303	0.39407	N	0.001363	T	0.49490	0.1560	L	0.47716	1.5	0.58432	D	0.999999	P	0.50272	0.933	P	0.57057	0.812	T	0.44406	-0.9330	10	0.51188	T	0.08	-29.7081	16.2121	0.82168	1.0:0.0:0.0:0.0	.	117	Q9BXX0	EMIL2_HUMAN	G	117	ENSP00000254528:D117G	ENSP00000254528:D117G	D	+	2	0	EMILIN2	2875054	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	6.750000	0.74888	2.223000	0.72356	0.528000	0.53228	GAT	.	.		0.522	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250337.2	NM_032048	
ZNF43	7594	hgsc.bcm.edu	37	19	22000753	22000753	+	Silent	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr19:22000753G>A	ENST00000354959.4	-	3	335	c.166C>T	c.(166-168)Ctg>Ttg	p.L56L	ZNF43_ENST00000595461.1_Silent_p.L50L|ZNF43_ENST00000598381.1_Silent_p.L50L|ZNF43_ENST00000598288.1_Silent_p.L50L|ZNF43_ENST00000594012.1_Silent_p.L50L	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	56	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		TCTTGCTCCAGACAGGTGATC	0.408																																					p.L65L		Atlas-SNP	.											.	ZNF43	152	.	0			c.C193T						.						156.0	157.0	156.0					19																	22000753		2203	4300	6503	SO:0001819	synonymous_variant	7594	exon3			GCTCCAGACAGGT	X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.166C>T	chr19.hg19:g.22000753G>A		61.0	0.0		52.0	34.0	NM_001256653	A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Silent	SNP	ENST00000354959.4	hg19	CCDS12413.2																																																																																			.	.		0.408	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250380.2	NM_003423	
KCNJ14	3770	hgsc.bcm.edu	37	19	48965315	48965315	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr19:48965315G>A	ENST00000391884.1	+	1	810	c.334G>A	c.(334-336)Gcc>Acc	p.A112T	KCNJ14_ENST00000342291.2_Missense_Mutation_p.A112T			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14	112					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	CTGGCTCATTGCCTCGCTGCA	0.692																																					p.G112S	NSCLC(148;170 3504 35216)	Atlas-SNP	.											.	KCNJ14	28	.	0			c.G334A						.						46.0	26.0	33.0					19																	48965315		2203	4300	6503	SO:0001583	missense	3770	exon2			CTCATTGCCTCGC	BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.334G>A	chr19.hg19:g.48965315G>A	ENSP00000375756:p.Ala112Thr	22.0	0.0		43.0	26.0	NM_013348		Missense_Mutation	SNP	ENST00000391884.1	hg19	CCDS12721.1	.	.	.	.	.	.	.	.	.	.	G	25.7	4.665038	0.88251	.	.	ENSG00000182324	ENST00000342291;ENST00000391884	D;D	0.96685	-4.09;-4.09	4.45	3.4	0.38934	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	D	0.000000	D	0.97851	0.9294	M	0.89601	3.045	0.54753	D	0.999983	D	0.54397	0.966	P	0.62089	0.898	D	0.97931	1.0320	10	0.87932	D	0	.	10.6938	0.45886	0.0959:0.0:0.9041:0.0	.	112	Q9UNX9	IRK14_HUMAN	T	112	ENSP00000341479:A112T;ENSP00000375756:A112T	ENSP00000341479:A112T	A	+	1	0	KCNJ14	53657127	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	9.786000	0.99046	1.008000	0.39264	0.591000	0.81541	GCC	.	.		0.692	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466127.1	NM_013348	
SLC24A3	57419	hgsc.bcm.edu	37	20	19560719	19560719	+	Splice_Site	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr20:19560719G>C	ENST00000328041.6	+	4	620		c.e4+1			NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3						ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GATCTGTGAGGTACGTGCCTC	0.532																																					.		Atlas-SNP	.											.	SLC24A3	92	.	0			c.423+1G>C						.						381.0	258.0	300.0					20																	19560719		2203	4300	6503	SO:0001630	splice_region_variant	57419	exon4			TGTGAGGTACGTG	AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.423+1G>C	chr20.hg19:g.19560719G>C		101.0	0.0		105.0	58.0	NM_020689	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Splice_Site	SNP	ENST00000328041.6	hg19	CCDS13140.1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.839821	0.91117	.	.	ENSG00000185052	ENST00000328041	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9079	0.86133	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC24A3	19508719	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.269000	0.95684	2.664000	0.90586	0.655000	0.94253	.	.	.		0.532	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078207.4	NM_020689	Intron
ZSWIM1	90204	hgsc.bcm.edu	37	20	44512235	44512235	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr20:44512235C>T	ENST00000372523.1	+	2	1099	c.1004C>T	c.(1003-1005)aCa>aTa	p.T335I	ZSWIM1_ENST00000372520.1_Missense_Mutation_p.T335I	NM_080603.4	NP_542170.3	Q9BR11	ZSWM1_HUMAN	zinc finger, SWIM-type containing 1	335						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13		Myeloproliferative disorder(115;0.028)				GCCATCTGCACAGGGCCAGCA	0.557																																					p.T335I		Atlas-SNP	.											.	ZSWIM1	35	.	0			c.C1004T						.						108.0	99.0	102.0					20																	44512235		2203	4300	6503	SO:0001583	missense	90204	exon2			TCTGCACAGGGCC	AL008726	CCDS13382.2	20q13.12	2013-09-20	2003-12-17	2003-12-19	ENSG00000168612	ENSG00000168612		"""Zinc fingers, SWIM-type"""	16155	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 162"""	C20orf162			Standard	NM_080603		Approved	dJ337O18.5	uc010ghi.3	Q9BR11	OTTHUMG00000074023	ENST00000372523.1:c.1004C>T	chr20.hg19:g.44512235C>T	ENSP00000361601:p.Thr335Ile	77.0	0.0		96.0	51.0	NM_080603	Q5JZH2|Q9BR12|Q9BV30	Missense_Mutation	SNP	ENST00000372523.1	hg19	CCDS13382.2	.	.	.	.	.	.	.	.	.	.	C	9.401	1.078054	0.20227	.	.	ENSG00000168612	ENST00000372523;ENST00000372520	T;T	0.24723	1.84;1.84	5.03	3.11	0.35812	.	0.231898	0.28742	U	0.014285	T	0.12689	0.0308	N	0.14661	0.345	0.26741	N	0.970397	B	0.29988	0.264	B	0.23150	0.044	T	0.15578	-1.0432	10	0.34782	T	0.22	-3.017	8.4234	0.32714	0.0:0.7659:0.0:0.2341	.	335	Q9BR11	ZSWM1_HUMAN	I	335	ENSP00000361601:T335I;ENSP00000361598:T335I	ENSP00000361598:T335I	T	+	2	0	ZSWIM1	43945642	0.870000	0.30015	0.755000	0.31263	0.997000	0.91878	1.441000	0.35035	0.717000	0.32145	0.655000	0.94253	ACA	.	.		0.557	ZSWIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157064.2	NM_080603	
TSPEAR	54084	hgsc.bcm.edu	37	21	45941865	45941865	+	Missense_Mutation	SNP	G	G	C	rs201105425		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr21:45941865G>C	ENST00000323084.4	-	9	1532	c.1467C>G	c.(1465-1467)ttC>ttG	p.F489L	C21orf90_ENST00000465978.1_Intron|TSPEAR_ENST00000397916.1_Missense_Mutation_p.F421L	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	489					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						CCACCACCAGGAACGAGTAGG	0.627																																					p.F489L		Atlas-SNP	.											.	TSPEAR	110	.	0			c.C1467G						.						183.0	184.0	183.0					21																	45941865		2203	4300	6503	SO:0001583	missense	54084	exon9			CACCAGGAACGAG	AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1467C>G	chr21.hg19:g.45941865G>C	ENSP00000321987:p.Phe489Leu	119.0	0.0		123.0	43.0	NM_144991		Missense_Mutation	SNP	ENST00000323084.4	hg19	CCDS13712.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062996	0.76187	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000397916;ENST00000341581	T;T	0.31769	1.48;1.57	5.18	2.98	0.34508	.	0.109447	0.64402	D	0.000003	T	0.52581	0.1743	M	0.82823	2.61	0.80722	D	1	D	0.65815	0.995	D	0.63283	0.913	T	0.59648	-0.7415	10	0.72032	D	0.01	-11.0242	10.935	0.47241	0.1982:0.0:0.8018:0.0	.	489	Q8WU66	TSEAR_HUMAN	L	489;342;421;490	ENSP00000321987:F489L;ENSP00000381012:F421L	ENSP00000321987:F489L	F	-	3	2	TSPEAR	44766293	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.433000	0.34947	1.327000	0.45338	0.563000	0.77884	TTC	.	G|0.999;A|0.001		0.627	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098761.1	NM_144991	
LIMK2	3985	hgsc.bcm.edu	37	22	31669449	31669449	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr22:31669449G>C	ENST00000331728.4	+	14	1684	c.1570G>C	c.(1570-1572)Gat>Cat	p.D524H	LIMK2_ENST00000444929.2_Missense_Mutation_p.D278H|LIMK2_ENST00000467301.1_3'UTR|LIMK2_ENST00000340552.4_Missense_Mutation_p.D503H|LIMK2_ENST00000333611.4_Missense_Mutation_p.D503H|LIMK2_ENST00000406516.1_Missense_Mutation_p.D446H	NM_005569.3	NP_005560.1	P53671	LIMK2_HUMAN	LIM domain kinase 2	524	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				phosphorylation (GO:0016310)|spermatogenesis (GO:0007283)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			endometrium(7)|kidney(3)|large_intestine(6)|lung(6)|ovary(2)|prostate(4)|skin(1)	29						AAAGAGCTATGATGAGACGGT	0.532											OREG0026477	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D524H		Atlas-SNP	.											.	LIMK2	101	.	0			c.G1570C						.						276.0	190.0	220.0					22																	31669449		2203	4300	6503	SO:0001583	missense	3985	exon14			AGCTATGATGAGA	D45906	CCDS13891.1, CCDS13892.1, CCDS33637.1	22q12	2005-01-21			ENSG00000182541	ENSG00000182541			6614	protein-coding gene	gene with protein product		601988				8537403, 10591208	Standard	NM_005569		Approved		uc003akh.3	P53671	OTTHUMG00000151251	ENST00000331728.4:c.1570G>C	chr22.hg19:g.31669449G>C	ENSP00000332687:p.Asp524His	62.0	0.0	826	54.0	14.0	NM_005569	A8K6H5|Q7KZ80|Q7L3H5|Q96E10|Q99464|Q9UFU0	Missense_Mutation	SNP	ENST00000331728.4	hg19	CCDS13891.1	.	.	.	.	.	.	.	.	.	.	.	22.7	4.323944	0.81580	.	.	ENSG00000182541	ENST00000406516;ENST00000444929;ENST00000331728;ENST00000436394;ENST00000333611;ENST00000340552	D;D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.64;-2.64	5.53	4.52	0.55395	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95188	0.8440	M	0.83384	2.64	0.58432	D	0.999995	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.997;0.996;0.998;0.998;0.989	D	0.95580	0.8645	10	0.87932	D	0	-20.9085	13.5652	0.61813	0.0749:0.0:0.9251:0.0	.	556;503;278;524;446	F5GY29;Q7L3H5;E7EUC1;P53671;B5MC51	.;.;.;LIMK2_HUMAN;.	H	446;278;524;556;503;503	ENSP00000384602:D446H;ENSP00000409522:D278H;ENSP00000332687:D524H;ENSP00000330470:D503H;ENSP00000339916:D503H	ENSP00000332687:D524H	D	+	1	0	LIMK2	29999449	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	9.476000	0.97823	1.329000	0.45376	0.563000	0.77884	GAT	.	.		0.532	LIMK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321911.1	NM_016733	
SREBF2	6721	hgsc.bcm.edu	37	22	42273946	42273946	+	Splice_Site	SNP	G	G	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr22:42273946G>T	ENST00000361204.4	+	9	1746	c.1580G>T	c.(1579-1581)gGt>gTt	p.G527V		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	527					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						TCCTTCTTAGGTTCTGGGGGC	0.532																																					p.G527V		Atlas-SNP	.											.	SREBF2	99	.	0			c.G1580T						.						156.0	149.0	152.0					22																	42273946		2203	4300	6503	SO:0001630	splice_region_variant	6721	exon9			TCTTAGGTTCTGG	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1580-1G>T	chr22.hg19:g.42273946G>T		45.0	0.0		34.0	14.0	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	hg19	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.194588	0.38806	.	.	ENSG00000198911	ENST00000361204;ENST00000444813;ENST00000457567	T	0.55052	0.54	4.96	3.94	0.45596	.	0.478366	0.25786	N	0.028315	T	0.33000	0.0848	L	0.29908	0.895	0.80722	D	1	P	0.40144	0.704	B	0.32289	0.143	T	0.08932	-1.0698	9	.	.	.	.	8.6039	0.33762	0.1892:0.0:0.8108:0.0	.	527	Q12772	SRBP2_HUMAN	V	527	ENSP00000354476:G527V	.	G	+	2	0	SREBF2	40603892	1.000000	0.71417	0.985000	0.45067	0.872000	0.50106	4.109000	0.57824	1.318000	0.45170	0.549000	0.68633	GGT	.	.		0.532	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	Missense_Mutation
TLR8	51311	hgsc.bcm.edu	37	X	12937389	12937389	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:12937389A>G	ENST00000218032.6	+	2	317	c.230A>G	c.(229-231)cAc>cGc	p.H77R	TLR8_ENST00000311912.5_Missense_Mutation_p.H95R	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	77					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TTCATCACACACATAACGAAT	0.418																																					p.H77R		Atlas-SNP	.											.	TLR8	134	.	0			c.A230G						.						110.0	103.0	105.0					X																	12937389		2203	4300	6503	SO:0001583	missense	51311	exon2			TCACACACATAAC	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.230A>G	chrX.hg19:g.12937389A>G	ENSP00000218032:p.His77Arg	394.0	0.0		306.0	99.0	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	ENST00000218032.6	hg19	CCDS14152.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.694149	0.00098	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.56275	0.47;0.47	4.52	-2.75	0.05914	.	1.094670	0.07150	N	0.848986	T	0.29914	0.0748	N	0.16708	0.43	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.31194	-0.9952	10	0.06494	T	0.89	.	9.4329	0.38622	0.5549:0.0:0.4451:0.0	.	77;95	Q9NR97;D1CS70	TLR8_HUMAN;.	R	77;95	ENSP00000218032:H77R;ENSP00000312082:H95R	ENSP00000218032:H77R	H	+	2	0	TLR8	12847310	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.233000	0.17911	-0.878000	0.04007	-0.434000	0.05882	CAC	.	.		0.418	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
GEMIN8	54960	hgsc.bcm.edu	37	X	14027290	14027290	+	Splice_Site	SNP	T	T	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:14027290T>A	ENST00000380523.4	-	5	791		c.e5-2		GEMIN8_ENST00000398355.3_Splice_Site	NM_017856.2	NP_060326.1	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8						spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	9						GCTGCCGCCCTGAGAACAAAC	0.587																																					.		Atlas-SNP	.											.	GEMIN8	19	.	0			c.473-2A>T						.						50.0	44.0	46.0					X																	14027290		2203	4300	6503	SO:0001630	splice_region_variant	54960	exon5			CCGCCCTGAGAAC	BC020785	CCDS14159.1	Xp22	2010-03-16	2006-11-24	2006-11-24	ENSG00000046647	ENSG00000046647			26044	protein-coding gene	gene with protein product			"""family with sequence similarity 51, member A1"""	FAM51A1		16434402	Standard	NM_017856		Approved	FLJ20514	uc004cwd.3	Q9NWZ8	OTTHUMG00000021160	ENST00000380523.4:c.473-2A>T	chrX.hg19:g.14027290T>A		103.0	0.0		81.0	25.0	NM_001042480	C4AMC4|Q2LJ66|Q6ZV27	Splice_Site	SNP	ENST00000380523.4	hg19	CCDS14159.1	.	.	.	.	.	.	.	.	.	.	T	18.83	3.707967	0.68615	.	.	ENSG00000046647	ENST00000380523;ENST00000398355;ENST00000332885	.	.	.	5.39	5.39	0.77823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6477	0.62292	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	GEMIN8	13937211	1.000000	0.71417	0.984000	0.44739	0.669000	0.39330	7.503000	0.81632	1.818000	0.53035	0.486000	0.48141	.	.	.		0.587	GEMIN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055815.1	NM_017856	Intron
PDK3	5165	hgsc.bcm.edu	37	X	24513001	24513001	+	Splice_Site	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:24513001G>C	ENST00000379162.4	+	2	483		c.e2+1		PDK3_ENST00000441463.2_Splice_Site|PDK3_ENST00000493226.1_Splice_Site	NM_005391.4	NP_005382.1	Q15120	PDK3_HUMAN	pyruvate dehydrogenase kinase, isozyme 3						cell death (GO:0008219)|cellular metabolic process (GO:0044237)|cellular response to fatty acid (GO:0071398)|cellular response to glucose stimulus (GO:0071333)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|peptidyl-serine phosphorylation (GO:0018105)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|regulation of reactive oxygen species metabolic process (GO:2000377)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			NS(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23						TTCAGAGTTGGTAAGTAAACA	0.448																																					.		Atlas-SNP	.											.	PDK3	86	.	0			c.248+1G>C						.						64.0	54.0	57.0					X																	24513001		2203	4300	6503	SO:0001630	splice_region_variant	5165	exon2			GAGTTGGTAAGTA	L42452	CCDS14212.1, CCDS48088.1	Xp22.12	2008-02-05	2005-11-16		ENSG00000067992	ENSG00000067992			8811	protein-coding gene	gene with protein product		300906	"""pyruvate dehydrogenase kinase, isoenzyme 3"""			7499431	Standard	NM_001142386		Approved		uc004dbh.3	Q15120	OTTHUMG00000021269	ENST00000379162.4:c.248+1G>C	chrX.hg19:g.24513001G>C		110.0	0.0		76.0	24.0	NM_001142386	B4DXG6	Splice_Site	SNP	ENST00000379162.4	hg19	CCDS14212.1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.545625	0.86022	.	.	ENSG00000067992	ENST00000379162;ENST00000441463	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1444	0.93459	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PDK3	24422922	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.779000	0.99018	2.557000	0.86248	0.594000	0.82650	.	.	.		0.448	PDK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056097.1	NM_005391	Intron
TFE3	7030	hgsc.bcm.edu	37	X	48895554	48895554	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:48895554C>T	ENST00000315869.7	-	5	1125	c.866G>A	c.(865-867)gGa>gAa	p.G289E	TFE3_ENST00000487451.1_5'UTR	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	289					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						GAGCTGCAGTCCTGTGGTGCC	0.502			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																p.G289E		Atlas-SNP	.		Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	.	TFE3	93	.	0			c.G866A						.						65.0	42.0	50.0					X																	48895554		2202	4299	6501	SO:0001583	missense	7030	exon5			TGCAGTCCTGTGG	X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.866G>A	chrX.hg19:g.48895554C>T	ENSP00000314129:p.Gly289Glu	144.0	0.0		130.0	46.0	NM_006521	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Missense_Mutation	SNP	ENST00000315869.7	hg19	CCDS14315.3	.	.	.	.	.	.	.	.	.	.	c	19.81	3.895958	0.72639	.	.	ENSG00000068323	ENST00000315869	T	0.12984	2.63	5.89	5.89	0.94794	.	0.050565	0.85682	D	0.000000	T	0.27134	0.0665	L	0.39245	1.2	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	T	0.02546	-1.1143	10	0.12103	T	0.63	-18.792	17.8426	0.88719	0.0:1.0:0.0:0.0	.	289	P19532	TFE3_HUMAN	E	289	ENSP00000314129:G289E	ENSP00000314129:G289E	G	-	2	0	TFE3	48782498	0.000000	0.05858	0.541000	0.28102	0.931000	0.56810	-0.081000	0.11321	2.488000	0.83962	0.509000	0.49947	GGA	.	.		0.502	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058872.2	NM_006521	
MAGED1	9500	hgsc.bcm.edu	37	X	51639742	51639742	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:51639742G>A	ENST00000375722.1	+	4	1243	c.991G>A	c.(991-993)Gcc>Acc	p.A331T	MAGED1_ENST00000326587.7_Missense_Mutation_p.A331T|MAGED1_ENST00000375772.3_Missense_Mutation_p.A331T|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Missense_Mutation_p.A387T			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	331	22 X 6 AA tandem repeats of W-[PQ]-X-P-X- X.|Pro-rich.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					GACCCCACCAGCCTGGCAGAA	0.612										Multiple Myeloma(10;0.10)																											p.A387T		Atlas-SNP	.											.	MAGED1	84	.	0			c.G1159A						.						61.0	58.0	59.0					X																	51639742		2203	4300	6503	SO:0001583	missense	9500	exon5			CCACCAGCCTGGC	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.991G>A	chrX.hg19:g.51639742G>A	ENSP00000364874:p.Ala331Thr	158.0	0.0		113.0	48.0	NM_001005333	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	hg19	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881762	0.33255	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	3.67	0.96	0.19631	.	0.240725	0.21627	N	0.071556	T	0.24353	0.0590	L	0.38175	1.15	0.27670	N	0.946784	P;P	0.37731	0.607;0.473	B;B	0.30782	0.12;0.056	T	0.10706	-1.0618	10	0.15066	T	0.55	.	2.1382	0.03768	0.4275:0.0:0.3268:0.2457	.	387;331	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	T	331;331;331;387	ENSP00000364927:A331T;ENSP00000364874:A331T;ENSP00000325333:A331T;ENSP00000364847:A387T	ENSP00000325333:A331T	A	+	1	0	MAGED1	51656482	0.904000	0.30761	1.000000	0.80357	0.969000	0.65631	0.164000	0.16542	0.110000	0.17919	0.284000	0.19432	GCC	.	.		0.612	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
CPXCR1	53336	hgsc.bcm.edu	37	X	88008954	88008954	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:88008954G>A	ENST00000276127.4	+	3	798	c.539G>A	c.(538-540)tGt>tAt	p.C180Y	CPXCR1_ENST00000373111.1_Missense_Mutation_p.C180Y	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	180							metal ion binding (GO:0046872)			NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						TATATAGCATGTCTTTACCAT	0.433																																					p.C180Y		Atlas-SNP	.											.	CPXCR1	83	.	0			c.G539A						.						69.0	54.0	59.0					X																	88008954		2203	4300	6503	SO:0001583	missense	53336	exon3			TAGCATGTCTTTA	AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.539G>A	chrX.hg19:g.88008954G>A	ENSP00000276127:p.Cys180Tyr	183.0	0.0		142.0	54.0	NM_001184771	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	ENST00000276127.4	hg19	CCDS14458.1	.	.	.	.	.	.	.	.	.	.	G	5.338	0.247607	0.10130	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.41758	0.99;0.99	3.06	1.9	0.25705	.	0.732237	0.11244	N	0.584366	T	0.23492	0.0568	N	0.19112	0.55	0.09310	N	1	B	0.26876	0.162	B	0.22880	0.042	T	0.20140	-1.0284	9	.	.	.	-2.2053	5.6224	0.17465	0.0:0.0:0.304:0.696	.	180	Q8N123	CPXCR_HUMAN	Y	180	ENSP00000276127:C180Y;ENSP00000362203:C180Y	.	C	+	2	0	CPXCR1	87895610	0.002000	0.14202	0.000000	0.03702	0.034000	0.12701	0.670000	0.25157	0.437000	0.26423	-0.325000	0.08501	TGT	.	.		0.433	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057418.1	NM_033048	
BTK	695	hgsc.bcm.edu	37	X	100608970	100608970	+	Silent	SNP	G	G	C			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:100608970G>C	ENST00000308731.7	-	17	1801	c.1638C>G	c.(1636-1638)gtC>gtG	p.V546V	BTK_ENST00000372880.1_Silent_p.V370V	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	546	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CATCATCCAGGACATACCTGC	0.468									Agammaglobulinemia, X-linked																												p.V546V		Atlas-SNP	.											.	BTK	87	.	0			c.C1638G						.						128.0	121.0	123.0					X																	100608970		2203	4300	6503	SO:0001819	synonymous_variant	695	exon17	Familial Cancer Database	Bruton Type Agammaglobulinemia	ATCCAGGACATAC	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.1638C>G	chrX.hg19:g.100608970G>C		58.0	0.0		57.0	16.0	NM_000061	B2RAW1|Q32ML5	Silent	SNP	ENST00000308731.7	hg19	CCDS14482.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.256|7.256	0.604286|0.604286	0.14002|0.14002	.|.	.|.	ENSG00000010671|ENSG00000010671	ENST00000443591|ENST00000372869	.|.	.|.	.|.	5.46|5.46	1.21|1.21	0.21127|0.21127	.|.	.|.	.|.	.|.	.|.	T|T	0.69043|0.69043	0.3067|0.3067	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.67444|0.67444	-0.5669|-0.5669	5|5	0.87932|0.87932	D|D	0|0	.|.	10.0043|10.0043	0.41949|0.41949	0.3506:0.0:0.6494:0.0|0.3506:0.0:0.6494:0.0	.|.	.|.	.|.	.|.	A|C	196|66	.|.	ENSP00000416302:P196A|ENSP00000361960:S66C	P|S	-|-	1|2	0|0	BTK|BTK	100495626|100495626	0.537000|0.537000	0.26386|0.26386	0.993000|0.993000	0.49108|0.49108	0.858000|0.858000	0.48976|0.48976	-0.178000|-0.178000	0.09782|0.09782	-0.206000|-0.206000	0.10203|0.10203	0.600000|0.600000	0.82982|0.82982	CCT|TCC	.	.		0.468	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057532.2	NM_000061	
HTR2C	3358	hgsc.bcm.edu	37	X	114141284	114141284	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:114141284C>G	ENST00000276198.1	+	6	1411	c.683C>G	c.(682-684)aCg>aGg	p.T228R	HTR2C_ENST00000371951.1_Missense_Mutation_p.T228R|HTR2C_ENST00000371950.3_Missense_Mutation_p.D196E	NM_000868.2	NP_000859.1	P28335	5HT2C_HUMAN	5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled	228					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|cGMP biosynthetic process (GO:0006182)|feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|regulation of appetite (GO:0032098)|regulation of corticotropin-releasing hormone secretion (GO:0043397)|regulation of neurological system process (GO:0031644)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|Gq/11-coupled serotonin receptor activity (GO:0001587)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(15)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50					Agomelatine(DB06594)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Doxepin(DB01142)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Lorcaserin(DB04871)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	ATACCGCTGACGATTATGGTG	0.502																																					p.T228R		Atlas-SNP	.											.	HTR2C	117	.	0			c.C683G						.						373.0	316.0	336.0					X																	114141284		2203	4300	6503	SO:0001583	missense	3358	exon6			CGCTGACGATTAT		CCDS14564.1, CCDS59174.1	Xq23	2013-12-19	2012-02-03		ENSG00000147246	ENSG00000147246		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5295	protein-coding gene	gene with protein product		312861	"""5-hydroxytryptamine (serotonin) receptor 2C"""	HTR1C		7895773	Standard	NM_000868		Approved	5-HT2C, 5HTR2C	uc004epu.1	P28335	OTTHUMG00000022226	ENST00000276198.1:c.683C>G	chrX.hg19:g.114141284C>G	ENSP00000276198:p.Thr228Arg	164.0	0.0		113.0	42.0	NM_000868	B1AMW4|Q5VUF8|Q9NP28	Missense_Mutation	SNP	ENST00000276198.1	hg19	CCDS14564.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.67|14.67	2.604386|2.604386	0.46423|0.46423	.|.	.|.	ENSG00000147246|ENSG00000147246	ENST00000371950|ENST00000276198;ENST00000371951	T|T;T	0.52295|0.38077	0.67|1.16;1.16	4.87|4.87	3.74|3.74	0.42951|0.42951	.|GPCR, rhodopsin-like superfamily (1);	.|0.226336	.|0.38164	.|N	.|0.001794	T|T	0.57286|0.57286	0.2043|0.2043	M|M	0.89353|0.89353	3.025|3.025	0.19300|0.19300	N|N	0.99998|0.99998	P|D	0.43094|0.71674	0.799|0.998	B|D	0.42798|0.70227	0.398|0.968	T|T	0.52381|0.52381	-0.8583|-0.8583	9|10	0.66056|0.46703	D|T	0.02|0.11	.|.	4.3412|4.3412	0.11110|0.11110	0.0:0.6903:0.0:0.3097|0.0:0.6903:0.0:0.3097	.|.	196|228	B1AMW4|P28335	.|5HT2C_HUMAN	E|R	196|228	ENSP00000361018:D196E|ENSP00000276198:T228R;ENSP00000361019:T228R	ENSP00000361018:D196E|ENSP00000276198:T228R	D|T	+|+	3|2	2|0	HTR2C|HTR2C	114047540|114047540	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.926000|0.926000	0.56050|0.56050	3.862000|3.862000	0.56009|0.56009	2.135000|2.135000	0.66039|0.66039	0.538000|0.538000	0.68166|0.68166	GAC|ACG	.	.		0.502	HTR2C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057962.1	NM_000868	
UPF3B	65109	hgsc.bcm.edu	37	X	118971720	118971720	+	Splice_Site	SNP	C	C	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:118971720C>G	ENST00000276201.2	-	10	1371	c.1302G>C	c.(1300-1302)aaG>aaC	p.K434N	UPF3B_ENST00000345865.2_Splice_Site_p.K421N|UPF3B_ENST00000478840.1_5'Flank	NM_080632.2	NP_542199.1	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B (yeast)	434	Necessary for interaction with RBM8A and for activating NMD.|Sufficient for association with EJC core.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|prostate(1)	30						CAAGCAGCACCTTGTTTCTTA	0.358																																					p.K434N		Atlas-SNP	.											.	UPF3B	74	.	0			c.G1302C						.						168.0	154.0	159.0					X																	118971720		2203	4300	6503	SO:0001630	splice_region_variant	65109	exon10			CAGCACCTTGTTT	AF318576	CCDS14587.1, CCDS14588.1	Xq25-q26	2014-01-31			ENSG00000125351	ENSG00000125351			20439	protein-coding gene	gene with protein product		300298	"""mental retardation, X-linked 62"""	MRX62		11113196, 11163187, 19238151	Standard	NM_023010		Approved	RENT3B, UPF3X, HUPF3B	uc004erz.2	Q9BZI7	OTTHUMG00000022282	ENST00000276201.2:c.1302+1G>C	chrX.hg19:g.118971720C>G		56.0	0.0		55.0	19.0	NM_080632	D3DWI3|D3DWI4|Q0VAK8|Q9H1J0	Missense_Mutation	SNP	ENST00000276201.2	hg19	CCDS14588.1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.583624	0.65992	.	.	ENSG00000125351	ENST00000276201;ENST00000345865	D;D	0.94046	-3.34;-3.21	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	D	0.96846	0.8970	M	0.82823	2.61	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.83275	0.996;0.991	D	0.96956	0.9698	9	.	.	.	.	17.42	0.87512	0.0:1.0:0.0:0.0	.	421;434	Q9BZI7-2;Q9BZI7	.;REN3B_HUMAN	N	434;421	ENSP00000276201:K434N;ENSP00000245418:K421N	.	K	-	3	2	UPF3B	118855748	1.000000	0.71417	1.000000	0.80357	0.501000	0.33797	6.942000	0.75928	2.328000	0.79073	0.526000	0.51066	AAG	.	.		0.358	UPF3B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058068.1		Missense_Mutation
SLC10A3	8273	hgsc.bcm.edu	37	X	153715955	153715955	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chrX:153715955G>T	ENST00000393587.4	-	3	1588	c.1325C>A	c.(1324-1326)gCt>gAt	p.A442D	SLC10A3_ENST00000393586.1_Missense_Mutation_p.A497D|UBL4A_ENST00000369653.4_5'Flank|UBL4A_ENST00000477777.1_5'Flank|SLC10A3_ENST00000369649.4_Missense_Mutation_p.A413D|UBL4A_ENST00000369660.4_5'Flank|SLC10A3_ENST00000263512.4_Missense_Mutation_p.A442D	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	442					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGCATAGTCAGCTTGAAGGCG	0.632																																					p.A442D		Atlas-SNP	.											.	SLC10A3	42	.	0			c.C1325A						.						46.0	43.0	44.0					X																	153715955		2203	4300	6503	SO:0001583	missense	8273	exon3			TAGTCAGCTTGAA	X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.1325C>A	chrX.hg19:g.153715955G>T	ENSP00000377212:p.Ala442Asp	130.0	0.0		124.0	37.0	NM_001142392	Q5HY79|Q9BSL2	Missense_Mutation	SNP	ENST00000393587.4	hg19	CCDS14755.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.028336	0.75390	.	.	ENSG00000126903	ENST00000369649;ENST00000393586;ENST00000263512;ENST00000393587	T;T;T;T	0.11495	2.94;2.77;2.79;2.79	5.1	4.23	0.50019	.	0.000000	0.64402	U	0.000001	T	0.26846	0.0657	L	0.53561	1.675	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.00783	-1.1568	10	0.87932	D	0	-20.2371	11.6956	0.51542	0.0906:0.0:0.9094:0.0	.	413;442	Q9BSL2;P09131	.;P3_HUMAN	D	413;497;442;442	ENSP00000358663:A413D;ENSP00000377211:A497D;ENSP00000263512:A442D;ENSP00000377212:A442D	ENSP00000263512:A442D	A	-	2	0	SLC10A3	153369149	1.000000	0.71417	0.599000	0.28851	0.972000	0.66771	8.439000	0.90308	1.036000	0.39998	0.513000	0.50165	GCT	.	.		0.632	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037235.3	NM_019848	
PLXNA2	5362	hgsc.bcm.edu	37	1	208219318	208219318	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr1:208219318delC	ENST00000367033.3	-	18	4157	c.3400delG	c.(3400-3402)gacfs	p.D1134fs		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	1134	IPT/TIG 3.				axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		AACTTGGTGTCGTTGTAAATT	0.493																																					p.D1134fs		Atlas-Indel,Pindel	.											.	PLXNA2	178	.	0			c.3401delA						.						181.0	173.0	175.0					1																	208219318		2203	4300	6503	SO:0001589	frameshift_variant	5362	exon18			.	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.3400delG	chr1.hg19:g.208219318delC	ENSP00000356000:p.Asp1134fs	196.0	0.0		168.0	132.0	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Frame_Shift_Del	DEL	ENST00000367033.3	hg19	CCDS31013.1																																																																																			.	.		0.493	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
POTEH	23784	hgsc.bcm.edu	37	22	16279260	16279260	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr22:16279260delT	ENST00000343518.6	-	4	1014	c.963delA	c.(961-963)aaafs	p.K321fs	POTEH-AS1_ENST00000422014.1_RNA|RNU6-816P_ENST00000390914.1_RNA	NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	321								p.K321K(1)		NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CCACTTGCTGTTTTTGCTCAT	0.323																																					p.Q322fs		Atlas-INDEL	.											.	POTEH	114	.	1	Substitution - coding silent(1)	urinary_tract(1)	c.964delC						.																																			SO:0001589	frameshift_variant	23784	exon4			.	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.963delA	chr22.hg19:g.16279260delT	ENSP00000340610:p.Lys321fs	384.0	0.0		387.0	41.0	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Frame_Shift_Del	DEL	ENST00000343518.6	hg19	CCDS46658.1																																																																																			.	.		0.323	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
CBX4	8535	hgsc.bcm.edu	37	17	77808750	77808751	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr17:77808750_77808751insG	ENST00000269397.4	-	5	867_868	c.690_691insC	c.(688-693)cccaacfs	p.N231fs		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	231	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			ATCATTCCGTTGGGGGGGCCCT	0.639											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N231fs		Atlas-Indel,Pindel	.											.,1	CBX4	40	.	0			c.691_692insC						.																																			SO:0001589	frameshift_variant	8535	exon5			.	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.691dupC	chr17.hg19:g.77808757_77808757dupG	ENSP00000269397:p.Asn231fs	120.0	0.0	1178	123.0	14.0	NM_003655	B1PJR7|Q6TPI8|Q96C04	Frame_Shift_Ins	INS	ENST00000269397.4	hg19	CCDS32758.1																																																																																			.	.		0.639	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
GCN1L1	10985	hgsc.bcm.edu	37	12	120580319	120580320	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr12:120580319_120580320insA	ENST00000300648.6	-	44	5832_5833	c.5820_5821insT	c.(5818-5823)gataagfs	p.K1941fs		NM_006836.1	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis 1-like 1 (yeast)	1941					regulation of translation (GO:0006417)|translation (GO:0006412)	cytoplasm (GO:0005737)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)			NS(2)|breast(2)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(13)|liver(1)|lung(36)|ovary(4)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	94	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACCGTTCTCTTATCTGCACACG	0.569																																					p.K1941_R1942delinsX		Atlas-Indel,Pindel	.											.	GCN1L1	207	.	0			c.5821_5822insT						.																																			SO:0001589	frameshift_variant	10985	exon44			.	U77700	CCDS41847.1	12q24.2	2008-07-03	2001-11-28						4199	protein-coding gene	gene with protein product		605614	"""GCN1 (general control of amino-acid synthesis 1, yeast)-like 1"""			9234705	Standard	NM_006836		Approved	KIAA0219, GCN1, GCN1L	uc001txo.3	Q92616	OTTHUMG00000169338	ENST00000300648.6:c.5821dupT	chr12.hg19:g.120580320_120580320dupA	ENSP00000300648:p.Lys1941fs	87.0	0.0		90.0	36.0	NM_006836	A8KAY1|O95001|O95651|Q6P2S3|Q86X65|Q8N5I5|Q8WU80|Q99736|Q9UE60	Frame_Shift_Ins	INS	ENST00000300648.6	hg19	CCDS41847.1																																																																																			.	.		0.569	GCN1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403592.1		
ACSM3	6296	hgsc.bcm.edu	37	16	20802201	20802219	+	Intron	DEL	GTCCCCTGAGGCCAGATCA	GTCCCCTGAGGCCAGATCA	-	rs145561309|rs372613008|rs368001171		TCGA-G3-A7M6-01A-11D-A33Q-10	TCGA-G3-A7M6-10A-01D-A33Q-10	GTCCCCTGAGGCCAGATCA	GTCCCCTGAGGCCAGATCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b169ab6b-42d8-4868-bfc2-8f08e8d8a0f6	23b38a16-e459-4735-8033-cc843860bb38	g.chr16:20802201_20802219delGTCCCCTGAGGCCAGATCA	ENST00000289416.5	+	10	1801				ACSM3_ENST00000450120.2_Intron|ACSM3_ENST00000567387.1_Intron|ERI2_ENST00000300005.3_Frame_Shift_Del_p.SDLASGD256fs	NM_005622.3	NP_005613.2	Q53FZ2	ACSM3_HUMAN	acyl-CoA synthetase medium-chain family member 3						cholesterol homeostasis (GO:0042632)|fatty acid biosynthetic process (GO:0006633)|regulation of blood pressure (GO:0008217)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty acid ligase activity (GO:0015645)|metal ion binding (GO:0046872)	p.G261G(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)	21						AAGCATGCTGGTCCCCTGAGGCCAGATCACTGTTCCAGG	0.443																																					p.257_263del		Atlas-Indel,Pindel	.											.	ERI2	50	.	1	Substitution - coding silent(1)	kidney(1)	c.769_787del						.																																			SO:0001627	intron_variant	112479	exon9			.	D16350	CCDS10589.1, CCDS45435.1	16p13.11	2006-02-08	2005-09-08	2005-09-08	ENSG00000005187	ENSG00000005187		"""Acyl-CoA synthetase family"""	10522	protein-coding gene	gene with protein product		145505	"""SA (rat hypertension-associated) homolog"", ""SA hypertension-associated homolog (rat)"""	SAH		7843754, 7907320, 11470804	Standard	NM_005622		Approved	SA	uc002dhr.3	Q53FZ2	OTTHUMG00000131552	ENST00000289416.5:c.1326+191GTCCCCTGAGGCCAGATCA>-	chr16.hg19:g.20802201_20802219delGTCCCCTGAGGCCAGATCA		376.0	0.0		263.0	48.0	NM_080663	O60363|Q13732|Q15425|Q7KYM6|Q9BUA2	Frame_Shift_Del	DEL	ENST00000289416.5	hg19	CCDS10589.1																																																																																			.	.		0.443	ACSM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254414.2	NM_005622	
