#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
KIF21B	23046	hgsc.bcm.edu	37	1	200945972	200945972	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:200945972G>A	ENST00000422435.2	-	32	4691	c.4375C>T	c.(4375-4377)Ctg>Ttg	p.L1459L	KIF21B_ENST00000332129.2_Silent_p.L1446L|KIF21B_ENST00000461742.2_Silent_p.L1459L|KIF21B_ENST00000360529.5_Silent_p.L1446L	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1459					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						GTGACCGTCAGGCACATCACA	0.627																																					p.L1459L		Atlas-SNP	.											.	KIF21B	208	.	0			c.C4375T						.						45.0	40.0	42.0					1																	200945972		2203	4300	6503	SO:0001819	synonymous_variant	23046	exon32			CCGTCAGGCACAT	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4375C>T	chr1.hg19:g.200945972G>A		52.0	0.0		33.0	13.0	NM_001252102	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	hg19	CCDS58056.1																																																																																			.	.		0.627	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
ITPKB	3707	hgsc.bcm.edu	37	1	226923399	226923399	+	Silent	SNP	T	T	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr1:226923399T>G	ENST00000272117.3	-	1	1760	c.1761A>C	c.(1759-1761)ggA>ggC	p.G587G	ITPKB_ENST00000366784.1_Silent_p.G587G|ITPKB_ENST00000429204.1_Silent_p.G587G			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	587					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCCGAGGGCTTCCCTGCGTCT	0.602																																					p.G587G	Colon(84;110 1851 5306 33547)	Atlas-SNP	.											.	ITPKB	158	.	0			c.A1761C						.						54.0	49.0	51.0					1																	226923399		2203	4300	6503	SO:0001819	synonymous_variant	3707	exon2			AGGGCTTCCCTGC	AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.1761A>C	chr1.hg19:g.226923399T>G		40.0	0.0		40.0	15.0	NM_002221	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	ENST00000272117.3	hg19	CCDS1555.1																																																																																			.	.		0.602	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091632.1	NM_002221	
GREB1	9687	hgsc.bcm.edu	37	2	11716535	11716535	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:11716535T>C	ENST00000381486.2	+	5	811	c.511T>C	c.(511-513)Ttc>Ctc	p.F171L	GREB1_ENST00000381483.2_Missense_Mutation_p.F171L|GREB1_ENST00000389825.3_Missense_Mutation_p.F61L|GREB1_ENST00000234142.5_Missense_Mutation_p.F171L|GREB1_ENST00000263834.5_Missense_Mutation_p.F171L	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	171						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CTTCACGGAATTCTCCAATCA	0.393																																					p.F171L	Ovarian(39;850 945 2785 23371 33093)	Atlas-SNP	.											.	GREB1	308	.	0			c.T511C						.						135.0	140.0	138.0					2																	11716535		2203	4300	6503	SO:0001583	missense	9687	exon5			ACGGAATTCTCCA		CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.511T>C	chr2.hg19:g.11716535T>C	ENSP00000370896:p.Phe171Leu	147.0	0.0		165.0	37.0	NM_148903	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	ENST00000381486.2	hg19	CCDS42655.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.929320	0.92389	.	.	ENSG00000196208	ENST00000381486;ENST00000263834;ENST00000389825;ENST00000381483;ENST00000234142	T;D;D;D;T	0.81821	2.77;-1.54;-1.54;-1.54;2.77	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.88621	0.6486	M	0.73962	2.25	0.80722	D	1	D;D;P;P	0.76494	0.995;0.999;0.954;0.95	D;D;P;P	0.85130	0.917;0.997;0.654;0.73	D	0.88557	0.3120	10	0.42905	T	0.14	-36.4097	14.6441	0.68748	0.0:0.0:0.0:1.0	.	171;61;171;171	Q4ZG55-2;F8W6E5;Q4ZG55-3;Q4ZG55	.;.;.;GREB1_HUMAN	L	171;171;61;171;171	ENSP00000370896:F171L;ENSP00000263834:F171L;ENSP00000374475:F61L;ENSP00000370892:F171L;ENSP00000234142:F171L	ENSP00000234142:F171L	F	+	1	0	GREB1	11633986	1.000000	0.71417	0.916000	0.36221	0.880000	0.50808	7.726000	0.84824	2.049000	0.60858	0.533000	0.62120	TTC	.	.		0.393	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000280490.1	NM_014668	
FAHD2B	151313	hgsc.bcm.edu	37	2	97751541	97751541	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:97751541G>A	ENST00000414820.1	-	6	850	c.580C>T	c.(580-582)Cgt>Tgt	p.R194C	FAHD2B_ENST00000272610.3_Missense_Mutation_p.R194C|FAHD2B_ENST00000440566.2_Missense_Mutation_p.R194C|FAHD2B_ENST00000468548.1_5'Flank			Q6P2I3	FAH2B_HUMAN	fumarylacetoacetate hydrolase domain containing 2B	194							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			kidney(5)|large_intestine(2)|lung(3)|skin(2)	12						AGCCAGTCACGAGCACTCACG	0.582																																					p.R194C		Atlas-SNP	.											.	FAHD2B	34	.	0			c.C580T						.						114.0	102.0	106.0					2																	97751541		2203	4300	6503	SO:0001583	missense	151313	exon5			AGTCACGAGCACT		CCDS2030.1	2q11.2	2012-06-29			ENSG00000144199	ENSG00000144199			25318	protein-coding gene	gene with protein product							Standard	NM_199336		Approved	DKFZp434N062	uc002sxm.3	Q6P2I3	OTTHUMG00000130533	ENST00000414820.1:c.580C>T	chr2.hg19:g.97751541G>A	ENSP00000410470:p.Arg194Cys	137.0	0.0		98.0	44.0	NM_199336	D3DXH7|Q8NDK1	Missense_Mutation	SNP	ENST00000414820.1	hg19	CCDS2030.1	.	.	.	.	.	.	.	.	.	.	g	18.38	3.610637	0.66558	.	.	ENSG00000144199	ENST00000414820;ENST00000272610;ENST00000440566	D;D;D	0.99226	-5.59;-5.59;-5.59	0.624	-1.25	0.09405	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99348	0.9771	H	0.95574	3.69	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	D	0.98323	1.0529	10	0.87932	D	0	.	4.9789	0.14155	0.0:0.0:0.6568:0.3432	.	194	Q6P2I3	FAH2B_HUMAN	C	194	ENSP00000410470:R194C;ENSP00000272610:R194C;ENSP00000444599:R194C	ENSP00000272610:R194C	R	-	1	0	FAHD2B	97115268	1.000000	0.71417	0.792000	0.32020	0.673000	0.39480	1.987000	0.40687	-0.423000	0.07394	0.306000	0.20318	CGT	.	.		0.582	FAHD2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339482.1	NM_199336	
RNF149	284996	hgsc.bcm.edu	37	2	101911551	101911551	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:101911551T>C	ENST00000295317.3	-	2	660	c.553A>G	c.(553-555)Ata>Gta	p.I185V		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	185					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						CCAACCCCTATGGTCATCGTT	0.453																																					p.I185V	Colon(25;331 612 6521 7355 31028)	Atlas-SNP	.											.	RNF149	25	.	0			c.A553G						.						153.0	140.0	144.0					2																	101911551		2203	4300	6503	SO:0001583	missense	284996	exon2			CCCCTATGGTCAT	AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.553A>G	chr2.hg19:g.101911551T>C	ENSP00000295317:p.Ile185Val	89.0	0.0		66.0	14.0	NM_173647	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	Missense_Mutation	SNP	ENST00000295317.3	hg19	CCDS2051.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.009826	0.35415	.	.	ENSG00000163162	ENST00000295317	T	0.07688	3.17	5.26	4.1	0.47936	.	0.082861	0.48767	D	0.000172	T	0.07773	0.0195	L	0.45051	1.395	0.46028	D	0.998825	P	0.43750	0.816	B	0.36766	0.232	T	0.21999	-1.0229	10	0.44086	T	0.13	.	10.9748	0.47459	0.0:0.0733:0.0:0.9267	.	185	Q8NC42	RN149_HUMAN	V	185	ENSP00000295317:I185V	ENSP00000295317:I185V	I	-	1	0	RNF149	101277983	1.000000	0.71417	0.217000	0.23759	0.157000	0.22087	5.073000	0.64395	0.841000	0.35020	0.482000	0.46254	ATA	.	.		0.453	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253180.2	NM_173647	
STEAP3	55240	hgsc.bcm.edu	37	2	120005515	120005515	+	Silent	SNP	C	C	A	rs372658109		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:120005515C>A	ENST00000354888.5	+	4	1257	c.753C>A	c.(751-753)ccC>ccA	p.P251P	STEAP3_ENST00000425223.2_Silent_p.P251P|STEAP3_ENST00000393110.2_Silent_p.P261P|STEAP3_ENST00000409811.1_Silent_p.P251P|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000393107.2_Silent_p.P251P|STEAP3_ENST00000393108.2_Silent_p.P251P|STEAP3_ENST00000450943.2_Silent_p.P251P|STEAP3_ENST00000393106.2_Silent_p.P251P	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	251					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						TCAAGCTGCCCGTGTCCGTGG	0.627																																					p.P261P		Atlas-SNP	.											.	STEAP3	44	.	0			c.C783A						.						120.0	115.0	116.0					2																	120005515		2203	4300	6503	SO:0001819	synonymous_variant	55240	exon4			GCTGCCCGTGTCC	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.753C>A	chr2.hg19:g.120005515C>A		32.0	0.0		43.0	21.0	NM_182915	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	ENST00000354888.5	hg19	CCDS2125.1																																																																																			.	.		0.627	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	NM_018234	
FIGN	55137	hgsc.bcm.edu	37	2	164468244	164468244	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:164468244C>G	ENST00000333129.3	-	3	412	c.98G>C	c.(97-99)cGg>cCg	p.R33P	FIGN_ENST00000409634.1_Intron|FIGN_ENST00000482917.1_5'UTR	NM_018086.2	NP_060556.2	Q5HY92	FIGN_HUMAN	fidgetin	33					mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)	p.R33Q(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(13)|lung(23)|ovary(1)|prostate(2)|skin(1)	47						GGCAGGAGACCGAGTGGTTGA	0.517																																					p.R33P		Atlas-SNP	.											FIGN,NS,carcinoma,0,1	FIGN	106	.	1	Substitution - Missense(1)	breast(1)	c.G98C						.						100.0	101.0	100.0					2																	164468244		2082	4234	6316	SO:0001583	missense	55137	exon3			GGAGACCGAGTGG	AK001267	CCDS2221.2	2q24	2010-04-21			ENSG00000182263	ENSG00000182263		"""ATPases / AAA-type"""	13285	protein-coding gene	gene with protein product		605295				11017077	Standard	XM_005246661		Approved		uc002uck.1	Q5HY92	OTTHUMG00000074059	ENST00000333129.3:c.98G>C	chr2.hg19:g.164468244C>G	ENSP00000333836:p.Arg33Pro	77.0	1.0		64.0	21.0	NM_018086	B3KWM0|Q9H6M5|Q9NVZ9	Missense_Mutation	SNP	ENST00000333129.3	hg19	CCDS2221.2	.	.	.	.	.	.	.	.	.	.	C	17.37	3.371699	0.61624	.	.	ENSG00000182263	ENST00000333129	T	0.25414	1.8	6.17	6.17	0.99709	.	0.000000	0.85682	U	0.000000	T	0.47116	0.1428	L	0.48362	1.52	0.80722	D	1	D	0.71674	0.998	D	0.77004	0.989	T	0.03148	-1.1067	10	0.31617	T	0.26	-14.7367	20.8794	0.99867	0.0:1.0:0.0:0.0	.	33	Q5HY92	FIGN_HUMAN	P	33	ENSP00000333836:R33P	ENSP00000333836:R33P	R	-	2	0	FIGN	164176490	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	CGG	.	.		0.517	FIGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157220.2	NM_018086	
FN1	2335	hgsc.bcm.edu	37	2	216256381	216256381	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr2:216256381G>T	ENST00000359671.1	-	25	4218	c.3953C>A	c.(3952-3954)cCt>cAt	p.P1318H	FN1_ENST00000357867.4_Missense_Mutation_p.P1318H|FN1_ENST00000446046.1_Missense_Mutation_p.P1318H|FN1_ENST00000357009.2_Missense_Mutation_p.P1318H|FN1_ENST00000346544.3_Missense_Mutation_p.P1318H|FN1_ENST00000421182.1_Missense_Mutation_p.P1318H|FN1_ENST00000323926.6_Missense_Mutation_p.P1409H|FN1_ENST00000345488.5_Missense_Mutation_p.P1318H|FN1_ENST00000443816.1_Missense_Mutation_p.P1318H|FN1_ENST00000356005.4_Missense_Mutation_p.P1318H|FN1_ENST00000354785.4_Missense_Mutation_p.P1409H|FN1_ENST00000432072.2_Missense_Mutation_p.P1409H|FN1_ENST00000336916.4_Missense_Mutation_p.P1318H			P02751	FINC_HUMAN	fibronectin 1	1318	Cell-attachment.|Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	ATTGTCTGAAGGAGAAATTGA	0.403																																					p.P1409H		Atlas-SNP	.											.	FN1	521	.	0			c.C4226A						.						134.0	126.0	129.0					2																	216256381		2203	4300	6503	SO:0001583	missense	2335	exon26			TCTGAAGGAGAAA		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3953C>A	chr2.hg19:g.216256381G>T	ENSP00000352696:p.Pro1318His	44.0	0.0		66.0	21.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	G	18.76	3.691754	0.68271	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000003	T	0.75170	0.3813	M	0.80982	2.52	0.45515	D	0.99847	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.988;0.999;1.0;1.0;0.999;1.0;1.0;0.999	D;P;D;D;D;D;D;D;D	0.97110	0.999;0.899;0.985;1.0;1.0;0.967;0.999;0.999;0.972	T	0.73795	-0.3870	10	0.38643	T	0.18	.	19.6604	0.95864	0.0:0.0:1.0:0.0	.	1409;1409;1318;1318;1318;1318;1318;1318;1409	P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;P02751-9;P02751-14;P02751-15	.;.;.;.;.;.;.;.;.	H	1318;1409;1318;1318;1409;1318;1318;1318;1318;1318;1318;1409;1318;125	ENSP00000394423:P1318H;ENSP00000323534:P1409H;ENSP00000338200:P1318H;ENSP00000350534:P1318H;ENSP00000346839:P1409H;ENSP00000352696:P1318H;ENSP00000265312:P1318H;ENSP00000273049:P1318H;ENSP00000349509:P1318H;ENSP00000410422:P1318H;ENSP00000415018:P1318H;ENSP00000399538:P1409H;ENSP00000348285:P1318H;ENSP00000416139:P125H	ENSP00000323534:P1409H	P	-	2	0	FN1	215964626	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	7.627000	0.83176	2.648000	0.89879	0.655000	0.94253	CCT	.	.		0.403	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
PRSS50	29122	hgsc.bcm.edu	37	3	46755757	46755757	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:46755757C>A	ENST00000460241.1	-	9	2375	c.705G>T	c.(703-705)aaG>aaT	p.K235N	PRSS50_ENST00000315170.7_Missense_Mutation_p.K235N			Q9UI38	TSP50_HUMAN	protease, serine, 50	235	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						GGGAATGGTCCTTCAACACAT	0.597																																					p.K235N	Pancreas(41;915 1239 11561 17469)	Atlas-SNP	.											.	PRSS50	35	.	0			c.G705T						.						121.0	91.0	101.0					3																	46755757		2202	4300	6502	SO:0001583	missense	29122	exon4			ATGGTCCTTCAAC	AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.705G>T	chr3.hg19:g.46755757C>A	ENSP00000418875:p.Lys235Asn	31.0	0.0		39.0	20.0	NM_013270		Missense_Mutation	SNP	ENST00000460241.1	hg19	CCDS2745.1	.	.	.	.	.	.	.	.	.	.	C	15.95	2.983530	0.53827	.	.	ENSG00000206549	ENST00000455218;ENST00000315170;ENST00000460241	D;D	0.89196	-2.48;-2.48	3.6	1.81	0.25067	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.735756	0.11871	N	0.521475	T	0.79317	0.4425	N	0.19112	0.55	0.22199	N	0.9993	B	0.30634	0.288	B	0.34038	0.174	T	0.66909	-0.5804	10	0.33141	T	0.24	.	5.9328	0.19148	0.0:0.7625:0.0:0.2375	.	235	Q9UI38	TSP50_HUMAN	N	149;235;235	ENSP00000326598:K235N;ENSP00000418875:K235N	ENSP00000326598:K235N	K	-	3	2	PRSS50	46730761	0.007000	0.16637	0.972000	0.41901	0.019000	0.09904	0.282000	0.18829	0.533000	0.28675	-0.381000	0.06696	AAG	.	.		0.597	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354544.1		
CHDH	55349	hgsc.bcm.edu	37	3	53851908	53851908	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:53851908T>C	ENST00000315251.6	-	9	2118	c.1681A>G	c.(1681-1683)Atc>Gtc	p.I561V		NM_018397.4	NP_060867.2	Q8NE62	CHDH_HUMAN	choline dehydrogenase	561					glycine betaine biosynthetic process from choline (GO:0019285)	mitochondrial inner membrane (GO:0005743)	choline dehydrogenase activity (GO:0008812)|flavin adenine dinucleotide binding (GO:0050660)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	17		Hepatocellular(537;0.152)		BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)	Choline(DB00122)	GCGATCATGATTGTGGGGGCG	0.597																																					p.I561V		Atlas-SNP	.											.	CHDH	34	.	0			c.A1681G						.						98.0	80.0	86.0					3																	53851908		2203	4300	6503	SO:0001583	missense	55349	exon9			TCATGATTGTGGG	AJ272267	CCDS2873.1	3p21	2004-11-24			ENSG00000016391	ENSG00000016391	1.1.99.1		24288	protein-coding gene	gene with protein product							Standard	NM_018397		Approved		uc003dgz.3	Q8NE62	OTTHUMG00000158281	ENST00000315251.6:c.1681A>G	chr3.hg19:g.53851908T>C	ENSP00000319851:p.Ile561Val	88.0	0.0		56.0	25.0	NM_018397	Q9NY17	Missense_Mutation	SNP	ENST00000315251.6	hg19	CCDS2873.1	.	.	.	.	.	.	.	.	.	.	T	11.41	1.630713	0.28978	.	.	ENSG00000016391	ENST00000315251	T	0.41758	0.99	5.69	1.48	0.22813	Glucose-methanol-choline oxidoreductase, C-terminal (1);	0.120942	0.56097	N	0.000039	T	0.32734	0.0839	L	0.39898	1.24	0.47037	D	0.999293	B	0.19073	0.033	B	0.21708	0.036	T	0.11421	-1.0588	10	0.62326	D	0.03	-24.6102	9.8993	0.41338	0.0:0.2126:0.0:0.7874	.	561	Q8NE62	CHDH_HUMAN	V	561	ENSP00000319851:I561V	ENSP00000319851:I561V	I	-	1	0	CHDH	53826948	0.995000	0.38212	0.181000	0.23098	0.410000	0.31052	2.417000	0.44653	0.017000	0.15025	-0.290000	0.09829	ATC	.	.		0.597	CHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350567.2	NM_018397	
TMPRSS7	344805	hgsc.bcm.edu	37	3	111764772	111764772	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:111764772G>C	ENST00000452346.2	+	5	676	c.673G>C	c.(673-675)Gac>Cac	p.D225H	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.D112H			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	225	SEA. {ECO:0000255|PROSITE- ProRule:PRU00188}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TGTGGACATGGACTCTGTGGT	0.473																																					p.D112H		Atlas-SNP	.											.	TMPRSS7	126	.	0			c.G334C						.						241.0	214.0	222.0					3																	111764772		692	1591	2283	SO:0001583	missense	344805	exon4			GACATGGACTCTG	BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.673G>C	chr3.hg19:g.111764772G>C	ENSP00000398236:p.Asp225His	177.0	0.0		151.0	45.0	NM_001042575	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	ENST00000452346.2	hg19		.	.	.	.	.	.	.	.	.	.	G	21.4	4.150002	0.78001	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127;ENST00000460599	T;T;T	0.35973	1.28;1.28;1.28	5.06	5.06	0.68205	.	.	.	.	.	T	0.40619	0.1124	N	0.08118	0	0.50039	D	0.999841	D	0.89917	1.0	D	0.91635	0.999	T	0.48031	-0.9070	9	0.52906	T	0.07	.	15.8068	0.78520	0.0:0.0:1.0:0.0	.	112	Q7RTY8-2	.	H	225;212;212;112;88	ENSP00000398236:D225H;ENSP00000411645:D112H;ENSP00000447563:D88H	ENSP00000411645:D112H	D	+	1	0	TMPRSS7	113247462	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.709000	0.84645	2.763000	0.94921	0.655000	0.94253	GAC	.	.		0.473	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000347592.2	XM_293599	
PTX3	5806	hgsc.bcm.edu	37	3	157160183	157160183	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:157160183G>A	ENST00000295927.3	+	3	706	c.561G>A	c.(559-561)atG>atA	p.M187I	VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392832.2_Intron|VEPH1_ENST00000543418.1_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	187	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			TATTCCCAATGCGTTCCAAGA	0.348																																					p.M187I		Atlas-SNP	.											.	PTX3	27	.	0			c.G561A						.						54.0	54.0	54.0					3																	157160183		2203	4300	6503	SO:0001583	missense	5806	exon3			CCCAATGCGTTCC	X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.561G>A	chr3.hg19:g.157160183G>A	ENSP00000295927:p.Met187Ile	27.0	0.0		34.0	11.0	NM_002852	B2R6T6|Q38M82	Missense_Mutation	SNP	ENST00000295927.3	hg19	CCDS3180.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105810	0.77096	.	.	ENSG00000163661	ENST00000295927	T	0.06218	3.33	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.037066	0.85682	D	0.000000	T	0.29028	0.0721	M	0.82630	2.6	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.01520	-1.1334	10	0.31617	T	0.26	-36.0161	19.3998	0.94623	0.0:0.0:1.0:0.0	.	187	P26022	PTX3_HUMAN	I	187	ENSP00000295927:M187I	ENSP00000295927:M187I	M	+	3	0	PTX3	158642877	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.238000	0.78173	2.586000	0.87340	0.655000	0.94253	ATG	.	.		0.348	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352028.1	NM_002852	
SI	6476	hgsc.bcm.edu	37	3	164737493	164737493	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:164737493G>T	ENST00000264382.3	-	28	3382	c.3320C>A	c.(3319-3321)cCa>cAa	p.P1107Q		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1107	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATATTCTGATGGCAGGCGAGT	0.408										HNSCC(35;0.089)																											p.P1107Q		Atlas-SNP	.											.	SI	500	.	0			c.C3320A						.						102.0	99.0	100.0					3																	164737493		2203	4299	6502	SO:0001583	missense	6476	exon28			TCTGATGGCAGGC	X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.3320C>A	chr3.hg19:g.164737493G>T	ENSP00000264382:p.Pro1107Gln	84.0	0.0		73.0	23.0	NM_001041	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	ENST00000264382.3	hg19	CCDS3196.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.349569	0.82132	.	.	ENSG00000090402	ENST00000264382	D	0.86497	-2.13	4.46	4.46	0.54185	Glycoside hydrolase-type carbohydrate-binding (1);	0.075502	0.64402	D	0.000020	D	0.95127	0.8421	M	0.93898	3.47	0.54753	D	0.999982	D	0.89917	1.0	D	0.79784	0.993	D	0.96547	0.9405	10	0.87932	D	0	.	17.305	0.87192	0.0:0.0:1.0:0.0	.	1107	P14410	SUIS_HUMAN	Q	1107	ENSP00000264382:P1107Q	ENSP00000264382:P1107Q	P	-	2	0	SI	166220187	1.000000	0.71417	0.996000	0.52242	0.922000	0.55478	8.963000	0.93385	2.293000	0.77203	0.591000	0.81541	CCA	.	.		0.408	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350116.1	NM_001041	
TP63	8626	hgsc.bcm.edu	37	3	189526152	189526152	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr3:189526152C>T	ENST00000264731.3	+	4	505	c.416C>T	c.(415-417)gCg>gTg	p.A139V	TP63_ENST00000418709.2_Missense_Mutation_p.A139V|TP63_ENST00000456148.1_Missense_Mutation_p.A45V|TP63_ENST00000382063.4_Intron|TP63_ENST00000437221.1_Missense_Mutation_p.A45V|TP63_ENST00000354600.5_Missense_Mutation_p.A45V|TP63_ENST00000392463.2_Missense_Mutation_p.A45V|TP63_ENST00000392460.3_Missense_Mutation_p.A139V|TP63_ENST00000449992.1_Intron|TP63_ENST00000320472.5_Missense_Mutation_p.A139V|TP63_ENST00000392461.3_Missense_Mutation_p.A45V|TP63_ENST00000440651.2_Missense_Mutation_p.A139V	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	139					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		ACAGACCACGCGCAGAACAGC	0.612										HNSCC(45;0.13)																											p.A139V		Atlas-SNP	.											.	TP63	187	.	0			c.C416T						.						184.0	137.0	153.0					3																	189526152		2203	4300	6503	SO:0001583	missense	8626	exon4			ACCACGCGCAGAA	AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.416C>T	chr3.hg19:g.189526152C>T	ENSP00000264731:p.Ala139Val	62.0	0.0		59.0	15.0	NM_001114979	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	ENST00000264731.3	hg19	CCDS3293.1	.	.	.	.	.	.	.	.	.	.	C	35	5.567392	0.96540	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000354600;ENST00000434928;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000456148	D;D;D;D;D;D;T;D;D;D;D	0.99793	-6.51;-6.77;-6.76;-6.76;-6.53;-6.43;-1.13;-6.63;-6.66;-6.64;-6.46	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.99483	0.9816	L	0.32530	0.975	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.76494	0.999;0.999;0.999;0.997;0.997;0.989;0.999;0.998;0.999	D;D;P;P;P;P;D;D;D	0.69307	0.949;0.963;0.908;0.815;0.815;0.522;0.963;0.919;0.963	D	0.99250	1.0887	9	.	.	.	-3.5143	19.122	0.93367	0.0:1.0:0.0:0.0	.	139;139;45;45;45;45;139;139;139	Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;P63_HUMAN;.	V	139;139;139;139;139;45;45;45;45;45;45	ENSP00000264731:A139V;ENSP00000407144:A139V;ENSP00000317510:A139V;ENSP00000376253:A139V;ENSP00000394337:A139V;ENSP00000346614:A45V;ENSP00000401661:A45V;ENSP00000392488:A45V;ENSP00000376256:A45V;ENSP00000376254:A45V;ENSP00000389485:A45V	.	A	+	2	0	TP63	191008846	1.000000	0.71417	0.934000	0.37439	0.991000	0.79684	7.487000	0.81328	2.770000	0.95276	0.655000	0.94253	GCG	.	.		0.612	TP63-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000343865.1	NM_003722	
WFS1	7466	hgsc.bcm.edu	37	4	6303650	6303650	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:6303650A>C	ENST00000226760.1	+	8	2298	c.2128A>C	c.(2128-2130)Act>Cct	p.T710P	WFS1_ENST00000503569.1_Missense_Mutation_p.T710P	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	710					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		CGTCCGCGTGACTGACATCGA	0.642																																					p.T710P		Atlas-SNP	.											.	WFS1	71	.	0			c.A2128C						.						39.0	34.0	36.0					4																	6303650		2203	4300	6503	SO:0001583	missense	7466	exon8			CGCGTGACTGACA	AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.2128A>C	chr4.hg19:g.6303650A>C	ENSP00000226760:p.Thr710Pro	31.0	0.0		34.0	11.0	NM_001145853	B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	ENST00000226760.1	hg19	CCDS3386.1	.	.	.	.	.	.	.	.	.	.	A	12.51	1.959340	0.34565	.	.	ENSG00000109501	ENST00000503569;ENST00000226760;ENST00000540337	D;D	0.97575	-4.44;-4.44	5.49	5.49	0.81192	.	0.050606	0.85682	D	0.000000	D	0.97986	0.9337	M	0.75447	2.3	0.48087	D	0.999588	D	0.71674	0.998	D	0.65010	0.931	D	0.98602	1.0659	10	0.62326	D	0.03	-39.7433	14.7629	0.69619	1.0:0.0:0.0:0.0	.	710	O76024	WFS1_HUMAN	P	710;710;88	ENSP00000423337:T710P;ENSP00000226760:T710P	ENSP00000226760:T710P	T	+	1	0	WFS1	6354551	1.000000	0.71417	0.975000	0.42487	0.213000	0.24496	3.589000	0.53972	2.092000	0.63282	0.459000	0.35465	ACT	.	.		0.642	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206863.1		
GUF1	60558	hgsc.bcm.edu	37	4	44693809	44693809	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:44693809T>C	ENST00000281543.5	+	13	1800	c.1606T>C	c.(1606-1608)Tat>Cat	p.Y536H	GUF1_ENST00000506793.1_3'UTR|RP11-700J17.1_ENST00000610260.1_RNA	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						ATCTTCTGGATATGCTAGGTA	0.279																																					p.Y536H		Atlas-SNP	.											.	GUF1	72	.	0			c.T1606C						.						91.0	107.0	102.0					4																	44693809		2201	4283	6484	SO:0001583	missense	60558	exon13			TCTGGATATGCTA		CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1606T>C	chr4.hg19:g.44693809T>C	ENSP00000281543:p.Tyr536His	59.0	0.0		41.0	15.0	NM_021927		Missense_Mutation	SNP	ENST00000281543.5	hg19	CCDS3468.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.168090	0.78339	.	.	ENSG00000151806	ENST00000281543	T	0.63913	-0.07	4.87	4.87	0.63330	Elongation factor G/III/V (1);Translation elongation factor EFG/EF2, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.84515	0.5489	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89165	0.3533	10	0.87932	D	0	-13.5349	13.9439	0.64073	0.0:0.0:0.0:1.0	.	536	Q8N442	GUF1_HUMAN	H	536	ENSP00000281543:Y536H	ENSP00000281543:Y536H	Y	+	1	0	GUF1	44388566	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.562000	0.82300	1.952000	0.56665	0.533000	0.62120	TAT	.	.		0.279	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250469.3	NM_021927	
NFXL1	152518	hgsc.bcm.edu	37	4	47850329	47850329	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:47850329T>A	ENST00000507489.1	-	23	2763	c.2587A>T	c.(2587-2589)Aga>Tga	p.R863*	NFXL1_ENST00000381538.3_Nonsense_Mutation_p.R863*	NM_001278624.1	NP_001265553.1	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like 1	863						integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(4)	27						CCCTTCAGTCTGTTTTCAAAA	0.328																																					p.R863X		Atlas-SNP	.											.	NFXL1	79	.	0			c.A2587T						.						122.0	119.0	120.0					4																	47850329		2203	4300	6503	SO:0001587	stop_gained	152518	exon23			TCAGTCTGTTTTC	AY134856	CCDS3478.2	4p12	2008-02-05			ENSG00000170448	ENSG00000170448			18726	protein-coding gene	gene with protein product	"""ovarian zinc finger protein"""						Standard	NM_152995		Approved	HOZFP	uc003gxp.3	Q6ZNB6	OTTHUMG00000128621	ENST00000507489.1:c.2587A>T	chr4.hg19:g.47850329T>A	ENSP00000422037:p.Arg863*	146.0	0.0		114.0	36.0	NM_152995	B1Q2K1|Q86VG1|Q8WVH1	Nonsense_Mutation	SNP	ENST00000507489.1	hg19	CCDS3478.2	.	.	.	.	.	.	.	.	.	.	T	37	6.286246	0.97444	.	.	ENSG00000170448	ENST00000381538;ENST00000507489	.	.	.	5.66	4.41	0.53225	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-22.0455	12.1758	0.54184	0.0:0.0:0.1426:0.8574	.	.	.	.	X	863	.	ENSP00000370949:R863X	R	-	1	2	NFXL1	47545086	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.341000	0.33907	2.158000	0.67659	0.528000	0.53228	AGA	.	.		0.328	NFXL1-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361636.1	NM_152995	
FRAS1	80144	hgsc.bcm.edu	37	4	79295351	79295351	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:79295351G>T	ENST00000325942.6	+	25	3537	c.3097G>T	c.(3097-3099)Gtc>Ttc	p.V1033F	FRAS1_ENST00000264895.6_Missense_Mutation_p.V1033F	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1033					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGCCCAGTGTGTCCAGGAATG	0.502																																					p.V1033F		Atlas-SNP	.											.	FRAS1	779	.	0			c.G3097T						.						125.0	123.0	123.0					4																	79295351		1948	4160	6108	SO:0001583	missense	80144	exon25			CAGTGTGTCCAGG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.3097G>T	chr4.hg19:g.79295351G>T	ENSP00000326330:p.Val1033Phe	59.0	0.0		33.0	21.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	15.15	2.748993	0.49257	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	D;D	0.87334	-2.24;-2.24	5.94	4.93	0.64822	.	0.063513	0.64402	D	0.000008	D	0.93429	0.7904	M	0.86097	2.795	0.80722	D	1	D;D	0.64830	0.983;0.994	P;D	0.65684	0.873;0.937	D	0.94029	0.7299	10	0.87932	D	0	.	15.7332	0.77822	0.0767:0.0:0.9233:0.0	.	1033;1033	E9PHH6;A2RRR8	.;.	F	1033	ENSP00000326330:V1033F;ENSP00000264895:V1033F	ENSP00000264895:V1033F	V	+	1	0	FRAS1	79514375	1.000000	0.71417	0.999000	0.59377	0.001000	0.01503	5.694000	0.68272	2.820000	0.97059	0.650000	0.86243	GTC	.	.		0.502	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
DSPP	1834	hgsc.bcm.edu	37	4	88535262	88535262	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:88535262A>G	ENST00000282478.7	+	4	1481	c.1448A>G	c.(1447-1449)aAt>aGt	p.N483S	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.N483S			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	483	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		GAAAGTGACAATAACAGCAGT	0.383																																					p.N483S		Atlas-SNP	.											.	DSPP	174	.	0			c.A1448G						.						126.0	119.0	121.0					4																	88535262		2008	4181	6189	SO:0001583	missense	1834	exon5			GTGACAATAACAG	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.1448A>G	chr4.hg19:g.88535262A>G	ENSP00000282478:p.Asn483Ser	87.0	0.0		37.0	24.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	5.630	0.300953	0.10678	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.89050	-2.46;-2.46	4.74	2.17	0.27698	.	0.713649	0.11506	N	0.557210	D	0.82669	0.5087	M	0.64997	1.995	0.09310	N	1	B	0.28713	0.22	B	0.23574	0.047	T	0.65417	-0.6173	10	0.08599	T	0.76	-16.9559	5.7554	0.18170	0.7372:0.169:0.0938:0.0	.	483	Q9NZW4	DSPP_HUMAN	S	483	ENSP00000382213:N483S;ENSP00000282478:N483S	ENSP00000282478:N483S	N	+	2	0	DSPP	88754286	0.000000	0.05858	0.006000	0.13384	0.107000	0.19398	0.581000	0.23819	0.684000	0.31448	0.366000	0.22137	AAT	.	.		0.383	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
NPY5R	4889	hgsc.bcm.edu	37	4	164272303	164272303	+	Missense_Mutation	SNP	C	C	T	rs146231711		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:164272303C>T	ENST00000515560.1	+	4	2400	c.878C>T	c.(877-879)aCa>aTa	p.T293I	NPY5R_ENST00000506953.1_Missense_Mutation_p.T293I|NPY5R_ENST00000338566.3_Missense_Mutation_p.T293I			Q15761	NPY5R_HUMAN	neuropeptide Y receptor Y5	293					cardiac left ventricle morphogenesis (GO:0003214)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of ovulation cycle rhythm (GO:0060112)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuropeptide signaling pathway (GO:0007218)|outflow tract morphogenesis (GO:0003151)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of smooth muscle cell proliferation (GO:0048661)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)|pancreatic polypeptide receptor activity (GO:0001602)|peptide YY receptor activity (GO:0001601)			NS(2)|biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(4)|lung(26)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_hematologic(180;0.166)	Prostate(90;0.109)				AGCAAGAAGACAGCATGTGTG	0.428																																					p.T293I	Melanoma(139;1287 1774 9781 19750 25599)	Atlas-SNP	.											.	NPY5R	101	.	0			c.C878T						.	C	ILE/THR	1,4405	2.1+/-5.4	0,1,2202	99.0	99.0	99.0		878	2.7	0.8	4	dbSNP_134	99	0,8600		0,0,4300	no	missense	NPY5R	NM_006174.2	89	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	293/446	164272303	1,13005	2203	4300	6503	SO:0001583	missense	4889	exon4			AGAAGACAGCATG	BC042416	CCDS3804.1	4q31-q32	2012-08-08				ENSG00000164129		"""GPCR / Class A : Neuropeptide receptors : Y"""	7958	protein-coding gene	gene with protein product		602001				8700207, 9417917	Standard	NM_006174		Approved	NPYR5	uc003iqn.3	Q15761		ENST00000515560.1:c.878C>T	chr4.hg19:g.164272303C>T	ENSP00000423917:p.Thr293Ile	55.0	0.0		15.0	9.0	NM_006174	Q6GTR7|Q92916	Missense_Mutation	SNP	ENST00000515560.1	hg19	CCDS3804.1	.	.	.	.	.	.	.	.	.	.	C	10.37	1.332690	0.24167	2.27E-4	0.0	ENSG00000164129	ENST00000338566;ENST00000515560;ENST00000506953	T;T;T	0.71817	-0.6;-0.6;-0.6	4.49	2.7	0.31948	GPCR, rhodopsin-like superfamily (1);	0.166788	0.27126	N	0.020803	T	0.63920	0.2552	L	0.43152	1.355	0.30306	N	0.789	P	0.45396	0.857	B	0.43623	0.425	T	0.62388	-0.6865	10	0.30078	T	0.28	.	13.6284	0.62181	0.2831:0.7169:0.0:0.0	.	293	Q15761	NPY5R_HUMAN	I	293	ENSP00000339377:T293I;ENSP00000423917:T293I;ENSP00000423474:T293I	ENSP00000339377:T293I	T	+	2	0	NPY5R	164491753	0.857000	0.29778	0.849000	0.33467	0.724000	0.41520	1.591000	0.36665	0.555000	0.29079	0.467000	0.42956	ACA	.	C|1.000;T|0.000		0.428	NPY5R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364633.1	NM_006174	
HELT	391723	hgsc.bcm.edu	37	4	185941802	185941802	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr4:185941802C>T	ENST00000515777.1	+	4	693	c.605C>T	c.(604-606)gCg>gTg	p.A202V	HELT_ENST00000505610.1_Missense_Mutation_p.A201V|HELT_ENST00000338875.4_Missense_Mutation_p.A287V			A6NFD8	HELT_HUMAN	helt bHLH transcription factor	202	Pro-rich.				central nervous system development (GO:0007417)|GABAergic neuron differentiation in basal ganglia (GO:0021858)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	14		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		GCTAGCCCAGCGCAGCAGCAC	0.726																																					p.A287V		Atlas-SNP	.											.	HELT	34	.	0			c.C860T						.						16.0	18.0	17.0					4																	185941802		2200	4290	6490	SO:0001583	missense	391723	exon4			GCCCAGCGCAGCA	BC144567	CCDS75214.1, CCDS75215.1	4q35.1	2014-07-17	2011-09-12		ENSG00000187821	ENSG00000187821		"""Basic helix-loop-helix proteins"""	33783	protein-coding gene	gene with protein product	"""megane bHLH factor"", ""HES-like"""		"""Hey-like transcription factor (zebrafish)"", ""HES/HEY-like transcription factor"""			14764602, 17611227	Standard	XM_005262989		Approved	HESL, HCM1228, Mgn, bHLHb44, MEGANE	uc011ckq.2	A6NFD8	OTTHUMG00000160484	ENST00000515777.1:c.605C>T	chr4.hg19:g.185941802C>T	ENSP00000426033:p.Ala202Val	11.0	0.0		16.0	13.0	NM_001029887	B2RTS5|B7ZMI7|B7ZMI8	Missense_Mutation	SNP	ENST00000515777.1	hg19		.	.	.	.	.	.	.	.	.	.	C	10.59	1.393785	0.25205	.	.	ENSG00000187821	ENST00000505610;ENST00000515777;ENST00000338875	T;T;T	0.64991	-0.13;-0.12;1.81	4.96	3.22	0.36961	.	0.134936	0.49916	D	0.000123	T	0.38904	0.1058	L	0.27053	0.805	0.26792	N	0.969387	P;B;B	0.41131	0.739;0.063;0.104	B;B;B	0.22753	0.041;0.016;0.036	T	0.16719	-1.0393	10	0.34782	T	0.22	.	10.6558	0.45673	0.1224:0.5445:0.333:0.0	.	287;202;201	A6NFD8;B7ZMI7;A6NFD8-2	HELT_HUMAN;.;.	V	201;202;287	ENSP00000422140:A201V;ENSP00000426033:A202V;ENSP00000343464:A287V	ENSP00000343464:A287V	A	+	2	0	HELT	186178796	0.975000	0.34042	0.924000	0.36721	0.088000	0.18126	2.287000	0.43505	0.493000	0.27837	0.561000	0.74099	GCG	.	.		0.726	HELT-002	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000360792.1	NM_001300781	
GPR98	84059	hgsc.bcm.edu	37	5	89948314	89948314	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:89948314C>T	ENST00000405460.2	+	19	3664	c.3568C>T	c.(3568-3570)Cat>Tat	p.H1190Y		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1190	Calx-beta 9. {ECO:0000305|PubMed:11606593}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AATCATTCTCCATGCTTTTCC	0.348																																					p.H1190Y		Atlas-SNP	.											.	GPR98	605	.	0			c.C3568T						.						90.0	82.0	85.0					5																	89948314		1878	4115	5993	SO:0001583	missense	84059	exon19			ATTCTCCATGCTT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3568C>T	chr5.hg19:g.89948314C>T	ENSP00000384582:p.His1190Tyr	148.0	0.0		72.0	39.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.32|15.32	2.797986|2.797986	0.50208|0.50208	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.26957|.	1.7|.	6.07|6.07	6.07|6.07	0.98685|0.98685	.|.	0.247806|.	0.47852|.	D|.	0.000218|.	T|T	0.57621|0.57621	0.2066|0.2066	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	P|.	0.40230|.	0.708|.	B|.	0.31191|.	0.125|.	T|T	0.48399|0.48399	-0.9039|-0.9039	10|5	0.66056|.	D|.	0.02|.	.|.	20.6525|20.6525	0.99598|0.99598	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1190|.	Q8WXG9|.	GPR98_HUMAN|.	Y|L	1190|778	ENSP00000384582:H1190Y|.	ENSP00000296619:H1190Y|.	H|P	+|+	1|2	0|0	GPR98|GPR98	89984070|89984070	0.975000|0.975000	0.34042|0.34042	0.994000|0.994000	0.49952|0.49952	0.861000|0.861000	0.49209|0.49209	2.369000|2.369000	0.44231|0.44231	2.890000|2.890000	0.99128|0.99128	0.585000|0.585000	0.79938|0.79938	CAT|CCA	.	.		0.348	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
SLCO6A1	133482	hgsc.bcm.edu	37	5	101813521	101813521	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:101813521C>T	ENST00000506729.1	-	3	832	c.661G>A	c.(661-663)Ggt>Agt	p.G221S	SLCO6A1_ENST00000379807.3_Missense_Mutation_p.G221S|SLCO6A1_ENST00000514551.1_Intron|SLCO6A1_ENST00000379810.1_Intron|SLCO6A1_ENST00000389019.3_Intron|SLCO6A1_ENST00000513675.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		AATGATATACCACTGCTCTGG	0.338																																					p.G221S		Atlas-SNP	.											.	SLCO6A1	153	.	0			c.G661A						.						170.0	166.0	168.0					5																	101813521		2203	4300	6503	SO:0001583	missense	133482	exon3			ATATACCACTGCT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.661G>A	chr5.hg19:g.101813521C>T	ENSP00000421339:p.Gly221Ser	95.0	0.0		25.0	17.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	hg19	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	C	4.681	0.126682	0.08931	.	.	ENSG00000205359	ENST00000506729;ENST00000379807	T;T	0.37235	1.21;1.21	4.84	-3.85	0.04243	Major facilitator superfamily domain, general substrate transporter (1);	5.373610	0.00754	N	0.001085	T	0.10294	0.0252	N	0.01576	-0.805	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.14699	-1.0463	10	0.08599	T	0.76	.	0.3132	0.00291	0.2792:0.1788:0.1454:0.3966	.	221	Q86UG4	SO6A1_HUMAN	S	221	ENSP00000421339:G221S;ENSP00000369135:G221S	ENSP00000369135:G221S	G	-	1	0	SLCO6A1	101841420	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.636000	0.05465	-0.485000	0.06754	-0.229000	0.12294	GGT	.	.		0.338	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
LVRN	206338	hgsc.bcm.edu	37	5	115323605	115323605	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:115323605G>C	ENST00000357872.4	+	4	1198	c.1074G>C	c.(1072-1074)ttG>ttC	p.L358F	AQPEP_ENST00000395528.2_5'UTR	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		358						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										TGGAGGATTTGTTTAATATCA	0.423																																					p.L358F		Atlas-SNP	.											.	.	.	.	0			c.G1074C						.						166.0	158.0	161.0					5																	115323605		2202	4300	6502	SO:0001583	missense	0	exon4			GGATTTGTTTAAT																												ENST00000357872.4:c.1074G>C	chr5.hg19:g.115323605G>C	ENSP00000350541:p.Leu358Phe	186.0	0.0		95.0	13.0	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	hg19	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	G	9.466	1.094306	0.20471	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.02631	4.22	5.14	1.06	0.20224	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.289067	0.24323	N	0.039539	T	0.04679	0.0127	L	0.31926	0.97	0.80722	D	1	D	0.53312	0.959	P	0.56960	0.81	T	0.55360	-0.8153	10	0.22706	T	0.39	.	7.9111	0.29791	0.6546:0.0:0.3454:0.0	.	358	Q6Q4G3	AMPQ_HUMAN	F	358;347	ENSP00000350541:L358F	ENSP00000350541:L358F	L	+	3	2	AC010282.1	115351504	0.929000	0.31497	0.998000	0.56505	0.981000	0.71138	0.051000	0.14141	-0.103000	0.12175	-0.471000	0.05019	TTG	.	.		0.423	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		
PCDHA7	56141	hgsc.bcm.edu	37	5	140215989	140215989	+	Missense_Mutation	SNP	A	A	T	rs370529939		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:140215989A>T	ENST00000525929.1	+	1	2021	c.2021A>T	c.(2020-2022)cAg>cTg	p.Q674L	PCDHA7_ENST00000378125.3_Missense_Mutation_p.Q674L|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	674	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAAAGCGGCCAGGCACCAAAG	0.657																																					p.Q674L	NSCLC(160;258 2013 5070 22440 28951)	Atlas-SNP	.											.	PCDHA7	367	.	0			c.A2021T						.						77.0	75.0	76.0					5																	140215989		2203	4299	6502	SO:0001583	missense	56141	exon1			GCGGCCAGGCACC	AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2021A>T	chr5.hg19:g.140215989A>T	ENSP00000436426:p.Gln674Leu	26.0	0.0		24.0	15.0	NM_031852	O75282	Missense_Mutation	SNP	ENST00000525929.1	hg19	CCDS54918.1	.	.	.	.	.	.	.	.	.	.	A	2.151	-0.394480	0.04899	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.52295	0.67;0.7	3.57	2.36	0.29203	Cadherin (2);	0.298550	0.17684	U	0.165532	T	0.44829	0.1312	M	0.69358	2.11	0.09310	N	1	B;B	0.16802	0.019;0.011	B;B	0.23150	0.044;0.013	T	0.45145	-0.9281	10	0.62326	D	0.03	.	8.7292	0.34489	0.63:0.37:0.0:0.0	.	674;674	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	L	674	ENSP00000436426:Q674L;ENSP00000367365:Q674L	ENSP00000367365:Q674L	Q	+	2	0	PCDHA7	140196173	0.000000	0.05858	0.024000	0.17045	0.008000	0.06430	-0.103000	0.10940	0.513000	0.28278	0.379000	0.24179	CAG	.	.		0.657	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372887.2	NM_018910	
PCDHB10	56126	hgsc.bcm.edu	37	5	140573688	140573688	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr5:140573688C>A	ENST00000239446.4	+	1	1747	c.1563C>A	c.(1561-1563)taC>taA	p.Y521*		NM_018930.3	NP_061753.1	Q9UN67	PCDBA_HUMAN	protocadherin beta 10	521	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(30)|ovary(4)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	76			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCTGGACTACGAGGCCCTGC	0.706																																					p.Y521X		Atlas-SNP	.											.	PCDHB10	177	.	0			c.C1563A						.						93.0	111.0	105.0					5																	140573688		2203	4298	6501	SO:0001587	stop_gained	56126	exon1			GGACTACGAGGCC	AF152489	CCDS4252.1	5q31.3	2010-06-15			ENSG00000120324	ENSG00000120324		"""Cadherins / Protocadherins : Clustered"""	8681	other	protocadherin		606336				10380929	Standard	NM_018930		Approved		uc003lix.3	Q9UN67	OTTHUMG00000129626	ENST00000239446.4:c.1563C>A	chr5.hg19:g.140573688C>A	ENSP00000239446:p.Tyr521*	71.0	0.0		59.0	17.0	NM_018930	Q96T99	Nonsense_Mutation	SNP	ENST00000239446.4	hg19	CCDS4252.1	.	.	.	.	.	.	.	.	.	.	c	36	5.833420	0.97003	.	.	ENSG00000120324	ENST00000239446	.	.	.	3.53	0.623	0.17654	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.8578	0.18730	0.0:0.4142:0.0:0.5858	.	.	.	.	X	521	.	ENSP00000239446:Y521X	Y	+	3	2	PCDHB10	140553872	0.000000	0.05858	0.960000	0.40013	0.961000	0.63080	-2.742000	0.00798	0.289000	0.22422	0.549000	0.68633	TAC	.	.		0.706	PCDHB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251821.1	NM_018930	
DDR1	780	hgsc.bcm.edu	37	6	30866689	30866689	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:30866689G>T	ENST00000324771.8	+	19	3024	c.2476G>T	c.(2476-2478)Gtg>Ttg	p.V826L	DDR1_ENST00000508312.1_Missense_Mutation_p.V807L|DDR1_ENST00000376575.3_Missense_Mutation_p.V832L|DDR1_ENST00000376568.3_Missense_Mutation_p.V826L|DDR1_ENST00000452441.1_Missense_Mutation_p.V826L|DDR1_ENST00000376570.4_Missense_Mutation_p.V789L|DDR1_ENST00000446312.1_3'UTR|DDR1_ENST00000513240.1_Missense_Mutation_p.V832L|DDR1_ENST00000361741.4_Intron|DDR1_ENST00000376567.2_Missense_Mutation_p.V789L|DDR1_ENST00000454612.2_Missense_Mutation_p.V789L|DDR1_ENST00000376569.3_Missense_Mutation_p.V789L|DDR1_ENST00000418800.2_Missense_Mutation_p.V789L			Q08345	DDR1_HUMAN	discoidin domain receptor tyrosine kinase 1	826	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|ear development (GO:0043583)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine autophosphorylation (GO:0038083)|protein autophosphorylation (GO:0046777)|regulation of cell growth (GO:0001558)|regulation of cell-matrix adhesion (GO:0001952)|regulation of extracellular matrix disassembly (GO:0010715)|smooth muscle cell migration (GO:0014909)|smooth muscle cell-matrix adhesion (GO:0061302)|wound healing, spreading of cells (GO:0044319)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|metal ion binding (GO:0046872)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(1)|prostate(1)|skin(1)	29					Imatinib(DB00619)	TGCGAGTGACGTGTGGGCCTT	0.597																																					p.V832L		Atlas-SNP	.											.	DDR1	213	.	0			c.G2494T						.						169.0	132.0	144.0					6																	30866689		2203	4300	6503	SO:0001583	missense	780	exon16			AGTGACGTGTGGG	X99031	CCDS4690.1, CCDS34385.1, CCDS47396.1, CCDS56411.1, CCDS75419.1	6p21.33	2010-02-17	2008-01-23		ENSG00000204580	ENSG00000204580	2.7.10.1	"""CD molecules"""	2730	protein-coding gene	gene with protein product		600408	"""discoidin domain receptor family, member 1"""	NTRK4, PTK3A, NEP, CAK, EDDR1		7789998	Standard	NM_001954		Approved	RTK6, CD167	uc003nrv.3	Q08345	OTTHUMG00000031236	ENST00000324771.8:c.2476G>T	chr6.hg19:g.30866689G>T	ENSP00000318217:p.Val826Leu	83.0	0.0		78.0	31.0	NM_013994	B5A975|B5A976|B7Z2K0|Q14196|Q16562|Q2L6H3|Q4LE50|Q5ST11|Q5ST12|Q6NSK4|Q9UD35|Q9UD36|Q9UD37|Q9UD86|Q9UDL2	Missense_Mutation	SNP	ENST00000324771.8	hg19	CCDS34385.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957658	0.53400	.	.	ENSG00000204580	ENST00000324771;ENST00000418800;ENST00000454612;ENST00000376569;ENST00000376575;ENST00000376570;ENST00000376568;ENST00000452441;ENST00000508312;ENST00000376567;ENST00000513240	D;D;D;D;D;D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	4.89	4.89	0.63831	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000002	D	0.86209	0.5878	M	0.80422	2.495	0.80722	D	1	B;B;B;B	0.25206	0.003;0.12;0.023;0.003	B;B;B;B	0.34722	0.012;0.188;0.082;0.017	D	0.87341	0.2331	10	0.87932	D	0	.	15.5589	0.76223	0.0:0.0:1.0:0.0	.	807;290;832;826	B7Z2K0;A2ABL4;Q08345-5;Q08345	.;.;.;DDR1_HUMAN	L	826;789;789;789;832;789;826;826;807;789;832	ENSP00000318217:V826L;ENSP00000407699:V789L;ENSP00000406091:V789L;ENSP00000365753:V789L;ENSP00000365759:V832L;ENSP00000365754:V789L;ENSP00000365752:V826L;ENSP00000405039:V826L;ENSP00000422442:V807L;ENSP00000365751:V789L;ENSP00000427552:V832L	ENSP00000318217:V826L	V	+	1	0	DDR1	30974668	1.000000	0.71417	0.990000	0.47175	0.515000	0.34225	9.823000	0.99369	2.256000	0.74724	0.467000	0.42956	GTG	.	.		0.597	DDR1-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076494.3	NM_013994	
ITPR3	3710	hgsc.bcm.edu	37	6	33639857	33639857	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:33639857T>C	ENST00000374316.5	+	23	3840	c.2780T>C	c.(2779-2781)aTg>aCg	p.M927T	ITPR3_ENST00000605930.1_Missense_Mutation_p.M927T			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	927					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	ATGTCCACCATGGTGCTGAGC	0.612																																					p.M927T		Atlas-SNP	.											.	ITPR3	409	.	0			c.T2780C						.						93.0	81.0	85.0					6																	33639857		2203	4300	6503	SO:0001583	missense	3710	exon22			CCACCATGGTGCT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2780T>C	chr6.hg19:g.33639857T>C	ENSP00000363435:p.Met927Thr	33.0	0.0		31.0	11.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	hg19	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.576476	0.86645	.	.	ENSG00000096433	ENST00000374316	D	0.92348	-3.02	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.93177	0.7827	M	0.79926	2.475	0.58432	D	0.999998	P	0.47910	0.902	P	0.51229	0.663	D	0.94018	0.7290	10	0.66056	D	0.02	-47.7924	15.5417	0.76057	0.0:0.0:0.0:1.0	.	927	Q14573	ITPR3_HUMAN	T	927	ENSP00000363435:M927T	ENSP00000363435:M927T	M	+	2	0	ITPR3	33747835	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.072000	0.62099	0.533000	0.62120	ATG	.	.		0.612	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
KHDC3L	154288	hgsc.bcm.edu	37	6	74072885	74072886	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:74072885_74072886GG>TT	ENST00000370367.3	+	2	290_291	c.237_238GG>TT	c.(235-240)ttGGac>ttTTac	p.79_80LD>FY		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	79	KH; atypical.						RNA binding (GO:0003723)										TGAATCGATTGGACCCTAACGG	0.569																																					p.L79F|p.D80Y		Atlas-SNP	.											.	.	.	.	0			c.G237T|c.G238T						.																																			SO:0001583	missense	154288	exon2			TCGATTGGACCCT|CGATTGGACCCTA	AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	Exception_encountered	chr6.hg19:g.74072885_74072886delinsTT	ENSP00000359392:p.L79_D80delinsFY	43.0	0.0		32.0|33.0	10.0|11.0	NM_001017361	B2RNW7	Missense_Mutation	SNP	ENST00000370367.3	hg19	CCDS34484.1																																																																																			.	.		0.569	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041202.3	NM_001017361	
IMPG1	3617	hgsc.bcm.edu	37	6	76720891	76720891	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:76720891T>A	ENST00000369950.3	-	8	1047	c.858A>T	c.(856-858)ttA>ttT	p.L286F	IMPG1_ENST00000369963.3_3'UTR	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				ACCTAAATCCTAACACATGGA	0.313																																					p.L286F	Pancreas(37;839 1141 2599 26037)	Atlas-SNP	.											.	IMPG1	143	.	0			c.A858T						.						50.0	54.0	53.0					6																	76720891		2200	4297	6497	SO:0001583	missense	3617	exon8			AAATCCTAACACA	AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.858A>T	chr6.hg19:g.76720891T>A	ENSP00000358966:p.Leu286Phe	116.0	0.0		86.0	36.0	NM_001563		Missense_Mutation	SNP	ENST00000369950.3	hg19	CCDS4985.1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.619027	0.66787	.	.	ENSG00000112706	ENST00000369950	T	0.44881	0.91	5.56	1.55	0.23275	SEA (3);	0.275088	0.25978	N	0.027093	T	0.47820	0.1466	M	0.73962	2.25	0.80722	D	1	D	0.71674	0.998	D	0.76575	0.988	T	0.50398	-0.8833	10	0.59425	D	0.04	.	8.2252	0.31564	0.0:0.2951:0.0:0.7049	.	286	Q17R60	IMPG1_HUMAN	F	286	ENSP00000358966:L286F	ENSP00000358966:L286F	L	-	3	2	IMPG1	76777611	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.498000	0.22530	0.487000	0.27698	0.528000	0.53228	TTA	.	.		0.313	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041288.1	NM_001563	
MAP3K7	6885	hgsc.bcm.edu	37	6	91269811	91269811	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:91269811C>A	ENST00000369329.3	-	5	627	c.466G>T	c.(466-468)Gac>Tac	p.D156Y	MAP3K7_ENST00000369327.3_Missense_Mutation_p.D156Y|MAP3K7_ENST00000369325.3_Missense_Mutation_p.D156Y|MAP3K7_ENST00000369332.3_Missense_Mutation_p.D156Y	NM_145331.2	NP_663304.1	O43318	M3K7_HUMAN	mitogen-activated protein kinase kinase kinase 7	156	Interaction with MAPK8IP1. {ECO:0000250}.|Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|Fc-epsilon receptor signaling pathway (GO:0038095)|histone H3 acetylation (GO:0043966)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of ripoptosome assembly involved in necroptotic process (GO:1902443)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|regulation of reactive oxygen species metabolic process (GO:2000377)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase activity (GO:0004708)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|scaffold protein binding (GO:0097110)			endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	28		all_cancers(76;6.4e-08)|Acute lymphoblastic leukemia(125;1.43e-09)|Prostate(29;9.32e-09)|all_hematologic(105;3.69e-06)|all_epithelial(107;0.000187)|Ovarian(999;0.0164)		OV - Ovarian serous cystadenocarcinoma(136;2.05e-11)|all cancers(137;3.25e-11)|GBM - Glioblastoma multiforme(226;0.0416)|BRCA - Breast invasive adenocarcinoma(108;0.0429)		GGTTTCAGGTCCCTGTGAATT	0.478																																					p.D156Y		Atlas-SNP	.											.	MAP3K7	100	.	0			c.G466T						.						239.0	217.0	225.0					6																	91269811		2203	4300	6503	SO:0001583	missense	6885	exon5			TCAGGTCCCTGTG	AB009356	CCDS5027.1, CCDS5028.1, CCDS5029.1, CCDS5030.1	6q15	2011-06-09			ENSG00000135341	ENSG00000135341		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6859	protein-coding gene	gene with protein product		602614		TAK1		9466656	Standard	NM_003188		Approved	MEKK7	uc003pnz.2	O43318	OTTHUMG00000015217	ENST00000369329.3:c.466G>T	chr6.hg19:g.91269811C>A	ENSP00000358335:p.Asp156Tyr	169.0	0.0		93.0	46.0	NM_145333	B2RE27|E1P523|O43317|O43319|Q5TDN2|Q5TDN3|Q5TDT7|Q9NTR3|Q9NZ70	Missense_Mutation	SNP	ENST00000369329.3	hg19	CCDS5028.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.417423	0.83449	.	.	ENSG00000135341	ENST00000369332;ENST00000369329;ENST00000369325;ENST00000369327	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	5.11	5.11	0.69529	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86657	0.5985	H	0.99675	4.695	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92805	0.6259	10	0.87932	D	0	.	18.8863	0.92379	0.0:1.0:0.0:0.0	.	156;156;156;156	O43318-4;O43318-2;O43318-3;O43318	.;.;.;M3K7_HUMAN	Y	156	ENSP00000358338:D156Y;ENSP00000358335:D156Y;ENSP00000358331:D156Y;ENSP00000358333:D156Y	ENSP00000358331:D156Y	D	-	1	0	MAP3K7	91326532	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.530000	0.85305	0.585000	0.79938	GAC	.	.		0.478	MAP3K7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041530.1	NM_145331	
EPHA7	2045	hgsc.bcm.edu	37	6	94120578	94120578	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:94120578C>T	ENST00000369303.4	-	3	657	c.473G>A	c.(472-474)gGt>gAt	p.G158D	EPHA7_ENST00000369297.1_Missense_Mutation_p.G158D	NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	158	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		ACCAAGGTCACCTTGGGTAAA	0.398																																					p.G158D		Atlas-SNP	.											.	EPHA7	251	.	0			c.G473A						.						135.0	135.0	135.0					6																	94120578		2203	4300	6503	SO:0001583	missense	2045	exon3			AGGTCACCTTGGG	L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.473G>A	chr6.hg19:g.94120578C>T	ENSP00000358309:p.Gly158Asp	131.0	0.0		80.0	28.0	NM_004440	A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	ENST00000369303.4	hg19	CCDS5031.1	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288944	0.59976	.	.	ENSG00000135333	ENST00000369303;ENST00000369297	T;T	0.09350	2.99;2.99	5.32	5.32	0.75619	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.22975	0.0555	L	0.55103	1.725	0.58432	D	0.999991	D;D;D;D	0.89917	0.983;1.0;1.0;1.0	P;D;D;D	0.97110	0.644;1.0;1.0;1.0	T	0.00503	-1.1701	10	0.52906	T	0.07	.	19.4211	0.94721	0.0:1.0:0.0:0.0	.	158;158;158;158	Q15375-4;Q15375-3;Q15375-2;Q15375	.;.;.;EPHA7_HUMAN	D	158	ENSP00000358309:G158D;ENSP00000358303:G158D	ENSP00000358303:G158D	G	-	2	0	EPHA7	94177299	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.744000	0.62118	2.676000	0.91093	0.650000	0.86243	GGT	.	.		0.398	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041545.1		
ASCC3	10973	hgsc.bcm.edu	37	6	101166124	101166124	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:101166124C>T	ENST00000369162.2	-	12	2250	c.1906G>A	c.(1906-1908)Gaa>Aaa	p.E636K	ASCC3_ENST00000522650.1_Missense_Mutation_p.E636K	NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	636	Helicase ATP-binding 1. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TGTGTGGATTCCACCTATATG	0.303																																					p.E636K		Atlas-SNP	.											.	ASCC3	205	.	0			c.G1906A						.						83.0	83.0	83.0					6																	101166124		2203	4300	6503	SO:0001583	missense	10973	exon12			TGGATTCCACCTA	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.1906G>A	chr6.hg19:g.101166124C>T	ENSP00000358159:p.Glu636Lys	75.0	0.0		49.0	19.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	hg19	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	C	32	5.148786	0.94603	.	.	ENSG00000112249	ENST00000369162;ENST00000522650	T;T	0.14640	2.49;2.49	5.36	5.36	0.76844	DEAD-like helicase (2);ATPase, AAA+ type, core (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.119748	0.56097	D	0.000034	T	0.34164	0.0888	M	0.81614	2.55	0.80722	D	1	D;D	0.71674	0.998;0.992	D;D	0.73380	0.98;0.954	T	0.18524	-1.0334	10	0.66056	D	0.02	.	19.0903	0.93224	0.0:1.0:0.0:0.0	.	636;636	E7EW23;Q8N3C0	.;HELC1_HUMAN	K	636	ENSP00000358159:E636K;ENSP00000430769:E636K	ENSP00000358159:E636K	E	-	1	0	ASCC3	101272845	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	7.818000	0.86416	2.499000	0.84300	0.585000	0.79938	GAA	.	.		0.303	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
TAAR1	134864	hgsc.bcm.edu	37	6	132966704	132966704	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr6:132966704T>C	ENST00000275216.1	-	1	438	c.439A>G	c.(439-441)Agt>Ggt	p.S147G		NM_138327.1	NP_612200.1	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	147					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)	18	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)|Dextroamphetamine(DB01576)|Methamphetamine(DB01577)|Propylhexedrine(DB06714)	ACACTCCAACTAATGAAGATC	0.393																																					p.S147G		Atlas-SNP	.											.	TAAR1	41	.	0			c.A439G						.						58.0	57.0	57.0					6																	132966704		2203	4300	6503	SO:0001583	missense	134864	exon1			TCCAACTAATGAA	AY180374	CCDS5158.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146399	ENSG00000146399		"""GPCR / Class A : Trace amine associated receptors"""	17734	protein-coding gene	gene with protein product		609333	"""trace amine receptor 1"""	TRAR1		11459929, 15718104	Standard	NM_138327		Approved	TAR1, TA1	uc003qdm.1	Q96RJ0	OTTHUMG00000015583	ENST00000275216.1:c.439A>G	chr6.hg19:g.132966704T>C	ENSP00000275216:p.Ser147Gly	77.0	0.0		49.0	17.0	NM_138327	Q2M1W5|Q3MIH8|Q5VUQ1	Missense_Mutation	SNP	ENST00000275216.1	hg19	CCDS5158.1	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019627	0.54576	.	.	ENSG00000146399	ENST00000275216	T	0.72051	-0.62	5.73	2.02	0.26589	GPCR, rhodopsin-like superfamily (1);	0.043249	0.85682	D	0.000000	T	0.59569	0.2203	M	0.82132	2.575	0.38986	D	0.95904	B	0.33841	0.428	B	0.39068	0.289	T	0.58317	-0.7657	10	0.45353	T	0.12	-9.8524	9.6416	0.39842	0.0:0.1977:0.0:0.8023	.	147	Q96RJ0	TAAR1_HUMAN	G	147	ENSP00000275216:S147G	ENSP00000275216:S147G	S	-	1	0	TAAR1	133008397	0.963000	0.33076	0.684000	0.30055	0.952000	0.60782	2.005000	0.40864	0.113000	0.18004	0.454000	0.30748	AGT	.	.		0.393	TAAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042259.1	NM_138327	
ABCA13	154664	hgsc.bcm.edu	37	7	48431663	48431663	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:48431663G>T	ENST00000435803.1	+	38	11824	c.11800G>T	c.(11800-11802)Gaa>Taa	p.E3934*		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3934	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E3879K(1)|p.E3934K(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CACCGTCCGGGAACATTTGCT	0.517																																					p.E3934X		Atlas-SNP	.											ABCA13_ENST00000435803,trunk,malignant_melanoma,0,2	ABCA13	1192	.	2	Substitution - Missense(2)	skin(2)	c.G11800T						.						124.0	127.0	126.0					7																	48431663		2021	4180	6201	SO:0001587	stop_gained	154664	exon38			GTCCGGGAACATT	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11800G>T	chr7.hg19:g.48431663G>T	ENSP00000411096:p.Glu3934*	67.0	0.0		56.0	21.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Nonsense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	G	52	19.415468	0.99919	.	.	ENSG00000179869	ENST00000435803	.	.	.	5.32	5.32	0.75619	.	0.000000	0.41294	U	0.000908	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.7134	0.77649	0.0:0.0:1.0:0.0	.	.	.	.	X	3934	.	ENSP00000411096:E3934X	E	+	1	0	ABCA13	48402209	1.000000	0.71417	0.046000	0.18839	0.049000	0.14656	8.042000	0.89430	2.485000	0.83878	0.467000	0.42956	GAA	.	.		0.517	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
PCLO	27445	hgsc.bcm.edu	37	7	82531973	82531973	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:82531973C>T	ENST00000333891.9	-	9	13859	c.13522G>A	c.(13522-13524)Gtt>Att	p.V4508I	PCLO_ENST00000423517.2_Missense_Mutation_p.V4508I	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTACCTGAAACTGTGTGATCC	0.279																																					p.V4508I		Atlas-SNP	.											.	PCLO	1506	.	0			c.G13522A						.						217.0	185.0	195.0					7																	82531973		1814	4082	5896	SO:0001583	missense	27445	exon9			CTGAAACTGTGTG	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13522G>A	chr7.hg19:g.82531973C>T	ENSP00000334319:p.Val4508Ile	119.0	0.0		78.0	27.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173092	0.38413	.	.	ENSG00000186472	ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.32	5.7	4.82	0.62117	.	.	.	.	.	T	0.13457	0.0326	L	0.28115	0.83	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.12156	0.007;0.007	T	0.03773	-1.1005	9	0.87932	D	0	.	11.4181	0.49965	0.0:0.862:0.0:0.138	.	4508;4508	Q9Y6V0-5;Q9Y6V0-6	.;.	I	4508	ENSP00000334319:V4508I;ENSP00000388393:V4508I	ENSP00000334319:V4508I	V	-	1	0	PCLO	82369909	0.997000	0.39634	1.000000	0.80357	0.987000	0.75469	3.627000	0.54252	2.694000	0.91930	0.467000	0.42956	GTT	.	.		0.279	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
HEPACAM2	253012	hgsc.bcm.edu	37	7	92837990	92837990	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr7:92837990T>A	ENST00000394468.2	-	4	992	c.915A>T	c.(913-915)aaA>aaT	p.K305N	HEPACAM2_ENST00000341723.4_Missense_Mutation_p.K293N|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.K293N|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.K328N	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	305	Ig-like C2-type 2.				centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						TCTGGGCTACTTTCTCAGATG	0.443																																					p.K305N		Atlas-SNP	.											.	HEPACAM2	132	.	0			c.A915T						.						167.0	147.0	154.0					7																	92837990		2203	4300	6503	SO:0001583	missense	253012	exon4			GGCTACTTTCTCA	AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.915A>T	chr7.hg19:g.92837990T>A	ENSP00000377980:p.Lys305Asn	134.0	0.0		97.0	32.0	NM_001039372	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	ENST00000394468.2	hg19	CCDS43616.1	.	.	.	.	.	.	.	.	.	.	T	12.04	1.817667	0.32145	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.23	-2.05	0.07321	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.394694	0.29631	N	0.011605	T	0.10337	0.0253	N	0.24115	0.695	0.26828	N	0.968639	P;P;B;B	0.49307	0.922;0.801;0.379;0.178	P;P;B;B	0.49528	0.614;0.494;0.196;0.145	T	0.28299	-1.0048	10	0.30854	T	0.27	-3.3532	8.3344	0.32206	0.0:0.1251:0.4308:0.444	.	328;293;305;293	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	N	305;293;293;328	ENSP00000377980:K305N;ENSP00000340532:K293N;ENSP00000389592:K293N;ENSP00000390204:K328N	ENSP00000340532:K293N	K	-	3	2	HEPACAM2	92675926	0.720000	0.27996	0.984000	0.44739	0.018000	0.09664	0.183000	0.16919	-0.089000	0.12484	-1.151000	0.01829	AAA	.	.		0.443	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254651.1	NM_198151	
TNKS	8658	hgsc.bcm.edu	37	8	9538246	9538246	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:9538246A>T	ENST00000310430.6	+	5	1069	c.1043A>T	c.(1042-1044)gAa>gTa	p.E348V	TNKS_ENST00000520408.1_Missense_Mutation_p.E348V|TNKS_ENST00000518027.1_3'UTR|TNKS_ENST00000518281.1_Missense_Mutation_p.E111V	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase	348					mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		AGTGGTAATGAAGAAAAACTA	0.303																																					p.E348V		Atlas-SNP	.											.	TNKS	198	.	0			c.A1043T						.						81.0	87.0	85.0					8																	9538246		2203	4300	6503	SO:0001583	missense	8658	exon5			GTAATGAAGAAAA	AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.1043A>T	chr8.hg19:g.9538246A>T	ENSP00000311579:p.Glu348Val	143.0	0.0		121.0	46.0	NM_003747	O95272|Q4G0F2	Missense_Mutation	SNP	ENST00000310430.6	hg19	CCDS5974.1	.	.	.	.	.	.	.	.	.	.	A	18.20	3.570510	0.65765	.	.	ENSG00000173273	ENST00000520408;ENST00000310430;ENST00000518281	T;T;T	0.62639	0.01;0.01;0.01	5.83	5.83	0.93111	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.77025	0.4070	M	0.69358	2.11	0.80722	D	1	D;P	0.71674	0.998;0.956	D;P	0.71184	0.972;0.809	T	0.77130	-0.2701	10	0.45353	T	0.12	.	16.1967	0.82036	1.0:0.0:0.0:0.0	.	348;348	E7EWY6;O95271	.;TNKS1_HUMAN	V	348;348;111	ENSP00000428299:E348V;ENSP00000311579:E348V;ENSP00000429890:E111V	ENSP00000311579:E348V	E	+	2	0	TNKS	9575656	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.483000	0.90442	2.217000	0.71921	0.477000	0.44152	GAA	.	.		0.303	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206935.1	NM_003747	
GATA4	2626	hgsc.bcm.edu	37	8	11615852	11615852	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:11615852C>T	ENST00000335135.4	+	7	1755	c.1197C>T	c.(1195-1197)gtC>gtT	p.V399V	GATA4_ENST00000532059.1_Silent_p.V400V|GATA4_ENST00000528712.1_Silent_p.V193V	NM_002052.3	NP_002043.2	P43694	GATA4_HUMAN	GATA binding protein 4	399					atrial septum morphogenesis (GO:0060413)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle morphogenesis (GO:0003208)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion development (GO:0003197)|endoderm development (GO:0007492)|endoderm formation (GO:0001706)|epithelial cell fate commitment (GO:0072148)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|lung lobe formation (GO:0060464)|male gonad development (GO:0008584)|negative regulation of autophagy (GO:0010507)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to mechanical stimulus (GO:0009612)|seminiferous tubule development (GO:0072520)|Sertoli cell differentiation (GO:0060008)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(10)	13	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		TCCACCCTGTCCTCTCGGCCC	0.602																																					p.V399V		Atlas-SNP	.											.	GATA4	29	.	0			c.C1197T						.						154.0	134.0	141.0					8																	11615852		2203	4300	6503	SO:0001819	synonymous_variant	2626	exon7			CCCTGTCCTCTCG	AK097060	CCDS5983.1	8p23.1-p22	2013-01-25	2001-11-28		ENSG00000136574	ENSG00000136574		"""GATA zinc finger domain containing"""	4173	protein-coding gene	gene with protein product		600576	"""GATA-binding protein 4"""			7665171	Standard	NM_002052		Approved		uc003wuc.2	P43694	OTTHUMG00000090800	ENST00000335135.4:c.1197C>T	chr8.hg19:g.11615852C>T		43.0	0.0		40.0	15.0	NM_002052	B7ZKX0|B7ZKZ4|Q3MJ45|Q5IFM8	Silent	SNP	ENST00000335135.4	hg19	CCDS5983.1																																																																																			.	.		0.602	GATA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207587.2	NM_002052	
ADAM18	8749	hgsc.bcm.edu	37	8	39505913	39505913	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:39505913G>C	ENST00000265707.5	+	12	1142	c.1097G>C	c.(1096-1098)aGa>aCa	p.R366T	ADAM18_ENST00000541111.1_Intron|ADAM18_ENST00000379866.1_Missense_Mutation_p.R342T	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	366	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			CACGACTATAGATATTTTGTT	0.348																																					p.R366T		Atlas-SNP	.											.	ADAM18	169	.	0			c.G1097C						.						62.0	63.0	63.0					8																	39505913		2203	4300	6503	SO:0001583	missense	8749	exon12			ACTATAGATATTT	AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.1097G>C	chr8.hg19:g.39505913G>C	ENSP00000265707:p.Arg366Thr	146.0	0.0		163.0	12.0	NM_014237	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Missense_Mutation	SNP	ENST00000265707.5	hg19	CCDS6113.1	.	.	.	.	.	.	.	.	.	.	G	5.674	0.308908	0.10733	.	.	ENSG00000168619	ENST00000265707;ENST00000379866;ENST00000522198	T;T	0.63580	-0.05;-0.05	5.4	-5.51	0.02568	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.930373	0.08987	N	0.864945	T	0.43831	0.1265	L	0.52364	1.645	0.09310	N	1	B;B	0.14805	0.009;0.011	B;B	0.18263	0.012;0.021	T	0.34527	-0.9825	10	0.22109	T	0.4	.	0.9863	0.01447	0.3381:0.3169:0.1508:0.1942	.	342;366	Q9Y3Q7-2;Q9Y3Q7	.;ADA18_HUMAN	T	366;342;298	ENSP00000265707:R366T;ENSP00000369195:R342T	ENSP00000265707:R366T	R	+	2	0	ADAM18	39625070	0.002000	0.14202	0.000000	0.03702	0.034000	0.12701	-0.404000	0.07205	-0.904000	0.03876	0.585000	0.79938	AGA	.	.		0.348	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376916.1	NM_014237	
ZFHX4	79776	hgsc.bcm.edu	37	8	77768145	77768145	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr8:77768145G>A	ENST00000521891.2	+	10	9436	c.8988G>A	c.(8986-8988)atG>atA	p.M2996I	ZFHX4_ENST00000455469.2_Missense_Mutation_p.M2951I|ZFHX4_ENST00000518282.1_Missense_Mutation_p.M2970I|ZFHX4_ENST00000050961.6_Missense_Mutation_p.M2951I	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2951					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGCCTTTCATGATCAATCAAG	0.473										HNSCC(33;0.089)																											p.M2996I		Atlas-SNP	.											.	ZFHX4	878	.	0			c.G8988A						.						45.0	44.0	44.0					8																	77768145		1909	4123	6032	SO:0001583	missense	79776	exon10			TTTCATGATCAAT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8988G>A	chr8.hg19:g.77768145G>A	ENSP00000430497:p.Met2996Ile	55.0	0.0		52.0	20.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830677	0.32329	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.48201	0.82;0.87;0.84;0.83	5.17	5.17	0.71159	.	0.000000	0.53938	U	0.000049	T	0.54967	0.1891	N	0.24115	0.695	0.54753	D	0.999981	P;P;P	0.51653	0.913;0.947;0.947	P;P;D	0.68192	0.746;0.871;0.956	T	0.47736	-0.9094	10	0.24483	T	0.36	.	18.8517	0.92235	0.0:0.0:1.0:0.0	.	2951;2951;2996	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	I	2996;2980;2951;2951;2970	ENSP00000430497:M2996I;ENSP00000399605:M2951I;ENSP00000050961:M2951I;ENSP00000430848:M2970I	ENSP00000050961:M2951I	M	+	3	0	ZFHX4	77930700	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	7.665000	0.83852	2.687000	0.91594	0.643000	0.83706	ATG	.	.		0.473	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
INSL4	3641	hgsc.bcm.edu	37	9	5231621	5231621	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:5231621C>A	ENST00000239316.4	+	1	203	c.98C>A	c.(97-99)cCc>cAc	p.P33H		NM_002195.1	NP_002186.1	Q14641	INSL4_HUMAN	insulin-like 4 (placenta)	33					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|female pregnancy (GO:0007565)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	insulin-like growth factor receptor binding (GO:0005159)|receptor binding (GO:0005102)			endometrium(2)|lung(2)|skin(1)|urinary_tract(1)	6	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.14)		GGATGTGGTCCCCGATTTGGA	0.562																																					p.P33H		Atlas-SNP	.											.	INSL4	20	.	0			c.C98A						.						96.0	84.0	88.0					9																	5231621		2203	4300	6503	SO:0001583	missense	3641	exon1			GTGGTCCCCGATT		CCDS6459.1	9p24	2008-02-05			ENSG00000120211	ENSG00000120211			6087	protein-coding gene	gene with protein product		600910				8666396, 9730618	Standard	NM_002195		Approved	EPIL	uc003ziy.3	Q14641	OTTHUMG00000019494	ENST00000239316.4:c.98C>A	chr9.hg19:g.5231621C>A	ENSP00000239316:p.Pro33His	55.0	0.0		48.0	11.0	NM_002195	A8K678|Q5W127	Missense_Mutation	SNP	ENST00000239316.4	hg19	CCDS6459.1	.	.	.	.	.	.	.	.	.	.	C	5.242	0.230205	0.09969	.	.	ENSG00000120211	ENST00000239316	D	0.84516	-1.86	1.8	-3.59	0.04583	.	0.850582	0.08754	U	0.898665	T	0.65080	0.2657	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.47686	-0.9098	10	0.59425	D	0.04	.	2.6307	0.04943	0.4657:0.2892:0.0:0.245	.	33	Q14641	INSL4_HUMAN	H	33	ENSP00000239316:P33H	ENSP00000239316:P33H	P	+	2	0	INSL4	5221621	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.654000	0.00855	-1.510000	0.01796	0.205000	0.17691	CCC	.	.		0.562	INSL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051616.2	NM_002195	
DNAJB5	25822	hgsc.bcm.edu	37	9	34993331	34993331	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:34993331A>C	ENST00000541010.1	+	1	3113	c.101A>C	c.(100-102)gAc>gCc	p.D34A	DNAJB5_ENST00000335998.3_Missense_Mutation_p.D68A|DNAJB5_ENST00000312316.5_Missense_Mutation_p.D34A|DNAJB5_ENST00000545841.1_Missense_Mutation_p.D34A|DNAJB5_ENST00000453597.3_Missense_Mutation_p.D148A|DNAJB5_ENST00000454002.2_Missense_Mutation_p.D106A			O75953	DNJB5_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 5	34	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)			kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(32;0.00575)			TACCACCCAGACAAGAATAAA	0.478																																					p.D148A		Atlas-SNP	.											.	DNAJB5	69	.	0			c.A443C						.						140.0	138.0	139.0					9																	34993331		2203	4300	6503	SO:0001583	missense	25822	exon3			ACCCAGACAAGAA	AF088982	CCDS35007.1, CCDS47959.1, CCDS47960.1, CCDS47960.2	9p	2011-09-02			ENSG00000137094	ENSG00000137094		"""Heat shock proteins / DNAJ (HSP40)"""	14887	protein-coding gene	gene with protein product		611328				10570961, 11147971	Standard	NM_001135004		Approved	Hsc40	uc003zvs.4	O75953	OTTHUMG00000019840	ENST00000541010.1:c.101A>C	chr9.hg19:g.34993331A>C	ENSP00000443151:p.Asp34Ala	46.0	0.0		43.0	16.0	NM_001135004	B3KN14|B4DSA6|J3KQM9|J3KR08|Q5T656|Q8TDR7|Q96EM4	Missense_Mutation	SNP	ENST00000541010.1	hg19	CCDS35007.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.118223	0.77323	.	.	ENSG00000137094	ENST00000453597;ENST00000335998;ENST00000378751;ENST00000312316;ENST00000541010;ENST00000454002;ENST00000545841;ENST00000539059;ENST00000443266	D;D;D;D;D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86;-2.86;-2.86;-2.86;-2.86	5.31	5.31	0.75309	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	D	0.96796	0.8954	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97952	1.0332	10	0.87932	D	0	.	14.5924	0.68378	1.0:0.0:0.0:0.0	.	106;34	B4DSA6;O75953	.;DNJB5_HUMAN	A	148;68;34;34;34;106;34;70;34	ENSP00000404079:D148A;ENSP00000337626:D68A;ENSP00000312517:D34A;ENSP00000443151:D34A;ENSP00000413684:D106A;ENSP00000441999:D34A;ENSP00000445536:D70A;ENSP00000396332:D34A	ENSP00000312517:D34A	D	+	2	0	DNAJB5	34983331	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.761000	0.91691	2.234000	0.73211	0.459000	0.35465	GAC	.	.		0.478	DNAJB5-008	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401397.1		
TLE4	7091	hgsc.bcm.edu	37	9	82267541	82267541	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:82267541C>A	ENST00000376552.2	+	7	1442	c.424C>A	c.(424-426)Cat>Aat	p.H142N	TLE4_ENST00000265284.6_Missense_Mutation_p.H117N|TLE4_ENST00000376537.4_Missense_Mutation_p.H142N|TLE4_ENST00000376544.3_Missense_Mutation_p.H142N|TLE4_ENST00000376520.4_Missense_Mutation_p.H142N|TLE4_ENST00000376534.4_De_novo_Start_InFrame|TLE4_ENST00000455913.1_3'UTR	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	142	Gly/Pro-rich (GP domain).				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						ATCACATGGACATGGTCTCCC	0.552																																					p.H142N		Atlas-SNP	.											.	TLE4	187	.	0			c.C424A						.						110.0	119.0	116.0					9																	82267541		2057	4188	6245	SO:0001583	missense	7091	exon7			CATGGACATGGTC	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.424C>A	chr9.hg19:g.82267541C>A	ENSP00000365735:p.His142Asn	88.0	0.0		69.0	16.0	NM_007005	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	hg19	CCDS43837.1	.	.	.	.	.	.	.	.	.	.	C	18.83	3.707990	0.68615	.	.	ENSG00000106829	ENST00000376552;ENST00000376544;ENST00000376520;ENST00000399288;ENST00000435650;ENST00000414465;ENST00000376537;ENST00000265284;ENST00000425506;ENST00000428713;ENST00000490347	T;T;T;T;T;T;T;T;T	0.52057	0.7;0.68;0.74;0.85;0.73;0.82;0.8;1.35;1.62	6.17	6.17	0.99709	.	0.096408	0.64402	D	0.000001	T	0.61022	0.2314	M	0.78049	2.395	0.80722	D	1	P;B;B;B	0.40875	0.731;0.027;0.38;0.059	P;B;B;B	0.44860	0.462;0.015;0.197;0.038	T	0.61053	-0.7140	10	0.52906	T	0.07	-20.9074	20.8794	0.99867	0.0:1.0:0.0:0.0	.	117;142;142;142	F8W6T6;Q04727-2;Q04727-3;Q04727	.;.;.;TLE4_HUMAN	N	142;142;142;156;156;128;142;117;140;127;12	ENSP00000365735:H142N;ENSP00000365727:H142N;ENSP00000365703:H142N;ENSP00000415423:H156N;ENSP00000365720:H142N;ENSP00000265284:H117N;ENSP00000412567:H140N;ENSP00000409313:H127N;ENSP00000417844:H12N	ENSP00000265284:H117N	H	+	1	0	TLE4	81457361	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.155000	0.77445	2.941000	0.99782	0.655000	0.94253	CAT	.	.		0.552	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
ZCCHC6	79670	hgsc.bcm.edu	37	9	88967620	88967620	+	Silent	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:88967620C>A	ENST00000375963.3	-	2	667	c.495G>T	c.(493-495)acG>acT	p.T165T	ZCCHC6_ENST00000375960.2_Silent_p.T165T|ZCCHC6_ENST00000375961.2_Silent_p.T165T|ZCCHC6_ENST00000375947.1_5'UTR|ZCCHC6_ENST00000277141.6_5'UTR	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	165					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						CCATTTCTGACGTGGTTTCTA	0.403																																					p.T165T		Atlas-SNP	.											.	ZCCHC6	105	.	0			c.G495T						.						155.0	157.0	156.0					9																	88967620		2203	4300	6503	SO:0001819	synonymous_variant	79670	exon2			TTCTGACGTGGTT	AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.495G>T	chr9.hg19:g.88967620C>A		201.0	0.0		140.0	37.0	NM_024617	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Silent	SNP	ENST00000375963.3	hg19	CCDS35057.1																																																																																			.	.		0.403	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052918.1	NM_024617	
SPATA31C2	645961	hgsc.bcm.edu	37	9	90746827	90746827	+	IGR	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:90746827A>G								U6 (133577 upstream) : U3 (242356 downstream)																							AAGCTACTCCAGTGTTCTTCA	0.512																																					p.T375T		Atlas-SNP	.											.	.	.	.	0			c.T1125C						.						10.0	10.0	10.0					9																	90746827		686	1582	2268	SO:0001628	intergenic_variant	645961	exon4			TACTCCAGTGTTC																													chr9.hg19:g.90746827A>G		87.0	0.0		73.0	38.0	NM_001166137		Silent	SNP		hg19																																																																																				.	.	0	0.512								
TSTD2	158427	hgsc.bcm.edu	37	9	100365038	100365038	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:100365038A>G	ENST00000341170.4	-	10	1646	c.1264T>C	c.(1264-1266)Tgt>Cgt	p.C422R		NM_139246.4	NP_640339.4	Q5T7W7	TSTD2_HUMAN	thiosulfate sulfurtransferase (rhodanese)-like domain containing 2	422										large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	15						CGGGCTCCACAGTATGAACAC	0.517																																					p.C422R		Atlas-SNP	.											.	TSTD2	42	.	0			c.T1264C						.						57.0	57.0	57.0					9																	100365038		2203	4300	6503	SO:0001583	missense	158427	exon10			CTCCACAGTATGA	AF258575	CCDS6727.2	9q22.33	2013-09-20	2009-08-12	2009-08-12	ENSG00000136925	ENSG00000136925			30087	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 97"""	C9orf97		12477932	Standard	NM_139246		Approved	PP4189	uc004axn.3	Q5T7W7	OTTHUMG00000020328	ENST00000341170.4:c.1264T>C	chr9.hg19:g.100365038A>G	ENSP00000342499:p.Cys422Arg	91.0	0.0		63.0	26.0	NM_139246	A6NMJ4|A8K584|Q6ZQZ6|Q8IYM3|Q8WY73|Q96ML6|Q96MU1	Missense_Mutation	SNP	ENST00000341170.4	hg19	CCDS6727.2	.	.	.	.	.	.	.	.	.	.	A	22.6	4.307103	0.81247	.	.	ENSG00000136925	ENST00000375173;ENST00000375172;ENST00000341170	T;T	0.33654	1.4;1.4	5.75	5.75	0.90469	Rhodanese-like (2);	0.000000	0.85682	D	0.000000	T	0.68696	0.3029	M	0.93197	3.39	0.80722	D	1	D	0.76494	0.999	D	0.66196	0.942	T	0.77686	-0.2495	10	0.66056	D	0.02	-12.5258	16.0276	0.80553	1.0:0.0:0.0:0.0	.	422	Q5T7W7	TSTD2_HUMAN	R	18;196;422	ENSP00000364316:C18R;ENSP00000342499:C422R	ENSP00000342499:C422R	C	-	1	0	TSTD2	99404859	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	8.850000	0.92190	2.326000	0.78906	0.533000	0.62120	TGT	.	.		0.517	TSTD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053325.4	NM_139246	
COL5A1	1289	hgsc.bcm.edu	37	9	137630354	137630354	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:137630354G>A	ENST00000371817.3	+	10	1838	c.1424G>A	c.(1423-1425)gGc>gAc	p.G475D		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	475	Interrupted collagenous region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGCCCAGAAGGCCCCGCGGTG	0.632																																					p.G475D		Atlas-SNP	.											.	COL5A1	323	.	0			c.G1424A						.						44.0	47.0	46.0					9																	137630354		2203	4300	6503	SO:0001583	missense	1289	exon10			CAGAAGGCCCCGC	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1424G>A	chr9.hg19:g.137630354G>A	ENSP00000360882:p.Gly475Asp	37.0	0.0		40.0	26.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521900	0.44866	.	.	ENSG00000130635	ENST00000371817	D	0.99353	-5.77	4.69	4.69	0.59074	.	0.000000	0.85682	U	0.000000	D	0.99711	0.9889	H	0.99197	4.465	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.97007	0.9733	10	0.66056	D	0.02	.	16.3829	0.83481	0.0:0.0:1.0:0.0	.	475	P20908	CO5A1_HUMAN	D	475	ENSP00000360882:G475D	ENSP00000360882:G475D	G	+	2	0	COL5A1	136770175	1.000000	0.71417	0.999000	0.59377	0.201000	0.24016	5.554000	0.67294	2.166000	0.68216	0.491000	0.48974	GGC	.	.		0.632	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
NELFB	25920	hgsc.bcm.edu	37	9	140158810	140158810	+	Splice_Site	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr9:140158810G>T	ENST00000343053.4	+	6	1233		c.e6+1			NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											AGGTGCTGGGGTGAGGGTCGG	0.657																																					.		Atlas-SNP	.											.	.	.	.	0			c.896+1G>T						.						51.0	52.0	52.0					9																	140158810		2192	4296	6488	SO:0001630	splice_region_variant	25920	exon6			GCTGGGGTGAGGG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.896+1G>T	chr9.hg19:g.140158810G>T		22.0	0.0		30.0	19.0	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Splice_Site	SNP	ENST00000343053.4	hg19	CCDS7040.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153040	0.78001	.	.	ENSG00000188986	ENST00000343053	.	.	.	4.41	4.41	0.53225	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.902	0.79384	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COBRA1	139278631	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	9.611000	0.98342	2.134000	0.65973	0.313000	0.20887	.	.	.		0.657	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	Intron
DIP2C	22982	hgsc.bcm.edu	37	10	375432	375432	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:375432A>G	ENST00000280886.6	-	30	3781	c.3694T>C	c.(3694-3696)Tcc>Ccc	p.S1232P		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1232						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		ACGGAGTAGGAGCAAAACGTG	0.597																																					p.S1232P		Atlas-SNP	.											.	DIP2C	195	.	0			c.T3694C						.						64.0	54.0	58.0					10																	375432		2203	4300	6503	SO:0001583	missense	22982	exon30			AGTAGGAGCAAAA	BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3694T>C	chr10.hg19:g.375432A>G	ENSP00000280886:p.Ser1232Pro	30.0	0.0		16.0	7.0	NM_014974	B4DPI5|Q5SS78	Missense_Mutation	SNP	ENST00000280886.6	hg19	CCDS7054.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	34|34	5.409065|5.409065	0.96072|0.96072	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000434695|ENST00000280886;ENST00000535541;ENST00000381503	.|T	.|0.39997	.|1.05	5.84|5.84	5.84|5.84	0.93424|0.93424	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.44519|0.44519	0.1297|0.1297	L|L	0.33668|0.33668	1.02|1.02	0.80722|0.80722	D|D	1|1	.|P	.|0.41475	.|0.751	.|P	.|0.54060	.|0.741	T|T	0.21793|0.21793	-1.0235|-1.0235	5|10	.|0.02654	.|T	.|1	-29.0651|-29.0651	16.2141|16.2141	0.82191|0.82191	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1232	.|Q9Y2E4	.|DIP2C_HUMAN	P|P	37|1232;157;81	.|ENSP00000280886:S1232P	.|ENSP00000280886:S1232P	L|S	-|-	2|1	0|0	DIP2C|DIP2C	365432|365432	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.958000|0.958000	0.62258|0.62258	9.339000|9.339000	0.96797|0.96797	2.230000|2.230000	0.72887|0.72887	0.528000|0.528000	0.53228|0.53228	CTC|TCC	.	.		0.597	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046389.1	NM_014974	
TRDMT1	1787	hgsc.bcm.edu	37	10	17202313	17202313	+	Silent	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:17202313A>G	ENST00000377799.3	-	6	497	c.450T>C	c.(448-450)tcT>tcC	p.S150S	TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000351358.4_Silent_p.S104S|TRDMT1_ENST00000457442.2_Silent_p.S69S|TRDMT1_ENST00000377766.5_Missense_Mutation_p.S79P|TRDMT1_ENST00000488990.1_Intron|TRDMT1_ENST00000412821.3_Silent_p.S126S|TRDMT1_ENST00000358282.7_3'UTR	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	150	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	CAGAGGTTGGAGATAATAGAA	0.284																																					p.S150S		Atlas-SNP	.											.	TRDMT1	46	.	0			c.T450C						.						25.0	25.0	25.0					10																	17202313		2201	4289	6490	SO:0001819	synonymous_variant	1787	exon6			GGTTGGAGATAAT	AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.450T>C	chr10.hg19:g.17202313A>G		198.0	0.0		121.0	38.0	NM_004412	B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Silent	SNP	ENST00000377799.3	hg19	CCDS7114.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.63|15.63	2.889911|2.889911	0.52014|0.52014	.|.	.|.	ENSG00000107614|ENSG00000107614	ENST00000436968|ENST00000377766;ENST00000313936	.|T	.|0.44482	.|0.92	5.79|5.79	3.29|3.29	0.37713|0.37713	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.48892|0.48892	0.1525|0.1525	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49051|0.49051	-0.8979|-0.8979	4|7	.|0.72032	.|D	.|0.01	-23.1687|-23.1687	7.4582|7.4582	0.27278|0.27278	0.7095:0.1486:0.0:0.142|0.7095:0.1486:0.0:0.142	.|.	.|.	.|.	.|.	P|P	58|79;84	.|ENSP00000324263:S84P	.|ENSP00000324263:S84P	L|S	-|-	2|1	0|0	TRDMT1|TRDMT1	17242319|17242319	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	2.014000|2.014000	0.40951|0.40951	0.977000|0.977000	0.38444|0.38444	0.455000|0.455000	0.32223|0.32223	CTC|TCC	.	.		0.284	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047024.3	NM_004412	
FAM13C	220965	hgsc.bcm.edu	37	10	61028335	61028335	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:61028335A>G	ENST00000373868.2	-	8	1007	c.920T>C	c.(919-921)tTt>tCt	p.F307S	FAM13C_ENST00000468840.2_Missense_Mutation_p.F224S|FAM13C_ENST00000277705.6_Missense_Mutation_p.F328S|FAM13C_ENST00000419214.2_Missense_Mutation_p.F307S|FAM13C_ENST00000435852.2_Missense_Mutation_p.F307S|FAM13C_ENST00000442566.3_Missense_Mutation_p.F328S|FAM13C_ENST00000373867.3_Missense_Mutation_p.F224S|FAM13C_ENST00000422313.2_Missense_Mutation_p.F307S	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	307										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						TTCTTGTTCAAATTTTTCTTC	0.498																																					p.F307S		Atlas-SNP	.											.	FAM13C	124	.	0			c.T920C						.						89.0	89.0	89.0					10																	61028335		2203	4300	6503	SO:0001583	missense	220965	exon8			TGTTCAAATTTTT	U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.920T>C	chr10.hg19:g.61028335A>G	ENSP00000362975:p.Phe307Ser	92.0	0.0		66.0	13.0	NM_198215	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	ENST00000373868.2	hg19	CCDS7255.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.983183	0.93044	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-0.26;-1.02;-1.02;-1.02;-1.02	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.89174	0.6640	M	0.83483	2.645	0.50813	D	0.999891	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.998;0.999	D	0.90406	0.4406	10	0.87932	D	0	-15.8349	16.8222	0.85835	1.0:0.0:0.0:0.0	.	307;224;307;307;307	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	S	224;307;328;328;307;224;307;307;85	ENSP00000362974:F224S;ENSP00000362975:F307S;ENSP00000395661:F328S;ENSP00000277705:F328S;ENSP00000391993:F307S;ENSP00000423896:F224S;ENSP00000392302:F307S;ENSP00000400241:F307S;ENSP00000445068:F85S	ENSP00000277705:F328S	F	-	2	0	FAM13C	60698341	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.207000	0.89746	2.371000	0.80710	0.533000	0.62120	TTT	.	.		0.498	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048162.2		
SORCS1	114815	hgsc.bcm.edu	37	10	108459041	108459041	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:108459041G>A	ENST00000263054.6	-	9	1351	c.1344C>T	c.(1342-1344)ttC>ttT	p.F448F	SORCS1_ENST00000369698.1_5'UTR|SORCS1_ENST00000344440.6_Silent_p.F448F	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	448					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		AGGCCAGGGTGAAGTAGACAC	0.517																																					p.F448F		Atlas-SNP	.											.	SORCS1	534	.	0			c.C1344T						.						263.0	197.0	219.0					10																	108459041		2203	4300	6503	SO:0001819	synonymous_variant	114815	exon9			CAGGGTGAAGTAG	AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.1344C>T	chr10.hg19:g.108459041G>A		92.0	0.0		51.0	19.0	NM_001206572	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	ENST00000263054.6	hg19	CCDS7559.1																																																																																			.	.		0.517	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050232.4	NM_052918	
OR4C46	119749	hgsc.bcm.edu	37	11	51515655	51515655	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr11:51515655G>T	ENST00000328188.1	+	1	374	c.374G>T	c.(373-375)tGc>tTc	p.C125F		NM_001004703.1	NP_001004703.1	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C, member 46	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(5)|large_intestine(5)|lung(31)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	48						GTGGCCATCTGCAAGCCCTTG	0.483																																					p.C125F		Atlas-SNP	.											.	OR4C46	96	.	0			c.G374T						.						159.0	157.0	157.0					11																	51515655		2201	4296	6497	SO:0001583	missense	119749	exon1			CCATCTGCAAGCC		CCDS73288.1	11p11.12	2012-08-09			ENSG00000185926	ENSG00000185926		"""GPCR / Class A : Olfactory receptors"""	31271	protein-coding gene	gene with protein product		614273					Standard	NM_001004703		Approved		uc010ric.2	A6NHA9	OTTHUMG00000166705	ENST00000328188.1:c.374G>T	chr11.hg19:g.51515655G>T	ENSP00000329056:p.Cys125Phe	100.0	0.0		70.0	38.0	NM_001004703		Missense_Mutation	SNP	ENST00000328188.1	hg19	CCDS31498.1	.	.	.	.	.	.	.	.	.	.	.	10.61	1.398440	0.25205	.	.	ENSG00000185926	ENST00000328188	T	0.34472	1.36	2.63	1.69	0.24217	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49916	D	0.000127	T	0.68476	0.3005	H	0.98901	4.365	0.35436	D	0.79443	D	0.76494	0.999	D	0.63488	0.915	T	0.76677	-0.2871	10	0.87932	D	0	.	7.4418	0.27187	0.1419:0.0:0.8581:0.0	.	125	A6NHA9	O4C46_HUMAN	F	125	ENSP00000329056:C125F	ENSP00000329056:C125F	C	+	2	0	OR4C46	51372231	1.000000	0.71417	0.974000	0.42286	0.038000	0.13279	7.151000	0.77411	0.463000	0.27118	0.134000	0.15878	TGC	.	.		0.483	OR4C46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391155.1	NM_001004703	
PPFIBP1	8496	hgsc.bcm.edu	37	12	27787982	27787982	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:27787982A>T	ENST00000318304.8	+	4	487	c.204A>T	c.(202-204)gaA>gaT	p.E68D	PPFIBP1_ENST00000545334.1_Missense_Mutation_p.E68D|PPFIBP1_ENST00000537927.1_Intron|PPFIBP1_ENST00000542629.1_Missense_Mutation_p.E68D|PPFIBP1_ENST00000228425.6_Missense_Mutation_p.E68D|PPFIBP1_ENST00000535047.1_Missense_Mutation_p.E68D	NM_001198916.1|NM_177444.2	NP_001185845.1|NP_803193	Q86W92	LIPB1_HUMAN	PTPRF interacting protein, binding protein 1 (liprin beta 1)	68					cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)			PPFIBP1/ALK(3)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(13)|prostate(2)|skin(1)	32	Lung SC(9;0.0873)					ATGAGAAAGAAGGCTTGAGAT	0.463																																					p.E68D		Atlas-SNP	.											.	PPFIBP1	153	.	0			c.A204T						.						102.0	104.0	104.0					12																	27787982		2203	4300	6503	SO:0001583	missense	8496	exon4			GAAAGAAGGCTTG	AF034802	CCDS8713.1, CCDS55812.1, CCDS55813.1, CCDS55814.1	12p12.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9249	protein-coding gene	gene with protein product		603141				9624153, 11836260	Standard	NM_003622		Approved	L2, hSGT2, hSgt2p, SGT2	uc001ric.2	Q86W92		ENST00000318304.8:c.204A>T	chr12.hg19:g.27787982A>T	ENSP00000314724:p.Glu68Asp	78.0	0.0		91.0	33.0	NM_003622	O75336|Q86X70|Q9NY03|Q9ULJ0	Missense_Mutation	SNP	ENST00000318304.8	hg19	CCDS55812.1	.	.	.	.	.	.	.	.	.	.	A	10.05	1.245443	0.22796	.	.	ENSG00000110841	ENST00000543820;ENST00000545381;ENST00000545334;ENST00000318304;ENST00000535047;ENST00000542629;ENST00000228425;ENST00000535575;ENST00000542187	T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48	4.53	0.91	0.19337	.	0.000000	0.33005	U	0.005396	T	0.05686	0.0149	N	0.11064	0.09	0.35587	D	0.80678	B;B;B;B;B	0.21452	0.002;0.056;0.004;0.003;0.039	B;B;B;B;B	0.23574	0.005;0.027;0.012;0.006;0.047	T	0.38607	-0.9653	10	0.19147	T	0.46	-22.965	5.2389	0.15462	0.5106:0.1516:0.3378:0.0	.	68;68;68;68;68	Q86W92;Q86W92-2;Q86W92-4;Q86W92-5;F5H0E0	LIPB1_HUMAN;.;.;.;.	D	68;68;68;68;68;68;68;68;81	ENSP00000445822:E68D;ENSP00000314724:E68D;ENSP00000444046:E68D;ENSP00000443442:E68D;ENSP00000228425:E68D	ENSP00000228425:E68D	E	+	3	2	PPFIBP1	27679249	0.972000	0.33761	0.999000	0.59377	0.856000	0.48823	0.226000	0.17776	0.006000	0.14734	0.254000	0.18369	GAA	.	.		0.463	PPFIBP1-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000402877.1	NM_003622	
IPO8	10526	hgsc.bcm.edu	37	12	30816574	30816574	+	Silent	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:30816574A>C	ENST00000256079.4	-	14	1781	c.1443T>G	c.(1441-1443)ctT>ctG	p.L481L	IPO8_ENST00000544829.1_Silent_p.L276L	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	481					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TAAATGCATGAAGTACCCAGC	0.338																																					p.L481L		Atlas-SNP	.											.	IPO8	105	.	0			c.T1443G						.						76.0	73.0	74.0					12																	30816574		2203	4300	6503	SO:0001819	synonymous_variant	10526	exon14			TGCATGAAGTACC	U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.1443T>G	chr12.hg19:g.30816574A>C		22.0	0.0		28.0	13.0	NM_006390	B7Z7M3	Silent	SNP	ENST00000256079.4	hg19	CCDS8719.1																																																																																			.	.		0.338	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402700.2	NM_006390	
XPOT	11260	hgsc.bcm.edu	37	12	64814173	64814173	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:64814173C>A	ENST00000332707.5	+	8	1244	c.715C>A	c.(715-717)Cta>Ata	p.L239I		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	239	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		AATAGAAGTTCTACGGGAAGA	0.318																																					p.L239I		Atlas-SNP	.											.	XPOT	105	.	0			c.C715A						.						69.0	72.0	71.0					12																	64814173		2203	4298	6501	SO:0001583	missense	11260	exon8			GAAGTTCTACGGG	AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.715C>A	chr12.hg19:g.64814173C>A	ENSP00000327821:p.Leu239Ile	76.0	0.0		72.0	25.0	NM_007235	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	ENST00000332707.5	hg19	CCDS31852.1	.	.	.	.	.	.	.	.	.	.	C	33	5.226256	0.95173	.	.	ENSG00000184575	ENST00000332707	T	0.68765	-0.35	4.89	4.89	0.63831	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.135823	0.51477	D	0.000099	T	0.78641	0.4315	M	0.64404	1.975	0.80722	D	1	D	0.61080	0.989	P	0.62740	0.906	T	0.77624	-0.2518	9	.	.	.	.	18.9398	0.92601	0.0:1.0:0.0:0.0	.	239	O43592	XPOT_HUMAN	I	239	ENSP00000327821:L239I	.	L	+	1	2	XPOT	63100440	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.657000	0.83745	2.649000	0.89929	0.655000	0.94253	CTA	.	.		0.318	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401122.1	NM_007235	
SLC6A15	55117	hgsc.bcm.edu	37	12	85277689	85277689	+	Silent	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:85277689G>T	ENST00000266682.5	-	5	1246	c.705C>A	c.(703-705)gcC>gcA	p.A235A	SLC6A15_ENST00000450363.3_Silent_p.A235A|SLC6A15_ENST00000552192.1_Silent_p.A128A|SLC6A15_ENST00000551388.1_Intron	NM_182767.5	NP_877499.1	Q9H2J7	S6A15_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 15	235					amino acid transport (GO:0006865)|ion transport (GO:0006811)|leucine transport (GO:0015820)|neurotransmitter transport (GO:0006836)|neutral amino acid transport (GO:0015804)|proline transport (GO:0015824)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter transporter activity (GO:0005326)|neurotransmitter:sodium symporter activity (GO:0005328)|proline:sodium symporter activity (GO:0005298)			kidney(1)|large_intestine(18)|lung(15)|ovary(1)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	44						CCATGACCCAGGCAGCCAACA	0.443																																					p.A235A		Atlas-SNP	.											.	SLC6A15	159	.	0			c.C705A						.						82.0	73.0	76.0					12																	85277689		2203	4300	6503	SO:0001819	synonymous_variant	55117	exon5			GACCCAGGCAGCC	AF265577	CCDS9026.1, CCDS9027.1, CCDS53816.1	12q21.31	2013-07-15	2008-09-02		ENSG00000072041	ENSG00000072041		"""Solute carriers"""	13621	protein-coding gene	gene with protein product	"""homolog of rat orphan transporter v7-3"", ""sodium/chloride dependent neurotransmitter transporter Homo sapiens orphan neurotransmitter transporter NTT7"""	607971	"""solute carrier family 6 (neurotransmitter transporter), member 15"""			10471414, 11112352, 16185194	Standard	NM_182767		Approved	hv7-3, NTT73, FLJ10316, V7-3, SBAT1	uc001szv.4	Q9H2J7	OTTHUMG00000169742	ENST00000266682.5:c.705C>A	chr12.hg19:g.85277689G>T		60.0	0.0		48.0	21.0	NM_018057	A8K592|B7Z2P7|E7ESJ5|Q9H9F5	Silent	SNP	ENST00000266682.5	hg19	CCDS9026.1																																																																																			.	.		0.443	SLC6A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405678.1	NM_018057, NM_182767	
ACTR6	64431	hgsc.bcm.edu	37	12	100594687	100594687	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:100594687G>A	ENST00000188312.2	+	1	823	c.58G>A	c.(58-60)Gaa>Aaa	p.E20K	ACTR6_ENST00000550813.1_3'UTR|ACTR6_ENST00000552376.1_Missense_Mutation_p.E20K|ACTR6_ENST00000551617.1_5'UTR|ACTR6_ENST00000546902.1_5'UTR	NM_022496.4	NP_071941.1	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog (yeast)	20						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14						TTACAGCCATGAAAATGTGTC	0.463																																					p.E20K		Atlas-SNP	.											.	ACTR6	29	.	0			c.G58A						.						238.0	193.0	208.0					12																	100594687		2203	4300	6503	SO:0001583	missense	64431	exon1			AGCCATGAAAATG	AF212251	CCDS9074.1	12q23.1	2012-07-09			ENSG00000075089	ENSG00000075089			24025	protein-coding gene	gene with protein product						11368909	Standard	NM_022496		Approved	ARP6, FLJ13433	uc001thb.2	Q9GZN1	OTTHUMG00000170245	ENST00000188312.2:c.58G>A	chr12.hg19:g.100594687G>A	ENSP00000188312:p.Glu20Lys	43.0	0.0		43.0	11.0	NM_022496	B3KW37|B4DLG9|Q53GH2|Q9BY39|Q9H8H6	Missense_Mutation	SNP	ENST00000188312.2	hg19	CCDS9074.1	.	.	.	.	.	.	.	.	.	.	G	15.10	2.732152	0.48939	.	.	ENSG00000075089	ENST00000188312;ENST00000552376	D;D	0.96104	-3.91;-3.91	5.5	4.6	0.57074	.	0.251983	0.45126	D	0.000385	D	0.95121	0.8419	M	0.79011	2.435	0.80722	D	1	P;B;B	0.35242	0.492;0.098;0.119	B;B;B	0.38225	0.268;0.107;0.171	D	0.95250	0.8359	10	0.87932	D	0	.	14.4601	0.67442	0.0722:0.0:0.9278:0.0	.	20;20;20	B4DLG9;F8W057;Q9GZN1	.;.;ARP6_HUMAN	K	20	ENSP00000188312:E20K;ENSP00000447237:E20K	ENSP00000188312:E20K	E	+	1	0	ACTR6	99118818	1.000000	0.71417	0.996000	0.52242	0.301000	0.27625	4.773000	0.62331	2.854000	0.98071	0.655000	0.94253	GAA	.	.		0.463	ACTR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408159.1	NM_022496	
SH2B3	10019	hgsc.bcm.edu	37	12	111885820	111885820	+	Missense_Mutation	SNP	T	T	C	rs537932422	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:111885820T>C	ENST00000341259.2	+	8	1799	c.1442T>C	c.(1441-1443)cTt>cCt	p.L481P	SH2B3_ENST00000538307.1_Missense_Mutation_p.L279P	NM_005475.2	NP_005466.1	Q9UQQ2	SH2B3_HUMAN	SH2B adaptor protein 3	481					blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|embryonic hemopoiesis (GO:0035162)|intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)	phosphate ion binding (GO:0042301)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	10					Pazopanib(DB06589)	CCTTTCTCCCTTCCTCACTGG	0.567																																					p.L481P		Atlas-SNP	.											.	SH2B3	62	.	0			c.T1442C						.						236.0	195.0	209.0					12																	111885820		2203	4300	6503	SO:0001583	missense	10019	exon8			TCTCCCTTCCTCA	AF055581	CCDS9153.1	12q24.12	2014-09-17				ENSG00000111252		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	29605	protein-coding gene	gene with protein product	"""lymphocyte adaptor protein"""	605093				10799879	Standard	NM_005475		Approved	LNK, IDDM20	uc001tse.3	Q9UQQ2		ENST00000341259.2:c.1442T>C	chr12.hg19:g.111885820T>C	ENSP00000345492:p.Leu481Pro	47.0	0.0		32.0	9.0	NM_005475	B9EGG5|O95184	Missense_Mutation	SNP	ENST00000341259.2	hg19	CCDS9153.1	.	.	.	.	.	.	.	.	.	.	T	9.555	1.116826	0.20795	.	.	ENSG00000111252	ENST00000341259;ENST00000551001;ENST00000538307	T;T	0.35421	1.32;1.31	4.96	4.96	0.65561	.	0.312186	0.30347	N	0.009823	T	0.21145	0.0509	N	0.14661	0.345	0.80722	D	1	B;B;B	0.29612	0.023;0.017;0.251	B;B;B	0.21917	0.032;0.009;0.037	T	0.06826	-1.0805	10	0.42905	T	0.14	.	11.5822	0.50898	0.0:0.0:0.1491:0.8509	.	279;345;481	F5GYM4;Q59H48;Q9UQQ2	.;.;SH2B3_HUMAN	P	481;291;279	ENSP00000345492:L481P;ENSP00000440597:L279P	ENSP00000345492:L481P	L	+	2	0	SH2B3	110370203	0.886000	0.30341	0.953000	0.39169	0.567000	0.35839	3.418000	0.52721	2.002000	0.58637	0.379000	0.24179	CTT	.	.		0.567	SH2B3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000404779.1	NM_005475	
TMEM132B	114795	hgsc.bcm.edu	37	12	125834213	125834213	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:125834213C>T	ENST00000299308.3	+	2	276	c.268C>T	c.(268-270)Cca>Tca	p.P90S	TMEM132B_ENST00000418253.2_3'UTR	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	90						integral component of membrane (GO:0016021)				NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		CAGCTATGGCCCATTTTCAGT	0.498																																					p.P90S		Atlas-SNP	.											.	TMEM132B	207	.	0			c.C268T						.						107.0	105.0	106.0					12																	125834213		1872	4105	5977	SO:0001583	missense	114795	exon2			TATGGCCCATTTT	AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.268C>T	chr12.hg19:g.125834213C>T	ENSP00000299308:p.Pro90Ser	51.0	0.0		67.0	20.0	NM_052907	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	ENST00000299308.3	hg19	CCDS41859.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.288066	0.80803	.	.	ENSG00000139364	ENST00000299308	T	0.11495	2.77	5.41	5.41	0.78517	.	.	.	.	.	T	0.26122	0.0637	L	0.39245	1.2	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.00422	-1.1749	9	0.49607	T	0.09	.	19.1923	0.93672	0.0:1.0:0.0:0.0	.	90	Q14DG7	T132B_HUMAN	S	90	ENSP00000299308:P90S	ENSP00000299308:P90S	P	+	1	0	TMEM132B	124400166	0.998000	0.40836	0.975000	0.42487	0.910000	0.53928	3.491000	0.53252	2.514000	0.84764	0.591000	0.81541	CCA	.	.		0.498	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400043.1	NM_052907	
FREM2	341640	hgsc.bcm.edu	37	13	39263789	39263789	+	Missense_Mutation	SNP	G	G	T	rs7327915	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr13:39263789G>T	ENST00000280481.7	+	1	2524	c.2308G>T	c.(2308-2310)Gtg>Ttg	p.V770L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	770			V -> M (in dbSNP:rs7327915).		cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		CCCCTCAGTCGTGGTGACCCA	0.537																																					p.V770L		Atlas-SNP	.											.	FREM2	385	.	0			c.G2308T						.						84.0	87.0	86.0					13																	39263789		2203	4300	6503	SO:0001583	missense	341640	exon1			TCAGTCGTGGTGA	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.2308G>T	chr13.hg19:g.39263789G>T	ENSP00000280481:p.Val770Leu	52.0	0.0		35.0	18.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	ENST00000280481.7	hg19	CCDS31960.1	.	.	.	.	.	.	.	.	.	.	G	7.127	0.579210	0.13686	.	.	ENSG00000150893	ENST00000280481	T	0.41400	1.0	5.8	1.81	0.25067	.	0.599178	0.17790	N	0.161915	T	0.28433	0.0703	L	0.34521	1.04	0.80722	P	0.0	B	0.10296	0.003	B	0.09377	0.004	T	0.25117	-1.0141	9	0.28530	T	0.3	.	8.671	0.34149	0.1301:0.2312:0.6386:0.0	.	770	Q5SZK8	FREM2_HUMAN	L	770	ENSP00000280481:V770L	ENSP00000280481:V770L	V	+	1	0	FREM2	38161789	0.018000	0.18449	0.310000	0.25168	0.901000	0.52897	1.470000	0.35354	0.330000	0.23485	0.655000	0.94253	GTG	.	G|0.960;A|0.040		0.537	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
DYNC1H1	1778	hgsc.bcm.edu	37	14	102446826	102446826	+	Silent	SNP	T	T	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr14:102446826T>G	ENST00000360184.4	+	5	1064	c.900T>G	c.(898-900)acT>acG	p.T300T		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	300	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TTCTCCTGACTCTGGATATCT	0.448																																					p.T300T		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.T900G						.						72.0	73.0	72.0					14																	102446826		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon5			CCTGACTCTGGAT	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.900T>G	chr14.hg19:g.102446826T>G		50.0	0.0		28.0	11.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	hg19	CCDS9966.1																																																																																			.	.		0.448	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
PLD4	122618	hgsc.bcm.edu	37	14	105398614	105398614	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr14:105398614G>T	ENST00000392593.4	+	10	1411	c.1243G>T	c.(1243-1245)Gtg>Ttg	p.V415L	PLD4_ENST00000553861.1_5'UTR|PLD4_ENST00000540372.1_Missense_Mutation_p.V422L	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	415					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			CATCGTGCCGGTGGGGAACCA	0.627																																					p.V415L		Atlas-SNP	.											.	PLD4	46	.	0			c.G1243T						.						47.0	53.0	51.0					14																	105398614		2100	4218	6318	SO:0001583	missense	122618	exon10			GTGCCGGTGGGGA		CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.1243G>T	chr14.hg19:g.105398614G>T	ENSP00000376372:p.Val415Leu	39.0	0.0		34.0	13.0	NM_138790	Q6UWD2	Missense_Mutation	SNP	ENST00000392593.4	hg19	CCDS9995.2	.	.	.	.	.	.	.	.	.	.	G	12.87	2.067649	0.36470	.	.	ENSG00000166428	ENST00000540372;ENST00000392593	T;T	0.22945	1.93;1.93	4.51	2.67	0.31697	.	0.085365	0.47093	D	0.000245	T	0.24198	0.0586	M	0.64404	1.975	0.80722	D	1	B;B	0.20988	0.044;0.05	B;B	0.24974	0.034;0.057	T	0.05209	-1.0899	10	0.37606	T	0.19	-18.6312	7.1021	0.25343	0.3452:0.0:0.6548:0.0	.	422;415	F5H2B5;Q96BZ4	.;PLD4_HUMAN	L	422;415	ENSP00000438677:V422L;ENSP00000376372:V415L	ENSP00000376372:V415L	V	+	1	0	PLD4	104469659	0.746000	0.28272	0.927000	0.36925	0.678000	0.39670	2.109000	0.41863	0.908000	0.36671	0.550000	0.68814	GTG	.	.		0.627	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000291348.2	NM_138790	
RYR3	6263	hgsc.bcm.edu	37	15	33895514	33895514	+	Missense_Mutation	SNP	G	G	T	rs552872767		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr15:33895514G>T	ENST00000389232.4	+	18	2183	c.2113G>T	c.(2113-2115)Gtt>Ttt	p.V705F	RYR3_ENST00000415757.3_Missense_Mutation_p.V705F	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	705	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGGCAATGGTGTTGGTGACGA	0.532																																					p.V705F		Atlas-SNP	.											.	RYR3	760	.	0			c.G2113T						.						243.0	254.0	250.0					15																	33895514		2136	4245	6381	SO:0001583	missense	6263	exon18			AATGGTGTTGGTG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2113G>T	chr15.hg19:g.33895514G>T	ENSP00000373884:p.Val705Phe	100.0	0.0		41.0	29.0	NM_001243996	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996826	0.93167	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.62364	0.03;0.03	5.42	5.42	0.78866	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000001	D	0.83811	0.5335	M	0.90542	3.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.86455	0.1775	10	0.87932	D	0	.	19.4732	0.94971	0.0:0.0:1.0:0.0	.	705;705	Q15413-2;Q15413	.;RYR3_HUMAN	F	705	ENSP00000373884:V705F;ENSP00000399610:V705F	ENSP00000354735:V705F	V	+	1	0	RYR3	31682806	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.539000	0.98076	2.831000	0.97527	0.644000	0.83932	GTT	.	.		0.532	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
NGFR	4804	hgsc.bcm.edu	37	17	47587941	47587941	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:47587941G>C	ENST00000172229.3	+	4	861	c.736G>C	c.(736-738)Ggc>Cgc	p.G246R	NGFR_ENST00000504201.1_Missense_Mutation_p.G152R|RP5-1029K10.2_ENST00000514506.1_RNA	NM_002507.3	NP_002498.1	P08138	TNR16_HUMAN	nerve growth factor receptor	246	Ser/Thr-rich.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|detection of temperature stimulus (GO:0016048)|glucose homeostasis (GO:0042593)|hair follicle morphogenesis (GO:0031069)|intracellular protein transport (GO:0006886)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell cycle (GO:0045786)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of hair follicle development (GO:0051799)|nerve development (GO:0021675)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of axonogenesis (GO:0050772)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of odontogenesis of dentin-containing tooth (GO:0042488)|regulation of axonogenesis (GO:0050770)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cell surface (GO:0009986)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|neuronal postsynaptic density (GO:0097481)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	death receptor activity (GO:0005035)|Rab GTPase binding (GO:0017137)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)	17	all_cancers(4;1.45e-13)|Breast(4;6.34e-28)|all_epithelial(4;4.95e-17)					GGTGACCCGAGGCACCACCGA	0.607																																					p.G246R		Atlas-SNP	.											.	NGFR	46	.	0			c.G736C						.						109.0	99.0	102.0					17																	47587941		2203	4300	6503	SO:0001583	missense	4804	exon4			ACCCGAGGCACCA	M14764	CCDS11549.1	17q21-q22	2013-05-22	2010-04-28		ENSG00000064300	ENSG00000064300		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	7809	protein-coding gene	gene with protein product	"""low affinity nerve growth factor receptor"", ""TNFR superfamily, member 16"""	162010	"""nerve growth factor receptor (TNFR superfamily, member 16)"""			3022937, 3006050	Standard	NM_002507		Approved	TNFRSF16, CD271, p75NTR	uc002ioz.4	P08138	OTTHUMG00000161495	ENST00000172229.3:c.736G>C	chr17.hg19:g.47587941G>C	ENSP00000172229:p.Gly246Arg	33.0	0.0		30.0	15.0	NM_002507	B2R961|B4E096	Missense_Mutation	SNP	ENST00000172229.3	hg19	CCDS11549.1	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449678	0.43531	.	.	ENSG00000064300	ENST00000172229;ENST00000504201	D;D	0.91295	-2.74;-2.82	4.85	4.85	0.62838	.	0.168500	0.51477	D	0.000088	D	0.88328	0.6407	M	0.65975	2.015	0.34770	D	0.733639	P	0.38617	0.64	B	0.33121	0.158	D	0.91457	0.5186	10	0.33940	T	0.23	-48.9827	16.0977	0.81139	0.0:0.0:1.0:0.0	.	246	P08138	TNR16_HUMAN	R	246;152	ENSP00000172229:G246R;ENSP00000421731:G152R	ENSP00000172229:G246R	G	+	1	0	NGFR	44942940	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	8.372000	0.90127	2.397000	0.81536	0.650000	0.86243	GGC	.	.		0.607	NGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365150.1		
ABCA5	23461	hgsc.bcm.edu	37	17	67287403	67287403	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:67287403C>T	ENST00000392676.3	-	12	1624	c.1560G>A	c.(1558-1560)aaG>aaA	p.K520K	ABCA5_ENST00000588877.1_Silent_p.K520K|ABCA5_ENST00000392677.2_Silent_p.K520K			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	520	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TCAATGTACTCTTTCCTGTTC	0.333																																					p.K520K		Atlas-SNP	.											.	ABCA5	162	.	0			c.G1560A						.						94.0	91.0	92.0					17																	67287403		2203	4300	6503	SO:0001819	synonymous_variant	23461	exon11			TGTACTCTTTCCT	U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.1560G>A	chr17.hg19:g.67287403C>T		101.0	0.0		58.0	18.0	NM_018672	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Silent	SNP	ENST00000392676.3	hg19	CCDS11685.1																																																																																			.	.		0.333	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450654.1	NM_018672	
ITGB4	3691	hgsc.bcm.edu	37	17	73723340	73723340	+	Missense_Mutation	SNP	G	G	T	rs146966502	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:73723340G>T	ENST00000200181.3	+	3	332	c.145G>T	c.(145-147)Gcc>Tcc	p.A49S	ITGB4_ENST00000339591.3_Missense_Mutation_p.A49S|ITGB4_ENST00000579662.1_Missense_Mutation_p.A49S|ITGB4_ENST00000450894.3_Missense_Mutation_p.A49S|ITGB4_ENST00000449880.2_Missense_Mutation_p.A49S|ITGB4_ENST00000584558.1_3'UTR	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	49	PSI.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			TAAGGACTGCGCCTACTGCAC	0.602																																					p.A49S		Atlas-SNP	.											.	ITGB4	165	.	0			c.G145T						.						78.0	65.0	69.0					17																	73723340		2203	4300	6503	SO:0001583	missense	3691	exon3			GACTGCGCCTACT		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.145G>T	chr17.hg19:g.73723340G>T	ENSP00000200181:p.Ala49Ser	46.0	0.0		36.0	11.0	NM_001005731	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	ENST00000200181.3	hg19	CCDS11727.1	.	.	.	.	.	.	.	.	.	.	G	13.19	2.164637	0.38217	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	D;D;D	0.86497	-2.13;-2.13;-2.13	5.36	5.36	0.76844	Integrin beta subunit, N-terminal (2);	0.063342	0.64402	D	0.000007	D	0.86740	0.6005	L	0.52364	1.645	0.51012	D	0.999901	B;P;P;P	0.45768	0.247;0.651;0.866;0.866	B;B;P;P	0.49276	0.279;0.354;0.605;0.605	D	0.85406	0.1134	10	0.36615	T	0.2	.	12.2711	0.54706	0.0:0.0:0.7128:0.2872	.	49;49;49;49	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	S	49	ENSP00000200181:A49S;ENSP00000344079:A49S;ENSP00000400217:A49S	ENSP00000200181:A49S	A	+	1	0	ITGB4	71234935	1.000000	0.71417	0.995000	0.50966	0.881000	0.50899	4.928000	0.63447	2.505000	0.84491	0.655000	0.94253	GCC	.	A|0.000;G|1.000		0.602	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
SEPT9	10801	hgsc.bcm.edu	37	17	75303253	75303253	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:75303253G>C	ENST00000427177.1	+	2	176	c.50G>C	c.(49-51)cGg>cCg	p.R17P	SEPT9_ENST00000591198.1_Intron|SEPT9_ENST00000449803.2_5'UTR|SEPT9_ENST00000431235.2_5'UTR	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9	17					cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			GGCCGGCTCCGGAGGCTTGGT	0.622																																					p.R17P		Atlas-SNP	.											.	SEPT9	105	.	0			c.G50C						.						90.0	89.0	90.0					17																	75303253		1568	3582	5150	SO:0001583	missense	10801	exon2			GGCTCCGGAGGCT	AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.50G>C	chr17.hg19:g.75303253G>C	ENSP00000391249:p.Arg17Pro	42.0	0.0		33.0	17.0	NM_001113491	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	Missense_Mutation	SNP	ENST00000427177.1	hg19	CCDS45790.1	.	.	.	.	.	.	.	.	.	.	g	15.13	2.742457	0.49151	.	.	ENSG00000184640	ENST00000427177	T	0.37915	1.17	3.66	2.69	0.31865	.	.	.	.	.	T	0.28333	0.0700	N	0.08118	0	0.80722	D	1	D	0.67145	0.996	P	0.55455	0.776	T	0.12192	-1.0557	9	0.87932	D	0	.	7.1862	0.25801	0.1219:0.0:0.8781:0.0	.	17	Q9UHD8	SEPT9_HUMAN	P	17	ENSP00000391249:R17P	ENSP00000391249:R17P	R	+	2	0	SEPT9	72814848	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	4.328000	0.59253	1.132000	0.42129	-0.265000	0.10407	CGG	.	.		0.622	SEPT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000436304.2	NM_006640	
CBX4	8535	hgsc.bcm.edu	37	17	77808471	77808471	+	Missense_Mutation	SNP	G	G	A	rs138355116		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:77808471G>A	ENST00000269397.4	-	5	1147	c.970C>T	c.(970-972)Ccg>Tcg	p.P324S		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	324	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.P324S(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTCTTGGGCGGCGCCTCCACC	0.672											OREG0024799	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P324S		Atlas-SNP	.											CBX4,abdomen,malignant_melanoma,0,1	CBX4	40	.	1	Substitution - Missense(1)	skin(1)	c.C970T						.						26.0	26.0	26.0					17																	77808471		2202	4300	6502	SO:0001583	missense	8535	exon5			TGGGCGGCGCCTC	AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.970C>T	chr17.hg19:g.77808471G>A	ENSP00000269397:p.Pro324Ser	39.0	0.0	1178	27.0	11.0	NM_003655	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	ENST00000269397.4	hg19	CCDS32758.1	.	.	.	.	.	.	.	.	.	.	g	8.228	0.803951	0.16467	.	.	ENSG00000141582	ENST00000269397	.	.	.	3.67	1.54	0.23209	.	0.686289	0.10318	U	0.689154	T	0.26629	0.0651	L	0.44542	1.39	0.18873	N	0.999981	B	0.16802	0.019	B	0.14578	0.011	T	0.30995	-0.9959	9	0.10636	T	0.68	-24.3783	1.2937	0.02065	0.1348:0.1775:0.3268:0.361	.	324	O00257	CBX4_HUMAN	S	324	.	ENSP00000269397:P324S	P	-	1	0	CBX4	75423066	0.781000	0.28676	0.003000	0.11579	0.868000	0.49771	1.202000	0.32271	0.059000	0.16252	-0.851000	0.03033	CCG	.	.		0.672	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318007.1	NM_003655	
VAV1	7409	hgsc.bcm.edu	37	19	6833726	6833726	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:6833726C>A	ENST00000602142.1	+	18	1795	c.1713C>A	c.(1711-1713)ttC>ttA	p.F571L	VAV1_ENST00000304076.2_Missense_Mutation_p.F571L|VAV1_ENST00000599806.1_Missense_Mutation_p.F516L|VAV1_ENST00000596764.1_Missense_Mutation_p.F539L|VAV1_ENST00000539284.1_Missense_Mutation_p.F474L	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	571					apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCGTAGATTTCCCAGGAACTA	0.537																																					p.F571L		Atlas-SNP	.											.	VAV1	140	.	0			c.C1713A						.						141.0	140.0	140.0					19																	6833726		2203	4300	6503	SO:0001583	missense	7409	exon18			AGATTTCCCAGGA		CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.1713C>A	chr19.hg19:g.6833726C>A	ENSP00000472929:p.Phe571Leu	36.0	0.0		28.0	15.0	NM_005428	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	ENST00000602142.1	hg19	CCDS12174.1	.	.	.	.	.	.	.	.	.	.	C	3.188	-0.166388	0.06461	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.74209	0.16;-0.82	3.95	-0.242	0.13039	.	1.240100	0.05538	N	0.565122	T	0.50582	0.1624	N	0.08118	0	0.09310	N	0.999999	B;B;B;B	0.23249	0.082;0.002;0.049;0.0	B;B;B;B	0.18561	0.022;0.004;0.01;0.001	T	0.32107	-0.9919	10	0.11485	T	0.65	.	7.1926	0.25834	0.0:0.5028:0.0:0.4972	.	474;571;516;571	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	L	571;474	ENSP00000302269:F571L;ENSP00000443242:F474L	ENSP00000302269:F571L	F	+	3	2	VAV1	6784726	0.032000	0.19561	0.010000	0.14722	0.015000	0.08874	0.104000	0.15313	0.010000	0.14839	0.491000	0.48974	TTC	.	.		0.537	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458475.1		
RYR1	6261	hgsc.bcm.edu	37	19	38960151	38960151	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:38960151G>A	ENST00000359596.3	+	27	3763	c.3763G>A	c.(3763-3765)Gag>Aag	p.E1255K	RYR1_ENST00000360985.3_Missense_Mutation_p.E1255K|RYR1_ENST00000355481.4_Missense_Mutation_p.E1255K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1255	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CCCTCACTATGAGGTAAGGAC	0.532																																					p.E1255K		Atlas-SNP	.											RYR1,right_lower_lobe,carcinoma,0,1	RYR1	708	.	0			c.G3763A						.						80.0	73.0	75.0					19																	38960151		2203	4300	6503	SO:0001583	missense	6261	exon27			CACTATGAGGTAA	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.3763G>A	chr19.hg19:g.38960151G>A	ENSP00000352608:p.Glu1255Lys	29.0	0.0		19.0	13.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	g	12.97	2.096627	0.36952	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96885	-4.15;-4.16;-4.16	3.48	3.48	0.39840	.	0.000000	0.64402	U	0.000007	D	0.95414	0.8511	L	0.50333	1.59	0.51767	D	0.999937	D;P	0.59767	0.986;0.817	P;B	0.50405	0.64;0.164	D	0.94650	0.7838	10	0.39692	T	0.17	.	14.86	0.70372	0.0:0.0:1.0:0.0	.	1255;1255	P21817-2;P21817	.;RYR1_HUMAN	K	1255	ENSP00000352608:E1255K;ENSP00000347667:E1255K;ENSP00000354254:E1255K	ENSP00000347667:E1255K	E	+	1	0	RYR1	43651991	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	5.925000	0.70062	1.816000	0.52996	0.434000	0.28630	GAG	.	.		0.532	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
RPL18	6141	hgsc.bcm.edu	37	19	49121059	49121059	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:49121059G>T	ENST00000549920.1	-	2	471	c.79C>A	c.(79-81)Ctg>Atg	p.L27M	RPL18_ENST00000549273.1_Missense_Mutation_p.L27M|SPHK2_ENST00000340932.3_5'Flank|RPL18_ENST00000550645.1_Missense_Mutation_p.L27M|RPL18_ENST00000552588.1_Intron|SPHK2_ENST00000600537.1_5'Flank|FAM83E_ENST00000595110.1_5'Flank|AC022154.7_ENST00000598735.1_RNA|SPHK2_ENST00000601712.1_5'Flank|AC022154.7_ENST00000594850.1_RNA|AC022154.7_ENST00000600303.1_RNA|SPHK2_ENST00000245222.4_5'Flank|SPHK2_ENST00000598088.1_5'Flank	NM_000979.3	NP_000970.1	Q07020	RL18_HUMAN	ribosomal protein L18	27					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|kidney(2)	3		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.89e-05)|all cancers(93;0.00011)|GBM - Glioblastoma multiforme(486;0.0061)|Epithelial(262;0.0154)		TTGACCAACAGCCTCAGGTAG	0.587																																					p.L27M		Atlas-SNP	.											.	RPL18	9	.	0			c.C79A						.						103.0	79.0	87.0					19																	49121059		2203	4300	6503	SO:0001583	missense	6141	exon2			CCAACAGCCTCAG	L11566	CCDS12726.1, CCDS58669.1	19q13	2011-04-06				ENSG00000063177		"""L ribosomal proteins"""	10310	protein-coding gene	gene with protein product	"""60S ribosomal protein L18"""	604179				8218404	Standard	NM_000979		Approved	L18	uc002pjq.2	Q07020	OTTHUMG00000169760	ENST00000549920.1:c.79C>A	chr19.hg19:g.49121059G>T	ENSP00000447001:p.Leu27Met	46.0	0.0		42.0	27.0	NM_000979	F8VWC5|Q8WTZ6	Missense_Mutation	SNP	ENST00000549920.1	hg19	CCDS12726.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.772589|4.772589	0.90108|0.90108	.|.	.|.	ENSG00000063177|ENSG00000063177	ENST00000084795|ENST00000549920;ENST00000550645;ENST00000549273;ENST00000450952	.|.	.|.	.|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|Ribosomal protein L18e/L15P (2);	.|0.070269	.|0.64402	.|D	.|0.000018	D|D	0.85292|0.85292	0.5663|0.5663	M|M	0.91561|0.91561	3.22|3.22	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.989	.|D;D	.|0.85130	.|0.997;0.918	D|D	0.87980|0.87980	0.2742|0.2742	5|9	.|0.62326	.|D	.|0.03	-18.4838|-18.4838	16.506|16.506	0.84272|0.84272	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|27;27	.|B4DDY5;Q07020	.|.;RL18_HUMAN	D|M	28|27	.|.	.|ENSP00000407348:L27M	A|L	-|-	2|1	0|2	RPL18|RPL18	53812871|53812871	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.991000|0.991000	0.79684|0.79684	6.673000|6.673000	0.74482|0.74482	2.690000|2.690000	0.91761|0.91761	0.655000|0.655000	0.94253|0.94253	GCT|CTG	.	.		0.587	RPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405732.2	NM_000979	
ZNF28	7576	hgsc.bcm.edu	37	19	53303883	53303883	+	Silent	SNP	A	A	G			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:53303883A>G	ENST00000457749.2	-	4	1334	c.1215T>C	c.(1213-1215)caT>caC	p.H405H	ZNF28_ENST00000414252.2_Silent_p.H352H|ZNF28_ENST00000360272.4_Silent_p.H352H|ZNF28_ENST00000438150.2_Silent_p.H352H	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	405					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TCTCTCCAGTATGAATCCTCT	0.373																																					p.H405H		Atlas-SNP	.											.	ZNF28	191	.	0			c.T1215C						.						105.0	112.0	110.0					19																	53303883		2203	4300	6503	SO:0001819	synonymous_variant	7576	exon4			TCCAGTATGAATC	X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1215T>C	chr19.hg19:g.53303883A>G		52.0	0.0		46.0	30.0	NM_006969	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Silent	SNP	ENST00000457749.2	hg19	CCDS33093.2																																																																																			.	.		0.373	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336038.2	NM_006969	
LENG8	114823	hgsc.bcm.edu	37	19	54966690	54966690	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:54966690G>A	ENST00000326764.5	+	8	1448	c.969G>A	c.(967-969)gcG>gcA	p.A323A	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	286										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		TGCTGCAGGCGCGGCTGCAGG	0.632																																					p.A323A		Atlas-SNP	.											.	LENG8	73	.	0			c.G969A						.						40.0	44.0	43.0					19																	54966690		2203	4300	6503	SO:0001819	synonymous_variant	114823	exon8			GCAGGCGCGGCTG	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.969G>A	chr19.hg19:g.54966690G>A		25.0	0.0		22.0	8.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	ENST00000326764.5	hg19	CCDS12894.1																																																																																			.	.		0.632	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
ZSCAN5B	342933	hgsc.bcm.edu	37	19	56704398	56704398	+	Silent	SNP	T	T	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:56704398T>A	ENST00000586855.2	-	2	337	c.24A>T	c.(22-24)tcA>tcT	p.S8S	ZSCAN5B_ENST00000358992.3_Silent_p.S8S			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	8					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						CCTGACCCCATGAGAGTGTCC	0.502																																					p.S8S		Atlas-SNP	.											.	ZSCAN5B	160	.	0			c.A24T						.						33.0	28.0	30.0					19																	56704398		692	1591	2283	SO:0001819	synonymous_variant	342933	exon1			ACCCCATGAGAGT		CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.24A>T	chr19.hg19:g.56704398T>A		46.0	0.0		38.0	6.0	NM_001080456		Silent	SNP	ENST00000586855.2	hg19	CCDS46203.1																																																																																			.	.		0.502	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457834.2	NM_001080456	
ZNF582	147948	hgsc.bcm.edu	37	19	56896171	56896171	+	Silent	SNP	C	C	T			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:56896171C>T	ENST00000301310.4	-	5	773	c.615G>A	c.(613-615)ggG>ggA	p.G205G	ZNF582_ENST00000586929.1_Silent_p.G205G|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		TAAAGGCCTTCCCACATTCCT	0.338																																					p.G205G	Ovarian(183;1887 2032 4349 30507 51343)	Atlas-SNP	.											.	ZNF582	56	.	0			c.G615A						.						68.0	70.0	69.0					19																	56896171		2203	4300	6503	SO:0001819	synonymous_variant	147948	exon5			GGCCTTCCCACAT	AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.615G>A	chr19.hg19:g.56896171C>T		70.0	0.0		70.0	16.0	NM_144690	B4DQZ9|B7Z9R3|Q6PJT6	Silent	SNP	ENST00000301310.4	hg19	CCDS33121.1																																																																																			.	.		0.338	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458387.2	NM_144690	
TTLL12	23170	hgsc.bcm.edu	37	22	43575637	43575637	+	Silent	SNP	G	G	A			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr22:43575637G>A	ENST00000216129.6	-	5	891	c.828C>T	c.(826-828)gcC>gcT	p.A276A		NM_015140.3	NP_055955.1	Q14166	TTL12_HUMAN	tubulin tyrosine ligase-like family, member 12	276					cellular protein modification process (GO:0006464)					central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	13		Ovarian(80;0.221)|Glioma(61;0.222)				GGTAGTGCTCGGCGGGCGGCT	0.622																																					p.A276A		Atlas-SNP	.											.	TTLL12	50	.	0			c.C828T						.						54.0	58.0	57.0					22																	43575637		2203	4300	6503	SO:0001819	synonymous_variant	23170	exon5			GTGCTCGGCGGGC	D63487	CCDS14047.1	22q13.31	2013-02-14	2006-02-02		ENSG00000100304	ENSG00000100304		"""Tubulin tyrosine ligase-like family"""	28974	protein-coding gene	gene with protein product						15890843	Standard	NM_015140		Approved	KIAA0153	uc003bdp.3	Q14166	OTTHUMG00000150682	ENST00000216129.6:c.828C>T	chr22.hg19:g.43575637G>A		24.0	0.0		20.0	9.0	NM_015140	Q20WK5|Q9UGU3	Silent	SNP	ENST00000216129.6	hg19	CCDS14047.1																																																																																			.	.		0.622	TTLL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319611.1	NM_015140	
MT-ND3	4537	hgsc.bcm.edu	37	M	10086	10086	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chrM:10086A>C	ENST00000361227.2	+	1	28	c.28A>C	c.(28-30)Aac>Cac	p.N10H	MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank			P03897	NU3M_HUMAN	mitochondrially encoded NADH dehydrogenase 3	10			N -> D (in dbSNP:rs28358274). {ECO:0000269|PubMed:6343397}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)										TTTTAATAATCAACACCCTCC	0.348																																					p.N10H		Atlas-SNP	.											.	.	.	.	0			c.A28C						.																																			SO:0001583	missense	0	exon1			ATAATCAACACCC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198840	ENSG00000198840	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7458	protein-coding gene	gene with protein product	"""complex I ND3 subunit"", ""NADH-ubiquinone oxidoreductase chain 3"""	516002	"""NADH dehydrogenase 3"""	MTND3			Standard			Approved	ND3, NAD3		P03897		ENST00000361227.2:c.28A>C	chrM.hg19:g.10086A>C	ENSP00000355206:p.Asn10His	152.0	0.0		471.0	67.0	ENST00000361227		Missense_Mutation	SNP	ENST00000361227.2	hg19																																																																																				.	.		0.348	MT-ND3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024033	
SPHK1	8877	hgsc.bcm.edu	37	17	74382080	74382096	+	Frame_Shift_Del	DEL	GGCGTGCTCCCGCGGCC	GGCGTGCTCCCGCGGCC	-	rs373986019		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	GGCGTGCTCCCGCGGCC	GGCGTGCTCCCGCGGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:74382080_74382096delGGCGTGCTCCCGCGGCC	ENST00000545180.1	+	5	834_850	c.25_41delGGCGTGCTCCCGCGGCC	c.(25-42)ggcgtgctcccgcggcccfs	p.GVLPRP9fs	SPHK1_ENST00000592299.1_Frame_Shift_Del_p.GVLPRP9fs|SPHK1_ENST00000392496.3_Frame_Shift_Del_p.GVLPRP9fs|SPHK1_ENST00000590959.1_Frame_Shift_Del_p.GVLPRP23fs|SPHK1_ENST00000323374.4_Frame_Shift_Del_p.GVLPRP95fs			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	9					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	CGGCCCCCGGGGCGTGCTCCCGCGGCCCTGCCGCGTG	0.659											OREG0024750	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.94_100del	GBM(90;966 1307 27369 33775 44498)	Atlas-INDEL	.											.	SPHK1	24	.	0			c.282_298del						.																																			SO:0001589	frameshift_variant	8877	exon3			.	BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.25_41delGGCGTGCTCCCGCGGCC	chr17.hg19:g.74382080_74382096delGGCGTGCTCCCGCGGCC	ENSP00000440970:p.Gly9fs	32.0	0.0	1152	26.0	10.0	NM_182965	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Frame_Shift_Del	DEL	ENST00000545180.1	hg19	CCDS45785.1																																																																																			.	.		0.659	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450113.1	NM_182965, NM_021972	
SLCO1C1	53919	hgsc.bcm.edu	37	12	20893142	20893145	+	Frame_Shift_Del	DEL	GGAA	GGAA	-	rs558577357		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	GGAA	GGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr12:20893142_20893145delGGAA	ENST00000266509.2	+	12	1941_1944	c.1573_1576delGGAA	c.(1573-1578)ggaattfs	p.GI525fs	SLCO1C1_ENST00000381552.1_Frame_Shift_Del_p.GI525fs|SLCO1C1_ENST00000545102.1_Frame_Shift_Del_p.GI407fs|SLCO1C1_ENST00000545604.1_Frame_Shift_Del_p.GI525fs|SLCO1C1_ENST00000540354.1_Frame_Shift_Del_p.GI476fs	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	525	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	CACTTGTGTGGGAATTGCAGCTTC	0.343																																					p.524_525del		Atlas-Indel,Pindel	.											.	SLCO1C1	216	.	0			c.1572_1575del						.																																			SO:0001589	frameshift_variant	53919	exon12			.	AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1573_1576delGGAA	chr12.hg19:g.20893142_20893145delGGAA	ENSP00000266509:p.Gly525fs	99.0	0.0		77.0	28.0	NM_017435	B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Frame_Shift_Del	DEL	ENST00000266509.2	hg19	CCDS8683.1																																																																																			.	.		0.343	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401765.1	NM_017435	
TOB1	10140	hgsc.bcm.edu	37	17	48940660	48940661	+	Frame_Shift_Ins	INS	-	-	GC	rs372275994		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:48940660_48940661insGC	ENST00000268957.3	-	3	1146_1147	c.718_719insGC	c.(718-720)ccafs	p.P240fs	TOB1_ENST00000499247.2_Frame_Shift_Ins_p.P240fs|TOB1_ENST00000509385.1_5'Flank	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	240	Poly-Gln.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			ctgttgctgtggctgctgctgG	0.55																																					p.P240fs	NSCLC(144;643 1919 24513 29423 40686)	Atlas-INDEL	.											.	TOB1	40	.	0			c.719_720insGC						.																																			SO:0001589	frameshift_variant	10140	exon2			.	D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.717_718dupGC	chr17.hg19:g.48940661_48940662dupGC	ENSP00000268957:p.Pro240fs	36.0	0.0		29.0	10.0	NM_005749	B2R9T0|D3DTY3|Q4KMQ0	Frame_Shift_Ins	INS	ENST00000268957.3	hg19	CCDS11576.1																																																																																			.	.		0.550	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000368364.1		
SYNE2	23224	hgsc.bcm.edu	37	14	64593080	64593089	+	Frame_Shift_Del	DEL	TAAAAAATTG	TAAAAAATTG	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	TAAAAAATTG	TAAAAAATTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr14:64593080_64593089delTAAAAAATTG	ENST00000344113.4	+	72	13802_13811	c.13590_13599delTAAAAAATTG	c.(13588-13599)gataaaaaattgfs	p.DKKL4530fs	SYNE2_ENST00000358025.3_Frame_Shift_Del_p.DKKL4530fs|SYNE2_ENST00000554584.1_Frame_Shift_Del_p.DKKL4481fs|SYNE2_ENST00000394768.2_Frame_Shift_Del_p.DKKL915fs|SYNE2_ENST00000555002.1_Frame_Shift_Del_p.DKKL1164fs|SYNE2_ENST00000357395.3_Frame_Shift_Del_p.DKKL915fs|ESR2_ENST00000542956.1_Intron	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4530					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCAATTTGGATAAAAAATTGTTTGAACTAT	0.41																																					p.4530_4533del		Atlas-Indel,Pindel	.											.	SYNE2	577	.	0			c.13589_13598del						.																																			SO:0001589	frameshift_variant	23224	exon72			.	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.13590_13599delTAAAAAATTG	chr14.hg19:g.64593080_64593089delTAAAAAATTG	ENSP00000341781:p.Asp4530fs	65.0	0.0		58.0	18.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Frame_Shift_Del	DEL	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.		0.410	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
MYO3A	53904	hgsc.bcm.edu	37	10	26462717	26462717	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr10:26462717delC	ENST00000265944.5	+	30	3690	c.3524delC	c.(3523-3525)accfs	p.T1176fs	MYO3A_ENST00000543632.1_Intron	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1176					ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						GAAGAGGAAACCACCAATGCT	0.373																																					p.T1175fs		Atlas-Indel,Pindel	.											.	MYO3A	371	.	0			c.3523delA						.						64.0	62.0	63.0					10																	26462717		2203	4300	6503	SO:0001589	frameshift_variant	53904	exon30			.	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.3524delC	chr10.hg19:g.26462717delC	ENSP00000265944:p.Thr1176fs	73.0	0.0		59.0	27.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Frame_Shift_Del	DEL	ENST00000265944.5	hg19	CCDS7148.1																																																																																			.	.		0.373	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57080487	57080489	+	In_Frame_Del	DEL	CCC	CCC	-	rs564910885	byFrequency	TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	CCC	CCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr11:57080487_57080489delCCC	ENST00000532437.1	-	4	1984_1986	c.1673_1675delGGG	c.(1672-1677)ggggag>gag	p.G558del	TNKS1BP1_ENST00000358252.3_In_Frame_Del_p.G558del|TNKS1BP1_ENST00000530920.1_5'Flank			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	558	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GGTTGACTCTCCCCATCGCCCTT	0.591																																					p.558_559del		Atlas-Indel,Pindel	.											.	TNKS1BP1	148	.	0			c.1674_1676del						.																																			SO:0001651	inframe_deletion	85456	exon5			.	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1673_1675delGGG	chr11.hg19:g.57080487_57080489delCCC	ENSP00000437271:p.Gly558del	68.0	0.0		43.0	15.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	In_Frame_Del	DEL	ENST00000532437.1	hg19	CCDS7951.1																																																																																			.	.		0.591	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
ZNF845	91664	hgsc.bcm.edu	37	19	53855612	53855612	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr19:53855612delG	ENST00000595091.1	+	5	1903	c.1684delG	c.(1684-1686)gggfs	p.G562fs	ZNF845_ENST00000458035.1_Frame_Shift_Del_p.G562fs			Q96IR2	ZN845_HUMAN	zinc finger protein 845	562					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						AGCCTTTCGTGGGCAGTCAGC	0.423																																					p.R561fs		Atlas-Indel,Pindel	.											.	ZNF845	101	.	0			c.1683delT						.			4,4240		1,2,2119	88.0	76.0	80.0			-1.5	0.0	19		79	12,8228		6,0,4114	no	frameshift	ZNF845	NM_138374.1		7,2,6233	A1A1,A1R,RR		0.1456,0.0943,0.1282			53855612	16,12468	692	1591	2283	SO:0001589	frameshift_variant	91664	exon4			.	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1684delG	chr19.hg19:g.53855612delG	ENSP00000470005:p.Gly562fs	52.0	0.0		45.0	25.0	NM_138374		Frame_Shift_Del	DEL	ENST00000595091.1	hg19	CCDS46170.1																																																																																			.	.		0.423	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
HSP90AA1	3320	hgsc.bcm.edu	37	14	102548666	102548670	+	Frame_Shift_Del	DEL	GTTGA	GTTGA	-			TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	GTTGA	GTTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr14:102548666_102548670delGTTGA	ENST00000216281.8	-	10	2072_2076	c.1867_1871delTCAAC	c.(1867-1872)tcaacafs	p.ST623fs	HSP90AA1_ENST00000334701.7_Frame_Shift_Del_p.ST745fs	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	623					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	GTAACCCATTGTTGAGTTGTCTCTT	0.444																																					p.745_746del		Pindel	.											.	HSP90AA1	65	.	0			c.2234_2238del						.																																			SO:0001589	frameshift_variant	3320	exon11			.	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.1867_1871delTCAAC	chr14.hg19:g.102548666_102548670delGTTGA	ENSP00000216281:p.Ser623fs	82.0	0.0		63.0	18.0	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Frame_Shift_Del	DEL	ENST00000216281.8	hg19	CCDS9967.1																																																																																			.	.		0.444	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
TP53	7157	hgsc.bcm.edu	37	17	7578264	7578270	+	Frame_Shift_Del	DEL	GATAAGA	GATAAGA	-	rs370216745|rs587780071		TCGA-G3-A7M9-01A-23D-A34Z-10	TCGA-G3-A7M9-10A-01D-A34Z-10	GATAAGA	GATAAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6df05259-d701-492f-ab3f-5fc66ecb1c34	546c2c7d-b949-4ef6-96c8-9f2479352bf3	g.chr17:7578264_7578270delGATAAGA	ENST00000269305.4	-	6	768_774	c.579_585delTCTTATC	c.(577-585)catcttatcfs	p.HLI193fs	TP53_ENST00000574684.1_Intron|TP53_ENST00000413465.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.HLI193fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.HLI193fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	193	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		H -> D (in sporadic cancers; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:7887414}.|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.L194R(47)|p.I195F(20)|p.L194F(17)|p.I195N(12)|p.I195S(10)|p.L194P(8)|p.0?(8)|p.L194H(8)|p.R196*(7)|p.I195fs*14(6)|p.I195fs*52(6)|p.?(6)|p.L101R(5)|p.L62R(5)|p.L194L(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I195M(3)|p.P191fs*53(2)|p.I102S(2)|p.L194fs*15(2)|p.I102T(2)|p.H193H(2)|p.I63T(2)|p.I63S(2)|p.L194V(1)|p.L194fs*14(1)|p.P191fs*6(1)|p.I102fs*52(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.L101H(1)|p.I63fs*14(1)|p.I195fs*50(1)|p.I102M(1)|p.I102F(1)|p.I63F(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.I63fs*>28(1)|p.L62H(1)|p.L194I(1)|p.I63M(1)|p.I195L(1)|p.L194fs*52(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTTCCACTCGGATAAGATGCTGAGGAG	0.551		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.194_196del	Pancreas(47;798 1329 9957 10801)	Pindel	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,adenocarcinoma,0,1	TP53	33396	.	286	Substitution - Missense(221)|Deletion - Frameshift(15)|Insertion - Frameshift(10)|Whole gene deletion(8)|Substitution - Nonsense(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(6)|Substitution - coding silent(6)|Complex - frameshift(1)	ovary(52)|breast(42)|lung(35)|large_intestine(34)|haematopoietic_and_lymphoid_tissue(18)|upper_aerodigestive_tract(14)|oesophagus(14)|skin(14)|biliary_tract(13)|urinary_tract(11)|stomach(10)|central_nervous_system(8)|liver(6)|bone(4)|pancreas(4)|endometrium(3)|soft_tissue(2)|eye(1)|prostate(1)	c.580_586del						.																																			SO:0001589	frameshift_variant	7157	exon6	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.579_585delTCTTATC	chr17.hg19:g.7578264_7578270delGATAAGA	ENSP00000269305:p.His193fs	60.0	0.0		24.0	10.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.551	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
