#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF4	7293	hgsc.bcm.edu	37	1	1148457	1148457	+	Silent	SNP	C	C	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:1148457C>G	ENST00000379236.3	-	3	289	c.285G>C	c.(283-285)cgG>cgC	p.R95R	TNFRSF4_ENST00000453580.1_5'UTR	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	95					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		ACAGCTGCTTCCGCTCACTCC	0.677																																					p.R95R		Atlas-SNP	.											.	TNFRSF4	12	.	0			c.G285C						.						14.0	16.0	15.0					1																	1148457		2193	4289	6482	SO:0001819	synonymous_variant	7293	exon3			CTGCTTCCGCTCA	X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.285G>C	chr1.hg19:g.1148457C>G		87.0	0.0		110.0	49.0	NM_003327	Q13663|Q2M312|Q5T7M0	Silent	SNP	ENST00000379236.3	hg19	CCDS11.1	.	.	.	.	.	.	.	.	.	.	c	0.024	-1.390492	0.01185	.	.	ENSG00000186827	ENST00000453580	.	.	.	3.69	0.631	0.17699	.	.	.	.	.	T	0.32133	0.0819	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.27297	-1.0078	4	.	.	.	-2.3683	7.4903	0.27458	0.1049:0.5304:0.3646:0.0	.	.	.	.	Q	41	.	.	E	-	1	0	TNFRSF4	1138320	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.663000	0.05299	0.040000	0.15660	-0.526000	0.04340	GAA	.	.		0.677	TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004086.1		
AADACL3	126767	hgsc.bcm.edu	37	1	12785873	12785873	+	Silent	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:12785873A>G	ENST00000359318.5	+	4	1168	c.963A>G	c.(961-963)ggA>ggG	p.G321G	AADACL3_ENST00000332530.3_Silent_p.G251G	NM_001103170.1	NP_001096640.1	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3	321							hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	15	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		GTTTCCATGGAGTGCTCAGGA	0.478																																					p.G321G		Atlas-SNP	.											.	AADACL3	84	.	0			c.A963G						.						75.0	73.0	73.0					1																	12785873		1973	4155	6128	SO:0001819	synonymous_variant	126767	exon4			CCATGGAGTGCTC		CCDS41253.1	1p36.21	2014-07-17			ENSG00000188984	ENSG00000188984			32037	protein-coding gene	gene with protein product							Standard	XM_006710337		Approved	OTTHUMG00000001887	uc009vnn.1	Q5VUY0	OTTHUMG00000001887	ENST00000359318.5:c.963A>G	chr1.hg19:g.12785873A>G		114.0	0.0		120.0	52.0	NM_001103170	B3KXR9|Q5VUY1	Silent	SNP	ENST00000359318.5	hg19	CCDS41253.1																																																																																			.	.		0.478	AADACL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005324.2	NM_001103170	
PRAMEF12	390999	hgsc.bcm.edu	37	1	12835197	12835197	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:12835197T>C	ENST00000357726.4	+	1	214	c.187T>C	c.(187-189)Tgc>Cgc	p.C63R		NM_001080830.1	NP_001074299.1	O95522	PRA12_HUMAN	PRAME family member 12	63					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(9)|ovary(3)|skin(1)|urinary_tract(1)	23	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00818)|Colorectal(212;5.04e-06)|Kidney(185;4.99e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000198)|COAD - Colon adenocarcinoma(227;0.000245)|BRCA - Breast invasive adenocarcinoma(304;0.000295)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCCCTTCACCTGCCTTCCTCT	0.577																																					p.C63R		Atlas-SNP	.											.	PRAMEF12	69	.	0			c.T187C						.						80.0	84.0	83.0					1																	12835197		2203	4300	6503	SO:0001583	missense	390999	exon1			TTCACCTGCCTTC		CCDS41254.1	1p36.21	2013-01-17			ENSG00000116726	ENSG00000116726		"""-"""	22125	protein-coding gene	gene with protein product							Standard	NM_001080830		Approved	OTTHUMG00000001927	uc001aui.3	O95522	OTTHUMG00000001927	ENST00000357726.4:c.187T>C	chr1.hg19:g.12835197T>C	ENSP00000350358:p.Cys63Arg	167.0	0.0		215.0	47.0	NM_001080830		Missense_Mutation	SNP	ENST00000357726.4	hg19	CCDS41254.1	.	.	.	.	.	.	.	.	.	.	.	1.284	-0.609441	0.03690	.	.	ENSG00000116726	ENST00000357726	T	0.13778	2.56	2.68	-1.2	0.09554	.	1.463560	0.03995	N	0.295465	T	0.06371	0.0164	N	0.05330	-0.07	0.09310	N	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.34403	-0.9830	10	0.16896	T	0.51	.	4.5886	0.12295	0.0:0.1753:0.1834:0.6413	.	63	O95522	PRA12_HUMAN	R	63	ENSP00000350358:C63R	ENSP00000350358:C63R	C	+	1	0	PRAMEF12	12757784	0.000000	0.05858	0.005000	0.12908	0.312000	0.27988	-1.603000	0.02077	-0.268000	0.09312	0.164000	0.16699	TGC	.	.		0.577	PRAMEF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005457.1	XM_372760	
USP48	84196	hgsc.bcm.edu	37	1	22032230	22032230	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:22032230C>T	ENST00000308271.9	-	19	3022	c.2374G>A	c.(2374-2376)Gat>Aat	p.D792N	USP48_ENST00000374732.3_Missense_Mutation_p.D330N|USP48_ENST00000400301.1_Missense_Mutation_p.D792N|USP48_ENST00000529637.1_Missense_Mutation_p.D804N	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	792	DUSP 3. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		AGTTTAGAATCTTCTTTGGTC	0.378																																					p.D792N		Atlas-SNP	.											USP48,NS,carcinoma,0,1	USP48	91	.	0			c.G2374A						.						57.0	62.0	60.0					1																	22032230		2203	4300	6503	SO:0001583	missense	84196	exon19			TAGAATCTTCTTT	AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.2374G>A	chr1.hg19:g.22032230C>T	ENSP00000309262:p.Asp792Asn	402.0	2.0		492.0	110.0	NM_032236	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	ENST00000308271.9	hg19	CCDS30623.1	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742447	0.89573	.	.	ENSG00000090686	ENST00000400301;ENST00000308271;ENST00000374732;ENST00000529637	T;T;T	0.06371	3.34;3.35;3.31	5.7	5.7	0.88788	Peptidase C19, ubiquitin-specific peptidase, DUSP domain (1);	0.000000	0.85682	D	0.000000	T	0.24198	0.0586	M	0.70595	2.14	0.80722	D	1	D;P;D;D;D	0.63880	0.993;0.867;0.976;0.958;0.993	P;B;P;P;D	0.63033	0.808;0.323;0.677;0.534;0.91	T	0.00049	-1.2202	10	0.59425	D	0.04	.	18.8179	0.92085	0.0:1.0:0.0:0.0	.	804;792;792;792;330	B7ZKS7;B7ZKS3;Q86UV5-2;Q86UV5;Q86UV5-5	.;.;.;UBP48_HUMAN;.	N	792;792;330;804	ENSP00000383157:D792N;ENSP00000309262:D792N;ENSP00000431949:D804N	ENSP00000309262:D792N	D	-	1	0	USP48	21904817	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	6.994000	0.76251	2.697000	0.92050	0.557000	0.71058	GAT	.	.		0.378	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021372.1	NM_032236	
EPHB2	2048	hgsc.bcm.edu	37	1	23232505	23232505	+	Silent	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:23232505C>T	ENST00000400191.3	+	10	1809	c.1791C>T	c.(1789-1791)atC>atT	p.I597I	EPHB2_ENST00000374630.3_Silent_p.I597I|EPHB2_ENST00000374627.1_Silent_p.I592I|EPHB2_ENST00000374632.3_Silent_p.I598I	NM_004442.6|NM_017449.3	NP_004433.2|NP_059145.2	P29323	EPHB2_HUMAN	EPH receptor B2	597					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|camera-type eye morphogenesis (GO:0048593)|central nervous system projection neuron axonogenesis (GO:0021952)|commissural neuron axon guidance (GO:0071679)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|ephrin receptor signaling pathway (GO:0048013)|inner ear morphogenesis (GO:0042472)|learning (GO:0007612)|negative regulation of axonogenesis (GO:0050771)|nervous system development (GO:0007399)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of synapse assembly (GO:0051965)|regulation of body fluid levels (GO:0050878)|retinal ganglion cell axon guidance (GO:0031290)|urogenital system development (GO:0001655)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|protein tyrosine kinase activity (GO:0004713)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(8)|stomach(1)|urinary_tract(1)	56		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AGATCTACATCGATCCTTTCA	0.522																																					p.I598I		Atlas-SNP	.											EPHB2_ENST00000374632,NS,carcinoma,0,2	EPHB2	257	.	0			c.C1794T						.						93.0	86.0	88.0					1																	23232505		2203	4300	6503	SO:0001819	synonymous_variant	2048	exon10			CTACATCGATCCT	AF025304	CCDS229.2, CCDS230.1	1p36.1-p35	2014-09-17	2004-10-28		ENSG00000133216	ENSG00000133216	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3393	protein-coding gene	gene with protein product		600997	"""EphB2"""	DRT, ERK, EPHT3		1648701	Standard	NM_017449		Approved	Hek5, Tyro5	uc001bge.3	P29323	OTTHUMG00000002881	ENST00000400191.3:c.1791C>T	chr1.hg19:g.23232505C>T		93.0	0.0		78.0	22.0	NM_004442	O43477|Q5T0U6|Q5T0U7|Q5T0U8	Silent	SNP	ENST00000400191.3	hg19																																																																																				.	.		0.522	EPHB2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000008060.2	NM_017449	
THRAP3	9967	hgsc.bcm.edu	37	1	36755239	36755239	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:36755239A>G	ENST00000354618.5	+	5	1843	c.1619A>G	c.(1618-1620)aAg>aGg	p.K540R	THRAP3_ENST00000469141.2_Missense_Mutation_p.K540R	NM_005119.3	NP_005110.2	Q9Y2W1	TR150_HUMAN	thyroid hormone receptor associated protein 3	540	Required for mRNA decay activity.				androgen receptor signaling pathway (GO:0030521)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|phosphoprotein binding (GO:0051219)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(12)|ovary(5)|stomach(1)	37		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCCCCAAGAAAGACCTCTGAG	0.512			T	USP6	aneurysmal bone cysts																																p.K540R	Pancreas(129;785 1795 20938 23278 32581)	Atlas-SNP	.		Dom	yes		1	1p34.3	9967	thyroid hormone receptor associated protein 3 (TRAP150)		M	.	THRAP3	93	.	0			c.A1619G						.						84.0	92.0	89.0					1																	36755239		2203	4300	6503	SO:0001583	missense	9967	exon5			CAAGAAAGACCTC	AF117756	CCDS405.1	1p34.3	2008-02-05			ENSG00000054118	ENSG00000054118			22964	protein-coding gene	gene with protein product		603809					Standard	NM_005119		Approved	TRAP150	uc001cae.4	Q9Y2W1	OTTHUMG00000007866	ENST00000354618.5:c.1619A>G	chr1.hg19:g.36755239A>G	ENSP00000346634:p.Lys540Arg	106.0	0.0		106.0	24.0	NM_005119	D3DPS5|Q5VTK6	Missense_Mutation	SNP	ENST00000354618.5	hg19	CCDS405.1	.	.	.	.	.	.	.	.	.	.	A	13.22	2.173270	0.38413	.	.	ENSG00000054118	ENST00000354618;ENST00000469141	T;T	0.16743	2.32;2.32	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.21022	0.0506	L	0.51422	1.61	0.42774	D	0.993849	B	0.26512	0.151	B	0.30716	0.119	T	0.02020	-1.1228	10	0.38643	T	0.18	-20.026	15.7905	0.78357	1.0:0.0:0.0:0.0	.	540	Q9Y2W1	TR150_HUMAN	R	540	ENSP00000346634:K540R;ENSP00000433825:K540R	ENSP00000346634:K540R	K	+	2	0	THRAP3	36527826	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.263000	0.58853	2.324000	0.78689	0.533000	0.62120	AAG	.	.		0.512	THRAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021688.2	NM_005119	
COL9A2	1298	hgsc.bcm.edu	37	1	40770006	40770006	+	Missense_Mutation	SNP	C	C	T	rs148912050		TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:40770006C>T	ENST00000372748.3	-	24	1369	c.1273G>A	c.(1273-1275)Gtc>Atc	p.V425I	COL9A2_ENST00000466267.1_5'UTR	NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	425	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			TCTCCTTTGACGCCTGGCAAG	0.612																																					p.V425I		Atlas-SNP	.											.	COL9A2	63	.	0			c.G1273A						.	C	ILE/VAL	0,4358		0,0,2179	26.0	26.0	26.0		1273	2.0	1.0	1	dbSNP_134	26	1,8535		0,1,4267	no	missense	COL9A2	NM_001852.3	29	0,1,6446	TT,TC,CC		0.0117,0.0,0.0078	benign	425/690	40770006	1,12893	2179	4268	6447	SO:0001583	missense	1298	exon24			CTTTGACGCCTGG	M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.1273G>A	chr1.hg19:g.40770006C>T	ENSP00000361834:p.Val425Ile	80.0	0.0		108.0	33.0	NM_001852	B2RMP9	Missense_Mutation	SNP	ENST00000372748.3	hg19	CCDS450.1	.	.	.	.	.	.	.	.	.	.	C	4.579	0.107636	0.08780	0.0	1.17E-4	ENSG00000049089	ENST00000372748	D	0.93307	-3.2	5.49	1.97	0.26223	.	0.265492	0.43416	N	0.000568	T	0.78960	0.4366	N	0.05230	-0.09	0.19775	N	0.99996	P	0.39665	0.682	B	0.29716	0.106	T	0.72171	-0.4371	10	0.27785	T	0.31	.	6.9054	0.24305	0.0:0.3562:0.0:0.6438	.	425	Q14055	CO9A2_HUMAN	I	425	ENSP00000361834:V425I	ENSP00000361834:V425I	V	-	1	0	COL9A2	40542593	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	1.511000	0.35801	0.393000	0.25203	-0.340000	0.08031	GTC	.	C|1.000;G|0.000		0.612	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015764.3	NM_001852	
OSBPL9	114883	hgsc.bcm.edu	37	1	52254955	52254955	+	IGR	SNP	A	A	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:52254955A>C	ENST00000428468.1	+	0	2893				NRD1_ENST00000352171.7_Missense_Mutation_p.F1137V|NRD1_ENST00000485608.1_5'UTR|NRD1_ENST00000539524.1_Missense_Mutation_p.F1073V|NRD1_ENST00000354831.7_Missense_Mutation_p.F1205V			Q96SU4	OSBL9_HUMAN	oxysterol binding protein-like 9						lipid transport (GO:0006869)	cytoplasm (GO:0005737)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|pancreas(1)|prostate(3)|skin(1)	18						GTTGTTGTGAAAGCCCTGATA	0.413																																					p.F1205V		Atlas-SNP	.											.	NRD1	89	.	0			c.T3613G						.						165.0	153.0	157.0					1																	52254955		2203	4300	6503	SO:0001628	intergenic_variant	4898	exon33			TTGTGAAAGCCCT	AF392445	CCDS558.1, CCDS41332.1, CCDS41333.1, CCDS41334.1, CCDS41332.2, CCDS41332.3, CCDS41333.2, CCDS44145.1, CCDS55598.1	1p32.3	2013-01-10			ENSG00000117859	ENSG00000117859		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16386	protein-coding gene	gene with protein product		606737					Standard	NM_148904		Approved		uc001csu.3	Q96SU4	OTTHUMG00000008234		chr1.hg19:g.52254955A>C		139.0	0.0		126.0	49.0	NM_002525	B1AKJ8|B3KPQ4|D3DQ31|Q5TFC0|Q6IA67|Q86YQ3|Q8NB17|Q8TAS8|Q96SK4|Q9H9X2	Missense_Mutation	SNP	ENST00000428468.1	hg19	CCDS41332.3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	31|31	5.064047|5.064047	0.93898|0.93898	.|.	.|.	ENSG00000078618|ENSG00000078618	ENST00000440943|ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665	.|T;T;T	.|0.39229	.|1.09;1.14;1.12	5.75|5.75	5.75|5.75	0.90469|0.90469	.|.	0.146511|0.146511	0.64402|0.64402	D|D	0.000008|0.000008	T|T	0.66436|0.66436	0.2789|0.2789	M|M	0.85041|0.85041	2.73|2.73	0.80722|0.80722	D|D	1|1	.|D;D	.|0.71674	.|0.989;0.998	.|P;P	.|0.62813	.|0.744;0.907	T|T	0.72883|0.72883	-0.4157|-0.4157	6|10	.|0.87932	.|D	.|0	-9.4331|-9.4331	15.2446|15.2446	0.73497|0.73497	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1136;1205	.|O43847;B1AKJ5	.|NRDC_HUMAN;.	C|V	523|1137;1205;1073;539	.|ENSP00000262679:F1137V;ENSP00000346890:F1205V;ENSP00000444416:F1073V	.|ENSP00000262679:F1137V	F|F	-|-	2|1	0|0	NRD1|NRD1	52027543|52027543	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	8.660000|8.660000	0.91121|0.91121	2.202000|2.202000	0.70862|0.70862	0.528000|0.528000	0.53228|0.53228	TTT|TTC	.	.		0.413	OSBPL9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000022584.4		
HOOK1	51361	hgsc.bcm.edu	37	1	60331564	60331564	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:60331564G>A	ENST00000371208.3	+	19	2022	c.1765G>A	c.(1765-1767)Gaa>Aaa	p.E589K	HOOK1_ENST00000465876.1_3'UTR|HOOK1_ENST00000395561.2_Missense_Mutation_p.E547K	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	589					early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					CAATGAACTTGAAGCTGCTCT	0.294																																					p.E589K		Atlas-SNP	.											.	HOOK1	54	.	0			c.G1765A						.						60.0	68.0	65.0					1																	60331564		2203	4299	6502	SO:0001583	missense	51361	exon19			GAACTTGAAGCTG	AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.1765G>A	chr1.hg19:g.60331564G>A	ENSP00000360252:p.Glu589Lys	666.0	1.0		701.0	239.0	NM_015888	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	ENST00000371208.3	hg19	CCDS612.1	.	.	.	.	.	.	.	.	.	.	G	17.66	3.444544	0.63178	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.19250	2.16;2.16	5.56	5.56	0.83823	.	0.289394	0.42821	D	0.000658	T	0.21550	0.0519	L	0.33339	1.005	0.46749	D	0.999186	P	0.38395	0.629	B	0.39771	0.309	T	0.01500	-1.1339	10	0.27082	T	0.32	.	19.5309	0.95228	0.0:0.0:1.0:0.0	.	589	Q9UJC3	HOOK1_HUMAN	K	589;547	ENSP00000360252:E589K;ENSP00000378928:E547K	ENSP00000360252:E589K	E	+	1	0	HOOK1	60104152	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.884000	0.56175	2.636000	0.89361	0.650000	0.86243	GAA	.	.		0.294	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000024934.1	NM_015888	
RPF1	80135	hgsc.bcm.edu	37	1	84955365	84955365	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:84955365A>T	ENST00000370654.5	+	4	431	c.416A>T	c.(415-417)cAg>cTg	p.Q139L		NM_025065.6	NP_079341.2	Q9H9Y2	RPF1_HUMAN	ribosome production factor 1 homolog (S. cerevisiae)	139					rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			breast(2)|endometrium(1)|kidney(3)|large_intestine(5)|lung(2)|prostate(1)	14						TTCAACAAACAGACTTCTCCC	0.338																																					p.Q139L		Atlas-SNP	.											.	RPF1	31	.	0			c.A416T						.						97.0	90.0	93.0					1																	84955365		2203	4300	6503	SO:0001583	missense	80135	exon4			ACAAACAGACTTC	AF322053	CCDS695.1	1p22.3	2009-09-25	2009-09-25	2009-09-25	ENSG00000117133	ENSG00000117133			30350	protein-coding gene	gene with protein product	"""RNA processing factor 1"", ""ribosome production factor 1"""		"""brix domain containing 5"""	BXDC5		11864606	Standard	NM_025065		Approved		uc001djv.4	Q9H9Y2	OTTHUMG00000009857	ENST00000370654.5:c.416A>T	chr1.hg19:g.84955365A>T	ENSP00000359688:p.Gln139Leu	101.0	0.0		93.0	29.0	NM_025065	Q5VSK7|Q6AHX1|Q8WXZ8	Missense_Mutation	SNP	ENST00000370654.5	hg19	CCDS695.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469077	0.43839	.	.	ENSG00000117133	ENST00000370654	T	0.30714	1.52	5.96	5.96	0.96718	.	0.166320	0.53938	D	0.000049	T	0.09291	0.0229	N	0.10972	0.075	0.51012	D	0.999909	B	0.02656	0.0	B	0.04013	0.001	T	0.11494	-1.0585	10	0.27785	T	0.31	-4.8633	16.4484	0.83959	1.0:0.0:0.0:0.0	.	139	Q9H9Y2	RPF1_HUMAN	L	139	ENSP00000359688:Q139L	ENSP00000359688:Q139L	Q	+	2	0	RPF1	84727953	1.000000	0.71417	0.955000	0.39395	0.985000	0.73830	6.640000	0.74319	2.285000	0.76669	0.533000	0.62120	CAG	.	.		0.338	RPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027238.1	NM_025065	
POLR3C	10623	hgsc.bcm.edu	37	1	145608260	145608260	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:145608260T>C	ENST00000334163.3	-	4	597	c.437A>G	c.(436-438)aAc>aGc	p.N146S	RNF115_ENST00000369291.5_5'Flank|POLR3C_ENST00000471254.1_5'UTR|POLR3C_ENST00000369294.1_Missense_Mutation_p.N146S	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	146					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			CACAAATGTGTTTGATACTTC	0.512																																					p.N146S		Atlas-SNP	.											.	POLR3C	41	.	0			c.A437G						.						186.0	165.0	172.0					1																	145608260		2203	4300	6503	SO:0001583	missense	10623	exon4			AATGTGTTTGATA	AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.437A>G	chr1.hg19:g.145608260T>C	ENSP00000334564:p.Asn146Ser	65.0	0.0		124.0	21.0	NM_006468	O15317|Q9Y3R6	Missense_Mutation	SNP	ENST00000334163.3	hg19	CCDS921.1	.	.	.	.	.	.	.	.	.	.	T	4.581	0.107977	0.08780	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.39787	1.06;1.06	5.41	-1.27	0.09347	RNA polymerase III Rpc82, C -terminal (1);	0.652107	0.17151	N	0.185056	T	0.05227	0.0139	N	0.05031	-0.125	0.33947	D	0.643959	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33828	-0.9853	10	0.08837	T	0.75	-13.0953	7.0262	0.24942	0.0:0.5191:0.1649:0.316	.	146;146;146	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	S	146	ENSP00000334564:N146S;ENSP00000358300:N146S	ENSP00000334564:N146S	N	-	2	0	POLR3C	144319617	0.188000	0.23250	0.973000	0.42090	0.426000	0.31534	0.158000	0.16422	-0.175000	0.10725	-0.290000	0.09829	AAC	.	.		0.512	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038542.1	NM_006468	
ASH1L	55870	hgsc.bcm.edu	37	1	155311812	155311812	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:155311812A>C	ENST00000368346.3	-	25	9029	c.8390T>G	c.(8389-8391)aTc>aGc	p.I2797S	ASH1L_ENST00000392403.3_Missense_Mutation_p.I2792S			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2797	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GTTCCGGTGGATCTTGTAAAA	0.478																																					p.I2792S		Atlas-SNP	.											.	ASH1L	279	.	0			c.T8375G						.						243.0	228.0	233.0					1																	155311812		2203	4300	6503	SO:0001583	missense	55870	exon25			CGGTGGATCTTGT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8390T>G	chr1.hg19:g.155311812A>C	ENSP00000357330:p.Ile2797Ser	135.0	0.0		191.0	71.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	A	27.2	4.805699	0.90623	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.91237	-2.81;-2.81	5.27	5.27	0.74061	Bromo adjacent homology (BAH) domain (2);	0.000000	0.85682	D	0.000000	D	0.93572	0.7948	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.994	D	0.94480	0.7692	10	0.87932	D	0	.	15.0168	0.71591	1.0:0.0:0.0:0.0	.	2797;2792	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	S	2797;2792	ENSP00000357330:I2797S;ENSP00000376204:I2792S	ENSP00000357330:I2797S	I	-	2	0	ASH1L	153578436	1.000000	0.71417	0.994000	0.49952	0.986000	0.74619	7.065000	0.76727	2.210000	0.71456	0.454000	0.30748	ATC	.	.		0.478	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
WNT3A	89780	hgsc.bcm.edu	37	1	228246759	228246759	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:228246759T>A	ENST00000284523.1	+	4	730	c.652T>A	c.(652-654)Tgg>Agg	p.W218R	WNT3A_ENST00000366753.2_Missense_Mutation_p.W218R	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	218					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				GAAGACATGCTGGTGGTCGCA	0.662																																					p.W218R		Atlas-SNP	.											.	WNT3A	40	.	0			c.T652A						.						52.0	53.0	52.0					1																	228246759		2203	4300	6503	SO:0001583	missense	89780	exon4			ACATGCTGGTGGT	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.652T>A	chr1.hg19:g.228246759T>A	ENSP00000284523:p.Trp218Arg	60.0	0.0		75.0	20.0	NM_033131	Q3SY79|Q3SY80|Q969P2	Missense_Mutation	SNP	ENST00000284523.1	hg19	CCDS1564.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.737611	0.89573	.	.	ENSG00000154342	ENST00000284523;ENST00000366753	T;T	0.81415	-1.49;-1.49	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.91274	0.7249	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.967	D	0.93238	0.6623	10	0.87932	D	0	.	14.2315	0.65895	0.0:0.0:0.0:1.0	.	218;218	P56704;Q3SY79	WNT3A_HUMAN;.	R	218	ENSP00000284523:W218R;ENSP00000355715:W218R	ENSP00000284523:W218R	W	+	1	0	WNT3A	226313382	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.933000	0.87642	1.818000	0.53035	0.402000	0.26972	TGG	.	.		0.662	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	NM_033131	
DISC1	27185	hgsc.bcm.edu	37	1	232144685	232144685	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:232144685C>A	ENST00000439617.2	+	11	2250	c.2197C>A	c.(2197-2199)Ccc>Acc	p.P733T	DISC1_ENST00000537876.1_3'UTR|DISC1_ENST00000366637.3_Missense_Mutation_p.P65T|DISC1_ENST00000427560.1_3'UTR|DISC1_ENST00000535983.1_3'UTR	NM_001164537.1|NM_001164540.1|NM_018662.2	NP_001158009.1|NP_001158012.1|NP_061132.2	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	733	Interaction with ATF4 and ATF5.|Interaction with PAFAH1B1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				TCCTCCTATTCCCCCCAGGCT	0.532																																					p.P765T		Atlas-SNP	.											.,1	DISC1	207	.	0			c.C2293A						.						67.0	66.0	66.0					1																	232144685		1920	4150	6070	SO:0001583	missense	27185	exon12			CCTATTCCCCCCA	AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000439617.2:c.2197C>A	chr1.hg19:g.232144685C>A	ENSP00000403888:p.Pro733Thr	115.0	0.0		106.0	40.0	NM_001164537	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	ENST00000439617.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.680|3.680	-0.065651|-0.065651	0.07273|0.07273	.|.	.|.	ENSG00000162946|ENSG00000162946	ENST00000422590|ENST00000439617;ENST00000366637;ENST00000366638;ENST00000532576;ENST00000427560	.|T	.|0.08634	.|3.07	4.46|4.46	-1.19|-1.19	0.09585|0.09585	.|.	.|1.195290	.|0.06147	.|N	.|0.673477	T|T	0.04048|0.04048	0.0113|0.0113	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B;B;B;B;B;B;B	.|0.10296	.|0.001;0.001;0.003;0.001;0.0;0.001;0.003	.|B;B;B;B;B;B;B	.|0.12156	.|0.003;0.002;0.007;0.005;0.002;0.003;0.003	T|T	0.45205|0.45205	-0.9277|-0.9277	5|10	.|0.22706	.|T	.|0.39	0.2137|0.2137	0.5697|0.5697	0.00693|0.00693	0.1764:0.3345:0.1722:0.3169|0.1764:0.3345:0.1722:0.3169	.|.	.|765;611;765;733;611;733;733	.|C4P096;C4P094;E2QRA4;C4P098;F5H1F1;Q9NRI5-2;Q9NRI5	.|.;.;.;.;.;.;DISC1_HUMAN	L|T	135|733;733;765;611;65	.|ENSP00000403888:P733T	.|ENSP00000355597:P733T	F|P	+|+	3|1	2|0	DISC1|DISC1	230211308|230211308	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	0.551000|0.551000	0.23361|0.23361	-0.081000|-0.081000	0.12662|0.12662	-0.127000|-0.127000	0.14921|0.14921	TTC|CCC	.	.		0.532	DISC1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000092351.2	NM_018662	
MTIF2	4528	hgsc.bcm.edu	37	2	55470681	55470681	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr2:55470681C>A	ENST00000263629.4	-	12	1750	c.1435G>T	c.(1435-1437)Gag>Tag	p.E479*	MTIF2_ENST00000403721.1_Nonsense_Mutation_p.E479*|MTIF2_ENST00000394600.3_Nonsense_Mutation_p.E479*	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	479					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						CCATACTTCTCACGGGCTTTC	0.388																																					p.E479X		Atlas-SNP	.											.	MTIF2	64	.	0			c.G1435T						.						208.0	201.0	203.0					2																	55470681		2203	4300	6503	SO:0001587	stop_gained	4528	exon12			ACTTCTCACGGGC	L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1435G>T	chr2.hg19:g.55470681C>A	ENSP00000263629:p.Glu479*	104.0	0.0		139.0	58.0	NM_002453	D6W5D0	Nonsense_Mutation	SNP	ENST00000263629.4	hg19	CCDS1853.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711596	0.89112	.	.	ENSG00000085760	ENST00000403721;ENST00000263629;ENST00000394600;ENST00000418823	.	.	.	5.6	5.6	0.85130	.	0.220434	0.46145	D	0.000302	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-6.8825	16.1438	0.81548	0.0:0.8575:0.1425:0.0	.	.	.	.	X	479;479;479;157	.	ENSP00000263629:E479X	E	-	1	0	MTIF2	55324185	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.087000	0.64480	2.645000	0.89757	0.655000	0.94253	GAG	.	.		0.388	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251486.4	NM_002453	
FAP	2191	hgsc.bcm.edu	37	2	163027578	163027578	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr2:163027578G>T	ENST00000188790.4	-	26	2401	c.2194C>A	c.(2194-2196)Cag>Aag	p.Q732K	AC007750.5_ENST00000609668.1_RNA|FAP_ENST00000443424.1_Missense_Mutation_p.Q707K|AC007750.5_ENST00000418968.3_RNA	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha											NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						CCGTGGTTCTGGTCAGAGTAC	0.433																																					p.Q732K		Atlas-SNP	.											.	FAP	122	.	0			c.C2194A						.						128.0	125.0	126.0					2																	163027578		2203	4300	6503	SO:0001583	missense	2191	exon26			GGTTCTGGTCAGA	U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.2194C>A	chr2.hg19:g.163027578G>T	ENSP00000188790:p.Gln732Lys	93.0	0.0		108.0	21.0	NM_004460		Missense_Mutation	SNP	ENST00000188790.4	hg19	CCDS33311.1	.	.	.	.	.	.	.	.	.	.	G	15.19	2.758770	0.49468	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.28666	1.6;1.6	5.6	5.6	0.85130	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.057851	0.64402	D	0.000001	T	0.11410	0.0278	N	0.01424	-0.875	0.42777	D	0.993859	B;B;B	0.14438	0.004;0.001;0.01	B;B;B	0.18871	0.017;0.003;0.023	T	0.27706	-1.0066	10	0.15066	T	0.55	-19.1118	10.9947	0.47569	0.0:0.1392:0.7166:0.1442	.	707;211;732	B4DLR2;Q12884-2;Q12884	.;.;SEPR_HUMAN	K	732;707	ENSP00000188790:Q732K;ENSP00000411391:Q707K	ENSP00000188790:Q732K	Q	-	1	0	FAP	162735824	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.116000	0.50399	2.650000	0.89964	0.655000	0.94253	CAG	.	.		0.433	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332852.2		
SPHKAP	80309	hgsc.bcm.edu	37	2	228996764	228996764	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr2:228996764G>T	ENST00000392056.3	-	2	116	c.70C>A	c.(70-72)Ccg>Acg	p.P24T	SPHKAP_ENST00000344657.5_Missense_Mutation_p.P24T	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	24						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CCCTGCTGCGGTTCCAAAACG	0.478																																					p.P24T		Atlas-SNP	.											.	SPHKAP	750	.	0			c.C70A						.						89.0	92.0	91.0					2																	228996764		2203	4300	6503	SO:0001583	missense	80309	exon2			GCTGCGGTTCCAA		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.70C>A	chr2.hg19:g.228996764G>T	ENSP00000375909:p.Pro24Thr	76.0	0.0		73.0	32.0	NM_030623	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	hg19	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	G	3.670	-0.067626	0.07273	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.55052	0.54;0.54	4.55	-9.09	0.00717	.	1.862920	0.02479	N	0.088282	T	0.29749	0.0743	N	0.14661	0.345	0.09310	N	1	B;B	0.10296	0.002;0.003	B;B	0.12156	0.003;0.007	T	0.18398	-1.0338	10	0.37606	T	0.19	.	5.3973	0.16276	0.1211:0.4938:0.1347:0.2504	.	24;24	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	T	24	ENSP00000375909:P24T;ENSP00000339886:P24T	ENSP00000339886:P24T	P	-	1	0	SPHKAP	228705008	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-1.352000	0.02619	-2.888000	0.00316	0.655000	0.94253	CCG	.	.		0.478	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
CYP8B1	1582	hgsc.bcm.edu	37	3	42916016	42916016	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr3:42916016C>A	ENST00000316161.4	-	1	1617	c.1293G>T	c.(1291-1293)atG>atT	p.M431I	KRBOX1_ENST00000426937.1_Intron|CYP8B1_ENST00000437102.1_Missense_Mutation_p.M431I|RP11-141M3.5_ENST00000471537.1_RNA	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	431					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		AACCCCAGGGCATGGTGTAGT	0.522																																					p.M431I		Atlas-SNP	.											.	CYP8B1	59	.	0			c.G1293T						.						117.0	112.0	114.0					3																	42916016		2203	4300	6503	SO:0001583	missense	1582	exon1			CCAGGGCATGGTG	AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.1293G>T	chr3.hg19:g.42916016C>A	ENSP00000318867:p.Met431Ile	147.0	0.0		181.0	64.0	NM_004391	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	ENST00000316161.4	hg19	CCDS2707.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.841611	0.91197	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.67523	-0.27;-0.27	5.39	5.39	0.77823	.	0.062837	0.64402	D	0.000018	T	0.74913	0.3779	L	0.42245	1.32	0.58432	D	0.999998	D;P	0.56287	0.975;0.949	P;P	0.60541	0.876;0.837	T	0.76041	-0.3104	10	0.56958	D	0.05	-26.4156	17.9083	0.88926	0.0:1.0:0.0:0.0	.	431;431	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	I	431	ENSP00000404499:M431I;ENSP00000318867:M431I	ENSP00000318867:M431I	M	-	3	0	CYP8B1	42891020	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.728000	0.84847	2.526000	0.85167	0.462000	0.41574	ATG	.	.		0.522	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256653.1	NM_004391	
NR1I2	8856	hgsc.bcm.edu	37	3	119530469	119530469	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr3:119530469G>T	ENST00000337940.4	+	4	580	c.532G>T	c.(532-534)Gga>Tga	p.G178*	NR1I2_ENST00000393716.2_Nonsense_Mutation_p.G139*|NR1I2_ENST00000466380.1_Nonsense_Mutation_p.G139*	NM_022002.2	NP_071285.1	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2	139	Hinge.				drug export (GO:0046618)|exogenous drug catabolic process (GO:0042738)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|steroid metabolic process (GO:0008202)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)|xenobiotic transport (GO:0042908)	nucleoplasm (GO:0005654)	drug binding (GO:0008144)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(2)|prostate(2)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.175)	Docetaxel(DB01248)|Erlotinib(DB00530)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Paclitaxel(DB01229)|Rifampicin(DB01045)|Rifaximin(DB01220)|Rilpivirine(DB08864)|Vitamin E(DB00163)	TCAGCCACTGGGAGTGCAGGG	0.552																																					p.G178X		Atlas-SNP	.											.	NR1I2	44	.	0			c.G532T						.						106.0	100.0	102.0					3																	119530469		2203	4300	6503	SO:0001587	stop_gained	8856	exon4			CCACTGGGAGTGC	AF061056	CCDS2995.1, CCDS43136.1, CCDS54627.1	3q12-q13.3	2013-03-25			ENSG00000144852	ENSG00000144852		"""Nuclear hormone receptors"""	7968	protein-coding gene	gene with protein product	"""pregnane X receptor"", ""orphan nuclear receptor PXR"""	603065				9727070, 9770465	Standard	NM_003889		Approved	ONR1, PXR, BXR, SXR, PAR2	uc003edk.3	O75469	OTTHUMG00000159400	ENST00000337940.4:c.532G>T	chr3.hg19:g.119530469G>T	ENSP00000336528:p.Gly178*	133.0	0.0		131.0	8.0	NM_022002	Q006P5|Q008C8|Q96AC7|Q9UJ22|Q9UJ23|Q9UJ24|Q9UJ25|Q9UJ26|Q9UJ27|Q9UNW4	Nonsense_Mutation	SNP	ENST00000337940.4	hg19	CCDS2995.1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171214	0.57584	.	.	ENSG00000144852	ENST00000393716;ENST00000466380;ENST00000337940	.	.	.	4.91	4.04	0.47022	.	1.095510	0.06879	N	0.802090	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	11.0649	0.47970	0.0897:0.0:0.9103:0.0	.	.	.	.	X	139;139;178	.	ENSP00000336528:G178X	G	+	1	0	NR1I2	121013159	0.051000	0.20477	0.002000	0.10522	0.016000	0.09150	1.815000	0.38981	1.297000	0.44761	0.591000	0.81541	GGA	.	.		0.552	NR1I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355126.1		
SLC2A2	6514	hgsc.bcm.edu	37	3	170732428	170732428	+	Silent	SNP	C	C	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr3:170732428C>G	ENST00000314251.3	-	3	280	c.201G>C	c.(199-201)ctG>ctC	p.L67L	SLC2A2_ENST00000382808.4_Intron	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	67					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	AGATTGTGGGCAGTTCATCTG	0.448																																					p.L67L		Atlas-SNP	.											.	SLC2A2	71	.	0			c.G201C						.						221.0	214.0	216.0					3																	170732428		2203	4300	6503	SO:0001819	synonymous_variant	6514	exon3			TGTGGGCAGTTCA	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.201G>C	chr3.hg19:g.170732428C>G		164.0	0.0		175.0	38.0	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Silent	SNP	ENST00000314251.3	hg19	CCDS3215.1																																																																																			.	.		0.448	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
ALG3	10195	hgsc.bcm.edu	37	3	183959685	183959685	+	IGR	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr3:183959685C>A	ENST00000397676.3	-	0	1528				ALG3_ENST00000463495.1_5'Flank|VWA5B2_ENST00000273794.5_Nonsense_Mutation_p.C978*|MIR1224_ENST00000408193.1_RNA|VWA5B2_ENST00000426955.2_Nonsense_Mutation_p.C1196*|EIF2B5_ENST00000444495.1_Intron	NM_005787.5	NP_005778.1	Q92685	ALG3_HUMAN	ALG3, alpha-1,3- mannosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|mannosylation (GO:0097502)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alpha-1,3-mannosyltransferase activity (GO:0000033)|dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase activity (GO:0052925)			kidney(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AGGCTGATTGCTGGCTGCGGG	0.692																																					p.C1196X		Atlas-SNP	.											.	VWA5B2	47	.	0			c.C3588A						.						12.0	14.0	14.0					3																	183959685		691	1588	2279	SO:0001628	intergenic_variant	90113	exon19			TGATTGCTGGCTG	BC002839	CCDS46967.1, CCDS46968.1	3q27.3	2013-02-26	2013-02-26		ENSG00000214160	ENSG00000214160	2.4.1.258	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	23056	protein-coding gene	gene with protein product	"""carbohydrate deficient glycoprotein syndrome type IV"", ""dol-P-Man:Man(5)GlcNAc(2)-PP-Dol alpha-1,3-mannosyltransferase"", ""dol-P-Man dependent alpha-1,3- mannosyltransferase"""	608750	"""asparagine-linked glycosylation 3 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 3, alpha-1,3- mannosyltransferase homolog (S. cerevisiae)"""			1058125	Standard	NM_005787		Approved	NOT56L, Not56, CDGS4, D16Ertd36e	uc003fne.2	Q92685	OTTHUMG00000156823		chr3.hg19:g.183959685C>A		78.0	0.0		81.0	15.0	NM_138345	A8JZZ6|Q9BT71	Nonsense_Mutation	SNP	ENST00000397676.3	hg19	CCDS46968.1	.	.	.	.	.	.	.	.	.	.	C	40	8.288329	0.98745	.	.	ENSG00000145198	ENST00000426955;ENST00000273794	.	.	.	4.73	2.8	0.32819	.	0.626474	0.14315	N	0.327441	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-3.912	0.87	0.01212	0.1701:0.3955:0.1941:0.2403	.	.	.	.	X	1196;978	.	ENSP00000273794:C978X	C	+	3	2	VWA5B2	185442379	0.586000	0.26782	0.993000	0.49108	0.934000	0.57294	0.476000	0.22180	0.605000	0.29947	0.462000	0.41574	TGC	.	.		0.692	ALG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346033.1	NM_005787	
KIAA1211	57482	hgsc.bcm.edu	37	4	57164426	57164426	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr4:57164426A>T	ENST00000504228.1	+	2	136	c.31A>T	c.(31-33)Att>Ttt	p.I11F	KIAA1211_ENST00000264229.6_Missense_Mutation_p.I11F|KIAA1211_ENST00000541073.1_5'UTR			Q6ZU35	K1211_HUMAN	KIAA1211	11										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCATGACAGTATTTTTATCCC	0.418																																					p.I11F		Atlas-SNP	.											.	KIAA1211	178	.	0			c.A31T						.						86.0	82.0	83.0					4																	57164426		1828	4100	5928	SO:0001583	missense	57482	exon4			GACAGTATTTTTA	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.31A>T	chr4.hg19:g.57164426A>T	ENSP00000423366:p.Ile11Phe	113.0	0.0		147.0	91.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	hg19	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	A	18.02	3.529410	0.64860	.	.	ENSG00000109265	ENST00000264229;ENST00000504228	T;T	0.23348	1.91;1.91	5.18	5.18	0.71444	.	.	.	.	.	T	0.49847	0.1581	M	0.69358	2.11	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52815	-0.8525	9	0.87932	D	0	-10.3488	15.1999	0.73126	1.0:0.0:0.0:0.0	.	11	Q6ZU35	K1211_HUMAN	F	11	ENSP00000264229:I11F;ENSP00000423366:I11F	ENSP00000264229:I11F	I	+	1	0	KIAA1211	56859183	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.899000	0.56288	2.186000	0.69663	0.533000	0.62120	ATT	.	.		0.418	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
SYNPO2	171024	hgsc.bcm.edu	37	4	119947953	119947953	+	Silent	SNP	T	T	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr4:119947953T>A	ENST00000429713.2	+	3	611	c.429T>A	c.(427-429)gcT>gcA	p.A143A	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Silent_p.A143A|SYNPO2_ENST00000307142.4_Silent_p.A143A	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	143						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)	p.A143A(2)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TTCCCCTAGCTGAGAACCAAA	0.547																																					p.A143A		Atlas-SNP	.											SYNPO2_ENST00000307142,NS,carcinoma,0,2	SYNPO2	353	.	2	Substitution - coding silent(2)	kidney(2)	c.T429A						.						44.0	46.0	46.0					4																	119947953		2203	4300	6503	SO:0001819	synonymous_variant	171024	exon3			CCTAGCTGAGAAC	AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.429T>A	chr4.hg19:g.119947953T>A		188.0	0.0		274.0	67.0	NM_001128934	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Silent	SNP	ENST00000429713.2	hg19	CCDS47129.1	.	.	.	.	.	.	.	.	.	.	T	6.091	0.385118	0.11524	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.29	-0.0133	0.13985	.	.	.	.	.	.	.	.	.	.	.	0.32797	N	0.500358	.	.	.	.	.	.	.	.	.	.	.	.	.	-4.2263	1.353	0.02177	0.1456:0.2677:0.133:0.4538	.	.	.	.	R	95	.	.	X	+	1	0	SYNPO2	120167401	0.933000	0.31639	0.792000	0.32020	0.495000	0.33615	0.117000	0.15583	0.355000	0.24131	0.455000	0.32223	TGA	.	.		0.547	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364020.1		
FAT4	79633	hgsc.bcm.edu	37	4	126237717	126237717	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr4:126237717G>T	ENST00000394329.3	+	1	164	c.151G>T	c.(151-153)Gtg>Ttg	p.V51L		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	51	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGTGTTCCAAGTGCTGGAAGA	0.602											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V51L		Atlas-SNP	.											.	FAT4	1752	.	0			c.G151T						.						58.0	69.0	65.0					4																	126237717		2002	4151	6153	SO:0001583	missense	79633	exon1			TTCCAAGTGCTGG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.151G>T	chr4.hg19:g.126237717G>T	ENSP00000377862:p.Val51Leu	81.0	0.0	1548	95.0	50.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	G	20.2	3.954511	0.73902	.	.	ENSG00000196159	ENST00000394329	T	0.80909	-1.43	4.88	4.88	0.63580	Cadherin (2);Cadherin-like (1);	.	.	.	.	D	0.86744	0.6006	L	0.49699	1.58	0.80722	D	1	D	0.58970	0.984	D	0.70016	0.967	D	0.86096	0.1553	9	0.42905	T	0.14	.	17.846	0.88730	0.0:0.0:1.0:0.0	.	51	Q6V0I7	FAT4_HUMAN	L	51	ENSP00000377862:V51L	ENSP00000377862:V51L	V	+	1	0	FAT4	126457167	1.000000	0.71417	0.979000	0.43373	0.650000	0.38633	7.566000	0.82347	2.519000	0.84933	0.650000	0.86243	GTG	.	.		0.602	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
TLL1	7092	hgsc.bcm.edu	37	4	166978381	166978381	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr4:166978381G>A	ENST00000061240.2	+	14	2413	c.1766G>A	c.(1765-1767)cGa>cAa	p.R589Q	TLL1_ENST00000507499.1_Missense_Mutation_p.R612Q	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	589	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		TGTGAGCAGCGATGTCTGAAC	0.478																																					p.R589Q		Atlas-SNP	.											.	TLL1	194	.	0			c.G1766A						.						181.0	171.0	174.0					4																	166978381		2203	4300	6503	SO:0001583	missense	7092	exon14			AGCAGCGATGTCT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.1766G>A	chr4.hg19:g.166978381G>A	ENSP00000061240:p.Arg589Gln	119.0	0.0		148.0	97.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	hg19	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	G	17.56	3.420880	0.62622	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	D;D	0.96265	-3.96;-3.96	5.85	4.12	0.48240	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.066004	0.56097	U	0.000023	D	0.94899	0.8351	L	0.37466	1.105	0.80722	D	1	D;P	0.54964	0.969;0.939	P;P	0.53360	0.583;0.724	D	0.93125	0.6528	10	0.26408	T	0.33	.	12.9648	0.58478	0.1331:0.0:0.8669:0.0	.	612;589	E9PD25;O43897	.;TLL1_HUMAN	Q	589;612	ENSP00000061240:R589Q;ENSP00000426082:R612Q	ENSP00000061240:R589Q	R	+	2	0	TLL1	167197831	1.000000	0.71417	0.852000	0.33557	0.151000	0.21798	4.843000	0.62838	1.479000	0.48272	0.650000	0.86243	CGA	.	.		0.478	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
MCC	4163	hgsc.bcm.edu	37	5	112823977	112823977	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr5:112823977C>G	ENST00000408903.3	-	1	550	c.135G>C	c.(133-135)caG>caC	p.Q45H		NM_001085377.1	NP_001078846	P23508	CRCM_HUMAN	mutated in colorectal cancers	0					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		CGTCGCACGTCTGGAAGAGGC	0.711																																					p.Q45H		Atlas-SNP	.											.	MCC	234	.	0			c.G135C						.						46.0	54.0	52.0					5																	112823977		2088	4206	6294	SO:0001583	missense	4163	exon1			GCACGTCTGGAAG		CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000408903.3:c.135G>C	chr5.hg19:g.112823977C>G	ENSP00000386227:p.Gln45His	64.0	0.0		57.0	29.0	NM_001085377	D3DT05|Q6ZR04	Missense_Mutation	SNP	ENST00000408903.3	hg19	CCDS43351.1	.	.	.	.	.	.	.	.	.	.	C	16.34	3.094430	0.56075	.	.	ENSG00000171444	ENST00000408903	T	0.71817	-0.6	3.39	3.39	0.38822	.	.	.	.	.	D	0.82811	0.5118	.	.	.	0.37157	D	0.902417	D	0.54397	0.966	D	0.72338	0.977	D	0.87504	0.2435	8	0.87932	D	0	-10.8979	13.4127	0.60952	0.0:1.0:0.0:0.0	.	45	P23508-2	.	H	45	ENSP00000386227:Q45H	ENSP00000386227:Q45H	Q	-	3	2	MCC	112851876	1.000000	0.71417	1.000000	0.80357	0.015000	0.08874	5.043000	0.64208	1.826000	0.53198	0.491000	0.48974	CAG	.	.		0.711	MCC-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370839.1	NM_001085377	
TGFBI	7045	hgsc.bcm.edu	37	5	135392461	135392461	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr5:135392461C>T	ENST00000442011.2	+	12	1816	c.1655C>T	c.(1654-1656)cCa>cTa	p.P552L	TGFBI_ENST00000508076.1_5'Flank|TGFBI_ENST00000305126.8_Missense_Mutation_p.P552L	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	552	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCCCTGCCACCAAGAGAACGG	0.532																																					p.P552L		Atlas-SNP	.											.	TGFBI	76	.	0			c.C1655T						.						51.0	55.0	54.0					5																	135392461		1954	4141	6095	SO:0001583	missense	7045	exon12			TGCCACCAAGAGA	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.1655C>T	chr5.hg19:g.135392461C>T	ENSP00000416330:p.Pro552Leu	299.0	0.0		225.0	37.0	NM_000358	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	ENST00000442011.2	hg19	CCDS47266.1	.	.	.	.	.	.	.	.	.	.	C	8.570	0.879751	0.17467	.	.	ENSG00000120708	ENST00000442011;ENST00000398813;ENST00000305126	D;D	0.91237	-2.81;-2.81	5.82	4.94	0.65067	FAS1 domain (5);	0.384151	0.30011	N	0.010630	D	0.89319	0.6681	M	0.81614	2.55	0.21627	N	0.999618	B;B	0.06786	0.001;0.001	B;B	0.12837	0.008;0.008	T	0.78727	-0.2091	10	0.29301	T	0.29	-14.3174	9.6118	0.39668	0.1819:0.581:0.2371:0.0	.	285;552	B9ZVW9;Q15582	.;BGH3_HUMAN	L	552;285;552	ENSP00000416330:P552L;ENSP00000306306:P552L	ENSP00000306306:P552L	P	+	2	0	TGFBI	135420360	0.000000	0.05858	0.248000	0.24265	0.413000	0.31143	0.165000	0.16564	1.456000	0.47831	0.655000	0.94253	CCA	.	.		0.532	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1		
FAF2	23197	hgsc.bcm.edu	37	5	175923517	175923517	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr5:175923517C>A	ENST00000261942.6	+	8	745	c.692C>A	c.(691-693)cCa>cAa	p.P231Q		NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2	231					lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						AACACCTATCCATTCCTGGCC	0.463																																					p.P231Q		Atlas-SNP	.											.	FAF2	38	.	0			c.C692A						.						164.0	148.0	154.0					5																	175923517		2203	4300	6503	SO:0001583	missense	23197	exon8			CCTATCCATTCCT	BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.692C>A	chr5.hg19:g.175923517C>A	ENSP00000261942:p.Pro231Gln	107.0	0.0		154.0	48.0	NM_014613	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Missense_Mutation	SNP	ENST00000261942.6	hg19	CCDS34296.1	.	.	.	.	.	.	.	.	.	.	C	33	5.288098	0.95517	.	.	ENSG00000113194	ENST00000261942	D	0.87887	-2.31	6.03	6.03	0.97812	UAS (1);	0.044974	0.85682	D	0.000000	D	0.95175	0.8436	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95035	0.8173	10	0.72032	D	0.01	-12.8976	20.5596	0.99324	0.0:1.0:0.0:0.0	.	231	Q96CS3	FAF2_HUMAN	Q	231	ENSP00000261942:P231Q	ENSP00000261942:P231Q	P	+	2	0	FAF2	175856123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.380000	0.79704	2.868000	0.98415	0.555000	0.69702	CCA	.	.		0.463	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372194.1	NM_014613	
ITPR3	3710	hgsc.bcm.edu	37	6	33638235	33638235	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:33638235G>T	ENST00000374316.5	+	20	3383	c.2323G>T	c.(2323-2325)Gcc>Tcc	p.A775S	ITPR3_ENST00000605930.1_Missense_Mutation_p.A775S			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	775					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TGACCTGCGCGCCTCCTTCTG	0.627																																					p.A775S		Atlas-SNP	.											.	ITPR3	409	.	0			c.G2323T						.						126.0	108.0	114.0					6																	33638235		2203	4300	6503	SO:0001583	missense	3710	exon19			CTGCGCGCCTCCT	D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.2323G>T	chr6.hg19:g.33638235G>T	ENSP00000363435:p.Ala775Ser	59.0	0.0		66.0	23.0	NM_002224	Q14649|Q5TAQ2	Missense_Mutation	SNP	ENST00000374316.5	hg19	CCDS4783.1	.	.	.	.	.	.	.	.	.	.	G	34	5.385389	0.95967	.	.	ENSG00000096433	ENST00000374316	D	0.94000	-3.33	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.96725	0.8931	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97509	1.0065	10	0.87932	D	0	-26.517	17.8678	0.88801	0.0:0.0:1.0:0.0	.	775	Q14573	ITPR3_HUMAN	S	775	ENSP00000363435:A775S	ENSP00000363435:A775S	A	+	1	0	ITPR3	33746213	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	9.720000	0.98763	2.209000	0.71365	0.563000	0.77884	GCC	.	.		0.627	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040204.2	NM_002224	
MICAL1	64780	hgsc.bcm.edu	37	6	109771627	109771627	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:109771627T>A	ENST00000358807.3	-	8	1378	c.1067A>T	c.(1066-1068)cAt>cTt	p.H356L	MICAL1_ENST00000483856.1_5'Flank|MICAL1_ENST00000358577.3_Intron|MICAL1_ENST00000368952.4_Missense_Mutation_p.H375L	NM_022765.3	NP_073602.3	Q8TDZ2	MICA1_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 1	356	Monooxygenase domain. {ECO:0000250}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of protein phosphorylation (GO:0001933)|oxidation-reduction process (GO:0055114)|signal transduction (GO:0007165)|sulfur oxidation (GO:0019417)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		AGGCTGCCCATGGGCATCCTG	0.607																																					p.H356L		Atlas-SNP	.											.	MICAL1	79	.	0			c.A1067T						.						45.0	47.0	47.0					6																	109771627		2203	4300	6503	SO:0001583	missense	64780	exon8			TGCCCATGGGCAT	AB048948	CCDS5076.1, CCDS55047.1	6q21	2013-03-26	2013-03-26	2005-02-16	ENSG00000135596	ENSG00000135596			20619	protein-coding gene	gene with protein product		607129	"""NEDD9 interacting protein with calponin homology and LIM domains"""	NICAL		11827972	Standard	NM_022765		Approved	MICAL, FLJ11937, DKFZp434B1517, FLJ21739	uc003ptk.3	Q8TDZ2	OTTHUMG00000015350	ENST00000358807.3:c.1067A>T	chr6.hg19:g.109771627T>A	ENSP00000351664:p.His356Leu	150.0	0.0		172.0	65.0	NM_022765	B7Z3R5|E1P5F0|Q7Z633|Q8IVS9|Q96G47|Q9H6X6|Q9H7I0|Q9HAA1|Q9UFF7	Missense_Mutation	SNP	ENST00000358807.3	hg19	CCDS5076.1	.	.	.	.	.	.	.	.	.	.	T	5.314	0.243239	0.10077	.	.	ENSG00000135596	ENST00000358807;ENST00000368952	T;T	0.10763	2.84;2.84	4.5	-2.96	0.05547	.	1.530710	0.03256	N	0.182578	T	0.02727	0.0082	L	0.33485	1.01	0.09310	N	0.999999	B;B	0.06786	0.0;0.001	B;B	0.06405	0.002;0.001	T	0.44128	-0.9348	10	0.25751	T	0.34	.	11.1259	0.48317	0.0:0.5699:0.0:0.4301	.	375;356	B7Z3R5;Q8TDZ2	.;MICA1_HUMAN	L	356;375	ENSP00000351664:H356L;ENSP00000357948:H375L	ENSP00000351664:H356L	H	-	2	0	MICAL1	109878320	0.000000	0.05858	0.013000	0.15412	0.161000	0.22273	-2.004000	0.01461	-0.346000	0.08312	0.460000	0.39030	CAT	.	.		0.607	MICAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041759.2	NM_022765	
ZBTB24	9841	hgsc.bcm.edu	37	6	109803061	109803061	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:109803061C>A	ENST00000230122.3	-	2	336	c.169G>T	c.(169-171)Gcc>Tcc	p.A57S		NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	57	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		TCACTACTGGCAGCAAGTAAG	0.463																																					p.A57S		Atlas-SNP	.											.	ZBTB24	64	.	0			c.G169T						.						103.0	99.0	101.0					6																	109803061		2203	4300	6503	SO:0001583	missense	9841	exon2			TACTGGCAGCAAG	AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.169G>T	chr6.hg19:g.109803061C>A	ENSP00000230122:p.Ala57Ser	144.0	0.0		172.0	59.0	NM_014797	Q17RC6|Q5TED5|Q8N455	Missense_Mutation	SNP	ENST00000230122.3	hg19	CCDS34509.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536654	0.85812	.	.	ENSG00000112365	ENST00000230122	T	0.72725	-0.68	5.55	5.55	0.83447	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.75606	0.3872	L	0.43598	1.365	0.52501	D	0.999956	D;D	0.89917	1.0;0.978	D;P	0.79784	0.993;0.829	T	0.72659	-0.4226	9	.	.	.	-19.395	19.4993	0.95086	0.0:1.0:0.0:0.0	.	57;57	O43167-2;O43167	.;ZBT24_HUMAN	S	57	ENSP00000230122:A57S	.	A	-	1	0	ZBTB24	109909754	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.336000	0.79245	2.598000	0.87819	0.655000	0.94253	GCC	.	.		0.463	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041758.1	NM_014797	
SERINC1	57515	hgsc.bcm.edu	37	6	122777722	122777722	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:122777722C>T	ENST00000339697.4	-	3	359	c.275G>A	c.(274-276)cGt>cAt	p.R92H		NM_020755.2	NP_065806.1	Q9NRX5	SERC1_HUMAN	serine incorporator 1	92					L-serine transport (GO:0015825)|phosphatidylserine metabolic process (GO:0006658)|phospholipid biosynthetic process (GO:0008654)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(2)|ovary(1)|skin(1)	13				GBM - Glioblastoma multiforme(226;0.126)		AAAGCACAAACGATATACAGC	0.378																																					p.R92H		Atlas-SNP	.											.	SERINC1	39	.	0			c.G275A						.						139.0	121.0	127.0					6																	122777722		2203	4300	6503	SO:0001583	missense	57515	exon3			CACAAACGATATA	AF087902	CCDS5125.1	6q22.32	2006-02-09	2005-10-14	2005-10-14	ENSG00000111897	ENSG00000111897			13464	protein-coding gene	gene with protein product		614548	"""tumor differentially expressed 2"""	TDE2		10637174	Standard	NM_020755		Approved	TMS-2, TDE1L, KIAA1253	uc003pyy.1	Q9NRX5	OTTHUMG00000015487	ENST00000339697.4:c.275G>A	chr6.hg19:g.122777722C>T	ENSP00000342962:p.Arg92His	151.0	0.0		180.0	24.0	NM_020755	B3KY69|E1P565|O75655|Q7Z2F5|Q8TAG1|Q9NTH8|Q9ULG7	Missense_Mutation	SNP	ENST00000339697.4	hg19	CCDS5125.1	.	.	.	.	.	.	.	.	.	.	C	35	5.566533	0.96540	.	.	ENSG00000111897	ENST00000339697;ENST00000368454	T;T	0.33438	1.41;1.41	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.63908	0.2551	M	0.93808	3.46	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.72802	-0.4183	10	0.72032	D	0.01	-15.0022	20.1551	0.98106	0.0:1.0:0.0:0.0	.	92	Q9NRX5	SERC1_HUMAN	H	92	ENSP00000342962:R92H;ENSP00000357439:R92H	ENSP00000342962:R92H	R	-	2	0	SERINC1	122819421	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.760000	0.94817	0.655000	0.94253	CGT	.	.		0.378	SERINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042031.2	NM_020755	
RMND1	55005	hgsc.bcm.edu	37	6	151748616	151748616	+	Splice_Site	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:151748616C>T	ENST00000367303.4	-	6	953		c.e6+1		RMND1_ENST00000336451.3_Splice_Site	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)						translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		AAGTTGCTTACTCTATTTTTA	0.313																																					.		Atlas-SNP	.											.	RMND1	32	.	0			c.830+1G>A						.						90.0	87.0	88.0					6																	151748616		2201	4298	6499	SO:0001630	splice_region_variant	55005	exon7			TGCTTACTCTATT	AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.830+1G>A	chr6.hg19:g.151748616C>T		66.0	0.0		88.0	23.0	NM_017909	A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Splice_Site	SNP	ENST00000367303.4	hg19	CCDS5232.1	.	.	.	.	.	.	.	.	.	.	C	15.58	2.877040	0.51801	.	.	ENSG00000155906	ENST00000336451;ENST00000367303;ENST00000444024	.	.	.	5.77	4.9	0.64082	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.226	0.65860	0.0:0.9278:0.0:0.0722	.	.	.	.	.	-1	.	.	.	-	.	.	RMND1	151790309	1.000000	0.71417	1.000000	0.80357	0.539000	0.34962	6.121000	0.71602	1.443000	0.47586	0.544000	0.68410	.	.	.		0.313	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042718.2	NM_017909	Intron
SYNE1	23345	hgsc.bcm.edu	37	6	152540223	152540223	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:152540223G>A	ENST00000367255.5	-	120	22560	c.21959C>T	c.(21958-21960)tCa>tTa	p.S7320L	SYNE1_ENST00000448038.1_Missense_Mutation_p.S7249L|SYNE1_ENST00000341594.5_Missense_Mutation_p.S6932L|SYNE1_ENST00000423061.1_Missense_Mutation_p.S7249L|SYNE1_ENST00000356820.4_Missense_Mutation_p.S1844L|SYNE1_ENST00000265368.4_Missense_Mutation_p.S7320L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	7320					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGAATAGCTGATGCTGCGGA	0.478										HNSCC(10;0.0054)																											p.S7320L		Atlas-SNP	.											.	SYNE1	3227	.	0			c.C21959T						.						146.0	140.0	142.0					6																	152540223		2203	4300	6503	SO:0001583	missense	23345	exon120			ATAGCTGATGCTG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.21959C>T	chr6.hg19:g.152540223G>A	ENSP00000356224:p.Ser7320Leu	69.0	0.0		96.0	30.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	G	8.359	0.832658	0.16820	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820;ENST00000367251	T;T;T;T;T;T;T	0.57595	0.48;0.52;0.39;0.52;0.62;2.52;1.59	5.79	3.95	0.45737	.	0.471003	0.18033	N	0.153877	T	0.28599	0.0708	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.28055	0.075;0.075;0.199;0.126	B;B;B;B	0.33620	0.08;0.08;0.167;0.08	T	0.22661	-1.0210	10	0.48119	T	0.1	.	12.4652	0.55753	0.0:0.1284:0.7379:0.1337	.	7320;7320;7249;7249	Q8NF91;E7EQI5;Q8NF91-4;E9PEL9	SYNE1_HUMAN;.;.;.	L	7320;7249;7320;7249;6932;1844;242	ENSP00000356224:S7320L;ENSP00000396024:S7249L;ENSP00000265368:S7320L;ENSP00000390975:S7249L;ENSP00000341887:S6932L;ENSP00000349276:S1844L;ENSP00000356220:S242L	ENSP00000265368:S7320L	S	-	2	0	SYNE1	152581916	0.998000	0.40836	0.002000	0.10522	0.075000	0.17131	6.179000	0.71974	0.740000	0.32651	0.650000	0.86243	TCA	.	.		0.478	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
OPRM1	4988	hgsc.bcm.edu	37	6	154428655	154428655	+	Intron	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:154428655A>G	ENST00000330432.7	+	4	1401				OPRM1_ENST00000337049.4_Intron|OPRM1_ENST00000435918.2_Intron|OPRM1_ENST00000414028.2_Intron|OPRM1_ENST00000518759.1_Intron|OPRM1_ENST00000522555.1_Intron|OPRM1_ENST00000434900.2_Intron|OPRM1_ENST00000419506.2_Missense_Mutation_p.Y407C|OPRM1_ENST00000452687.2_Intron|OPRM1_ENST00000524163.1_Intron|OPRM1_ENST00000522236.1_Intron|OPRM1_ENST00000520708.1_Intron	NM_000914.3	NP_000905.3	P35372	OPRM_HUMAN	opioid receptor, mu 1						adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral response to ethanol (GO:0048149)|calcium ion transmembrane transport (GO:0070588)|cellular response to stress (GO:0033554)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|locomotory behavior (GO:0007626)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of Wnt protein secretion (GO:0061358)|neuropeptide signaling pathway (GO:0007218)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neurogenesis (GO:0050769)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-endorphin receptor activity (GO:0004979)|G-protein alpha-subunit binding (GO:0001965)|G-protein coupled receptor activity (GO:0004930)|morphine receptor activity (GO:0038047)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(15)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	33		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Alvimopan(DB06274)|Amitriptyline(DB00321)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Ethylmorphine(DB01466)|Fentanyl(DB00813)|Heroin(DB01452)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Methylnaltrexone(DB06800)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Ondansetron(DB00904)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Pethidine(DB00454)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	ccactgagctacaatgcaggg	0.418																																					p.Y407C		Atlas-SNP	.											.	OPRM1	241	.	0			c.A1220G						.						140.0	128.0	132.0					6																	154428655		692	1591	2283	SO:0001627	intron_variant	4988	exon4			TGAGCTACAATGC	L29301	CCDS43517.1, CCDS43518.1, CCDS47503.1, CCDS47504.1, CCDS47505.1, CCDS47506.1, CCDS47507.1, CCDS47508.1, CCDS55071.1, CCDS55068.1, CCDS55069.1, CCDS55070.1	6q24-q25	2012-08-08			ENSG00000112038	ENSG00000112038		"""GPCR / Class A : Opioid receptors"""	8156	protein-coding gene	gene with protein product		600018					Standard	NM_001145285		Approved	MOR1	uc003qpo.1	P35372	OTTHUMG00000015870	ENST00000330432.7:c.1165-11163A>G	chr6.hg19:g.154428655A>G		73.0	0.0		106.0	43.0	NM_001145286	B0FXJ1|B2R9S7|B8Q1L7|B8Q1L8|B8Q1L9|E7EWZ3|G8XRH6|G8XRH8|Q12930|Q4VWM1|Q4VWM2|Q4VWM3|Q4VWM4|Q4VWM6|Q4VWX6|Q5TDA1|Q6UPP1|Q6UQ80|Q7Z2D8|Q86V80|Q8IWW3|Q8IWW4|Q9UCZ4|Q9UN57	Missense_Mutation	SNP	ENST00000330432.7	hg19	CCDS55070.1	.	.	.	.	.	.	.	.	.	.	A	0.186	-1.057906	0.01965	.	.	ENSG00000112038	ENST00000419506	T	0.70282	-0.47	0.225	0.225	0.15325	.	.	.	.	.	T	0.43809	0.1264	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39722	-0.9600	5	0.38643	T	0.18	.	.	.	.	.	407	P35372-9	.	C	407	ENSP00000403549:Y407C	ENSP00000403549:Y407C	Y	+	2	0	OPRM1	154470347	0.083000	0.21467	0.068000	0.19968	0.068000	0.16541	0.332000	0.19751	0.257000	0.21650	0.254000	0.18369	TAC	.	.		0.418	OPRM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042786.2	NM_000914	
LFNG	3955	hgsc.bcm.edu	37	7	2564371	2564371	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr7:2564371C>T	ENST00000222725.5	+	2	495	c.475C>T	c.(475-477)Cac>Tac	p.H159Y	LFNG_ENST00000338732.3_Missense_Mutation_p.H30Y|MIR4648_ENST00000580107.1_RNA|LFNG_ENST00000359574.3_Missense_Mutation_p.H159Y|LFNG_ENST00000402045.1_Missense_Mutation_p.H30Y|LFNG_ENST00000402506.1_Missense_Mutation_p.H88Y	NM_001040167.1	NP_001035257.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	159					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		CCTGGCCAGGCACACGGGTGA	0.667																																					p.H159Y		Atlas-SNP	.											.	LFNG	57	.	0			c.C475T						.						22.0	19.0	20.0					7																	2564371		2187	4290	6477	SO:0001583	missense	3955	exon2			GCCAGGCACACGG	BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	ENST00000222725.5:c.475C>T	chr7.hg19:g.2564371C>T	ENSP00000222725:p.His159Tyr	236.0	0.0		280.0	98.0	NM_001040167	B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Missense_Mutation	SNP	ENST00000222725.5	hg19	CCDS34587.1	.	.	.	.	.	.	.	.	.	.	C	11.56	1.675315	0.29783	.	.	ENSG00000106003	ENST00000402506;ENST00000402045;ENST00000338732;ENST00000222725;ENST00000359574	T;T;T;T;T	0.63096	0.97;-0.02;-0.02;-0.02;-0.02	4.83	4.83	0.62350	.	0.287035	0.37669	N	0.001982	T	0.53834	0.1821	L	0.36672	1.1	0.22266	N	0.999246	P;B	0.40681	0.727;0.134	B;B	0.41135	0.331;0.348	T	0.56001	-0.8051	10	0.66056	D	0.02	-15.7766	11.8814	0.52578	0.2998:0.7002:0.0:0.0	.	159;159	Q8NES3-3;Q8NES3	.;LFNG_HUMAN	Y	88;30;30;159;159	ENSP00000385764:H88Y;ENSP00000384786:H30Y;ENSP00000343095:H30Y;ENSP00000222725:H159Y;ENSP00000352579:H159Y	ENSP00000222725:H159Y	H	+	1	0	LFNG	2530897	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.060000	0.49955	2.378000	0.81104	0.655000	0.94253	CAC	.	.		0.667	LFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325021.1	NM_002304	
SP8	221833	hgsc.bcm.edu	37	7	20824970	20824970	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr7:20824970C>T	ENST00000361443.4	-	3	649	c.412G>A	c.(412-414)Ggc>Agc	p.G138S	SP8_ENST00000418710.2_Missense_Mutation_p.G156S	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	138					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						ccgccgccgccgctgcccccg	0.761																																					p.G156S		Atlas-SNP	.											.	SP8	43	.	0			c.G466A						.																																			SO:0001583	missense	221833	exon2			CGCCGCCGCTGCC		CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.412G>A	chr7.hg19:g.20824970C>T	ENSP00000354482:p.Gly138Ser	75.0	0.0		77.0	6.0	NM_182700	Q7Z615|Q7Z616|Q96MJ1	Missense_Mutation	SNP	ENST00000361443.4	hg19	CCDS5372.1	.	.	.	.	.	.	.	.	.	.	C	6.365	0.435495	0.12045	.	.	ENSG00000164651	ENST00000418710;ENST00000361443	D;D	0.81821	-1.54;-1.54	3.09	2.16	0.27623	.	0.366549	0.17990	U	0.155235	T	0.58308	0.2113	N	0.08118	0	0.31008	N	0.719562	D;D	0.55605	0.972;0.972	B;B	0.41860	0.368;0.368	T	0.60005	-0.7347	10	0.08837	T	0.75	.	10.7467	0.46185	0.1919:0.8081:0.0:0.0	.	138;138	Q7Z615;Q8IXZ3	.;SP8_HUMAN	S	156;138	ENSP00000408792:G156S;ENSP00000354482:G138S	ENSP00000354482:G138S	G	-	1	0	SP8	20791495	.	.	0.969000	0.41365	0.291000	0.27294	.	.	0.455000	0.26910	0.306000	0.20318	GGC	.	.		0.761	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326904.2		
ANLN	54443	hgsc.bcm.edu	37	7	36447554	36447554	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr7:36447554C>A	ENST00000265748.2	+	5	1306	c.1085C>A	c.(1084-1086)tCt>tAt	p.S362Y	ANLN_ENST00000396068.2_Missense_Mutation_p.S362Y|ANLN_ENST00000495714.1_3'UTR	NM_018685.2	NP_061155.2	Q9NQW6	ANLN_HUMAN	anillin, actin binding protein	362	Interaction with F-actin.				hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|regulation of exit from mitosis (GO:0007096)|septin ring assembly (GO:0000921)	actin cytoskeleton (GO:0015629)|actomyosin contractile ring (GO:0005826)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(2)|endometrium(5)|kidney(5)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(2)	45						AAAGACAAATCTACGACACCA	0.318																																					p.S362Y		Atlas-SNP	.											.	ANLN	101	.	0			c.C1085A						.						47.0	46.0	47.0					7																	36447554		2202	4299	6501	SO:0001583	missense	54443	exon5			ACAAATCTACGAC	AF273437	CCDS5447.1, CCDS64628.1	7p15-p14	2013-01-10	2006-08-22		ENSG00000011426	ENSG00000011426		"""Pleckstrin homology (PH) domain containing"""	14082	protein-coding gene	gene with protein product			"""anillin (Drosophila Scraps homolog), actin binding protein"", ""anillin, actin binding protein (scraps homolog, Drosophila)"""			10931866	Standard	NM_001284301		Approved	ANILLIN, Scraps, scra	uc003tff.3	Q9NQW6	OTTHUMG00000023143	ENST00000265748.2:c.1085C>A	chr7.hg19:g.36447554C>A	ENSP00000265748:p.Ser362Tyr	83.0	0.0		113.0	17.0	NM_018685	Q5CZ78|Q6NSK5|Q9H8Y4|Q9NVN9|Q9NVP0	Missense_Mutation	SNP	ENST00000265748.2	hg19	CCDS5447.1	.	.	.	.	.	.	.	.	.	.	C	3.727	-0.056405	0.07362	.	.	ENSG00000011426	ENST00000265748;ENST00000396068	T;T	0.12039	2.72;2.72	5.36	4.46	0.54185	.	0.924789	0.09407	N	0.806359	T	0.15262	0.0368	L	0.44542	1.39	0.30086	N	0.808731	B;B;B;B	0.14012	0.003;0.005;0.009;0.005	B;B;B;B	0.09377	0.002;0.002;0.004;0.002	T	0.06862	-1.0803	10	0.54805	T	0.06	-2.0518	12.2565	0.54627	0.0:0.9188:0.0:0.0812	.	239;362;362;362	B4DSL6;A8K5D9;Q9NQW6-2;Q9NQW6	.;.;.;ANLN_HUMAN	Y	362	ENSP00000265748:S362Y;ENSP00000379380:S362Y	ENSP00000265748:S362Y	S	+	2	0	ANLN	36414079	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	2.295000	0.43576	1.557000	0.49525	0.591000	0.81541	TCT	.	.		0.318	ANLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218582.3	NM_018685	
WBSCR28	135886	hgsc.bcm.edu	37	7	73280168	73280168	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr7:73280168A>G	ENST00000320531.2	+	3	799	c.763A>G	c.(763-765)Aca>Gca	p.T255A		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	255						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				AGAGTCTGGAACAGTTTTGCC	0.572																																					p.T255A		Atlas-SNP	.											.	WBSCR28	24	.	0			c.A763G						.						105.0	114.0	112.0					7																	73280168		1979	4159	6138	SO:0001583	missense	135886	exon3			TCTGGAACAGTTT	BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.763A>G	chr7.hg19:g.73280168A>G	ENSP00000316775:p.Thr255Ala	35.0	0.0		33.0	18.0	NM_182504	Q6UE04|Q8NHP4	Missense_Mutation	SNP	ENST00000320531.2	hg19	CCDS43597.1	.	.	.	.	.	.	.	.	.	.	a	8.344	0.829444	0.16749	.	.	ENSG00000175877	ENST00000320531	T	0.17054	2.3	3.75	-0.432	0.12291	.	1.335060	0.05287	N	0.520448	T	0.08133	0.0203	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33752	-0.9856	10	0.44086	T	0.13	-1.5	2.4764	0.04576	0.1789:0.3625:0.3474:0.1113	.	255	Q6UE05	WBS28_HUMAN	A	255	ENSP00000316775:T255A	ENSP00000316775:T255A	T	+	1	0	WBSCR28	72918104	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.108000	0.15396	-0.074000	0.12820	-0.142000	0.14014	ACA	.	.		0.572	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348130.1	NM_182504	
TAF6	6878	hgsc.bcm.edu	37	7	99704953	99704953	+	Silent	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr7:99704953A>G	ENST00000344095.4	-	15	2475	c.1950T>C	c.(1948-1950)gcT>gcC	p.A650A	AP4M1_ENST00000421755.1_Intron|TAF6_ENST00000453269.2_Silent_p.A650A|TAF6_ENST00000452041.1_Silent_p.A650A|TAF6_ENST00000418432.2_Silent_p.A574A|TAF6_ENST00000472509.1_Silent_p.A707A|TAF6_ENST00000437822.2_Silent_p.A687A	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	650					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GACTGTCCCCAGCCTCCTGCT	0.672																																					p.A687A		Atlas-SNP	.											.	TAF6	55	.	0			c.T2061C						.						29.0	36.0	34.0					7																	99704953		2203	4298	6501	SO:0001819	synonymous_variant	6878	exon15			GTCCCCAGCCTCC		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.1950T>C	chr7.hg19:g.99704953A>G		35.0	0.0		49.0	27.0	NM_001190415	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Silent	SNP	ENST00000344095.4	hg19	CCDS5686.1																																																																																			.	.		0.672	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
CALD1	800	hgsc.bcm.edu	37	7	134644750	134644750	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr7:134644750A>C	ENST00000361675.2	+	12	2316	c.2087A>C	c.(2086-2088)aAg>aCg	p.K696T	CALD1_ENST00000422748.1_Missense_Mutation_p.K466T|CALD1_ENST00000495522.1_Missense_Mutation_p.K460T|CALD1_ENST00000424922.1_Missense_Mutation_p.K435T|CALD1_ENST00000393118.2_Missense_Mutation_p.K461T|CALD1_ENST00000543443.1_Missense_Mutation_p.K446T|CALD1_ENST00000417172.1_Missense_Mutation_p.K441T|CALD1_ENST00000361901.2_Missense_Mutation_p.K441T|CALD1_ENST00000361388.2_Missense_Mutation_p.K467T|CALD1_ENST00000466704.1_3'UTR			Q05682	CALD1_HUMAN	caldesmon 1	696					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						AAACCTACAAAGCCGGCAGCC	0.448																																					p.K696T		Atlas-SNP	.											.	CALD1	150	.	0			c.A2087C						.						87.0	81.0	83.0					7																	134644750		2203	4300	6503	SO:0001583	missense	800	exon12			CTACAAAGCCGGC	M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.2087A>C	chr7.hg19:g.134644750A>C	ENSP00000354826:p.Lys696Thr	197.0	0.0		205.0	82.0	NM_033138	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	ENST00000361675.2	hg19	CCDS5835.1	.	.	.	.	.	.	.	.	.	.	A	18.38	3.612287	0.66672	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000432646;ENST00000361675;ENST00000361901;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53;0.53	5.74	5.74	0.90152	.	0.000000	0.53938	D	0.000045	T	0.74442	0.3717	M	0.81682	2.555	0.48341	D	0.999635	D;D;D;D;D;D;D;D;D;D	0.89917	0.998;0.999;1.0;1.0;0.999;0.999;0.999;0.999;0.999;1.0	D;D;D;D;D;D;D;D;D;D	0.87578	0.978;0.981;0.989;0.989;0.981;0.981;0.962;0.981;0.989;0.998	T	0.78239	-0.2281	10	0.72032	D	0.01	-32.6572	16.0292	0.80564	1.0:0.0:0.0:0.0	.	390;446;466;460;435;461;441;467;696;441	B4DPW5;F5H1Z9;A8K0X1;E7EX44;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;.;.;CALD1_HUMAN;.	T	441;441;467;466;74;696;441;461;435;460;446	ENSP00000398826:K441T;ENSP00000411476:K441T;ENSP00000355000:K467T;ENSP00000395710:K466T;ENSP00000354826:K696T;ENSP00000354513:K441T;ENSP00000376826:K461T;ENSP00000393621:K435T;ENSP00000419673:K460T;ENSP00000445641:K446T	ENSP00000355000:K467T	K	+	2	0	CALD1	134295290	1.000000	0.71417	0.983000	0.44433	0.234000	0.25298	4.742000	0.62103	2.187000	0.69744	0.533000	0.62120	AAG	.	.		0.448	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339939.1	NM_033138	
MYOM2	9172	hgsc.bcm.edu	37	8	2054372	2054372	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr8:2054372G>T	ENST00000262113.4	+	23	3124	c.2983G>T	c.(2983-2985)Gtt>Ttt	p.V995F	MYOM2_ENST00000523438.1_Missense_Mutation_p.V420F	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	995	Ig-like C2-type 3.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		CTCCAGTTTTGTTCTGGACCC	0.408																																					p.V995F		Atlas-SNP	.											.	MYOM2	251	.	0			c.G2983T						.						82.0	80.0	81.0					8																	2054372		2203	4300	6503	SO:0001583	missense	9172	exon23			AGTTTTGTTCTGG		CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.2983G>T	chr8.hg19:g.2054372G>T	ENSP00000262113:p.Val995Phe	148.0	0.0		81.0	56.0	NM_003970	Q7Z3Y2	Missense_Mutation	SNP	ENST00000262113.4	hg19	CCDS5957.1	.	.	.	.	.	.	.	.	.	.	G	7.702	0.693259	0.15039	.	.	ENSG00000036448	ENST00000262113;ENST00000523438	T;T	0.54071	0.59;0.76	5.33	4.45	0.53987	Immunoglobulin-like (1);	0.241386	0.42548	D	0.000687	T	0.47838	0.1467	M	0.63428	1.95	0.09310	N	0.999996	P	0.35208	0.49	B	0.32624	0.149	T	0.47959	-0.9076	10	0.52906	T	0.07	.	10.678	0.45797	0.2029:0.0:0.7971:0.0	.	995	P54296	MYOM2_HUMAN	F	995;420	ENSP00000262113:V995F;ENSP00000428396:V420F	ENSP00000262113:V995F	V	+	1	0	MYOM2	2041779	0.024000	0.19004	0.009000	0.14445	0.101000	0.19017	1.411000	0.34702	1.239000	0.43787	0.655000	0.94253	GTT	.	.		0.408	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251249.1	NM_003970	
FNTA	2339	hgsc.bcm.edu	37	8	42938314	42938314	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr8:42938314A>C	ENST00000302279.3	+	7	1030	c.836A>C	c.(835-837)tAt>tCt	p.Y279S	FNTA_ENST00000342116.4_Missense_Mutation_p.Y212S|FNTA_ENST00000529687.1_Missense_Mutation_p.Y128S	NM_002027.2	NP_002018.1	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha	279					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|phototransduction, visible light (GO:0007603)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of tubulin deacetylation (GO:0090044)|protein farnesylation (GO:0018343)|protein geranylgeranylation (GO:0018344)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transforming growth factor beta receptor signaling pathway (GO:0007179)	CAAX-protein geranylgeranyltransferase complex (GO:0005953)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule associated complex (GO:0005875)|protein farnesyltransferase complex (GO:0005965)	alpha-tubulin binding (GO:0043014)|CAAX-protein geranylgeranyltransferase activity (GO:0004662)|microtubule binding (GO:0008017)|protein farnesyltransferase activity (GO:0004660)|protein geranylgeranyltransferase activity (GO:0004661)			cervix(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(8)|ovary(1)|prostate(1)|urinary_tract(1)	16	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			GCATGGAACTATTTGAAAGGG	0.299																																					p.Y279S		Atlas-SNP	.											.	FNTA	34	.	0			c.A836C						.						81.0	93.0	89.0					8																	42938314		2203	4300	6503	SO:0001583	missense	2339	exon7			GGAACTATTTGAA	L10413	CCDS6140.1	8p11.21	2011-06-27			ENSG00000168522	ENSG00000168522		"""Prenyltransferase alpha subunit repeat containing"""	3782	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 2"""	134635				8276393	Standard	NR_033698		Approved	FPTA, PGGT1A, PTAR2	uc003xps.3	P49354	OTTHUMG00000165279	ENST00000302279.3:c.836A>C	chr8.hg19:g.42938314A>C	ENSP00000303423:p.Tyr279Ser	489.0	0.0		300.0	168.0	NM_002027	A6NJW0|Q53XJ9|Q9UDC1	Missense_Mutation	SNP	ENST00000302279.3	hg19	CCDS6140.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.970218	0.74246	.	.	ENSG00000168522	ENST00000302279;ENST00000342116;ENST00000533336	.	.	.	4.8	4.8	0.61643	Protein prenyltransferase (1);	0.000000	0.85682	D	0.000000	D	0.85243	0.5652	M	0.93808	3.46	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.88768	0.3262	9	0.87932	D	0	-16.0628	12.5844	0.56408	1.0:0.0:0.0:0.0	.	212;188;279	P49354-2;A8MVX8;P49354	.;.;FNTA_HUMAN	S	279;212;217	.	ENSP00000303423:Y279S	Y	+	2	0	FNTA	43057471	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.998000	0.93550	1.935000	0.56089	0.477000	0.44152	TAT	.	.		0.299	FNTA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383178.1	NM_002027	
FAM91A1	157769	hgsc.bcm.edu	37	8	124787447	124787447	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr8:124787447A>G	ENST00000334705.7	+	3	464	c.218A>G	c.(217-219)gAt>gGt	p.D73G	FAM91A1_ENST00000521166.1_Missense_Mutation_p.D73G	NM_144963.2	NP_659400	Q658Y4	F91A1_HUMAN	family with sequence similarity 91, member A1	73										breast(4)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	28	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			TACAGCCGAGATCATCTCATG	0.383																																					p.D73G		Atlas-SNP	.											.	FAM91A1	77	.	0			c.A218G						.						112.0	102.0	105.0					8																	124787447		1929	4138	6067	SO:0001583	missense	157769	exon3			GCCGAGATCATCT	AK074370	CCDS6346.2	8q24.13	2005-10-04			ENSG00000176853	ENSG00000176853			26306	protein-coding gene	gene with protein product						12477932	Standard	XM_005250806		Approved	FLJ23790	uc003yqv.3	Q658Y4	OTTHUMG00000133021	ENST00000334705.7:c.218A>G	chr8.hg19:g.124787447A>G	ENSP00000335082:p.Asp73Gly	112.0	0.0		218.0	20.0	NM_144963	B6YY23|Q658T5|Q8TE89	Missense_Mutation	SNP	ENST00000334705.7	hg19	CCDS6346.2	.	.	.	.	.	.	.	.	.	.	A	15.77	2.932100	0.52866	.	.	ENSG00000176853	ENST00000521166;ENST00000334705;ENST00000395537	T;T	0.44083	0.93;1.52	5.33	5.33	0.75918	.	0.120960	0.53938	U	0.000057	T	0.33789	0.0875	N	0.22421	0.69	0.80722	D	1	B;B	0.23185	0.081;0.081	B;B	0.28784	0.094;0.094	T	0.12889	-1.0530	10	0.48119	T	0.1	.	15.3017	0.73958	1.0:0.0:0.0:0.0	.	73;73	E7ER68;Q658Y4	.;F91A1_HUMAN	G	73	ENSP00000429491:D73G;ENSP00000335082:D73G	ENSP00000335082:D73G	D	+	2	0	FAM91A1	124856628	1.000000	0.71417	0.922000	0.36590	0.606000	0.37113	9.139000	0.94554	2.019000	0.59389	0.533000	0.62120	GAT	.	.		0.383	FAM91A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256607.1	NM_144963	
SMARCA2	6595	hgsc.bcm.edu	37	9	2070419	2070419	+	Splice_Site	SNP	A	A	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr9:2070419A>C	ENST00000382203.1	+	10	1903	c.1694A>C	c.(1693-1695)aAg>aCg	p.K565T	SMARCA2_ENST00000357248.2_Splice_Site_p.K565T|SMARCA2_ENST00000349721.2_Splice_Site_p.K565T|SMARCA2_ENST00000382194.1_Splice_Site_p.K565T			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	565					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		GTTTTGCAGAAGGCTGAGGAG	0.483																																					p.K565T		Atlas-SNP	.											.	SMARCA2	313	.	0			c.A1694C						.						179.0	151.0	161.0					9																	2070419		2203	4300	6503	SO:0001630	splice_region_variant	6595	exon10			TGCAGAAGGCTGA	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.1693-1A>C	chr9.hg19:g.2070419A>C		141.0	0.0		127.0	52.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	hg19	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.237751	0.79800	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	D;D;D;D	0.88354	-2.36;-2.37;-2.36;-2.37	5.64	5.64	0.86602	.	0.126714	0.52532	D	0.000063	T	0.81814	0.4902	L	0.29908	0.895	0.80722	D	1	B;P;B	0.36535	0.14;0.557;0.421	B;B;B	0.33890	0.091;0.172;0.118	T	0.79815	-0.1644	10	0.15952	T	0.53	-38.2952	15.6824	0.77381	1.0:0.0:0.0:0.0	.	166;565;565	B4DK35;P51531-2;P51531	.;.;SMCA2_HUMAN	T	565	ENSP00000265773:K565T;ENSP00000349788:K565T;ENSP00000371638:K565T;ENSP00000371629:K565T	ENSP00000265773:K565T	K	+	2	0	SMARCA2	2060419	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.426000	0.73374	2.367000	0.80283	0.528000	0.53228	AAG	.	.		0.483	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	Missense_Mutation
BNC2	54796	hgsc.bcm.edu	37	9	16738420	16738420	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr9:16738420C>A	ENST00000380672.4	-	2	124	c.67G>T	c.(67-69)Gag>Tag	p.E23*	BNC2_ENST00000380667.2_Nonsense_Mutation_p.E23*|BNC2_ENST00000380666.2_Nonsense_Mutation_p.E23*|BNC2_ENST00000545497.1_Intron	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		CAGTCTTGCTCACTAAGCCTG	0.443																																					p.E23X		Atlas-SNP	.											.	BNC2	166	.	0			c.G67T						.						176.0	143.0	154.0					9																	16738420		2203	4300	6503	SO:0001587	stop_gained	54796	exon2			CTTGCTCACTAAG	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.67G>T	chr9.hg19:g.16738420C>A	ENSP00000370047:p.Glu23*	139.0	0.0		163.0	72.0	NM_017637		Nonsense_Mutation	SNP	ENST00000380672.4	hg19	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	C	36	5.804736	0.96967	.	.	ENSG00000173068	ENST00000380672;ENST00000456672;ENST00000436939;ENST00000380667;ENST00000380666;ENST00000540340	.	.	.	3.75	2.86	0.33363	.	0.356329	0.20282	N	0.095439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-1.5509	7.3435	0.26650	0.0:0.8803:0.0:0.1197	.	.	.	.	X	23	.	ENSP00000370041:E23X	E	-	1	0	BNC2	16728420	0.000000	0.05858	0.096000	0.21009	0.949000	0.60115	0.497000	0.22514	1.168000	0.42723	0.579000	0.79373	GAG	.	.		0.443	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
COL5A1	1289	hgsc.bcm.edu	37	9	137707833	137707833	+	Splice_Site	SNP	C	C	T	rs151115748		TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr9:137707833C>T	ENST00000371817.3	+	52	4535	c.4121C>T	c.(4120-4122)aCg>aTg	p.T1374M		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1374	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		CCCGGGCAGACGGTGAGTCCA	0.552																																					p.T1374M		Atlas-SNP	.											.	COL5A1	323	.	0			c.C4121T						.	C	MET/THR	0,4406		0,0,2203	145.0	132.0	137.0		4121	5.2	1.0	9	dbSNP_134	137	3,8597	3.0+/-9.4	0,3,4297	yes	missense-near-splice	COL5A1	NM_000093.3	81	0,3,6500	TT,TC,CC		0.0349,0.0,0.0231	probably-damaging	1374/1839	137707833	3,13003	2203	4300	6503	SO:0001630	splice_region_variant	1289	exon52			GGCAGACGGTGAG	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.4122+1C>T	chr9.hg19:g.137707833C>T		181.0	0.0		210.0	75.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	hg19	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	C	18.81	3.703132	0.68501	0.0	3.49E-4	ENSG00000130635	ENST00000371817	D	0.93763	-3.28	5.2	5.2	0.72013	.	0.141091	0.47852	U	0.000217	D	0.91099	0.7198	N	0.16602	0.42	0.49389	D	0.999785	D	0.67145	0.996	P	0.50490	0.642	D	0.92941	0.6372	10	0.87932	D	0	.	18.7294	0.91730	0.0:1.0:0.0:0.0	.	1374	P20908	CO5A1_HUMAN	M	1374	ENSP00000360882:T1374M	ENSP00000360882:T1374M	T	+	2	0	COL5A1	136847654	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	7.742000	0.85008	2.404000	0.81709	0.551000	0.68910	ACG	.	C|1.000;T|0.000		0.552	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	Missense_Mutation
AKR1C1	1645	hgsc.bcm.edu	37	10	5009211	5009211	+	Silent	SNP	T	T	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr10:5009211T>G	ENST00000380872.4	+	3	537	c.345T>G	c.(343-345)ctT>ctG	p.L115L	AKR1C1_ENST00000434459.2_Silent_p.L115L|AKR1C1_ENST00000380859.1_Silent_p.L117L|AKR1C1_ENST00000477661.1_3'UTR	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	115					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	ACCTCTACCTTATTCATTTTC	0.383																																					p.L115L	Colon(130;2054 2316 13360 15380)	Atlas-SNP	.											.	AKR1C1	39	.	0			c.T345G						.						120.0	110.0	113.0					10																	5009211		2203	4300	6503	SO:0001819	synonymous_variant	1645	exon3			CTACCTTATTCAT	D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.345T>G	chr10.hg19:g.5009211T>G		198.0	0.0		168.0	16.0	NM_001353	P52896|Q5SR15|Q7M4N2|Q9UCX2	Silent	SNP	ENST00000380872.4	hg19	CCDS7061.1	.	.	.	.	.	.	.	.	.	.	T	3.872	-0.027723	0.07589	.	.	ENSG00000187134	ENST00000442997	.	.	.	2.95	0.525	0.17072	.	0.426776	0.20623	N	0.088733	.	.	.	.	.	.	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.4217	0.16403	0.0:0.2949:0.0:0.7051	.	.	.	.	X	82	.	ENSP00000416415:L82X	L	+	2	0	AKR1C1	4999211	0.974000	0.33945	0.027000	0.17364	0.019000	0.09904	-0.024000	0.12435	-0.002000	0.14469	0.254000	0.18369	TTA	.	.		0.383	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046523.2	NM_001353	
FZD8	8325	hgsc.bcm.edu	37	10	35930025	35930025	+	Silent	SNP	G	G	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr10:35930025G>A	ENST00000374694.1	-	1	337	c.333C>T	c.(331-333)tgC>tgT	p.C111C	MIR4683_ENST00000579659.1_RNA	NM_031866.2	NP_114072.1	Q9H461	FZD8_HUMAN	frizzled class receptor 8	111	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	11						TGGCGCGCTCGCACACCGAGC	0.682																																					p.C111C		Atlas-SNP	.											.	FZD8	41	.	0			c.C333T						.						23.0	26.0	25.0					10																	35930025		2200	4297	6497	SO:0001819	synonymous_variant	8325	exon1			GCGCTCGCACACC	AB043703	CCDS7192.1	10p11.2	2014-01-29	2014-01-29		ENSG00000177283	ENSG00000177283		"""GPCR / Class F : Frizzled receptors"""	4046	protein-coding gene	gene with protein product		606146	"""frizzled (Drosophila) homolog 8"", ""frizzled homolog 8 (Drosophila)"", ""frizzled 8, seven transmembrane spanning receptor"", ""frizzled family receptor 8"""			11295046	Standard	NM_031866		Approved		uc001iyz.1	Q9H461	OTTHUMG00000017956	ENST00000374694.1:c.333C>T	chr10.hg19:g.35930025G>A		38.0	0.0		63.0	14.0	NM_031866		Silent	SNP	ENST00000374694.1	hg19	CCDS7192.1																																																																																			.	.		0.682	FZD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047575.2	NM_031866	
RBP3	5949	hgsc.bcm.edu	37	10	48388584	48388584	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr10:48388584A>G	ENST00000224600.4	-	1	2407	c.2294T>C	c.(2293-2295)gTg>gCg	p.V765A	AL731561.2_ENST00000581861.1_RNA	NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	765	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	TACCAGCCGCACCAGCTGTGG	0.647																																					p.V765A		Atlas-SNP	.											.	RBP3	152	.	0			c.T2294C						.						29.0	29.0	29.0					10																	48388584		2201	4299	6500	SO:0001583	missense	5949	exon1			AGCCGCACCAGCT	M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.2294T>C	chr10.hg19:g.48388584A>G	ENSP00000224600:p.Val765Ala	100.0	0.0		109.0	34.0	NM_002900	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	ENST00000224600.4	hg19	CCDS7218.1	.	.	.	.	.	.	.	.	.	.	A	11.50	1.658498	0.29425	.	.	ENSG00000107618	ENST00000224600	T	0.65916	-0.18	5.53	5.53	0.82687	Interphotoreceptor retinol-binding (2);	0.309269	0.28828	N	0.014018	T	0.59865	0.2225	L	0.48877	1.53	0.47949	D	0.999556	P	0.43938	0.822	B	0.42625	0.393	T	0.65504	-0.6152	10	0.87932	D	0	-20.2627	14.8399	0.70214	1.0:0.0:0.0:0.0	.	765	P10745	RET3_HUMAN	A	765	ENSP00000224600:V765A	ENSP00000224600:V765A	V	-	2	0	RBP3	48008590	0.569000	0.26643	0.954000	0.39281	0.020000	0.10135	5.629000	0.67798	2.109000	0.64355	0.533000	0.62120	GTG	.	.		0.647	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047888.1	NM_002900	
ZRANB1	54764	hgsc.bcm.edu	37	10	126655297	126655297	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr10:126655297C>T	ENST00000359653.4	+	2	1320	c.949C>T	c.(949-951)Cac>Tac	p.H317Y		NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	317					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		TACTCTTGTACACTTGGCTAT	0.413																																					p.H317Y		Atlas-SNP	.											.	ZRANB1	60	.	0			c.C949T						.						262.0	193.0	217.0					10																	126655297		2203	4300	6503	SO:0001583	missense	54764	exon2			CTTGTACACTTGG	AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.949C>T	chr10.hg19:g.126655297C>T	ENSP00000352676:p.His317Tyr	125.0	0.0		121.0	30.0	NM_017580	B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	ENST00000359653.4	hg19	CCDS7642.1	.	.	.	.	.	.	.	.	.	.	C	33	5.261754	0.95368	.	.	ENSG00000019995	ENST00000359653	T	0.22539	1.95	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.50069	0.1594	M	0.73962	2.25	0.80722	D	1	D	0.63046	0.992	D	0.71656	0.974	T	0.47289	-0.9129	10	0.87932	D	0	-28.9487	20.2789	0.98501	0.0:1.0:0.0:0.0	.	317	Q9UGI0	ZRAN1_HUMAN	Y	317	ENSP00000352676:H317Y	ENSP00000352676:H317Y	H	+	1	0	ZRANB1	126645287	1.000000	0.71417	0.974000	0.42286	0.995000	0.86356	7.461000	0.80834	2.788000	0.95919	0.650000	0.86243	CAC	.	.		0.413	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050898.1	NM_017580	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33628245	33628245	+	Silent	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr11:33628245C>A	ENST00000321505.4	+	13	4227	c.4047C>A	c.(4045-4047)gcC>gcA	p.A1349A	KIAA1549L_ENST00000389726.3_Silent_p.A1355A			Q6ZVL6	K154L_HUMAN	KIAA1549-like	1349						integral component of membrane (GO:0016021)											GCAAGGTGGCCGCTGAACCCT	0.542																																					p.A1349A		Atlas-SNP	.											.	.	.	.	0			c.C4047A						.						64.0	70.0	68.0					11																	33628245		2041	4195	6236	SO:0001819	synonymous_variant	25758	exon13			GGTGGCCGCTGAA	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.4047C>A	chr11.hg19:g.33628245C>A		125.0	0.0		136.0	58.0	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	hg19	CCDS44565.2	.	.	.	.	.	.	.	.	.	.	C	2.219	-0.378866	0.05000	.	.	ENSG00000110427	ENST00000526400	.	.	.	5.43	-8.09	0.01090	.	.	.	.	.	T	0.17789	0.0427	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28364	-1.0046	4	.	.	.	-3.1816	4.2001	0.10462	0.192:0.4617:0.154:0.1923	.	.	.	.	Q	747	.	.	P	+	2	0	C11orf41	33584821	0.000000	0.05858	0.019000	0.16419	0.288000	0.27193	-2.415000	0.01036	-0.899000	0.03901	-0.367000	0.07326	CCG	.	.		0.542	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
PDGFD	80310	hgsc.bcm.edu	37	11	103780494	103780494	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr11:103780494C>A	ENST00000393158.2	-	7	1220	c.1041G>T	c.(1039-1041)atG>atT	p.M347I	PDGFD_ENST00000302251.5_Missense_Mutation_p.M341I			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	347					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		CAACTAGAGCCATGGTCTTAG	0.463																																					p.M347I		Atlas-SNP	.											.	PDGFD	125	.	0			c.G1041T						.						319.0	257.0	278.0					11																	103780494		2202	4299	6501	SO:0001583	missense	80310	exon7			TAGAGCCATGGTC	AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.1041G>T	chr11.hg19:g.103780494C>A	ENSP00000376865:p.Met347Ile	123.0	0.0		122.0	42.0	NM_025208	A8K9T6|Q9BWV5	Missense_Mutation	SNP	ENST00000393158.2	hg19	CCDS41703.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592965	0.46214	.	.	ENSG00000170962	ENST00000393158;ENST00000302251	T;T	0.25414	1.8;1.8	5.91	5.91	0.95273	Platelet-derived growth factor (PDGF) (3);	0.082351	0.85682	D	0.000000	T	0.49966	0.1588	L	0.57536	1.79	0.48830	D	0.999718	D;P	0.54964	0.969;0.885	D;B	0.70227	0.968;0.392	T	0.22034	-1.0228	10	0.42905	T	0.14	-33.239	20.3057	0.98631	0.0:1.0:0.0:0.0	.	347;341	Q9GZP0;Q9GZP0-2	PDGFD_HUMAN;.	I	347;341	ENSP00000376865:M347I;ENSP00000302193:M341I	ENSP00000302193:M341I	M	-	3	0	PDGFD	103285704	1.000000	0.71417	1.000000	0.80357	0.226000	0.24999	4.085000	0.57657	2.791000	0.96007	0.655000	0.94253	ATG	.	.		0.463	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387231.2	NM_025208	
ZNF384	171017	hgsc.bcm.edu	37	12	6777081	6777081	+	Silent	SNP	C	C	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr12:6777081C>T	ENST00000396801.3	-	11	1740	c.1533G>A	c.(1531-1533)caG>caA	p.Q511Q	ZNF384_ENST00000361959.3_Silent_p.Q511Q|RP4-761J14.8_ENST00000586338.1_RNA|RP4-761J14.8_ENST00000589924.1_RNA|ZNF384_ENST00000355772.4_Silent_p.Q395Q|ZNF384_ENST00000319770.3_Silent_p.Q434Q|ZNF384_ENST00000396799.2_Silent_p.Q450Q|ZNF384_ENST00000396795.1_Silent_p.Q450Q	NM_001135734.2	NP_001129206.1	Q8TF68	ZN384_HUMAN	zinc finger protein 384	511	Gln-rich.				nucleocytoplasmic transport (GO:0006913)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	focal adhesion (GO:0005925)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)		EWSR1/ZNF384(4)	breast(3)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(1)	18						gctgctgctgctgctgctgct	0.667			T	"""EWSR1, TAF15 """	ALL																																p.Q511Q		Atlas-SNP	.		Dom	yes		12	12p13	171017	zinc finger protein 384 (CIZ/NMP4)		L	.,4	ZNF384	102	.	0			c.G1533A						.						15.0	19.0	18.0					12																	6777081		2200	4287	6487	SO:0001819	synonymous_variant	171017	exon11			CTGCTGCTGCTGC	U80738	CCDS8557.1, CCDS31732.1, CCDS44817.1	12p12	2013-01-08	2002-05-23	2002-05-24		ENSG00000126746		"""Zinc fingers, C2H2-type"""	11955	protein-coding gene	gene with protein product		609951	"""trinucleotide repeat containing 1"""	TNRC1		9225980, 11149472	Standard	NM_001135734		Approved	CAGH1A, CIZ, NMP4, NP	uc010sfh.2	Q8TF68		ENST00000396801.3:c.1533G>A	chr12.hg19:g.6777081C>T		33.0	0.0		47.0	8.0	NM_001135734	O15407|Q7Z722|Q8N938	Silent	SNP	ENST00000396801.3	hg19	CCDS44817.1																																																																																			.	.		0.667	ZNF384-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400712.1		
CPNE8	144402	hgsc.bcm.edu	37	12	39242371	39242371	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr12:39242371G>A	ENST00000331366.5	-	4	376	c.280C>T	c.(280-282)Cgt>Tgt	p.R94C	CPNE8_ENST00000360449.3_Missense_Mutation_p.R82C	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	94	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)		p.R94C(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				AAGTCAAAACGAAGATTCTCT	0.308																																					p.R94C		Atlas-SNP	.											CPNE8,caecum,carcinoma,0,1	CPNE8	66	.	1	Substitution - Missense(1)	large_intestine(1)	c.C280T						.						34.0	36.0	36.0					12																	39242371		2197	4285	6482	SO:0001583	missense	144402	exon4			CAAAACGAAGATT	AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.280C>T	chr12.hg19:g.39242371G>A	ENSP00000329748:p.Arg94Cys	275.0	0.0		318.0	125.0	NM_153634	Q2TB41|Q86VY2	Missense_Mutation	SNP	ENST00000331366.5	hg19	CCDS8733.1	.	.	.	.	.	.	.	.	.	.	G	18.09	3.545615	0.65198	.	.	ENSG00000139117	ENST00000331366;ENST00000360449	T;T	0.70516	-0.49;-0.49	3.8	3.8	0.43715	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000003	D	0.84401	0.5464	M	0.89287	3.02	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	D	0.86708	0.1934	10	0.87932	D	0	-9.626	10.7166	0.46015	0.0:0.0:0.8086:0.1914	.	94	Q86YQ8	CPNE8_HUMAN	C	94;82	ENSP00000329748:R94C;ENSP00000353633:R82C	ENSP00000329748:R94C	R	-	1	0	CPNE8	37528638	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	4.160000	0.58164	2.045000	0.60652	0.484000	0.47621	CGT	.	.		0.308	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403856.1	NM_153634	
GNPTAB	79158	hgsc.bcm.edu	37	12	102161840	102161840	+	Nonsense_Mutation	SNP	G	G	T	rs377176041		TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr12:102161840G>T	ENST00000299314.7	-	11	1645	c.1383C>A	c.(1381-1383)tgC>tgA	p.C461*	GNPTAB_ENST00000549940.1_Nonsense_Mutation_p.C461*|RNU6-101P_ENST00000410323.1_RNA	NM_024312.4	NP_077288.2	Q3T906	GNPTA_HUMAN	N-acetylglucosamine-1-phosphate transferase, alpha and beta subunits	461			C -> G (in MLIIIA). {ECO:0000269|PubMed:19634183}.		carbohydrate phosphorylation (GO:0046835)|cell differentiation (GO:0030154)|lysosome organization (GO:0007040)|protein secretion (GO:0009306)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|UDP-N-acetylglucosamine-lysosomal-enzyme N-acetylglucosaminephosphotransferase activity (GO:0003976)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	37						CATCCCAATCGCAGGCTGAAT	0.418																																					p.C461X		Atlas-SNP	.											.	GNPTAB	120	.	0			c.C1383A						.						99.0	90.0	93.0					12																	102161840		2203	4300	6503	SO:0001587	stop_gained	79158	exon11			CCAATCGCAGGCT	AY687932	CCDS9088.1	12q23.3	2013-01-10				ENSG00000111670		"""EF-hand domain containing"""	29670	protein-coding gene	gene with protein product		607840		GNPTA		10574462, 16116615	Standard	NM_024312		Approved	KIAA1208, MGC4170	uc001tit.3	Q3T906	OTTHUMG00000170444	ENST00000299314.7:c.1383C>A	chr12.hg19:g.102161840G>T	ENSP00000299314:p.Cys461*	130.0	0.0		119.0	5.0	NM_024312	A2RRQ9|Q3ZQK2|Q6IPW5|Q86TQ2|Q96N13|Q9ULL2	Nonsense_Mutation	SNP	ENST00000299314.7	hg19	CCDS9088.1	.	.	.	.	.	.	.	.	.	.	G	37	6.244113	0.97408	.	.	ENSG00000111670	ENST00000299314;ENST00000549940	.	.	.	5.71	0.637	0.17735	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.3477	9.7664	0.40563	0.7566:0.0:0.2434:0.0	.	.	.	.	X	461	.	ENSP00000299314:C461X	C	-	3	2	GNPTAB	100685971	1.000000	0.71417	0.997000	0.53966	0.873000	0.50193	1.385000	0.34408	-0.035000	0.13691	-1.000000	0.02509	TGC	.	.		0.418	GNPTAB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409182.1		
MYO1H	283446	hgsc.bcm.edu	37	12	109834356	109834356	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr12:109834356A>G	ENST00000431443.2	+	3	410	c.410A>G	c.(409-411)gAc>gGc	p.D137G	MYO1H_ENST00000310903.5_Missense_Mutation_p.D137G	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	137	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						ATAGCCCGTGACAGACTGCTG	0.522																																					p.D137G		Atlas-SNP	.											.	MYO1H	98	.	0			c.A410G						.						68.0	67.0	67.0					12																	109834356		1925	4142	6067	SO:0001583	missense	283446	exon3			CCCGTGACAGACT		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.410A>G	chr12.hg19:g.109834356A>G	ENSP00000444076:p.Asp137Gly	94.0	0.0		98.0	32.0	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	hg19		.	.	.	.	.	.	.	.	.	.	A	23.6	4.430668	0.83776	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.72505	-0.66;-0.66	4.8	4.8	0.61643	.	.	.	.	.	D	0.83797	0.5332	M	0.83223	2.63	0.53688	D	0.99997	D	0.76494	0.999	D	0.66716	0.946	D	0.86693	0.1924	9	0.87932	D	0	.	14.2704	0.66149	1.0:0.0:0.0:0.0	.	137	F5H3C6	.	G	137	ENSP00000439182:D137G;ENSP00000444076:D137G	ENSP00000439182:D137G	D	+	2	0	MYO1H	108318739	1.000000	0.71417	0.995000	0.50966	0.989000	0.77384	9.227000	0.95236	2.112000	0.64535	0.524000	0.50904	GAC	.	.		0.522	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
ATP2A2	488	hgsc.bcm.edu	37	12	110778716	110778716	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr12:110778716G>T	ENST00000539276.2	+	14	2123	c.2014G>T	c.(2014-2016)Gcc>Tcc	p.A672S	ATP2A2_ENST00000308664.6_Missense_Mutation_p.A672S|ATP2A2_ENST00000395494.2_Missense_Mutation_p.A645S			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	672					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						CTGCCTGAACGCCCGCTGTTT	0.512																																					p.A672S		Atlas-SNP	.											.	ATP2A2	78	.	0			c.G2014T						.						55.0	55.0	55.0					12																	110778716		2203	4300	6503	SO:0001583	missense	488	exon14			CTGAACGCCCGCT		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2014G>T	chr12.hg19:g.110778716G>T	ENSP00000440045:p.Ala672Ser	128.0	0.0		153.0	57.0	NM_001681	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	hg19	CCDS9144.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.195941|4.195941	0.78902|0.78902	.|.	.|.	ENSG00000174437|ENSG00000174437	ENST00000308664;ENST00000395494;ENST00000539276|ENST00000548169	D;D;D|.	0.96011|.	-3.88;-3.88;-3.88|.	5.81|5.81	5.81|5.81	0.92471|0.92471	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71358|0.71358	0.3330|0.3330	L|L	0.49350|0.49350	1.555|1.555	0.80722|0.80722	D|D	1|1	B;B;B|.	0.20459|.	0.045;0.001;0.001|.	B;B;B|.	0.22152|.	0.038;0.012;0.02|.	T|T	0.65841|0.65841	-0.6070|-0.6070	10|5	0.48119|.	T|.	0.1|.	.|.	20.0784|20.0784	0.97758|0.97758	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	645;672;672|.	P16615-4;P16615-2;P16615|.	.;.;AT2A2_HUMAN|.	S|L	672;645;672|562	ENSP00000311186:A672S;ENSP00000378872:A645S;ENSP00000440045:A672S|.	ENSP00000311186:A672S|.	A|R	+|+	1|2	0|0	ATP2A2|ATP2A2	109263099|109263099	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.925000|0.925000	0.55904|0.55904	9.869000|9.869000	0.99810|0.99810	2.736000|2.736000	0.93811|0.93811	0.655000|0.655000	0.94253|0.94253	GCC|CGC	.	.		0.512	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
CIT	11113	hgsc.bcm.edu	37	12	120271933	120271933	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr12:120271933T>C	ENST00000261833.7	-	6	668	c.616A>G	c.(616-618)Att>Gtt	p.I206V	CIT_ENST00000392521.2_Missense_Mutation_p.I206V	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	206	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		ACAGCCAAAATCAGCTCAGCT	0.443																																					p.I206V		Atlas-SNP	.											.	CIT	535	.	0			c.A616G						.						130.0	112.0	118.0					12																	120271933		2203	4300	6503	SO:0001583	missense	11113	exon6			CCAAAATCAGCTC	AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.616A>G	chr12.hg19:g.120271933T>C	ENSP00000261833:p.Ile206Val	152.0	0.0		110.0	38.0	NM_001206999	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	ENST00000261833.7	hg19	CCDS9192.1	.	.	.	.	.	.	.	.	.	.	T	2.933	-0.220503	0.06061	.	.	ENSG00000122966	ENST00000392521;ENST00000261833	T;T	0.38240	1.15;1.15	5.45	4.32	0.51571	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.171581	0.37261	N	0.002161	T	0.09512	0.0234	N	0.01257	-0.925	0.41808	D	0.989958	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.28106	-1.0054	10	0.02654	T	1	.	5.1096	0.14802	0.0:0.2646:0.0:0.7354	.	206;206	Q2M5E1;O14578	.;CTRO_HUMAN	V	206	ENSP00000376306:I206V;ENSP00000261833:I206V	ENSP00000261833:I206V	I	-	1	0	CIT	118756316	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	2.199000	0.42715	2.086000	0.62901	0.379000	0.24179	ATT	.	.		0.443	CIT-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000259410.4	NM_007174	
SAP18	10284	hgsc.bcm.edu	37	13	21721331	21721331	+	Silent	SNP	G	G	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr13:21721331G>A	ENST00000607003.1	+	4	344	c.312G>A	c.(310-312)aaG>aaA	p.K104K	SAP18_ENST00000382533.4_Silent_p.K123K			O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa	104	Involved in splicing regulation activity.				mRNA processing (GO:0006397)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	ASAP complex (GO:0061574)|cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			kidney(1)|large_intestine(1)|lung(4)	6		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)		ACAGAGTTAAGGAGATTGGCA	0.408																																					p.K123K		Atlas-SNP	.											.	SAP18	12	.	0			c.G369A						.						91.0	92.0	91.0					13																	21721331		2203	4300	6503	SO:0001819	synonymous_variant	10284	exon4			AGTTAAGGAGATT	U96915	CCDS9295.2	13q12.11	2008-02-05	2006-02-02		ENSG00000150459	ENSG00000150459			10530	protein-coding gene	gene with protein product		602949	"""sin3A-associated protein, 18kDa"""			9150135	Standard	NM_005870		Approved	SAP18p, 2HOR0202, MGC27131	uc001uns.3	O00422	OTTHUMG00000016535	ENST00000607003.1:c.312G>A	chr13.hg19:g.21721331G>A		283.0	0.0		341.0	72.0	NM_005870	B2R494|Q2TTR4|Q6IAW9|Q8N606|Q9UF14	Silent	SNP	ENST00000607003.1	hg19		.	.	.	.	.	.	.	.	.	.	G	8.608	0.888339	0.17540	.	.	ENSG00000150459	ENST00000450573	.	.	.	5.78	3.78	0.43462	.	.	.	.	.	T	0.62816	0.2459	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61628	-0.7024	4	.	.	.	-12.8462	11.9977	0.53212	0.1856:0.0:0.8144:0.0	.	.	.	.	R	118	.	.	G	+	1	0	SAP18	20619331	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.711000	0.37930	1.419000	0.47118	0.591000	0.81541	GGA	.	.		0.408	SAP18-009	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000470725.1	NM_005870	
SACS	26278	hgsc.bcm.edu	37	13	23907171	23907171	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr13:23907171T>G	ENST00000382292.3	-	9	11117	c.10844A>C	c.(10843-10845)aAc>aCc	p.N3615T	SACS_ENST00000402364.1_Missense_Mutation_p.N2865T|SACS_ENST00000382298.3_Missense_Mutation_p.N3615T			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	3615					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		TTTGGACCAGTTTTCTGTATT	0.343																																					p.N3615T		Atlas-SNP	.											SACS_ENST00000382298,NS,adenocarcinoma,0,2	SACS	871	.	0			c.A10844C						.						62.0	65.0	64.0					13																	23907171		2203	4299	6502	SO:0001583	missense	26278	exon10			GACCAGTTTTCTG	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.10844A>C	chr13.hg19:g.23907171T>G	ENSP00000371729:p.Asn3615Thr	153.0	0.0		92.0	23.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	T	12.73	2.026858	0.35797	.	.	ENSG00000151835	ENST00000382292;ENST00000402364;ENST00000382298	D;D;D	0.88124	-2.18;-2.34;-2.18	5.91	5.91	0.95273	.	0.147838	0.64402	D	0.000007	T	0.75925	0.3916	L	0.27053	0.805	0.27877	N	0.939824	P	0.35077	0.483	B	0.27887	0.084	T	0.67673	-0.5610	10	0.21540	T	0.41	.	10.6466	0.45623	0.0:0.0711:0.0:0.9289	.	3615	Q9NZJ4	SACS_HUMAN	T	3615;2865;3615	ENSP00000371729:N3615T;ENSP00000385844:N2865T;ENSP00000371735:N3615T	ENSP00000371729:N3615T	N	-	2	0	SACS	22805171	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.146000	0.58072	2.263000	0.75096	0.379000	0.24179	AAC	.	.		0.343	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
LINC00283	100874057	hgsc.bcm.edu	37	13	103398523	103398524	+	RNA	DNP	AT	AT	CA			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A|T	A|T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr13:103398523_103398524AT>CA	ENST00000430111.1	+	0	3894									long intergenic non-protein coding RNA 283																		GTCCATTAATATGTAGCTCCAG	0.455																																					p.H1508Q|p.H1508L		Atlas-SNP	.											.	.	.	.	0			c.T4524G|c.A4523T						.																																					643677	exon4			ATTAATATGTAGC|TTAATATGTAGCT			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311	Exception_encountered	chr13.hg19:g.103398523_103398524delinsCA		101.0	0.0		140.0|141.0	36.0|37.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.455	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
FOXN3	1112	hgsc.bcm.edu	37	14	89878384	89878384	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr14:89878384T>C	ENST00000345097.4	-	2	553	c.437A>G	c.(436-438)gAa>gGa	p.E146G	RP11-33N16.3_ENST00000555070.1_RNA|RP11-33N16.2_ENST00000556383.1_RNA|FOXN3_ENST00000557258.1_Missense_Mutation_p.E146G|FOXN3_ENST00000555353.1_Missense_Mutation_p.E146G|FOXN3_ENST00000261302.5_Missense_Mutation_p.E146G	NM_001085471.1	NP_001078940.1	O00409	FOXN3_HUMAN	forkhead box N3	146					mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CGGAAAATGTTCCAAGATCCA	0.438																																					p.E146G		Atlas-SNP	.											.	FOXN3	78	.	0			c.A437G						.						82.0	84.0	83.0					14																	89878384		2203	4300	6503	SO:0001583	missense	1112	exon2			AAATGTTCCAAGA		CCDS32138.1, CCDS41977.1	14q32.11	2012-04-17	2007-05-02	2007-05-02	ENSG00000053254	ENSG00000053254		"""Forkhead boxes"""	1928	protein-coding gene	gene with protein product		602628	"""chromosome 14 open reading frame 116"", ""checkpoint suppressor 1"""	C14orf116, CHES1		9154802	Standard	NM_005197		Approved		uc001xxo.4	O00409	OTTHUMG00000170898	ENST00000345097.4:c.437A>G	chr14.hg19:g.89878384T>C	ENSP00000343288:p.Glu146Gly	164.0	0.0		160.0	32.0	NM_005197	Q96II7|Q9UIE7	Missense_Mutation	SNP	ENST00000345097.4	hg19	CCDS41977.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.0|22.0	4.231812|4.231812	0.79688|0.79688	.|.	.|.	ENSG00000053254|ENSG00000053254	ENST00000345097;ENST00000261302;ENST00000557258;ENST00000555353;ENST00000555855|ENST00000556916	D;D;D;D;D|.	0.95885|.	-3.84;-3.84;-3.84;-3.84;-3.84|.	4.99|4.99	4.99|4.99	0.66335|0.66335	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70937|0.70937	0.3281|0.3281	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	B;P|.	0.39480|.	0.368;0.675|.	B;B|.	0.39379|.	0.219;0.298|.	T|T	0.70662|0.70662	-0.4810|-0.4810	10|5	0.66056|.	D|.	0.02|.	.|.	14.9853|14.9853	0.71342|0.71342	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	146;146|.	O00409;O00409-2|.	FOXN3_HUMAN;.|.	G|D	146|7	ENSP00000343288:E146G;ENSP00000261302:E146G;ENSP00000452005:E146G;ENSP00000452227:E146G;ENSP00000451135:E146G|.	ENSP00000261302:E146G|.	E|N	-|-	2|1	0|0	FOXN3|FOXN3	88948137|88948137	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.260000|6.260000	0.72502|0.72502	2.005000|2.005000	0.58758|0.58758	0.374000|0.374000	0.22700|0.22700	GAA|AAC	.	.		0.438	FOXN3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410902.2	NM_005197	
THBS1	7057	hgsc.bcm.edu	37	15	39874930	39874930	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr15:39874930G>T	ENST00000260356.5	+	3	769	c.604G>T	c.(604-606)Ggg>Tgg	p.G202W		NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	202	Laminin G-like.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		CATCGCAAAGGGGGGCGTCAA	0.557																																					p.G202W		Atlas-SNP	.											.	THBS1	106	.	0			c.G604T						.						39.0	37.0	38.0					15																	39874930		2200	4297	6497	SO:0001583	missense	7057	exon3			GCAAAGGGGGGCG		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.604G>T	chr15.hg19:g.39874930G>T	ENSP00000260356:p.Gly202Trp	16.0	0.0		41.0	15.0	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	hg19	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.032978	0.93575	.	.	ENSG00000137801	ENST00000260356	T	0.02395	4.31	5.56	5.56	0.83823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.000000	0.35291	N	0.003319	T	0.16471	0.0396	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00007	-1.2504	10	0.87932	D	0	-13.6668	18.6764	0.91529	0.0:0.0:1.0:0.0	.	202	P07996	TSP1_HUMAN	W	202	ENSP00000260356:G202W	ENSP00000260356:G202W	G	+	1	0	THBS1	37662222	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.419000	0.97397	2.890000	0.99128	0.655000	0.94253	GGG	.	.		0.557	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	
ONECUT1	3175	hgsc.bcm.edu	37	15	53081884	53081884	+	Silent	SNP	T	T	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr15:53081884T>G	ENST00000305901.5	-	1	325	c.198A>C	c.(196-198)ggA>ggC	p.G66G	ONECUT1_ENST00000561401.2_Intron	NM_004498.2	NP_004489.1	Q9UBC0	HNF6_HUMAN	one cut homeobox 1	66					B cell differentiation (GO:0030183)|cell fate commitment (GO:0045165)|cilium assembly (GO:0042384)|endocrine pancreas development (GO:0031018)|endoderm development (GO:0007492)|epithelial cell development (GO:0002064)|glucose metabolic process (GO:0006006)|liver development (GO:0001889)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription, DNA-templated (GO:0006355)|spleen development (GO:0048536)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	17				all cancers(107;0.0708)		GGTGGTAATCTCCGCCGCCGC	0.736																																					p.G66G		Atlas-SNP	.											.	ONECUT1	48	.	0			c.A198C						.						13.0	14.0	13.0					15																	53081884		2187	4277	6464	SO:0001819	synonymous_variant	3175	exon1			GTAATCTCCGCCG	U77975	CCDS10150.1	15q21.3	2012-03-09	2007-07-16		ENSG00000169856	ENSG00000169856		"""Homeoboxes / CUT class"""	8138	protein-coding gene	gene with protein product		604164	"""one cut domain, family member 1"""	HNF6, HNF6A		8887657, 8790352	Standard	NM_004498		Approved	HNF-6	uc002aci.2	Q9UBC0	OTTHUMG00000131899	ENST00000305901.5:c.198A>C	chr15.hg19:g.53081884T>G		19.0	0.0		17.0	7.0	NM_004498	B2RTV4|Q99744|Q9UMR6	Silent	SNP	ENST00000305901.5	hg19	CCDS10150.1																																																																																			.	.		0.736	ONECUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254849.2		
ADAMTS7	11173	hgsc.bcm.edu	37	15	79067100	79067100	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr15:79067100C>A	ENST00000388820.4	-	12	1952	c.1742G>T	c.(1741-1743)cGc>cTc	p.R581L	ADAMTS7_ENST00000566303.1_Intron	NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	581	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						GAAGCGCTTGCGCTCACCCAC	0.647																																					p.R581L		Atlas-SNP	.											.	ADAMTS7	142	.	0			c.G1742T						.						69.0	79.0	76.0					15																	79067100		2196	4292	6488	SO:0001583	missense	11173	exon12			CGCTTGCGCTCAC	AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.1742G>T	chr15.hg19:g.79067100C>A	ENSP00000373472:p.Arg581Leu	28.0	0.0		35.0	6.0	NM_014272	Q14F51|Q6P7J9	Missense_Mutation	SNP	ENST00000388820.4	hg19	CCDS32303.1	.	.	.	.	.	.	.	.	.	.	C	16.48	3.135211	0.56828	.	.	ENSG00000136378	ENST00000388820	T	0.00441	7.41	3.51	3.51	0.40186	.	0.145279	0.42821	D	0.000653	T	0.00875	0.0029	L	0.55743	1.74	0.48762	D	0.999702	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78516	-0.2174	10	0.87932	D	0	.	14.2729	0.66162	0.0:1.0:0.0:0.0	.	581;581	A8MQ00;Q9UKP4	.;ATS7_HUMAN	L	581	ENSP00000373472:R581L	ENSP00000373472:R581L	R	-	2	0	ADAMTS7	76854155	1.000000	0.71417	0.117000	0.21633	0.050000	0.14768	7.439000	0.80444	1.986000	0.57962	0.289000	0.19496	CGC	.	.		0.647	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421331.1	NM_014272	
SMG1	23049	hgsc.bcm.edu	37	16	18841077	18841077	+	Splice_Site	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr16:18841077C>A	ENST00000446231.2	-	54	9546	c.9134G>T	c.(9133-9135)gGa>gTa	p.G3045V	SMG1_ENST00000389467.3_Splice_Site_p.G3045V			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3045					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGAACTTGATCCTACAAAAAG	0.303																																					p.G3045V		Atlas-SNP	.											.	SMG1	401	.	0			c.G9134T						.						28.0	27.0	27.0					16																	18841077		1814	4078	5892	SO:0001630	splice_region_variant	23049	exon54			CTTGATCCTACAA	AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9134-1G>T	chr16.hg19:g.18841077C>A		59.0	0.0		81.0	28.0	NM_015092	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	ENST00000446231.2	hg19	CCDS45430.1	.	.	.	.	.	.	.	.	.	.	C	17.02	3.280822	0.59758	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01185	5.21;5.21	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000004	T	0.04452	0.0122	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.53739	-0.8396	10	0.87932	D	0	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	3045	Q96Q15	SMG1_HUMAN	V	3045	ENSP00000402515:G3045V;ENSP00000374118:G3045V	ENSP00000374118:G3045V	G	-	2	0	SMG1	18748578	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.644000	0.74338	2.890000	0.99128	0.585000	0.79938	GGA	.	.		0.303	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000391817.1	NM_015092	Missense_Mutation
NCOR1	9611	hgsc.bcm.edu	37	17	16040642	16040642	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr17:16040642G>A	ENST00000268712.3	-	14	1749	c.1492C>T	c.(1492-1494)Cgc>Tgc	p.R498C	NCOR1_ENST00000395848.1_Missense_Mutation_p.R389C|NCOR1_ENST00000395851.1_Missense_Mutation_p.R498C|RNU6-862P_ENST00000362804.1_RNA	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	498					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CTGCCTCTGCGTTTCCCATAA	0.373																																					p.R498C		Atlas-SNP	.											.	NCOR1	240	.	0			c.C1492T						.						74.0	69.0	71.0					17																	16040642		2203	4300	6503	SO:0001583	missense	9611	exon13			CTCTGCGTTTCCC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.1492C>T	chr17.hg19:g.16040642G>A	ENSP00000268712:p.Arg498Cys	99.0	0.0		70.0	49.0	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	ENST00000268712.3	hg19	CCDS11175.1	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854572	0.32791	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.09	4.12	0.48240	.	0.051934	0.85682	D	0.000000	T	0.62804	0.2458	M	0.83774	2.66	0.80722	D	1	D;D;D;D;D;B	0.89917	1.0;1.0;1.0;1.0;1.0;0.035	D;D;D;D;D;B	0.80764	0.972;0.972;0.972;0.973;0.994;0.016	T	0.65861	-0.6065	10	0.87932	D	0	-7.2267	7.8821	0.29629	0.0818:0.0:0.7586:0.1596	.	507;498;498;389;498;498	E7EU93;E7EV02;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	C	498;498;389;507;389;498;507	ENSP00000268712:R498C;ENSP00000379192:R498C;ENSP00000379189:R389C;ENSP00000407998:R498C;ENSP00000387727:R507C	ENSP00000268712:R498C	R	-	1	0	NCOR1	15981367	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.117000	0.71577	1.269000	0.44280	0.563000	0.77884	CGC	.	.		0.373	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
SPECC1	92521	hgsc.bcm.edu	37	17	20108414	20108414	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr17:20108414A>G	ENST00000261503.5	+	4	1103	c.1052A>G	c.(1051-1053)aAg>aGg	p.K351R	SPECC1_ENST00000395522.2_Missense_Mutation_p.K270R|SPECC1_ENST00000395529.3_Missense_Mutation_p.K351R|AC004702.2_ENST00000580225.1_lincRNA|SPECC1_ENST00000584527.1_5'Flank|SPECC1_ENST00000472876.1_Intron|SPECC1_ENST00000536879.1_Intron|SPECC1_ENST00000395530.2_Missense_Mutation_p.K270R|SPECC1_ENST00000395525.3_Missense_Mutation_p.K270R|SPECC1_ENST00000395527.4_Missense_Mutation_p.K351R	NM_001033553.2	NP_001028725.1	Q5M775	CYTSB_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1	351	Ser-rich.				cell adhesion (GO:0007155)	nucleus (GO:0005634)				breast(1)|large_intestine(3)|ovary(4)	8				KIRC - Kidney renal clear cell carcinoma(2;0.166)|Kidney(2;0.196)		AACCCCTTTAAGAGTTCAAAG	0.483																																					p.K351R		Atlas-SNP	.											.	SPECC1	100	.	0			c.A1052G						.						119.0	129.0	126.0					17																	20108414		2203	4300	6503	SO:0001583	missense	92521	exon4			CCTTTAAGAGTTC	AY816329, AB041533	CCDS32590.1, CCDS42280.1, CCDS42281.1, CCDS45628.1, CCDS58531.1	17p11.2	2012-11-19	2010-09-17	2010-09-17	ENSG00000128487	ENSG00000128487			30615	protein-coding gene	gene with protein product	"""sperm antigen HCMOGT 1"", ""cytokinesis and spindle organization B"", ""cytospin B"""	608793				15602574, 18763323, 15087372	Standard	NM_001033553		Approved	HCMOGT-1, FLJ36955, NSP, CYTSB	uc002gwq.3	Q5M775	OTTHUMG00000179808	ENST00000261503.5:c.1052A>G	chr17.hg19:g.20108414A>G	ENSP00000261503:p.Lys351Arg	128.0	0.0		182.0	13.0	NM_001033553	B4DHH0|B7WNS8|Q5IBP1|Q5IBP2|Q5IBP3|Q5IBP4|Q5M772|Q5M773|Q5M774|Q86XT8|Q8N4U4|Q8WU84|Q9HCQ3	Missense_Mutation	SNP	ENST00000261503.5	hg19	CCDS32590.1	.	.	.	.	.	.	.	.	.	.	A	4.500	0.092814	0.08632	.	.	ENSG00000128487	ENST00000395530;ENST00000261503;ENST00000395529;ENST00000395522;ENST00000395527;ENST00000395525	T;T;T;T	0.64991	-0.13;3.46;2.87;2.87	5.38	4.3	0.51218	.	0.271400	0.48286	N	0.000194	T	0.55689	0.1936	L	0.59436	1.845	0.80722	D	1	B;B;B;B;B	0.16603	0.001;0.018;0.018;0.018;0.003	B;B;B;B;B	0.17722	0.002;0.011;0.019;0.019;0.005	T	0.51156	-0.8741	10	0.34782	T	0.22	-34.3834	9.6345	0.39800	0.9167:0.0:0.0833:0.0	.	351;270;270;351;351	A8MV89;Q5M775-4;Q5M775-3;Q5M775-2;Q5M775	.;.;.;.;CYTSB_HUMAN	R	351;351;351;270;270;270	ENSP00000261503:K351R;ENSP00000378900:K351R;ENSP00000378893:K270R;ENSP00000378896:K270R	ENSP00000261503:K351R	K	+	2	0	SPECC1	20049006	1.000000	0.71417	0.992000	0.48379	0.115000	0.19883	3.056000	0.49923	0.997000	0.38969	0.533000	0.62120	AAG	.	.		0.483	SPECC1-018	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441206.1	NM_152904	
NLK	51701	hgsc.bcm.edu	37	17	26495650	26495650	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr17:26495650A>T	ENST00000407008.3	+	6	1732	c.1014A>T	c.(1012-1014)agA>agT	p.R338S		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	338	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		TAGGACGAAGAATATTGTTTC	0.418																																					p.R338S		Atlas-SNP	.											.	NLK	88	.	0			c.A1014T						.						119.0	114.0	116.0					17																	26495650		2203	4300	6503	SO:0001583	missense	51701	exon6			ACGAAGAATATTG	AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.1014A>T	chr17.hg19:g.26495650A>T	ENSP00000384625:p.Arg338Ser	86.0	0.0		123.0	9.0	NM_016231	B2RCX1|Q2PNI9|Q6P2A3	Missense_Mutation	SNP	ENST00000407008.3	hg19	CCDS11224.2	.	.	.	.	.	.	.	.	.	.	A	21.5	4.157440	0.78114	.	.	ENSG00000087095	ENST00000407008	T	0.66280	-0.2	6.08	4.98	0.66077	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.70298	0.3208	L	0.48260	1.515	0.80722	D	1	D	0.56746	0.977	D	0.65573	0.936	T	0.71586	-0.4548	10	0.72032	D	0.01	-6.235	10.3619	0.43998	0.8629:0.0:0.1371:0.0	.	338	Q9UBE8	NLK_HUMAN	S	338	ENSP00000384625:R338S	ENSP00000384625:R338S	R	+	3	2	NLK	23519777	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.644000	0.46613	1.079000	0.41038	0.533000	0.62120	AGA	.	.		0.418	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255607.3	NM_016231	
DNAH17	8632	hgsc.bcm.edu	37	17	76481047	76481047	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr17:76481047C>G	ENST00000585328.1	-	48	7661	c.7537G>C	c.(7537-7539)Gtc>Ctc	p.V2513L	DNAH17_ENST00000389840.5_Missense_Mutation_p.V2504L|RP11-559N14.5_ENST00000588565.1_RNA|DNAH17_ENST00000586052.1_5'UTR|RP11-559N14.5_ENST00000585969.1_RNA	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2504	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			ATGAAGTAGACGAGCTTCTTA	0.622																																					p.V2518L		Atlas-SNP	.											.	DNAH17	347	.	0			c.G7552C						.						61.0	66.0	65.0					17																	76481047		2090	4219	6309	SO:0001583	missense	8632	exon48			AGTAGACGAGCTT	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.7537G>C	chr17.hg19:g.76481047C>G	ENSP00000465516:p.Val2513Leu	64.0	0.0		96.0	10.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	C	16.58	3.161819	0.57368	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.50277	0.75	4.96	3.88	0.44766	.	.	.	.	.	T	0.43344	0.1243	L	0.39147	1.195	0.25468	N	0.987857	.	.	.	.	.	.	T	0.33189	-0.9878	7	0.49607	T	0.09	.	7.9096	0.29782	0.0:0.1608:0.0:0.8392	.	.	.	.	L	2513;2504	ENSP00000374490:V2504L	ENSP00000300671:V2513L	V	-	1	0	DNAH17	73992642	0.974000	0.33945	0.999000	0.59377	0.939000	0.58152	1.813000	0.38962	0.742000	0.32697	-0.339000	0.08088	GTC	.	.		0.622	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
APCDD1	147495	hgsc.bcm.edu	37	18	10485748	10485748	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr18:10485748G>T	ENST00000355285.5	+	4	1418	c.1064G>T	c.(1063-1065)aGg>aTg	p.R355M	APCDD1_ENST00000578882.1_Splice_Site	NM_153000.4	NP_694545.1			adenomatosis polyposis coli down-regulated 1									p.R355M(1)		NS(1)|breast(1)|endometrium(3)|large_intestine(5)|lung(7)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				READ - Rectum adenocarcinoma(15;0.08)		CTCTCGTCCAGGGTCATGGGA	0.582																																					p.R355M		Atlas-SNP	.											APCDD1,NS,carcinoma,0,1	APCDD1	57	.	1	Substitution - Missense(1)	endometrium(1)	c.G1064T						.						47.0	43.0	44.0					18																	10485748		2203	4300	6503	SO:0001583	missense	147495	exon4			CGTCCAGGGTCAT	AB056722	CCDS11849.1	18p11.21	2006-07-07			ENSG00000154856	ENSG00000154856			15718	protein-coding gene	gene with protein product		607479				12384519	Standard	NM_153000		Approved	B7323	uc002kom.4	Q8J025	OTTHUMG00000131635	ENST00000355285.5:c.1064G>T	chr18.hg19:g.10485748G>T	ENSP00000347433:p.Arg355Met	62.0	0.0		60.0	3.0	NM_153000		Missense_Mutation	SNP	ENST00000355285.5	hg19	CCDS11849.1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078007	0.36662	.	.	ENSG00000154856	ENST00000355285;ENST00000423585	T	0.16597	2.33	4.88	2.1	0.27182	.	0.206132	0.48286	D	0.000193	T	0.28928	0.0718	M	0.62723	1.935	0.80722	D	1	P	0.40032	0.699	P	0.54499	0.754	T	0.01617	-1.1311	10	0.62326	D	0.03	-21.8375	6.8657	0.24093	0.4703:0.0:0.5297:0.0	.	355	Q8J025	APCD1_HUMAN	M	355;406	ENSP00000347433:R355M	ENSP00000347433:R355M	R	+	2	0	APCDD1	10475748	0.351000	0.24887	0.943000	0.38184	0.640000	0.38277	1.560000	0.36331	0.260000	0.21731	0.561000	0.74099	AGG	.	.		0.582	APCDD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254529.2	NM_153000	
MUM1	84939	hgsc.bcm.edu	37	19	1360549	1360549	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr19:1360549A>G	ENST00000415183.3	+	4	658	c.632A>G	c.(631-633)aAt>aGt	p.N211S	MUM1_ENST00000591806.1_Missense_Mutation_p.N211S|MUM1_ENST00000344663.3_Missense_Mutation_p.N211S|MUM1_ENST00000311401.5_Missense_Mutation_p.N142S			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	210					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCACAAAAATTGGACTCTT	0.532											OREG0025088	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N211S		Atlas-SNP	.											.	MUM1	54	.	0			c.A632G						.						57.0	55.0	56.0					19																	1360549		2203	4300	6503	SO:0001583	missense	84939	exon5			ACAAAAATTGGAC	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.632A>G	chr19.hg19:g.1360549A>G	ENSP00000394925:p.Asn211Ser	149.0	0.0	595	175.0	50.0	NM_032853	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	ENST00000415183.3	hg19		.	.	.	.	.	.	.	.	.	.	A	0.026	-1.367576	0.01225	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183;ENST00000542512	T;T;T	0.35236	1.32;1.32;1.32	3.99	-7.97	0.01139	.	2.441580	0.01285	N	0.009850	T	0.15478	0.0373	N	0.08118	0	0.09310	N	1	B;B;B;B	0.12013	0.002;0.005;0.002;0.0	B;B;B;B	0.06405	0.001;0.001;0.002;0.0	T	0.21449	-1.0245	10	0.09084	T	0.74	.	8.9226	0.35621	0.1691:0.3778:0.4531:0.0	.	211;211;142;210	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	S	211;142;211;140	ENSP00000345789:N211S;ENSP00000309135:N142S;ENSP00000394925:N211S	ENSP00000309135:N142S	N	+	2	0	MUM1	1311549	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.097000	0.11042	-1.614000	0.01575	-1.007000	0.02485	AAT	.	.		0.532	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	
RYR1	6261	hgsc.bcm.edu	37	19	39025793	39025793	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr19:39025793C>A	ENST00000359596.3	+	80	11372	c.11372C>A	c.(11371-11373)gCc>gAc	p.A3791D	RYR1_ENST00000360985.3_Missense_Mutation_p.A3791D|RYR1_ENST00000355481.4_Missense_Mutation_p.A3786D|AC067969.2_ENST00000595853.1_RNA			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	3791					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GAGACAGGTGCCATGGTGTCC	0.552																																					p.A3791D		Atlas-SNP	.											.	RYR1	708	.	0			c.C11372A						.						77.0	56.0	63.0					19																	39025793		2203	4300	6503	SO:0001583	missense	6261	exon80			CAGGTGCCATGGT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.11372C>A	chr19.hg19:g.39025793C>A	ENSP00000352608:p.Ala3791Asp	25.0	0.0		27.0	6.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	C	12.81	2.048735	0.36181	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.87650	-2.28;-2.28;-2.28	3.83	3.83	0.44106	.	0.601453	0.14238	U	0.332278	T	0.75413	0.3846	N	0.11313	0.125	0.38694	D	0.952844	B;B;B	0.30973	0.231;0.302;0.201	B;B;B	0.28232	0.087;0.079;0.036	T	0.73471	-0.3972	10	0.25106	T	0.35	.	15.0434	0.71807	0.0:1.0:0.0:0.0	.	3791;3786;3791	P21817-3;P21817-2;P21817	.;.;RYR1_HUMAN	D	3791;3786;3791	ENSP00000352608:A3791D;ENSP00000347667:A3786D;ENSP00000354254:A3791D	ENSP00000347667:A3786D	A	+	2	0	RYR1	43717633	0.557000	0.26546	0.980000	0.43619	0.988000	0.76386	0.728000	0.26013	2.146000	0.66826	0.561000	0.74099	GCC	.	.		0.552	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
ZNF222	7673	hgsc.bcm.edu	37	19	44529605	44529605	+	5'UTR	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr19:44529605A>G	ENST00000187879.8	+	0	91				ZNF222_ENST00000590160.1_3'UTR|ZNF223_ENST00000591793.1_Missense_Mutation_p.E6G|ZNF222_ENST00000391960.3_Missense_Mutation_p.E6G|AC067968.3_ENST00000592583.1_lincRNA|ZNF222_ENST00000587846.1_Missense_Mutation_p.E6G	NM_013360.2	NP_037492.2	Q9UK12	ZN222_HUMAN	zinc finger protein 222						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20		Prostate(69;0.0435)				GATTCAGGAGAAAAGAAGCCT	0.577																																					p.E6G		Atlas-SNP	.											.	ZNF222	90	.	0			c.A17G						.						21.0	22.0	22.0					19																	44529605		692	1591	2283	SO:0001623	5_prime_UTR_variant	7673	exon1			CAGGAGAAAAGAA	AF187988	CCDS33045.1, CCDS46098.1	19q13.2	2013-01-08				ENSG00000159885		"""Zinc fingers, C2H2-type"", ""-"""	13015	protein-coding gene	gene with protein product							Standard	NM_013360		Approved		uc002oye.3	Q9UK12		ENST00000187879.8:c.-72A>G	chr19.hg19:g.44529605A>G		63.0	0.0		76.0	30.0	NM_001129996	G5E9B9|Q8N6G7|Q9P1U5	Missense_Mutation	SNP	ENST00000187879.8	hg19	CCDS33045.1	.	.	.	.	.	.	.	.	.	.	A	13.37	2.216308	0.39201	.	.	ENSG00000159885	ENST00000391960	T	0.06371	3.31	1.3	0.145	0.14829	.	.	.	.	.	T	0.05181	0.0138	N	0.08118	0	0.09310	N	1	D	0.58620	0.983	P	0.53861	0.736	T	0.37753	-0.9692	9	0.36615	T	0.2	.	4.0037	0.09592	0.617:0.383:0.0:0.0	.	6	G5E9B9	.	G	6	ENSP00000375822:E6G	ENSP00000375822:E6G	E	+	2	0	ZNF222	49221445	0.019000	0.18553	0.003000	0.11579	0.004000	0.04260	0.157000	0.16402	-0.018000	0.14079	-0.805000	0.03199	GAA	.	.		0.577	ZNF222-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000460465.2		
MARK4	57787	hgsc.bcm.edu	37	19	45797639	45797639	+	Silent	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr19:45797639A>G	ENST00000262891.4	+	14	1858	c.1527A>G	c.(1525-1527)agA>agG	p.R509R	MARK4_ENST00000300843.4_Silent_p.R509R	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	509					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		TGACCCGCAGAAACACCTACG	0.597																																					p.R509R		Atlas-SNP	.											.	MARK4	132	.	0			c.A1527G						.						77.0	57.0	64.0					19																	45797639		2203	4300	6503	SO:0001819	synonymous_variant	57787	exon14			CCGCAGAAACACC	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1527A>G	chr19.hg19:g.45797639A>G		90.0	0.0		112.0	43.0	NM_001199867	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Silent	SNP	ENST00000262891.4	hg19	CCDS56097.1																																																																																			.	.		0.597	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417	
ATF5	22809	hgsc.bcm.edu	37	19	50434173	50434173	+	Silent	SNP	A	A	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr19:50434173A>C	ENST00000423777.2	+	2	443	c.66A>C	c.(64-66)ggA>ggC	p.G22G	IL4I1_ENST00000341114.3_5'Flank|ATF5_ENST00000600336.1_Silent_p.G22G|NUP62_ENST00000597723.1_5'Flank|NUP62_ENST00000422090.2_5'Flank|ATF5_ENST00000595125.1_Silent_p.G22G|NUP62_ENST00000600583.1_5'Flank|IL4I1_ENST00000595948.1_5'Flank|NUP62_ENST00000596217.1_5'Flank|NUP62_ENST00000597029.1_5'Flank|CTC-326K19.6_ENST00000451973.1_Intron|NUP62_ENST00000413454.1_5'Flank|NUP62_ENST00000352066.3_5'Flank|MIR4751_ENST00000578027.1_RNA	NM_001193646.1	NP_001180575.1	Q9Y2D1	ATF5_HUMAN	activating transcription factor 5	22					multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|olfactory bulb interneuron development (GO:0021891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|transcription corepressor activity (GO:0003714)			NS(1)|endometrium(2)|large_intestine(1)|skin(3)	7		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00221)|OV - Ovarian serous cystadenocarcinoma(262;0.017)	Pseudoephedrine(DB00852)	GTGGGCTGGGATGGCTCGTAG	0.677																																					p.G22G	GBM(48;768 989 9196 9511 26329)	Atlas-SNP	.											.	ATF5	27	.	0			c.A66C						.						22.0	22.0	22.0					19																	50434173		2203	4299	6502	SO:0001819	synonymous_variant	22809	exon3			GCTGGGATGGCTC	AF101388	CCDS12789.1	19q13.33	2013-09-20			ENSG00000169136	ENSG00000169136		"""basic leucine zipper proteins"""	790	protein-coding gene	gene with protein product		606398				10373550	Standard	NM_012068		Approved		uc002prd.3	Q9Y2D1	OTTHUMG00000183065	ENST00000423777.2:c.66A>C	chr19.hg19:g.50434173A>C		146.0	0.0		150.0	55.0	NM_012068	B3KND3|Q9BSA1|Q9UNQ3	Silent	SNP	ENST00000423777.2	hg19	CCDS12789.1																																																																																			.	.		0.677	ATF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464915.2		
SAMHD1	25939	hgsc.bcm.edu	37	20	35540887	35540887	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr20:35540887T>G	ENST00000262878.4	-	10	1330	c.1131A>C	c.(1129-1131)aaA>aaC	p.K377N	SAMHD1_ENST00000373694.5_Missense_Mutation_p.K162N	NM_015474.3	NP_056289.2	Q9Y3Z3	SAMH1_HUMAN	SAM domain and HD domain 1	377					dATP catabolic process (GO:0046061)|defense response to virus (GO:0051607)|dGTP catabolic process (GO:0006203)|immune response (GO:0006955)|innate immune response (GO:0045087)|protein homotetramerization (GO:0051289)|regulation of innate immune response (GO:0045088)	intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dGTP binding (GO:0032567)|dGTPase activity (GO:0008832)|nucleic acid binding (GO:0003676)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	20		Myeloproliferative disorder(115;0.00878)				TGTTGCCAACTTTGTGTTGAT	0.353																																					p.K377N		Atlas-SNP	.											.	SAMHD1	62	.	0			c.A1131C						.						114.0	107.0	110.0					20																	35540887		2203	4300	6503	SO:0001583	missense	25939	exon10			GCCAACTTTGTGT	AF228421	CCDS13288.1	20q11.23	2014-09-17			ENSG00000101347	ENSG00000101347		"""Sterile alpha motif (SAM) domain containing"""	15925	protein-coding gene	gene with protein product	"""HD domain containing 1"", ""monocyte protein 5"", ""Aicardi-Goutieres syndrome 5"""	606754				11064105, 11230166	Standard	NM_015474		Approved	SBBI88, Mg11, HDDC1, MOP-5, AGS5	uc002xgh.2	Q9Y3Z3	OTTHUMG00000032402	ENST00000262878.4:c.1131A>C	chr20.hg19:g.35540887T>G	ENSP00000262878:p.Lys377Asn	79.0	0.0		102.0	25.0	NM_015474	B4E2A5|E1P5V2|Q5JXG8|Q8N491|Q9H004|Q9H005|Q9H3U9	Missense_Mutation	SNP	ENST00000262878.4	hg19	CCDS13288.1	.	.	.	.	.	.	.	.	.	.	t	20.5	3.995882	0.74703	.	.	ENSG00000101347	ENST00000262878;ENST00000373694	D;D	0.95756	-3.8;-3.8	5.46	1.83	0.25207	HD domain (1);	0.140244	0.64402	D	0.000006	D	0.96463	0.8846	M	0.89785	3.06	0.50813	D	0.999896	P	0.49358	0.923	P	0.51615	0.675	D	0.94942	0.8092	10	0.62326	D	0.03	-19.3235	8.8773	0.35354	0.0:0.3191:0.0:0.6809	.	377	Q9Y3Z3	SAMH1_HUMAN	N	377;162	ENSP00000262878:K377N;ENSP00000362798:K162N	ENSP00000262878:K377N	K	-	3	2	SAMHD1	34974301	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.395000	0.34520	0.324000	0.23333	0.456000	0.33151	AAA	.	.		0.353	SAMHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079062.2	NM_015474	
TTC3	7267	hgsc.bcm.edu	37	21	38510935	38510935	+	Splice_Site	SNP	A	A	G			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr21:38510935A>G	ENST00000399017.2	+	19	4327	c.1580A>G	c.(1579-1581)cAa>cGa	p.Q527R	TTC3_ENST00000355666.1_Splice_Site_p.Q527R|TTC3_ENST00000354749.2_Splice_Site_p.Q527R|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000540756.1_Splice_Site_p.Q217R	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	527					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TATTGACAGCAATTGAACCTG	0.373																																					p.Q527R	Ovarian(38;194 1649 35661)	Atlas-SNP	.											.	TTC3	182	.	0			c.A1580G						.						187.0	174.0	178.0					21																	38510935		2203	4300	6503	SO:0001630	splice_region_variant	7267	exon19			GACAGCAATTGAA	D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.1579-1A>G	chr21.hg19:g.38510935A>G		131.0	0.0		207.0	27.0	NM_001001894	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	ENST00000399017.2	hg19	CCDS13651.1	.	.	.	.	.	.	.	.	.	.	A	14.44	2.536054	0.45176	.	.	ENSG00000182670	ENST00000418766;ENST00000450533;ENST00000438055;ENST00000355666;ENST00000540756;ENST00000399017;ENST00000354749	T;T;T;T;T;T;T	0.48836	2.62;0.8;2.62;2.94;0.82;2.94;2.94	5.22	5.22	0.72569	Tetratricopeptide-like helical (1);	0.227351	0.31507	N	0.007523	T	0.48750	0.1517	N	0.17082	0.46	0.35037	D	0.759371	B;D	0.63880	0.141;0.993	B;D	0.70227	0.047;0.968	T	0.60172	-0.7315	10	0.44086	T	0.13	-17.0806	9.5896	0.39537	0.9199:0.0:0.0801:0.0	.	217;527	B4DSZ9;P53804	.;TTC3_HUMAN	R	527;527;509;527;217;527;527	ENSP00000403943:Q527R;ENSP00000408456:Q527R;ENSP00000391891:Q509R;ENSP00000347889:Q527R;ENSP00000442875:Q217R;ENSP00000381981:Q527R;ENSP00000346791:Q527R	ENSP00000346791:Q527R	Q	+	2	0	TTC3	37432805	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.926000	0.63433	2.103000	0.63969	0.460000	0.39030	CAA	.	.		0.373	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194776.1		Missense_Mutation
UMODL1	89766	hgsc.bcm.edu	37	21	43531035	43531035	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr21:43531035G>C	ENST00000408910.2	+	11	1703	c.1703G>C	c.(1702-1704)gGg>gCg	p.G568A	C21orf128_ENST00000329015.2_5'Flank|UMODL1_ENST00000400427.1_Missense_Mutation_p.G496A|UMODL1_ENST00000400424.2_Missense_Mutation_p.G496A|UMODL1_ENST00000408989.2_Missense_Mutation_p.G568A	NM_001004416.2	NP_001004416	Q5DID0	UROL1_HUMAN	uromodulin-like 1	568					adipose tissue development (GO:0060612)|cellular response to gonadotropin-releasing hormone (GO:0097211)|multicellular organismal reproductive process (GO:0048609)|regulation of apoptotic process (GO:0042981)|regulation of gene expression (GO:0010468)|regulation of ovarian follicle development (GO:2000354)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|peptidase inhibitor activity (GO:0030414)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(22)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	47						GCGGCAACAGGGGTAACGGTC	0.632																																					p.G568A	Pancreas(122;680 807 13940 14411 22888 25505 31742 36028 36332 38435)	Atlas-SNP	.											.	UMODL1	186	.	0			c.G1703C						.						31.0	38.0	36.0					21																	43531035		2078	4211	6289	SO:0001583	missense	89766	exon11			CAACAGGGGTAAC		CCDS42935.1, CCDS42936.1, CCDS56214.1, CCDS56215.1	21q22.3	2008-07-04			ENSG00000177398	ENSG00000177398			12560	protein-coding gene	gene with protein product	"""olfactorin"""	613859				16026467	Standard	NM_173568		Approved		uc002zag.1	Q5DID0	OTTHUMG00000086788	ENST00000408910.2:c.1703G>C	chr21.hg19:g.43531035G>C	ENSP00000386147:p.Gly568Ala	211.0	0.0		311.0	156.0	NM_173568	C9JCE6|Q5DIC9|Q6LA40|Q6LA41|Q8N216	Missense_Mutation	SNP	ENST00000408910.2	hg19	CCDS42936.1	.	.	.	.	.	.	.	.	.	.	G	1.512	-0.549215	0.04024	.	.	ENSG00000177398	ENST00000400427;ENST00000400424;ENST00000408989;ENST00000408910	T;T;T;T	0.71579	-0.58;-0.56;-0.58;-0.55	3.61	-1.77	0.07982	.	0.797000	0.10786	N	0.634261	T	0.61899	0.2384	L	0.29908	0.895	0.09310	N	1	D;B	0.58970	0.984;0.329	P;B	0.56088	0.791;0.084	T	0.54214	-0.8327	10	0.14252	T	0.57	-7.7189	4.7456	0.13036	0.2949:0.2963:0.4087:0.0	.	568;568	Q5DID0-2;Q5DID0	.;UROL1_HUMAN	A	496;496;568;568	ENSP00000383279:G496A;ENSP00000383276:G496A;ENSP00000386126:G568A;ENSP00000386147:G568A	ENSP00000383276:G496A	G	+	2	0	UMODL1	42404104	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.020000	0.12525	-0.389000	0.07786	0.591000	0.81541	GGG	.	.		0.632	UMODL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195292.2		
MT-CYB	4519	hgsc.bcm.edu	37	M	14934	14934	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chrM:14934T>C	ENST00000361789.2	+	1	188	c.188T>C	c.(187-189)tTt>tCt	p.F63S	MT-ND6_ENST00000361681.2_5'Flank|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	63					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CTCAACCGCCTTTTCATCAAT	0.498																																					p.F63S		Atlas-SNP	.											.	.	.	.	0			c.T188C						.																																			SO:0001583	missense	0	exon1			CCGCCTTTTCATC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.188T>C	chrM.hg19:g.14934T>C	ENSP00000354554:p.Phe63Ser	53.0	0.0		122.0	21.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.498	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
AKAP2	11217	hgsc.bcm.edu	37	9	112900409	112900411	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr9:112900409_112900411delCTC	ENST00000259318.7	+	2	2099_2101	c.1892_1894delCTC	c.(1891-1896)tctcct>tct	p.P632del	AKAP2_ENST00000555236.1_In_Frame_Del_p.P863del|PALM2-AKAP2_ENST00000374530.3_In_Frame_Del_p.P863del|AKAP2_ENST00000434623.2_In_Frame_Del_p.P721del|AKAP2_ENST00000510514.5_In_Frame_Del_p.P863del|AKAP2_ENST00000374525.1_In_Frame_Del_p.P721del|PALM2-AKAP2_ENST00000302798.7_In_Frame_Del_p.P863del	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	632										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CAGGTGTCTTCTCCTGTTCAAGA	0.567																																					p.862_862del		Atlas-INDEL	.											.	PALM2-AKAP2	117	.	0			c.2584_2586del						.																																			SO:0001651	inframe_deletion	445815	exon8			.	AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.1892_1894delCTC	chr9.hg19:g.112900409_112900411delCTC	ENSP00000259318:p.Pro632del	57.0	0.0		65.0	11.0	NM_007203	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	In_Frame_Del	DEL	ENST00000259318.7	hg19	CCDS48003.1																																																																																			.	.		0.567	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346067.3	NM_001004065	
UBE2D3	7323	hgsc.bcm.edu	37	4	103720567	103720568	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr4:103720567_103720568delTC	ENST00000453744.2	-	7	907_908	c.394_395delGA	c.(394-396)gatfs	p.D132fs	UBE2D3_ENST00000343106.5_Frame_Shift_Del_p.D132fs|UBE2D3_ENST00000349311.8_Frame_Shift_Del_p.D132fs|UBE2D3_ENST00000394804.2_Frame_Shift_Del_p.D132fs|UBE2D3_ENST00000321805.7_Frame_Shift_Del_p.D132fs|UBE2D3_ENST00000357194.6_Frame_Shift_Del_p.D134fs|UBE2D3_ENST00000504211.1_Frame_Shift_Del_p.D103fs|UBE2D3_ENST00000394801.4_Frame_Shift_Del_p.D132fs|UBE2D3_ENST00000350435.7_Frame_Shift_Del_p.D126fs|UBE2D3_ENST00000507845.1_Frame_Shift_Del_p.D103fs|UBE2D3_ENST00000394803.5_Frame_Shift_Del_p.D132fs|UBE2D3_ENST00000505207.1_Frame_Shift_Del_p.D103fs|UBE2D3_ENST00000338145.3_Frame_Shift_Del_p.D132fs|UBE2D3_ENST00000502404.1_Frame_Shift_Del_p.D103fs	NM_181891.1	NP_871620.1	P61077	UB2D3_HUMAN	ubiquitin-conjugating enzyme E2D 3	132					apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|DNA repair (GO:0006281)|gene expression (GO:0010467)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|lung(3)|skin(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.13e-08)		TACTTACTTATCTCTGTCTGTT	0.351																																					p.134_134del		Atlas-INDEL	.											.	UBE2D3	25	.	0			c.401_402del						.																																			SO:0001589	frameshift_variant	7323	exon6			.	U39318	CCDS3659.1, CCDS3660.1, CCDS3661.1, CCDS75172.1	4q24	2011-05-19	2011-05-19		ENSG00000109332	ENSG00000109332		"""Ubiquitin-conjugating enzymes E2"""	12476	protein-coding gene	gene with protein product		602963	"""ubiquitin-conjugating enzyme E2D 3 (homologous to yeast UBC4/5)"", ""ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast)"""			8530467	Standard	NM_181886		Approved	UbcH5C	uc003hwl.3	P61077	OTTHUMG00000131119	ENST00000453744.2:c.394_395delGA	chr4.hg19:g.103720569_103720570delTC	ENSP00000396901:p.Asp132fs	307.0	0.0		472.0	242.0	NM_181893	A6NJ93|A6NJB1|A6NM99|P47986|Q6IB88|Q6NXS4|Q8N924	Frame_Shift_Del	DEL	ENST00000453744.2	hg19	CCDS3660.1																																																																																			.	.		0.351	UBE2D3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253791.2	NM_181893	
HNRNPM	4670	hgsc.bcm.edu	37	19	8550614	8550614	+	Frame_Shift_Del	DEL	C	C	-	rs531035663		TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr19:8550614delC	ENST00000325495.4	+	14	1343	c.1302delC	c.(1300-1302)atcfs	p.I434fs	HNRNPM_ENST00000348943.3_Frame_Shift_Del_p.I395fs	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	434	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						GCTCCGAGATCGAGCGCATGG	0.706																																					p.I434fs		Atlas-INDEL	.											.	HNRNPM	61	.	0			c.1301delT						.						71.0	76.0	74.0					19																	8550614		2203	4298	6501	SO:0001589	frameshift_variant	4670	exon14			.	L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1302delC	chr19.hg19:g.8550614delC	ENSP00000325376:p.Ile434fs	80.0	0.0		114.0	43.0	NM_005968	Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Frame_Shift_Del	DEL	ENST00000325495.4	hg19	CCDS12203.1																																																																																			.	.		0.706	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460894.1		
KIRREL	55243	hgsc.bcm.edu	37	1	158046019	158046019	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr1:158046019delG	ENST00000359209.6	+	2	236	c.169delG	c.(169-171)gggfs	p.G57fs	KIRREL_ENST00000360089.4_5'UTR|KIRREL_ENST00000392272.2_Frame_Shift_Del_p.G57fs|KIRREL_ENST00000368173.3_Frame_Shift_Del_p.G57fs|KIRREL_ENST00000416935.2_Intron			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	57	Ig-like C2-type 1.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GACCAAGGACGGGCTGGCCCT	0.622																																					p.D56fs		Atlas-INDEL	.											.	KIRREL	346	.	0			c.168delC						.						102.0	103.0	102.0					1																	158046019		2203	4300	6503	SO:0001589	frameshift_variant	55243	exon2			.	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.169delG	chr1.hg19:g.158046019delG	ENSP00000352138:p.Gly57fs	93.0	0.0		153.0	59.0	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Frame_Shift_Del	DEL	ENST00000359209.6	hg19	CCDS1172.2																																																																																			.	.		0.622	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
CNPY3	10695	hgsc.bcm.edu	37	6	42905826	42905827	+	Splice_Site	DEL	AG	AG	-			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr6:42905826_42905827delAG	ENST00000372836.4	+	5	866		c.e5-1		CNPY3_ENST00000394142.3_Splice_Site|RP3-475N16.1_ENST00000450671.1_RNA	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3						innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)				central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			tatgattaACAGTGTGATGTGC	0.54																																					.		Atlas-INDEL	.											.	CNPY3	25	.	0			.						.																																			SO:0001630	splice_region_variant	10695	.			.	U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.496-1AG>-	chr6.hg19:g.42905826_42905827delAG		156.0	0.0		178.0	41.0	.	O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	Splice_Site	DEL	ENST00000372836.4	hg19	CCDS4875.1																																																																																			.	.		0.540	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040564.1	NM_006586	Intron
SLC2A2	6514	hgsc.bcm.edu	37	3	170732455	170732457	+	In_Frame_Del	DEL	GTT	GTT	-			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	GTT	GTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr3:170732455_170732457delGTT	ENST00000314251.3	-	3	251_253	c.172_174delAAC	c.(172-174)aacdel	p.N58del	SLC2A2_ENST00000382808.4_Intron	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	58					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	TGATAACATAGTTGTTGATAGCT	0.404																																					p.58_59del		Atlas-INDEL	.											.	SLC2A2	71	.	0			c.173_175del						.																																			SO:0001651	inframe_deletion	6514	exon3			.	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.172_174delAAC	chr3.hg19:g.170732458_170732460delGTT	ENSP00000323568:p.Asn58del	141.0	0.0		161.0	41.0	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	In_Frame_Del	DEL	ENST00000314251.3	hg19	CCDS3215.1																																																																																			.	.		0.404	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
TGFBI	7045	hgsc.bcm.edu	37	5	135392457	135392457	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-AAUZ-01A-11D-A382-10	TCGA-G3-AAUZ-10A-01D-A385-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d883fcad-d1c0-4b14-9e2f-450d3c75f28e	8f178264-c9f3-4f66-9b51-f31d6244ba04	g.chr5:135392457delC	ENST00000442011.2	+	12	1812	c.1651delC	c.(1651-1653)ccafs	p.P552fs	TGFBI_ENST00000508076.1_5'Flank|TGFBI_ENST00000305126.8_Frame_Shift_Del_p.P552fs	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	552	FAS1 4. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCGAGCCCTGCCACCAAGAGA	0.532																																					p.L550fs		Atlas-INDEL	.											.	TGFBI	76	.	0			c.1650delG						.						52.0	56.0	55.0					5																	135392457		1955	4138	6093	SO:0001589	frameshift_variant	7045	exon12			.	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.1651delC	chr5.hg19:g.135392457delC	ENSP00000416330:p.Pro552fs	297.0	0.0		225.0	38.0	NM_000358	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Frame_Shift_Del	DEL	ENST00000442011.2	hg19	CCDS47266.1																																																																																			.	.		0.532	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1		
