#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TPRG1L	127262	hgsc.bcm.edu	37	1	3542011	3542011	+	Silent	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:3542011G>A	ENST00000378344.2	+	2	296	c.225G>A	c.(223-225)gtG>gtA	p.V75V	RP11-46F15.2_ENST00000435049.1_RNA|TPRG1L_ENST00000344579.5_Silent_p.V75V	NM_182752.3	NP_877429.2	Q5T0D9	TPRGL_HUMAN	tumor protein p63 regulated 1-like	75						cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|synaptic vesicle (GO:0008021)				endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(1)	8	all_cancers(77;0.0119)|all_epithelial(69;0.00481)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.41e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.83e-22)|GBM - Glioblastoma multiforme(42;4.77e-14)|Colorectal(212;1.12e-05)|COAD - Colon adenocarcinoma(227;5.61e-05)|Kidney(185;0.000351)|BRCA - Breast invasive adenocarcinoma(365;0.000688)|KIRC - Kidney renal clear cell carcinoma(229;0.00553)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.201)		AGCAGGCAGTGGAGGAGATCC	0.716																																					p.V75V		Atlas-SNP	.											.	TPRG1L	24	.	0			c.G225A						.						28.0	33.0	31.0					1																	3542011		2198	4292	6490	SO:0001819	synonymous_variant	127262	exon2			GGCAGTGGAGGAG	BC019034	CCDS47.1	1p36.32	2008-02-05	2008-01-16	2008-01-16	ENSG00000158109	ENSG00000158109			27007	protein-coding gene	gene with protein product		611460	"""family with sequence similarity 79, member A"""	FAM79A		12477932	Standard	NM_182752		Approved	RP11-46F15.3, FLJ21811	uc001akm.3	Q5T0D9	OTTHUMG00000000609	ENST00000378344.2:c.225G>A	chr1.hg19:g.3542011G>A		202.0	0.0		173.0	73.0	NM_182752	A8K1K4|Q8WV04	Silent	SNP	ENST00000378344.2	hg19	CCDS47.1																																																																																			.	.		0.716	TPRG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001466.1	NM_182752	
CHD5	26038	hgsc.bcm.edu	37	1	6209325	6209325	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:6209325T>G	ENST00000262450.3	-	8	1241	c.1142A>C	c.(1141-1143)aAg>aCg	p.K381T	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GCAGCTCCACTTGCCCTCGGG	0.677																																					p.K381T		Atlas-SNP	.											.	CHD5	267	.	0			c.A1142C						.						24.0	25.0	25.0					1																	6209325		2203	4299	6502	SO:0001583	missense	26038	exon8			CTCCACTTGCCCT	AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.1142A>C	chr1.hg19:g.6209325T>G	ENSP00000262450:p.Lys381Thr	73.0	0.0		88.0	43.0	NM_015557	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	ENST00000262450.3	hg19	CCDS57.1	.	.	.	.	.	.	.	.	.	.	T	16.79	3.219164	0.58560	.	.	ENSG00000116254	ENST00000262450	D	0.85702	-2.02	4.03	4.03	0.46877	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, RING-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.64402	U	0.000001	T	0.78142	0.4237	L	0.41415	1.275	0.80722	D	1	P	0.36909	0.573	B	0.33521	0.165	T	0.78979	-0.1990	10	0.49607	T	0.09	-28.7911	12.4529	0.55686	0.0:0.0:0.0:1.0	.	381	Q8TDI0	CHD5_HUMAN	T	381	ENSP00000262450:K381T	ENSP00000262450:K381T	K	-	2	0	CHD5	6131912	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	4.052000	0.57420	1.623000	0.50342	0.260000	0.18958	AAG	.	.		0.677	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002823.2	NM_015557	
UBE4B	10277	hgsc.bcm.edu	37	1	10195205	10195205	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:10195205G>C	ENST00000253251.8	+	15	2637	c.1798G>C	c.(1798-1800)Gca>Cca	p.A600P	UBE4B_ENST00000343090.6_Missense_Mutation_p.A729P|UBE4B_ENST00000377157.3_Missense_Mutation_p.A484P					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GCGTGTGAATGCAACGATGGA	0.438																																					p.A729P		Atlas-SNP	.											.	UBE4B	233	.	0			c.G2185C						.						142.0	121.0	128.0					1																	10195205		2203	4300	6503	SO:0001583	missense	10277	exon16			GTGAATGCAACGA	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.1798G>C	chr1.hg19:g.10195205G>C	ENSP00000253251:p.Ala600Pro	120.0	0.0		126.0	56.0	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	hg19	CCDS110.1	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192376	0.58017	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.48201	0.82;0.82;0.82	6.04	6.04	0.98038	Ubiquitin conjugation factor E4, core (1);	0.000000	0.85682	D	0.000000	T	0.72574	0.3477	M	0.83774	2.66	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.998	D;D;D	0.72338	0.977;0.915;0.962	T	0.69209	-0.5205	10	0.35671	T	0.21	-18.3443	20.5836	0.99426	0.0:0.0:1.0:0.0	.	600;729;600	A8K8S9;O95155;O95155-2	.;UBE4B_HUMAN;.	P	600;484;729	ENSP00000253251:A600P;ENSP00000366362:A484P;ENSP00000343001:A729P	ENSP00000253251:A600P	A	+	1	0	UBE4B	10117792	1.000000	0.71417	0.544000	0.28141	0.067000	0.16453	9.813000	0.99286	2.870000	0.98441	0.637000	0.83480	GCA	.	.		0.438	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
EPHA8	2046	hgsc.bcm.edu	37	1	22902776	22902776	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:22902776A>C	ENST00000166244.3	+	3	298	c.226A>C	c.(226-228)Atg>Ctg	p.M76L	EPHA8_ENST00000538803.1_Missense_Mutation_p.M76L|EPHA8_ENST00000374644.4_Missense_Mutation_p.M76L	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	76	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TTGCAACGTCATGAGCCCCAA	0.602																																					p.M76L		Atlas-SNP	.											.	EPHA8	221	.	0			c.A226C						.						98.0	95.0	96.0					1																	22902776		2203	4300	6503	SO:0001583	missense	2046	exon3			AACGTCATGAGCC	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.226A>C	chr1.hg19:g.22902776A>C	ENSP00000166244:p.Met76Leu	262.0	0.0		275.0	109.0	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Missense_Mutation	SNP	ENST00000166244.3	hg19	CCDS225.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.073692	0.76415	.	.	ENSG00000070886	ENST00000166244;ENST00000374644;ENST00000538803	T;T;T	0.08984	3.03;3.03;3.03	4.47	4.47	0.54385	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.20210	0.0486	L	0.47078	1.49	0.58432	D	0.999996	P;D	0.61697	0.832;0.99	D;D	0.78314	0.921;0.991	T	0.00975	-1.1494	10	0.33940	T	0.23	.	12.7216	0.57146	1.0:0.0:0.0:0.0	.	76;76	P29322;P29322-2	EPHA8_HUMAN;.	L	76	ENSP00000166244:M76L;ENSP00000363775:M76L;ENSP00000440274:M76L	ENSP00000166244:M76L	M	+	1	0	EPHA8	22775363	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.937000	0.70162	1.877000	0.54381	0.363000	0.22086	ATG	.	.		0.602	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
HMGCL	3155	hgsc.bcm.edu	37	1	24147006	24147006	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:24147006A>C	ENST00000374490.3	-	2	181	c.138T>G	c.(136-138)aaT>aaG	p.N46K	HMGCL_ENST00000436439.2_Missense_Mutation_p.N46K|HMGCL_ENST00000374483.4_Missense_Mutation_p.N21K|HMGCL_ENST00000509389.1_5'UTR	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	46					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		TTACCTTTTCATTTTGTAGTC	0.413																																					p.N46K		Atlas-SNP	.											.	HMGCL	22	.	0			c.T138G	GRCh37	CI952229	HMGCL	I		.						168.0	144.0	153.0					1																	24147006		2203	4300	6503	SO:0001583	missense	3155	exon2			CTTTTCATTTTGT	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.138T>G	chr1.hg19:g.24147006A>C	ENSP00000363614:p.Asn46Lys	161.0	0.0		122.0	50.0	NM_000191	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Missense_Mutation	SNP	ENST00000374490.3	hg19	CCDS243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.33|16.33	3.093907|3.093907	0.56075|0.56075	.|.	.|.	ENSG00000117305|ENSG00000117305	ENST00000235958|ENST00000374490;ENST00000436439;ENST00000374483;ENST00000543166	.|D;D;D	.|0.98264	.|-4.83;-4.65;-4.83	5.27|5.27	2.9|2.9	0.33743|0.33743	.|Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	.|0.177290	.|0.64402	.|D	.|0.000009	D|D	0.98639|0.98639	0.9544|0.9544	H|H	0.98594|0.98594	4.275|4.275	0.53005|0.53005	D|D	0.999962|0.999962	.|B;B;B;B	.|0.33135	.|0.399;0.135;0.135;0.135	.|B;B;B;B	.|0.40782	.|0.34;0.217;0.275;0.217	D|D	0.99486|0.99486	1.0949|1.0949	5|10	.|0.72032	.|D	.|0.01	-5.5475|-5.5475	8.2613|8.2613	0.31786|0.31786	0.7729:0.0:0.2271:0.0|0.7729:0.0:0.2271:0.0	.|.	.|46;46;21;46	.|B4DUP4;Q6IBC0;B1AK13;P35914	.|.;.;.;HMGCL_HUMAN	R|K	42|46;46;21;21	.|ENSP00000363614:N46K;ENSP00000389281:N46K;ENSP00000363607:N21K	.|ENSP00000363607:N21K	M|N	-|-	2|3	0|2	HMGCL|HMGCL	24019593|24019593	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	3.196000|3.196000	0.51020|0.51020	1.026000|1.026000	0.39733|0.39733	0.456000|0.456000	0.33151|0.33151	ATG|AAT	.	.		0.413	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	
HMGCL	3155	hgsc.bcm.edu	37	1	24147010	24147010	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:24147010T>A	ENST00000374490.3	-	2	177	c.134A>T	c.(133-135)cAa>cTa	p.Q45L	HMGCL_ENST00000436439.2_Missense_Mutation_p.Q45L|HMGCL_ENST00000374483.4_Missense_Mutation_p.Q20L|HMGCL_ENST00000509389.1_5'UTR	NM_000191.2	NP_000182.2	P35914	HMGCL_HUMAN	3-hydroxymethyl-3-methylglutaryl-CoA lyase	45					acyl-CoA metabolic process (GO:0006637)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|leucine catabolic process (GO:0006552)|liver development (GO:0001889)|mitochondrion organization (GO:0007005)|protein tetramerization (GO:0051262)|response to fatty acid (GO:0070542)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	carboxylic acid binding (GO:0031406)|fatty-acyl-CoA binding (GO:0000062)|hydroxymethylglutaryl-CoA lyase activity (GO:0004419)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		CTTTTCATTTTGTAGTCCATC	0.408																																					p.Q45L		Atlas-SNP	.											.	HMGCL	22	.	0			c.A134T						.						164.0	142.0	149.0					1																	24147010		2203	4300	6503	SO:0001583	missense	3155	exon2			TCATTTTGTAGTC	BC010570	CCDS243.1, CCDS53279.1	1p36.1-p35	2010-04-30	2010-04-30		ENSG00000117305	ENSG00000117305	4.1.3.4		5005	protein-coding gene	gene with protein product	"""hydroxymethylglutaricaciduria"""	613898	"""3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase"""			8102917, 8978493	Standard	NM_001166059		Approved	HL	uc001bib.3	P35914	OTTHUMG00000002963	ENST00000374490.3:c.134A>T	chr1.hg19:g.24147010T>A	ENSP00000363614:p.Gln45Leu	159.0	0.0		123.0	12.0	NM_000191	B4DUP4|B7UCC6|D3Y5K7|Q6IBC0|Q96FP8	Missense_Mutation	SNP	ENST00000374490.3	hg19	CCDS243.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	32|32	5.114377|5.114377	0.94339|0.94339	.|.	.|.	ENSG00000117305|ENSG00000117305	ENST00000235958|ENST00000374490;ENST00000436439;ENST00000374483;ENST00000543166	.|D;D;D	.|0.99825	.|-6.6;-6.97;-6.6	5.27|5.27	5.27|5.27	0.74061|0.74061	.|Aldolase-type TIM barrel (1);Pyruvate carboxyltransferase (2);	.|0.047872	.|0.85682	.|D	.|0.000000	.|D	.|0.99910	.|0.9957	H|H	0.99391|0.99391	4.545|4.545	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.999;0.987;0.987;0.987	.|D;D;D;D	.|0.79108	.|0.992;0.913;0.913;0.913	.|D	.|0.96097	.|0.9066	.|10	.|0.87932	.|D	.|0	-10.7394|-10.7394	14.3693|14.3693	0.66828|0.66828	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|45;45;20;45	.|B4DUP4;Q6IBC0;B1AK13;P35914	.|.;.;.;HMGCL_HUMAN	X|L	41|45;45;20;20	.|ENSP00000363614:Q45L;ENSP00000389281:Q45L;ENSP00000363607:Q20L	.|ENSP00000363607:Q20L	K|Q	-|-	1|2	0|0	HMGCL|HMGCL	24019597|24019597	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	7.271000|7.271000	0.78506|0.78506	2.227000|2.227000	0.72691|0.72691	0.456000|0.456000	0.33151|0.33151	AAA|CAA	.	.		0.408	HMGCL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008253.2	NM_000191	
RNF19B	127544	hgsc.bcm.edu	37	1	33430200	33430200	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:33430200C>T	ENST00000373456.7	-	1	86	c.87G>A	c.(85-87)cgG>cgA	p.R29R	RNF19B_ENST00000356990.5_Silent_p.R29R|RNF19B_ENST00000235150.4_Silent_p.R29R	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	29	Poly-Arg.				interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				ggcgccggcgccggccgccgc	0.776																																					p.R29R		Atlas-SNP	.											.	RNF19B	43	.	0			c.G87A						.						1.0	2.0	2.0					1																	33430200		240	871	1111	SO:0001819	synonymous_variant	127544	exon1			CCGGCGCCGGCCG	AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.87G>A	chr1.hg19:g.33430200C>T		27.0	0.0		41.0	21.0	NM_001127361	B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Silent	SNP	ENST00000373456.7	hg19	CCDS372.2																																																																																			.	.		0.776	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011465.3	NM_153341	
GJB5	2709	hgsc.bcm.edu	37	1	35223441	35223441	+	Silent	SNP	C	C	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:35223441C>G	ENST00000338513.1	+	2	683	c.510C>G	c.(508-510)ccC>ccG	p.P170P	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	170					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				ATCCATGTCCCAATATAGTGG	0.517																																					p.P170P		Atlas-SNP	.											.	GJB5	35	.	0			c.C510G						.						103.0	91.0	95.0					1																	35223441		2203	4300	6503	SO:0001819	synonymous_variant	2709	exon2			ATGTCCCAATATA	BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.510C>G	chr1.hg19:g.35223441C>G		86.0	0.0		58.0	22.0	NM_005268	Q9UPA3	Silent	SNP	ENST00000338513.1	hg19	CCDS382.1																																																																																			.	.		0.517	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011561.1	NM_005268	
HIVEP3	59269	hgsc.bcm.edu	37	1	41976245	41976245	+	Silent	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:41976245T>A	ENST00000372583.1	-	9	7983	c.7098A>T	c.(7096-7098)ccA>ccT	p.P2366P	HIVEP3_ENST00000247584.5_Silent_p.P2366P|HIVEP3_ENST00000429157.2_Silent_p.P2365P|HIVEP3_ENST00000460604.1_5'UTR|HIVEP3_ENST00000372584.1_Silent_p.P2365P	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	2366					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				TCGTCCGGGCTGGGAAGCGGG	0.701																																					p.P2366P		Atlas-SNP	.											.	HIVEP3	235	.	0			c.A7098T						.						14.0	14.0	14.0					1																	41976245		2165	4253	6418	SO:0001819	synonymous_variant	59269	exon9			CCGGGCTGGGAAG	AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.7098A>T	chr1.hg19:g.41976245T>A		119.0	0.0		79.0	23.0	NM_024503	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	ENST00000372583.1	hg19	CCDS463.1																																																																																			.	.		0.701	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000016978.1	NM_024503	
MAST2	23139	hgsc.bcm.edu	37	1	46269721	46269721	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:46269721G>A	ENST00000361297.2	+	1	437	c.154G>A	c.(154-156)Gcg>Acg	p.A52T	MAST2_ENST00000372009.2_Missense_Mutation_p.A52T	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					GACGGGCCCCGCGGGGCCCGA	0.736																																					p.A52T		Atlas-SNP	.											.	MAST2	136	.	0			c.G154A						.						2.0	3.0	3.0					1																	46269721		741	1926	2667	SO:0001583	missense	23139	exon1			GGCCCCGCGGGGC	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.154G>A	chr1.hg19:g.46269721G>A	ENSP00000354671:p.Ala52Thr	166.0	0.0		222.0	78.0	NM_015112		Missense_Mutation	SNP	ENST00000361297.2	hg19	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	G	5.516	0.280175	0.10458	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.63913	-0.0;-0.07	2.79	-5.58	0.02512	.	.	.	.	.	T	0.29355	0.0731	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.12400	-1.0549	9	0.23891	T	0.37	2.0859	0.4333	0.00475	0.2152:0.2892:0.2032:0.2925	.	52;52	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	T	52	ENSP00000354671:A52T;ENSP00000361079:A52T	ENSP00000354671:A52T	A	+	1	0	MAST2	46042308	0.001000	0.12720	0.001000	0.08648	0.196000	0.23810	-1.625000	0.02036	-1.437000	0.01967	-1.283000	0.01379	GCG	.	.		0.736	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
ZFYVE9	9372	hgsc.bcm.edu	37	1	52705044	52705044	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:52705044A>T	ENST00000371591.1	+	3	2086	c.1955A>T	c.(1954-1956)tAt>tTt	p.Y652F	ZFYVE9_ENST00000287727.3_Missense_Mutation_p.Y652F|ZFYVE9_ENST00000357206.2_Missense_Mutation_p.Y652F	NM_004799.2|NM_007324.2	NP_004790.2|NP_015563.2	O95405	ZFYV9_HUMAN	zinc finger, FYVE domain containing 9	652					endocytosis (GO:0006897)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|SMAD protein complex assembly (GO:0007183)|SMAD protein import into nucleus (GO:0007184)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome (GO:0005769)|early endosome membrane (GO:0031901)	1-phosphatidylinositol binding (GO:0005545)|metal ion binding (GO:0046872)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(4)|endometrium(3)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	53						TTAGAAAGTTATGAGGCTGAG	0.433																																					p.Y652F		Atlas-SNP	.											.	ZFYVE9	131	.	0			c.A1955T						.						109.0	107.0	108.0					1																	52705044		2203	4300	6503	SO:0001583	missense	9372	exon4			AAAGTTATGAGGC	AF104304	CCDS563.1, CCDS564.1	1p32.3	2014-06-13	2004-05-21	2004-05-26	ENSG00000157077	ENSG00000157077		"""Zinc fingers, FYVE domain containing"""	6775	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 173"""	603755	"""MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor"""	MADHIP		9865696	Standard	NM_007324		Approved	SMADIP, SARA, PPP1R173	uc001cto.4	O95405	OTTHUMG00000008061	ENST00000371591.1:c.1955A>T	chr1.hg19:g.52705044A>T	ENSP00000360647:p.Tyr652Phe	141.0	0.0		175.0	67.0	NM_007323	Q5T0F6|Q5T0F7|Q9UNE1|Q9Y5R7	Missense_Mutation	SNP	ENST00000371591.1	hg19	CCDS563.1	.	.	.	.	.	.	.	.	.	.	A	6.680	0.494102	0.12702	.	.	ENSG00000157077	ENST00000357206;ENST00000361625;ENST00000287727;ENST00000371591	T;T;T;T	0.54279	1.05;0.58;1.07;1.07	4.94	3.79	0.43588	.	0.000000	0.49305	D	0.000157	T	0.28764	0.0713	N	0.12182	0.205	0.28834	N	0.896984	B;B;B	0.14438	0.001;0.001;0.01	B;B;B	0.11329	0.004;0.002;0.006	T	0.15838	-1.0423	10	0.15952	T	0.53	.	7.1007	0.25336	0.7017:0.1524:0.0:0.1459	.	652;652;652	O95405-2;O95405;O95405-3	.;ZFYV9_HUMAN;.	F	652	ENSP00000349737:Y652F;ENSP00000355358:Y652F;ENSP00000287727:Y652F;ENSP00000360647:Y652F	ENSP00000287727:Y652F	Y	+	2	0	ZFYVE9	52477632	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	3.057000	0.49931	0.983000	0.38602	0.459000	0.35465	TAT	.	.		0.433	ZFYVE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022083.1	NM_007324	
GLIS1	148979	hgsc.bcm.edu	37	1	53995579	53995579	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:53995579A>C	ENST00000312233.2	-	4	1408	c.842T>G	c.(841-843)aTc>aGc	p.I281S		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						CCTCAGGTGGATCTTGAGGTT	0.652																																					p.I281S		Atlas-SNP	.											.	GLIS1	52	.	0			c.T842G						.						55.0	59.0	58.0					1																	53995579		2203	4300	6503	SO:0001583	missense	148979	exon4			AGGTGGATCTTGA	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.842T>G	chr1.hg19:g.53995579A>C	ENSP00000309653:p.Ile281Ser	63.0	0.0		49.0	20.0	NM_147193		Missense_Mutation	SNP	ENST00000312233.2	hg19	CCDS582.1	.	.	.	.	.	.	.	.	.	.	A	18.32	3.598955	0.66332	.	.	ENSG00000174332	ENST00000312233	T	0.17213	2.29	4.58	4.58	0.56647	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.48286	D	0.000184	T	0.26991	0.0661	N	0.17872	0.535	0.58432	D	0.999994	D	0.89917	1.0	D	0.85130	0.997	T	0.07635	-1.0762	10	0.56958	D	0.05	.	14.2651	0.66113	1.0:0.0:0.0:0.0	.	281	Q8NBF1	GLIS1_HUMAN	S	281	ENSP00000309653:I281S	ENSP00000309653:I281S	I	-	2	0	GLIS1	53768167	1.000000	0.71417	1.000000	0.80357	0.716000	0.41182	9.287000	0.95975	1.842000	0.53543	0.402000	0.26972	ATC	.	.		0.652	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193	
SLC35D1	23169	hgsc.bcm.edu	37	1	67518480	67518480	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:67518480C>T	ENST00000235345.5	-	3	383	c.298G>A	c.(298-300)Gac>Aac	p.D100N	SLC35D1_ENST00000506472.2_Missense_Mutation_p.D21N	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	100					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						CTGTCAAGGTCAGGAAACTTG	0.398																																					p.D100N		Atlas-SNP	.											.	SLC35D1	22	.	0			c.G298A						.						114.0	113.0	113.0					1																	67518480		2203	4300	6503	SO:0001583	missense	23169	exon3			CAAGGTCAGGAAA	AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.298G>A	chr1.hg19:g.67518480C>T	ENSP00000235345:p.Asp100Asn	129.0	0.0		144.0	58.0	NM_015139	A8K185|B7Z3X2|Q52LU5|Q92548	Missense_Mutation	SNP	ENST00000235345.5	hg19	CCDS636.1	.	.	.	.	.	.	.	.	.	.	C	20.2	3.944537	0.73672	.	.	ENSG00000116704	ENST00000235345;ENST00000506472	T;T	0.64991	-0.13;0.3	5.18	5.18	0.71444	.	0.045850	0.85682	D	0.000000	T	0.45418	0.1341	L	0.60957	1.885	0.80722	D	1	B;B	0.23442	0.085;0.038	B;B	0.21151	0.033;0.033	T	0.44467	-0.9326	10	0.21540	T	0.41	-30.0873	17.4611	0.87620	0.0:1.0:0.0:0.0	.	21;100	B7Z3X2;Q9NTN3	.;S35D1_HUMAN	N	100;21	ENSP00000235345:D100N;ENSP00000445189:D21N	ENSP00000235345:D100N	D	-	1	0	SLC35D1	67291068	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.390000	0.79816	2.412000	0.81896	0.655000	0.94253	GAC	.	.		0.398	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025948.1	NM_015139	
ACADM	34	hgsc.bcm.edu	37	1	76216231	76216231	+	Splice_Site	SNP	G	G	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:76216231G>C	ENST00000370841.4	+	10	1382	c.945G>C	c.(943-945)gaG>gaC	p.E315D	ACADM_ENST00000420607.2_Splice_Site_p.E319D|ACADM_ENST00000370834.5_Splice_Site_p.E348D|ACADM_ENST00000543667.1_Splice_Site_p.E126D|ACADM_ENST00000481374.1_3'UTR|ACADM_ENST00000541113.1_Splice_Site_p.E279D	NM_000016.4|NM_001127328.1	NP_000007.1|NP_001120800.1	P11310	ACADM_HUMAN	acyl-CoA dehydrogenase, C-4 to C-12 straight chain	315					cardiac muscle cell differentiation (GO:0055007)|carnitine biosynthetic process (GO:0045329)|carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|glycogen biosynthetic process (GO:0005978)|liver development (GO:0001889)|medium-chain fatty acid catabolic process (GO:0051793)|medium-chain fatty acid metabolic process (GO:0051791)|oxidation-reduction process (GO:0055114)|post-embryonic development (GO:0009791)|regulation of gluconeogenesis (GO:0006111)|response to cold (GO:0009409)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	axon (GO:0030424)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|identical protein binding (GO:0042802)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)			breast(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	18					Flavin adenine dinucleotide(DB03147)	TACTTGTAGAGGTAATTTTAA	0.343																																					p.E319D		Atlas-SNP	.											.	ACADM	50	.	0			c.G957C						.						65.0	71.0	69.0					1																	76216231		2203	4299	6502	SO:0001630	splice_region_variant	34	exon10			TGTAGAGGTAATT	M16827	CCDS668.1, CCDS44165.1, CCDS65562.1, CCDS72807.1	1p31	2014-09-17	2010-04-30		ENSG00000117054	ENSG00000117054	1.3.99.3		89	protein-coding gene	gene with protein product		607008	"""acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain"""			3035565	Standard	NM_000016		Approved	MCAD, MCADH, ACAD1	uc009wbp.3	P11310	OTTHUMG00000009784	ENST00000370841.4:c.945+1G>C	chr1.hg19:g.76216231G>C		94.0	0.0		131.0	14.0	NM_001127328	Q5T4U4|Q9NYF1	Missense_Mutation	SNP	ENST00000370841.4	hg19	CCDS668.1	.	.	.	.	.	.	.	.	.	.	G	10.91	1.485317	0.26598	.	.	ENSG00000117054	ENST00000370841;ENST00000370834;ENST00000541113;ENST00000543667;ENST00000420607	D;D;D;D;D	0.95821	-3.82;-3.82;-3.82;-3.82;-3.82	5.58	5.58	0.84498	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);	0.000000	0.85682	D	0.000000	D	0.86234	0.5884	N	0.12920	0.275	0.80722	D	1	B;B;B;B;B	0.12013	0.0;0.0;0.005;0.0;0.0	B;B;B;B;B	0.21360	0.001;0.001;0.034;0.0;0.0	T	0.82627	-0.0364	10	0.40728	T	0.16	.	13.8243	0.63342	0.0753:0.0:0.9247:0.0	.	279;229;348;319;315	B7Z9I1;B4DVE0;Q5T4U5;P11310-2;P11310	.;.;.;.;ACADM_HUMAN	D	315;348;279;126;319	ENSP00000359878:E315D;ENSP00000359871:E348D;ENSP00000442324:E279D;ENSP00000446176:E126D;ENSP00000409612:E319D	ENSP00000359871:E348D	E	+	3	2	ACADM	75988819	1.000000	0.71417	1.000000	0.80357	0.078000	0.17371	5.052000	0.64263	2.622000	0.88805	0.585000	0.79938	GAG	.	.		0.343	ACADM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000026967.1		Missense_Mutation
ADAM30	11085	hgsc.bcm.edu	37	1	120436684	120436684	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:120436684T>C	ENST00000369400.1	-	1	2434	c.2276A>G	c.(2275-2277)cAg>cGg	p.Q759R		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	759	5 X 9 AA approximate repeats.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		AGATTCTTCCTGTCCAGTTTT	0.353																																					p.Q759R		Atlas-SNP	.											.	ADAM30	88	.	0			c.A2276G						.						280.0	293.0	288.0					1																	120436684		2203	4300	6503	SO:0001583	missense	11085	exon1			TCTTCCTGTCCAG	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.2276A>G	chr1.hg19:g.120436684T>C	ENSP00000358407:p.Gln759Arg	171.0	0.0		162.0	72.0	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	hg19	CCDS907.1	.	.	.	.	.	.	.	.	.	.	T	7.085	0.571068	0.13623	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.01145	5.27	2.47	-1.66	0.08265	.	.	.	.	.	T	0.00241	0.0007	N	0.19112	0.55	0.09310	N	1	B	0.16802	0.019	B	0.04013	0.001	T	0.35724	-0.9777	9	0.09843	T	0.71	.	3.5289	0.07769	0.0:0.2834:0.2063:0.5103	.	759	Q9UKF2	ADA30_HUMAN	R	759	ENSP00000358407:Q759R	ENSP00000358407:Q759R	Q	-	2	0	ADAM30	120238207	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.167000	0.03126	-0.189000	0.10482	-0.619000	0.04042	CAG	.	.		0.353	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
PGLYRP4	57115	hgsc.bcm.edu	37	1	153315636	153315636	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:153315636A>T	ENST00000359650.5	-	5	466	c.402T>A	c.(400-402)aaT>aaA	p.N134K	PGLYRP4_ENST00000490266.1_5'Flank|PGLYRP4_ENST00000368739.3_Missense_Mutation_p.N130K	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	134					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CTCCTTGGATATTCCAGCCAA	0.488																																					p.N134K		Atlas-SNP	.											.	PGLYRP4	45	.	0			c.T402A						.						219.0	166.0	184.0					1																	153315636		2203	4300	6503	SO:0001583	missense	57115	exon5			TTGGATATTCCAG	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.402T>A	chr1.hg19:g.153315636A>T	ENSP00000352672:p.Asn134Lys	183.0	0.0		250.0	69.0	NM_020393	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	ENST00000359650.5	hg19	CCDS30871.1	.	.	.	.	.	.	.	.	.	.	A	9.868	1.198211	0.22037	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.24723	1.84;1.84	4.71	-8.85	0.00799	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.680921	0.13774	N	0.363694	T	0.08447	0.0210	M	0.62154	1.92	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.17979	0.011;0.02	T	0.26018	-1.0115	10	0.66056	D	0.02	-21.3531	10.1063	0.42535	0.7094:0.0:0.1863:0.1043	.	130;134	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	K	130;134	ENSP00000357728:N130K;ENSP00000352672:N134K	ENSP00000352672:N134K	N	-	3	2	PGLYRP4	151582260	0.000000	0.05858	0.000000	0.03702	0.598000	0.36846	-2.644000	0.00862	-2.005000	0.00959	-1.179000	0.01719	AAT	.	.		0.488	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
ASH1L	55870	hgsc.bcm.edu	37	1	155451459	155451459	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:155451459T>A	ENST00000368346.3	-	3	1841	c.1202A>T	c.(1201-1203)aAt>aTt	p.N401I	ASH1L_ENST00000392403.3_Missense_Mutation_p.N401I|ASH1L_ENST00000548830.1_3'UTR			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	401					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			AATGTCCTTATTAACCAATCC	0.423																																					p.N401I		Atlas-SNP	.											.	ASH1L	279	.	0			c.A1202T						.						140.0	136.0	137.0					1																	155451459		2203	4300	6503	SO:0001583	missense	55870	exon3			TCCTTATTAACCA	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.1202A>T	chr1.hg19:g.155451459T>A	ENSP00000357330:p.Asn401Ile	70.0	0.0		104.0	31.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	ENST00000368346.3	hg19		.	.	.	.	.	.	.	.	.	.	T	11.84	1.757434	0.31137	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89123	-2.47;-2.47	4.64	-1.93	0.07594	.	0.303702	0.27936	N	0.017252	T	0.59280	0.2182	N	0.08118	0	0.80722	D	1	B;B	0.27791	0.119;0.189	B;B	0.30179	0.052;0.112	T	0.51403	-0.8710	10	0.72032	D	0.01	.	4.7871	0.13230	0.0:0.3613:0.3509:0.2878	.	401;401	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	I	401	ENSP00000357330:N401I;ENSP00000376204:N401I	ENSP00000357330:N401I	N	-	2	0	ASH1L	153718083	0.991000	0.36638	0.992000	0.48379	0.995000	0.86356	0.004000	0.13106	-0.203000	0.10251	0.460000	0.39030	AAT	.	.		0.423	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
METTL18	92342	hgsc.bcm.edu	37	1	169762137	169762137	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:169762137T>A	ENST00000310392.4	-	2	1053	c.700A>T	c.(700-702)Aac>Tac	p.N234Y	METTL18_ENST00000303469.2_Missense_Mutation_p.N234Y|C1orf112_ENST00000498289.1_Intron|C1orf112_ENST00000413811.2_5'Flank|C1orf112_ENST00000456684.1_5'Flank|C1orf112_ENST00000359326.4_5'Flank|C1orf112_ENST00000286031.6_5'Flank	NM_033418.2	NP_219486.1	O95568	MET18_HUMAN	methyltransferase like 18	234						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			kidney(1)|large_intestine(3)|lung(4)	8						AAAGTGGAGTTAGCTACTACA	0.348																																					p.N234Y		Atlas-SNP	.											.	METTL18	23	.	0			c.A700T						.						131.0	140.0	137.0					1																	169762137		2202	4299	6501	SO:0001583	missense	92342	exon2			TGGAGTTAGCTAC	AL035369	CCDS1284.1	1q24.2	2013-10-11	2011-03-02	2011-03-02	ENSG00000171806	ENSG00000171806			28793	protein-coding gene	gene with protein product	"""histidine protein methyltransferase 1"""	615255	"""chromosome 1 open reading frame 156"""	C1orf156		20864530	Standard	NM_033418		Approved	MGC9084, AsTP2, HPM1	uc001ggn.4	O95568	OTTHUMG00000035813	ENST00000310392.4:c.700A>T	chr1.hg19:g.169762137T>A	ENSP00000307975:p.Asn234Tyr	160.0	0.0		279.0	85.0	NM_033418	B2R9T5	Missense_Mutation	SNP	ENST00000310392.4	hg19	CCDS1284.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.304733	0.81247	.	.	ENSG00000171806	ENST00000310392;ENST00000303469	D;D	0.89415	-2.51;-2.51	6.06	6.06	0.98353	.	0.052808	0.64402	D	0.000001	D	0.94182	0.8133	M	0.85542	2.76	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94930	0.8081	10	0.72032	D	0.01	-53.9551	15.4394	0.75171	0.0:0.0:0.0:1.0	.	234	O95568	MET18_HUMAN	Y	234	ENSP00000307975:N234Y;ENSP00000307077:N234Y	ENSP00000307077:N234Y	N	-	1	0	METTL18	168028761	1.000000	0.71417	0.714000	0.30535	0.987000	0.75469	7.470000	0.80973	2.315000	0.78130	0.533000	0.62120	AAC	.	.		0.348	METTL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087109.1	NM_033418	
PRRC2C	23215	hgsc.bcm.edu	37	1	171511016	171511016	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:171511016G>A	ENST00000338920.4	+	16	4642	c.4405G>A	c.(4405-4407)Gtt>Att	p.V1469I	PRRC2C_ENST00000367742.3_Missense_Mutation_p.V1471I|PRRC2C_ENST00000426496.2_Missense_Mutation_p.V1469I|PRRC2C_ENST00000392078.3_Missense_Mutation_p.V1471I	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	1469					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										TCAAGAACCAGTTAATACTCT	0.423																																					p.V1469I		Atlas-SNP	.											.	.	.	.	0			c.G4405A						.						64.0	65.0	65.0					1																	171511016		2203	4300	6503	SO:0001583	missense	23215	exon16			GAACCAGTTAATA	AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.4405G>A	chr1.hg19:g.171511016G>A	ENSP00000343629:p.Val1469Ile	190.0	0.0		247.0	79.0	NM_015172	Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	ENST00000338920.4	hg19	CCDS1296.2	.	.	.	.	.	.	.	.	.	.	G	3.787	-0.044463	0.07452	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080	T;T;T;T	0.01947	4.54;4.54;4.54;4.54	5.65	3.78	0.43462	.	0.344565	0.20672	N	0.087809	T	0.00784	0.0026	L	0.46157	1.445	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.49447	-0.8939	10	0.54805	T	0.06	.	3.1049	0.06339	0.1466:0.2159:0.5056:0.1319	.	1469	Q9Y520-4	.	I	1471;1470;1469;1471;1469;1226	ENSP00000375928:V1471I;ENSP00000410219:V1469I;ENSP00000356716:V1471I;ENSP00000343629:V1469I	ENSP00000343629:V1469I	V	+	1	0	PRRC2C	169777640	0.942000	0.31987	0.700000	0.30305	0.782000	0.44232	1.683000	0.37638	0.747000	0.32809	-0.156000	0.13503	GTT	.	.		0.423	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314826.4	NM_015172	
RASAL2	9462	hgsc.bcm.edu	37	1	178408712	178408712	+	Splice_Site	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:178408712T>C	ENST00000462775.1	+	4	509		c.e4+2		RASAL2_ENST00000367649.3_Splice_Site|RASAL2_ENST00000448150.3_Splice_Site	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2						negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						TGCTTTGAGGTAAAAATAAAG	0.373																																					.		Atlas-SNP	.											.	RASAL2	334	.	0			c.828+2T>C						.						80.0	78.0	79.0					1																	178408712		2203	4300	6503	SO:0001630	splice_region_variant	9462	exon6			TTGAGGTAAAAAT	AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.384+2T>C	chr1.hg19:g.178408712T>C		85.0	0.0		154.0	39.0	NM_170692	F8W755|O95174|Q2TB22|Q5TFU9	Splice_Site	SNP	ENST00000462775.1	hg19	CCDS1322.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.151339	0.78001	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	.	.	.	6.02	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9635	0.53021	0.0:0.0674:0.0:0.9326	.	.	.	.	.	-1	.	.	.	+	.	.	RASAL2	176675335	1.000000	0.71417	0.997000	0.53966	0.921000	0.55340	5.869000	0.69613	1.099000	0.41499	0.533000	0.62120	.	.	.		0.373	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000084758.3	NM_170692	Intron
ABL2	27	hgsc.bcm.edu	37	1	179112161	179112161	+	Intron	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:179112161G>T	ENST00000502732.1	-	2	361				ABL2_ENST00000392043.3_Intron|ABL2_ENST00000344730.3_Missense_Mutation_p.L7I|ABL2_ENST00000408940.3_Missense_Mutation_p.L7I|ABL2_ENST00000504405.1_Missense_Mutation_p.L7I|ABL2_ENST00000507173.1_Intron|ABL2_ENST00000512653.1_Missense_Mutation_p.L7I|ABL2_ENST00000367623.4_Intron|ABL2_ENST00000511413.1_Intron	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase						actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	GGTGGAAGGAGAACTGTCCCA	0.458			T	ETV6	AML																																p.L7I		Atlas-SNP	.		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	.	ABL2	307	.	0			c.C19A						.						101.0	98.0	99.0					1																	179112161		1950	4141	6091	SO:0001627	intron_variant	27	exon1			GAAGGAGAACTGT	M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.158-9652C>A	chr1.hg19:g.179112161G>T		126.0	0.0		170.0	44.0	NM_001136000	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Missense_Mutation	SNP	ENST00000502732.1	hg19	CCDS30947.1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.718852	0.30503	.	.	ENSG00000143322	ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405	T;T;T;T	0.76186	-0.98;-0.91;-0.92;-1.0	5.62	2.73	0.32206	.	.	.	.	.	T	0.59783	0.2219	.	.	.	0.21220	N	0.999756	B;B;B;B;B;B	0.32968	0.003;0.392;0.392;0.01;0.006;0.003	B;B;B;B;B;B	0.25140	0.007;0.058;0.058;0.007;0.003;0.007	T	0.53344	-0.8452	8	0.66056	D	0.02	.	6.3642	0.21445	0.1635:0.1524:0.6841:0.0	.	7;7;7;7;7;7	P42684-4;P42684-9;P42684-2;P42684-3;D1MPS6;P42684-10	.;.;.;.;.;.	I	7	ENSP00000386152:L7I;ENSP00000339209:L7I;ENSP00000423578:L7I;ENSP00000426831:L7I	ENSP00000339209:L7I	L	-	1	0	ABL2	177378784	1.000000	0.71417	0.897000	0.35233	0.399000	0.30720	2.343000	0.44001	0.726000	0.32339	-0.136000	0.14681	CTC	.	.		0.458	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085174.3	NM_005158	
CAMSAP2	23271	hgsc.bcm.edu	37	1	200819254	200819254	+	Silent	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:200819254T>C	ENST00000236925.4	+	12	3439	c.3390T>C	c.(3388-3390)gaT>gaC	p.D1130D	CAMSAP2_ENST00000413307.2_Silent_p.D1103D|CAMSAP2_ENST00000358823.2_Silent_p.D1119D			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	1130					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										CCCTCTCAGATTTGAAACCCC	0.408																																					p.D1119D		Atlas-SNP	.											.	.	.	.	0			c.T3357C						.						109.0	121.0	117.0					1																	200819254		2203	4300	6503	SO:0001819	synonymous_variant	23271	exon11			CTCAGATTTGAAA	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.3390T>C	chr1.hg19:g.200819254T>C		211.0	0.0		300.0	163.0	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Silent	SNP	ENST00000236925.4	hg19																																																																																				.	.		0.408	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
PTPN7	5778	hgsc.bcm.edu	37	1	202119444	202119444	+	Silent	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:202119444T>G	ENST00000308986.5	-	9	1114	c.984A>C	c.(982-984)ctA>ctC	p.L328L	PTPN7_ENST00000543735.1_Silent_p.L157L|PTPN7_ENST00000492977.1_5'UTR|PTPN7_ENST00000367279.4_Silent_p.L367L|PTPN7_ENST00000544762.1_Silent_p.L104L|PTPN7_ENST00000309017.3_Silent_p.L433L			P35236	PTN7_HUMAN	protein tyrosine phosphatase, non-receptor type 7	328	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)|soft_tissue(1)|urinary_tract(1)	13						CCCACCTGTCTAGCCGCAGTT	0.567																																					p.L433L		Atlas-SNP	.											.	PTPN7	31	.	0			c.A1299C						.						76.0	59.0	65.0					1																	202119444		2203	4300	6503	SO:0001819	synonymous_variant	5778	exon9			CCTGTCTAGCCGC	BC001746	CCDS1422.1, CCDS1423.1, CCDS1423.2	1q32.1	2011-06-09			ENSG00000143851	ENSG00000143851		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9659	protein-coding gene	gene with protein product		176889				1510684	Standard	NM_002832		Approved	HEPTP, LC-PTP	uc010ppx.2	P35236	OTTHUMG00000035931	ENST00000308986.5:c.984A>C	chr1.hg19:g.202119444T>G		114.0	0.0		105.0	30.0	NM_002832	B3KXE1|Q53XK4|Q5SXQ0|Q5SXQ1|Q9BV05	Silent	SNP	ENST00000308986.5	hg19																																																																																				.	.		0.567	PTPN7-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_002832	
LGR6	59352	hgsc.bcm.edu	37	1	202163198	202163198	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:202163198G>T	ENST00000367278.3	+	1	170	c.81G>T	c.(79-81)caG>caT	p.Q27H		NM_001017403.1	NP_001017403.1	Q9HBX8	LGR6_HUMAN	leucine-rich repeat containing G protein-coupled receptor 6	27	LRRNT.				G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of Wnt signaling pathway (GO:0030177)|Wnt signaling pathway (GO:0016055)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	36						gcgccccccagcccggcccgg	0.771																																					p.Q27H		Atlas-SNP	.											.	LGR6	102	.	0			c.G81T						.						3.0	3.0	3.0					1																	202163198		1342	2962	4304	SO:0001583	missense	59352	exon1			CCCCCAGCCCGGC	AF190501	CCDS1424.1, CCDS30971.1, CCDS30972.1	1q32.1	2012-08-21	2011-01-25		ENSG00000133067	ENSG00000133067		"""GPCR / Class A : Orphans"""	19719	protein-coding gene	gene with protein product		606653	"""leucine-rich repeat-containing G protein-coupled receptor 6"""			10935549	Standard	XM_005245404		Approved	FLJ14471	uc001gxu.3	Q9HBX8	OTTHUMG00000041383	ENST00000367278.3:c.81G>T	chr1.hg19:g.202163198G>T	ENSP00000356247:p.Gln27His	15.0	0.0		28.0	9.0	NM_001017403	Q5T509|Q5T512|Q6UY15|Q86VU0|Q96K69|Q9BYD7	Missense_Mutation	SNP	ENST00000367278.3	hg19	CCDS30971.1	.	.	.	.	.	.	.	.	.	.	G	9.610	1.130892	0.21041	.	.	ENSG00000133067	ENST00000367278	T	0.60920	0.15	3.74	3.74	0.42951	.	1.063570	0.07431	U	0.895695	T	0.45438	0.1342	L	0.36672	1.1	0.80722	D	1	P	0.36438	0.553	B	0.28849	0.095	T	0.39840	-0.9594	10	0.45353	T	0.12	.	9.0658	0.36462	0.1066:0.0:0.8934:0.0	.	27	Q9HBX8	LGR6_HUMAN	H	27	ENSP00000356247:Q27H	ENSP00000356247:Q27H	Q	+	3	2	LGR6	200429821	0.991000	0.36638	0.528000	0.27938	0.105000	0.19272	2.672000	0.46850	1.777000	0.52277	0.305000	0.20034	CAG	.	.		0.771	LGR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099143.1	NM_021636	
SYT14	255928	hgsc.bcm.edu	37	1	210334239	210334239	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:210334239A>G	ENST00000472886.1	+	8	1534	c.1520A>G	c.(1519-1521)aAc>aGc	p.N507S	SYT14_ENST00000422431.1_Missense_Mutation_p.N571S|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000399639.2_3'UTR|SYT14_ENST00000537238.1_Missense_Mutation_p.N469S|SYT14_ENST00000367019.1_Missense_Mutation_p.N526S|SYT14_ENST00000367015.1_Missense_Mutation_p.N469S|SYT14_ENST00000534859.1_Missense_Mutation_p.N533S			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	507	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TCTGTGTATAACAAACGCAGC	0.413																																					p.N571S		Atlas-SNP	.											.	SYT14	89	.	0			c.A1712G						.						146.0	143.0	144.0					1																	210334239		2203	4299	6502	SO:0001583	missense	255928	exon10			TGTATAACAAACG	AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1520A>G	chr1.hg19:g.210334239A>G	ENSP00000418901:p.Asn507Ser	159.0	0.0		181.0	49.0	NM_001146261	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	ENST00000472886.1	hg19	CCDS31014.1	.	.	.	.	.	.	.	.	.	.	A	8.561	0.877760	0.17395	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T	0.72167	-0.63;-0.63;-0.63;-0.63;-0.63;-0.63	5.54	4.39	0.52855	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.145255	0.64402	D	0.000012	T	0.59742	0.2216	N	0.26162	0.8	0.50039	D	0.999846	B;B;B;B	0.32338	0.198;0.08;0.15;0.365	B;B;B;B	0.35607	0.206;0.05;0.082;0.131	T	0.57562	-0.7790	10	0.41790	T	0.15	-6.2841	12.4631	0.55743	0.8287:0.1713:0.0:0.0	.	554;507;526;571	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	S	571;533;469;526;507;469	ENSP00000389039:N571S;ENSP00000442891:N533S;ENSP00000437423:N469S;ENSP00000355986:N526S;ENSP00000418901:N507S;ENSP00000355982:N469S	ENSP00000355982:N469S	N	+	2	0	SYT14	208400862	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.302000	0.51849	0.963000	0.38082	0.477000	0.44152	AAC	.	.		0.413	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089124.1	NM_153262	
SPATA17	128153	hgsc.bcm.edu	37	1	217822303	217822303	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:217822303G>A	ENST00000366933.4	+	2	203	c.148G>A	c.(148-150)Gca>Aca	p.A50T		NM_138796.2	NP_620151.1	Q96L03	SPT17_HUMAN	spermatogenesis associated 17	50	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.					cytoplasm (GO:0005737)				endometrium(1)|kidney(1)|large_intestine(9)|lung(6)|pancreas(2)|prostate(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.0516)|all cancers(67;0.0891)|GBM - Glioblastoma multiforme(131;0.117)		TCAAGTTCGGGCATATATCAG	0.299																																					p.A50T		Atlas-SNP	.											.	SPATA17	59	.	0			c.G148A						.						116.0	114.0	115.0					1																	217822303		2203	4299	6502	SO:0001583	missense	128153	exon2			GTTCGGGCATATA	AK098591	CCDS1519.1	1q41	2008-02-05			ENSG00000162814	ENSG00000162814			25184	protein-coding gene	gene with protein product	"""IQ motif containing H"""	611032				16395525	Standard	NM_138796		Approved	IQCH	uc001hlh.1	Q96L03	OTTHUMG00000037875	ENST00000366933.4:c.148G>A	chr1.hg19:g.217822303G>A	ENSP00000355900:p.Ala50Thr	90.0	0.0		168.0	93.0	NM_138796	A5D6N2	Missense_Mutation	SNP	ENST00000366933.4	hg19	CCDS1519.1	.	.	.	.	.	.	.	.	.	.	G	16.73	3.205169	0.58234	.	.	ENSG00000162814	ENST00000366933	T	0.25085	1.82	5.33	5.33	0.75918	.	0.059144	0.64402	D	0.000003	T	0.34687	0.0906	M	0.79475	2.455	0.42444	D	0.992727	P	0.37083	0.581	B	0.39258	0.295	T	0.14309	-1.0477	10	0.38643	T	0.18	-15.578	14.8927	0.70620	0.0:0.0:1.0:0.0	.	50	Q96L03	SPT17_HUMAN	T	50	ENSP00000355900:A50T	ENSP00000355900:A50T	A	+	1	0	SPATA17	215888926	1.000000	0.71417	0.974000	0.42286	0.947000	0.59692	3.078000	0.50096	2.655000	0.90218	0.650000	0.86243	GCA	.	.		0.299	SPATA17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092433.2	NM_138796	
AHCTF1	25909	hgsc.bcm.edu	37	1	247027263	247027263	+	Nonsense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:247027263G>T	ENST00000391829.2	-	27	3626	c.3503C>A	c.(3502-3504)tCa>tAa	p.S1168*	AHCTF1_ENST00000326225.3_Nonsense_Mutation_p.S1177*|AHCTF1_ENST00000366508.1_Nonsense_Mutation_p.S1203*|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1168	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ATGTAATTCTGAAGCCCTGGA	0.418																																					p.S1177X	Colon(145;197 1800 4745 15099 26333)	Atlas-SNP	.											.	AHCTF1	187	.	0			c.C3530A						.						87.0	93.0	91.0					1																	247027263		2203	4300	6503	SO:0001587	stop_gained	25909	exon27			AATTCTGAAGCCC		CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3503C>A	chr1.hg19:g.247027263G>T	ENSP00000375705:p.Ser1168*	198.0	0.0		318.0	28.0	NM_015446	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Nonsense_Mutation	SNP	ENST00000391829.2	hg19		.	.	.	.	.	.	.	.	.	.	G	41	8.802195	0.98960	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	.	.	.	5.82	4.92	0.64577	.	0.327598	0.30020	N	0.010613	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6241	13.1694	0.59589	0.0733:0.0:0.9267:0.0	.	.	.	.	X	1203;1177;1168	.	ENSP00000355465:S1177X	S	-	2	0	AHCTF1	245093886	1.000000	0.71417	0.988000	0.46212	0.175000	0.22909	3.486000	0.53215	1.483000	0.48342	0.650000	0.86243	TCA	.	.		0.418	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015446	
OR2G2	81470	hgsc.bcm.edu	37	1	247751681	247751681	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:247751681C>A	ENST00000320065.1	+	1	20	c.20C>A	c.(19-21)aCc>aAc	p.T7N	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GTGAGACATACCAATGAGAGC	0.398																																					p.T7N		Atlas-SNP	.											.	OR2G2	88	.	0			c.C20A						.						159.0	147.0	151.0					1																	247751681		2203	4300	6503	SO:0001583	missense	81470	exon1			GACATACCAATGA	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.20C>A	chr1.hg19:g.247751681C>A	ENSP00000326349:p.Thr7Asn	113.0	0.0		171.0	51.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	hg19	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	C	4.228	0.041136	0.08196	.	.	ENSG00000177489	ENST00000320065	T	0.00265	8.39	3.57	-0.81	0.10860	.	0.600527	0.12505	U	0.463024	T	0.00073	0.0002	N	0.11023	0.085	0.09310	N	1	B	0.18741	0.03	B	0.09377	0.004	T	0.03840	-1.0999	10	0.13108	T	0.6	.	2.94	0.05826	0.1969:0.4596:0.0:0.3435	.	7	Q8NGZ5	OR2G2_HUMAN	N	7	ENSP00000326349:T7N	ENSP00000326349:T7N	T	+	2	0	OR2G2	245818304	0.145000	0.22656	0.000000	0.03702	0.018000	0.09664	0.300000	0.19156	-0.287000	0.09064	0.591000	0.81541	ACC	.	.		0.398	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
OR2T3	343173	hgsc.bcm.edu	37	1	248637531	248637531	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:248637531A>T	ENST00000359594.2	+	1	905	c.880A>T	c.(880-882)Att>Ttt	p.I294F		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAACCCCCTCATTTACAGTCT	0.498																																					p.I294F		Atlas-SNP	.											.	OR2T3	79	.	0			c.A880T						.						126.0	128.0	128.0					1																	248637531		2201	4277	6478	SO:0001583	missense	343173	exon1			CCCCTCATTTACA		CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.880A>T	chr1.hg19:g.248637531A>T	ENSP00000352604:p.Ile294Phe	912.0	0.0		1255.0	159.0	NM_001005495	B2RNJ1	Missense_Mutation	SNP	ENST00000359594.2	hg19	CCDS31117.1	.	.	.	.	.	.	.	.	.	.	a	11.32	1.602647	0.28534	.	.	ENSG00000196539	ENST00000359594	T	0.57107	0.42	2.37	-0.371	0.12525	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.62684	0.2448	M	0.84219	2.685	0.09310	N	1	P	0.49862	0.929	P	0.53689	0.732	T	0.55321	-0.8159	9	0.87932	D	0	.	6.2504	0.20842	0.7015:0.0:0.2985:0.0	.	294	Q8NH03	OR2T3_HUMAN	F	294	ENSP00000352604:I294F	ENSP00000352604:I294F	I	+	1	0	OR2T3	246704154	0.619000	0.27059	0.003000	0.11579	0.069000	0.16628	1.324000	0.33712	-0.459000	0.07013	-1.388000	0.01159	ATT	.	.		0.498	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097348.1	NM_001005495	
RSAD2	91543	hgsc.bcm.edu	37	2	7017965	7017965	+	Nonsense_Mutation	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:7017965A>T	ENST00000382040.3	+	1	170	c.34A>T	c.(34-36)Aag>Tag	p.K12*	RSAD2_ENST00000541728.1_5'Flank	NM_080657.4	NP_542388.2			radical S-adenosyl methionine domain containing 2											endometrium(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(1)	20	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		TTTTGCTGGGAAGCTCTTGAG	0.542																																					p.K12X		Atlas-SNP	.											.	RSAD2	38	.	0			c.A34T						.						76.0	71.0	73.0					2																	7017965		2203	4300	6503	SO:0001587	stop_gained	91543	exon1			GCTGGGAAGCTCT	AF442151	CCDS1656.1	2p25.2	2008-02-05			ENSG00000134321	ENSG00000134321			30908	protein-coding gene	gene with protein product		607810				11752458	Standard	NM_080657		Approved	cig5, viperin, vig1	uc002qyp.1	Q8WXG1	OTTHUMG00000090352	ENST00000382040.3:c.34A>T	chr2.hg19:g.7017965A>T	ENSP00000371471:p.Lys12*	72.0	0.0		131.0	40.0	NM_080657		Nonsense_Mutation	SNP	ENST00000382040.3	hg19	CCDS1656.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.389101	0.82902	.	.	ENSG00000134321	ENST00000382040	.	.	.	5.31	1.47	0.22746	.	0.910843	0.09520	N	0.791097	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.05351	T	0.99	-12.0684	5.7876	0.18343	0.6063:0.2397:0.154:0.0	.	.	.	.	X	12	.	ENSP00000371471:K12X	K	+	1	0	RSAD2	6935416	0.001000	0.12720	0.000000	0.03702	0.009000	0.06853	0.068000	0.14531	0.075000	0.16796	0.460000	0.39030	AAG	.	.		0.542	RSAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206724.2	NM_080657	
PDIA6	10130	hgsc.bcm.edu	37	2	10937247	10937247	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:10937247C>A	ENST00000272227.3	-	4	453	c.306G>T	c.(304-306)aaG>aaT	p.K102N	PDIA6_ENST00000404371.2_Missense_Mutation_p.K154N|PDIA6_ENST00000404824.2_Missense_Mutation_p.K150N|PDIA6_ENST00000381611.4_Missense_Mutation_p.K107N|PDIA6_ENST00000489662.1_5'UTR|PDIA6_ENST00000540494.1_Missense_Mutation_p.K99N	NM_001282707.1|NM_005742.2	NP_001269636.1|NP_005733.1	Q15084	PDIA6_HUMAN	protein disulfide isomerase family A, member 6	102	Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic cell clearance (GO:0043277)|cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	protein disulfide isomerase activity (GO:0003756)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|prostate(2)	18	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.149)|OV - Ovarian serous cystadenocarcinoma(76;0.15)		ATCCAAAAATCTTAATGGTAG	0.408																																					p.K102N	GBM(73;509 1219 34219 41343 41551)	Atlas-SNP	.											.	PDIA6	31	.	0			c.G306T						.						176.0	173.0	174.0					2																	10937247		2203	4300	6503	SO:0001583	missense	10130	exon4			AAAAATCTTAATG	BC001312	CCDS1675.1, CCDS62852.1, CCDS62853.1, CCDS62854.1, CCDS62855.1	2p25.1	2009-11-20	2005-06-29	2005-03-03	ENSG00000143870	ENSG00000143870	5.3.4.1	"""Protein disulfide isomerases"""	30168	protein-coding gene	gene with protein product	"""protein disulfide isomerase-related protein"""	611099	"""thioredoxin domain containing 7 (protein disulfide isomerase)"", ""protein disulfide isomerase-associated 6"""	TXNDC7		7590364, 12204115	Standard	XM_005246145		Approved	P5, ERp5	uc002rau.3	Q15084	OTTHUMG00000090479	ENST00000272227.3:c.306G>T	chr2.hg19:g.10937247C>A	ENSP00000272227:p.Lys102Asn	119.0	0.0		163.0	46.0	NM_005742	B3KY95|B5MCQ5|B7Z254|B7Z4M8|F8WA83|Q53RC7|Q6ZSH5|Q99778	Missense_Mutation	SNP	ENST00000272227.3	hg19	CCDS1675.1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.969369	0.92855	.	.	ENSG00000143870	ENST00000272227;ENST00000404371;ENST00000404824;ENST00000540494;ENST00000381611	T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0	5.86	5.86	0.93980	Thioredoxin domain (1);Thioredoxin-like fold (3);Disulphide isomerase (1);	0.040380	0.85682	D	0.000000	T	0.74824	0.3767	H	0.96175	3.78	0.80722	D	1	B;D;D;P	0.89917	0.246;1.0;1.0;0.823	P;D;D;P	0.97110	0.514;1.0;0.999;0.818	T	0.81714	-0.0807	10	0.87932	D	0	.	13.7319	0.62792	0.0:0.9298:0.0:0.0702	.	99;150;154;102	B7Z254;B5MCQ5;Q15084-2;Q15084	.;.;.;PDIA6_HUMAN	N	102;154;150;99;107	ENSP00000272227:K102N;ENSP00000385385:K154N;ENSP00000384459:K150N;ENSP00000438778:K99N;ENSP00000371024:K107N	ENSP00000272227:K102N	K	-	3	2	PDIA6	10854698	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.992000	0.56980	2.937000	0.99478	0.650000	0.86243	AAG	.	.		0.408	PDIA6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000206933.1	NM_005742	
UBXN2A	165324	hgsc.bcm.edu	37	2	24199886	24199886	+	Missense_Mutation	SNP	C	C	G	rs538162030	byFrequency	TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:24199886C>G	ENST00000309033.4	+	4	472	c.228C>G	c.(226-228)gaC>gaG	p.D76E	UBXN2A_ENST00000446425.2_3'UTR|UBXN2A_ENST00000535786.1_Missense_Mutation_p.D76E|UBXN2A_ENST00000404924.1_Missense_Mutation_p.D76E	NM_181713.3	NP_859064.2	P68543	UBX2A_HUMAN	UBX domain protein 2A	76	SEP. {ECO:0000255|PROSITE- ProRule:PRU00732}.				regulation of gene expression (GO:0010468)|regulation of protein catabolic process (GO:0042176)|regulation of protein ubiquitination (GO:0031396)	cis-Golgi network (GO:0005801)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)				endometrium(1)|large_intestine(3)|liver(1)|lung(6)	11						CCGTCAACGACGATTTCAGAA	0.393																																					p.D76E		Atlas-SNP	.											.	UBXN2A	20	.	0			c.C228G						.						80.0	77.0	78.0					2																	24199886		2203	4300	6503	SO:0001583	missense	165324	exon4			CAACGACGATTTC	BC037901	CCDS1704.1	2p24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000173960	ENSG00000173960		"""UBX domain containing"""	27265	protein-coding gene	gene with protein product			"""UBX domain containing 4"""	UBXD4		12477932	Standard	NM_181713		Approved		uc002ren.3	P68543	OTTHUMG00000125497	ENST00000309033.4:c.228C>G	chr2.hg19:g.24199886C>G	ENSP00000312107:p.Asp76Glu	48.0	0.0		110.0	22.0	NM_181713	A8K577|B7ZKP8|Q569G8	Missense_Mutation	SNP	ENST00000309033.4	hg19	CCDS1704.1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.859909	0.51482	.	.	ENSG00000173960	ENST00000404924;ENST00000309033;ENST00000535786	T;T;T	0.68025	-0.07;-0.07;-0.3	4.81	2.39	0.29439	SEP domain (4);	0.145094	0.64402	D	0.000013	T	0.74313	0.3700	M	0.74258	2.255	0.29087	N	0.882318	D;P	0.62365	0.991;0.925	P;P	0.59546	0.859;0.619	T	0.68625	-0.5359	10	0.56958	D	0.05	5.3368	7.6482	0.28334	0.0:0.2538:0.0:0.7462	.	76;76	B7ZKP8;P68543	.;UBX2A_HUMAN	E	76	ENSP00000385525:D76E;ENSP00000312107:D76E;ENSP00000440533:D76E	ENSP00000312107:D76E	D	+	3	2	UBXN2A	24053390	0.994000	0.37717	0.999000	0.59377	0.390000	0.30446	0.065000	0.14466	0.397000	0.25310	-0.340000	0.08031	GAC	.	.		0.393	UBXN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000246824.2	NM_181713	
NCOA1	8648	hgsc.bcm.edu	37	2	24929659	24929659	+	Silent	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:24929659T>C	ENST00000406961.1	+	13	1972	c.1320T>C	c.(1318-1320)agT>agC	p.S440S	NCOA1_ENST00000288599.5_Silent_p.S440S|NCOA1_ENST00000395856.3_Silent_p.S440S|NCOA1_ENST00000538539.1_Silent_p.S440S|NCOA1_ENST00000405141.1_Silent_p.S440S|NCOA1_ENST00000348332.3_Silent_p.S440S|NCOA1_ENST00000407230.1_Silent_p.S289S			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	440	Interaction with STAT3.|Ser-rich.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCAAGGAAGTTTCGGATGCT	0.463			T	PAX3	alveolar rhadomyosarcoma																																p.S440S		Atlas-SNP	.		Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	.	NCOA1	210	.	0			c.T1320C						.						94.0	92.0	93.0					2																	24929659		2203	4300	6503	SO:0001819	synonymous_variant	8648	exon11			AGGAAGTTTCGGA	U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.1320T>C	chr2.hg19:g.24929659T>C		148.0	0.0		180.0	47.0	NM_147223	O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Silent	SNP	ENST00000406961.1	hg19	CCDS1712.1																																																																																			.	.		0.463	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246852.3	NM_147223	
SNX17	9784	hgsc.bcm.edu	37	2	27598432	27598432	+	Silent	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:27598432G>A	ENST00000233575.2	+	10	1056	c.834G>A	c.(832-834)gtG>gtA	p.V278V	SNX17_ENST00000543024.1_Silent_p.V64V|SNX17_ENST00000542478.1_Silent_p.V64V|ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000537606.1_Silent_p.V253V	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	278	FERM-like.|PTB-like F3 module.				cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATGCCTGTGTGGCTGACTTCC	0.582																																					p.V278V		Atlas-SNP	.											.	SNX17	40	.	0			c.G834A						.						91.0	83.0	86.0					2																	27598432		2203	4300	6503	SO:0001819	synonymous_variant	9784	exon10			CTGTGTGGCTGAC	D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.834G>A	chr2.hg19:g.27598432G>A		68.0	0.0		111.0	26.0	NM_014748	B4DQM7|Q53HN7|Q6IAS3	Silent	SNP	ENST00000233575.2	hg19	CCDS1750.1																																																																																			.	.		0.582	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215024.1	NM_014748	
LTBP1	4052	hgsc.bcm.edu	37	2	33498742	33498742	+	Silent	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:33498742G>A	ENST00000404816.2	+	16	2990	c.2637G>A	c.(2635-2637)gtG>gtA	p.V879V	LTBP1_ENST00000390003.4_Silent_p.V554V|LTBP1_ENST00000354476.3_Silent_p.V880V|LTBP1_ENST00000418533.2_Silent_p.V553V|LTBP1_ENST00000407925.1_Silent_p.V553V|LTBP1_ENST00000404525.1_Silent_p.V500V|LTBP1_ENST00000402934.1_Silent_p.V500V			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	879	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				AATGTACTGTGAACCCTGATA	0.368																																					p.V879V		Atlas-SNP	.											.	LTBP1	317	.	0			c.G2637A						.						70.0	68.0	69.0					2																	33498742		2203	4300	6503	SO:0001819	synonymous_variant	4052	exon16			TACTGTGAACCCT		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.2637G>A	chr2.hg19:g.33498742G>A		106.0	0.0		105.0	36.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	hg19	CCDS33177.2																																																																																			.	.		0.368	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
VPS54	51542	hgsc.bcm.edu	37	2	64126619	64126619	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:64126619C>T	ENST00000272322.4	-	21	2876	c.2722G>A	c.(2722-2724)Gaa>Aaa	p.E908K	VPS54_ENST00000354504.3_Missense_Mutation_p.E755K|VPS54_ENST00000409558.4_Missense_Mutation_p.E896K			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	908					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TGTGTTTGTTCTTCTGGAAGG	0.358																																					p.E908K		Atlas-SNP	.											VPS54,colon,carcinoma,0,1	VPS54	57	.	0			c.G2722A						.						116.0	115.0	115.0					2																	64126619		2203	4300	6503	SO:0001583	missense	51542	exon21			TTTGTTCTTCTGG	AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.2722G>A	chr2.hg19:g.64126619C>T	ENSP00000272322:p.Glu908Lys	58.0	0.0		66.0	25.0	NM_016516	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	ENST00000272322.4	hg19	CCDS33208.1	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041656	0.55003	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.33438	1.41;1.42;1.42	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.23133	0.0559	L	0.41710	1.295	0.80722	D	1	P;B;B	0.36768	0.569;0.043;0.072	B;B;B	0.26770	0.073;0.012;0.026	T	0.07731	-1.0757	10	0.08381	T	0.77	.	19.9348	0.97133	0.0:1.0:0.0:0.0	.	755;908;896	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	K	755;908;896;896;908	ENSP00000346499:E755K;ENSP00000272322:E908K;ENSP00000386980:E896K	ENSP00000272322:E908K	E	-	1	0	VPS54	63980123	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.189000	0.77747	2.789000	0.95967	0.591000	0.81541	GAA	.	.		0.358	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327062.2	NM_016516	
IMMT	10989	hgsc.bcm.edu	37	2	86385747	86385747	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:86385747G>T	ENST00000410111.3	-	10	1517	c.1130C>A	c.(1129-1131)aCt>aAt	p.T377N	IMMT_ENST00000442664.2_Missense_Mutation_p.T376N|IMMT_ENST00000409051.2_Missense_Mutation_p.T330N|IMMT_ENST00000449247.2_Missense_Mutation_p.T366N|IMMT_ENST00000254636.5_Missense_Mutation_p.T278N|Y_RNA_ENST00000363371.1_RNA|IMMT_ENST00000490238.1_5'UTR	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	377					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						GACTTCTGGAGTAATACTGTC	0.423																																					p.T377N		Atlas-SNP	.											.	IMMT	65	.	0			c.C1130A						.						82.0	74.0	77.0					2																	86385747		1881	4113	5994	SO:0001583	missense	10989	exon10			TCTGGAGTAATAC	D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.1130C>A	chr2.hg19:g.86385747G>T	ENSP00000387262:p.Thr377Asn	125.0	0.0		123.0	46.0	NM_006839	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Missense_Mutation	SNP	ENST00000410111.3	hg19	CCDS46355.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.145014|5.145014	0.94603|0.94603	.|.	.|.	ENSG00000132305|ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000409715|ENST00000419070	T;T;T;T;T|.	0.32272|.	1.46;1.46;1.46;1.46;1.46|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.77260|.	0.4104|.	M|M	0.72118|0.72118	2.19|2.19	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.67145|.	0.993;0.996;0.995;0.996;0.995;0.995;0.996|.	D;D;D;D;P;D;D|.	0.67900|.	0.937;0.937;0.923;0.954;0.897;0.948;0.937|.	T|.	0.74383|.	-0.3683|.	10|.	0.16420|.	T|.	0.52|.	-20.7377|-20.7377	20.4024|20.4024	0.99000|0.99000	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	330;365;345;279;366;345;377|.	B9A067;B4DKR1;F8W9I1;B4DS66;Q16891-2;Q16891-3;Q16891|.	.;.;.;.;.;.;IMMT_HUMAN|.	N|X	278;366;377;376;330;366;345;278|231	ENSP00000254636:T278N;ENSP00000396899:T366N;ENSP00000387262:T377N;ENSP00000407788:T376N;ENSP00000387227:T330N|.	ENSP00000254636:T278N|.	T|Y	-|-	2|3	0|2	IMMT|IMMT	86239258|86239258	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.246000|9.246000	0.95438|0.95438	2.827000|2.827000	0.97445|0.97445	0.650000|0.650000	0.86243|0.86243	ACT|TAC	.	.		0.423	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000329909.2	NM_006839	
POTEE	445582	hgsc.bcm.edu	37	2	131984418	131984418	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:131984418T>G	ENST00000356920.5	+	4	927	c.833T>G	c.(832-834)cTt>cGt	p.L278R	POTEE_ENST00000358087.5_Missense_Mutation_p.L288R|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|RNU6-127P_ENST00000390897.1_RNA	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	278					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											CCACTGTTACTTGGTGTACAT	0.323																																					p.L278R		Atlas-SNP	.											.	.	.	.	0			c.T833G						.						78.0	92.0	87.0					2																	131984418		1497	2701	4198	SO:0001583	missense	445582	exon4			TGTTACTTGGTGT	AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.833T>G	chr2.hg19:g.131984418T>G	ENSP00000439189:p.Leu278Arg	321.0	0.0		384.0	112.0	NM_001083538	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	ENST00000356920.5	hg19	CCDS46414.1	.	.	.	.	.	.	.	.	.	.	.	10.60	1.395571	0.25205	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.68624	0.47;-0.34	1.16	1.16	0.20824	Ankyrin repeat-containing domain (4);	0.279276	0.18784	U	0.131260	T	0.68311	0.2987	L	0.55990	1.75	0.09310	N	1	D	0.67145	0.996	P	0.58970	0.849	T	0.56950	-0.7894	10	0.87932	D	0	.	4.5417	0.12061	0.0:0.0:0.0:1.0	.	278	Q6S8J3	POTEE_HUMAN	R	278;288	ENSP00000439189:L278R;ENSP00000443049:L288R	ENSP00000439189:L278R	L	+	2	0	AC131180.1	131700888	0.697000	0.27767	0.043000	0.18650	0.028000	0.11728	1.583000	0.36579	0.784000	0.33661	0.136000	0.15936	CTT	.	.		0.323	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001083538	
FMNL2	114793	hgsc.bcm.edu	37	2	153192209	153192209	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:153192209T>A	ENST00000288670.9	+	1	459	c.92T>A	c.(91-93)cTg>cAg	p.L31Q		NM_052905.3	NP_443137.2	Q96PY5	FMNL2_HUMAN	formin-like 2	31	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						CCAGGTGAACTGGAGGAGCGA	0.706																																					p.L31Q		Atlas-SNP	.											.	FMNL2	75	.	0			c.T92A						.						53.0	58.0	56.0					2																	153192209		2032	4192	6224	SO:0001583	missense	114793	exon1			GTGAACTGGAGGA	AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000288670.9:c.92T>A	chr2.hg19:g.153192209T>A	ENSP00000288670:p.Leu31Gln	299.0	0.0		333.0	153.0	NM_052905	B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	ENST00000288670.9	hg19	CCDS46429.1	.	.	.	.	.	.	.	.	.	.	T	22.4	4.284392	0.80803	.	.	ENSG00000157827	ENST00000288670	D	0.89681	-2.55	4.83	4.83	0.62350	.	0.000000	0.53938	D	0.000044	D	0.94798	0.8320	M	0.86953	2.85	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.95606	0.8667	10	0.87932	D	0	.	14.2262	0.65860	0.0:0.0:0.0:1.0	.	31	Q96PY5-3	.	Q	31	ENSP00000288670:L31Q	ENSP00000288670:L31Q	L	+	2	0	FMNL2	152900455	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.287000	0.78681	2.028000	0.59812	0.533000	0.62120	CTG	.	.		0.706	FMNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333582.2	NM_052905	
XIRP2	129446	hgsc.bcm.edu	37	2	168100314	168100315	+	Missense_Mutation	DNP	GG	GG	TT	rs530786380		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:168100314_168100315GG>TT	ENST00000409195.1	+	9	2501_2502	c.2412_2413GG>TT	c.(2410-2415)ggGGtg>ggTTtg	p.V805L	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.V805L|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.V583L|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	630					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TCAAAGGTGGGGTGAGTAAGGC	0.376																																					p.G804G|p.V805L		Atlas-SNP	.											.	XIRP2	914	.	0			c.G2412T|c.G2413T						.																																			SO:0001583	missense	129446	exon9			AGGTGGGGTGAGT|GGTGGGGTGAGTA	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	Exception_encountered	chr2.hg19:g.168100314_168100315delinsTT	ENSP00000386840:p.Val805Leu	403.0|400.0	0.0|1.0		409.0|405.0	187.0|186.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent|Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1																																																																																			.	.		0.376	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
TTN	7273	hgsc.bcm.edu	37	2	179638708	179638708	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:179638708T>A	ENST00000591111.1	-	31	7411	c.7187A>T	c.(7186-7188)cAg>cTg	p.Q2396L	TTN_ENST00000360870.5_Missense_Mutation_p.Q2396L|TTN_ENST00000589042.1_Missense_Mutation_p.Q2396L|TTN_ENST00000342992.6_Missense_Mutation_p.Q2396L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.Q2350L|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q2350L|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Q2350L			Q8WZ42	TITIN_HUMAN	titin	12718	Ig-like 13.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCACTGGGCTGCACTTCTTG	0.438																																					p.Q2396L		Atlas-SNP	.											.	TTN	18412	.	0			c.A7187T						.						142.0	126.0	131.0					2																	179638708		2203	4300	6503	SO:0001583	missense	7273	exon31			CTGGGCTGCACTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7187A>T	chr2.hg19:g.179638708T>A	ENSP00000465570:p.Gln2396Leu	103.0	0.0		112.0	45.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.91	1.780606	0.31502	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.82	4.66	0.58398	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.65417	0.2689	L	0.42529	1.33	0.24873	N	0.992273	B;B;B;B;P	0.41848	0.175;0.175;0.175;0.175;0.763	B;B;B;B;P	0.44897	0.174;0.174;0.174;0.174;0.463	T	0.59300	-0.7480	9	0.87932	D	0	.	13.2513	0.60053	0.0:0.0:0.1325:0.8675	.	2350;2350;2350;2396;2396	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	L	2396;2350;2350;2350;2350;2396	ENSP00000343764:Q2396L;ENSP00000434586:Q2350L;ENSP00000340554:Q2350L;ENSP00000352154:Q2350L;ENSP00000354117:Q2396L	ENSP00000340554:Q2350L	Q	-	2	0	TTN	179346953	1.000000	0.71417	0.647000	0.29507	0.982000	0.71751	4.352000	0.59404	1.021000	0.39600	0.528000	0.53228	CAG	.	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FN1	2335	hgsc.bcm.edu	37	2	216243896	216243896	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:216243896T>A	ENST00000359671.1	-	33	5571	c.5306A>T	c.(5305-5307)aAc>aTc	p.N1769I	FN1_ENST00000443816.1_Missense_Mutation_p.N1679I|FN1_ENST00000432072.2_Missense_Mutation_p.N1770I|FN1_ENST00000490833.1_5'Flank|FN1_ENST00000346544.3_Missense_Mutation_p.N1769I|FN1_ENST00000336916.4_Missense_Mutation_p.N1769I|FN1_ENST00000323926.6_Missense_Mutation_p.N1860I|FN1_ENST00000356005.4_Missense_Mutation_p.N1679I|FN1_ENST00000421182.1_Missense_Mutation_p.N1679I|FN1_ENST00000354785.4_Missense_Mutation_p.N1860I|FN1_ENST00000357867.4_Missense_Mutation_p.N1679I|FN1_ENST00000345488.5_Missense_Mutation_p.N1769I|FN1_ENST00000357009.2_Missense_Mutation_p.N1769I|FN1_ENST00000446046.1_Missense_Mutation_p.N1769I			P02751	FINC_HUMAN	fibronectin 1	1769	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Heparin-binding 2.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	AGGAGCAAGGTTGATTTCTTT	0.488																																					p.N1860I		Atlas-SNP	.											.	FN1	521	.	0			c.A5579T						.						148.0	136.0	140.0					2																	216243896		2203	4300	6503	SO:0001583	missense	2335	exon34			GCAAGGTTGATTT		CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.5306A>T	chr2.hg19:g.216243896T>A	ENSP00000352696:p.Asn1769Ile	159.0	0.0		195.0	30.0	NM_212482	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	ENST00000359671.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.35	2.808682	0.50421	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000357867;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000346544;ENST00000345488;ENST00000357009;ENST00000446046;ENST00000443816;ENST00000432072;ENST00000356005;ENST00000456923	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58506	0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33;0.33	6.17	6.17	0.99709	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.139910	0.49916	D	0.000121	T	0.73783	0.3631	M	0.74546	2.27	0.22034	N	0.999406	D;D;P;D;D;D;D;D;D;D;D;D	0.76494	0.993;0.997;0.887;0.996;0.999;0.997;0.957;0.999;0.996;0.996;0.997;0.993	D;D;D;D;D;D;D;D;D;D;D;D	0.97110	0.999;0.987;0.933;0.987;0.999;0.992;0.961;1.0;0.999;0.999;0.999;0.992	T	0.68911	-0.5284	10	0.51188	T	0.08	.	11.0511	0.47889	0.0:0.0685:0.0:0.9315	.	1769;1770;1860;1679;1679;1769;1769;1770;1679;1679;1860;1769	F8W7G7;P02751-13;P02751-7;P02751-10;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;.;.;FINC_HUMAN	I	1679;1860;1769;1679;1860;1770;1769;1769;1769;1769;1769;1679;1770;1679;486	ENSP00000394423:N1679I;ENSP00000323534:N1860I;ENSP00000338200:N1769I;ENSP00000350534:N1679I;ENSP00000346839:N1860I;ENSP00000352696:N1769I;ENSP00000265312:N1769I;ENSP00000273049:N1769I;ENSP00000349509:N1769I;ENSP00000410422:N1769I;ENSP00000415018:N1679I;ENSP00000399538:N1770I;ENSP00000348285:N1679I;ENSP00000416139:N486I	ENSP00000265313:N1770I	N	-	2	0	FN1	215952141	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.153000	0.50685	2.371000	0.80710	0.533000	0.62120	AAC	.	.		0.488	FN1-204	KNOWN	basic	protein_coding	protein_coding		NM_212476	
HRH1	3269	hgsc.bcm.edu	37	3	11300884	11300884	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:11300884G>T	ENST00000397056.1	+	3	352	c.161G>T	c.(160-162)aGt>aTt	p.S54I	HRH1_ENST00000431010.2_Missense_Mutation_p.S54I|HRH1_ENST00000438284.2_Missense_Mutation_p.S54I	NM_000861.3|NM_001098211.1	NP_000852.1|NP_001091681.1	P35367	HRH1_HUMAN	histamine receptor H1	54					cellular response to histamine (GO:0071420)|eosinophil chemotaxis (GO:0048245)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|inositol phosphate-mediated signaling (GO:0048016)|memory (GO:0007613)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|positive regulation of vasoconstriction (GO:0045907)|regulation of synaptic plasticity (GO:0048167)|regulation of vascular permeability (GO:0043114)|visual learning (GO:0008542)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|histamine receptor activity (GO:0004969)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25					Aceprometazine(DB01615)|Alcaftadine(DB06766)|Alimemazine(DB01246)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Antazoline(DB08799)|Aripiprazole(DB01238)|Asenapine(DB06216)|Astemizole(DB00637)|Azatadine(DB00719)|Azelastine(DB00972)|Benzatropine(DB00245)|Bepotastine(DB04890)|Betahistine(DB06698)|Bromodiphenhydramine(DB01237)|Brompheniramine(DB00835)|Buclizine(DB00354)|Carbinoxamine(DB00748)|Cetirizine(DB00341)|Chlorcyclizine(DB08936)|Chloropyramine(DB08800)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Citalopram(DB00215)|Clemastine(DB00283)|Clofedanol(DB04837)|Clozapine(DB00363)|Cyclizine(DB01176)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexbrompheniramine(DB00405)|Dimenhydrinate(DB00985)|Dimetindene(DB08801)|Diphenhydramine(DB01075)|Diphenylpyraline(DB01146)|Doxepin(DB01142)|Doxylamine(DB00366)|Emedastine(DB01084)|Epinastine(DB00751)|Escitalopram(DB01175)|Fexofenadine(DB00950)|Flunarizine(DB04841)|Histamine Phosphate(DB00667)|Hydroxyzine(DB00557)|Iloperidone(DB04946)|Imipramine(DB00458)|Isothipendyl(DB08802)|Ketotifen(DB00920)|Levocabastine(DB01106)|Loratadine(DB00455)|Loxapine(DB00408)|Maprotiline(DB00934)|Meclizine(DB00737)|Mepyramine(DB06691)|Mequitazine(DB01071)|Methdilazine(DB00902)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Olopatadine(DB00768)|Orphenadrine(DB01173)|Paliperidone(DB01267)|Phenindamine(DB01619)|Pheniramine(DB01620)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Risperidone(DB00734)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Tripelennamine(DB00792)|Triprolidine(DB00427)|Ziprasidone(DB00246)	GCCGTACGGAGTGAGCGGAAG	0.592																																					p.S54I		Atlas-SNP	.											.	HRH1	58	.	0			c.G161T						.						128.0	101.0	110.0					3																	11300884		2203	4300	6503	SO:0001583	missense	3269	exon3			TACGGAGTGAGCG		CCDS2604.1	3p25	2012-11-12			ENSG00000196639	ENSG00000196639		"""GPCR / Class A : Histamine receptors"""	5182	protein-coding gene	gene with protein product		600167				8003029	Standard	NM_001098211		Approved		uc010hds.3	P35367	OTTHUMG00000129719	ENST00000397056.1:c.161G>T	chr3.hg19:g.11300884G>T	ENSP00000380247:p.Ser54Ile	136.0	0.0		149.0	66.0	NM_000861	A8K047|Q6P9E5	Missense_Mutation	SNP	ENST00000397056.1	hg19	CCDS2604.1	.	.	.	.	.	.	.	.	.	.	G	7.694	0.691604	0.15039	.	.	ENSG00000196639	ENST00000438284;ENST00000431010;ENST00000397056	T;T;T	0.37235	1.21;1.21;1.21	5.98	-2.52	0.06346	GPCR, rhodopsin-like superfamily (1);	0.328255	0.33959	N	0.004384	T	0.16642	0.0400	N	0.21508	0.67	0.09310	N	1	B	0.31503	0.326	B	0.34536	0.185	T	0.12477	-1.0546	10	0.23302	T	0.38	-0.2436	2.1031	0.03684	0.1386:0.3575:0.1771:0.3268	.	54	P35367	HRH1_HUMAN	I	54	ENSP00000406705:S54I;ENSP00000397028:S54I;ENSP00000380247:S54I	ENSP00000380247:S54I	S	+	2	0	HRH1	11275884	0.000000	0.05858	0.000000	0.03702	0.115000	0.19883	-0.037000	0.12164	-0.393000	0.07739	-0.169000	0.13324	AGT	.	.		0.592	HRH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251928.2		
NKTR	4820	hgsc.bcm.edu	37	3	42678871	42678871	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:42678871C>A	ENST00000232978.8	+	13	1863	c.1675C>A	c.(1675-1677)Cac>Aac	p.H559N	RP4-613B23.1_ENST00000445452.1_RNA|RP4-613B23.1_ENST00000434363.1_RNA|RP4-613B23.1_ENST00000438017.1_RNA	NM_005385.3	NP_005376.2	P30414	NKTR_HUMAN	natural killer cell triggering receptor	559	Arg/Ser-rich.				protein folding (GO:0006457)	membrane (GO:0016020)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	41				KIRC - Kidney renal clear cell carcinoma(284;0.24)		CAAGTCTGGGCACCGAAAGAG	0.403																																					p.H559N		Atlas-SNP	.											.	NKTR	116	.	0			c.C1675A						.						82.0	88.0	86.0					3																	42678871		2203	4300	6503	SO:0001583	missense	4820	exon13			TCTGGGCACCGAA		CCDS2702.1	3p22.1	2014-01-20	2014-01-20		ENSG00000114857	ENSG00000114857			7833	protein-coding gene	gene with protein product	"""NK-tumor recognition protein"", ""natural-killer cells cyclophilin-related protein"", ""NK-TR protein"""	161565	"""natural killer-tumor recognition sequence"""			8314596, 8144875	Standard	XM_005265173		Approved	p104	uc003clo.3	P30414	OTTHUMG00000133037	ENST00000232978.8:c.1675C>A	chr3.hg19:g.42678871C>A	ENSP00000232978:p.His559Asn	264.0	0.0		319.0	143.0	NM_005385		Missense_Mutation	SNP	ENST00000232978.8	hg19	CCDS2702.1	.	.	.	.	.	.	.	.	.	.	C	1.288	-0.608404	0.03717	.	.	ENSG00000114857	ENST00000232978	T	0.11712	2.75	5.65	4.59	0.56863	.	0.724193	0.14537	N	0.313484	T	0.10508	0.0257	L	0.40543	1.245	0.27381	N	0.955405	B;B	0.30973	0.302;0.09	B;B	0.32465	0.146;0.069	T	0.17684	-1.0361	10	0.08179	T	0.78	-0.9586	15.4557	0.75311	0.0:0.9221:0.0:0.0779	.	259;559	Q6M1B8;P30414	.;NKTR_HUMAN	N	559	ENSP00000232978:H559N	ENSP00000232978:H559N	H	+	1	0	NKTR	42653875	0.906000	0.30813	0.879000	0.34478	0.330000	0.28571	2.371000	0.44248	2.664000	0.90586	0.491000	0.48974	CAC	.	.		0.403	NKTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256642.2	NM_005385	
LAMB2	3913	hgsc.bcm.edu	37	3	49166162	49166162	+	Silent	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:49166162G>A	ENST00000418109.1	-	15	1986	c.1822C>T	c.(1822-1824)Ctg>Ttg	p.L608L	LAMB2_ENST00000305544.4_Silent_p.L608L	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	608	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGGAACTCCAGGGTCTGACCT	0.597																																					p.L608L		Atlas-SNP	.											.	LAMB2	156	.	0			c.C1822T						.						73.0	77.0	76.0					3																	49166162		2203	4300	6503	SO:0001819	synonymous_variant	3913	exon14			ACTCCAGGGTCTG		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.1822C>T	chr3.hg19:g.49166162G>A		74.0	0.0		96.0	46.0	NM_002292	Q16321	Silent	SNP	ENST00000418109.1	hg19	CCDS2789.1																																																																																			.	.		0.597	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
BSN	8927	hgsc.bcm.edu	37	3	49694957	49694957	+	Silent	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:49694957C>A	ENST00000296452.4	+	5	8082	c.7968C>A	c.(7966-7968)gcC>gcA	p.A2656A		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	2656					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)	p.A2656A(1)		breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GTGCTGCTGCCACTGTGAGGG	0.637																																					p.A2656A		Atlas-SNP	.											BSN,NS,carcinoma,0,1	BSN	272	.	1	Substitution - coding silent(1)	lung(1)	c.C7968A						.						44.0	46.0	46.0					3																	49694957		2203	4298	6501	SO:0001819	synonymous_variant	8927	exon5			TGCTGCCACTGTG	AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.7968C>A	chr3.hg19:g.49694957C>A		141.0	0.0		157.0	63.0	NM_003458	O43161|Q7LGH3	Silent	SNP	ENST00000296452.4	hg19	CCDS2800.1																																																																																			.	.		0.637	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258164.1	NM_003458	
TRMT10C	54931	hgsc.bcm.edu	37	3	101284684	101284684	+	Silent	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:101284684A>G	ENST00000309922.6	+	2	1213	c.1059A>G	c.(1057-1059)ttA>ttG	p.L353L		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	353	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										ATCTCACCTTAGATCAAATGA	0.388																																					p.L353L		Atlas-SNP	.											.	.	.	.	0			c.A1059G						.						49.0	49.0	49.0					3																	101284684		1828	4072	5900	SO:0001819	synonymous_variant	54931	exon2			CACCTTAGATCAA	AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.1059A>G	chr3.hg19:g.101284684A>G		119.0	0.0		133.0	54.0	NM_017819	Q9NRG5|Q9NX54|Q9Y596	Silent	SNP	ENST00000309922.6	hg19	CCDS43122.1																																																																																			.	.		0.388	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353400.2	NM_017819	
GOLGB1	2804	hgsc.bcm.edu	37	3	121409566	121409566	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:121409566T>A	ENST00000340645.5	-	14	8755	c.8630A>T	c.(8629-8631)cAg>cTg	p.Q2877L	GOLGB1_ENST00000393667.3_Missense_Mutation_p.Q2882L	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2877					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TTTTAAACTCTGTACTTCAGC	0.433																																					p.Q2882L		Atlas-SNP	.											.	GOLGB1	319	.	0			c.A8645T						.						51.0	51.0	51.0					3																	121409566		2203	4300	6503	SO:0001583	missense	2804	exon14			AAACTCTGTACTT	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.8630A>T	chr3.hg19:g.121409566T>A	ENSP00000341848:p.Gln2877Leu	65.0	0.0		63.0	23.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	9.079	0.998930	0.19121	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.15139	2.45;2.45	5.3	5.3	0.74995	.	0.220504	0.32533	N	0.005966	T	0.12050	0.0293	N	0.14661	0.345	0.39773	D	0.972197	P;P;B	0.39480	0.493;0.675;0.152	B;B;B	0.41988	0.157;0.372;0.074	T	0.22626	-1.0211	10	0.28530	T	0.3	.	11.5637	0.50792	0.0:0.0:0.0:1.0	.	2882;2882;2877	E7EP74;B2ZZ91;Q14789	.;.;GOGB1_HUMAN	L	2877;2882	ENSP00000341848:Q2877L;ENSP00000377275:Q2882L	ENSP00000341848:Q2877L	Q	-	2	0	GOLGB1	122892256	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	2.182000	0.42556	2.225000	0.72522	0.533000	0.62120	CAG	.	.		0.433	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
UROC1	131669	hgsc.bcm.edu	37	3	126236538	126236538	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:126236538A>C	ENST00000290868.2	-	1	78	c.25T>G	c.(25-27)Tct>Gct	p.S9A	UROC1_ENST00000383579.3_Missense_Mutation_p.S9A	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	9					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		GGCAGGCCAGAGCACAGCGCC	0.672																																					p.S9A		Atlas-SNP	.											.	UROC1	150	.	0			c.T25G						.						16.0	19.0	18.0					3																	126236538		2168	4274	6442	SO:0001583	missense	131669	exon1			GGCCAGAGCACAG	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.25T>G	chr3.hg19:g.126236538A>C	ENSP00000290868:p.Ser9Ala	208.0	0.0		214.0	104.0	NM_001165974	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	ENST00000290868.2	hg19	CCDS3038.1	.	.	.	.	.	.	.	.	.	.	A	5.808	0.333380	0.11013	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.57436	0.41;0.4	4.64	0.886	0.19194	.	0.659026	0.15719	N	0.248014	T	0.20210	0.0486	N	0.05441	-0.05	0.26651	N	0.972101	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.003	T	0.23297	-1.0192	10	0.06757	T	0.87	-2.6157	0.9693	0.01412	0.4991:0.1985:0.1113:0.1911	.	9;9	E9PE13;Q96N76	.;HUTU_HUMAN	A	9	ENSP00000290868:S9A;ENSP00000373073:S9A	ENSP00000290868:S9A	S	-	1	0	UROC1	127719228	0.886000	0.30341	1.000000	0.80357	0.606000	0.37113	0.690000	0.25451	1.727000	0.51537	0.402000	0.26972	TCT	.	.		0.672	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639	
PODXL2	50512	hgsc.bcm.edu	37	3	127391218	127391218	+	Silent	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:127391218G>T	ENST00000342480.6	+	8	1752	c.1713G>T	c.(1711-1713)ctG>ctT	p.L571L	ABTB1_ENST00000468137.1_5'Flank|ABTB1_ENST00000393363.3_5'Flank|ABTB1_ENST00000232744.8_5'Flank|ABTB1_ENST00000453791.2_5'Flank	NM_015720.2	NP_056535.1	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2	571					leukocyte tethering or rolling (GO:0050901)	integral component of plasma membrane (GO:0005887)	glycosaminoglycan binding (GO:0005539)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	26						ACCCCAGCCTGAACGGCGGCG	0.711																																					p.L571L		Atlas-SNP	.											.	PODXL2	53	.	0			c.G1713T						.						5.0	6.0	6.0					3																	127391218		2019	4017	6036	SO:0001819	synonymous_variant	50512	exon8			CAGCCTGAACGGC	AF219137	CCDS3044.1	3q21.3	2005-02-18			ENSG00000114631	ENSG00000114631			17936	protein-coding gene	gene with protein product	"""endoglycan"""					10722749	Standard	NM_015720		Approved	PODLX2, endoglycan	uc003ejq.3	Q9NZ53	OTTHUMG00000159642	ENST00000342480.6:c.1713G>T	chr3.hg19:g.127391218G>T		90.0	0.0		84.0	32.0	NM_015720	Q6UVY4|Q8WUV6	Silent	SNP	ENST00000342480.6	hg19	CCDS3044.1																																																																																			.	.		0.711	PODXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356638.1	NM_015720	
PPP2R3A	5523	hgsc.bcm.edu	37	3	135721279	135721279	+	Silent	SNP	T	T	C	rs35214119	byFrequency	TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:135721279T>C	ENST00000264977.3	+	2	1556	c.939T>C	c.(937-939)aaT>aaC	p.N313N	PPP2R3A_ENST00000490467.1_Intron	NM_001190447.1|NM_002718.4	NP_001177376.1|NP_002709.2	Q06190	P2R3A_HUMAN	protein phosphatase 2, regulatory subunit B'', alpha	313					eye photoreceptor cell differentiation (GO:0001754)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein catabolic process (GO:0045732)|protein dephosphorylation (GO:0006470)|regulation of catalytic activity (GO:0050790)|regulation of cell motility involved in somitogenic axis elongation (GO:0090249)|somatic muscle development (GO:0007525)|somite development (GO:0061053)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	protein phosphatase type 2A complex (GO:0000159)	calcium ion binding (GO:0005509)|protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						TGATCAGTAATATGCCTAGCT	0.423																																					p.N313N		Atlas-SNP	.											.	PPP2R3A	114	.	0			c.T939C						.						120.0	113.0	115.0					3																	135721279		2203	4300	6503	SO:0001819	synonymous_variant	5523	exon2			CAGTAATATGCCT	L12146	CCDS3087.1, CCDS3088.1, CCDS54642.1	3q22.2-q22.3	2013-01-10	2010-06-18	2002-04-26	ENSG00000073711	ENSG00000073711	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""EF-hand domain containing"""	9307	protein-coding gene	gene with protein product		604944	"""protein phosphatase 2 (formerly 2A), regulatory subunit B'' (PR 72), alpha isoform and (PR 130), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B'', alpha"""	PPP2R3		8392071	Standard	NM_002718		Approved		uc003eqv.2	Q06190	OTTHUMG00000159766	ENST00000264977.3:c.939T>C	chr3.hg19:g.135721279T>C		117.0	0.0		154.0	60.0	NM_002718	A8KAE7|B4DNU1|B7ZAE3|Q06189|Q9NPQ5	Silent	SNP	ENST00000264977.3	hg19	CCDS3087.1																																																																																			.	T|1.000;G|0.000		0.423	PPP2R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357232.1	NM_002718	
TBL1XR1	79718	hgsc.bcm.edu	37	3	176750884	176750884	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:176750884G>A	ENST00000430069.1	-	14	1550	c.1291C>T	c.(1291-1293)Cga>Tga	p.R431*	TBL1XR1_ENST00000457928.2_Nonsense_Mutation_p.R431*			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	431					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CATATCCCTCGGTCTACATCC	0.423																																					p.R431X		Atlas-SNP	.											.	TBL1XR1	87	.	0			c.C1291T						.						116.0	112.0	113.0					3																	176750884		1916	4154	6070	SO:0001587	stop_gained	79718	exon14			TCCCTCGGTCTAC	AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.1291C>T	chr3.hg19:g.176750884G>A	ENSP00000405574:p.Arg431*	283.0	0.0		294.0	117.0	NM_024665	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Nonsense_Mutation	SNP	ENST00000430069.1	hg19	CCDS46961.1	.	.	.	.	.	.	.	.	.	.	G	40	8.405543	0.98796	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000536758	.	.	.	5.87	-0.529	0.11901	.	0.072293	0.53938	D	0.000043	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-4.6556	12.7824	0.57485	0.0621:0.0:0.226:0.7119	.	.	.	.	X	431;431;293	.	ENSP00000405574:R431X	R	-	1	2	TBL1XR1	178233578	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	1.640000	0.37186	-0.421000	0.07416	0.655000	0.94253	CGA	.	.		0.423	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347587.3	NM_024665	
PIK3CA	5290	hgsc.bcm.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	T	rs121913279		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:178952085A>T	ENST00000263967.3	+	21	3297	c.3140A>T	c.(3139-3141)cAt>cTt	p.H1047L	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047L	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,adenocarcinoma,0,2044	PIK3CA	8460	.	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140T						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290	exon21			ATGCACATCATGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>T	chr3.hg19:g.178952085A>T	ENSP00000263967:p.His1047Leu	182.0	0.0		178.0	77.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	4.518	0.096038	0.08681	.	.	ENSG00000121879	ENST00000263967	T	0.78126	-1.15	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.47002	0.1422	N	0.00611	-1.325	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.58053	-0.7704	10	0.02654	T	1	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	L	1047	ENSP00000263967:H1047L	ENSP00000263967:H1047L	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	.	.		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
HRG	3273	hgsc.bcm.edu	37	3	186395095	186395095	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr3:186395095C>T	ENST00000232003.4	+	7	1081	c.1001C>T	c.(1000-1002)aCa>aTa	p.T334I		NM_000412.2	NP_000403.1	P04196	HRG_HUMAN	histidine-rich glycoprotein	334					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|defense response to fungus (GO:0050832)|fibrinolysis (GO:0042730)|heme export (GO:0097037)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel remodeling (GO:2000504)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of immune response to tumor cell (GO:0002839)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet activation (GO:0010543)|regulation of protein complex assembly (GO:0043254)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|response to organic cyclic compound (GO:0014070)	blood microparticle (GO:0072562)|endolysosome (GO:0036019)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|phagolysosome membrane (GO:0061474)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heme binding (GO:0020037)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|immunoglobulin binding (GO:0019865)|metal ion binding (GO:0046872)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(12)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0683)		ACTTTTGGCACAAATGGGGCC	0.493																																					p.T334I		Atlas-SNP	.											.	HRG	81	.	0			c.C1001T						.						147.0	137.0	140.0					3																	186395095		2203	4300	6503	SO:0001583	missense	3273	exon7			TTGGCACAAATGG		CCDS3280.1	3q27	2008-07-18			ENSG00000113905	ENSG00000113905			5181	protein-coding gene	gene with protein product	"""histidine-proline rich glycoprotein"", ""thrombophilia due to elevated HRG"""	142640				1678514	Standard	NM_000412		Approved	HRGP, HPRG	uc003fqq.3	P04196	OTTHUMG00000156578	ENST00000232003.4:c.1001C>T	chr3.hg19:g.186395095C>T	ENSP00000232003:p.Thr334Ile	160.0	0.0		164.0	76.0	NM_000412	B9EK35|D3DNU7	Missense_Mutation	SNP	ENST00000232003.4	hg19	CCDS3280.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854561	0.32791	.	.	ENSG00000113905	ENST00000232003	T	0.12984	2.63	4.37	-4.63	0.03359	.	1.713730	0.02938	N	0.140060	T	0.11281	0.0275	L	0.51422	1.61	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.28299	-1.0048	10	0.34782	T	0.22	6.2402	2.4691	0.04560	0.1364:0.209:0.1342:0.5204	.	334	P04196	HRG_HUMAN	I	334	ENSP00000232003:T334I	ENSP00000232003:T334I	T	+	2	0	HRG	187877789	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.189000	0.09629	-0.779000	0.04560	-0.300000	0.09419	ACA	.	.		0.493	HRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344655.1	NM_000412	
LCORL	254251	hgsc.bcm.edu	37	4	17885695	17885695	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:17885695G>C	ENST00000382226.5	-	7	1565	c.1457C>G	c.(1456-1458)cCt>cGt	p.P486R	LCORL_ENST00000326877.4_Intron|LCORL_ENST00000539056.1_Intron|LCORL_ENST00000382224.1_Missense_Mutation_p.P402R	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	486					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						AAGACACAAAGGAGAGAGGTC	0.378																																					p.P486R		Atlas-SNP	.											.	LCORL	60	.	0			c.C1457G						.						36.0	27.0	30.0					4																	17885695		692	1590	2282	SO:0001583	missense	254251	exon7			CACAAAGGAGAGA		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.1457C>G	chr4.hg19:g.17885695G>C	ENSP00000371661:p.Pro486Arg	202.0	0.0		240.0	99.0	NM_001166139	Q96NK1	Missense_Mutation	SNP	ENST00000382226.5	hg19	CCDS54749.1	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111331	0.37242	.	.	ENSG00000178177	ENST00000382224;ENST00000382226	.	.	.	5.19	5.19	0.71726	.	0.200177	0.45126	D	0.000381	T	0.50684	0.1630	N	0.08118	0	0.58432	D	0.999999	.	.	.	.	.	.	T	0.58983	-0.7539	7	0.54805	T	0.06	.	19.0837	0.93194	0.0:0.0:1.0:0.0	.	.	.	.	R	402;486	.	ENSP00000371659:P402R	P	-	2	0	LCORL	17494793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.851000	0.69481	2.577000	0.86979	0.655000	0.94253	CCT	.	.		0.378	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_153686	
GABRA2	2555	hgsc.bcm.edu	37	4	46305505	46305505	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:46305505T>A	ENST00000510861.1	-	8	1001	c.828A>T	c.(826-828)agA>agT	p.R276S	GABRA2_ENST00000381620.4_Missense_Mutation_p.R276S|GABRA2_ENST00000514090.1_Missense_Mutation_p.R276S|GABRA2_ENST00000540012.1_Missense_Mutation_p.R221S|GABRA2_ENST00000507069.1_Missense_Mutation_p.R276S|GABRA2_ENST00000515082.1_Missense_Mutation_p.R276S|GABRA2_ENST00000356504.1_Missense_Mutation_p.R276S			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	276					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	GCACAGATTCTCTGTTAAGCC	0.373																																					p.R276S		Atlas-SNP	.											.	GABRA2	134	.	0			c.A828T						.						120.0	116.0	118.0					4																	46305505		2203	4300	6503	SO:0001583	missense	2555	exon8			AGATTCTCTGTTA		CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.828A>T	chr4.hg19:g.46305505T>A	ENSP00000421828:p.Arg276Ser	273.0	1.0		315.0	144.0	NM_000807	A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	ENST00000510861.1	hg19	CCDS3471.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.305102	0.81247	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069;ENST00000515082	D;D;D;D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88;-1.88;-1.88;-1.88	5.17	2.76	0.32466	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.85522	0.5716	L	0.28740	0.885	0.54753	D	0.999987	D;D;D	0.89917	1.0;0.993;1.0	D;P;D	0.91635	0.987;0.898;0.999	D	0.83985	0.0334	10	0.52906	T	0.07	.	8.4705	0.32982	0.0:0.1592:0.0:0.8408	.	221;276;276	B7Z1H8;G5E9Z6;P47869	.;.;GBRA2_HUMAN	S	276;276;276;276;221;276;276	ENSP00000421828:R276S;ENSP00000421300:R276S;ENSP00000371033:R276S;ENSP00000348897:R276S;ENSP00000444409:R221S;ENSP00000427603:R276S;ENSP00000423840:R276S	ENSP00000348897:R276S	R	-	3	2	GABRA2	46000262	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.032000	0.30178	0.928000	0.37168	0.533000	0.62120	AGA	.	.		0.373	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360848.2		
KIAA1211	57482	hgsc.bcm.edu	37	4	57181349	57181349	+	Missense_Mutation	SNP	G	G	A	rs370638037		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:57181349G>A	ENST00000504228.1	+	6	1786	c.1681G>A	c.(1681-1683)Gca>Aca	p.A561T	KIAA1211_ENST00000264229.6_Missense_Mutation_p.A561T|KIAA1211_ENST00000541073.1_Missense_Mutation_p.A554T			Q6ZU35	K1211_HUMAN	KIAA1211	561										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CGTGACGCCCGCAAAGGACAC	0.647																																					p.A561T		Atlas-SNP	.											.	KIAA1211	178	.	0			c.G1681A						.						12.0	18.0	16.0					4																	57181349		1973	4130	6103	SO:0001583	missense	57482	exon8			ACGCCCGCAAAGG	AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1681G>A	chr4.hg19:g.57181349G>A	ENSP00000423366:p.Ala561Thr	144.0	0.0		155.0	59.0	NM_020722	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	ENST00000504228.1	hg19	CCDS43230.1	.	.	.	.	.	.	.	.	.	.	G	8.498	0.863525	0.17250	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.02216	4.39;4.39;4.39	4.48	-2.49	0.06403	.	.	.	.	.	T	0.01489	0.0048	L	0.38175	1.15	0.09310	N	1	P;P;P	0.43314	0.803;0.803;0.645	B;B;B	0.33454	0.164;0.164;0.071	T	0.38585	-0.9654	9	0.62326	D	0.03	-1.8037	1.1214	0.01725	0.2132:0.3164:0.2556:0.2147	.	554;554;561	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	T	561;561;554;471	ENSP00000264229:A561T;ENSP00000423366:A561T;ENSP00000444006:A554T	ENSP00000264229:A561T	A	+	1	0	KIAA1211	56876106	0.000000	0.05858	0.000000	0.03702	0.185000	0.23345	0.028000	0.13644	-0.927000	0.03766	-0.314000	0.08810	GCA	.	.		0.647	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362097.2	NM_020722	
ALB	213	hgsc.bcm.edu	37	4	74285253	74285253	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:74285253C>G	ENST00000503124.1	+	11	1439	c.1232C>G	c.(1231-1233)cCc>cGc	p.P411R	ALB_ENST00000295897.4_Missense_Mutation_p.P561R|ALB_ENST00000509063.1_Missense_Mutation_p.P561R|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000415165.2_Missense_Mutation_p.P369R|ALB_ENST00000401494.3_Missense_Mutation_p.P446R			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AAACACAAGCCCAAGGCAACA	0.408																																					p.P561R		Atlas-SNP	.											.	ALB	132	.	0			c.C1682G						.						88.0	83.0	84.0					4																	74285253		2203	4300	6503	SO:0001583	missense	213	exon13			ACAAGCCCAAGGC	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1232C>G	chr4.hg19:g.74285253C>G	ENSP00000421027:p.Pro411Arg	116.0	0.0		104.0	34.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.	.	.	.	.	.	.	.	.	.	C	22.4	4.285424	0.80803	.	.	ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000329326;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202	T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55	6.17	6.17	0.99709	Serum albumin-like (1);Serum albumin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.88299	0.6399	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.89512	0.3772	10	0.87932	D	0	-24.0555	19.4432	0.94831	0.0:1.0:0.0:0.0	.	446;369;411;561;561	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768	.;.;.;.;ALBU_HUMAN	R	561;369;348;411;561;446;570	ENSP00000295897:P561R;ENSP00000401820:P369R;ENSP00000421027:P411R;ENSP00000422784:P561R;ENSP00000384695:P446R	ENSP00000295897:P561R	P	+	2	0	ALB	74504117	1.000000	0.71417	0.999000	0.59377	0.834000	0.47266	3.206000	0.51098	2.941000	0.99782	0.655000	0.94253	CCC	.	.		0.408	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
CDS1	1040	hgsc.bcm.edu	37	4	85569727	85569727	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:85569727A>C	ENST00000295887.5	+	13	1697	c.1274A>C	c.(1273-1275)aAa>aCa	p.K425T		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	0	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		AATCCCAGCAAAGTGCTACAG	0.393																																					p.K425T		Atlas-SNP	.											.	CDS1	58	.	0			c.A1274C						.						66.0	65.0	65.0					4																	85569727		2203	4300	6503	SO:0001583	missense	1040	exon13			CCAGCAAAGTGCT	U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.1274A>C	chr4.hg19:g.85569727A>C	ENSP00000295887:p.Lys425Thr	277.0	0.0		147.0	107.0	NM_001263	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	ENST00000295887.5	hg19	CCDS3608.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.666965	0.47677	.	.	ENSG00000163624	ENST00000295887	T	0.45276	0.9	5.66	2.0	0.26442	.	0.131525	0.64402	D	0.000003	T	0.39517	0.1081	M	0.69823	2.125	0.58432	D	0.999999	P	0.42357	0.777	B	0.42030	0.373	T	0.14559	-1.0468	10	0.24483	T	0.36	-5.9792	8.3155	0.32097	0.7621:0.0:0.2379:0.0	.	425	Q92903	CDS1_HUMAN	T	425	ENSP00000295887:K425T	ENSP00000295887:K425T	K	+	2	0	CDS1	85788751	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.630000	0.61297	0.418000	0.25898	0.528000	0.53228	AAA	.	.		0.393	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252817.2		
ZGRF1	55345	hgsc.bcm.edu	37	4	113538660	113538660	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:113538660T>A	ENST00000505019.1	-	6	2663	c.2538A>T	c.(2536-2538)aaA>aaT	p.K846N	C4orf21_ENST00000309071.5_Missense_Mutation_p.K846N|C4orf21_ENST00000445203.2_Missense_Mutation_p.K815N	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		846						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TATTTTTCTTTTTCAATATTT	0.348																																					p.K846N		Atlas-SNP	.											.	C4orf21	223	.	0			c.A2538T						.						121.0	118.0	119.0					4																	113538660		2203	4300	6503	SO:0001583	missense	55345	exon6			TTTCTTTTTCAAT																												ENST00000505019.1:c.2538A>T	chr4.hg19:g.113538660T>A	ENSP00000424737:p.Lys846Asn	213.0	0.0		254.0	108.0	NM_018392	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Missense_Mutation	SNP	ENST00000505019.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.42	2.528647	0.44969	.	.	ENSG00000138658	ENST00000505019;ENST00000309071;ENST00000445203	D;T;T	0.91740	-2.9;0.7;0.25	5.98	0.805	0.18703	.	0.517073	0.18868	N	0.128941	D	0.88433	0.6435	M	0.68952	2.095	0.09310	N	1	B;B	0.31227	0.314;0.096	B;B	0.31686	0.134;0.134	T	0.81113	-0.1080	10	0.72032	D	0.01	-4.388	5.6126	0.17414	0.1305:0.377:0.0:0.4925	.	846;846	Q86YA3;G5EA02	CD021_HUMAN;.	N	846;846;815	ENSP00000424737:K846N;ENSP00000309095:K846N;ENSP00000390505:K815N	ENSP00000309095:K846N	K	-	3	2	C4orf21	113758109	0.000000	0.05858	0.001000	0.08648	0.071000	0.16799	-0.002000	0.12924	0.169000	0.19679	0.533000	0.62120	AAA	.	.		0.348	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000256413.1		
SPATA5	166378	hgsc.bcm.edu	37	4	123868516	123868516	+	Silent	SNP	G	G	A	rs140187138		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:123868516G>A	ENST00000274008.4	+	9	1656	c.1587G>A	c.(1585-1587)cgG>cgA	p.R529R	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	529					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						CTCAGGACCGGCTAGATATTC	0.522																																					p.R529R		Atlas-SNP	.											.	SPATA5	62	.	0			c.G1587A						.						91.0	90.0	90.0					4																	123868516		2203	4300	6503	SO:0001819	synonymous_variant	166378	exon9			GGACCGGCTAGAT	AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.1587G>A	chr4.hg19:g.123868516G>A		101.0	0.0		107.0	40.0	NM_145207	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Silent	SNP	ENST00000274008.4	hg19	CCDS3730.1																																																																																			.	G|1.000;T|0.000		0.522	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256714.2	NM_145207	
JADE1	79960	hgsc.bcm.edu	37	4	129782877	129782877	+	Missense_Mutation	SNP	C	C	T	rs369651997		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:129782877C>T	ENST00000226319.6	+	9	1280	c.1000C>T	c.(1000-1002)Cgc>Tgc	p.R334C	PHF17_ENST00000512960.1_Missense_Mutation_p.R334C|PHF17_ENST00000413543.2_Missense_Mutation_p.R334C|PHF17_ENST00000511647.1_Missense_Mutation_p.R334C|PHF17_ENST00000452328.2_Missense_Mutation_p.R322C	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GAAGAACTGCCGCACAGCCTT	0.483																																					p.R334C		Atlas-SNP	.											.	PHF17	63	.	0			c.C1000T						.	C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	83.0	86.0	85.0		1000,1000	5.1	1.0	4		85	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	PHF17	NM_024900.3,NM_199320.2	180,180	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	334/510,334/843	129782877	1,13005	2203	4300	6503	SO:0001583	missense	79960	exon9			AACTGCCGCACAG																												ENST00000226319.6:c.1000C>T	chr4.hg19:g.129782877C>T	ENSP00000226319:p.Arg334Cys	115.0	0.0		138.0	59.0	NM_199320		Missense_Mutation	SNP	ENST00000226319.6	hg19	CCDS34062.1	.	.	.	.	.	.	.	.	.	.	C	19.76	3.887780	0.72410	0.0	1.16E-4	ENSG00000077684	ENST00000226319;ENST00000511647;ENST00000452328;ENST00000512960;ENST00000535321;ENST00000413543	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.08	5.08	0.68730	Zinc finger, PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.73583	0.3605	L	0.56199	1.76	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.996	D;D;P	0.75020	0.94;0.985;0.894	T	0.72161	-0.4374	9	.	.	.	.	14.5181	0.67833	0.1557:0.8443:0.0:0.0	.	322;334;334	Q6IE81-2;Q6IE81;Q6IE81-3	.;JADE1_HUMAN;.	C	334;334;322;334;334;334	ENSP00000226319:R334C;ENSP00000423737:R334C;ENSP00000388015:R322C;ENSP00000425730:R334C;ENSP00000404211:R334C	.	R	+	1	0	PHF17	130002327	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	3.337000	0.52120	2.640000	0.89533	0.655000	0.94253	CGC	.	.		0.483	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364280.1		
TBC1D9	23158	hgsc.bcm.edu	37	4	141600769	141600769	+	Splice_Site	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:141600769C>T	ENST00000442267.2	-	4	663	c.589G>A	c.(589-591)Gcg>Acg	p.A197T		NM_015130.2	NP_055945.2	Q6ZT07	TBCD9_HUMAN	TBC1 domain family, member 9 (with GRAM domain)	197	GRAM 1.						calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	31	all_hematologic(180;0.162)	Medulloblastoma(177;0.00498)				GATGACTTACCTTCCCTTCCC	0.398																																					p.A197T		Atlas-SNP	.											.	TBC1D9	198	.	0			c.G589A						.						38.0	37.0	37.0					4																	141600769		1815	4080	5895	SO:0001630	splice_region_variant	23158	exon4			ACTTACCTTCCCT	AB020689	CCDS47136.1	4q31.1	2013-01-10	2006-07-12		ENSG00000109436	ENSG00000109436		"""EF-hand domain containing"""	21710	protein-coding gene	gene with protein product			"""TBC1 domain family, member 9"""			12970790	Standard	NM_015130		Approved	KIAA0882, MDR1	uc010ioj.3	Q6ZT07	OTTHUMG00000161405	ENST00000442267.2:c.589+1G>A	chr4.hg19:g.141600769C>T		127.0	0.0		168.0	69.0	NM_015130	A6H8U8|D3DNZ1|O94958	Missense_Mutation	SNP	ENST00000442267.2	hg19	CCDS47136.1	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024541	0.54683	.	.	ENSG00000109436	ENST00000442267	D	0.87029	-2.2	5.41	5.41	0.78517	GRAM (2);	0.107851	0.64402	D	0.000006	T	0.68915	0.3053	N	0.01096	-1.015	0.80722	D	1	B	0.15141	0.012	B	0.15052	0.012	T	0.66976	-0.5787	9	.	.	.	.	19.2074	0.93736	0.0:1.0:0.0:0.0	.	197	Q6ZT07	TBCD9_HUMAN	T	197	ENSP00000411197:A197T	.	A	-	1	0	TBC1D9	141820219	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.572000	0.82409	2.548000	0.85928	0.655000	0.94253	GCG	.	.		0.398	TBC1D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364806.1	NM_015130	Missense_Mutation
DCHS2	54798	hgsc.bcm.edu	37	4	155163890	155163890	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:155163890T>A	ENST00000357232.4	-	22	5610	c.5611A>T	c.(5611-5613)Agg>Tgg	p.R1871W		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1871	Cadherin 16. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTAGAAAGCCTGGGCATCCCT	0.388																																					p.R1871W		Atlas-SNP	.											.	DCHS2	594	.	0			c.A5611T						.						115.0	109.0	111.0					4																	155163890		2203	4300	6503	SO:0001583	missense	54798	exon22			AAAGCCTGGGCAT	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5611A>T	chr4.hg19:g.155163890T>A	ENSP00000349768:p.Arg1871Trp	65.0	0.0		58.0	30.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	hg19	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555579	0.65425	.	.	ENSG00000197410	ENST00000357232	T	0.53206	0.63	5.24	2.69	0.31865	Cadherin (4);Cadherin-like (1);	0.392907	0.22924	N	0.053987	T	0.60753	0.2293	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.70487	0.969	T	0.60352	-0.7280	10	0.72032	D	0.01	.	11.9721	0.53069	0.0:0.0:0.3225:0.6775	.	1871	Q6V1P9	PCD23_HUMAN	W	1871	ENSP00000349768:R1871W	ENSP00000349768:R1871W	R	-	1	2	DCHS2	155383340	1.000000	0.71417	0.273000	0.24645	0.830000	0.47004	2.930000	0.48924	0.326000	0.23384	0.533000	0.62120	AGG	.	.		0.388	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
TRIML1	339976	hgsc.bcm.edu	37	4	189068011	189068011	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:189068011T>A	ENST00000332517.3	+	6	1032	c.892T>A	c.(892-894)Tat>Aat	p.Y298N	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	298	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		AGCTAATGCCTATCTCGTGTT	0.507																																					p.Y298N	Melanoma(31;213 1036 16579 23968 32372)	Atlas-SNP	.											.	TRIML1	126	.	0			c.T892A						.						155.0	156.0	156.0					4																	189068011		2203	4300	6503	SO:0001583	missense	339976	exon6			AATGCCTATCTCG	AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.892T>A	chr4.hg19:g.189068011T>A	ENSP00000327738:p.Tyr298Asn	168.0	0.0		182.0	69.0	NM_178556	Q96BE5	Missense_Mutation	SNP	ENST00000332517.3	hg19	CCDS3851.1	.	.	.	.	.	.	.	.	.	.	t	9.157	1.017748	0.19355	.	.	ENSG00000184108	ENST00000332517	T	0.13420	2.59	4.92	3.74	0.42951	Concanavalin A-like lectin/glucanase (1);SPRY-associated (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	0.140133	0.33631	N	0.004715	T	0.07593	0.0191	N	0.20986	0.625	0.22171	N	0.999317	B	0.17268	0.021	B	0.19666	0.026	T	0.34403	-0.9830	10	0.19147	T	0.46	-11.4335	4.3025	0.10932	0.1757:0.0929:0.0:0.7315	.	298	Q8N9V2	TRIML_HUMAN	N	298	ENSP00000327738:Y298N	ENSP00000327738:Y298N	Y	+	1	0	TRIML1	189305005	0.000000	0.05858	0.740000	0.30986	0.021000	0.10359	-1.860000	0.01656	1.036000	0.39998	0.449000	0.29647	TAT	.	.		0.507	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359813.1	NM_178556	
TRIO	7204	hgsc.bcm.edu	37	5	14394211	14394211	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:14394211G>A	ENST00000344204.4	+	28	4307	c.4283G>A	c.(4282-4284)cGa>cAa	p.R1428Q	TRIO_ENST00000537187.1_Missense_Mutation_p.R1428Q|TRIO_ENST00000509967.2_Missense_Mutation_p.R1379Q	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	1428	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					CCAGTTCAGCGAATAACGAAG	0.313																																					p.R1428Q		Atlas-SNP	.											.	TRIO	305	.	0			c.G4283A						.						118.0	115.0	116.0					5																	14394211		2203	4300	6503	SO:0001583	missense	7204	exon28			TTCAGCGAATAAC	AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.4283G>A	chr5.hg19:g.14394211G>A	ENSP00000339299:p.Arg1428Gln	160.0	0.0		188.0	73.0	NM_007118	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	ENST00000344204.4	hg19	CCDS3883.1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.683643	0.88639	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.67698	-0.28;-0.28;-0.28	5.1	5.1	0.69264	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	D	0.87744	0.6254	H	0.95504	3.68	0.80722	D	1	D;D;D	0.89917	1.0;0.993;1.0	D;B;D	0.87578	0.998;0.392;0.996	D	0.91409	0.5149	10	0.87932	D	0	.	18.8837	0.92367	0.0:0.0:1.0:0.0	.	1379;1428;1428	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	Q	1428;1428;1379;1115	ENSP00000339299:R1428Q;ENSP00000446348:R1428Q;ENSP00000445592:R1379Q	ENSP00000339299:R1428Q	R	+	2	0	TRIO	14447211	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	9.813000	0.99286	2.520000	0.84964	0.655000	0.94253	CGA	.	.		0.313	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253711.2	NM_007118	
ITGA2	3673	hgsc.bcm.edu	37	5	52376395	52376395	+	Nonsense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:52376395C>T	ENST00000296585.5	+	25	3126	c.2983C>T	c.(2983-2985)Cag>Tag	p.Q995*		NM_002203.3	NP_002194.2	P17301	ITA2_HUMAN	integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)	995					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cellular response to hormone stimulus (GO:0032870)|collagen-activated signaling pathway (GO:0038065)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|hepatocyte differentiation (GO:0070365)|hypotonic response (GO:0006971)|integrin-mediated signaling pathway (GO:0007229)|mammary gland development (GO:0030879)|mesodermal cell differentiation (GO:0048333)|organ morphogenesis (GO:0009887)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell projection organization (GO:0031346)|positive regulation of collagen binding (GO:0033343)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA binding (GO:0043388)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|response to amine (GO:0014075)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to L-ascorbic acid (GO:0033591)|response to muscle activity (GO:0014850)|response to organic cyclic compound (GO:0014070)|skin morphogenesis (GO:0043589)|substrate-dependent cell migration (GO:0006929)|tissue homeostasis (GO:0001894)|viral process (GO:0016032)	axon terminus (GO:0043679)|basal part of cell (GO:0045178)|cell outer membrane (GO:0009279)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin alpha2-beta1 complex (GO:0034666)|integrin complex (GO:0008305)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)|virus receptor activity (GO:0001618)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(1)|lung(18)|pancreas(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	47		Lung NSC(810;3.11e-05)|Breast(144;0.014)|Prostate(461;0.0181)				CCACATCCCTCAGTATACCAA	0.388																																					p.Q995X		Atlas-SNP	.											.	ITGA2	211	.	0			c.C2983T						.						173.0	163.0	167.0					5																	52376395		2203	4300	6503	SO:0001587	stop_gained	3673	exon25			ATCCCTCAGTATA		CCDS3957.1	5q11.2	2010-03-23			ENSG00000164171	ENSG00000164171		"""CD molecules"", ""Integrins"""	6137	protein-coding gene	gene with protein product		192974		CD49B			Standard	NM_002203		Approved	CD49b	uc003joy.3	P17301	OTTHUMG00000131165	ENST00000296585.5:c.2983C>T	chr5.hg19:g.52376395C>T	ENSP00000296585:p.Gln995*	159.0	0.0		136.0	55.0	NM_002203	Q14595	Nonsense_Mutation	SNP	ENST00000296585.5	hg19	CCDS3957.1	.	.	.	.	.	.	.	.	.	.	C	40	8.334747	0.98764	.	.	ENSG00000164171	ENST00000296585	.	.	.	5.1	5.1	0.69264	.	0.632453	0.17193	N	0.183421	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	10.9753	0.47463	0.1419:0.7205:0.1376:0.0	.	.	.	.	X	995	.	ENSP00000296585:Q995X	Q	+	1	0	ITGA2	52412152	0.602000	0.26916	0.991000	0.47740	0.951000	0.60555	1.096000	0.30976	2.814000	0.96858	0.655000	0.94253	CAG	.	.		0.388	ITGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253857.2	NM_002203	
FST	10468	hgsc.bcm.edu	37	5	52776658	52776658	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:52776658C>G	ENST00000256759.3	+	1	420	c.37C>G	c.(37-39)Ctc>Gtc	p.L13V	FST_ENST00000396947.3_Missense_Mutation_p.L13V	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	13					BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				TGGGCTTTGCCTCCTGCTGCT	0.741																																					p.L13V		Atlas-SNP	.											.	FST	42	.	0			c.C37G						.						20.0	15.0	17.0					5																	52776658		1986	3815	5801	SO:0001583	missense	10468	exon1			CTTTGCCTCCTGC	M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.37C>G	chr5.hg19:g.52776658C>G	ENSP00000256759:p.Leu13Val	65.0	0.0		83.0	40.0	NM_013409	B5BU94|Q9BTH0	Missense_Mutation	SNP	ENST00000256759.3	hg19	CCDS3959.1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.776810	0.31411	.	.	ENSG00000134363	ENST00000256759;ENST00000511025;ENST00000396947	T;T	0.36340	1.26;1.53	3.97	3.1	0.35709	.	0.072035	0.51477	D	0.000096	T	0.23210	0.0561	L	0.31664	0.95	0.44728	D	0.997725	B	0.06786	0.001	B	0.06405	0.002	T	0.05053	-1.0909	10	0.30078	T	0.28	-8.9785	7.7763	0.29039	0.1712:0.7379:0.0:0.0908	.	13	P19883	FST_HUMAN	V	13	ENSP00000256759:L13V;ENSP00000380151:L13V	ENSP00000256759:L13V	L	+	1	0	FST	52812415	1.000000	0.71417	0.999000	0.59377	0.718000	0.41266	1.512000	0.35812	0.885000	0.36088	-0.339000	0.08088	CTC	.	.		0.741	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253906.1	NM_013409	
BHMT2	23743	hgsc.bcm.edu	37	5	78379661	78379661	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:78379661A>C	ENST00000255192.3	+	7	1058	c.992A>C	c.(991-993)aAa>aCa	p.K331T	BHMT2_ENST00000521567.1_Missense_Mutation_p.K267T|DMGDH_ENST00000520388.1_Intron	NM_017614.4	NP_060084.2	Q9H2M3	BHMT2_HUMAN	betaine--homocysteine S-methyltransferase 2	331					L-methionine salvage (GO:0071267)|S-adenosylmethionine metabolic process (GO:0046500)|S-methylmethionine metabolic process (GO:0033477)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|S-methylmethionine-homocysteine S-methyltransferase activity (GO:0061627)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|urinary_tract(1)	15		all_lung(232;0.00063)|Lung NSC(167;0.00171)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;2.09e-45)|Epithelial(54;9.3e-41)|all cancers(79;4.09e-36)	L-Methionine(DB00134)	ATGCACACCAAACCCTGGATT	0.413																																					p.K331T		Atlas-SNP	.											.	BHMT2	44	.	0			c.A992C						.						31.0	33.0	32.0					5																	78379661		2203	4300	6503	SO:0001583	missense	23743	exon7			ACACCAAACCCTG		CCDS4045.1, CCDS54871.1	5q13	2010-04-28	2010-04-28		ENSG00000132840	ENSG00000132840	2.1.1.5		1048	protein-coding gene	gene with protein product		605932				11087663, 18230605	Standard	NM_017614		Approved		uc003kft.3	Q9H2M3	OTTHUMG00000108158	ENST00000255192.3:c.992A>C	chr5.hg19:g.78379661A>C	ENSP00000255192:p.Lys331Thr	293.0	0.0		308.0	109.0	NM_017614	B7Z516|Q9NXX7	Missense_Mutation	SNP	ENST00000255192.3	hg19	CCDS4045.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.840213	0.51057	.	.	ENSG00000132840	ENST00000255192;ENST00000521567	T;T	0.30981	1.51;1.51	5.44	5.44	0.79542	Homocysteine S-methyltransferase (2);	0.091397	0.64402	D	0.000001	T	0.57888	0.2084	M	0.85859	2.78	0.80722	D	1	D;D	0.71674	0.998;0.968	D;P	0.71870	0.975;0.63	T	0.59606	-0.7423	10	0.26408	T	0.33	-22.597	15.4981	0.75673	1.0:0.0:0.0:0.0	.	267;331	B7Z516;Q9H2M3	.;BHMT2_HUMAN	T	331;267	ENSP00000255192:K331T;ENSP00000430278:K267T	ENSP00000255192:K331T	K	+	2	0	BHMT2	78415417	1.000000	0.71417	1.000000	0.80357	0.017000	0.09413	9.086000	0.94088	2.061000	0.61500	0.533000	0.62120	AAA	.	.		0.413	BHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226962.2	NM_017614	
GPR98	84059	hgsc.bcm.edu	37	5	90079735	90079735	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:90079735T>C	ENST00000405460.2	+	67	13610	c.13514T>C	c.(13513-13515)aTc>aCc	p.I4505T	GPR98_ENST00000425867.2_Missense_Mutation_p.I166T	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	4505					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTGAGCAGAATCATAATAGCT	0.433																																					p.I4505T		Atlas-SNP	.											.	GPR98	605	.	0			c.T13514C						.						62.0	60.0	61.0					5																	90079735		1839	4086	5925	SO:0001583	missense	84059	exon67			GCAGAATCATAAT	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.13514T>C	chr5.hg19:g.90079735T>C	ENSP00000384582:p.Ile4505Thr	117.0	0.0		127.0	53.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	T	12.85	2.062368	0.36373	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000425867	T;T	0.32272	1.46;1.46	5.97	5.97	0.96955	.	0.260709	0.43110	D	0.000606	T	0.40145	0.1105	M	0.79475	2.455	0.39623	D	0.970056	P;B;P	0.46512	0.546;0.361;0.879	B;B;B	0.40940	0.1;0.054;0.344	T	0.51624	-0.8682	10	0.87932	D	0	.	16.4454	0.83928	0.0:0.0:0.0:1.0	.	166;4505;166	E7EML1;Q8WXG9;Q8WXG9-2	.;GPR98_HUMAN;.	T	4505;4505;166	ENSP00000384582:I4505T;ENSP00000392618:I166T	ENSP00000296619:I4505T	I	+	2	0	GPR98	90115491	1.000000	0.71417	0.647000	0.29507	0.239000	0.25481	7.756000	0.85195	2.275000	0.75901	0.533000	0.62120	ATC	.	.		0.433	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
VDAC1	7416	hgsc.bcm.edu	37	5	133326695	133326695	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:133326695G>A	ENST00000265333.3	-	4	512	c.268C>T	c.(268-270)Cag>Tag	p.Q90*	VDAC1_ENST00000395047.2_Nonsense_Mutation_p.Q90*|VDAC1_ENST00000466080.1_5'UTR|VDAC1_ENST00000395044.3_Nonsense_Mutation_p.Q90*	NM_003374.2	NP_003365.1	P21796	VDAC1_HUMAN	voltage-dependent anion channel 1	90					anion transport (GO:0006820)|apoptotic process (GO:0006915)|behavioral fear response (GO:0001662)|epithelial cell differentiation (GO:0030855)|learning (GO:0007612)|neuron-neuron synaptic transmission (GO:0007270)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pore complex (GO:0046930)	porin activity (GO:0015288)|protein kinase binding (GO:0019901)|voltage-gated anion channel activity (GO:0008308)			endometrium(1)|large_intestine(1)|lung(1)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)		Dihydroxyaluminium(DB01375)	GCCATTACCTGATCTTCCACA	0.438																																					p.Q90X	NSCLC(127;1776 1806 35523 41489 48154)	Atlas-SNP	.											.	VDAC1	17	.	0			c.C268T						.						233.0	219.0	224.0					5																	133326695		2203	4300	6503	SO:0001587	stop_gained	7416	exon4			TTACCTGATCTTC		CCDS4168.1	5q31	2011-11-15			ENSG00000213585	ENSG00000213585		"""Voltage-dependent anion channels"""	12669	protein-coding gene	gene with protein product		604492				7517385	Standard	NM_003374		Approved	MGC111064, PORIN	uc003kyr.2	P21796	OTTHUMG00000129118	ENST00000265333.3:c.268C>T	chr5.hg19:g.133326695G>A	ENSP00000265333:p.Gln90*	100.0	0.0		96.0	41.0	NM_003374	B3KVK4|D3DQ93|Q5FVE7|Q9UIQ5|Q9UPL0	Nonsense_Mutation	SNP	ENST00000265333.3	hg19	CCDS4168.1	.	.	.	.	.	.	.	.	.	.	G	36	5.735651	0.96865	.	.	ENSG00000213585	ENST00000265333;ENST00000395044;ENST00000395047;ENST00000425992	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09843	T	0.71	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	.	.	.	X	90	.	ENSP00000265333:Q90X	Q	-	1	0	VDAC1	133354594	1.000000	0.71417	0.997000	0.53966	0.363000	0.29612	7.968000	0.87980	2.793000	0.96121	0.655000	0.94253	CAG	.	.		0.438	VDAC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259208.1		
TGFBI	7045	hgsc.bcm.edu	37	5	135389646	135389646	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:135389646G>A	ENST00000442011.2	+	9	1302	c.1141G>A	c.(1141-1143)Gaa>Aaa	p.E381K	TGFBI_ENST00000305126.8_Missense_Mutation_p.E381K	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	381	FAS1 3. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GACACTATTTGAATTGGCTGC	0.488																																					p.E381K		Atlas-SNP	.											.	TGFBI	76	.	0			c.G1141A						.						77.0	79.0	78.0					5																	135389646		1914	4148	6062	SO:0001583	missense	7045	exon9			CTATTTGAATTGG	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.1141G>A	chr5.hg19:g.135389646G>A	ENSP00000416330:p.Glu381Lys	80.0	0.0		98.0	35.0	NM_000358	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	ENST00000442011.2	hg19	CCDS47266.1	.	.	.	.	.	.	.	.	.	.	G	34	5.379424	0.95945	.	.	ENSG00000120708	ENST00000442011;ENST00000398813;ENST00000305126	T;T	0.74002	-0.8;-0.8	5.87	5.87	0.94306	FAS1 domain (2);	0.000000	0.85682	D	0.000000	D	0.87716	0.6247	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.993	D	0.88088	0.2811	10	0.72032	D	0.01	-19.453	19.8011	0.96507	0.0:0.0:1.0:0.0	.	114;381	B9ZVW9;Q15582	.;BGH3_HUMAN	K	381;114;381	ENSP00000416330:E381K;ENSP00000306306:E381K	ENSP00000306306:E381K	E	+	1	0	TGFBI	135417545	1.000000	0.71417	0.995000	0.50966	0.772000	0.43724	9.690000	0.98676	2.785000	0.95823	0.655000	0.94253	GAA	.	.		0.488	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1		
KDM3B	51780	hgsc.bcm.edu	37	5	137708413	137708413	+	Silent	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:137708413A>G	ENST00000314358.5	+	2	443	c.243A>G	c.(241-243)aaA>aaG	p.K81K		NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	81					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CCTGGGTAAAAGTTCATGCTG	0.473																																					p.K81K		Atlas-SNP	.											.	KDM3B	177	.	0			c.A243G						.						110.0	105.0	107.0					5																	137708413		2203	4300	6503	SO:0001819	synonymous_variant	51780	exon2			GGTAAAAGTTCAT	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.243A>G	chr5.hg19:g.137708413A>G		128.0	0.0		135.0	61.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Silent	SNP	ENST00000314358.5	hg19	CCDS34242.1																																																																																			.	.		0.473	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
LCP2	3937	hgsc.bcm.edu	37	5	169693828	169693828	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:169693828T>G	ENST00000046794.5	-	10	1371	c.756A>C	c.(754-756)agA>agC	p.R252S	LCP2_ENST00000521416.1_Missense_Mutation_p.R47S	NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	252					blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TGAAGGGTTCTCTATCAAACG	0.413																																					p.R252S		Atlas-SNP	.											.	LCP2	133	.	0			c.A756C						.						220.0	216.0	217.0					5																	169693828		1899	4110	6009	SO:0001583	missense	3937	exon10			GGGTTCTCTATCA		CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.756A>C	chr5.hg19:g.169693828T>G	ENSP00000046794:p.Arg252Ser	153.0	0.0		177.0	65.0	NM_005565	A8KA25|Q53XV4	Missense_Mutation	SNP	ENST00000046794.5	hg19	CCDS47339.1	.	.	.	.	.	.	.	.	.	.	T	17.87	3.496044	0.64186	.	.	ENSG00000043462	ENST00000046794;ENST00000521416	T;T	0.52983	0.85;0.64	5.46	0.604	0.17547	.	0.000000	0.48286	D	0.000200	T	0.57917	0.2086	M	0.64997	1.995	0.42249	D	0.991967	D;D;D	0.89917	1.0;0.999;0.994	D;D;P	0.80764	0.943;0.994;0.873	T	0.53725	-0.8398	9	.	.	.	-18.2395	7.0587	0.25113	0.0:0.3763:0.0:0.6237	.	47;252;252	E7ESF6;A8KA25;Q13094	.;.;LCP2_HUMAN	S	252;47	ENSP00000046794:R252S;ENSP00000428871:R47S	.	R	-	3	2	LCP2	169626406	1.000000	0.71417	0.999000	0.59377	0.901000	0.52897	1.401000	0.34589	0.089000	0.17243	0.533000	0.62120	AGA	.	.		0.413	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371727.1	NM_005565	
HNRNPH1	3187	hgsc.bcm.edu	37	5	179046347	179046347	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr5:179046347C>T	ENST00000356731.5	-	4	1994	c.459G>A	c.(457-459)ggG>ggA	p.G153G	HNRNPH1_ENST00000329433.6_Silent_p.G153G|HNRNPH1_ENST00000393432.4_Silent_p.G153G|HNRNPH1_ENST00000524180.1_5'Flank|HNRNPH1_ENST00000442819.2_Silent_p.G153G|HNRNPH1_ENST00000511300.2_5'Flank|HNRNPH1_ENST00000510411.1_Silent_p.G153G			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)	153	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						CGAAGGCCTCCCCCGTACTCC	0.512																																					p.G153G		Atlas-SNP	.											.	HNRNPH1	62	.	0			c.G459A						.						172.0	165.0	168.0					5																	179046347		2203	4300	6503	SO:0001819	synonymous_variant	3187	exon5			GGCCTCCCCCGTA	BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.459G>A	chr5.hg19:g.179046347C>T		154.0	0.0		196.0	80.0	NM_001257293	B3KW86|D3DWQ2|Q6IBM4	Silent	SNP	ENST00000356731.5	hg19	CCDS4446.1	.	.	.	.	.	.	.	.	.	.	c	5.226	0.227111	0.09916	.	.	ENSG00000169045	ENST00000521173	T	0.52983	0.64	5.77	5.77	0.91146	.	0.045398	0.85682	N	0.000000	T	0.69593	0.3128	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72235	-0.4352	7	0.87932	D	0	-5.6286	19.9855	0.97347	0.0:1.0:0.0:0.0	.	.	.	.	E	28	ENSP00000428620:G28E	ENSP00000428620:G28E	G	-	2	0	HNRNPH1	178978953	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.715000	0.92844	0.655000	0.94253	GGG	.	.		0.512	HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253497.3	NM_005520	
NEDD9	4739	hgsc.bcm.edu	37	6	11213881	11213881	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:11213881G>A	ENST00000379446.5	-	2	258	c.92C>T	c.(91-93)aCc>aTc	p.T31I	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Missense_Mutation_p.T31I|NEDD9_ENST00000379433.5_Missense_Mutation_p.T31I	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	31	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			CTCTATGACGGTCAGGATGTC	0.537																																					p.T31I		Atlas-SNP	.											.	NEDD9	191	.	0			c.C92T						.						127.0	110.0	116.0					6																	11213881		2203	4300	6503	SO:0001583	missense	4739	exon2			ATGACGGTCAGGA	L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.92C>T	chr6.hg19:g.11213881G>A	ENSP00000368759:p.Thr31Ile	102.0	0.0		100.0	41.0	NM_182966	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	ENST00000379446.5	hg19	CCDS4520.1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.014436	0.75161	.	.	ENSG00000111859	ENST00000379446;ENST00000504387;ENST00000379433;ENST00000513989;ENST00000397378	T;T;T;T;T	0.63417	-0.04;-0.04;-0.04;0.62;1.92	6.17	6.17	0.99709	Src homology-3 domain (4);	0.000000	0.85682	D	0.000000	T	0.68659	0.3025	L	0.33093	0.98	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.999	D;D;D	0.87578	0.976;0.998;0.995	T	0.68462	-0.5402	10	0.59425	D	0.04	-24.8521	20.8794	0.99867	0.0:0.0:1.0:0.0	.	31;31;31	G5E9Y9;Q5XKI0;Q14511	.;.;CASL_HUMAN	I	31;31;31;25;31	ENSP00000368759:T31I;ENSP00000422871:T31I;ENSP00000368745:T31I;ENSP00000421282:T25I;ENSP00000380534:T31I	ENSP00000368745:T31I	T	-	2	0	NEDD9	11321867	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	9.441000	0.97557	2.941000	0.99782	0.655000	0.94253	ACC	.	.		0.537	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039853.2	NM_006403	
OR2J3	442186	hgsc.bcm.edu	37	6	29079911	29079911	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:29079911C>T	ENST00000377169.1	+	1	244	c.244C>T	c.(244-246)Cct>Tct	p.P82S		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	82						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						CAGCTCTATCCCTCAGTTGCT	0.483																																					p.P82S		Atlas-SNP	.											.	OR2J3	53	.	0			c.C244T						.						199.0	204.0	202.0					6																	29079911		1276	2597	3873	SO:0001583	missense	442186	exon1			TCTATCCCTCAGT		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.244C>T	chr6.hg19:g.29079911C>T	ENSP00000366374:p.Pro82Ser	132.0	0.0		148.0	66.0	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	hg19	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239944	0.39598	.	.	ENSG00000204701	ENST00000377169	T	0.01854	4.6	2.78	2.78	0.32641	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.13372	0.0324	H	0.97186	3.955	0.42398	D	0.992556	D	0.89917	1.0	D	0.97110	1.0	T	0.17198	-1.0377	9	0.87932	D	0	.	13.5409	0.61672	0.0:1.0:0.0:0.0	.	82	O76001	OR2J3_HUMAN	S	82	ENSP00000366374:P82S	ENSP00000366374:P82S	P	+	1	0	OR2J3	29187890	0.980000	0.34600	0.833000	0.33012	0.252000	0.25951	4.241000	0.58707	1.549000	0.49425	0.436000	0.28706	CCT	.	.		0.483	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
MUC21	394263	hgsc.bcm.edu	37	6	30955326	30955326	+	Silent	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:30955326T>G	ENST00000376296.3	+	2	1615	c.1374T>G	c.(1372-1374)acT>acG	p.T458T	MUC21_ENST00000486149.2_Silent_p.T4T	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	458					cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TGCACACAACTTCCCATAGTG	0.597																																					p.T458T		Atlas-SNP	.											MUC21,NS,malignant_melanoma,0,2	MUC21	98	.	0			c.T1374G						.						121.0	115.0	117.0					6																	30955326		2203	4300	6503	SO:0001819	synonymous_variant	394263	exon2			CACAACTTCCCAT	AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1374T>G	chr6.hg19:g.30955326T>G		136.0	0.0		149.0	65.0	NM_001010909	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	ENST00000376296.3	hg19	CCDS34388.1																																																																																			.	.		0.597	MUC21-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000128579.3	NM_001010909	
HLA-C	3107	hgsc.bcm.edu	37	6	31238146	31238146	+	Missense_Mutation	SNP	C	C	T	rs281860561		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:31238146C>T	ENST00000376228.5	-	4	750	c.736G>A	c.(736-738)Gag>Aag	p.E246K	HLA-C_ENST00000383329.3_Missense_Mutation_p.E246K	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	246	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						GTCTGGTCCTCCCCATCCCGC	0.637																																					p.E246K		Atlas-SNP	.											.	HLA-C	92	.	0			c.G736A						.						40.0	36.0	37.0					6																	31238146		2195	4276	6471	SO:0001583	missense	3107	exon4			GGTCCTCCCCATC	M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.736G>A	chr6.hg19:g.31238146C>T	ENSP00000365402:p.Glu246Lys	84.0	0.0		87.0	35.0	NM_002117	O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	ENST00000376228.5	hg19	CCDS34393.1	.	.	.	.	.	.	.	.	.	.	.	5.901	0.350405	0.11182	.	.	ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307	T;T	0.02682	4.2;4.2	2.67	1.74	0.24563	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.716864	0.11456	U	0.562222	T	0.01421	0.0046	L	0.53780	1.695	0.30207	N	0.79809	B;B;B;B	0.15141	0.012;0.001;0.001;0.006	B;B;B;B	0.23852	0.049;0.013;0.021;0.023	T	0.36504	-0.9745	10	0.87932	D	0	.	7.2957	0.26391	0.0:0.724:0.276:0.0	.	246;246;246;246	A2AEA4;A6H578;A2AEA2;P10321	.;.;.;1C07_HUMAN	K	246;246;246;283	ENSP00000365402:E246K;ENSP00000372819:E246K	ENSP00000365402:E246K	E	-	1	0	HLA-C	31346125	0.000000	0.05858	1.000000	0.80357	0.326000	0.28443	0.060000	0.14342	0.656000	0.30886	0.298000	0.19748	GAG	.	.		0.637	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076281.3	NM_002117	
C2	717	hgsc.bcm.edu	37	6	31903820	31903820	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:31903820G>A	ENST00000299367.5	+	7	1246	c.970G>A	c.(970-972)Gaa>Aaa	p.E324K	CFB_ENST00000456570.1_Intron|C2_ENST00000469372.1_Missense_Mutation_p.E78K|CFB_ENST00000477310.1_Intron|C2_ENST00000452323.2_Intron|C2_ENST00000442278.2_Missense_Mutation_p.E192K|CFB_ENST00000556679.1_Intron	NM_000063.4	NP_000054.2	P06681	CO2_HUMAN	complement component 2	324	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	27		Ovarian(999;0.00965)		LUAD - Lung adenocarcinoma(999;0.247)		CAGCAGCCTGGAAAATGCCAA	0.498																																					p.E324K		Atlas-SNP	.											.	C2	50	.	0			c.G970A						.						68.0	61.0	64.0					6																	31903820		1511	2709	4220	SO:0001583	missense	717	exon7			AGCCTGGAAAATG		CCDS4728.1, CCDS54991.1, CCDS56416.1, CCDS75427.1, CCDS75428.1	6p21.3	2014-09-17			ENSG00000166278	ENSG00000166278		"""Complement system"""	1248	protein-coding gene	gene with protein product		613927					Standard	NM_001145903		Approved		uc011hbs.1	P06681	OTTHUMG00000031190	ENST00000299367.5:c.970G>A	chr6.hg19:g.31903820G>A	ENSP00000299367:p.Glu324Lys	103.0	0.0		117.0	38.0	NM_000063	B4DPF3|B4DV20|E9PFN7|O19694|Q13904	Missense_Mutation	SNP	ENST00000299367.5	hg19	CCDS4728.1	.	.	.	.	.	.	.	.	.	.	G	11.48	1.652514	0.29336	.	.	ENSG00000166278	ENST00000469372;ENST00000497706;ENST00000432397;ENST00000299367;ENST00000375493;ENST00000442278	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.51	0.249	0.15531	von Willebrand factor, type A (3);	1.434070	0.04871	N	0.445996	T	0.39145	0.1067	.	.	.	0.49582	D	0.999807	B;B;B;B;B	0.28783	0.222;0.024;0.017;0.022;0.024	B;B;B;B;B	0.22880	0.032;0.014;0.013;0.042;0.023	T	0.40813	-0.9543	9	0.16420	T	0.52	-4.1617	5.789	0.18349	0.2369:0.4129:0.3502:0.0	.	295;78;192;324;111	B4DV48;B4DQI1;E9PFN7;P06681;E9PDZ0	.;.;.;CO2_HUMAN;.	K	78;111;111;324;9;192	ENSP00000418923:E78K;ENSP00000417482:E111K;ENSP00000299367:E324K;ENSP00000395683:E192K	ENSP00000299367:E324K	E	+	1	0	C2	32011799	0.998000	0.40836	0.082000	0.20525	0.019000	0.09904	0.916000	0.28651	0.027000	0.15297	0.461000	0.40582	GAA	.	.		0.498	C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076379.9		
SKIV2L	6499	hgsc.bcm.edu	37	6	31933608	31933608	+	Missense_Mutation	SNP	C	C	G	rs565924623		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:31933608C>G	ENST00000375394.2	+	18	2133	c.2020C>G	c.(2020-2022)Cgt>Ggt	p.R674G	SKIV2L_ENST00000544581.1_Missense_Mutation_p.R481G	NM_006929.4	NP_008860.4	Q15477	SKIV2_HUMAN	superkiller viralicidic activity 2-like (S. cerevisiae)	674	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)	nucleus (GO:0005634)|Ski complex (GO:0055087)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|large_intestine(1)|ovary(1)	4						CATGCCTGCTCGTACAGTAGT	0.562																																					p.R674G		Atlas-SNP	.											.	SKIV2L	97	.	0			c.C2020G						.						149.0	112.0	125.0					6																	31933608		1511	2709	4220	SO:0001583	missense	6499	exon18			CCTGCTCGTACAG		CCDS4731.1	6p21	2010-02-17	2001-11-28		ENSG00000204351	ENSG00000204351			10898	protein-coding gene	gene with protein product		600478	"""superkiller viralicidic activity 2 (S. cerevisiae homolog)-like"""	SKIV2		7759100, 9799600	Standard	XM_006715168		Approved	HLP, DDX13, SKI2W, 170A	uc003nyn.1	Q15477	OTTHUMG00000031146	ENST00000375394.2:c.2020C>G	chr6.hg19:g.31933608C>G	ENSP00000364543:p.Arg674Gly	157.0	0.0		161.0	48.0	NM_006929	O15005|Q12902|Q15476|Q5ST66	Missense_Mutation	SNP	ENST00000375394.2	hg19	CCDS4731.1	.	.	.	.	.	.	.	.	.	.	C	16.41	3.114822	0.56505	.	.	ENSG00000204351	ENST00000375394;ENST00000433155;ENST00000544581	T;T	0.75050	-0.9;-0.9	5.48	3.58	0.41010	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.84437	0.5472	M	0.88640	2.97	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	D	0.87690	0.2553	10	0.87932	D	0	-12.3974	12.9788	0.58552	0.4201:0.5799:0.0:0.0	.	674	Q15477	SKIV2_HUMAN	G	674;516;481	ENSP00000364543:R674G;ENSP00000442645:R481G	ENSP00000364543:R674G	R	+	1	0	SKIV2L	32041587	0.514000	0.26202	0.463000	0.27130	0.840000	0.47671	1.048000	0.30379	1.256000	0.44068	0.655000	0.94253	CGT	.	.		0.562	SKIV2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076264.3		
RGL2	5863	hgsc.bcm.edu	37	6	33264534	33264534	+	Missense_Mutation	SNP	C	C	T	rs562018570		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:33264534C>T	ENST00000497454.1	-	4	755	c.260G>A	c.(259-261)cGt>cAt	p.R87H	RGL2_ENST00000444031.2_Missense_Mutation_p.R5H|RGL2_ENST00000437840.2_5'UTR|PFDN6_ENST00000463584.1_Intron	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	87					positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						TCGGGAGGAACGTGGGGGAGG	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		18926	0.0		0.001	False		,,,				2504	0.0				p.R87H		Atlas-SNP	.											.	RGL2	58	.	0			c.G260A						.						51.0	56.0	54.0					6																	33264534		2203	4300	6503	SO:0001583	missense	5863	exon4			GAGGAACGTGGGG		CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.260G>A	chr6.hg19:g.33264534C>T	ENSP00000420211:p.Arg87His	153.0	0.0		170.0	63.0	NM_004761	B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	ENST00000497454.1	hg19	CCDS4774.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348003	0.41599	.	.	ENSG00000237441	ENST00000497454;ENST00000444031;ENST00000425946	T;T;T	0.31247	1.5;1.5;1.5	4.22	4.22	0.49857	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.522151	0.19201	N	0.120193	T	0.33089	0.0851	L	0.44542	1.39	0.37229	D	0.905586	D;D	0.76494	0.999;0.998	P;D	0.69479	0.869;0.964	T	0.05007	-1.0912	10	0.40728	T	0.16	.	11.9785	0.53107	0.0:1.0:0.0:0.0	.	5;87	B4DG72;O15211	.;RGL2_HUMAN	H	87;5;87	ENSP00000420211:R87H;ENSP00000403070:R5H;ENSP00000392918:R87H	ENSP00000392918:R87H	R	-	2	0	RGL2	33372512	0.917000	0.31117	0.652000	0.29579	0.710000	0.40934	2.303000	0.43646	2.177000	0.69029	0.643000	0.83706	CGT	.	.		0.577	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076098.2		
DNAH8	1769	hgsc.bcm.edu	37	6	38758095	38758095	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:38758095G>A	ENST00000359357.3	+	18	2298	c.2044G>A	c.(2044-2046)Gtg>Atg	p.V682M	DNAH8_ENST00000441566.1_Missense_Mutation_p.V682M|DNAH8_ENST00000449981.2_Missense_Mutation_p.V899M			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	682					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						AGGACTCACAGTGTTAACATG	0.363																																					p.V899M		Atlas-SNP	.											.	DNAH8	1239	.	0			c.G2695A						.						172.0	165.0	168.0					6																	38758095		2203	4300	6503	SO:0001583	missense	1769	exon20			CTCACAGTGTTAA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.2044G>A	chr6.hg19:g.38758095G>A	ENSP00000352312:p.Val682Met	132.0	0.0		155.0	63.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	G	3.405	-0.121364	0.06838	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.55588	0.51;0.51;0.51	5.2	2.38	0.29361	Dynein heavy chain, domain-1 (1);	0.341577	0.26086	N	0.026430	T	0.10852	0.0265	N	0.05351	-0.065	0.27704	N	0.945672	B	0.10296	0.003	B	0.16722	0.016	T	0.21484	-1.0244	10	0.41790	T	0.15	.	3.9524	0.09375	0.637:0.0:0.2153:0.1477	.	682	Q96JB1	DYH8_HUMAN	M	887;887;682;682	ENSP00000333363:V887M;ENSP00000352312:V682M;ENSP00000402294:V682M	ENSP00000333363:V887M	V	+	1	0	DNAH8	38866073	0.065000	0.20965	0.930000	0.37139	0.007000	0.05969	0.423000	0.21313	0.244000	0.21351	-0.312000	0.09012	GTG	.	.		0.363	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
MCM3	4172	hgsc.bcm.edu	37	6	52132768	52132768	+	Splice_Site	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:52132768T>A	ENST00000229854.7	-	14	2045		c.e14-2		MCM3_ENST00000419835.2_Splice_Site|MCM3_ENST00000596288.1_Splice_Site			P25205	MCM3_HUMAN	minichromosome maintenance complex component 3						DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	alpha DNA polymerase:primase complex (GO:0005658)|centrosome (GO:0005813)|intracellular membrane-bounded organelle (GO:0043231)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	20	Lung NSC(77;0.0931)					ctccAGAACCTAAGACCAAGG	0.502																																					.		Atlas-SNP	.											.	MCM3	63	.	0			c.1999-2A>T						.						163.0	135.0	145.0					6																	52132768		2203	4300	6503	SO:0001630	splice_region_variant	4172	exon14			AGAACCTAAGACC	X62153	CCDS4940.1, CCDS4940.2, CCDS75468.1	6p12	2008-02-05	2007-04-04		ENSG00000112118	ENSG00000112118			6945	protein-coding gene	gene with protein product		602693	"""minichromosome maintenance deficient (S. cerevisiae) 3"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae)"""			1549468	Standard	NM_002388		Approved		uc011dwu.2	P25205	OTTHUMG00000014844	ENST00000229854.7:c.1969-2A>T	chr6.hg19:g.52132768T>A		91.0	0.0		111.0	43.0	NM_001270472	B4DWW4|Q92660|Q9BTR3|Q9NUE7	Splice_Site	SNP	ENST00000229854.7	hg19		.	.	.	.	.	.	.	.	.	.	T	16.96	3.266946	0.59540	.	.	ENSG00000112118	ENST00000229854;ENST00000340349;ENST00000419835;ENST00000421471	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6461	0.45621	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MCM3	52240727	1.000000	0.71417	0.997000	0.53966	0.874000	0.50279	3.003000	0.49505	2.288000	0.76882	0.533000	0.62120	.	.	.		0.502	MCM3-006	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470784.1		Intron
RIMS1	22999	hgsc.bcm.edu	37	6	73017046	73017046	+	Silent	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:73017046A>G	ENST00000521978.1	+	27	3936	c.3936A>G	c.(3934-3936)caA>caG	p.Q1312Q	RIMS1_ENST00000401910.3_Silent_p.Q632Q|RIMS1_ENST00000517960.1_Silent_p.Q1104Q|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000538414.1_Silent_p.Q118Q|RIMS1_ENST00000348717.5_Silent_p.Q1104Q|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000264839.7_Silent_p.Q1161Q|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000491071.2_Silent_p.Q1135Q|RIMS1_ENST00000425662.2_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1312					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GTTCTAGTCAAGAACTTGATC	0.388																																					p.Q1312Q		Atlas-SNP	.											.	RIMS1	278	.	0			c.A3936G						.						71.0	67.0	69.0					6																	73017046		1874	4111	5985	SO:0001819	synonymous_variant	22999	exon27			TAGTCAAGAACTT	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3936A>G	chr6.hg19:g.73017046A>G		106.0	0.0		114.0	43.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Silent	SNP	ENST00000521978.1	hg19	CCDS47449.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.893|8.893	0.954576|0.954576	0.18431|0.18431	.|.	.|.	ENSG00000079841|ENSG00000079841	ENST00000522211|ENST00000517433	.|.	.|.	.|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	.|.	.|.	.|.	.|.	T|T	0.64516|0.64516	0.2605|0.2605	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.64846|0.64846	-0.6311|-0.6311	4|4	.|.	.|.	.|.	-14.1812|-14.1812	15.8645|15.8645	0.79055|0.79055	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	R|G	230|658	.|.	.|.	K|R	+|+	2|1	0|2	RIMS1|RIMS1	73073767|73073767	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.159000|6.159000	0.71856|0.71856	2.147000|2.147000	0.66899|0.66899	0.528000|0.528000	0.53228|0.53228	AAG|AGA	.	.		0.388	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
METTL24	728464	hgsc.bcm.edu	37	6	110620219	110620219	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:110620219T>C	ENST00000338882.4	-	4	691	c.692A>G	c.(691-693)gAc>gGc	p.D231G		NM_001123364.1	NP_001116836.1	Q5JXM2	MET24_HUMAN	methyltransferase like 24	231						extracellular region (GO:0005576)	methyltransferase activity (GO:0008168)										ATCCCGCCAGTCAATGGACAA	0.483																																					p.D231G		Atlas-SNP	.											.	.	.	.	0			c.A692G						.						98.0	87.0	90.0					6																	110620219		1568	3582	5150	SO:0001583	missense	728464	exon4			CGCCAGTCAATGG		CCDS43489.1	6q21	2012-03-08	2012-02-21	2012-02-21	ENSG00000053328	ENSG00000053328			21566	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 186"""	C6orf186			Standard	NM_001123364		Approved	dJ71D21.2	uc010kdu.1	Q5JXM2	OTTHUMG00000015359	ENST00000338882.4:c.692A>G	chr6.hg19:g.110620219T>C	ENSP00000344071:p.Asp231Gly	51.0	0.0		50.0	20.0	NM_001123364	Q6ZSU5	Missense_Mutation	SNP	ENST00000338882.4	hg19	CCDS43489.1	.	.	.	.	.	.	.	.	.	.	T	13.46	2.243430	0.39697	.	.	ENSG00000053328	ENST00000338882	T	0.33438	1.41	5.56	4.37	0.52481	.	0.096695	0.64402	D	0.000002	T	0.10594	0.0259	L	0.38175	1.15	0.54753	D	0.999984	B	0.25312	0.123	B	0.30943	0.122	T	0.05616	-1.0874	10	0.09338	T	0.73	-10.2894	12.6085	0.56538	0.0:0.0:0.1387:0.8613	.	231	Q5JXM2	CF186_HUMAN	G	231	ENSP00000344071:D231G	ENSP00000344071:D231G	D	-	2	0	C6orf186	110726912	1.000000	0.71417	0.460000	0.27093	0.967000	0.64934	5.473000	0.66774	0.905000	0.36596	0.533000	0.62120	GAC	.	.		0.483	METTL24-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000041794.1	NM_001123364	
TBC1D32	221322	hgsc.bcm.edu	37	6	121624863	121624863	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:121624863A>C	ENST00000398212.2	-	9	1029	c.980T>G	c.(979-981)gTt>gGt	p.V327G	TBC1D32_ENST00000275159.6_Missense_Mutation_p.V327G	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	327					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										ATTATGTTTAACTGTTAACAA	0.338																																					p.V327G		Atlas-SNP	.											.	C6orf170	146	.	0			c.T980G						.						109.0	99.0	102.0					6																	121624863		1815	4079	5894	SO:0001583	missense	221322	exon9			TGTTTAACTGTTA	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.980T>G	chr6.hg19:g.121624863A>C	ENSP00000381270:p.Val327Gly	168.0	0.0		179.0	11.0	NM_152730	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	ENST00000398212.2	hg19	CCDS43501.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.199180	0.38806	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.21932	1.98;1.98	5.19	4.04	0.47022	.	0.501604	0.20236	N	0.096390	T	0.10937	0.0267	L	0.56769	1.78	0.58432	D	0.999994	B	0.32573	0.376	B	0.29942	0.109	T	0.02766	-1.1113	10	0.72032	D	0.01	-19.3815	10.9913	0.47551	0.9261:0.0:0.0739:0.0	.	327	Q96NH3	BROMI_HUMAN	G	327	ENSP00000275159:V327G;ENSP00000381270:V327G	ENSP00000275159:V327G	V	-	2	0	C6orf170	121666562	1.000000	0.71417	0.990000	0.47175	0.555000	0.35460	3.511000	0.53400	0.918000	0.36919	-0.334000	0.08254	GTT	.	.		0.338	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
SYNE1	23345	hgsc.bcm.edu	37	6	152671436	152671436	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:152671436T>C	ENST00000367255.5	-	72	12369	c.11768A>G	c.(11767-11769)gAc>gGc	p.D3923G	SYNE1_ENST00000448038.1_Intron|SYNE1_ENST00000341594.5_Missense_Mutation_p.D3847G|SYNE1_ENST00000265368.4_Missense_Mutation_p.D3923G|SYNE1_ENST00000423061.1_Intron	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3923					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GTCTTCATGGTCTTTGACTTT	0.488										HNSCC(10;0.0054)																											p.D3923G		Atlas-SNP	.											SYNE1_ENST00000265368,NS,carcinoma,0,2	SYNE1	3227	.	0			c.A11768G						.						110.0	100.0	104.0					6																	152671436		2203	4300	6503	SO:0001583	missense	23345	exon72			TCATGGTCTTTGA	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11768A>G	chr6.hg19:g.152671436T>C	ENSP00000356224:p.Asp3923Gly	61.0	0.0		54.0	21.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964310	0.53507	.	.	ENSG00000131018	ENST00000367255;ENST00000265368;ENST00000341594	T;T;T	0.35789	1.29;1.29;1.29	5.93	5.93	0.95920	.	0.090393	0.47455	D	0.000234	T	0.16854	0.0405	N	0.22421	0.69	0.80722	D	1	B;B;B	0.27823	0.19;0.19;0.19	B;B;B	0.29785	0.107;0.107;0.107	T	0.05053	-1.0909	10	0.42905	T	0.14	.	16.3943	0.83563	0.0:0.0:0.0:1.0	.	3923;3923;3923	B7ZBC3;Q8NF91;E7EQI5	.;SYNE1_HUMAN;.	G	3923;3923;3847	ENSP00000356224:D3923G;ENSP00000265368:D3923G;ENSP00000341887:D3847G	ENSP00000265368:D3923G	D	-	2	0	SYNE1	152713129	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.676000	0.84012	2.281000	0.76405	0.533000	0.62120	GAC	.	.		0.488	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
GPR146	115330	hgsc.bcm.edu	37	7	1097405	1097405	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:1097405T>G	ENST00000397095.1	+	2	477	c.254T>G	c.(253-255)cTc>cGc	p.L85R	C7orf50_ENST00000357429.6_Intron|RP11-449P15.1_ENST00000549241.1_RNA|C7orf50_ENST00000397100.2_Intron|C7orf50_ENST00000488073.1_Intron|C7orf50_ENST00000397098.3_Intron|GPR146_ENST00000297468.3_Missense_Mutation_p.L85R			Q96CH1	GP146_HUMAN	G protein-coupled receptor 146	85						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|ovary(1)|skin(1)	8		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GTGCACCTGCTCGGCCCCCCG	0.642																																					p.L85R		Atlas-SNP	.											.	GPR146	20	.	0			c.T254G						.						31.0	30.0	31.0					7																	1097405		2200	4299	6499	SO:0001583	missense	115330	exon1			ACCTGCTCGGCCC	BC014241	CCDS5321.1	7p22.3	2012-08-21			ENSG00000164849	ENSG00000164849		"""GPCR / Class A : Orphans"""	21718	protein-coding gene	gene with protein product							Standard	NM_138445		Approved	PGR8	uc003sjy.1	Q96CH1	OTTHUMG00000023934	ENST00000397095.1:c.254T>G	chr7.hg19:g.1097405T>G	ENSP00000380283:p.Leu85Arg	56.0	0.0		83.0	27.0	NM_138445	Q86SP5	Missense_Mutation	SNP	ENST00000397095.1	hg19	CCDS5321.1	.	.	.	.	.	.	.	.	.	.	T	14.67	2.605579	0.46527	.	.	ENSG00000164849	ENST00000444847;ENST00000397095;ENST00000500070;ENST00000297468	T;T;T	0.49720	0.77;0.77;0.77	5.09	3.91	0.45181	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000001	T	0.55878	0.1948	L	0.36672	1.1	0.52099	D	0.999947	D	0.89917	1.0	D	0.76071	0.987	T	0.55573	-0.8120	10	0.62326	D	0.03	-17.8684	10.4615	0.44583	0.1459:0.0:0.0:0.8541	.	85	Q96CH1	GP146_HUMAN	R	85;85;3;85	ENSP00000410743:L85R;ENSP00000380283:L85R;ENSP00000297468:L85R	ENSP00000297468:L85R	L	+	2	0	GPR146	1063931	1.000000	0.71417	0.503000	0.27626	0.014000	0.08584	7.422000	0.80217	0.762000	0.33152	0.459000	0.35465	CTC	.	.		0.642	GPR146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206855.1	NM_138445	
SFRP4	6424	hgsc.bcm.edu	37	7	37955894	37955894	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:37955894C>T	ENST00000436072.2	-	1	623	c.246G>A	c.(244-246)gcG>gcA	p.A82A	EPDR1_ENST00000476620.1_Intron	NM_003014.3	NP_003005.2	Q6FHJ7	SFRP4_HUMAN	secreted frizzled-related protein 4	82	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				brain development (GO:0007420)|cell differentiation (GO:0030154)|decidualization (GO:0046697)|epithelium development (GO:0060429)|gonad development (GO:0008406)|mammary gland involution (GO:0060056)|menstrual cycle phase (GO:0022601)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of JNK cascade (GO:0046329)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of sodium-dependent phosphate transport (GO:2000119)|phosphate ion homeostasis (GO:0055062)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epidermal cell differentiation (GO:0045606)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte apoptotic process (GO:1902174)|positive regulation of receptor internalization (GO:0002092)|response to hormone (GO:0009725)|vasculature development (GO:0001944)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)	PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						TGCAAATGGGCGCGTACATGG	0.622																																					p.A82A		Atlas-SNP	.											.	SFRP4	66	.	0			c.G246A						.						113.0	91.0	99.0					7																	37955894		2203	4300	6503	SO:0001819	synonymous_variant	6424	exon1			AATGGGCGCGTAC	AF026692	CCDS5453.1	7p14.1	2008-07-18			ENSG00000106483	ENSG00000106483		"""Secreted frizzled-related proteins"""	10778	protein-coding gene	gene with protein product		606570				10211996	Standard	NM_003014		Approved	frpHE, FRP-4, FRPHE	uc003tfo.4	Q6FHJ7	OTTHUMG00000023026	ENST00000436072.2:c.246G>A	chr7.hg19:g.37955894C>T		96.0	0.0		95.0	37.0	NM_003014	B4DYC1|O14877|Q05BG7|Q1ZYW2|Q4G124|Q6FHM0|Q6PD64	Silent	SNP	ENST00000436072.2	hg19	CCDS5453.1																																																																																			.	.		0.622	SFRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220017.2	NM_003014	
PCLO	27445	hgsc.bcm.edu	37	7	82545938	82545938	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:82545938A>T	ENST00000333891.9	-	7	11701	c.11364T>A	c.(11362-11364)gaT>gaA	p.D3788E	PCLO_ENST00000423517.2_Missense_Mutation_p.D3788E|PCLO_ENST00000437081.1_Missense_Mutation_p.D508E	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTTCTTCTTCATCAAGCTCTG	0.438																																					p.D3788E		Atlas-SNP	.											.	PCLO	1506	.	0			c.T11364A						.						144.0	128.0	133.0					7																	82545938		1903	4131	6034	SO:0001583	missense	27445	exon7			TTCTTCATCAAGC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11364T>A	chr7.hg19:g.82545938A>T	ENSP00000334319:p.Asp3788Glu	114.0	0.0		106.0	40.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.483676	0.44147	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.19250	2.17;2.16	5.8	4.66	0.58398	.	.	.	.	.	T	0.36082	0.0954	L	0.41236	1.265	0.51233	D	0.99991	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.991;0.999;0.999	T	0.08680	-1.0710	9	0.87932	D	0	.	11.5677	0.50815	0.9308:0.0:0.0692:0.0	.	3719;3788;3788	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	E	3788;3788;508	ENSP00000334319:D3788E;ENSP00000388393:D3788E	ENSP00000334319:D3788E	D	-	3	2	PCLO	82383874	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.416000	0.66417	1.047000	0.40274	0.460000	0.39030	GAT	.	.		0.438	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
ABCB4	5244	hgsc.bcm.edu	37	7	87047881	87047881	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:87047881A>T	ENST00000265723.4	-	20	2561	c.2450T>A	c.(2449-2451)cTt>cAt	p.L817H	ABCB4_ENST00000359206.3_Missense_Mutation_p.L817H|ABCB4_ENST00000453593.1_Missense_Mutation_p.L817H|ABCB4_ENST00000545634.1_Missense_Mutation_p.L817H|ABCB4_ENST00000358400.3_Missense_Mutation_p.L817H	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	817	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	ATCTGTGGCAAGTCTTGTAGA	0.383																																					p.L817H		Atlas-SNP	.											.	ABCB4	177	.	0			c.T2450A						.						136.0	111.0	119.0					7																	87047881		2203	4300	6503	SO:0001583	missense	5244	exon20			GTGGCAAGTCTTG	M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.2450T>A	chr7.hg19:g.87047881A>T	ENSP00000265723:p.Leu817His	81.0	0.0		103.0	41.0	NM_018850	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	ENST00000265723.4	hg19	CCDS5606.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.492753	0.84962	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13;-3.13	5.58	5.58	0.84498	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97601	0.9214	H	0.97214	3.96	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.99094	1.0841	10	0.87932	D	0	-15.9331	15.7496	0.77972	1.0:0.0:0.0:0.0	.	817;817;817	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	H	817	ENSP00000352135:L817H;ENSP00000351172:L817H;ENSP00000265723:L817H;ENSP00000392983:L817H;ENSP00000437465:L817H	ENSP00000265723:L817H	L	-	2	0	ABCB4	86885817	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.933000	0.87642	2.117000	0.64856	0.528000	0.53228	CTT	.	.		0.383	ABCB4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000336083.1	NM_000443	
RELN	5649	hgsc.bcm.edu	37	7	103185629	103185629	+	Silent	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:103185629T>C	ENST00000428762.1	-	42	6624	c.6465A>G	c.(6463-6465)tcA>tcG	p.S2155S	RELN_ENST00000424685.2_Silent_p.S2155S|RELN_ENST00000343529.5_Silent_p.S2155S	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2155	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGGTTGGACCTGAGTAGCCAG	0.403																																					p.S2155S	NSCLC(146;835 1944 15585 22231 52158)	Atlas-SNP	.											.	RELN	593	.	0			c.A6465G						.						127.0	124.0	125.0					7																	103185629		2203	4300	6503	SO:0001819	synonymous_variant	5649	exon42			TGGACCTGAGTAG		CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6465A>G	chr7.hg19:g.103185629T>C		155.0	0.0		198.0	9.0	NM_173054	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Silent	SNP	ENST00000428762.1	hg19	CCDS47680.1																																																																																			.	.		0.403	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348148.1	NM_005045	
KCND2	3751	hgsc.bcm.edu	37	7	120381672	120381672	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:120381672A>G	ENST00000331113.4	+	3	2328	c.1363A>G	c.(1363-1365)Aat>Gat	p.N455D		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	455					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TTTACTCAGTAATCAGCTGCA	0.363																																					p.N455D		Atlas-SNP	.											.	KCND2	194	.	0			c.A1363G						.						88.0	93.0	91.0					7																	120381672		2203	4300	6503	SO:0001583	missense	3751	exon3			CTCAGTAATCAGC	AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.1363A>G	chr7.hg19:g.120381672A>G	ENSP00000333496:p.Asn455Asp	271.0	0.0		333.0	137.0	NM_012281	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	ENST00000331113.4	hg19	CCDS5776.1	.	.	.	.	.	.	.	.	.	.	A	4.242	0.043940	0.08196	.	.	ENSG00000184408	ENST00000331113	D	0.81739	-1.53	5.11	5.11	0.69529	Potassium channel, voltage dependent, Kv4, C-terminal (1);	0.060294	0.64402	D	0.000005	T	0.50582	0.1624	N	0.01297	-0.9	0.30045	N	0.812238	B	0.02656	0.0	B	0.01281	0.0	T	0.48115	-0.9063	9	.	.	.	.	7.6847	0.28534	0.8408:0.0:0.1592:0.0	.	455	Q9NZV8	KCND2_HUMAN	D	455	ENSP00000333496:N455D	.	N	+	1	0	KCND2	120168908	1.000000	0.71417	0.930000	0.37139	0.992000	0.81027	4.775000	0.62346	1.938000	0.56188	0.528000	0.53228	AAT	.	.		0.363	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346996.1	NM_012281	
SND1	27044	hgsc.bcm.edu	37	7	127729698	127729698	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:127729698G>A	ENST00000354725.3	+	22	2770	c.2576G>A	c.(2575-2577)gGg>gAg	p.G859E		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	859					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						GTGAAGGAAGGGCTGGTCATG	0.592																																					p.G859E		Atlas-SNP	.											.	SND1	104	.	0			c.G2576A						.						147.0	140.0	142.0					7																	127729698		2203	4300	6503	SO:0001583	missense	27044	exon22			AGGAAGGGCTGGT		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2576G>A	chr7.hg19:g.127729698G>A	ENSP00000346762:p.Gly859Glu	116.0	0.0		146.0	73.0	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	hg19	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.767568	0.90020	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	D	0.85484	-1.99	5.02	5.02	0.67125	Staphylococcal nuclease (SNase-like) (2);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.049893	0.85682	N	0.000000	D	0.93556	0.7943	M	0.89904	3.07	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94802	0.7971	10	0.87932	D	0	-18.6366	15.8344	0.78787	0.0:0.0:1.0:0.0	.	859	Q7KZF4	SND1_HUMAN	E	859;849	ENSP00000346762:G859E	ENSP00000346762:G859E	G	+	2	0	SND1	127516934	1.000000	0.71417	0.950000	0.38849	0.990000	0.78478	9.162000	0.94745	2.346000	0.79739	0.549000	0.68633	GGG	.	.		0.592	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
NOM1	64434	hgsc.bcm.edu	37	7	156743034	156743034	+	Silent	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:156743034G>A	ENST00000275820.3	+	1	618	c.603G>A	c.(601-603)aaG>aaA	p.K201K		NM_138400.1	NP_612409.1	Q5C9Z4	NOM1_HUMAN	nucleolar protein with MIF4G domain 1	201	Necessary for nucleolar localization and for targeting PPP1CA to the nucleolus.					nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(4)|large_intestine(9)|lung(7)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	31	Ovarian(565;0.218)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00301)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		GCAAAAAGAAGGACGGCAGCA	0.587																																					p.K201K		Atlas-SNP	.											.	NOM1	73	.	0			c.G603A						.						91.0	103.0	99.0					7																	156743034		2203	4300	6503	SO:0001819	synonymous_variant	64434	exon1			AAAGAAGGACGGC	AF107455	CCDS34787.1	7q36.3	2014-06-13	2005-03-30	2005-03-30	ENSG00000146909	ENSG00000146909			13244	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 113"""	611269	"""chromosome 7 open reading frame 3"""	C7orf3		10329000	Standard	XM_005249560		Approved	SGD1, PPP1R113	uc003wmy.3	Q5C9Z4	OTTHUMG00000152639	ENST00000275820.3:c.603G>A	chr7.hg19:g.156743034G>A		144.0	0.0		128.0	60.0	NM_138400	Q96I08	Silent	SNP	ENST00000275820.3	hg19	CCDS34787.1																																																																																			.	.		0.587	NOM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327098.1	NM_138400	
LOXL2	4017	hgsc.bcm.edu	37	8	23217767	23217767	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr8:23217767A>C	ENST00000389131.3	-	3	736	c.367T>G	c.(367-369)Tta>Gta	p.L123V	RP11-177H13.2_ENST00000519692.1_RNA	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	123	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		AGATTGTCTAACCAGATGGGC	0.567																																					p.L123V		Atlas-SNP	.											.	LOXL2	97	.	0			c.T367G						.						52.0	40.0	44.0					8																	23217767		2203	4300	6503	SO:0001583	missense	4017	exon3			TGTCTAACCAGAT	U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.367T>G	chr8.hg19:g.23217767A>C	ENSP00000373783:p.Leu123Val	86.0	0.0		31.0	14.0	NM_002318	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	ENST00000389131.3	hg19	CCDS34864.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.171023	0.78452	.	.	ENSG00000134013	ENST00000389131;ENST00000524144;ENST00000520871;ENST00000518083;ENST00000524168	T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;1.17;1.17	5.53	-4.55	0.03441	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.225756	0.45126	D	0.000384	T	0.71022	0.3291	M	0.85099	2.735	0.43439	D	0.995612	D	0.58970	0.984	P	0.61874	0.895	T	0.72246	-0.4349	10	0.87932	D	0	.	6.9493	0.24536	0.3951:0.0:0.4516:0.1532	.	123	Q9Y4K0	LOXL2_HUMAN	V	123;204;164;123;123	ENSP00000373783:L123V;ENSP00000427883:L204V;ENSP00000429778:L164V;ENSP00000430519:L123V;ENSP00000428497:L123V	ENSP00000373783:L123V	L	-	1	2	LOXL2	23273712	0.007000	0.16637	0.991000	0.47740	0.947000	0.59692	-1.028000	0.03589	-0.381000	0.07882	-0.256000	0.11100	TTA	.	.		0.567	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375603.1		
PLAT	5327	hgsc.bcm.edu	37	8	42037780	42037780	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr8:42037780T>C	ENST00000220809.4	-	11	1458	c.1202A>G	c.(1201-1203)gAc>gGc	p.D401G	PLAT_ENST00000429089.2_Missense_Mutation_p.D401G|PLAT_ENST00000429710.2_Missense_Mutation_p.D275G|PLAT_ENST00000270189.6_Intron|PLAT_ENST00000352041.3_Missense_Mutation_p.D355G|PLAT_ENST00000524009.1_Missense_Mutation_p.D312G|PLAT_ENST00000519510.1_Missense_Mutation_p.D338G	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	401	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	GTCGTAAGTGTCATCATCGAA	0.473																																					p.D401G		Atlas-SNP	.											.	PLAT	62	.	0			c.A1202G						.						170.0	171.0	171.0					8																	42037780		2203	4300	6503	SO:0001583	missense	5327	exon11			TAAGTGTCATCAT		CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.1202A>G	chr8.hg19:g.42037780T>C	ENSP00000220809:p.Asp401Gly	81.0	0.0		95.0	41.0	NM_000930	A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	ENST00000220809.4	hg19	CCDS6126.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.562750	0.27915	.	.	ENSG00000104368	ENST00000429089;ENST00000220809;ENST00000352041;ENST00000519510;ENST00000429710;ENST00000524009	D;D;D;D;D;D	0.89123	-2.47;-2.47;-2.47;-2.47;-2.47;-2.47	5.39	2.78	0.32641	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.343467	0.37178	N	0.002210	T	0.80994	0.4731	L	0.29908	0.895	0.80722	D	1	B;B;B;B;B;B	0.11235	0.004;0.004;0.002;0.002;0.002;0.001	B;B;B;B;B;B	0.17979	0.02;0.02;0.017;0.014;0.008;0.011	T	0.75139	-0.3423	10	0.51188	T	0.08	.	8.3543	0.32321	0.0:0.0696:0.2237:0.7067	.	275;312;338;401;355;401	B4DNJ1;B4DN26;B4DV92;B8ZX62;P00750-3;P00750	.;.;.;.;.;TPA_HUMAN	G	401;401;355;338;275;312	ENSP00000392045:D401G;ENSP00000220809:D401G;ENSP00000270188:D355G;ENSP00000428886:D338G;ENSP00000407861:D275G;ENSP00000429401:D312G	ENSP00000220809:D401G	D	-	2	0	PLAT	42156937	1.000000	0.71417	0.168000	0.22838	0.482000	0.33219	3.754000	0.55189	0.952000	0.37798	0.533000	0.62120	GAC	.	.		0.473	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377100.1	NM_000930	
TRPA1	8989	hgsc.bcm.edu	37	8	72958795	72958795	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr8:72958795T>G	ENST00000262209.4	-	17	2221	c.2014A>C	c.(2014-2016)Aaa>Caa	p.K672Q	RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000524152.1_Intron	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	672					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GTAGGTGTTTTTTTGGTGAAT	0.274																																					p.K672Q		Atlas-SNP	.											.	TRPA1	256	.	0			c.A2014C						.						138.0	153.0	148.0					8																	72958795		2203	4299	6502	SO:0001583	missense	8989	exon17			GTGTTTTTTTGGT	Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2014A>C	chr8.hg19:g.72958795T>G	ENSP00000262209:p.Lys672Gln	62.0	0.0		61.0	30.0	NM_007332	A6NIN6	Missense_Mutation	SNP	ENST00000262209.4	hg19	CCDS34908.1	.	.	.	.	.	.	.	.	.	.	T	5.274	0.235932	0.10023	.	.	ENSG00000104321	ENST00000523582;ENST00000262209	T;T	0.79033	-1.23;-1.23	4.89	3.72	0.42706	.	0.658545	0.15998	N	0.234499	T	0.68531	0.3011	L	0.57536	1.79	0.21841	N	0.999511	B	0.26975	0.165	B	0.24701	0.055	T	0.53099	-0.8486	10	0.16420	T	0.52	-14.2475	6.2149	0.20649	0.0:0.0838:0.1607:0.7555	.	672	O75762	TRPA1_HUMAN	Q	524;672	ENSP00000428151:K524Q;ENSP00000262209:K672Q	ENSP00000262209:K672Q	K	-	1	0	TRPA1	73121349	0.546000	0.26457	0.111000	0.21465	0.033000	0.12548	0.393000	0.20817	0.803000	0.34113	0.454000	0.30748	AAA	.	.		0.274	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379079.2	NM_007332	
KCNQ3	3786	hgsc.bcm.edu	37	8	133492604	133492604	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr8:133492604G>T	ENST00000388996.4	-	1	596	c.176C>A	c.(175-177)gCc>gAc	p.A59D	KCNQ3_ENST00000519445.1_Missense_Mutation_p.A59D	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	59					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GTCGGCTCCGGCCCCGAGCGC	0.761																																					p.A59D		Atlas-SNP	.											.	KCNQ3	164	.	0			c.C176A						.						9.0	11.0	11.0					8																	133492604		2164	4191	6355	SO:0001583	missense	3786	exon1			GCTCCGGCCCCGA	AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.176C>A	chr8.hg19:g.133492604G>T	ENSP00000373648:p.Ala59Asp	326.0	1.0		353.0	131.0	NM_004519	A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	ENST00000388996.4	hg19	CCDS34943.1	.	.	.	.	.	.	.	.	.	.	G	11.47	1.647114	0.29246	.	.	ENSG00000184156	ENST00000388996;ENST00000519445;ENST00000542679	D;D	0.99167	-5.49;-5.51	4.1	4.1	0.47936	.	0.490062	0.15630	N	0.252412	D	0.96125	0.8737	N	0.14661	0.345	0.29963	N	0.819181	B;B	0.26400	0.148;0.148	B;B	0.19946	0.027;0.027	D	0.94511	0.7718	10	0.52906	T	0.07	-3.6727	15.0561	0.71915	0.0:0.0:1.0:0.0	.	59;59	E7ET42;O43525	.;KCNQ3_HUMAN	D	59;59;48	ENSP00000373648:A59D;ENSP00000428790:A59D	ENSP00000373648:A59D	A	-	2	0	KCNQ3	133561786	1.000000	0.71417	0.546000	0.28166	0.135000	0.20990	3.603000	0.54074	2.113000	0.64589	0.557000	0.71058	GCC	.	.		0.761	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268621.2	NM_004519	
MFSD3	113655	hgsc.bcm.edu	37	8	145737311	145737311	+	IGR	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr8:145737311C>T	ENST00000301327.4	+	0	1548				CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000428558.2_Missense_Mutation_p.E1126K|RECQL4_ENST00000532237.1_5'UTR	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			TGCCCTGGCTCGGGGCCCTGT	0.657																																					p.E1126K		Atlas-SNP	.											.	RECQL4	75	.	0			c.G3376A						.						25.0	28.0	27.0					8																	145737311		2149	4250	6399	SO:0001628	intergenic_variant	9401	exon20			CTGGCTCGGGGCC		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		chr8.hg19:g.145737311C>T		55.0	0.0		87.0	11.0	NM_004260		Missense_Mutation	SNP	ENST00000301327.4	hg19	CCDS6431.1																																																																																			.	.		0.657	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
CDKN2A	1029	hgsc.bcm.edu	37	9	21971036	21971036	+	Missense_Mutation	SNP	C	C	A	rs121913381		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr9:21971036C>A	ENST00000304494.5	-	2	592	c.322G>T	c.(322-324)Gat>Tat	p.D108Y	CDKN2A_ENST00000579122.1_Missense_Mutation_p.D108Y|CDKN2A_ENST00000579755.1_Missense_Mutation_p.R122L|CDKN2A_ENST00000498628.2_Missense_Mutation_p.D57Y|CDKN2A_ENST00000578845.2_Missense_Mutation_p.D57Y|CDKN2A_ENST00000479692.2_Missense_Mutation_p.D57Y|CDKN2A_ENST00000498124.1_Missense_Mutation_p.D108Y|CDKN2A_ENST00000494262.1_Missense_Mutation_p.D57Y|CDKN2A_ENST00000530628.2_Missense_Mutation_p.R122L|CDKN2A_ENST00000446177.1_Missense_Mutation_p.D108Y|CDKN2A_ENST00000361570.3_Missense_Mutation_p.R163L|CDKN2A_ENST00000497750.1_Missense_Mutation_p.D57Y|RP11-145E5.5_ENST00000404796.2_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	108			D -> H (in a bladder tumor).|D -> Y (in a head and neck tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.D108Y(18)|p.D108N(7)|p.D108H(7)|p.R163L(3)|p.H83fs*2(2)|p.D105fs*8(1)|p.0(1)|p.R163Q(1)|p.A68fs*3(1)|p.R107fs*33(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCCCAGGCATCGCGCACGTCC	0.741		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.R122L		Atlas-SNP	.											CDKN2A_ENST00000498124,bladder,carcinoma,0,3	CDKN2A	4810	.	1401	Whole gene deletion(1316)|Unknown(44)|Substitution - Missense(36)|Deletion - Frameshift(5)	haematopoietic_and_lymphoid_tissue(283)|skin(174)|central_nervous_system(167)|lung(160)|urinary_tract(97)|bone(74)|upper_aerodigestive_tract(62)|soft_tissue(57)|pleura(51)|oesophagus(51)|ovary(36)|kidney(32)|pancreas(32)|breast(32)|thyroid(14)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(9)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.G365T	GRCh37	CM071585|CM973278	CDKN2A	M	rs121913381	.						16.0	19.0	18.0					9																	21971036		2198	4292	6490	SO:0001583	missense	1029	exon2			AGGCATCGCGCAC	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.322G>T	chr9.hg19:g.21971036C>A	ENSP00000307101:p.Asp108Tyr	120.0	0.0		133.0	54.0	NM_058195	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	hg19	CCDS6510.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.308521|4.308521	0.81247|0.81247	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000304494;ENST00000446177|ENST00000361570;ENST00000530628	D;D|T;T	0.94232|0.79845	-3.38;-3.38|-1.31;-1.25	5.93|5.93	5.93|5.93	0.95920|0.95920	Ankyrin repeat-containing domain (4);|.	.|0.000000	.|0.30428	.|N	.|0.009646	D|D	0.84678|0.84678	0.5525|0.5525	L|L	0.29908|0.29908	0.895|0.895	0.47308|0.47308	D|D	0.999383|0.999383	D|D	0.89917|0.89917	1.0|1.0	D|D	0.97110|0.67548	1.0|0.952	D|D	0.85416|0.85416	0.1140|0.1140	9|10	0.87932|0.62326	D|D	0|0.03	-14.8146|-14.8146	19.1221|19.1221	0.93367|0.93367	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	108|163	P42771|Q8N726	CD2A1_HUMAN|CD2A2_HUMAN	Y|L	108|163;122	ENSP00000307101:D108Y;ENSP00000394932:D108Y|ENSP00000355153:R163L;ENSP00000432664:R122L	ENSP00000307101:D108Y|ENSP00000355153:R163L	D|R	-|-	1|2	0|0	CDKN2A|CDKN2A	21961036|21961036	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.627000|0.627000	0.37826|0.37826	5.136000|5.136000	0.64783|0.64783	2.808000|2.808000	0.96608|0.96608	0.655000|0.655000	0.94253|0.94253	GAT|CGA	.	.		0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
AQP3	360	hgsc.bcm.edu	37	9	33442436	33442436	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr9:33442436C>T	ENST00000297991.4	-	5	653	c.573G>A	c.(571-573)gaG>gaA	p.E191E	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	191					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		CGGTGAAGGCCTCCAGGCCTC	0.627																																					p.E191E		Atlas-SNP	.											.	AQP3	18	.	0			c.G573A						.						37.0	44.0	41.0					9																	33442436		2203	4300	6503	SO:0001819	synonymous_variant	360	exon5			GAAGGCCTCCAGG		CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.573G>A	chr9.hg19:g.33442436C>T		226.0	0.0		197.0	70.0	NM_004925	A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Silent	SNP	ENST00000297991.4	hg19	CCDS6542.1																																																																																			.	.		0.627	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052055.1	NM_004925	
SLC46A2	57864	hgsc.bcm.edu	37	9	115652684	115652684	+	Missense_Mutation	SNP	G	G	C	rs376774946		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr9:115652684G>C	ENST00000374228.4	-	1	509	c.278C>G	c.(277-279)gCc>gGc	p.A93G		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	93					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						CAGCCCGTAGGCGGACAGCAG	0.617																																					p.A93G		Atlas-SNP	.											.	SLC46A2	30	.	0			c.C278G						.						91.0	93.0	92.0					9																	115652684		2203	4300	6503	SO:0001583	missense	57864	exon1			CCGTAGGCGGACA	AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.278C>G	chr9.hg19:g.115652684G>C	ENSP00000363345:p.Ala93Gly	132.0	0.0		151.0	62.0	NM_033051	B1ALK1|Q86VT0|Q96NE2	Missense_Mutation	SNP	ENST00000374228.4	hg19	CCDS6786.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285827	0.80803	.	.	ENSG00000119457	ENST00000374228	T	0.58797	0.31	5.56	5.56	0.83823	Major facilitator superfamily domain, general substrate transporter (1);	0.157498	0.56097	D	0.000028	T	0.72938	0.3523	L	0.59436	1.845	0.58432	D	0.999998	D	0.71674	0.998	D	0.72982	0.979	T	0.68550	-0.5379	10	0.31617	T	0.26	-25.0855	19.1663	0.93559	0.0:0.0:1.0:0.0	.	93	Q9BY10	TSCOT_HUMAN	G	93	ENSP00000363345:A93G	ENSP00000363345:A93G	A	-	2	0	SLC46A2	114692505	1.000000	0.71417	0.938000	0.37757	0.964000	0.63967	7.771000	0.85420	2.623000	0.88846	0.650000	0.86243	GCC	.	.		0.617	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053702.1	NM_033051	
EHMT1	79813	hgsc.bcm.edu	37	9	140671290	140671290	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr9:140671290C>T	ENST00000460843.1	+	12	2039	c.2012C>T	c.(2011-2013)aCg>aTg	p.T671M	EHMT1_ENST00000462484.1_Missense_Mutation_p.T671M|EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000334856.6_Missense_Mutation_p.T640M	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	671					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GACACCACAACGGGCAGGTAC	0.572																																					p.T671M		Atlas-SNP	.											.	EHMT1	196	.	0			c.C2012T						.						43.0	40.0	41.0					9																	140671290		2203	4300	6503	SO:0001583	missense	79813	exon12			CCACAACGGGCAG	AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.2012C>T	chr9.hg19:g.140671290C>T	ENSP00000417980:p.Thr671Met	127.0	0.0		118.0	9.0	NM_001145527	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	ENST00000460843.1	hg19	CCDS7050.2	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588333	0.86851	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;T	0.71817	1.44;0.67;-0.6	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	D	0.82949	0.5148	M	0.69823	2.125	0.58432	D	0.999999	P;D;D	0.76494	0.607;0.998;0.999	B;P;D	0.66084	0.107;0.849;0.941	D	0.83742	0.0204	10	0.52906	T	0.07	.	18.6174	0.91308	0.0:1.0:0.0:0.0	.	671;640;671	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	M	640;640;671;671	ENSP00000334476:T640M;ENSP00000417328:T671M;ENSP00000417980:T671M	ENSP00000334476:T640M	T	+	2	0	EHMT1	139791111	1.000000	0.71417	0.982000	0.44146	0.959000	0.62525	7.578000	0.82498	2.477000	0.83638	0.561000	0.74099	ACG	.	.		0.572	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055371.2	NM_024757	
EXOC6	54536	hgsc.bcm.edu	37	10	94669328	94669328	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr10:94669328A>C	ENST00000260762.6	+	6	617	c.603A>C	c.(601-603)aaA>aaC	p.K201N	EXOC6_ENST00000443748.2_Missense_Mutation_p.K201N|EXOC6_ENST00000371547.4_Missense_Mutation_p.K217N|EXOC6_ENST00000497262.1_3'UTR|EXOC6_ENST00000371552.4_Missense_Mutation_p.K196N	NM_019053.4	NP_061926.3	Q8TAG9	EXOC6_HUMAN	exocyst complex component 6	201					cellular protein metabolic process (GO:0044267)|erythrocyte differentiation (GO:0030218)|membrane organization (GO:0061024)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)|plasma membrane (GO:0005886)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	26		Colorectal(252;0.123)				CTGATCTCAAAGACTTTTTGG	0.323																																					p.K201N		Atlas-SNP	.											.	EXOC6	147	.	0			c.A603C						.						73.0	73.0	73.0					10																	94669328		2203	4300	6503	SO:0001583	missense	54536	exon6			TCTCAAAGACTTT	BC028395	CCDS7424.2, CCDS31247.1	10q23.33	2013-01-22	2006-11-07	2006-11-07	ENSG00000138190	ENSG00000138190			23196	protein-coding gene	gene with protein product		609672	"""SEC15-like 1 (S. cerevisiae)"""	SEC15L1		8889548	Standard	NM_001013848		Approved	SEC15L, FLJ1125, DKFZp761I2124, MGC33397, Sec15p, EXOC6A	uc001kig.3	Q8TAG9	OTTHUMG00000018767	ENST00000260762.6:c.603A>C	chr10.hg19:g.94669328A>C	ENSP00000260762:p.Lys201Asn	235.0	0.0		237.0	91.0	NM_019053	E9PHI3|Q5VXH8|Q9NZ24	Missense_Mutation	SNP	ENST00000260762.6	hg19	CCDS7424.2	.	.	.	.	.	.	.	.	.	.	A	15.67	2.903345	0.52333	.	.	ENSG00000138190	ENST00000371547;ENST00000371552;ENST00000443748;ENST00000260762	T;T;T;T	0.29655	1.56;1.56;1.56;1.56	5.69	2.17	0.27698	.	0.000000	0.85682	D	0.000000	T	0.32406	0.0828	M	0.82056	2.57	0.30859	N	0.733747	B;B;B;B;B	0.32071	0.149;0.355;0.128;0.031;0.031	B;B;B;B;B	0.32393	0.145;0.057;0.06;0.017;0.028	T	0.34576	-0.9823	10	0.54805	T	0.06	-20.5353	6.8684	0.24106	0.5099:0.0:0.4901:0.0	.	217;201;193;201;196	F2Z2Q3;E7EW84;B4DEZ1;Q8TAG9;E9PHI3	.;.;.;EXOC6_HUMAN;.	N	217;196;201;201	ENSP00000360602:K217N;ENSP00000360607:K196N;ENSP00000396206:K201N;ENSP00000260762:K201N	ENSP00000260762:K201N	K	+	3	2	EXOC6	94659308	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.552000	0.36244	0.451000	0.26802	0.528000	0.53228	AAA	.	.		0.323	EXOC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049410.2	NM_019053	
CYP2C9	1559	hgsc.bcm.edu	37	10	96745877	96745877	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr10:96745877C>A	ENST00000260682.6	+	8	1249	c.1237C>A	c.(1237-1239)Ctg>Atg	p.L413M		NM_000771.3	NP_000762.2	P11712	CP2C9_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 9	413			L -> P (in dbSNP:rs28371687). {ECO:0000269|PubMed:15469410}.		arachidonic acid metabolic process (GO:0019369)|cellular amide metabolic process (GO:0043603)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|urea metabolic process (GO:0019627)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	(R)-limonene 6-monooxygenase activity (GO:0052741)|(S)-limonene 6-monooxygenase activity (GO:0018675)|(S)-limonene 7-monooxygenase activity (GO:0018676)|caffeine oxidase activity (GO:0034875)|drug binding (GO:0008144)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|steroid hydroxylase activity (GO:0008395)			breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	34		Colorectal(252;0.0902)		all cancers(201;6.93e-05)	Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Agomelatine(DB06594)|Alosetron(DB00969)|Alprazolam(DB00404)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Arformoterol(DB01274)|Artemether(DB06697)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Atovaquone(DB01117)|Azelastine(DB00972)|Bexarotene(DB00307)|Bicalutamide(DB01128)|Bortezomib(DB00188)|Bosentan(DB00559)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabozantinib(DB08875)|Caffeine(DB00201)|Candesartan(DB00796)|Capecitabine(DB01101)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Celecoxib(DB00482)|Chloramphenicol(DB00446)|Chlorpropamide(DB00672)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Clevidipine(DB04920)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclizine(DB01176)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapagliflozin(DB06292)|Dapsone(DB00250)|Delavirdine(DB00705)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diclofenamide(DB01144)|Dicoumarol(DB00266)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disulfiram(DB00822)|Dolasetron(DB00757)|Donepezil(DB00843)|Dopamine(DB00988)|Dorzolamide(DB00869)|Doxepin(DB01142)|Dronabinol(DB00470)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enzalutamide(DB08899)|Epinephrine(DB00668)|Epoprostenol(DB01240)|Eprosartan(DB00876)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Eszopiclone(DB00402)|Ethanol(DB00898)|Etodolac(DB00749)|Etoricoxib(DB01628)|Etravirine(DB06414)|Felodipine(DB01023)|Fenofibrate(DB01039)|Flecainide(DB01195)|Fluconazole(DB00196)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Glyburide(DB01016)|Guanfacine(DB01018)|Haloperidol(DB00502)|Halothane(DB01159)|Hexobarbital(DB01355)|Histamine Phosphate(DB00667)|Human Serum Albumin(DB00062)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indinavir(DB00224)|Indomethacin(DB00328)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Lidocaine(DB00281)|Lopinavir(DB01601)|Loratadine(DB00455)|Lornoxicam(DB06725)|Losartan(DB00678)|Lovastatin(DB00227)|Lumiracoxib(DB01283)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Melatonin(DB01065)|Meloxicam(DB00814)|Mestranol(DB01357)|Methadone(DB00333)|Methazolamide(DB00703)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Metronidazole(DB00916)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Montelukast(DB00471)|Naproxen(DB00788)|Nateglinide(DB00731)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Ospemifene(DB04938)|Oxaprozin(DB00991)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paramethadione(DB00617)|Paroxetine(DB00715)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phentermine(DB00191)|Phenylbutazone(DB00812)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Prasugrel(DB06209)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Promethazine(DB01069)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quazepam(DB01589)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sitaxentan(DB06268)|Sorafenib(DB00398)|Sulfadiazine(DB00359)|Sulfadimethoxine(DB06150)|Sulfamethizole(DB00576)|Sulfamethoxazole(DB01015)|Sulfamoxole(DB08798)|Sulfanilamide(DB00259)|Sulfaphenazole(DB06729)|Sulfapyridine(DB00891)|Sulfinpyrazone(DB01138)|Sulfisoxazole(DB00263)|Suprofen(DB00870)|Tamoxifen(DB00675)|Tapentadol(DB06204)|Temazepam(DB00231)|Teniposide(DB00444)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiamylal(DB01154)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Tolcapone(DB00323)|Tolterodine(DB01036)|Torasemide(DB00214)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Treprostinil(DB00374)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Valsartan(DB00177)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vismodegib(DB08828)|Voriconazole(DB00582)|Warfarin(DB00682)|Ximelagatran(DB04898)|Zafirlukast(DB00549)|Zalcitabine(DB00943)|Zidovudine(DB00495)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TCATCACTTTCTGGATGAAGG	0.368																																					p.L413M	Ovarian(54;1266 1406 16072 35076)	Atlas-SNP	.											.	CYP2C9	82	.	0			c.C1237A						.						120.0	117.0	118.0					10																	96745877		2203	4300	6503	SO:0001583	missense	1559	exon8			CACTTTCTGGATG	M61855	CCDS7437.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138109	ENSG00000138109		"""Cytochrome P450s"""	2623	protein-coding gene	gene with protein product		601130	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 9"""	CYP2C10		2009263, 7841444	Standard	NM_000771		Approved	P450IIC9	uc001kka.4	P11712	OTTHUMG00000018805	ENST00000260682.6:c.1237C>A	chr10.hg19:g.96745877C>A	ENSP00000260682:p.Leu413Met	121.0	0.0		138.0	50.0	NM_000771	P11713|Q16756|Q16872|Q5VX92|Q6IRV8|Q8WW80	Missense_Mutation	SNP	ENST00000260682.6	hg19	CCDS7437.1	.	.	.	.	.	.	.	.	.	.	.	12.84	2.059761	0.36373	.	.	ENSG00000138109	ENST00000545448;ENST00000260682	T	0.74106	-0.81	3.57	2.63	0.31362	.	0.000000	0.53938	U	0.000057	D	0.86397	0.5923	M	0.93062	3.375	0.30354	N	0.784481	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82172	-0.0589	10	0.87932	D	0	.	6.1827	0.20480	0.0:0.7582:0.0:0.2418	.	413;413	Q5VX92;P11712	.;CP2C9_HUMAN	M	413	ENSP00000260682:L413M	ENSP00000260682:L413M	L	+	1	2	CYP2C9	96735867	0.999000	0.42202	0.945000	0.38365	0.384000	0.30261	1.294000	0.33365	0.813000	0.34350	0.446000	0.29264	CTG	.	.		0.368	CYP2C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049501.1	NM_000771	
COX15	1355	hgsc.bcm.edu	37	10	101476153	101476153	+	Silent	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr10:101476153T>C	ENST00000016171.5	-	8	1103	c.1053A>G	c.(1051-1053)agA>agG	p.R351R	CUTC_ENST00000493385.1_Intron|COX15_ENST00000497381.1_5'UTR|COX15_ENST00000370483.5_Silent_p.R351R			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)	351					cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		TCTTGGTCCTTCTAGGAAGGG	0.438																																					p.R351R		Atlas-SNP	.											.	COX15	25	.	0			c.A1053G						.						132.0	133.0	133.0					10																	101476153		2203	4300	6503	SO:0001819	synonymous_variant	1355	exon8			GGTCCTTCTAGGA	AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893	ENST00000016171.5:c.1053A>G	chr10.hg19:g.101476153T>C		90.0	0.0		86.0	29.0	NM_078470	A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Silent	SNP	ENST00000016171.5	hg19	CCDS7482.1																																																																																			.	.		0.438	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049818.1	NP_510870	
ADRA2A	150	hgsc.bcm.edu	37	10	112838915	112838915	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr10:112838915C>T	ENST00000280155.2	+	1	2126	c.1161C>T	c.(1159-1161)ttC>ttT	p.F387F		NM_000681.3	NP_000672.3	P08913	ADA2A_HUMAN	adrenoceptor alpha 2A	372					actin cytoskeleton organization (GO:0030036)|activation of MAPK activity by adrenergic receptor signaling pathway (GO:0071883)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|acute inflammatory response (GO:0002526)|adenylate cyclase-inhibiting adrenergic receptor signaling pathway (GO:0071881)|blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|DNA replication (GO:0006260)|energy reserve metabolic process (GO:0006112)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|fear response (GO:0042596)|female pregnancy (GO:0007565)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|intestinal absorption (GO:0050892)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of adrenergic receptor signaling pathway (GO:0071878)|negative regulation of calcium ion transmembrane transporter activity (GO:1901020)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of insulin secretion (GO:0046676)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of norepinephrine secretion (GO:0010700)|negative regulation of uterine smooth muscle contraction (GO:0070473)|phospholipase C-activating adrenergic receptor signaling pathway (GO:0071882)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of vasodilation (GO:0045909)|positive regulation of wound healing (GO:0090303)|Ras protein signal transduction (GO:0007265)|regulation of insulin secretion (GO:0050796)|regulation of vasoconstriction (GO:0019229)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|thermoception (GO:0050955)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	alpha-1B adrenergic receptor binding (GO:0031692)|alpha-2C adrenergic receptor binding (GO:0031696)|alpha2-adrenergic receptor activity (GO:0004938)|epinephrine binding (GO:0051379)|heterotrimeric G-protein binding (GO:0032795)|norepinephrine binding (GO:0051380)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|thioesterase binding (GO:0031996)			breast(1)|cervix(3)|endometrium(6)|large_intestine(3)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(234;0.0735)|Lung NSC(174;0.238)		Epithelial(162;0.000316)|all cancers(201;0.00501)|BRCA - Breast invasive adenocarcinoma(275;0.118)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Apraclonidine(DB00964)|Aripiprazole(DB01238)|Asenapine(DB06216)|Benzphetamine(DB00865)|Bethanidine(DB00217)|Brimonidine(DB00484)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Clozapine(DB00363)|Desipramine(DB01151)|Dexmedetomidine(DB00633)|Dihydroergotamine(DB00320)|Dipivefrin(DB00449)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinastine(DB00751)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Flupirtine(DB06623)|Guanabenz(DB00629)|Guanfacine(DB01018)|Lisuride(DB00589)|Lofexidine(DB04948)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methamphetamine(DB01577)|Methotrimeprazine(DB01403)|Methyldopa(DB00968)|Mianserin(DB06148)|Mirtazapine(DB00370)|Naphazoline(DB06711)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxymetazoline(DB00935)|Paliperidone(DB01267)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phentolamine(DB00692)|Phenylpropanolamine(DB00397)|Pramipexole(DB00413)|Prazosin(DB00457)|Propericiazine(DB01608)|Pseudoephedrine(DB00852)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Tizanidine(DB00697)|Tolazoline(DB00797)|Trazodone(DB00656)|Trimipramine(DB00726)|Xylometazoline(DB06694)|Yohimbine(DB01392)|Ziprasidone(DB00246)	AGAAGCGCTTCACGTTCGTGC	0.706																																					p.F387F	Esophageal Squamous(173;605 2658 7278 49362)	Atlas-SNP	.											.	ADRA2A	38	.	0			c.C1161T						.						110.0	89.0	96.0					10																	112838915		2203	4300	6503	SO:0001819	synonymous_variant	150	exon1			GCGCTTCACGTTC	AF284095	CCDS7569.2	10q25.2	2012-08-08	2012-05-09		ENSG00000150594	ENSG00000150594		"""GPCR / Class A : Adrenoceptors : alpha"""	281	protein-coding gene	gene with protein product	"""alpha-2AAR subtype C10"", "" alpha-2A-adrenergic receptor"""	104210	"""adrenergic, alpha-2A-, receptor"""	ADRA2, ADRA2R			Standard	NM_000681		Approved	ADRAR	uc001kzo.3	P08913	OTTHUMG00000019050	ENST00000280155.2:c.1161C>T	chr10.hg19:g.112838915C>T		48.0	0.0		38.0	12.0	NM_000681	B0LPF6|Q2I8G2|Q2XN99|Q86TH8|Q9BZK1	Silent	SNP	ENST00000280155.2	hg19	CCDS7569.2																																																																																			.	.		0.706	ADRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050372.2	NM_000681	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33565296	33565296	+	Silent	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:33565296T>A	ENST00000321505.4	+	1	1476	c.1296T>A	c.(1294-1296)atT>atA	p.I432I	KIAA1549L_ENST00000265654.5_Silent_p.I432I|KIAA1549L_ENST00000389726.3_Silent_p.I432I			Q6ZVL6	K154L_HUMAN	KIAA1549-like	432						integral component of membrane (GO:0016021)											GACACACAATTAGCACCACAA	0.403											OREG0020868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I432I		Atlas-SNP	.											.	.	.	.	0			c.T1296A						.						91.0	88.0	89.0					11																	33565296		1869	4096	5965	SO:0001819	synonymous_variant	25758	exon1			CACAATTAGCACC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.1296T>A	chr11.hg19:g.33565296T>A		88.0	0.0	841	81.0	28.0	NM_012194	B0QYU0	Silent	SNP	ENST00000321505.4	hg19	CCDS44565.2																																																																																			.	.		0.403	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
AMBRA1	55626	hgsc.bcm.edu	37	11	46567302	46567302	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:46567302C>A	ENST00000458649.2	-	5	821	c.403G>T	c.(403-405)Gat>Tat	p.D135Y	AMBRA1_ENST00000426438.1_Missense_Mutation_p.D135Y|AMBRA1_ENST00000314845.3_Missense_Mutation_p.D135Y|AMBRA1_ENST00000533727.1_Missense_Mutation_p.D135Y|AMBRA1_ENST00000528950.1_Missense_Mutation_p.D135Y|AMBRA1_ENST00000298834.3_Missense_Mutation_p.D135Y|AMBRA1_ENST00000534300.1_Missense_Mutation_p.D135Y			Q9C0C7	AMRA1_HUMAN	autophagy/beclin-1 regulator 1	135					autophagy (GO:0006914)|cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron apoptotic process (GO:0043524)|neural tube development (GO:0021915)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|phagocytic vesicle (GO:0045335)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	39				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		TTGTTGCTATCTGTGAACCAG	0.507																																					p.D135Y		Atlas-SNP	.											.	AMBRA1	201	.	0			c.G403T						.						90.0	78.0	82.0					11																	46567302		2201	4299	6500	SO:0001583	missense	55626	exon5			TGCTATCTGTGAA	AB051523	CCDS31475.1, CCDS58132.1, CCDS73281.1	11p11.2	2013-01-09			ENSG00000110497	ENSG00000110497		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	25990	protein-coding gene	gene with protein product	"""WD repeat domain 94"", ""DDB1 and CUL4 associated factor 3"""	611359				17622796, 17603510, 17589504	Standard	NM_001267782		Approved	FLJ20294, KIAA1736, WDR94, DCAF3	uc001ncv.3	Q9C0C7	OTTHUMG00000166500	ENST00000458649.2:c.403G>T	chr11.hg19:g.46567302C>A	ENSP00000415327:p.Asp135Tyr	105.0	0.0		133.0	54.0	NM_001267783	A6XN33|D3DQP8|G3V193|Q86XD6|Q9H8Z0|Q9NXE7	Missense_Mutation	SNP	ENST00000458649.2	hg19		.	.	.	.	.	.	.	.	.	.	C	22.1	4.240509	0.79912	.	.	ENSG00000110497	ENST00000314845;ENST00000533727;ENST00000534300;ENST00000426438;ENST00000298834;ENST00000314823;ENST00000458649;ENST00000528950	T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.75	5.75	0.90469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.045696	0.85682	D	0.000000	T	0.39860	0.1094	N	0.14661	0.345	0.80722	D	1	D;D;D;D;D;D	0.71674	0.996;0.998;0.998;0.994;0.998;0.994	P;D;D;P;D;P	0.63381	0.823;0.914;0.914;0.878;0.914;0.878	T	0.42682	-0.9437	10	0.87932	D	0	.	19.9478	0.97189	0.0:1.0:0.0:0.0	.	135;135;135;135;135;135	Q9C0C7;Q9C0C7-3;Q9C0C7-2;G3V193;Q9C0C7-5;Q9C0C7-4	AMRA1_HUMAN;.;.;.;.;.	Y	135	ENSP00000318313:D135Y;ENSP00000433372:D135Y;ENSP00000431926:D135Y;ENSP00000410899:D135Y;ENSP00000298834:D135Y;ENSP00000415327:D135Y;ENSP00000433945:D135Y	ENSP00000298834:D135Y	D	-	1	0	AMBRA1	46523878	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.696000	0.84270	2.712000	0.92718	0.591000	0.81541	GAT	.	.		0.507	AMBRA1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000390103.1	NM_017749	
OR5L1	219437	hgsc.bcm.edu	37	11	55579061	55579061	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:55579061T>A	ENST00000333973.2	+	1	208	c.119T>A	c.(118-120)tTa>tAa	p.L40*		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	40						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				GTCACGTTGTTAGCCAACCTG	0.502																																					p.L40X		Atlas-SNP	.											.	OR5L1	145	.	0			c.T119A						.						313.0	275.0	288.0					11																	55579061		2200	4296	6496	SO:0001587	stop_gained	219437	exon1			CGTTGTTAGCCAA	AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.119T>A	chr11.hg19:g.55579061T>A	ENSP00000335529:p.Leu40*	100.0	0.0		95.0	36.0	NM_001004738	B2RNK6|Q6IFD0	Nonsense_Mutation	SNP	ENST00000333973.2	hg19	CCDS31509.1	.	.	.	.	.	.	.	.	.	.	t	14.22	2.469113	0.43839	.	.	ENSG00000186117	ENST00000333973	.	.	.	4.32	1.74	0.24563	.	1.310130	0.05498	N	0.557829	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	-8.9498	5.9005	0.18964	0.0:0.0897:0.3188:0.5915	.	.	.	.	X	40	.	ENSP00000335529:L40X	L	+	2	0	OR5L1	55335637	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.795000	0.26972	0.517000	0.28361	0.358000	0.22013	TTA	.	.		0.502	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391514.1	NM_001004738	
VEGFB	7423	hgsc.bcm.edu	37	11	64005084	64005084	+	Silent	SNP	C	C	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:64005084C>G	ENST00000309422.2	+	6	899	c.603C>G	c.(601-603)tcC>tcG	p.S201S	VEGFB_ENST00000426086.2_Missense_Mutation_p.R168G	NM_001243733.1|NM_003377.4	NP_001230662.1|NP_003368.1	P49765	VEGFB_HUMAN	vascular endothelial growth factor B	201					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|coronary vasculature development (GO:0060976)|induction of positive chemotaxis (GO:0050930)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of neuron apoptotic process (GO:0043524)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation of vascular wound healing (GO:0035470)|protein O-linked glycosylation (GO:0006493)|response to drug (GO:0042493)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|heparin binding (GO:0008201)|vascular endothelial growth factor receptor 1 binding (GO:0043183)			endometrium(2)|large_intestine(2)|prostate(1)|stomach(1)	6					Aflibercept(DB08885)	CAGCTTCCTCCGTTGCCAAGG	0.692																																					p.R168G		Atlas-SNP	.											.	VEGFB	18	.	0			c.C502G						.						6.0	7.0	7.0					11																	64005084		2088	4112	6200	SO:0001819	synonymous_variant	7423	exon6			TTCCTCCGTTGCC	BC008818	CCDS8062.1, CCDS58144.1	11q13	2005-09-29				ENSG00000173511			12681	protein-coding gene	gene with protein product		601398		VRF		8637916, 8919691	Standard	NM_001243733		Approved	VEGFL	uc001nyw.3	P49765		ENST00000309422.2:c.603C>G	chr11.hg19:g.64005084C>G		37.0	0.0		59.0	18.0	NM_001243733	Q16528	Missense_Mutation	SNP	ENST00000309422.2	hg19	CCDS8062.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.44|16.44	3.124247|3.124247	0.56613|0.56613	.|.	.|.	ENSG00000173511|ENSG00000173511	ENST00000541681|ENST00000426086	.|.	.|.	.|.	4.86|4.86	4.86|4.86	0.63082|0.63082	.|.	.|.	.|.	.|.	.|.	T|T	0.43500|0.43500	0.1250|0.1250	.|.	.|.	.|.	0.29978|0.29978	N|N	0.817926|0.817926	.|B	.|0.30281	.|0.275	.|B	.|0.31614	.|0.133	T|T	0.51044|0.51044	-0.8755|-0.8755	4|7	.|0.72032	.|D	.|0.01	-5.9925|-5.9925	15.2806|15.2806	0.73781|0.73781	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|168	.|P49765-2	.|.	R|G	26|168	.|.	.|ENSP00000401550:R168G	P|R	+|+	2|1	0|0	VEGFB|VEGFB	63761660|63761660	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.775000|2.775000	0.47702|0.47702	2.437000|2.437000	0.82529|0.82529	0.561000|0.561000	0.74099|0.74099	CCG|CGT	.	.		0.692	VEGFB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000396393.2	NM_003377	
RPS6KB2	6199	hgsc.bcm.edu	37	11	67200122	67200122	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:67200122C>A	ENST00000312629.5	+	6	554	c.509C>A	c.(508-510)aCg>aAg	p.T170K	RPS6KB2_ENST00000539188.1_3'UTR|AP003419.16_ENST00000535922.1_RNA|RPS6KB2_ENST00000524814.1_3'UTR	NM_003952.2	NP_003943.2	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide 2	170	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of translational initiation (GO:0045948)|protein kinase B signaling (GO:0043491)|signal transduction (GO:0007165)|translation (GO:0006412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|peptide binding (GO:0042277)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ribosomal protein S6 kinase activity (GO:0004711)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|salivary_gland(1)|stomach(2)	25			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			CTGGAAGATACGGCCTGGTGG	0.592																																					p.T170K		Atlas-SNP	.											.	RPS6KB2	92	.	0			c.C509A						.						134.0	152.0	146.0					11																	67200122		2178	4267	6445	SO:0001583	missense	6199	exon6			AAGATACGGCCTG	AB019245	CCDS41677.1	11q13.1	2011-04-05	2002-08-29		ENSG00000175634	ENSG00000175634			10437	protein-coding gene	gene with protein product		608939	"""ribosomal protein S6 kinase, 70kD, polypeptide 2"""			9878560, 9804755	Standard	XM_005274164		Approved	p70S6Kb, P70-BETA, STK14B, KLS	uc001old.3	Q9UBS0	OTTHUMG00000167673	ENST00000312629.5:c.509C>A	chr11.hg19:g.67200122C>A	ENSP00000308413:p.Thr170Lys	91.0	0.0		135.0	46.0	NM_003952	B2RMZ9|B4DML8|O94809|Q9UEC1	Missense_Mutation	SNP	ENST00000312629.5	hg19	CCDS41677.1	.	.	.	.	.	.	.	.	.	.	C	17.57	3.421834	0.62622	.	.	ENSG00000175634	ENST00000312629	T	0.64438	-0.1	5.43	5.43	0.79202	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.64091	0.2567	N	0.13198	0.31	0.80722	D	1	D;D	0.56746	0.965;0.977	P;P	0.59703	0.77;0.862	T	0.70132	-0.4956	10	0.66056	D	0.02	.	18.8483	0.92217	0.0:1.0:0.0:0.0	.	170;170	Q9BRS0;Q9UBS0	.;KS6B2_HUMAN	K	170	ENSP00000308413:T170K	ENSP00000308413:T170K	T	+	2	0	RPS6KB2	66956698	1.000000	0.71417	0.992000	0.48379	0.131000	0.20780	5.601000	0.67606	2.542000	0.85734	0.561000	0.74099	ACG	.	.		0.592	RPS6KB2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395508.1	NM_003952	
MYO7A	4647	hgsc.bcm.edu	37	11	76890167	76890167	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:76890167T>C	ENST00000409709.3	+	20	2631	c.2359T>C	c.(2359-2361)Tac>Cac	p.Y787H	MYO7A_ENST00000409893.1_Missense_Mutation_p.Y787H|MYO7A_ENST00000409619.2_Missense_Mutation_p.Y776H|MYO7A_ENST00000458637.2_Missense_Mutation_p.Y787H	NM_000260.3	NP_000251.3	Q13402	MYO7A_HUMAN	myosin VIIA	787	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|auditory receptor cell stereocilium organization (GO:0060088)|equilibrioception (GO:0050957)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|metabolic process (GO:0008152)|phagolysosome assembly (GO:0001845)|pigment granule transport (GO:0051904)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|myosin VII complex (GO:0031477)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium (GO:0032420)|synapse (GO:0045202)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|spectrin binding (GO:0030507)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TAGGAAGAACTACGGGCTGGT	0.597																																					p.Y787H		Atlas-SNP	.											.	MYO7A	164	.	0			c.T2359C						.						34.0	39.0	38.0					11																	76890167		2059	4192	6251	SO:0001583	missense	4647	exon20			AAGAACTACGGGC	U39226	CCDS53683.1, CCDS53684.1, CCDS53685.1	11q13.5	2013-01-08	2005-09-12		ENSG00000137474	ENSG00000137474		"""A-kinase anchor proteins"", ""Myosins / Myosin superfamily : Class VII"""	7606	protein-coding gene	gene with protein product		276903	"""myosin VIIA (Usher syndrome 1B (autosomal recessive, severe))"""	USH1B, DFNB2, DFNA11		8884266	Standard	NM_000260		Approved	NSRD2	uc001oyb.2	Q13402	OTTHUMG00000152822	ENST00000409709.3:c.2359T>C	chr11.hg19:g.76890167T>C	ENSP00000386331:p.Tyr787His	79.0	0.0		97.0	53.0	NM_001127179	B9A011|F8VUN5|P78427|Q13321|Q14785|Q92821|Q92822	Missense_Mutation	SNP	ENST00000409709.3	hg19	CCDS53683.1	.	.	.	.	.	.	.	.	.	.	T	17.30	3.354888	0.61293	.	.	ENSG00000137474	ENST00000409709;ENST00000409893;ENST00000458637;ENST00000409619;ENST00000358342;ENST00000343356;ENST00000341717;ENST00000343419	T;T;T;T	0.36157	1.27;1.27;1.27;1.27	4.87	4.87	0.63330	.	0.000000	0.64402	D	0.000001	T	0.61451	0.2348	M	0.80746	2.51	0.80722	D	1	D;B;D	0.89917	1.0;0.154;0.996	D;B;D	0.83275	0.996;0.152;0.975	T	0.66500	-0.5908	10	0.59425	D	0.04	.	13.6853	0.62513	0.0:0.0:0.0:1.0	.	787;787;787	B9A012;F8VUN5;Q13402	.;.;MYO7A_HUMAN	H	787;787;787;776;786;786;663;786	ENSP00000386331:Y787H;ENSP00000386689:Y787H;ENSP00000392185:Y787H;ENSP00000386635:Y776H	ENSP00000345075:Y663H	Y	+	1	0	MYO7A	76567815	1.000000	0.71417	0.969000	0.41365	0.417000	0.31264	7.979000	0.88103	1.843000	0.53566	0.240000	0.17902	TAC	.	.		0.597	MYO7A-001	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328133.1	NM_000260	
INTS4	92105	hgsc.bcm.edu	37	11	77669833	77669833	+	Silent	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:77669833T>A	ENST00000534064.1	-	7	790	c.756A>T	c.(754-756)gcA>gcT	p.A252A	INTS4_ENST00000529807.1_Silent_p.A252A	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	252					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TAAGCTGGACTGCAGCACTGC	0.463																																					p.A252A		Atlas-SNP	.											.	INTS4	89	.	0			c.A756T						.						56.0	47.0	50.0					11																	77669833		2200	4292	6492	SO:0001819	synonymous_variant	92105	exon7			CTGGACTGCAGCA	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.756A>T	chr11.hg19:g.77669833T>A		436.0	0.0		702.0	402.0	NM_033547	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	ENST00000534064.1	hg19	CCDS31644.1																																																																																			.	.		0.463	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
FAM181B	220382	hgsc.bcm.edu	37	11	82443621	82443621	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:82443621G>A	ENST00000329203.3	-	1	1285	c.1151C>T	c.(1150-1152)cCg>cTg	p.P384L		NM_175885.3	NP_787081.2	A6NEQ2	F181B_HUMAN	family with sequence similarity 181, member B	384	Pro-rich.									large_intestine(1)|lung(2)|prostate(1)	4						CGGCGGCGGCGGGGGCAGGGC	0.697																																					p.P384L		Atlas-SNP	.											.	FAM181B	14	.	0			c.C1151T						.						5.0	6.0	6.0					11																	82443621		1835	3917	5752	SO:0001583	missense	220382	exon1			GGCGGCGGGGGCA	AK095054, BC039262	CCDS31648.1	11q14.1	2011-11-30			ENSG00000182103	ENSG00000182103			28512	protein-coding gene	gene with protein product						12477932	Standard	NM_175885		Approved	LOC220382, MGC33846	uc001ozp.3	A6NEQ2	OTTHUMG00000166869	ENST00000329203.3:c.1151C>T	chr11.hg19:g.82443621G>A	ENSP00000365295:p.Pro384Leu	144.0	0.0		197.0	14.0	NM_175885	B2RWP1	Missense_Mutation	SNP	ENST00000329203.3	hg19	CCDS31648.1	.	.	.	.	.	.	.	.	.	.	G	15.46	2.841559	0.51057	.	.	ENSG00000182103	ENST00000329203	T	0.34859	1.34	5.08	4.16	0.48862	.	.	.	.	.	T	0.27384	0.0672	N	0.24115	0.695	0.43255	D	0.995188	D	0.57899	0.981	P	0.45406	0.479	T	0.02087	-1.1216	8	.	.	.	.	11.6849	0.51481	0.0:0.0:0.6785:0.3215	.	384	A6NEQ2	F181B_HUMAN	L	384	ENSP00000365295:P384L	.	P	-	2	0	FAM181B	82121269	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	0.991000	0.29654	1.331000	0.45412	0.655000	0.94253	CCG	.	.		0.697	FAM181B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391626.1	NM_175885	
PCF11	51585	hgsc.bcm.edu	37	11	82877710	82877710	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:82877710T>C	ENST00000298281.4	+	5	2223	c.1771T>C	c.(1771-1773)Tcc>Ccc	p.S591P		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	591					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CTGGCAAAGTTCCAAGTCTGC	0.358																																					p.S591P		Atlas-SNP	.											.	PCF11	220	.	0			c.T1771C						.						70.0	70.0	70.0					11																	82877710		1795	3967	5762	SO:0001583	missense	51585	exon5			CAAAGTTCCAAGT	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1771T>C	chr11.hg19:g.82877710T>C	ENSP00000298281:p.Ser591Pro	375.0	0.0		457.0	143.0	NM_015885	A6H8W7|O43671|Q6P0X8	Missense_Mutation	SNP	ENST00000298281.4	hg19	CCDS44689.1	.	.	.	.	.	.	.	.	.	.	T	10.60	1.394882	0.25205	.	.	ENSG00000165494	ENST00000298281;ENST00000530660;ENST00000530304	T;T;T	0.48836	1.79;0.83;0.8	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000015	T	0.30135	0.0755	N	0.17082	0.46	0.37024	D	0.896341	B;B	0.19073	0.033;0.027	B;B	0.15484	0.013;0.012	T	0.30238	-0.9985	9	.	.	.	.	10.8996	0.47043	0.0:0.0695:0.0:0.9305	.	591;591	E9PQ01;O94913	.;PCF11_HUMAN	P	591	ENSP00000298281:S591P;ENSP00000434540:S591P;ENSP00000431567:S591P	.	S	+	1	0	PCF11	82555358	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.091000	0.41691	2.326000	0.78906	0.533000	0.62120	TCC	.	.		0.358	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
RBM7	10179	hgsc.bcm.edu	37	11	114271428	114271428	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:114271428T>C	ENST00000540163.1	+	1	677	c.35T>C	c.(34-36)cTc>cCc	p.L12P	RP11-212D19.4_ENST00000544347.1_Missense_Mutation_p.S9P|C11orf71_ENST00000325636.4_5'Flank|RBM7_ENST00000375490.5_Missense_Mutation_p.L12P|RBM7_ENST00000545678.1_5'UTR|RBM7_ENST00000544582.1_Missense_Mutation_p.L12P|RBM7_ENST00000541475.1_Missense_Mutation_p.L12P			Q9Y580	RBM7_HUMAN	RNA binding motif protein 7	12	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				meiotic nuclear division (GO:0007126)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17		all_cancers(61;5.06e-12)|all_epithelial(67;5.3e-06)|all_hematologic(158;7.68e-05)|Acute lymphoblastic leukemia(157;0.000966)|Melanoma(852;0.00153)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.0818)|Prostate(24;0.104)		BRCA - Breast invasive adenocarcinoma(274;2.56e-06)|Epithelial(105;4.17e-05)|all cancers(92;0.000348)		GATCGCACTCTCTTTGTGGGC	0.617																																					p.L12P		Atlas-SNP	.											.	RBM7	33	.	0			c.T35C						.						55.0	60.0	58.0					11																	114271428		2201	4296	6497	SO:0001583	missense	10179	exon1			GCACTCTCTTTGT	AF156098	CCDS8370.1, CCDS66233.1, CCDS73395.1	11q23.1-q23.2	2013-02-12			ENSG00000076053	ENSG00000076053		"""RNA binding motif (RRM) containing"""	9904	protein-coding gene	gene with protein product		612413				12477932	Standard	NM_001286045		Approved		uc001pov.3	Q9Y580		ENST00000540163.1:c.35T>C	chr11.hg19:g.114271428T>C	ENSP00000439918:p.Leu12Pro	163.0	0.0		75.0	10.0	NM_016090	B2R6K8|Q9NUT4	Missense_Mutation	SNP	ENST00000540163.1	hg19	CCDS8370.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.215709	0.79352	.	.	ENSG00000076053	ENST00000540163;ENST00000375490;ENST00000541475;ENST00000544582	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	5.4	4.28	0.50868	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.057265	0.64402	N	0.000001	D	0.93324	0.7872	H	0.97131	3.945	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.93462	0.6811	10	0.87932	D	0	-6.8725	10.1373	0.42715	0.0:0.0792:0.0:0.9208	.	12;12	Q6IRX3;Q9Y580	.;RBM7_HUMAN	P	12	ENSP00000439918:L12P;ENSP00000364639:L12P;ENSP00000440949:L12P;ENSP00000440923:L12P	ENSP00000364639:L12P	L	+	2	0	RBM7	113776638	1.000000	0.71417	0.971000	0.41717	0.740000	0.42216	7.030000	0.76484	0.898000	0.36418	0.460000	0.39030	CTC	.	.		0.617	RBM7-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399010.1	NM_016090	
CD163L1	283316	hgsc.bcm.edu	37	12	7551140	7551140	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:7551140G>T	ENST00000313599.3	-	7	1506	c.1449C>A	c.(1447-1449)agC>agA	p.S483R	CD163L1_ENST00000416109.2_Missense_Mutation_p.S493R|CD163L1_ENST00000396630.1_Missense_Mutation_p.S483R			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	483	SRCR 5. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CATAACAGGGGCTATGAGCCC	0.458																																					p.S483R		Atlas-SNP	.											.	CD163L1	238	.	0			c.C1449A						.						77.0	67.0	71.0					12																	7551140		2203	4300	6503	SO:0001583	missense	283316	exon7			ACAGGGGCTATGA	AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.1449C>A	chr12.hg19:g.7551140G>T	ENSP00000315945:p.Ser483Arg	104.0	0.0		149.0	53.0	NM_174941	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Missense_Mutation	SNP	ENST00000313599.3	hg19	CCDS8577.1	.	.	.	.	.	.	.	.	.	.	G	10.22	1.288910	0.23478	.	.	ENSG00000177675	ENST00000313599;ENST00000416109;ENST00000396630	T;T;T	0.33654	1.4;1.4;1.4	1.88	-1.28	0.09318	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	0.534254	0.14164	U	0.337200	T	0.34861	0.0912	L	0.52759	1.655	0.09310	N	1	P;P	0.45078	0.85;0.85	P;P	0.48524	0.58;0.58	T	0.21415	-1.0246	10	0.51188	T	0.08	.	6.3128	0.21174	0.6182:0.0:0.3818:0.0	.	493;483	E7EVK4;Q9NR16	.;C163B_HUMAN	R	483;493;483	ENSP00000315945:S483R;ENSP00000393474:S493R;ENSP00000379871:S483R	ENSP00000315945:S483R	S	-	3	2	CD163L1	7442407	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.571000	0.05889	-0.402000	0.07633	-0.459000	0.05422	AGC	.	.		0.458	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399329.1	NM_174941	
LRRK2	120892	hgsc.bcm.edu	37	12	40668428	40668428	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:40668428T>C	ENST00000298910.7	+	15	1758	c.1700T>C	c.(1699-1701)aTt>aCt	p.I567T	LRRK2_ENST00000343742.2_Missense_Mutation_p.I567T	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	567					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTAAAAGTAATTTCTTCTATT	0.348																																					p.I567T		Atlas-SNP	.											.	LRRK2	763	.	0			c.T1700C						.						145.0	147.0	146.0					12																	40668428		2203	4300	6503	SO:0001583	missense	120892	exon15			AAGTAATTTCTTC	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.1700T>C	chr12.hg19:g.40668428T>C	ENSP00000298910:p.Ile567Thr	83.0	0.0		80.0	27.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	hg19	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	T	11.93	1.785895	0.31593	.	.	ENSG00000188906	ENST00000416796;ENST00000343742;ENST00000298910	T;T;T	0.68624	-0.34;1.12;1.12	6.07	6.07	0.98685	Armadillo-like helical (1);Armadillo-type fold (1);	0.264252	0.38548	N	0.001644	T	0.58221	0.2107	L	0.43152	1.355	0.31900	N	0.61603	B;P	0.37914	0.03;0.611	B;B	0.29524	0.033;0.103	T	0.70457	-0.4866	10	0.72032	D	0.01	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	567;567	E9PC85;Q5S007	.;LRRK2_HUMAN	T	315;567;567	ENSP00000398726:I315T;ENSP00000341930:I567T;ENSP00000298910:I567T	ENSP00000298910:I567T	I	+	2	0	LRRK2	38954695	0.999000	0.42202	0.260000	0.24451	0.226000	0.24999	6.609000	0.74173	2.326000	0.78906	0.533000	0.62120	ATT	.	.		0.348	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
KMT2D	8085	hgsc.bcm.edu	37	12	49431855	49431855	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:49431855C>T	ENST00000301067.7	-	34	9283	c.9284G>A	c.(9283-9285)gGc>gAc	p.G3095D	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3095					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										CTCCTCAGGGCCCAAGGGTCC	0.632																																					p.G3095D		Atlas-SNP	.											.	MLL2	1173	.	0			c.G9284A						.						33.0	32.0	33.0					12																	49431855		1959	4144	6103	SO:0001583	missense	8085	exon34			TCAGGGCCCAAGG	AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9284G>A	chr12.hg19:g.49431855C>T	ENSP00000301067:p.Gly3095Asp	94.0	0.0		81.0	33.0	NM_003482	O14687	Missense_Mutation	SNP	ENST00000301067.7	hg19	CCDS44873.1	.	.	.	.	.	.	.	.	.	.	C	9.243	1.038899	0.19669	.	.	ENSG00000167548	ENST00000301067	T	0.79141	-1.24	5.2	3.19	0.36642	.	0.199359	0.25208	N	0.032327	T	0.60170	0.2248	N	0.14661	0.345	0.27352	N	0.956227	P	0.43477	0.808	B	0.39419	0.299	T	0.58945	-0.7546	10	0.87932	D	0	.	9.3404	0.38076	0.1625:0.6803:0.1572:0.0	.	3095	O14686	MLL2_HUMAN	D	3095	ENSP00000301067:G3095D	ENSP00000301067:G3095D	G	-	2	0	MLL2	47718122	0.001000	0.12720	0.997000	0.53966	0.991000	0.79684	-0.060000	0.11712	1.289000	0.44618	0.655000	0.94253	GGC	.	.		0.632	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390183.2		
KRT85	3891	hgsc.bcm.edu	37	12	52757067	52757067	+	Missense_Mutation	SNP	C	C	A	rs529513894		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:52757067C>A	ENST00000257901.3	-	5	989	c.914G>T	c.(913-915)cGc>cTc	p.R305L	KRT85_ENST00000544265.1_Missense_Mutation_p.R93L	NM_002283.3	NP_002274.1	P78386	KRT85_HUMAN	keratin 85	305	Coil 2.|Rod.				epidermis development (GO:0008544)	extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(7)|liver(1)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	36	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		GGCCCGGCTGCGGCTGGCAAC	0.557																																					p.R305L		Atlas-SNP	.											.	KRT85	78	.	0			c.G914T						.						89.0	68.0	75.0					12																	52757067		2203	4300	6503	SO:0001583	missense	3891	exon5			CGGCTGCGGCTGG	X99140	CCDS8824.1, CCDS73472.1	12q13.13	2013-06-20	2006-07-17	2006-07-17	ENSG00000135443	ENSG00000135443		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6462	protein-coding gene	gene with protein product	"""hard keratin type II"""	602767	"""keratin, hair, basic, 5"""	KRTHB5		9084137, 16831889	Standard	NM_002283		Approved	Hb-5	uc001sag.3	P78386	OTTHUMG00000169633	ENST00000257901.3:c.914G>T	chr12.hg19:g.52757067C>A	ENSP00000257901:p.Arg305Leu	79.0	0.0		85.0	7.0	NM_002283	Q9NSB1	Missense_Mutation	SNP	ENST00000257901.3	hg19	CCDS8824.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416862	0.83449	.	.	ENSG00000135443	ENST00000257901;ENST00000544265	D;T	0.89050	-2.46;-1.13	4.87	4.87	0.63330	Filament (1);	0.000000	0.64402	D	0.000015	D	0.94847	0.8335	H	0.94886	3.595	0.27837	N	0.941246	D	0.54601	0.967	P	0.60345	0.873	D	0.90562	0.4516	10	0.66056	D	0.02	.	11.1722	0.48577	0.0:0.8637:0.0:0.1363	.	305	P78386	KRT85_HUMAN	L	305;93	ENSP00000257901:R305L;ENSP00000440240:R93L	ENSP00000257901:R305L	R	-	2	0	KRT85	51043334	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.336000	0.33850	2.243000	0.73865	0.561000	0.74099	CGC	.	.		0.557	KRT85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405184.1	NM_002283	
TIMELESS	8914	hgsc.bcm.edu	37	12	56817448	56817448	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:56817448C>T	ENST00000553532.1	-	17	2160	c.2010G>A	c.(2008-2010)gaG>gaA	p.E670E	TIMELESS_ENST00000554616.1_Intron|TIMELESS_ENST00000229201.4_Silent_p.E669E					timeless circadian clock									p.E670E(1)		NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						cctcctcctcctcttcttctt	0.527																																					p.E670E		Atlas-SNP	.											TIMELESS,NS,carcinoma,0,1	TIMELESS	107	.	1	Substitution - coding silent(1)	kidney(1)	c.G2010A						.						51.0	49.0	50.0					12																	56817448		2203	4300	6503	SO:0001819	synonymous_variant	8914	exon17			CTCCTCCTCTTCT	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2010G>A	chr12.hg19:g.56817448C>T		52.0	0.0		63.0	4.0	NM_003920		Silent	SNP	ENST00000553532.1	hg19	CCDS8918.1																																																																																			.	.		0.527	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
PRIM1	5557	hgsc.bcm.edu	37	12	57136845	57136845	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:57136845T>A	ENST00000338193.6	-	7	710	c.674A>T	c.(673-675)gAa>gTa	p.E225V		NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	225					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						CAAGGCATATTCTTCAAAGTA	0.318																																					p.E225V		Atlas-SNP	.											.	PRIM1	22	.	0			c.A674T						.						42.0	34.0	37.0					12																	57136845		1763	4032	5795	SO:0001583	missense	5557	exon7			GCATATTCTTCAA	BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.674A>T	chr12.hg19:g.57136845T>A	ENSP00000350491:p.Glu225Val	60.0	0.0		62.0	26.0	NM_000946		Missense_Mutation	SNP	ENST00000338193.6	hg19	CCDS44926.1	.	.	.	.	.	.	.	.	.	.	T	13.82	2.352023	0.41700	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000549549;ENST00000550770	T;T;T	0.46819	0.86;0.86;0.86	5.12	2.76	0.32466	.	0.670556	0.15662	N	0.250865	T	0.47060	0.1425	L	0.56769	1.78	0.37668	D	0.923021	P	0.36222	0.544	B	0.41299	0.353	T	0.49634	-0.8919	10	0.52906	T	0.07	-1.3865	9.2186	0.37362	0.0:0.1544:0.0:0.8456	.	225	P49642	PRI1_HUMAN	V	226;225;13;228	ENSP00000350491:E225V;ENSP00000449806:E13V;ENSP00000450185:E228V	ENSP00000350491:E225V	E	-	2	0	PRIM1	55423112	0.807000	0.29009	0.992000	0.48379	0.802000	0.45316	1.296000	0.33389	0.491000	0.27793	0.402000	0.26972	GAA	.	.		0.318	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406956.1	NM_000946	
PAH	5053	hgsc.bcm.edu	37	12	103310862	103310862	+	Missense_Mutation	SNP	G	G	A	rs62642906		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:103310862G>A	ENST00000553106.1	-	1	519	c.47C>T	c.(46-48)tCt>tTt	p.S16F	PAH_ENST00000307000.2_5'UTR|PAH_ENST00000551988.1_5'UTR	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	16			S -> P (in PKU).		catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	TCCAAAGTCAGAGAGTTTCCT	0.577																																					p.S16F		Atlas-SNP	.											.	PAH	77	.	0			c.C47T						.						86.0	82.0	83.0					12																	103310862		2203	4300	6503	SO:0001583	missense	5053	exon1			AAGTCAGAGAGTT	U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.47C>T	chr12.hg19:g.103310862G>A	ENSP00000448059:p.Ser16Phe	88.0	0.0		87.0	32.0	NM_000277	Q16717|Q8TC14	Missense_Mutation	SNP	ENST00000553106.1	hg19	CCDS9092.1	.	.	.	.	.	.	.	.	.	.	G	9.961	1.222897	0.22457	.	.	ENSG00000171759	ENST00000553106;ENST00000551337;ENST00000546844	D;D;D	0.99405	-5.84;-4.63;-5.07	5.2	3.36	0.38483	.	0.377447	0.28156	N	0.016381	D	0.96331	0.8803	N	0.08118	0	0.26233	N	0.978983	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.0	D	0.93323	0.6694	10	0.49607	T	0.09	-9.4426	8.416	0.32672	0.0:0.183:0.6515:0.1655	.	16;16	B4DPN2;P00439	.;PH4H_HUMAN	F	16	ENSP00000448059:S16F;ENSP00000447620:S16F;ENSP00000446658:S16F	ENSP00000446658:S16F	S	-	2	0	PAH	101834992	0.943000	0.32029	0.010000	0.14722	0.008000	0.06430	1.681000	0.37618	0.867000	0.35654	0.655000	0.94253	TCT	.	.		0.577	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406692.1		
ATP6V0A2	23545	hgsc.bcm.edu	37	12	124242532	124242532	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:124242532T>G	ENST00000330342.3	+	20	2772	c.2524T>G	c.(2524-2526)Ttc>Gtc	p.F842V	ATP6V0A2_ENST00000543687.1_3'UTR|ATP6V0A2_ENST00000544833.1_Missense_Mutation_p.F124V	NM_012463.3	NP_036595.2	Q9Y487	VPP2_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a2	842					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|immune response (GO:0006955)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(10)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.000625)|all cancers(50;0.00775)		TCCTTTCTCATTCAGTCTACT	0.343																																					p.F842V		Atlas-SNP	.											.	ATP6V0A2	68	.	0			c.T2524G						.						126.0	113.0	117.0					12																	124242532		2203	4300	6503	SO:0001583	missense	23545	exon20			TTCTCATTCAGTC	AF112972	CCDS9254.1	12q24.31	2010-04-21	2006-01-20		ENSG00000185344	ENSG00000185344		"""ATPases / V-type"""	18481	protein-coding gene	gene with protein product	"""infantile malignant osteopetrosis"""	611716	"""infantile malignant osteopetrosis"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 2"", ""ATPase, H+ transporting, lysosomal V0 subunit A2"""			2247090, 18157129	Standard	NM_012463		Approved	TJ6, a2, TJ6s, TJ6M, ATP6a2, J6B7, ATP6N1D, Vph1, Stv1	uc001ufr.3	Q9Y487	OTTHUMG00000168723	ENST00000330342.3:c.2524T>G	chr12.hg19:g.124242532T>G	ENSP00000332247:p.Phe842Val	64.0	0.0		71.0	19.0	NM_012463	A8K026|Q6NUM0	Missense_Mutation	SNP	ENST00000330342.3	hg19	CCDS9254.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.134365	0.77662	.	.	ENSG00000185344	ENST00000330342;ENST00000534943;ENST00000544833	D;D;D	0.87029	-2.2;-2.2;-2.2	5.71	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.89942	0.6861	M	0.90019	3.08	0.80722	D	1	P	0.40000	0.698	B	0.41946	0.371	D	0.89950	0.4079	10	0.87932	D	0	-19.7366	11.829	0.52283	0.0:0.0685:0.0:0.9315	.	842	Q9Y487	VPP2_HUMAN	V	842;122;124	ENSP00000332247:F842V;ENSP00000443726:F122V;ENSP00000441143:F124V	ENSP00000332247:F842V	F	+	1	0	ATP6V0A2	122808485	1.000000	0.71417	0.918000	0.36340	0.671000	0.39405	6.235000	0.72332	0.982000	0.38575	0.533000	0.62120	TTC	.	.		0.343	ATP6V0A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400765.2	NM_012463	
ATP12A	479	hgsc.bcm.edu	37	13	25265114	25265114	+	Intron	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr13:25265114C>T	ENST00000381946.3	+	8	966				ATP12A_ENST00000218548.6_Missense_Mutation_p.P271L			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide						ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TCTACTTCCCCTGTAGGCACT	0.572																																					p.P271L	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.C812T						.						132.0	125.0	128.0					13																	25265114		2203	4300	6503	SO:0001627	intron_variant	479	exon8			CTTCCCCTGTAGG	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.800-6C>T	chr13.hg19:g.25265114C>T		91.0	0.0		76.0	29.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	hg19	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	C	4.251	0.045541	0.08196	.	.	ENSG00000075673	ENST00000218548	D	0.92911	-3.13	5.02	4.09	0.47781	.	0.466770	0.15887	U	0.239723	D	0.86146	0.5863	.	.	.	0.33231	D	0.555972	B	0.06786	0.001	B	0.08055	0.003	D	0.84299	0.0504	9	0.45353	T	0.12	.	7.5117	0.27577	0.0:0.8826:0.0:0.1174	.	271	P54707-2	.	L	271	ENSP00000218548:P271L	ENSP00000218548:P271L	P	+	2	0	ATP12A	24163114	0.002000	0.14202	0.066000	0.19879	0.004000	0.04260	0.619000	0.24388	2.600000	0.87896	0.462000	0.41574	CCT	.	.		0.572	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
TM9SF2	9375	hgsc.bcm.edu	37	13	100206556	100206556	+	Splice_Site	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr13:100206556A>T	ENST00000376387.4	+	14	1678		c.e14-1			NM_004800.1	NP_004791.1	Q99805	TM9S2_HUMAN	transmembrane 9 superfamily member 2						transport (GO:0006810)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)	17	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.218)					TTTTTACTGAAGGCCATTGAA	0.403																																					.		Atlas-SNP	.											.	TM9SF2	52	.	0			c.1489-2A>T						.						132.0	126.0	128.0					13																	100206556		2203	4300	6503	SO:0001630	splice_region_variant	9375	exon14			TACTGAAGGCCAT	U81006	CCDS9493.1	13q32.2	2011-03-28			ENSG00000125304	ENSG00000125304			11865	protein-coding gene	gene with protein product		604678				9729438	Standard	NM_004800		Approved	P76	uc001voj.2	Q99805	OTTHUMG00000017272	ENST00000376387.4:c.1489-1A>T	chr13.hg19:g.100206556A>T		70.0	0.0		76.0	25.0	NM_004800	A8K399|Q2TAY5	Splice_Site	SNP	ENST00000376387.4	hg19	CCDS9493.1	.	.	.	.	.	.	.	.	.	.	A	21.0	4.086358	0.76642	.	.	ENSG00000125304	ENST00000376387	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TM9SF2	99004557	1.000000	0.71417	0.939000	0.37840	0.726000	0.41606	9.098000	0.94202	2.281000	0.76405	0.533000	0.62120	.	.	.		0.403	TM9SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045602.3		Intron
IRS2	8660	hgsc.bcm.edu	37	13	110434682	110434682	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr13:110434682C>T	ENST00000375856.3	-	1	4233	c.3719G>A	c.(3718-3720)cGc>cAc	p.R1240H		NM_003749.2	NP_003740.2	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1240					brain development (GO:0007420)|cell proliferation (GO:0008283)|cellular response to glucose stimulus (GO:0071333)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid homeostasis (GO:0055088)|mammary gland development (GO:0030879)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of kinase activity (GO:0033673)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mesenchymal cell proliferation (GO:0002053)|regulation of lipid metabolic process (GO:0019216)|response to glucose (GO:0009749)|signal transduction (GO:0007165)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)			kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	19	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			GGTCTCTCTGCGCATGGGCGA	0.721																																					p.R1240H	Melanoma(100;613 2409 40847)	Atlas-SNP	.											.	IRS2	44	.	0			c.G3719A						.						15.0	16.0	15.0					13																	110434682		2082	4127	6209	SO:0001583	missense	8660	exon1			TCTCTGCGCATGG	AB000732	CCDS9510.1	13q34	2013-01-10			ENSG00000185950	ENSG00000185950		"""Pleckstrin homology (PH) domain containing"""	6126	protein-coding gene	gene with protein product		600797				9312143	Standard	NM_003749		Approved		uc001vqv.3	Q9Y4H2	OTTHUMG00000017338	ENST00000375856.3:c.3719G>A	chr13.hg19:g.110434682C>T	ENSP00000365016:p.Arg1240His	137.0	0.0		136.0	55.0	NM_003749	Q96RR2|Q9BZG0|Q9Y6I5	Missense_Mutation	SNP	ENST00000375856.3	hg19	CCDS9510.1	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326636	0.41197	.	.	ENSG00000185950	ENST00000375856	T	0.49432	0.78	3.85	3.0	0.34707	.	0.117336	0.64402	N	0.000014	T	0.40694	0.1127	L	0.44542	1.39	0.28707	N	0.903781	D	0.61697	0.99	P	0.45099	0.469	T	0.37174	-0.9717	10	0.54805	T	0.06	-20.5501	9.4461	0.38699	0.0:0.8998:0.0:0.1002	.	1240	Q9Y4H2	IRS2_HUMAN	H	1240	ENSP00000365016:R1240H	ENSP00000365016:R1240H	R	-	2	0	IRS2	109232683	1.000000	0.71417	0.968000	0.41197	0.678000	0.39670	3.797000	0.55514	0.819000	0.34492	0.462000	0.41574	CGC	.	.		0.721	IRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045755.1	NM_003749	
MCF2L	23263	hgsc.bcm.edu	37	13	113750772	113750772	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr13:113750772G>A	ENST00000375608.3	+	29	3311	c.3253G>A	c.(3253-3255)Gtg>Atg	p.V1085M	MCF2L_ENST00000423482.2_Missense_Mutation_p.V1053M|MCF2L_ENST00000375604.2_Missense_Mutation_p.V1112M|MCF2L_ENST00000434480.2_Missense_Mutation_p.V1061M|MCF2L_ENST00000535094.2_Missense_Mutation_p.V1055M|MCF2L_ENST00000397030.1_Missense_Mutation_p.V1088M|MCF2L_ENST00000375601.3_Missense_Mutation_p.V1059M|MCF2L_ENST00000442652.2_Missense_Mutation_p.V1085M|MCF2L_ENST00000421756.1_Missense_Mutation_p.V1059M			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	1085	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GGTGGAGCTGGTGCAGGAGGG	0.697																																					p.V1055M		Atlas-SNP	.											.	MCF2L	182	.	0			c.G3163A						.						23.0	35.0	31.0					13																	113750772		1553	3571	5124	SO:0001583	missense	23263	exon28			GAGCTGGTGCAGG	AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.3253G>A	chr13.hg19:g.113750772G>A	ENSP00000364758:p.Val1085Met	194.0	0.0		189.0	91.0	NM_001112732	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	ENST00000375608.3	hg19		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	14.08|14.08|14.08	2.428920|2.428920|2.428920	0.43122|0.43122|0.43122	.|.|.	.|.|.	ENSG00000126217|ENSG00000126217|ENSG00000126217	ENST00000397017;ENST00000453297|ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000440749|ENST00000261963;ENST00000420013	.|T;T;T;T;T;T;T;T;T|.	.|0.36520|.	.|3.06;3.06;3.06;1.25;3.06;1.25;3.06;3.06;3.06|.	5.14|5.14|5.14	-3.77|-3.77|-3.77	0.04346|0.04346|0.04346	.|Src homology-3 domain (3);Variant SH3 (1);|.	.|0.488214|.	.|0.20551|.	.|N|.	.|0.090106|.	T|T|.	0.50086|0.50086|.	0.1595|0.1595|.	M|M|M	0.69248|0.69248|0.69248	2.105|2.105|2.105	0.33741|0.33741|0.33741	D|D|D	0.619422|0.619422|0.619422	.|P;P;P;P|.	.|0.42620|.	.|0.534;0.534;0.745;0.785|.	.|P;P;P;P|.	.|0.52710|.	.|0.459;0.459;0.583;0.707|.	T|T|.	0.58713|0.58713|.	-0.7588|-0.7588|.	5|10|.	.|0.48119|.	.|T|.	.|0.1|.	.|.|.	3.9769|3.9769|3.9769	0.09478|0.09478|0.09478	0.2268:0.5102:0.1459:0.1171|0.2268:0.5102:0.1459:0.1171|0.2268:0.5102:0.1459:0.1171	.|.|.	.|1053;1055;1112;1085|.	.|E9PDN8;O15068-9;G5E9A1;O15068|.	.|.;.;.;MCF2L_HUMAN|.	D|M|X	740;265|1085;1085;1112;1088;1055;1059;1059;1061;1053;896|225;126	.|ENSP00000364758:V1085M;ENSP00000401422:V1085M;ENSP00000364754:V1112M;ENSP00000380225:V1088M;ENSP00000440374:V1055M;ENSP00000397285:V1059M;ENSP00000364751:V1059M;ENSP00000407722:V1061M;ENSP00000405639:V1053M|.	.|ENSP00000364751:V1059M|.	G|V|W	+|+|+	2|1|3	0|0|0	MCF2L|MCF2L|MCF2L	112798773|112798773|112798773	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.198000|0.198000|0.198000	0.23420|0.23420|0.23420	0.043000|0.043000|0.043000	0.13939|0.13939|0.13939	1.334000|1.334000|1.334000	0.33827|0.33827|0.33827	-0.395000|-0.395000|-0.395000	0.07715|0.07715|0.07715	-0.302000|-0.302000|-0.302000	0.09304|0.09304|0.09304	GGT|GTG|TGG	.	.		0.697	MCF2L-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045849.4		
OR4Q3	441669	hgsc.bcm.edu	37	14	20216431	20216431	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr14:20216431T>C	ENST00000331723.1	+	1	845	c.845T>C	c.(844-846)aTg>aCg	p.M282T		NM_172194.1	NP_751944.1	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q, member 3	282						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(4)|endometrium(3)|kidney(2)|large_intestine(1)|lung(28)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	47	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATTACACCTATGTTGAACCCC	0.418																																					p.M282T		Atlas-SNP	.											.	OR4Q3	117	.	0			c.T845C						.						124.0	125.0	125.0					14																	20216431		2203	4300	6503	SO:0001583	missense	441669	exon1			CACCTATGTTGAA	AF179768	CCDS32020.1	14p13	2012-08-09				ENSG00000182652		"""GPCR / Class A : Olfactory receptors"""	15426	protein-coding gene	gene with protein product				OR4Q4			Standard	NM_172194		Approved	C14orf13	uc010tkt.2	Q8NH05		ENST00000331723.1:c.845T>C	chr14.hg19:g.20216431T>C	ENSP00000330049:p.Met282Thr	117.0	0.0		101.0	18.0	NM_172194	Q6IEX4	Missense_Mutation	SNP	ENST00000331723.1	hg19	CCDS32020.1	.	.	.	.	.	.	.	.	.	.	.	10.74	1.434411	0.25813	.	.	ENSG00000182652	ENST00000331723	T	0.37411	1.2	4.35	4.35	0.52113	GPCR, rhodopsin-like superfamily (1);	0.312743	0.22513	U	0.059065	T	0.33962	0.0881	L	0.28054	0.825	0.28647	N	0.906885	P	0.52842	0.956	P	0.49829	0.623	T	0.19484	-1.0304	10	0.87932	D	0	.	11.5383	0.50651	0.0:0.0:0.0:1.0	.	282	Q8NH05	OR4Q3_HUMAN	T	282	ENSP00000330049:M282T	ENSP00000330049:M282T	M	+	2	0	OR4Q3	19286271	0.111000	0.22076	1.000000	0.80357	0.959000	0.62525	2.433000	0.44793	1.827000	0.53221	0.411000	0.27672	ATG	.	.		0.418	OR4Q3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409818.2		
MGA	23269	hgsc.bcm.edu	37	15	41988768	41988768	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr15:41988768C>T	ENST00000570161.1	+	2	1560	c.1560C>T	c.(1558-1560)ttC>ttT	p.F520F	MGA_ENST00000568630.1_3'UTR|MGA_ENST00000545763.1_Silent_p.F520F|MGA_ENST00000219905.7_Silent_p.F520F|MGA_ENST00000566586.1_Silent_p.F520F|MGA_ENST00000389936.4_Silent_p.F520F			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Maltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGACTGCCTTCTGCTTAGGCA	0.383																																					p.F520F		Atlas-SNP	.											.	MGA	264	.	0			c.C1560T						.						69.0	63.0	65.0					15																	41988768		1845	4098	5943	SO:0001819	synonymous_variant	23269	exon3			TGCCTTCTGCTTA	AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.1560C>T	chr15.hg19:g.41988768C>T		135.0	0.0		166.0	62.0	NM_001080541	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000570161.1	hg19	CCDS55959.1																																																																																			.	.		0.383	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000420229.1	NM_001164273.1	
LRRC57	255252	hgsc.bcm.edu	37	15	42839593	42839593	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr15:42839593G>C	ENST00000323443.2	-	3	725	c.358C>G	c.(358-360)Ctg>Gtg	p.L120V	LRRC57_ENST00000397130.3_Missense_Mutation_p.L120V|HAUS2_ENST00000568876.1_5'Flank|HAUS2_ENST00000568846.2_5'Flank|LRRC57_ENST00000563454.1_Missense_Mutation_p.L120V|HAUS2_ENST00000260372.3_5'Flank			Q8N9N7	LRC57_HUMAN	leucine rich repeat containing 57	120						extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|lung(5)|prostate(1)	8		all_cancers(109;1.99e-12)|all_epithelial(112;5.11e-11)|Lung NSC(122;4.53e-07)|all_lung(180;1.64e-06)|Melanoma(134;0.0262)		GBM - Glioblastoma multiforme(94;6.87e-07)		AATGCTCCCAGTTGGTTCCCA	0.512																																					p.L120V		Atlas-SNP	.											.	LRRC57	20	.	0			c.C358G						.						91.0	79.0	83.0					15																	42839593		2203	4299	6502	SO:0001583	missense	255252	exon4			CTCCCAGTTGGTT	AK094891	CCDS10089.1	15q15.1	2006-02-13			ENSG00000180979	ENSG00000180979			26719	protein-coding gene	gene with protein product							Standard	NM_153260		Approved	FLJ36812	uc001zqc.3	Q8N9N7	OTTHUMG00000130679	ENST00000323443.2:c.358C>G	chr15.hg19:g.42839593G>C	ENSP00000326817:p.Leu120Val	122.0	0.0		131.0	53.0	NM_153260	Q7Z2Z6|Q8N1T6	Missense_Mutation	SNP	ENST00000323443.2	hg19	CCDS10089.1	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302679	0.40795	.	.	ENSG00000180979	ENST00000323443;ENST00000397130	T;T	0.64438	-0.1;-0.1	5.41	4.5	0.54988	.	0.121671	0.56097	D	0.000030	T	0.66733	0.2819	M	0.84082	2.675	0.46298	D	0.998978	B	0.31413	0.322	B	0.32980	0.156	T	0.70128	-0.4957	10	0.56958	D	0.05	.	14.2328	0.65906	0.0716:0.0:0.9284:0.0	.	120	Q8N9N7	LRC57_HUMAN	V	120	ENSP00000326817:L120V;ENSP00000380319:L120V	ENSP00000326817:L120V	L	-	1	2	LRRC57	40626885	1.000000	0.71417	0.945000	0.38365	0.949000	0.60115	3.210000	0.51129	1.433000	0.47394	0.655000	0.94253	CTG	.	.		0.512	LRRC57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253174.1	NM_153260	
PRTG	283659	hgsc.bcm.edu	37	15	55972370	55972370	+	Silent	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr15:55972370T>G	ENST00000389286.4	-	6	902	c.855A>C	c.(853-855)ggA>ggC	p.G285G	RP11-420M1.2_ENST00000561155.1_RNA	NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		GATTACCATTTCCAAGTACCC	0.378																																					p.G285G		Atlas-SNP	.											.	PRTG	110	.	0			c.A855C						.						70.0	66.0	68.0					15																	55972370		1880	4112	5992	SO:0001819	synonymous_variant	283659	exon6			ACCATTTCCAAGT	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.855A>C	chr15.hg19:g.55972370T>G		202.0	0.0		213.0	87.0	NM_173814		Silent	SNP	ENST00000389286.4	hg19	CCDS42040.1																																																																																			.	.		0.378	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	
IGDCC4	57722	hgsc.bcm.edu	37	15	65693281	65693281	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr15:65693281G>A	ENST00000352385.2	-	5	913	c.704C>T	c.(703-705)tCc>tTc	p.S235F		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	235						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						GGACGCCAGGGACCCTGGCGA	0.592											OREG0023196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S235F		Atlas-SNP	.											IGDCC4,NS,lymphoid_neoplasm,0,2	IGDCC4	95	.	0			c.C704T						.						91.0	81.0	84.0					15																	65693281		2201	4299	6500	SO:0001583	missense	57722	exon5			GCCAGGGACCCTG		CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.704C>T	chr15.hg19:g.65693281G>A	ENSP00000319623:p.Ser235Phe	63.0	0.0	1086	88.0	9.0	NM_020962	Q9HCE4	Missense_Mutation	SNP	ENST00000352385.2	hg19	CCDS10206.1	.	.	.	.	.	.	.	.	.	.	G	19.94	3.919954	0.73098	.	.	ENSG00000103742	ENST00000352385	T	0.61392	0.11	5.15	5.15	0.70609	.	0.750986	0.12048	N	0.504402	T	0.69287	0.3094	L	0.60455	1.87	0.47374	D	0.999409	D	0.54397	0.966	P	0.53593	0.73	T	0.69837	-0.5037	10	0.56958	D	0.05	-24.9329	18.6484	0.91419	0.0:0.0:1.0:0.0	.	235	Q8TDY8	IGDC4_HUMAN	F	235	ENSP00000319623:S235F	ENSP00000319623:S235F	S	-	2	0	IGDCC4	63480334	1.000000	0.71417	1.000000	0.80357	0.402000	0.30811	4.742000	0.62103	2.409000	0.81822	0.561000	0.74099	TCC	.	.		0.592	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000256825.2	NM_020962	
AKAP13	11214	hgsc.bcm.edu	37	15	86124904	86124904	+	Nonsense_Mutation	SNP	C	C	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr15:86124904C>G	ENST00000394518.2	+	7	3700	c.3605C>G	c.(3604-3606)tCa>tGa	p.S1202*	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Nonsense_Mutation_p.S1202*	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	1202					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						ATGGAGCTCTCAGCCCATGAT	0.582																																					p.S1202X	Melanoma(94;603 1453 3280 32295 32951)	Atlas-SNP	.											.	AKAP13	394	.	0			c.C3605G						.						55.0	53.0	53.0					15																	86124904		2202	4299	6501	SO:0001587	stop_gained	11214	exon7			AGCTCTCAGCCCA	M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.3605C>G	chr15.hg19:g.86124904C>G	ENSP00000378026:p.Ser1202*	58.0	0.0		56.0	11.0	NM_007200	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Nonsense_Mutation	SNP	ENST00000394518.2	hg19	CCDS32319.1	.	.	.	.	.	.	.	.	.	.	C	41	9.005782	0.99033	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	.	.	.	5.29	-1.9	0.07665	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	4.9398	0.13960	0.0:0.371:0.1569:0.4721	.	.	.	.	X	1202;1202;1201;1201	.	ENSP00000354718:S1202X	S	+	2	0	AKAP13	83925908	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.327000	0.07955	-0.011000	0.14247	0.650000	0.86243	TCA	.	.		0.582	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417318.1	NM_007200	
AGBL1	123624	hgsc.bcm.edu	37	15	86814917	86814917	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr15:86814917C>T	ENST00000441037.2	+	14	2012	c.1917C>T	c.(1915-1917)ggC>ggT	p.G639G	AGBL1_ENST00000421325.2_Silent_p.G639G|AGBL1_ENST00000389298.3_Silent_p.G370G	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	639					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TAAGGACAGGCCATGAAATAT	0.403																																					p.G639G		Atlas-SNP	.											.	AGBL1	151	.	0			c.C1917T						.						162.0	161.0	161.0					15																	86814917		1867	4096	5963	SO:0001819	synonymous_variant	123624	exon14			GACAGGCCATGAA	AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.1917C>T	chr15.hg19:g.86814917C>T		97.0	0.0		105.0	35.0	NM_152336	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	ENST00000441037.2	hg19	CCDS58398.1																																																																																			.	.		0.403	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314929.5	NM_152336	
LONP2	83752	hgsc.bcm.edu	37	16	48385598	48385598	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr16:48385598T>C	ENST00000285737.4	+	15	2537	c.2444T>C	c.(2443-2445)gTa>gCa	p.V815A	LONP2_ENST00000564259.1_3'UTR|LONP2_ENST00000535754.1_Missense_Mutation_p.V771A	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CCAGGCAACGTACGACAGGAT	0.468																																					p.V815A		Atlas-SNP	.											.	LONP2	63	.	0			c.T2444C						.						91.0	88.0	89.0					16																	48385598		2200	4300	6500	SO:0001583	missense	83752	exon15			GCAACGTACGACA	AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.2444T>C	chr16.hg19:g.48385598T>C	ENSP00000285737:p.Val815Ala	75.0	0.0		87.0	26.0	NM_031490		Missense_Mutation	SNP	ENST00000285737.4	hg19	CCDS10734.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.056363	0.55325	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754	T;T	0.35973	1.28;1.28	6.04	6.04	0.98038	Ribosomal protein S5 domain 2-type fold (1);Peptidase S16, Lon C-terminal (1);	0.163209	0.53938	D	0.000051	T	0.52008	0.1708	M	0.71871	2.18	0.80722	D	1	D;D	0.53151	0.958;0.958	P;P	0.51833	0.681;0.681	T	0.56432	-0.7980	10	0.87932	D	0	-18.691	16.6349	0.85050	0.0:0.0:0.0:1.0	.	771;815	B7ZKL7;Q86WA8	.;LONP2_HUMAN	A	815;544;771	ENSP00000285737:V815A;ENSP00000445426:V771A	ENSP00000285737:V815A	V	+	2	0	LONP2	46943099	1.000000	0.71417	0.045000	0.18777	0.397000	0.30659	8.008000	0.88588	2.330000	0.79161	0.477000	0.44152	GTA	.	.		0.468	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256839.2	NM_031490	
DNAH9	1770	hgsc.bcm.edu	37	17	11650915	11650915	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:11650915T>C	ENST00000262442.4	+	32	6510	c.6442T>C	c.(6442-6444)Ttt>Ctt	p.F2148L	DNAH9_ENST00000454412.2_Missense_Mutation_p.F2148L	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	2148	AAA 2. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GCACTCTGTATTTGTGGTGGG	0.592																																					p.F2148L		Atlas-SNP	.											.	DNAH9	695	.	0			c.T6442C						.						69.0	65.0	66.0					17																	11650915		2203	4300	6503	SO:0001583	missense	1770	exon32			TCTGTATTTGTGG	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.6442T>C	chr17.hg19:g.11650915T>C	ENSP00000262442:p.Phe2148Leu	51.0	0.0		83.0	29.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	ENST00000262442.4	hg19	CCDS11160.1	.	.	.	.	.	.	.	.	.	.	T	18.27	3.585991	0.66105	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.21361	2.01;2.01	4.5	4.5	0.54988	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	T	0.49201	0.1543	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.56860	-0.7909	10	0.72032	D	0.01	.	13.9979	0.64414	0.0:0.0:0.0:1.0	.	2148	Q9NYC9	DYH9_HUMAN	L	2148;2148;730	ENSP00000262442:F2148L;ENSP00000414874:F2148L	ENSP00000262442:F2148L	F	+	1	0	DNAH9	11591640	1.000000	0.71417	0.994000	0.49952	0.122000	0.20287	7.697000	0.84279	1.902000	0.55061	0.455000	0.32223	TTT	.	.		0.592	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
CRLF3	51379	hgsc.bcm.edu	37	17	29123225	29123225	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:29123225C>T	ENST00000324238.6	-	4	680	c.556G>A	c.(556-558)Gaa>Aaa	p.E186K	CRLF3_ENST00000544695.1_Missense_Mutation_p.E70K|CRLF3_ENST00000577725.1_Intron	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	186	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATTAGTTCTTCTATCTGTACT	0.393																																					p.E186K	Pancreas(30;346 881 29244 33464 41299)	Atlas-SNP	.											.	CRLF3	36	.	0			c.G556A						.						123.0	107.0	113.0					17																	29123225		2203	4300	6503	SO:0001583	missense	51379	exon4			GTTCTTCTATCTG	AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.556G>A	chr17.hg19:g.29123225C>T	ENSP00000318804:p.Glu186Lys	105.0	0.0		121.0	10.0	NM_015986	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Missense_Mutation	SNP	ENST00000324238.6	hg19	CCDS32607.1	.	.	.	.	.	.	.	.	.	.	C	32	5.109650	0.94292	.	.	ENSG00000176390	ENST00000324238;ENST00000544695	T;T	0.27557	1.66;1.66	5.24	5.24	0.73138	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.045060	0.85682	D	0.000000	T	0.54791	0.1880	M	0.65498	2.005	0.80722	D	1	D	0.69078	0.997	D	0.68765	0.96	T	0.54925	-0.8220	10	0.51188	T	0.08	-24.7215	18.8146	0.92072	0.0:1.0:0.0:0.0	.	186	Q8IUI8	CRLF3_HUMAN	K	186;70	ENSP00000318804:E186K;ENSP00000444188:E70K	ENSP00000318804:E186K	E	-	1	0	CRLF3	26147351	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.059000	0.76684	2.457000	0.83068	0.313000	0.20887	GAA	.	.		0.393	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444354.1		
AP2B1	163	hgsc.bcm.edu	37	17	33968894	33968894	+	Splice_Site	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:33968894A>T	ENST00000262325.7	+	12	1990		c.e12-1		AP2B1_ENST00000537622.2_Splice_Site|AP2B1_ENST00000545922.2_Splice_Site|AP2B1_ENST00000538556.1_Splice_Site|AP2B1_ENST00000589344.1_Splice_Site|AP2B1_ENST00000312678.8_Splice_Site|AP2B1_ENST00000592545.1_Splice_Site	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ATGTCTGTTTAGGTGCAGCTC	0.443																																					.		Atlas-SNP	.											.	AP2B1	70	.	0			c.1438-2A>T						.						69.0	64.0	66.0					17																	33968894		2203	4300	6503	SO:0001630	splice_region_variant	163	exon12			CTGTTTAGGTGCA	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.1438-1A>T	chr17.hg19:g.33968894A>T		60.0	0.0		62.0	22.0	NM_001282	A6NJP3|P21851|Q7Z451|Q96J19	Splice_Site	SNP	ENST00000262325.7	hg19	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.517642	0.85495	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1167	0.72407	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AP2B1	30993007	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.069000	0.93967	2.222000	0.72286	0.528000	0.53228	.	.	.		0.443	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		Intron
HDAC5	10014	hgsc.bcm.edu	37	17	42171077	42171078	+	Missense_Mutation	DNP	GC	GC	TT			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:42171077_42171078GC>TT	ENST00000393622.2	-	4	550_551	c.219_220GC>AA	c.(217-222)gaGCag>gaAAag	p.Q74K	HDAC5_ENST00000586802.1_Missense_Mutation_p.Q74K|HDAC5_ENST00000336057.5_Missense_Mutation_p.Q74K|HDAC5_ENST00000225983.6_Missense_Mutation_p.Q75K	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	74					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		tgcagttgctgctcccgcAGTG	0.649																																					p.Q75K|p.E74E		Atlas-SNP	.											.	HDAC5	67	.	0			c.C223A|c.G222A						.																																			SO:0001583	missense	10014	exon4			GTTGCTGCTCCCG|TTGCTGCTCCCGC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.219_220delinsTT	chr17.hg19:g.42171077_42171078delinsTT	ENSP00000377244:p.Gln74Lys	80.0	0.0		121.0|119.0	53.0|52.0	NM_001015053	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation|Silent	SNP	ENST00000393622.2	hg19	CCDS45696.1																																																																																			.	.		0.649	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053	
ITGA2B	3674	hgsc.bcm.edu	37	17	42452979	42452979	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:42452979G>T	ENST00000262407.5	-	26	2738	c.2707C>A	c.(2707-2709)Ctt>Att	p.L903I	ITGA2B_ENST00000353281.4_Missense_Mutation_p.L903I	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	903					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	GGATCCTGAAGCCTCGAGGGC	0.687																																					p.L903I		Atlas-SNP	.											.	ITGA2B	88	.	0			c.C2707A						.						42.0	42.0	42.0					17																	42452979		2203	4300	6503	SO:0001583	missense	3674	exon26			CCTGAAGCCTCGA		CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.2707C>A	chr17.hg19:g.42452979G>T	ENSP00000262407:p.Leu903Ile	99.0	0.0		100.0	40.0	NM_000419	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	ENST00000262407.5	hg19	CCDS32665.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.257087	0.39896	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.57436	0.4;0.4	3.66	1.54	0.23209	Integrin alpha-2 (1);	0.374925	0.16034	U	0.232720	T	0.54111	0.1838	M	0.61703	1.905	0.09310	N	1	P;P	0.47191	0.891;0.822	P;P	0.48952	0.596;0.471	T	0.43278	-0.9401	10	0.33141	T	0.24	.	9.7263	0.40333	0.0:0.4075:0.5925:0.0	.	501;903	Q59FA8;P08514	.;ITA2B_HUMAN	I	903	ENSP00000262407:L903I;ENSP00000340536:L903I	ENSP00000262407:L903I	L	-	1	0	ITGA2B	39808505	0.004000	0.15560	0.001000	0.08648	0.352000	0.29268	1.498000	0.35660	0.475000	0.27415	0.491000	0.48974	CTT	.	.		0.687	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439823.1		
OR4D2	124538	hgsc.bcm.edu	37	17	56247048	56247048	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:56247048A>T	ENST00000545221.1	+	1	32	c.32A>T	c.(31-33)gAc>gTc	p.D11V		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						TGGGTATCAGACTTTGTCTTC	0.463																																					p.D11V		Atlas-SNP	.											.	OR4D2	48	.	0			c.A32T						.						116.0	108.0	111.0					17																	56247048		2203	4300	6503	SO:0001583	missense	124538	exon1			TATCAGACTTTGT		CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.32A>T	chr17.hg19:g.56247048A>T	ENSP00000441354:p.Asp11Val	141.0	0.0		111.0	45.0	NM_001004707	Q6IFN8|Q96R75	Missense_Mutation	SNP	ENST00000545221.1	hg19	CCDS32688.1	.	.	.	.	.	.	.	.	.	.	A	8.969	0.972496	0.18736	.	.	ENSG00000255713	ENST00000545221	T	0.02944	4.1	5.4	5.4	0.78164	.	0.511199	0.17605	N	0.168286	T	0.02848	0.0085	N	0.13140	0.3	0.45899	D	0.998745	B	0.18013	0.025	B	0.23275	0.045	T	0.54002	-0.8358	10	0.87932	D	0	-1.0221	13.6574	0.62346	1.0:0.0:0.0:0.0	.	11	P58180	OR4D2_HUMAN	V	11	ENSP00000441354:D11V	ENSP00000441354:D11V	D	+	2	0	OR4D2	53602047	1.000000	0.71417	0.996000	0.52242	0.068000	0.16541	6.389000	0.73199	2.178000	0.69098	0.496000	0.49642	GAC	.	.		0.463	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443366.1		
SECTM1	6398	hgsc.bcm.edu	37	17	80280192	80280192	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:80280192C>T	ENST00000269389.3	-	5	942	c.592G>A	c.(592-594)Gcc>Acc	p.A198T	SECTM1_ENST00000580437.1_3'UTR	NM_003004.2	NP_002995.1	Q8WVN6	SCTM1_HUMAN	secreted and transmembrane 1	198					immune response (GO:0006955)|mesoderm development (GO:0007498)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine activity (GO:0005125)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(2)|lung(1)	4	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			CCCTGCTGGGCTCCCGCTCTG	0.652																																					p.A198T		Atlas-SNP	.											.	SECTM1	14	.	0			c.G592A						.						60.0	65.0	63.0					17																	80280192		2203	4300	6503	SO:0001583	missense	6398	exon5			GCTGGGCTCCCGC	U77643	CCDS11808.1	17q25	2008-07-18				ENSG00000141574			10707	protein-coding gene	gene with protein product	"""K12 protein"", ""type 1a transmembrane protein"""	602602				9480746	Standard	NM_003004		Approved	K12	uc002keo.3	Q8WVN6		ENST00000269389.3:c.592G>A	chr17.hg19:g.80280192C>T	ENSP00000269389:p.Ala198Thr	90.0	0.0		80.0	34.0	NM_003004	B2R7H0|O00466	Missense_Mutation	SNP	ENST00000269389.3	hg19	CCDS11808.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.747134	0.00669	.	.	ENSG00000141574	ENST00000269389	.	.	.	0.775	-0.253	0.12996	.	.	.	.	.	T	0.14527	0.0351	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.26780	-1.0093	8	0.20046	T	0.44	.	3.2483	0.06804	0.0:0.6765:0.0:0.3235	.	198;198	Q8WVN6;A8K3U3	SCTM1_HUMAN;.	T	198	.	ENSP00000269389:A198T	A	-	1	0	SECTM1	77873481	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.811000	0.01728	-0.085000	0.12573	-0.444000	0.05651	GCC	.	.		0.652	SECTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442856.1	NM_003004	
FN3KRP	79672	hgsc.bcm.edu	37	17	80684867	80684867	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr17:80684867C>T	ENST00000269373.6	+	6	823	c.750C>T	c.(748-750)ggC>ggT	p.G250G	RP11-388C12.5_ENST00000570919.1_lincRNA|FN3KRP_ENST00000535965.1_Silent_p.G200G	NM_024619.3	NP_078895.2	Q9HA64	KT3K_HUMAN	fructosamine 3 kinase related protein	250							kinase activity (GO:0016301)			breast(1)|large_intestine(2)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	7	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CAATAGCTGGCATGTTTGGGG	0.537																																					p.G250G		Atlas-SNP	.											.	FN3KRP	31	.	0			c.C750T						.						61.0	65.0	64.0					17																	80684867		2203	4300	6503	SO:0001819	synonymous_variant	79672	exon6			AGCTGGCATGTTT	AY360465	CCDS11817.1	17q25.3	2014-08-12			ENSG00000141560	ENSG00000141560			25700	protein-coding gene	gene with protein product		611683				14633848	Standard	NM_024619		Approved	FLJ12171, FN3KL	uc002kfu.3	Q9HA64	OTTHUMG00000177846	ENST00000269373.6:c.750C>T	chr17.hg19:g.80684867C>T		101.0	0.0		109.0	41.0	NM_024619	Q969F4|Q9H0U7	Silent	SNP	ENST00000269373.6	hg19	CCDS11817.1																																																																																			.	.		0.537	FN3KRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439219.1	NM_024619	
LAMA3	3909	hgsc.bcm.edu	37	18	21343451	21343451	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr18:21343451C>T	ENST00000313654.9	+	8	1387	c.1146C>T	c.(1144-1146)ggC>ggT	p.G382G	LAMA3_ENST00000399516.3_Silent_p.G382G	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	382	Domain V.|Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					ATACCCAGGGCATCTATGCTG	0.468																																					p.G382G		Atlas-SNP	.											.	LAMA3	397	.	0			c.C1146T						.						126.0	128.0	128.0					18																	21343451		2024	4183	6207	SO:0001819	synonymous_variant	3909	exon8			CCAGGGCATCTAT	L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.1146C>T	chr18.hg19:g.21343451C>T		106.0	0.0		105.0	40.0	NM_001127717	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Silent	SNP	ENST00000313654.9	hg19	CCDS42419.1																																																																																			.	.		0.468	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254824.3	NM_000227, NM_198129	
TTC39C	125488	hgsc.bcm.edu	37	18	21649143	21649143	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr18:21649143C>T	ENST00000317571.3	+	4	604	c.368C>T	c.(367-369)cCc>cTc	p.P123L	TTC39C_ENST00000578150.1_Intron|TTC39C_ENST00000304621.6_Missense_Mutation_p.P62L	NM_001135993.1	NP_001129465.1	Q8N584	TT39C_HUMAN	tetratricopeptide repeat domain 39C	123										breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|skin(1)	19						AAATCCGCCCCCTCTATGGTT	0.443																																					p.P123L		Atlas-SNP	.											.	TTC39C	83	.	0			c.C368T						.						105.0	93.0	97.0					18																	21649143		2203	4300	6503	SO:0001583	missense	125488	exon4			CCGCCCCCTCTAT	AK091080	CCDS32804.1, CCDS45839.1, CCDS58616.1	18q11.2	2014-02-07	2008-06-23	2008-06-23	ENSG00000168234	ENSG00000168234		"""Tetratricopeptide (TTC) repeat domain containing"""	26595	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 17"""	C18orf17		14702039	Standard	NM_153211		Approved	FLJ33761, HsT2697	uc002kuw.3	Q8N584	OTTHUMG00000179403	ENST00000317571.3:c.368C>T	chr18.hg19:g.21649143C>T	ENSP00000323645:p.Pro123Leu	104.0	0.0		127.0	55.0	NM_001135993	B7WP63|J3QRR1|Q0VAJ2|Q8N284	Missense_Mutation	SNP	ENST00000317571.3	hg19	CCDS45839.1	.	.	.	.	.	.	.	.	.	.	C	8.770	0.925719	0.18056	.	.	ENSG00000168234	ENST00000304621;ENST00000317571	T;T	0.40756	1.02;1.02	5.54	4.68	0.58851	.	0.481843	0.24089	N	0.041644	T	0.21962	0.0529	N	0.12182	0.205	0.21147	N	0.99977	B	0.02656	0.0	B	0.01281	0.0	T	0.11616	-1.0580	10	0.27785	T	0.31	0.2152	6.344	0.21339	0.1488:0.6893:0.0:0.1619	.	123	Q8N584	TT39C_HUMAN	L	62;123	ENSP00000306598:P62L;ENSP00000323645:P123L	ENSP00000306598:P62L	P	+	2	0	TTC39C	19903141	0.003000	0.15002	0.995000	0.50966	0.774000	0.43823	0.509000	0.22707	1.359000	0.45940	0.655000	0.94253	CCC	.	.		0.443	TTC39C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446107.1	NM_153211	
TAF4B	6875	hgsc.bcm.edu	37	18	23937719	23937719	+	Silent	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr18:23937719T>A	ENST00000269142.5	+	14	3380	c.2382T>A	c.(2380-2382)atT>atA	p.I794I	TAF4B_ENST00000578121.1_Silent_p.I799I	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	794					gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			TTGCAGCTATTGGACCAAGGA	0.343																																					p.I794I		Atlas-SNP	.											.	TAF4B	71	.	0			c.T2382A						.						98.0	85.0	89.0					18																	23937719		1836	4088	5924	SO:0001819	synonymous_variant	6875	exon14			AGCTATTGGACCA	Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.2382T>A	chr18.hg19:g.23937719T>A		419.0	1.0		560.0	219.0	NM_005640	Q29YA4|Q29YA5	Silent	SNP	ENST00000269142.5	hg19	CCDS42421.1																																																																																			.	.		0.343	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000446260.3	NM_005640	
SAFB	6294	hgsc.bcm.edu	37	19	5645350	5645350	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:5645350A>G	ENST00000292123.5	+	5	656	c.549A>G	c.(547-549)atA>atG	p.I183M	SAFB_ENST00000586934.1_3'UTR|SAFB_ENST00000454510.1_Missense_Mutation_p.I114M|SAFB_ENST00000433404.1_Missense_Mutation_p.I13M|SAFB_ENST00000592224.1_Missense_Mutation_p.I183M|SAFB_ENST00000588852.1_Missense_Mutation_p.I183M|SAFB_ENST00000538656.1_Missense_Mutation_p.I26M	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	183					chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		TTTTACAGATAGAGGACAAAG	0.299																																					p.I183M	Colon(88;338 1345 6184 8214 20897)	Atlas-SNP	.											.	SAFB	74	.	0			c.A549G						.						94.0	87.0	89.0					19																	5645350		2198	4297	6495	SO:0001583	missense	6294	exon5			ACAGATAGAGGAC	L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.549A>G	chr19.hg19:g.5645350A>G	ENSP00000292123:p.Ile183Met	76.0	0.0		137.0	36.0	NM_002967	A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Missense_Mutation	SNP	ENST00000292123.5	hg19	CCDS12142.1	.	.	.	.	.	.	.	.	.	.	A	11.37	1.618922	0.28801	.	.	ENSG00000160633	ENST00000454510;ENST00000433404;ENST00000292123;ENST00000538656	T;T;T;T	0.11063	2.9;3.06;2.93;2.81	5.31	-5.78	0.02362	.	1.274100	0.05472	N	0.553294	T	0.03390	0.0098	N	0.03115	-0.41	0.09310	N	0.999991	B;P;B;B;B;B;B	0.45176	0.113;0.852;0.08;0.0;0.08;0.08;0.08	B;B;B;B;B;B;B	0.29663	0.04;0.105;0.029;0.0;0.029;0.029;0.029	T	0.42832	-0.9428	10	0.38643	T	0.18	-3.8438	10.8267	0.46635	0.3023:0.0:0.5854:0.1123	.	26;114;183;183;183;183;183	B7Z2F6;F5H0H3;B7ZLP5;B7Z2H3;A0AV56;Q15424;B7ZLP6	.;.;.;.;.;SAFB1_HUMAN;.	M	114;13;183;26	ENSP00000415895:I114M;ENSP00000404545:I13M;ENSP00000292123:I183M;ENSP00000438880:I26M	ENSP00000292123:I183M	I	+	3	3	SAFB	5596350	0.000000	0.05858	0.183000	0.23137	0.856000	0.48823	-1.525000	0.02231	-1.165000	0.02786	-0.400000	0.06385	ATA	.	.		0.299	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000451641.2		
FBN3	84467	hgsc.bcm.edu	37	19	8191482	8191482	+	Silent	SNP	G	G	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:8191482G>A	ENST00000600128.1	-	20	2838	c.2424C>T	c.(2422-2424)acC>acT	p.T808T	FBN3_ENST00000601739.1_Silent_p.T808T|FBN3_ENST00000270509.2_Silent_p.T808T			Q75N90	FBN3_HUMAN	fibrillin 3	808						proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						AGGTGCCCTTGGTGCTGTCTG	0.667																																					p.T808T		Atlas-SNP	.											.	FBN3	300	.	0			c.C2424T						.						37.0	34.0	35.0					19																	8191482		2203	4300	6503	SO:0001819	synonymous_variant	84467	exon19			GCCCTTGGTGCTG		CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.2424C>T	chr19.hg19:g.8191482G>A		44.0	0.0		72.0	13.0	NM_032447	Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Silent	SNP	ENST00000600128.1	hg19	CCDS12196.1																																																																																			.	.		0.667	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461428.2	NM_032447	
DOCK6	57572	hgsc.bcm.edu	37	19	11339658	11339658	+	Silent	SNP	G	G	A	rs201482446	byFrequency	TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:11339658G>A	ENST00000294618.7	-	23	2783	c.2772C>T	c.(2770-2772)cgC>cgT	p.R924R	DOCK6_ENST00000319867.7_Silent_p.R263R	NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	924					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						GGATGGCCTCGCGTACGGCAC	0.647																																					p.R924R		Atlas-SNP	.											.	DOCK6	104	.	0			c.C2772T						.						38.0	43.0	41.0					19																	11339658		2150	4248	6398	SO:0001819	synonymous_variant	57572	exon23			GGCCTCGCGTACG		CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.2772C>T	chr19.hg19:g.11339658G>A		129.0	0.0		163.0	47.0	NM_020812	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	ENST00000294618.7	hg19	CCDS45975.1																																																																																			.	G|0.998;C|0.002		0.647	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453155.1	NM_020812	
ZNF20	7568	hgsc.bcm.edu	37	19	12244794	12244794	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:12244794C>T	ENST00000334213.5	-	4	431	c.207G>A	c.(205-207)atG>atA	p.M69I	ZNF20_ENST00000485451.1_5'UTR|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000600335.1_Intron	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	69	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						GTTTCTCTCTCATAAGACTTC	0.413																																					p.M69I		Atlas-SNP	.											.	ZNF20	86	.	0			c.G207A						.						66.0	60.0	62.0					19																	12244794		1879	4107	5986	SO:0001583	missense	7568	exon4			CTCTCTCATAAGA	X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.207G>A	chr19.hg19:g.12244794C>T	ENSP00000335437:p.Met69Ile	27.0	0.0		71.0	22.0	NM_021143	Q8N457|Q9UG41	Missense_Mutation	SNP	ENST00000334213.5	hg19	CCDS45986.1	.	.	.	.	.	.	.	.	.	.	C	0.731	-0.779892	0.02929	.	.	ENSG00000132010	ENST00000334213;ENST00000292241;ENST00000418866	T;T	0.05447	3.44;6.81	0.94	-1.88	0.07713	Krueppel-associated box (1);	.	.	.	.	T	0.03178	0.0093	N	0.16478	0.41	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.43212	-0.9405	9	0.31617	T	0.26	.	2.0414	0.03551	0.257:0.3425:0.0:0.4005	.	69	P17024	ZNF20_HUMAN	I	69;69;66	ENSP00000335437:M69I;ENSP00000390115:M66I	ENSP00000292241:M69I	M	-	3	0	ZNF20	12105794	0.000000	0.05858	0.000000	0.03702	0.138000	0.21146	-1.142000	0.03203	-1.394000	0.02077	-0.823000	0.03104	ATG	.	.		0.413	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344101.1	NM_021143	
MVB12A	93343	hgsc.bcm.edu	37	19	17534830	17534830	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:17534830C>T	ENST00000317040.7	+	7	1711	c.656C>T	c.(655-657)cCc>cTc	p.P219L	MVB12A_ENST00000528515.1_Missense_Mutation_p.P177S|MVB12A_ENST00000392702.2_Missense_Mutation_p.P179L|MVB12A_ENST00000529939.1_Missense_Mutation_p.P219L|MVB12A_ENST00000543795.1_Missense_Mutation_p.P219L|CTD-2521M24.6_ENST00000593957.1_RNA			Q96EY5	MB12A_HUMAN	multivesicular body subunit 12A	219	Interaction with TSG101, VPS37B and VPS28.|UMA. {ECO:0000255|PROSITE- ProRule:PRU00830}.				protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|vesicle (GO:0031982)	lipid binding (GO:0008289)|ubiquitin binding (GO:0043130)										GATGGGGTTCCCTTCACACTC	0.637																																					p.P219L		Atlas-SNP	.											.	.	.	.	0			c.C656T						.						91.0	76.0	81.0					19																	17534830		2203	4300	6503	SO:0001583	missense	93343	exon7			GGGTTCCCTTCAC	BC011840	CCDS12359.1	19p13.11	2013-10-11	2012-12-03	2012-12-03	ENSG00000141971	ENSG00000141971			25153	protein-coding gene	gene with protein product			"""family with sequence similarity 125, member A"""	FAM125A		18005716, 20654576, 22232651	Standard	NM_138401		Approved	FLJ32495	uc002ngo.1	Q96EY5	OTTHUMG00000166252	ENST00000317040.7:c.656C>T	chr19.hg19:g.17534830C>T	ENSP00000324810:p.Pro219Leu	25.0	0.0		42.0	14.0	NM_138401	Q96I18	Missense_Mutation	SNP	ENST00000317040.7	hg19	CCDS12359.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	21.2|21.2	4.117011|4.117011	0.77323|0.77323	.|.	.|.	ENSG00000141971|ENSG00000141971	ENST00000528604;ENST00000317040;ENST00000392702;ENST00000529939;ENST00000543795|ENST00000528515	T;T;T;T;T|.	0.63744|.	-0.06;-0.06;-0.06;-0.06;-0.06|.	4.97|4.97	4.97|4.97	0.65823|0.65823	UMA domain (1);|.	0.000000|0.000000	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.73329|0.73329	0.3573|0.3573	M|M	0.71581|0.71581	2.175|2.175	0.58432|0.58432	D|D	0.999994|0.999994	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.76506|0.76506	-0.2934|-0.2934	10|7	0.87932|0.66056	D|D	0|0.02	7.0E-4|7.0E-4	13.7604|13.7604	0.62961|0.62961	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	219|.	Q96EY5|.	F125A_HUMAN|.	L|S	80;219;179;219;219|177	ENSP00000435052:P80L;ENSP00000324810:P219L;ENSP00000376466:P179L;ENSP00000432526:P219L;ENSP00000444653:P219L|.	ENSP00000324810:P219L|ENSP00000433677:P177S	P|P	+|+	2|1	0|0	FAM125A|FAM125A	17395830|17395830	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	5.053000|5.053000	0.64269|0.64269	2.315000|2.315000	0.78130|0.78130	0.558000|0.558000	0.71614|0.71614	CCC|CCT	.	.		0.637	MVB12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388723.2	NM_138401	
LPAR2	9170	hgsc.bcm.edu	37	19	19737371	19737371	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:19737371C>T	ENST00000542587.1	-	5	1625	c.723G>A	c.(721-723)aaG>aaA	p.K241K	LPAR2_ENST00000586703.1_Silent_p.K241K|LPAR2_ENST00000407877.3_Silent_p.K241K|LPAR2_ENST00000589311.1_5'Flank			Q9HBW0	LPAR2_HUMAN	lysophosphatidic acid receptor 2	241					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of Rho protein signal transduction (GO:0035025)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|lysophosphatidic acid receptor activity (GO:0070915)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	10						TGACAACAGTCTTGACCAGGC	0.597																																					p.K241K		Atlas-SNP	.											.	LPAR2	28	.	0			c.G723A						.						83.0	94.0	90.0					19																	19737371		2194	4292	6486	SO:0001819	synonymous_variant	9170	exon2			AACAGTCTTGACC	AF011466	CCDS12407.1	19p12	2012-08-08	2008-04-11	2008-04-11		ENSG00000064547		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3168	protein-coding gene	gene with protein product		605110	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4"""	EDG4		9525886, 9804623	Standard	NM_004720		Approved	EDG-4, LPA2	uc002nnb.4	Q9HBW0		ENST00000542587.1:c.723G>A	chr19.hg19:g.19737371C>T		152.0	0.0		221.0	57.0	NM_004720	O00543|O43431	Silent	SNP	ENST00000542587.1	hg19	CCDS12407.1																																																																																			.	.		0.597	LPAR2-003	KNOWN	alternative_5_UTR|non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460544.1	NM_004720	
ZNF14	7561	hgsc.bcm.edu	37	19	19823467	19823467	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:19823467T>C	ENST00000344099.3	-	4	761	c.623A>G	c.(622-624)tAt>tGt	p.Y208C		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	208					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AGACTGGTAATATATAAAGGT	0.358																																					p.Y208C		Atlas-SNP	.											.	ZNF14	89	.	0			c.A623G						.						63.0	64.0	64.0					19																	19823467		2203	4300	6503	SO:0001583	missense	7561	exon4			TGGTAATATATAA	AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.623A>G	chr19.hg19:g.19823467T>C	ENSP00000340514:p.Tyr208Cys	114.0	0.0		179.0	45.0	NM_021030	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	ENST00000344099.3	hg19	CCDS12409.1	.	.	.	.	.	.	.	.	.	.	T	9.599	1.128182	0.20959	.	.	ENSG00000105708	ENST00000344099	T	0.08546	3.08	1.86	-0.936	0.10419	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04588	0.0125	N	0.17838	0.53	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.41179	-0.9523	9	0.37606	T	0.19	.	3.164	0.06529	0.0:0.1663:0.2438:0.5899	.	208	P17017	ZNF14_HUMAN	C	208	ENSP00000340514:Y208C	ENSP00000340514:Y208C	Y	-	2	0	ZNF14	19684467	0.000000	0.05858	0.000000	0.03702	0.859000	0.49053	0.146000	0.16180	-0.498000	0.06632	0.383000	0.25322	TAT	.	.		0.358	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460775.1	NM_021030	
RYR1	6261	hgsc.bcm.edu	37	19	39068789	39068789	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:39068789T>A	ENST00000359596.3	+	99	14309	c.14309T>A	c.(14308-14310)aTg>aAg	p.M4770K	RYR1_ENST00000360985.3_Missense_Mutation_p.M4765K|RYR1_ENST00000355481.4_Missense_Mutation_p.M4765K			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4770					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CACAGGCTCATGTCCATCGAT	0.627																																					p.M4770K		Atlas-SNP	.											.	RYR1	708	.	0			c.T14309A						.						52.0	48.0	49.0					19																	39068789		2203	4300	6503	SO:0001583	missense	6261	exon99			GGCTCATGTCCAT	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14309T>A	chr19.hg19:g.39068789T>A	ENSP00000352608:p.Met4770Lys	81.0	0.0		111.0	34.0	NM_000540	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	T	11.45	1.641536	0.29157	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96427	-4.01;-4.01;-4.01	4.93	4.93	0.64822	.	0.152050	0.41001	U	0.000979	D	0.91123	0.7205	L	0.36672	1.1	0.34127	D	0.664818	B;B	0.26775	0.131;0.159	B;B	0.27262	0.046;0.078	D	0.87234	0.2262	10	0.19590	T	0.45	.	3.9929	0.09545	0.0:0.167:0.1869:0.6461	.	4765;4770	P21817-2;P21817	.;RYR1_HUMAN	K	4770;4765;4765	ENSP00000352608:M4770K;ENSP00000347667:M4765K;ENSP00000354254:M4765K	ENSP00000347667:M4765K	M	+	2	0	RYR1	43760629	0.947000	0.32204	1.000000	0.80357	0.985000	0.73830	0.534000	0.23098	2.077000	0.62373	0.454000	0.30748	ATG	.	.		0.627	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
FCGBP	8857	hgsc.bcm.edu	37	19	40366455	40366455	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:40366455C>T	ENST00000221347.6	-	30	13786	c.13779G>A	c.(13777-13779)ggG>ggA	p.G4593G		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4593	VWFD 11. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CGAAGCTGTCCCCATCGAAAG	0.662																																					p.G4593G		Atlas-SNP	.											.	FCGBP	416	.	0			c.G13779A						.						34.0	40.0	38.0					19																	40366455		2199	4298	6497	SO:0001819	synonymous_variant	8857	exon30			GCTGTCCCCATCG	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.13779G>A	chr19.hg19:g.40366455C>T		147.0	0.0		260.0	56.0	NM_003890	O95784	Silent	SNP	ENST00000221347.6	hg19	CCDS12546.1																																																																																			.	.		0.662	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41787180	41787180	+	Splice_Site	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:41787180G>T	ENST00000392006.3	+	7	1172	c.999G>T	c.(997-999)gcG>gcT	p.A333A	HNRNPUL1_ENST00000595018.1_Splice_Site_p.A233A|HNRNPUL1_ENST00000352456.3_Splice_Site_p.A233A|HNRNPUL1_ENST00000263367.3_Splice_Site_p.A244A|HNRNPUL1_ENST00000378215.4_Intron|HNRNPUL1_ENST00000602130.1_Splice_Site_p.A333A|HNRNPUL1_ENST00000593587.1_Splice_Site_p.A233A	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	333	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Necessary for interaction with TP53.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						GCTGCTTTGCGGTGAGTGCTA	0.502																																					p.A333A		Atlas-SNP	.											.	HNRNPUL1	73	.	0			c.G999T						.						68.0	50.0	56.0					19																	41787180		2203	4300	6503	SO:0001630	splice_region_variant	11100	exon7			CTTTGCGGTGAGT	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.999+1G>T	chr19.hg19:g.41787180G>T		87.0	0.0		203.0	46.0	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Silent	SNP	ENST00000392006.3	hg19	CCDS12576.1																																																																																			.	.		0.502	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	Silent
IRGC	56269	hgsc.bcm.edu	37	19	44223843	44223843	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:44223843T>G	ENST00000244314.5	+	2	1332	c.1133T>G	c.(1132-1134)tTt>tGt	p.F378C		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	378						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				GGCATCAGCTTTGGCGCTGTC	0.667																																					p.F378C	Colon(189;350 2037 11447 13433 38914)	Atlas-SNP	.											.	IRGC	67	.	0			c.T1133G						.						33.0	29.0	30.0					19																	44223843		2203	4300	6503	SO:0001583	missense	56269	exon2			TCAGCTTTGGCGC	BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.1133T>G	chr19.hg19:g.44223843T>G	ENSP00000244314:p.Phe378Cys	69.0	0.0		113.0	29.0	NM_019612	Q05BR8	Missense_Mutation	SNP	ENST00000244314.5	hg19	CCDS12629.1	.	.	.	.	.	.	.	.	.	.	T	13.14	2.149132	0.37923	.	.	ENSG00000124449	ENST00000244314	T	0.28255	1.62	4.78	4.78	0.61160	.	0.074705	0.56097	D	0.000034	T	0.48187	0.1486	L	0.50333	1.59	0.32833	D	0.504261	D	0.89917	1.0	D	0.83275	0.996	T	0.61113	-0.7128	10	0.62326	D	0.03	.	12.2724	0.54714	0.0:0.0:0.0:1.0	.	378	Q6NXR0	IIGP5_HUMAN	C	378	ENSP00000244314:F378C	ENSP00000244314:F378C	F	+	2	0	IRGC	48915683	0.995000	0.38212	1.000000	0.80357	0.537000	0.34900	2.486000	0.45259	1.804000	0.52760	0.533000	0.62120	TTT	.	.		0.667	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336191.1	NM_019612	
SHANK1	50944	hgsc.bcm.edu	37	19	51170365	51170365	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:51170365C>A	ENST00000293441.1	-	22	4870	c.4852G>T	c.(4852-4854)Gac>Tac	p.D1618Y	SHANK1_ENST00000391813.1_Missense_Mutation_p.D1005Y|SHANK1_ENST00000391814.1_Missense_Mutation_p.D1626Y|SYT3_ENST00000544769.1_Intron|SHANK1_ENST00000359082.3_Missense_Mutation_p.D1609Y	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1618					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GCGGTGGAGTCCAGGGTGGGA	0.741																																					p.D1618Y		Atlas-SNP	.											.	SHANK1	210	.	0			c.G4852T						.						6.0	7.0	6.0					19																	51170365		2103	4139	6242	SO:0001583	missense	50944	exon22			TGGAGTCCAGGGT	AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.4852G>T	chr19.hg19:g.51170365C>A	ENSP00000293441:p.Asp1618Tyr	48.0	0.0		110.0	30.0	NM_016148	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	ENST00000293441.1	hg19	CCDS12799.1	.	.	.	.	.	.	.	.	.	.	C	9.919	1.211589	0.22289	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.50277	0.83;1.37;0.81;0.75	2.39	2.39	0.29439	.	0.373786	0.24703	U	0.036292	T	0.58666	0.2138	L	0.46157	1.445	0.53005	D	0.999969	D;D	0.89917	1.0;1.0	D;D	0.79108	0.981;0.992	T	0.61302	-0.7090	10	0.72032	D	0.01	.	11.7292	0.51726	0.0:1.0:0.0:0.0	.	1618;1005	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	Y	1618;1005;1609;1626	ENSP00000293441:D1618Y;ENSP00000375689:D1005Y;ENSP00000351984:D1609Y;ENSP00000375690:D1626Y	ENSP00000293441:D1618Y	D	-	1	0	SHANK1	55862177	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	5.427000	0.66483	1.043000	0.40175	0.205000	0.17691	GAC	.	.		0.741	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268071.1	NM_016148	
KLK6	5653	hgsc.bcm.edu	37	19	51462563	51462563	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:51462563C>A	ENST00000376851.3	-	6	1031	c.592G>T	c.(592-594)Ggg>Tgg	p.G198W	KLK6_ENST00000456750.2_Missense_Mutation_p.G91W|KLK6_ENST00000594641.1_Missense_Mutation_p.G198W|KLK6_ENST00000376853.4_Silent_p.L69L|CTB-147C22.8_ENST00000594939.1_RNA|KLK6_ENST00000310157.2_Missense_Mutation_p.G198W|KLK6_ENST00000391808.1_Missense_Mutation_p.G91W|CTB-147C22.8_ENST00000601506.1_RNA	NM_001012964.1	NP_001012982.1	Q92876	KLK6_HUMAN	kallikrein-related peptidase 6	198	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amyloid precursor protein metabolic process (GO:0042982)|central nervous system development (GO:0007417)|collagen catabolic process (GO:0030574)|hormone metabolic process (GO:0042445)|myelination (GO:0042552)|neuron death (GO:0070997)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|protein autoprocessing (GO:0016540)|regulation of cell differentiation (GO:0045595)|regulation of neuron projection development (GO:0010975)|response to wounding (GO:0009611)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|skin(4)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00372)|GBM - Glioblastoma multiforme(134;0.00871)		AGCGGACCCCCAGAATCACCC	0.532																																					p.G198W		Atlas-SNP	.											.	KLK6	35	.	0			c.G592T						.						113.0	105.0	108.0					19																	51462563		2203	4300	6503	SO:0001583	missense	5653	exon6			GACCCCCAGAATC	U62801	CCDS12811.1, CCDS42599.1	19q13.3	2011-09-07	2006-10-27			ENSG00000167755		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6367	protein-coding gene	gene with protein product		602652	"""protease, serine, 18"", ""kallikrein 6 (neurosin, zyme)"""	PRSS9, PRSS18		9003450, 16800724, 16800723	Standard	NM_002774		Approved	Bssp, Klk7, neurosin	uc002pui.3	Q92876		ENST00000376851.3:c.592G>T	chr19.hg19:g.51462563C>A	ENSP00000366047:p.Gly198Trp	126.0	0.0		193.0	42.0	NM_001012964	A6NJA1|A8MW09|Q6H301	Missense_Mutation	SNP	ENST00000376851.3	hg19	CCDS12811.1	.	.	.	.	.	.	.	.	.	.	N	13.69	2.312081	0.40895	.	.	ENSG00000167755	ENST00000310157;ENST00000376851;ENST00000391808;ENST00000456750	D;D;D;D	0.99871	-7.35;-7.35;-7.35;-7.35	3.89	3.89	0.44902	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.99919	0.9962	H	0.99464	4.58	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95920	0.8930	9	0.87932	D	0	.	13.7773	0.63062	0.0:1.0:0.0:0.0	.	198;91	Q92876;Q92876-2	KLK6_HUMAN;.	W	198;198;91;91	ENSP00000309148:G198W;ENSP00000366047:G198W;ENSP00000375684:G91W;ENSP00000409241:G91W	ENSP00000309148:G198W	G	-	1	0	KLK6	56154375	1.000000	0.71417	0.505000	0.27651	0.043000	0.13939	6.767000	0.74975	2.156000	0.67533	0.645000	0.84053	GGG	.	.		0.532	KLK6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465060.1	NM_002774	
CD33	945	hgsc.bcm.edu	37	19	51729149	51729149	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:51729149A>G	ENST00000262262.4	+	3	530	c.509A>G	c.(508-510)gAg>gGg	p.E170G	CD33_ENST00000391796.3_Missense_Mutation_p.E170G|CD33_ENST00000436584.2_Missense_Mutation_p.E43G|CD33_ENST00000421133.2_Missense_Mutation_p.E43G	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	170	Ig-like C2-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TGGGCCTGTGAGCAGGGAACA	0.607																																					p.E170G		Atlas-SNP	.											.	CD33	55	.	0			c.A509G						.						89.0	87.0	88.0					19																	51729149		2203	4300	6503	SO:0001583	missense	945	exon3			CCTGTGAGCAGGG	M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.509A>G	chr19.hg19:g.51729149A>G	ENSP00000262262:p.Glu170Gly	52.0	0.0		97.0	19.0	NM_001772	B4E3P8|C9JEN7|F8WAL2|Q8TD24	Missense_Mutation	SNP	ENST00000262262.4	hg19	CCDS33084.1	.	.	.	.	.	.	.	.	.	.	.	13.82	2.350121	0.41599	.	.	ENSG00000105383	ENST00000436584;ENST00000262262;ENST00000421133;ENST00000391796	T;T;T;T	0.03386	3.95;3.95;3.95;3.95	3.07	2.04	0.26737	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.496120	0.14910	N	0.291331	T	0.09202	0.0227	M	0.83483	2.645	0.09310	N	1	B;B;B	0.32302	0.363;0.073;0.046	B;B;B	0.42692	0.395;0.14;0.033	T	0.13980	-1.0489	10	0.62326	D	0.03	.	4.344	0.11124	0.8389:0.0:0.1611:0.0	.	43;170;170	C9JEN7;F8WAL2;P20138	.;.;CD33_HUMAN	G	43;170;43;170	ENSP00000403331:E43G;ENSP00000262262:E170G;ENSP00000410126:E43G;ENSP00000375673:E170G	ENSP00000262262:E170G	E	+	2	0	CD33	56420961	0.364000	0.24997	0.364000	0.25888	0.606000	0.37113	2.064000	0.41432	1.409000	0.46915	0.374000	0.22700	GAG	.	.		0.607	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464199.2	NM_001772	
ZNF845	91664	hgsc.bcm.edu	37	19	53855788	53855788	+	Silent	SNP	A	A	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:53855788A>G	ENST00000595091.1	+	5	2079	c.1860A>G	c.(1858-1860)tcA>tcG	p.S620S	ZNF845_ENST00000458035.1_Silent_p.S620S			Q96IR2	ZN845_HUMAN	zinc finger protein 845	620					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(10)|lung(7)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	26						GACATCGTTCATACCTTGCAG	0.358																																					p.S620S		Atlas-SNP	.											.	ZNF845	101	.	0			c.A1860G						.						30.0	25.0	27.0					19																	53855788		692	1590	2282	SO:0001819	synonymous_variant	91664	exon4			TCGTTCATACCTT	BC007307	CCDS46170.1	19q13.42	2013-01-08			ENSG00000213799	ENSG00000213799		"""Zinc fingers, C2H2-type"", ""-"""	25112	protein-coding gene	gene with protein product							Standard	NM_138374		Approved		uc010ydv.1	Q96IR2		ENST00000595091.1:c.1860A>G	chr19.hg19:g.53855788A>G		89.0	0.0		136.0	61.0	NM_138374		Silent	SNP	ENST00000595091.1	hg19	CCDS46170.1																																																																																			.	.		0.358	ZNF845-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464359.1	XM_039908	
CDC42EP5	148170	hgsc.bcm.edu	37	19	54976410	54976410	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:54976410C>A	ENST00000301200.2	-	3	663	c.322G>T	c.(322-324)Gac>Tac	p.D108Y	LENG9_ENST00000333834.4_5'Flank	NM_145057.2	NP_659494.2	Q6NZY7	BORG3_HUMAN	CDC42 effector protein (Rho GTPase binding) 5	108					JNK cascade (GO:0007254)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)			lung(1)|skin(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.138)		CGCGCCGCGTCCATGACGCCC	0.781																																					p.D108Y		Atlas-SNP	.											.	CDC42EP5	4	.	0			c.G322T						.						2.0	3.0	2.0					19																	54976410		1595	3290	4885	SO:0001583	missense	148170	exon3			CCGCGTCCATGAC	BC024327	CCDS12896.1	19q13.42	2008-02-05			ENSG00000167617	ENSG00000167617			17408	protein-coding gene	gene with protein product		609171					Standard	NM_145057		Approved	CEP5, Borg3	uc002qfz.1	Q6NZY7	OTTHUMG00000065699	ENST00000301200.2:c.322G>T	chr19.hg19:g.54976410C>A	ENSP00000301200:p.Asp108Tyr	25.0	0.0		28.0	8.0	NM_145057	B0VJZ2|Q8TB51	Missense_Mutation	SNP	ENST00000301200.2	hg19	CCDS12896.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.198283	0.58126	.	.	ENSG00000167617	ENST00000301200	T	0.52057	0.68	3.07	3.07	0.35406	.	0.000000	0.37857	U	0.001901	T	0.46833	0.1413	M	0.79123	2.44	0.36916	D	0.89116	P	0.43094	0.799	B	0.40702	0.338	T	0.60434	-0.7264	10	0.66056	D	0.02	-6.5555	7.6538	0.28363	0.2524:0.7476:0.0:0.0	.	108	Q6NZY7	BORG3_HUMAN	Y	108	ENSP00000301200:D108Y	ENSP00000301200:D108Y	D	-	1	0	CDC42EP5	59668222	0.999000	0.42202	0.998000	0.56505	0.796000	0.44982	1.853000	0.39358	1.743000	0.51761	0.555000	0.69702	GAC	.	.		0.781	CDC42EP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140804.1	NM_145057	
PPP6R1	22870	hgsc.bcm.edu	37	19	55756527	55756527	+	Silent	SNP	C	C	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:55756527C>T	ENST00000412770.2	-	5	1145	c.579G>A	c.(577-579)caG>caA	p.Q193Q	PPP6R1_ENST00000587283.1_Silent_p.Q193Q	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	193	Interaction with PPP6C.				regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						CAATCAGCCGCTGGACGATCT	0.632																																					p.Q193Q		Atlas-SNP	.											.	PPP6R1	63	.	0			c.G579A						.						58.0	71.0	67.0					19																	55756527		2123	4241	6364	SO:0001819	synonymous_variant	22870	exon5			CAGCCGCTGGACG	AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.579G>A	chr19.hg19:g.55756527C>T		60.0	0.0		128.0	23.0	NM_014931	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Silent	SNP	ENST00000412770.2	hg19	CCDS46186.1																																																																																			.	.		0.632	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452663.1	NM_014931	
BPIFB4	149954	hgsc.bcm.edu	37	20	31671301	31671301	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr20:31671301G>T	ENST00000375483.3	+	3	298	c.298G>T	c.(298-300)Ggg>Tgg	p.G100W		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	100						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TGCTCAGCTGGGGGGCAAATA	0.522																																					p.G100W		Atlas-SNP	.											.	.	.	.	0			c.G298T						.						83.0	75.0	78.0					20																	31671301		2203	4300	6503	SO:0001583	missense	149954	exon3			CAGCTGGGGGGCA	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.298G>T	chr20.hg19:g.31671301G>T	ENSP00000364632:p.Gly100Trp	116.0	0.0		124.0	55.0	NM_182519	Q5TDX6	Missense_Mutation	SNP	ENST00000375483.3	hg19	CCDS13213.2	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931534	0.34096	.	.	ENSG00000186191	ENST00000375483	T	0.02103	4.45	3.28	3.28	0.37604	.	0.291835	0.22981	N	0.053309	T	0.06234	0.0161	L	0.32530	0.975	0.35533	D	0.802407	D	0.89917	1.0	D	0.83275	0.996	T	0.36768	-0.9734	10	0.87932	D	0	-14.8948	10.1994	0.43073	0.0:0.0:1.0:0.0	.	100	P59827	BPIB4_HUMAN	W	100	ENSP00000364632:G100W	ENSP00000364632:G100W	G	+	1	0	BPIFB4	31134962	1.000000	0.71417	1.000000	0.80357	0.307000	0.27823	2.936000	0.48971	1.827000	0.53221	0.462000	0.41574	GGG	.	.		0.522	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
CHD6	84181	hgsc.bcm.edu	37	20	40127986	40127986	+	Silent	SNP	T	T	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr20:40127986T>C	ENST00000373233.3	-	6	1041	c.864A>G	c.(862-864)gaA>gaG	p.E288E	CHD6_ENST00000373222.3_Silent_p.E323E|CHD6_ENST00000309279.7_Silent_p.E288E	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	288	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TTGCATCATCTTCTGGAGGCT	0.388																																					p.E288E		Atlas-SNP	.											.	CHD6	312	.	0			c.A864G						.						58.0	48.0	51.0					20																	40127986		2203	4300	6503	SO:0001819	synonymous_variant	84181	exon6			ATCATCTTCTGGA	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.864A>G	chr20.hg19:g.40127986T>C		77.0	0.0		64.0	31.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	hg19	CCDS13317.1																																																																																			.	.		0.388	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
ST13	6767	hgsc.bcm.edu	37	22	41252470	41252470	+	Silent	SNP	G	G	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr22:41252470G>C	ENST00000216218.3	-	1	556	c.75C>G	c.(73-75)acC>acG	p.T25T	XPNPEP3_ENST00000357137.4_5'Flank|XPNPEP3_ENST00000414396.1_5'Flank|XPNPEP3_ENST00000541156.1_5'Flank	NM_003932.3	NP_003923.2	P50502	F10A1_HUMAN	suppression of tumorigenicity 13 (colon carcinoma) (Hsp70 interacting protein)	25					chaperone cofactor-dependent protein refolding (GO:0070389)|negative regulation of protein refolding (GO:0061084)|protein folding (GO:0006457)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	dATP binding (GO:0032564)|protein binding, bridging (GO:0030674)			cervix(1)|large_intestine(1)|lung(3)|skin(1)	6						GCATTTCCTCGGTGTGCAGAA	0.637																																					p.T25T		Atlas-SNP	.											.	ST13	16	.	0			c.C75G						.						60.0	64.0	62.0					22																	41252470		2203	4300	6503	SO:0001819	synonymous_variant	6767	exon1			TTCCTCGGTGTGC		CCDS14006.1	22q13.2	2013-01-10	2001-11-29		ENSG00000100380	ENSG00000100380		"""Tetratricopeptide (TTC) repeat domain containing"""	11343	protein-coding gene	gene with protein product	"""progesterone receptor-associated p48 protein"""	606796	"""suppression of tumorigenicity 13 (colon carcinoma) (Hsp70-interacting protein)"""			9925927, 8721986	Standard	NM_003932		Approved	SNC6, HSPABP1, HIP, P48, FAM10A1	uc003aze.3	P50502	OTTHUMG00000151201	ENST00000216218.3:c.75C>G	chr22.hg19:g.41252470G>C		399.0	0.0		482.0	27.0	NM_003932	O14999|Q2TU77	Silent	SNP	ENST00000216218.3	hg19	CCDS14006.1																																																																																			.	.		0.637	ST13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321759.1	NM_003932	
CAPN6	827	hgsc.bcm.edu	37	X	110490682	110490682	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chrX:110490682G>T	ENST00000324068.1	-	12	1824	c.1657C>A	c.(1657-1659)Cct>Act	p.P553T	CAPN6_ENST00000541758.1_Missense_Mutation_p.P298T	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	553	C2.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						TTCTGGACAGGAGAACGGACT	0.398																																					p.P553T		Atlas-SNP	.											.	CAPN6	120	.	0			c.C1657A						.						153.0	130.0	138.0					X																	110490682		2203	4300	6503	SO:0001583	missense	827	exon12			GGACAGGAGAACG	AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.1657C>A	chrX.hg19:g.110490682G>T	ENSP00000317214:p.Pro553Thr	160.0	0.0		137.0	16.0	NM_014289	D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	ENST00000324068.1	hg19	CCDS14555.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.448025	0.26074	.	.	ENSG00000077274	ENST00000324068;ENST00000541758	T;T	0.68181	-0.31;-0.31	4.99	4.99	0.66335	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	1.323950	0.04588	N	0.396165	T	0.58061	0.2096	N	0.24115	0.695	0.32655	N	0.518917	B	0.33777	0.425	B	0.36378	0.223	T	0.53479	-0.8433	10	0.37606	T	0.19	.	9.7844	0.40666	0.0974:0.0:0.9026:0.0	.	553	Q9Y6Q1	CAN6_HUMAN	T	553;298	ENSP00000317214:P553T;ENSP00000441736:P298T	ENSP00000317214:P553T	P	-	1	0	CAPN6	110377338	0.325000	0.24660	1.000000	0.80357	0.989000	0.77384	0.534000	0.23098	2.308000	0.77769	0.517000	0.50305	CCT	.	.		0.398	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057922.1		
GRIA3	2892	hgsc.bcm.edu	37	X	122551286	122551286	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chrX:122551286A>C	ENST00000371251.1	+	11	1586	c.1534A>C	c.(1534-1536)Aca>Cca	p.T512P	GRIA3_ENST00000542149.1_Missense_Mutation_p.T512P|GRIA3_ENST00000264357.5_Missense_Mutation_p.T512P|GRIA3_ENST00000541091.1_Missense_Mutation_p.T496P|GRIA3_ENST00000371256.5_Missense_Mutation_p.T512P			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	512					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	ACTCACTATAACATTGGTCCG	0.358																																					p.T512P		Atlas-SNP	.											.	GRIA3	386	.	0			c.A1534C						.						120.0	122.0	121.0					X																	122551286		2203	4300	6503	SO:0001583	missense	2892	exon11			ACTATAACATTGG	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1534A>C	chrX.hg19:g.122551286A>C	ENSP00000360297:p.Thr512Pro	145.0	0.0		299.0	129.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	ENST00000371251.1	hg19	CCDS14604.1	.	.	.	.	.	.	.	.	.	.	A	19.62	3.862388	0.71949	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	T;T;T;T;T	0.62105	0.69;0.69;0.69;0.69;0.05	5.84	5.84	0.93424	Ionotropic glutamate receptor (1);	0.000000	0.85682	D	0.000000	D	0.87398	0.6167	H	0.98769	4.325	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.80764	0.993;0.986;0.994	D	0.92172	0.5744	10	0.87932	D	0	.	14.2236	0.65843	1.0:0.0:0.0:0.0	.	496;512;512	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	P	512;512;512;512;496	ENSP00000264357:T512P;ENSP00000446146:T512P;ENSP00000360302:T512P;ENSP00000360297:T512P;ENSP00000446440:T496P	ENSP00000264357:T512P	T	+	1	0	GRIA3	122378967	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.327000	0.79147	1.957000	0.56846	0.486000	0.48141	ACA	.	.		0.358	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
Unknown	0	hgsc.bcm.edu	37	X	139174143	139174143	+	IGR	SNP	T	T	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chrX:139174143T>G								RN7SL727P (5836 upstream) : AC004070.1 (124043 downstream)																							CAGCAAGGACTTTCCATGTGG	0.577																																					p.L81R		Atlas-SNP	.											.	.	.	.	0			c.T242G						.																																			SO:0001628	intergenic_variant	0	exon1			AAGGACTTTCCAT																													chrX.hg19:g.139174143T>G		3.0	0.0		16.0	8.0	NM_001271560		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.577								
SLC17A7	57030	hgsc.bcm.edu	37	19	49937289	49937289	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:49937289delC	ENST00000221485.3	-	6	823	c.652delG	c.(652-654)gcgfs	p.A218fs	SLC17A7_ENST00000600601.1_Frame_Shift_Del_p.A151fs|SLC17A7_ENST00000543531.1_Frame_Shift_Del_p.A206fs	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	218					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		GCGACCACCGCCCCAGCATAG	0.632																																					p.A218fs		Atlas-Indel,Pindel	.											SLC17A7,colon,carcinoma,0,1	SLC17A7	57	.	0			c.653delC						.						31.0	32.0	32.0					19																	49937289		2203	4299	6502	SO:0001589	frameshift_variant	57030	exon6			.	AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.652delG	chr19.hg19:g.49937289delC	ENSP00000221485:p.Ala218fs	201.0	0.0		437.0	81.0	NM_020309	B4DFR9|B4DG46|Q6PCD0	Frame_Shift_Del	DEL	ENST00000221485.3	hg19	CCDS12764.1																																																																																			.	.		0.632	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2		
WAPAL	23063	hgsc.bcm.edu	37	10	88231999	88232010	+	In_Frame_Del	DEL	TTAAGCCACTTA	TTAAGCCACTTA	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	TTAAGCCACTTA	TTAAGCCACTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr10:88231999_88232010delTTAAGCCACTTA	ENST00000298767.5	-	7	2457_2468	c.1985_1996delTAAGTGGCTTAA	c.(1984-1998)ttaagtggcttaaag>tag	p.662_666LSGLK>*	WAPAL_ENST00000263070.7_5'Flank	NM_015045.2	NP_055860.1	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog (Drosophila)	662	WAPL. {ECO:0000255|PROSITE- ProRule:PRU00603}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA replication (GO:0008156)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of fibroblast proliferation (GO:0048146)|protein localization to chromatin (GO:0071168)|regulation of chromosome condensation (GO:0060623)|regulation of cohesin localization to chromatin (GO:0071922)|response to toxic substance (GO:0009636)|viral process (GO:0016032)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)				breast(2)|endometrium(2)|kidney(5)|large_intestine(6)|lung(13)|ovary(2)|stomach(1)	31						TGAGTGCTCTTTAAGCCACTTAACAAGTACTC	0.349																																					p.662_666del		Atlas-Indel,Pindel	.											WAPAL,NS,carcinoma,0,1	WAPAL	81	.	0			c.1986_1997del						.																																			SO:0001651	inframe_deletion	23063	exon7			.	AB065003	CCDS7375.1	10q23.31	2006-12-08	2006-03-16	2006-03-16	ENSG00000062650	ENSG00000062650			23293	protein-coding gene	gene with protein product	"""friend of EBNA2"""	610754	"""KIAA0261"""	KIAA0261		9039502, 17112726	Standard	XM_006717726		Approved	FOE, WAPL	uc001kdo.3	Q7Z5K2	OTTHUMG00000018651	ENST00000298767.5:c.1985_1996delTAAGTGGCTTAA	chr10.hg19:g.88231999_88232010delTTAAGCCACTTA	ENSP00000298767:p.Leu662_Lys666delins*	335.0	0.0		343.0	100.0	NM_015045	A7E2B5|Q5VSK5|Q8IX10|Q92549	In_Frame_Del	DEL	ENST00000298767.5	hg19	CCDS7375.1																																																																																			.	.		0.349	WAPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049151.2	NM_015045	
PCK1	5105	hgsc.bcm.edu	37	20	56140179	56140191	+	Splice_Site	DEL	GCAGAACATAAAG	GCAGAACATAAAG	-	rs373827777		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	GCAGAACATAAAG	GCAGAACATAAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr20:56140179_56140191delGCAGAACATAAAG	ENST00000319441.4	+	9	1566_1578	c.1402_1414delGCAGAACATAAAG	c.(1402-1416)gcagaacataaaggc>gc	p.AEHKG468fs	PCK1_ENST00000543666.1_Splice_Site_p.AEHKG151fs|PCK1_ENST00000535860.1_3'UTR	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	468					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CACAGCGGCTGCAGAACATAAAGGTAAATCAAA	0.484																																					p.467_471del		Atlas-INDEL	.											.	PCK1	95	.	0			c.1401_1413del						.																																			SO:0001630	splice_region_variant	5105	exon9			.		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1414+1GCAGAACATAAAG>-	chr20.hg19:g.56140179_56140191delGCAGAACATAAAG		213.0	0.0		149.0	23.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Frame_Shift_Del	DEL	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	.		0.484	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		Frame_Shift_Del
CELSR2	1952	hgsc.bcm.edu	37	1	109793071	109793072	+	Frame_Shift_Ins	INS	-	-	C	rs140803839		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:109793071_109793072insC	ENST00000271332.3	+	1	431_432	c.370_371insC	c.(370-372)tccfs	p.S124fs		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	124					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		AGGCCACCTTTCCCCACAGGGC	0.644																																					p.S124fs	NSCLC(158;1285 2011 34800 34852 42084)	Atlas-Indel,Pindel	.											.	CELSR2	228	.	0			c.370_371insC						.																																			SO:0001589	frameshift_variant	1952	exon1			.	D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.374dupC	chr1.hg19:g.109793075_109793075dupC	ENSP00000271332:p.Ser124fs	116.0	0.0		132.0	52.0	NM_001408	Q5T2Y7|Q92566	Frame_Shift_Ins	INS	ENST00000271332.3	hg19	CCDS796.1																																																																																			.	.		0.644	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033200.1	NM_001408	
TMED1	11018	hgsc.bcm.edu	37	19	10943778	10943791	+	Frame_Shift_Del	DEL	CCCGCTCCAAGTTG	CCCGCTCCAAGTTG	-	rs139968960		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	CCCGCTCCAAGTTG	CCCGCTCCAAGTTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:10943778_10943791delCCCGCTCCAAGTTG	ENST00000214869.2	-	4	662_675	c.564_577delCAACTTGGAGCGGG	c.(562-579)ggcaacttggagcgggtcfs	p.NLERV189fs	TMED1_ENST00000591695.1_Frame_Shift_Del_p.ATWSG127fs|TMED1_ENST00000588289.1_Frame_Shift_Del_p.NLERV44fs	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	189					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CAGAAGTTGACCCGCTCCAAGTTGCCCTCTTGCA	0.636																																					p.189_193del		Atlas-Indel,Pindel	.											.	TMED1	22	.	0			c.565_578del						.																																			SO:0001589	frameshift_variant	11018	exon4			.	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.564_577delCAACTTGGAGCGGG	chr19.hg19:g.10943778_10943791delCCCGCTCCAAGTTG	ENSP00000214869:p.Asn189fs	106.0	0.0		119.0	33.0	NM_006858		Frame_Shift_Del	DEL	ENST00000214869.2	hg19	CCDS12249.1																																																																																			.	.		0.636	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
MRPL35	51318	hgsc.bcm.edu	37	2	86434440	86434440	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:86434440delT	ENST00000337109.4	+	3	402	c.368delT	c.(367-369)gtgfs	p.V123fs	MRPL35_ENST00000409180.1_Frame_Shift_Del_p.V123fs|MRPL35_ENST00000605125.1_Intron|MRPL35_ENST00000254644.8_Frame_Shift_Del_p.V123fs	NM_016622.3	NP_057706.2	Q9NZE8	RM35_HUMAN	mitochondrial ribosomal protein L35	123					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(2)	14						GGCCTTTGGGTGAGGAGAAAG	0.483																																					p.V123X		Atlas-Indel,Pindel	.											MRPL35,NS,carcinoma,0,1	MRPL35	23	.	0			c.367delG						.						98.0	93.0	95.0					2																	86434440		2203	4300	6503	SO:0001589	frameshift_variant	51318	exon3			.	AF208849	CCDS1987.1, CCDS1988.1	2p11.2	2012-09-13			ENSG00000132313	ENSG00000132313		"""Mitochondrial ribosomal proteins / large subunits"""	14489	protein-coding gene	gene with protein product		611841				11042152, 11551941	Standard	NM_016622		Approved		uc002srg.4	Q9NZE8	OTTHUMG00000037385	ENST00000337109.4:c.368delT	chr2.hg19:g.86434440delT	ENSP00000338389:p.Val123fs	145.0	0.0		153.0	59.0	NM_145644	A6NKV6|B2RB93|Q658U7|Q8WWA2	Frame_Shift_Del	DEL	ENST00000337109.4	hg19	CCDS1988.1																																																																																			.	.		0.483	MRPL35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091002.2	NM_016622	
RGPD2	729857	hgsc.bcm.edu	37	2	88095295	88095295	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:88095295delG	ENST00000398146.3	-	10	1568	c.1346delC	c.(1345-1347)gctfs	p.A449fs	RGPD2_ENST00000327544.6_5'UTR|RGPD2_ENST00000420840.2_Frame_Shift_Del_p.A441fs			P0DJD1	RGPD2_HUMAN	RANBP2-like and GRIP domain containing 2	449					protein targeting to Golgi (GO:0000042)					breast(1)|pancreas(1)	2						TCCAGGTAAAGCAGGCAATGA	0.378																																					p.A449fs		Atlas-INDEL	.											.	RGPD2	14	.	0			c.1347delT						.						1.0	1.0	1.0					2																	88095295		23	63	86	SO:0001589	frameshift_variant	729857	exon10			.		CCDS42710.1, CCDS42710.2	2p11.2	2013-01-10			ENSG00000185304	ENSG00000185304		"""Tetratricopeptide (TTC) repeat domain containing"""	32415	protein-coding gene	gene with protein product		612705				15710750, 15815621	Standard	NM_001078170		Approved	RGP2, RANBP2L2		P0DJD1	OTTHUMG00000153276	ENST00000398146.3:c.1346delC	chr2.hg19:g.88095295delG	ENSP00000381214:p.Ala449fs	927.0	0.0		1040.0	71.0	NM_001078170	P0C839|Q68DN6|Q6V1X0	Frame_Shift_Del	DEL	ENST00000398146.3	hg19	CCDS42710.2																																																																																			.	.		0.378	RGPD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330534.2	NM_001078170	
REV3L	5980	hgsc.bcm.edu	37	6	111695854	111695854	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr6:111695854delG	ENST00000358835.3	-	14	4158	c.3704delC	c.(3703-3705)tctfs	p.S1235fs	REV3L_ENST00000435970.1_Frame_Shift_Del_p.S1157fs|REV3L_ENST00000368805.1_Frame_Shift_Del_p.S1235fs|REV3L_ENST00000368802.3_Frame_Shift_Del_p.S1235fs			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1235					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTCAGCACCAGACTGAGATTT	0.353								DNA polymerases (catalytic subunits)																													p.S1235fs		Atlas-Indel,Pindel	.											.	REV3L	386	.	0			c.3705delT						.						83.0	84.0	84.0					6																	111695854		2202	4298	6500	SO:0001589	frameshift_variant	5980	exon13			.	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3704delC	chr6.hg19:g.111695854delG	ENSP00000351697:p.Ser1235fs	61.0	0.0		76.0	30.0	NM_002912	O43214|Q5TC33	Frame_Shift_Del	DEL	ENST00000358835.3	hg19	CCDS5091.2																																																																																			.	.		0.353	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
DIP2A	23181	hgsc.bcm.edu	37	21	47983839	47983839	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr21:47983839delG	ENST00000417564.2	+	35	4179	c.4158delG	c.(4156-4158)ctgfs	p.L1386fs	DIP2A_ENST00000400274.1_Frame_Shift_Del_p.L1382fs|DIP2A_ENST00000479654.1_3'UTR|DIP2A_ENST00000318711.7_Frame_Shift_Del_p.L1387fs			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1386					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		ACTCACACCTGGGAGAGGTGA	0.542																																					p.L1386fs		Atlas-Indel,Pindel	.											.	DIP2A	332	.	0			c.4157delT						.						44.0	46.0	45.0					21																	47983839		1911	4136	6047	SO:0001589	frameshift_variant	23181	exon35			.	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.4158delG	chr21.hg19:g.47983839delG	ENSP00000392066:p.Leu1386fs	98.0	0.0		76.0	33.0	NM_015151	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Frame_Shift_Del	DEL	ENST00000417564.2	hg19	CCDS46655.1																																																																																			.	.		0.542	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
TIMM50	92609	hgsc.bcm.edu	37	19	39971479	39971479	+	5'UTR	DEL	T	T	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:39971479delT	ENST00000607714.1	+	0	8				TIMM50_ENST00000314349.4_Frame_Shift_Del_p.W99fs|TIMM50_ENST00000544017.1_5'Flank|TIMM50_ENST00000599794.1_5'Flank			Q3ZCQ8	TIM50_HUMAN	translocase of inner mitochondrial membrane 50 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|mitochondrial membrane organization (GO:0007006)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein targeting to mitochondrion (GO:0006626)|release of cytochrome c from mitochondria (GO:0001836)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)	interleukin-2 receptor binding (GO:0005134)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)			NS(1)|endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)	14	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGGGGCCGCGTGGCGTCAGCG	0.736																																					p.A98fs		Atlas-Indel,Pindel	.											.	TIMM50	37	.	0			c.294delG						.						9.0	11.0	10.0					19																	39971479		2156	4181	6337	SO:0001623	5_prime_UTR_variant	92609	exon1			.	BC009072	CCDS33023.1	19q13.2	2010-06-21	2006-04-04		ENSG00000105197	ENSG00000105197		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	23656	protein-coding gene	gene with protein product		607381	"""translocase of inner mitochondrial membrane 50 homolog (yeast)"""			12437925	Standard	NM_001001563		Approved	TIM50L	uc002olu.1	Q3ZCQ8		ENST00000607714.1:c.-15T>-	chr19.hg19:g.39971479delT		49.0	0.0		85.0	21.0	NM_001001563	Q330K1|Q6QA00|Q96FJ5|Q96GY2|Q9H370	Frame_Shift_Del	DEL	ENST00000607714.1	hg19																																																																																				.	.		0.736	TIMM50-021	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470728.1	NM_001001563	
KRT75	9119	hgsc.bcm.edu	37	12	52826861	52826861	+	Frame_Shift_Del	DEL	A	A	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr12:52826861delA	ENST00000252245.5	-	2	894	c.674delT	c.(673-675)ctgfs	p.L225fs		NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	225	Coil 1B.|Rod.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		CATGTTCCTCAGTTCAGCTTC	0.537																																					p.L225fs		Atlas-Indel,Pindel	.											.	KRT75	75	.	0			c.675delG						.						121.0	108.0	112.0					12																	52826861		2203	4300	6503	SO:0001589	frameshift_variant	9119	exon2			.	Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.674delT	chr12.hg19:g.52826861delA	ENSP00000252245:p.Leu225fs	129.0	0.0		116.0	51.0	NM_004693	B4DQU4|Q9NSA9	Frame_Shift_Del	DEL	ENST00000252245.5	hg19	CCDS8827.1																																																																																			.	.		0.537	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404968.1	NM_004693	
PCF11	51585	hgsc.bcm.edu	37	11	82877748	82877749	+	In_Frame_Ins	INS	-	-	AAT			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr11:82877748_82877749insAAT	ENST00000298281.4	+	5	2261_2262	c.1809_1810insAAT	c.(1810-1812)aat>AATaat	p.604_604N>NN		NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	604					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						GTTGGGAAGAAAATAAAAGGTA	0.327																																					p.E603delinsEN		Atlas-Indel,Pindel	.											.	PCF11	220	.	0			c.1809_1810insAAT						.																																			SO:0001652	inframe_insertion	51585	exon5			.	AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.1810_1812dupAAT	chr11.hg19:g.82877749_82877751dupAAT	ENSP00000298281:p.Asn604dup	353.0	0.0		428.0	91.0	NM_015885	A6H8W7|O43671|Q6P0X8	In_Frame_Ins	INS	ENST00000298281.4	hg19	CCDS44689.1																																																																																			.	.		0.327	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392548.2	NM_015885	
AHDC1	27245	hgsc.bcm.edu	37	1	27874319	27874361	+	Frame_Shift_Del	DEL	GTGGCCCAGGCTGGCCCCCTGGAGTCCATGCTTGAGGGGCTCG	GTGGCCCAGGCTGGCCCCCTGGAGTCCATGCTTGAGGGGCTCG	-	rs566131872|rs368747937|rs527518359|rs375964883|rs372813656	byFrequency	TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	GTGGCCCAGGCTGGCCCCCTGGAGTCCATGCTTGAGGGGCTCG	GTGGCCCAGGCTGGCCCCCTGGAGTCCATGCTTGAGGGGCTCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:27874319_27874361delGTGGCCCAGGCTGGCCCCCTGGAGTCCATGCTTGAGGGGCTCG	ENST00000247087.5	-	5	4862_4904	c.4266_4308delCGAGCCCCTCAAGCATGGACTCCAGGGGGCCAGCCTGGGCCAC	c.(4264-4308)tgcgagcccctcaagcatggactccagggggccagcctgggccacfs	p.CEPLKHGLQGASLGH1422fs	AHDC1_ENST00000374011.2_Frame_Shift_Del_p.CEPLKHGLQGASLGH1422fs			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1422							DNA binding (GO:0003677)	p.L1429R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		CTGCAGCTGCGTGGCCCAGGCTGGCCCCCTGGAGTCCATGCTTGAGGGGCTCGCAGGCAGCCA	0.675																																					p.1423_1437del		Atlas-Indel,Pindel	.											.	AHDC1	98	.	1	Substitution - Missense(1)	prostate(1)	c.4267_4309del						.																																			SO:0001589	frameshift_variant	27245	exon6			.	AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.4266_4308delCGAGCCCCTCAAGCATGGACTCCAGGGGGCCAGCCTGGGCCAC	chr1.hg19:g.27874319_27874361delGTGGCCCAGGCTGGCCCCCTGGAGTCCATGCTTGAGGGGCTCG	ENSP00000247087:p.Cys1422fs	86.0	0.0		52.0	16.0	NM_001029882	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Frame_Shift_Del	DEL	ENST00000247087.5	hg19	CCDS30652.1																																																																																			.	.		0.675	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009523.3		
NTAN1	123803	hgsc.bcm.edu	37	16	15131989	15131990	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr16:15131989_15131990insT	ENST00000287706.3	-	10	923_924	c.831_832insA	c.(829-834)aaacacfs	p.H278fs	PDXDC1_ENST00000535621.2_Intron	NM_001270766.1|NM_173474.3	NP_001257695.1|NP_775745.1	Q96AB6	NTAN1_HUMAN	N-terminal asparagine amidase	278					adult locomotory behavior (GO:0008344)|memory (GO:0007613)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-N-terminal asparagine amidohydrolase activity (GO:0008418)	p.K277fs*>34(2)		endometrium(1)|large_intestine(4)|lung(3)	8						GGAGATGGGTGTTTTTTTAAAA	0.411																																					p.H278fs		Atlas-Indel,Pindel	.											.,1	NTAN1	21	.	2	Deletion - Frameshift(2)	large_intestine(1)|lung(1)	c.832_833insA						.																																			SO:0001589	frameshift_variant	123803	exon10			.	AF092440	CCDS10558.1, CCDS73832.1	16p13	2008-02-05			ENSG00000157045	ENSG00000157045			29909	protein-coding gene	gene with protein product		615367				8910481	Standard	NM_173474		Approved		uc002ddd.4	Q96AB6	OTTHUMG00000129849	ENST00000287706.3:c.832dupA	chr16.hg19:g.15131996_15131996dupT	ENSP00000287706:p.His278fs	142.0	0.0		165.0	65.0	NM_173474	Q7Z4Z0	Frame_Shift_Ins	INS	ENST00000287706.3	hg19	CCDS10558.1																																																																																			.	.		0.411	NTAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252089.1	NM_173474	
DNAJA4	55466	hgsc.bcm.edu	37	15	78556708	78556709	+	5'Flank	INS	-	-	AAAGG			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr15:78556708_78556709insAAAGG	ENST00000394852.3	+	0	0				DNAJA4_ENST00000394855.3_Frame_Shift_Ins_p.-20fs|DNAJA4_ENST00000343789.3_5'Flank|RP11-762H8.3_ENST00000558971.1_RNA|DNAJA4_ENST00000489435.2_Frame_Shift_Ins_p.-20fs|DNAJA4_ENST00000446172.2_5'Flank|RP11-762H8.3_ENST00000559954.1_RNA	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4						negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						GACGGGCAGCCAAAGGAGCAGA	0.767																																					p.P18fs		Atlas-Indel,Pindel	.											.	DNAJA4	63	.	0			c.53_54insAAAGG						.																																			SO:0001631	upstream_gene_variant	55466	exon1			.	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733		chr15.hg19:g.78556709_78556713dupAAAGG	Exception_encountered	26.0	0.0		20.0	10.0	NM_018602	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Frame_Shift_Ins	INS	ENST00000394852.3	hg19	CCDS45316.1																																																																																			.	.		0.767	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602	
PCK1	5105	hgsc.bcm.edu	37	20	56140173	56140177	+	Frame_Shift_Del	DEL	GCGGC	GCGGC	-	rs548285338		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	GCGGC	GCGGC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr20:56140173_56140177delGCGGC	ENST00000319441.4	+	9	1560_1564	c.1396_1400delGCGGC	c.(1396-1401)gcggctfs	p.AA466fs	PCK1_ENST00000543666.1_Frame_Shift_Del_p.AA149fs|PCK1_ENST00000535860.1_3'UTR	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	466					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			AGAGGCCACAGCGGCTGCAGAACAT	0.473																																					p.465_467del		Atlas-INDEL	.											.	PCK1	95	.	0			c.1395_1399del						.																																			SO:0001589	frameshift_variant	5105	exon9			.		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1396_1400delGCGGC	chr20.hg19:g.56140173_56140177delGCGGC	ENSP00000319814:p.Ala466fs	222.0	0.0		156.0	23.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Frame_Shift_Del	DEL	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	.		0.473	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
CSDE1	7812	hgsc.bcm.edu	37	1	115262274	115262275	+	Frame_Shift_Ins	INS	-	-	G			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:115262274_115262275insG	ENST00000358528.4	-	18	2567_2568	c.2141_2142insC	c.(2140-2142)ggafs	p.G714fs	CSDE1_ENST00000483407.1_5'Flank|CSDE1_ENST00000438362.2_Frame_Shift_Ins_p.G760fs|CSDE1_ENST00000339438.6_Frame_Shift_Ins_p.G683fs|CSDE1_ENST00000534699.1_Frame_Shift_Ins_p.G714fs|CSDE1_ENST00000369530.1_Frame_Shift_Ins_p.G729fs|CSDE1_ENST00000261443.5_Frame_Shift_Ins_p.G683fs|NRAS_ENST00000369535.4_5'Flank|CSDE1_ENST00000530886.1_Frame_Shift_Ins_p.G584fs	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	714	CSD 9.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)	p.G714V(1)		NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCACCTCATCTCCTGCCTGTAG	0.426																																					p.G760fs		Atlas-Indel,Pindel	.											.	CSDE1	145	.	1	Substitution - Missense(1)	lung(1)	c.2280_2281insC						.																																			SO:0001589	frameshift_variant	7812	exon19			.		CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.2141_2142insC	chr1.hg19:g.115262274_115262275insG	ENSP00000351329:p.Gly714fs	93.0	0.0		107.0	37.0	NM_001242891	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Frame_Shift_Ins	INS	ENST00000358528.4	hg19	CCDS30812.1																																																																																			.	.		0.426	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033397.1	NM_007158	
RGPD3	653489	hgsc.bcm.edu	37	2	107053238	107053238	+	Frame_Shift_Del	DEL	G	G	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:107053238delG	ENST00000409886.3	-	10	1436	c.1349delC	c.(1348-1350)gctfs	p.A450fs	RGPD3_ENST00000304514.7_Frame_Shift_Del_p.A450fs	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	450					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TCCAGGTAAAGCAGGCAATGA	0.383																																					p.A450fs		Atlas-INDEL	.											.	RGPD3	316	.	0			c.1350delT						.																																			SO:0001589	frameshift_variant	653489	exon10			.		CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.1349delC	chr2.hg19:g.107053238delG	ENSP00000386588:p.Ala450fs	1114.0	0.0		1291.0	193.0	NM_001144013	B8ZZM4	Frame_Shift_Del	DEL	ENST00000409886.3	hg19	CCDS46379.1																																																																																			.	.		0.383	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000329975.1	XM_929931	
HSD11B1	3290	hgsc.bcm.edu	37	1	209879238	209879239	+	Frame_Shift_Ins	INS	-	-	GGAGCCCATGTGGT			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:209879238_209879239insGGAGCCCATGTGGT	ENST00000367028.2	+	3	340_341	c.171_172insGGAGCCCATGTGGT	c.(172-174)ggafs	p.-62fs	RP1-28O10.1_ENST00000441672.1_RNA|HSD11B1_ENST00000261465.1_Frame_Shift_Ins_p.-62fs|HSD11B1_ENST00000367027.3_Frame_Shift_Ins_p.-62fs	NM_001206741.1	NP_001193670.1	P28845	DHI1_HUMAN	hydroxysteroid (11-beta) dehydrogenase 1						glucocorticoid biosynthetic process (GO:0006704)|lung development (GO:0030324)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	11-beta-hydroxysteroid dehydrogenase (NADP+) activity (GO:0070524)|11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(9)	16				OV - Ovarian serous cystadenocarcinoma(81;1.04e-55)|Epithelial(68;1.57e-52)|all cancers(67;1.83e-46)|Colorectal(1306;0.115)	Prednisone(DB00635)	TGGCGAAGATGGGAGCCCATGT	0.51																																					p.M57fs		Atlas-Indel,Pindel	.											.	HSD11B1	35	.	0			c.171_172insGGAGCCCATGTGGT						.																																			SO:0001589	frameshift_variant	3290	exon2			.	BC012593	CCDS1489.1	1q32-q41	2011-09-20			ENSG00000117594	ENSG00000117594	1.1.1.146	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5208	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 26C, member 1"""	600713		HSD11B, HSD11		1885595, 19027726	Standard	NM_005525		Approved	SDR26C1	uc001hhk.3	P28845	OTTHUMG00000036481	ENST00000367028.2:c.172_185dupGGAGCCCATGTGGT	chr1.hg19:g.209879238_209879239insGGAGCCCATGTGGT	ENSP00000355995:p.Val62fs	132.0	0.0		136.0	16.0	NM_005525	B2R9Z1|D3DT89	Frame_Shift_Ins	INS	ENST00000367028.2	hg19	CCDS1489.1																																																																																			.	.		0.510	HSD11B1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088743.2	NM_005525	
EPHA8	2046	hgsc.bcm.edu	37	1	22902805	22902806	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr1:22902805_22902806delCA	ENST00000166244.3	+	3	327_328	c.255_256delCA	c.(253-258)cgcacgfs	p.T86fs	EPHA8_ENST00000538803.1_Frame_Shift_Del_p.T86fs|EPHA8_ENST00000374644.4_Frame_Shift_Del_p.T86fs	NM_020526.3	NP_065387.1	P29322	EPHA8_HUMAN	EPH receptor A8	86	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|ephrin receptor signaling pathway (GO:0048013)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell adhesion mediated by integrin (GO:0033628)|substrate-dependent cell migration (GO:0006929)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(6)|lung(22)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ACTGGCTGCGCACGAGCTGGGT	0.614																																					p.85_85del		Atlas-Indel,Pindel	.											.	EPHA8	221	.	0			c.254_255del						.																																			SO:0001589	frameshift_variant	2046	exon3			.	BC038796	CCDS225.1, CCDS30626.1	1p36.12	2013-02-11	2004-10-28		ENSG00000070886	ENSG00000070886	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3391	protein-coding gene	gene with protein product		176945	"""EphA8"""	EEK		1648701	Standard	NM_001006943		Approved	Hek3	uc001bfx.1	P29322	OTTHUMG00000002892	ENST00000166244.3:c.255_256delCA	chr1.hg19:g.22902805_22902806delCA	ENSP00000166244:p.Thr86fs	248.0	0.0		249.0	96.0	NM_020526	Q6IN80|Q8IUX6|Q9NUA9|Q9P269	Frame_Shift_Del	DEL	ENST00000166244.3	hg19	CCDS225.1																																																																																			.	.		0.614	EPHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008085.1	NM_020526	
DKKL1	27120	hgsc.bcm.edu	37	19	49868878	49868879	+	In_Frame_Ins	INS	-	-	CCTCTCCAG			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr19:49868878_49868879insCCTCTCCAG	ENST00000221498.2	+	3	701_702	c.296_297insCCTCTCCAG	c.(295-300)accctc>acCCTCTCCAGcctc	p.100_101insSSL	DKKL1_ENST00000594268.1_Intron	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	100					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		GGGAACAACACCCTCTCCAGCC	0.604																																					p.T99delinsTLSS		Atlas-Indel,Pindel	.											.	DKKL1	23	.	0			c.296_297insCCTCTCCAG						.																																			SO:0001652	inframe_insertion	27120	exon3			.	AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.297_305dupCCTCTCCAG	chr19.hg19:g.49868879_49868887dupCCTCTCCAG	ENSP00000221498:p.Leu100_Ser101insSerSerLeu	80.0	0.0		142.0	15.0	NM_014419		In_Frame_Ins	INS	ENST00000221498.2	hg19	CCDS12762.1																																																																																			.	.		0.604	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465454.2	NM_014419	
TTR	7276	hgsc.bcm.edu	37	18	29175221	29175222	+	Intron	DEL	GA	GA	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr18:29175221_29175222delGA	ENST00000237014.3	+	3	513					NM_000371.3	NP_000362.1	P02766	TTHY_HUMAN	transthyretin						extracellular matrix organization (GO:0030198)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	hormone binding (GO:0042562)|identical protein binding (GO:0042802)			cervix(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	13			OV - Ovarian serous cystadenocarcinoma(10;0.00523)		Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diflunisal(DB00861)|Dimethyl sulfoxide(DB01093)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	ATGCAGAGGTGAGTATACAGAC	0.431																																					.		Atlas-Indel,Pindel	.											.	TTR	21	.	0			.						.																																			SO:0001627	intron_variant	7276	.			.	M10605	CCDS11899.1	18q12.1	2014-09-17	2008-07-31		ENSG00000118271	ENSG00000118271			12405	protein-coding gene	gene with protein product		176300	"""prealbumin, amyloidosis type I"", ""carpal tunnel syndrome 1"""	PALB, CTS1		8309582	Standard	NM_000371		Approved	HsT2651, CTS	uc002kwx.4	P02766	OTTHUMG00000131984	ENST00000237014.3:c.336+3GA>-	chr18.hg19:g.29175221_29175222delGA		152.0	0.0		163.0	66.0	.	Q549C7|Q6IB96|Q9UBZ6|Q9UCM9	Splice_Site	DEL	ENST00000237014.3	hg19	CCDS11899.1																																																																																			.	.		0.431	TTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254948.1	NM_000371	
RGPD4	285190	hgsc.bcm.edu	37	2	108475642	108475642	+	Frame_Shift_Del	DEL	C	C	-			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr2:108475642delC	ENST00000408999.3	+	10	1426	c.1349delC	c.(1348-1350)gctfs	p.A450fs	RGPD4_ENST00000354986.4_Frame_Shift_Del_p.A450fs	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	450					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TCATTGCCTGCTTTACCTGGA	0.383																																					p.A450fs		Atlas-INDEL	.											.	RGPD4	112	.	0			c.1348delG						.						1.0	1.0	1.0					2																	108475642		2	4	6	SO:0001589	frameshift_variant	285190	exon10			.	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.1349delC	chr2.hg19:g.108475642delC	ENSP00000386810:p.Ala450fs	1028.0	0.0		1263.0	228.0	NM_182588	B9A029	Frame_Shift_Del	DEL	ENST00000408999.3	hg19	CCDS46381.1																																																																																			.	.		0.383	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	
AOAH	313	hgsc.bcm.edu	37	7	36570105	36570124	+	Splice_Site	DEL	AGAGTTGCTCTGCTCTCTGA	AGAGTTGCTCTGCTCTCTGA	-	rs143459033	byFrequency	TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	AGAGTTGCTCTGCTCTCTGA	AGAGTTGCTCTGCTCTCTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr7:36570105_36570124delAGAGTTGCTCTGCTCTCTGA	ENST00000258749.5	-	19	1825_1840	c.1426_1441delTCAGAGAGCAGAGCAACTCT	c.(1426-1443)tcagagagcagagcaact>ct	p.SESRAT476fs	AOAH_ENST00000491444.1_5'UTR|AOAH_ENST00000538464.1_Splice_Site_p.SESRAT198fs|AOAH_ENST00000431169.1_Splice_Site_p.SESRAT476fs|AOAH_ENST00000535891.1_Splice_Site_p.SESRAT444fs	NM_001637.3	NP_001628.1	P28039	AOAH_HUMAN	acyloxyacyl hydrolase (neutrophil)	476					inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|lipopolysaccharide metabolic process (GO:0008653)|negative regulation of inflammatory response (GO:0050728)	extracellular region (GO:0005576)	acyloxyacyl hydrolase activity (GO:0050528)|catalytic activity (GO:0003824)|lipoprotein lipase activity (GO:0004465)	p.E478E(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(21)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	41						AGTGTGTTGGAGAGTTGCTCTGCTCTCTGAAGAGAGAGGA	0.395																																					p.476_481del		Atlas-Indel,Pindel	.											.	AOAH	79	.	1	Substitution - coding silent(1)	large_intestine(1)	c.1426_1442del						.																																			SO:0001630	splice_region_variant	313	exon19			.	BC025698	CCDS5448.1, CCDS55102.1, CCDS75584.1	7p14-p12	2014-03-14			ENSG00000136250	ENSG00000136250	3.1.1.77		548	protein-coding gene	gene with protein product		102593				1883828	Standard	NM_001637		Approved		uc022abu.1	P28039	OTTHUMG00000023566	ENST00000258749.5:c.1426-1TCAGAGAGCAGAGCAACTCT>-	chr7.hg19:g.36570105_36570124delAGAGTTGCTCTGCTCTCTGA		93.0	0.0		82.0	14.0	NM_001637	A4D1Y5|B7Z490|Q53F13	Frame_Shift_Del	DEL	ENST00000258749.5	hg19	CCDS5448.1																																																																																			.	.		0.395	AOAH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219829.2	NM_001637	Frame_Shift_Del
RFC1	5981	hgsc.bcm.edu	37	4	39344053	39344054	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr4:39344053_39344054insT	ENST00000381897.1	-	4	375_376	c.242_243insA	c.(241-243)aatfs	p.N81fs	RFC1_ENST00000349703.2_Frame_Shift_Ins_p.N81fs|RFC1_ENST00000418436.1_5'UTR	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	81					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)	p.N81fs*61(1)		haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GCTTTTTGGCATTTTTTACCTG	0.351																																					p.N81fs	Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	Atlas-Indel,Pindel	.											.	RFC1	114	.	1	Deletion - Frameshift(1)	large_intestine(1)	c.243_244insA						.																																			SO:0001589	frameshift_variant	5981	exon4			.	L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.243dupA	chr4.hg19:g.39344059_39344059dupT	ENSP00000371321:p.Asn81fs	110.0	0.0		116.0	12.0	NM_002913	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Frame_Shift_Ins	INS	ENST00000381897.1	hg19	CCDS56329.1																																																																																			.	.		0.351	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216808.1	NM_002913	
PCK1	5105	hgsc.bcm.edu	37	20	56140173	56140191	+	Splice_Site	DEL	GCGGCTGCAGAACATAAAG	GCGGCTGCAGAACATAAAG	-	rs548285338|rs373827777		TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	GCGGCTGCAGAACATAAAG	GCGGCTGCAGAACATAAAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr20:56140173_56140191delGCGGCTGCAGAACATAAAG	ENST00000319441.4	+	9	1560_1578	c.1396_1414delGCGGCTGCAGAACATAAAG	c.(1396-1416)gcggctgcagaacataaaggc>gc	p.AAAEHKG466fs	PCK1_ENST00000543666.1_Splice_Site_p.AAAEHKG149fs|PCK1_ENST00000535860.1_3'UTR	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	466					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			AGAGGCCACAGCGGCTGCAGAACATAAAGGTAAATCAAA	0.479																																					p.465_471del		Pindel	.											.	PCK1	95	.	0			c.1395_1413del						.																																			SO:0001630	splice_region_variant	5105	exon9			.		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.1414+1GCGGCTGCAGAACATAAAG>-	chr20.hg19:g.56140173_56140191delGCGGCTGCAGAACATAAAG		199.0	0.0		158.0	33.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Frame_Shift_Del	DEL	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	.		0.479	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		Frame_Shift_Del
SFXN4	119559	hgsc.bcm.edu	37	10	120917178	120917237	+	Splice_Site	DEL	ATTTGACAGATTCTAAAAATACCTACTCCTAAGAAAGTTGAAGAAGCAACGGCTCCCGCC	ATTTGACAGATTCTAAAAATACCTACTCCTAAGAAAGTTGAAGAAGCAACGGCTCCCGCC	-	rs543162504|rs202129977|rs370994281|rs368279951|rs374603053	byFrequency	TCGA-G3-AAV0-01A-11D-A36X-10	TCGA-G3-AAV0-10A-01D-A370-10	ATTTGACAGATTCTAAAAATACCTACTCCTAAGAAAGTTGAAGAAGCAACGGCTCCCGCC	ATTTGACAGATTCTAAAAATACCTACTCCTAAGAAAGTTGAAGAAGCAACGGCTCCCGCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	cf7c19ad-4570-4952-9604-41305e544984	60d8b369-5133-44f7-9021-71ffb112a0ce	g.chr10:120917178_120917237delATTTGACAGATTCTAAAAATACCTACTCCTAAGAAAGTTGAAGAAGCAACGGCTCCCGCC	ENST00000355697.2	-	9	499_557	c.480_538delGGCGGGAGCCGTTGCTTCTTCAACTTTCTTAGGAGTAGGTATTTTTAGAATCTGTCAAAT	c.(478-540)aaggcgggagccgttgcttcttcaactttcttaggagtaggtatttttagaatctgtcaaatt>aatt	p.160_180KAGAVASSTFLGVGIFRICQI>N	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Splice_Site_p.151_171KAGAVASSTFLGVGIFRICQI>N	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	160					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		AAAAATACCTACTCCTAAGAAAGTTGAAGAAGCAACGGCTCCCGCCATTAGTAATGATCTTTCTAGTGGCTTACAAGTCT	0.304																																					p.169_179del		Pindel	.											.	SFXN4	24	.	0			c.505_537del						.																																			SO:0001630	splice_region_variant	119559	exon9			.		CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.537+1GGCGGGAGCCGTTGCTTCTTCAACTTTCTTAGGAGTAGGTATTTTTAGAATCTGTCAAAT>-	chr10.hg19:g.120917178_120917237delATTTGACAGATTCTAAAAATACCTACTCCTAAGAAAGTTGAAGAAGCAACGGCTCCCGCC		431.0	0.0		324.0	58.0	NM_213649	Q6WSU4|Q86TD9	In_Frame_Del	DEL	ENST00000355697.2	hg19	CCDS7610.1																																																																																			.	.		0.304	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050642.3	XM_058406	In_Frame_Del
