#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
GABPB2	126626	hgsc.bcm.edu	37	1	151079530	151079530	+	Missense_Mutation	SNP	A	A	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr1:151079530A>G	ENST00000368918.3	+	7	1085	c.754A>G	c.(754-756)Ata>Gta	p.I252V	GABPB2_ENST00000467551.1_3'UTR|GABPB2_ENST00000368916.1_Missense_Mutation_p.I214V|GABPB2_ENST00000368917.1_Missense_Mutation_p.I214V	NM_144618.2	NP_653219.1	Q8TAK5	GABP2_HUMAN	GA binding protein transcription factor, beta subunit 2	252					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(3)|liver(2)|lung(7)	15				all cancers(107;7.17e-05)|GBM - Glioblastoma multiforme(94;0.000662)		AGAGGAAATTATAGAAGGAAA	0.398																																					p.I252V		Atlas-SNP	.											.	GABPB2	41	.	0			c.A754G						.						56.0	58.0	57.0					1																	151079530		2203	4300	6503	SO:0001583	missense	126626	exon7			GAAATTATAGAAG		CCDS983.1	1q21.2	2013-01-10			ENSG00000143458	ENSG00000143458		"""Ankyrin repeat domain containing"""	28441	protein-coding gene	gene with protein product						7958862	Standard	NM_144618		Approved	MGC29891	uc001ewr.2	Q8TAK5	OTTHUMG00000012193	ENST00000368918.3:c.754A>G	chr1.hg19:g.151079530A>G	ENSP00000357914:p.Ile252Val	61.0	0.0		103.0	16.0	NM_144618	B1AVJ8|D3DV14|Q8NAR5	Missense_Mutation	SNP	ENST00000368918.3	hg19	CCDS983.1	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.846529	0.00568	.	.	ENSG00000143458	ENST00000368918;ENST00000368917;ENST00000368916	T;T;T	0.55234	0.57;0.53;0.53	5.41	-2.48	0.06423	.	0.560322	0.20442	N	0.092264	T	0.06371	0.0164	N	0.10916	0.065	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.29882	-0.9997	10	0.07030	T	0.85	-4.0734	2.6748	0.05078	0.2388:0.2474:0.3931:0.1208	.	214;252;252	Q5SZG2;B2R924;Q8TAK5	.;.;GABP2_HUMAN	V	252;214;214	ENSP00000357914:I252V;ENSP00000357913:I214V;ENSP00000357912:I214V	ENSP00000357912:I214V	I	+	1	0	GABPB2	149346154	0.004000	0.15560	0.049000	0.19019	0.344000	0.29017	0.023000	0.13533	-0.623000	0.05618	0.455000	0.32223	ATA	.	.		0.398	GABPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033700.2	NM_144618	
PIGM	93183	hgsc.bcm.edu	37	1	160000854	160000854	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr1:160000854C>A	ENST00000368090.2	-	1	929	c.676G>T	c.(676-678)Gct>Tct	p.A226S		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	226					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGCAGCACAGCCCGATTACAC	0.483																																					p.A226S		Atlas-SNP	.											.	PIGM	27	.	0			c.G676T						.						96.0	101.0	99.0					1																	160000854		2203	4300	6503	SO:0001583	missense	93183	exon1			GCACAGCCCGATT	AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.676G>T	chr1.hg19:g.160000854C>A	ENSP00000357069:p.Ala226Ser	92.0	0.0		200.0	28.0	NM_145167		Missense_Mutation	SNP	ENST00000368090.2	hg19	CCDS1192.1	.	.	.	.	.	.	.	.	.	.	C	0.677	-0.799710	0.02841	.	.	ENSG00000143315	ENST00000368090	T	0.45276	0.9	5.16	4.25	0.50352	.	0.742461	0.12881	N	0.431423	T	0.11452	0.0279	N	0.13098	0.295	0.09310	N	0.999999	B	0.02656	0.0	B	0.12156	0.007	T	0.23013	-1.0200	9	.	.	.	-14.9299	13.6165	0.62110	0.0:0.8438:0.1562:0.0	.	226	Q9H3S5	PIGM_HUMAN	S	226	ENSP00000357069:A226S	.	A	-	1	0	PIGM	158267478	0.000000	0.05858	0.059000	0.19551	0.051000	0.14879	0.048000	0.14078	1.401000	0.46761	0.462000	0.41574	GCT	.	.		0.483	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060643.2	NM_145167	
TROVE2	6738	hgsc.bcm.edu	37	1	193045716	193045716	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr1:193045716C>T	ENST00000367446.3	+	4	1097	c.887C>T	c.(886-888)cCa>cTa	p.P296L	TROVE2_ENST00000367443.1_Missense_Mutation_p.P296L|TROVE2_ENST00000367445.3_Missense_Mutation_p.P296L|TROVE2_ENST00000400968.2_Missense_Mutation_p.P296L|TROVE2_ENST00000432079.1_Missense_Mutation_p.P21L|TROVE2_ENST00000367444.3_Missense_Mutation_p.P296L|TROVE2_ENST00000367441.1_Missense_Mutation_p.P296L|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000416058.2_Missense_Mutation_p.P21L	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2	296	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						GTACTTGAACCAGGAAATTCA	0.318																																					p.P296L		Atlas-SNP	.											.	TROVE2	50	.	0			c.C887T						.						111.0	106.0	107.0					1																	193045716		1818	4078	5896	SO:0001583	missense	6738	exon4			TTGAACCAGGAAA	BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.887C>T	chr1.hg19:g.193045716C>T	ENSP00000356416:p.Pro296Leu	250.0	0.0		419.0	84.0	NM_004600	B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	Missense_Mutation	SNP	ENST00000367446.3	hg19	CCDS1379.1	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920793	0.92249	.	.	ENSG00000116747	ENST00000400968;ENST00000416058;ENST00000367446;ENST00000367443;ENST00000367445;ENST00000367444;ENST00000367441	T;T;T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38;2.38;2.38	5.38	5.38	0.77491	TROVE (2);	0.049749	0.85682	D	0.000000	T	0.48589	0.1508	M	0.84433	2.695	0.80722	D	1	P;P;D;D	0.76494	0.951;0.951;0.99;0.999	D;D;D;D	0.79108	0.94;0.94;0.936;0.992	T	0.47711	-0.9096	10	0.44086	T	0.13	-31.9485	19.5625	0.95378	0.0:1.0:0.0:0.0	.	296;296;296;296	Q5LJ99;Q5LJ98;Q5LJA0;P10155	.;.;.;RO60_HUMAN	L	296;21;296;296;296;296;296	ENSP00000383752:P296L;ENSP00000411421:P21L;ENSP00000356416:P296L;ENSP00000356413:P296L;ENSP00000356415:P296L;ENSP00000356414:P296L;ENSP00000356411:P296L	ENSP00000356411:P296L	P	+	2	0	TROVE2	191312339	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.290000	0.59019	2.700000	0.92200	0.558000	0.71614	CCA	.	.		0.318	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086688.1	NM_004600	
HHAT	55733	hgsc.bcm.edu	37	1	210637884	210637884	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr1:210637884G>T	ENST00000367010.1	+	8	1119	c.892G>T	c.(892-894)Gtg>Ttg	p.V298L	HHAT_ENST00000367009.1_5'UTR|HHAT_ENST00000413764.2_Missense_Mutation_p.V298L|HHAT_ENST00000261458.3_Missense_Mutation_p.V298L|HHAT_ENST00000391905.3_Missense_Mutation_p.V298L|HHAT_ENST00000545154.1_Missense_Mutation_p.V299L|HHAT_ENST00000541565.1_Missense_Mutation_p.V161L|HHAT_ENST00000545781.1_Missense_Mutation_p.V235L|HHAT_ENST00000537898.1_Missense_Mutation_p.V233L|HHAT_ENST00000308852.6_Missense_Mutation_p.V253L	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	298					multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)			breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		CTTTTTCTACGTGAAGTACTT	0.557																																					p.V299L		Atlas-SNP	.											.	HHAT	66	.	0			c.G895T						.						219.0	214.0	215.0					1																	210637884		2203	4300	6503	SO:0001583	missense	55733	exon7			TTCTACGTGAAGT	AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.892G>T	chr1.hg19:g.210637884G>T	ENSP00000355977:p.Val298Leu	55.0	0.0		92.0	15.0	NM_001170587	B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	ENST00000367010.1	hg19	CCDS1495.1	.	.	.	.	.	.	.	.	.	.	G	16.28	3.077886	0.55753	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000426968	T;T;T;T;T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56;-0.56	5.42	4.5	0.54988	.	0.128145	0.51477	N	0.000087	T	0.60077	0.2241	L	0.31207	0.915	0.40205	D	0.977564	B;B;B;B;B	0.31680	0.188;0.256;0.115;0.221;0.335	B;B;B;B;B	0.39379	0.18;0.133;0.14;0.237;0.298	T	0.55418	-0.8144	10	0.02654	T	1	-20.7441	14.9169	0.70805	0.0:0.1533:0.8467:0.0	.	253;299;161;233;298	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	L	298;161;299;233;298;235;298;253;298;170	ENSP00000416845:V298L;ENSP00000444995:V161L;ENSP00000438468:V299L;ENSP00000442625:V233L;ENSP00000375773:V298L;ENSP00000439229:V235L;ENSP00000261458:V298L;ENSP00000308628:V253L;ENSP00000355977:V298L;ENSP00000413399:V170L	ENSP00000261458:V298L	V	+	1	0	HHAT	208704507	1.000000	0.71417	0.993000	0.49108	0.944000	0.59088	5.922000	0.70036	1.263000	0.44181	0.555000	0.69702	GTG	.	.		0.557	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088662.1	NM_018194	
EPHX1	2052	hgsc.bcm.edu	37	1	226027596	226027596	+	Silent	SNP	C	C	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr1:226027596C>T	ENST00000366837.4	+	6	985	c.789C>T	c.(787-789)ctC>ctT	p.L263L	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Silent_p.L263L	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	263					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					TGACCCTCCTCCTGGGACAGC	0.567																																					p.L263L		Atlas-SNP	.											.	EPHX1	57	.	0			c.C789T						.						198.0	184.0	189.0					1																	226027596		2203	4300	6503	SO:0001819	synonymous_variant	2052	exon6			CCTCCTCCTGGGA	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.789C>T	chr1.hg19:g.226027596C>T		92.0	0.0		173.0	68.0	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Silent	SNP	ENST00000366837.4	hg19	CCDS1547.1																																																																																			.	.		0.567	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
OR2T4	127074	hgsc.bcm.edu	37	1	248525799	248525799	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr1:248525799T>C	ENST00000366475.1	+	1	917	c.917T>C	c.(916-918)gTa>gCa	p.V306A		NM_001004696.1	NP_001004696.1	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T, member 4	306						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|liver(2)|lung(47)	56	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GACATGATGGTATCTGTCTTC	0.488																																					p.V306A		Atlas-SNP	.											.	OR2T4	126	.	0			c.T917C						.						146.0	144.0	144.0					1																	248525799		2203	4300	6503	SO:0001583	missense	127074	exon1			TGATGGTATCTGT	BK004464	CCDS31113.1	1q44	2012-08-09			ENSG00000196944	ENSG00000196944		"""GPCR / Class A : Olfactory receptors"""	15016	protein-coding gene	gene with protein product							Standard	NM_001004696		Approved	OR2T4Q	uc001ieh.1	Q8NH00	OTTHUMG00000040453	ENST00000366475.1:c.917T>C	chr1.hg19:g.248525799T>C	ENSP00000355431:p.Val306Ala	496.0	0.0		736.0	154.0	NM_001004696	Q6IEZ8	Missense_Mutation	SNP	ENST00000366475.1	hg19	CCDS31113.1	.	.	.	.	.	.	.	.	.	.	T	9.787	1.176907	0.21787	.	.	ENSG00000196944	ENST00000366475	T	0.39406	1.08	3.0	0.497	0.16902	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42294	D	0.000722	T	0.30541	0.0768	L	0.35341	1.055	0.09310	N	1	B	0.24618	0.107	B	0.32724	0.151	T	0.29058	-1.0024	10	0.59425	D	0.04	.	7.1922	0.25832	0.0:0.2085:0.0:0.7914	.	306	Q8NH00	OR2T4_HUMAN	A	306	ENSP00000355431:V306A	ENSP00000355431:V306A	V	+	2	0	OR2T4	246592422	0.000000	0.05858	0.997000	0.53966	0.727000	0.41649	-0.087000	0.11215	0.265000	0.21872	0.477000	0.44152	GTA	.	.		0.488	OR2T4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097349.2	NM_001004696	
PGBD2	267002	hgsc.bcm.edu	37	1	249212344	249212344	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr1:249212344G>T	ENST00000329291.5	+	3	1708	c.1561G>T	c.(1561-1563)Gcc>Tcc	p.A521S	PGBD2_ENST00000539153.1_Missense_Mutation_p.A518S|PGBD2_ENST00000355360.4_Missense_Mutation_p.A270S	NM_170725.2	NP_733843.1	Q6P3X8	PGBD2_HUMAN	piggyBac transposable element derived 2	521										NS(1)|endometrium(3)|lung(6)|ovary(1)|skin(3)	14	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.012)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			GAGATACATTGCCTGTGTGTA	0.532																																					p.A521S		Atlas-SNP	.											.	PGBD2	103	.	0			c.G1561T						.						112.0	97.0	102.0					1																	249212344		2203	4300	6503	SO:0001583	missense	267002	exon3			TACATTGCCTGTG	AF229602	CCDS31128.1, CCDS31129.1	1q	2008-02-05			ENSG00000185220	ENSG00000185220			19399	protein-coding gene	gene with protein product							Standard	XM_005270333		Approved		uc001ifh.3	Q6P3X8	OTTHUMG00000040424	ENST00000329291.5:c.1561G>T	chr1.hg19:g.249212344G>T	ENSP00000331643:p.Ala521Ser	57.0	0.0		78.0	14.0	NM_170725	B3KVR8|Q6MZF8	Missense_Mutation	SNP	ENST00000329291.5	hg19	CCDS31128.1	.	.	.	.	.	.	.	.	.	.	.	12.34	1.907149	0.33628	.	.	ENSG00000185220	ENST00000355360;ENST00000329291;ENST00000539153	T;T;T	0.15139	2.45;2.61;2.61	3.05	3.05	0.35203	.	0.122356	0.33650	N	0.004692	T	0.18045	0.0433	N	0.11201	0.11	0.28769	N	0.900468	D;D	0.76494	0.998;0.999	D;D	0.78314	0.954;0.991	T	0.06716	-1.0811	10	0.21014	T	0.42	.	9.8324	0.40950	0.0:0.0:1.0:0.0	.	518;521	F5H4U7;Q6P3X8	.;PGBD2_HUMAN	S	270;521;518	ENSP00000355424:A270S;ENSP00000331643:A521S;ENSP00000439950:A518S	ENSP00000331643:A521S	A	+	1	0	PGBD2	247178967	0.991000	0.36638	0.858000	0.33744	0.037000	0.13140	3.764000	0.55264	1.999000	0.58509	0.467000	0.42956	GCC	.	.		0.532	PGBD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000097318.1		
TPO	7173	hgsc.bcm.edu	37	2	1459869	1459869	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:1459869G>T	ENST00000345913.4	+	7	725	c.634G>T	c.(634-636)Gtc>Ttc	p.V212F	TPO_ENST00000346956.3_Missense_Mutation_p.V212F|TPO_ENST00000329066.4_Missense_Mutation_p.V212F|TPO_ENST00000382201.3_Missense_Mutation_p.V212F|TPO_ENST00000497517.2_Intron|TPO_ENST00000382198.1_Missense_Mutation_p.V212F|TPO_ENST00000337415.3_Missense_Mutation_p.V212F|TPO_ENST00000349624.3_Missense_Mutation_p.V212F	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	212					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	GACAAGACATGTCATTCAAGT	0.507																																					p.V212F		Atlas-SNP	.											.	TPO	224	.	0			c.G634T						.						108.0	77.0	87.0					2																	1459869		2203	4300	6503	SO:0001583	missense	7173	exon7			AGACATGTCATTC		CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.634G>T	chr2.hg19:g.1459869G>T	ENSP00000318820:p.Val212Phe	123.0	0.0		174.0	35.0	NM_175719	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Missense_Mutation	SNP	ENST00000345913.4	hg19	CCDS1643.1	.	.	.	.	.	.	.	.	.	.	G	11.46	1.643946	0.29246	.	.	ENSG00000115705	ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000329066;ENST00000382201;ENST00000382198;ENST00000422464	T;T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	5.04	-2.11	0.07187	.	0.195535	0.50627	D	0.000120	T	0.62109	0.2401	L	0.53729	1.69	0.35091	D	0.76429	P;B;P;D	0.52996	0.946;0.112;0.946;0.957	P;B;P;P	0.50490	0.509;0.029;0.509;0.642	T	0.67078	-0.5761	10	0.72032	D	0.01	-15.945	6.9462	0.24520	0.6615:0.1569:0.1816:0.0	.	212;212;212;212	P07202-4;P07202-5;P07202-2;P07202	.;.;.;PERT_HUMAN	F	212;212;212;212;212;212;212;141	ENSP00000337263:V212F;ENSP00000318820:V212F;ENSP00000263886:V212F;ENSP00000332044:V212F;ENSP00000329869:V212F;ENSP00000371636:V212F;ENSP00000371633:V212F;ENSP00000405788:V141F	ENSP00000329869:V212F	V	+	1	0	TPO	1438876	0.769000	0.28531	0.000000	0.03702	0.036000	0.12997	1.078000	0.30754	-0.249000	0.09569	0.563000	0.77884	GTC	.	.		0.507	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206594.2	NM_000547	
HADHB	3032	hgsc.bcm.edu	37	2	26502123	26502123	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:26502123C>G	ENST00000317799.5	+	9	855	c.751C>G	c.(751-753)Cta>Gta	p.L251V	HADHB_ENST00000405867.3_Intron|HADHB_ENST00000545822.1_Missense_Mutation_p.L229V|HADHB_ENST00000494615.1_3'UTR|HADHB_ENST00000537713.1_Missense_Mutation_p.L236V	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	251					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCTCACAGTCTAGCCAAGAA	0.512																																					p.L251V		Atlas-SNP	.											.	HADHB	50	.	0			c.C751G						.						108.0	99.0	102.0					2																	26502123		2203	4300	6503	SO:0001583	missense	3032	exon9			CACAGTCTAGCCA		CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.751C>G	chr2.hg19:g.26502123C>G	ENSP00000325136:p.Leu251Val	54.0	0.0		78.0	16.0	NM_000183	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	ENST00000317799.5	hg19	CCDS1722.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.573593	0.86542	.	.	ENSG00000138029	ENST00000317799;ENST00000537713;ENST00000545822	D;D;D	0.87966	-2.32;-2.32;-2.32	5.2	5.2	0.72013	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.95541	0.8551	H	0.96208	3.785	0.80722	D	1	P;P;D	0.63046	0.94;0.873;0.992	P;P;D	0.66351	0.755;0.752;0.943	D	0.96412	0.9305	10	0.66056	D	0.02	-12.5094	18.179	0.89771	0.0:1.0:0.0:0.0	.	236;229;251	F5GZQ3;B4E2W0;P55084	.;.;ECHB_HUMAN	V	251;236;229	ENSP00000325136:L251V;ENSP00000444295:L236V;ENSP00000442665:L229V	ENSP00000325136:L251V	L	+	1	2	HADHB	26355627	0.974000	0.33945	1.000000	0.80357	0.998000	0.95712	2.417000	0.44653	2.805000	0.96524	0.655000	0.94253	CTA	.	.		0.512	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214050.2	NM_000183	
LRP1B	53353	hgsc.bcm.edu	37	2	141625228	141625228	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:141625228T>C	ENST00000389484.3	-	27	5481	c.4510A>G	c.(4510-4512)Agt>Ggt	p.S1504G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1504					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGAATCACACTGACATTCTGC	0.478										TSP Lung(27;0.18)																											p.S1504G	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.A4510G						.						209.0	182.0	191.0					2																	141625228		2203	4300	6503	SO:0001583	missense	53353	exon27			TCACACTGACATT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.4510A>G	chr2.hg19:g.141625228T>C	ENSP00000374135:p.Ser1504Gly	126.0	0.0		131.0	26.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801275	0.70567	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.90788	-2.73;-2.73	5.42	5.42	0.78866	Six-bladed beta-propeller, TolB-like (1);	0.061302	0.64402	D	0.000004	D	0.86322	0.5905	L	0.49778	1.585	0.43662	D	0.996089	B;P	0.43094	0.227;0.799	B;B	0.35182	0.179;0.197	D	0.85354	0.1103	10	0.26408	T	0.33	.	15.4528	0.75285	0.0:0.0:0.0:1.0	.	687;1504	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	G	1504;1442;649	ENSP00000374135:S1504G;ENSP00000413239:S649G	ENSP00000374135:S1504G	S	-	1	0	LRP1B	141341698	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.986000	0.88173	2.060000	0.61445	0.533000	0.62120	AGT	.	.		0.478	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
XIRP2	129446	hgsc.bcm.edu	37	2	168107938	168107938	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:168107938T>A	ENST00000409195.1	+	9	10125	c.10036T>A	c.(10036-10038)Tct>Act	p.S3346T	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S3346T|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.S3124T|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3171					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGGCCCAGTTTCTGAAGCAAA	0.383																																					p.S3346T		Atlas-SNP	.											.	XIRP2	914	.	0			c.T10036A						.						98.0	94.0	95.0					2																	168107938		1862	4107	5969	SO:0001583	missense	129446	exon9			CCAGTTTCTGAAG	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.10036T>A	chr2.hg19:g.168107938T>A	ENSP00000386840:p.Ser3346Thr	107.0	0.0		193.0	40.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	T	12.52	1.962708	0.34659	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02369	4.32;4.32;4.32	6.07	6.07	0.98685	.	0.300219	0.38111	N	0.001808	T	0.02929	0.0087	N	0.22421	0.69	0.20196	N	0.999922	B;B;B	0.12013	0.003;0.005;0.001	B;B;B	0.12837	0.003;0.008;0.002	T	0.39231	-0.9624	10	0.72032	D	0.01	-11.3709	11.2379	0.48951	0.1371:0.0:0.0:0.8629	.	3171;3171;3124	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	T	3346;3346;3124;760	ENSP00000386840:S3346T;ENSP00000295237:S3346T;ENSP00000387255:S3124T	ENSP00000295237:S3346T	S	+	1	0	XIRP2	167816184	0.994000	0.37717	0.991000	0.47740	0.979000	0.70002	3.091000	0.50199	2.330000	0.79161	0.477000	0.44152	TCT	.	.		0.383	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:178098803C>G	ENST00000397062.3	-	2	796	c.242G>C	c.(241-243)gGt>gCt	p.G81A	NFE2L2_ENST00000423513.1_Missense_Mutation_p.G65A|NFE2L2_ENST00000446151.2_Missense_Mutation_p.G65A|NFE2L2_ENST00000464747.1_Missense_Mutation_p.G65A|NFE2L2_ENST00000397063.4_Missense_Mutation_p.G65A	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	81					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81D(5)|p.G81V(4)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.G81A		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,-1,11	NFE2L2	225	.	10	Substitution - Missense(9)|Deletion - In frame(1)	lung(4)|oesophagus(2)|liver(2)|endometrium(1)|kidney(1)	c.G242C						.						143.0	142.0	142.0					2																	178098803		1901	4105	6006	SO:0001583	missense	4780	exon2			AATTCACCTGTCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.242G>C	chr2.hg19:g.178098803C>G	ENSP00000380252:p.Gly81Ala	48.0	0.0		69.0	17.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.3|27.3	4.820816|4.820816	0.90873|0.90873	.|.	.|.	ENSG00000116044|ENSG00000116044	ENST00000449627|ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	.|T;T;T;T;T;T	.|0.51574	.|1.23;1.23;1.23;0.7;0.7;1.23	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.74749	.|0.3757	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.999;1.0;1.0	.|D;D;D;D	.|0.91635	.|0.998;0.997;0.999;0.998	.|T	.|0.76350	.|-0.2991	.|10	.|0.51188	.|T	.|0.08	.|.	19.9976|19.9976	0.97389|0.97389	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|65;65;65;81	.|E9PGJ7;B4DNB0;C9JFL6;Q16236	.|.;.;.;NF2L2_HUMAN	.|A	-1|65;81;65;65;65;65	.|ENSP00000380253:G65A;ENSP00000380252:G81A;ENSP00000411575:G65A;ENSP00000400073:G65A;ENSP00000412191:G65A;ENSP00000410015:G65A	.|ENSP00000380252:G81A	.|G	-|-	.|2	.|0	NFE2L2|NFE2L2	177807049|177807049	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.993000|0.993000	0.82548|0.82548	7.298000|7.298000	0.78815|0.78815	2.737000|2.737000	0.93849|0.93849	0.563000|0.563000	0.77884|0.77884	.|GGT	.	.		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
ATIC	471	hgsc.bcm.edu	37	2	216198147	216198147	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:216198147A>T	ENST00000236959.9	+	9	1215	c.889A>T	c.(889-891)Aca>Tca	p.T297S	ATIC_ENST00000540518.1_Missense_Mutation_p.T238S|ATIC_ENST00000435675.1_Missense_Mutation_p.T296S	NM_004044.6	NP_004035.2	P31939	PUR9_HUMAN	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase	297					'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|dihydrofolate metabolic process (GO:0046452)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	IMP cyclohydrolase activity (GO:0003937)|phosphoribosylaminoimidazolecarboxamide formyltransferase activity (GO:0004643)|protein homodimerization activity (GO:0042803)		ATIC/ALK(24)	large_intestine(2)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	8		Renal(323;0.229)		Epithelial(149;2.02e-06)|all cancers(144;0.000316)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.0097)	Methotrexate(DB00563)|Pemetrexed(DB00642)|Tetrahydrofolic acid(DB00116)	TAAAACCCTCACACCCATCTC	0.393			T	ALK	ALCL																																p.T297S		Atlas-SNP	.		Dom	yes		2	2q35	471	5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase		L	.	ATIC	84	.	0			c.A889T						.						109.0	104.0	106.0					2																	216198147		2203	4300	6503	SO:0001583	missense	471	exon9			ACCCTCACACCCA		CCDS2398.1	2q35	2010-04-27			ENSG00000138363	ENSG00000138363	2.1.2.3, 3.5.4.10		794	protein-coding gene	gene with protein product	"""phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase"""	601731				8567683, 9378707	Standard	NM_004044		Approved	PURH, AICARFT, IMPCHASE	uc002vex.4	P31939	OTTHUMG00000133023	ENST00000236959.9:c.889A>T	chr2.hg19:g.216198147A>T	ENSP00000236959:p.Thr297Ser	129.0	0.0		171.0	31.0	NM_004044	A8K202|E9PBU3|Q13856|Q53S28	Missense_Mutation	SNP	ENST00000236959.9	hg19	CCDS2398.1	.	.	.	.	.	.	.	.	.	.	A	9.052	0.992251	0.18966	.	.	ENSG00000138363	ENST00000236959;ENST00000540518;ENST00000435675	T;T;T	0.75704	-0.96;-0.96;-0.96	6.07	6.07	0.98685	AICAR transformylase domain (1);Cytidine deaminase-like (1);	0.044591	0.85682	D	0.000000	T	0.54062	0.1835	N	0.04787	-0.16	0.80722	D	1	B;B	0.12630	0.004;0.006	B;B	0.11329	0.006;0.004	T	0.53968	-0.8363	10	0.10636	T	0.68	-25.2601	16.2891	0.82738	1.0:0.0:0.0:0.0	.	296;297	E9PBU3;P31939	.;PUR9_HUMAN	S	297;238;296	ENSP00000236959:T297S;ENSP00000440523:T238S;ENSP00000415935:T296S	ENSP00000236959:T297S	T	+	1	0	ATIC	215906392	1.000000	0.71417	0.165000	0.22776	0.015000	0.08874	7.349000	0.79376	2.330000	0.79161	0.528000	0.53228	ACA	.	.		0.393	ATIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256610.1	NM_004044	
IGFBP5	3488	hgsc.bcm.edu	37	2	217542908	217542908	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:217542908G>A	ENST00000233813.4	-	3	1363	c.614C>T	c.(613-615)gCc>gTc	p.A205V		NM_000599.3	NP_000590.1	P24593	IBP5_HUMAN	insulin-like growth factor binding protein 5	205	Thyroglobulin type-1. {ECO:0000255|PROSITE-ProRule:PRU00500}.				cellular protein metabolic process (GO:0044267)|cellular response to cAMP (GO:0071320)|cellular response to organic cyclic compound (GO:0071407)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|hair follicle morphogenesis (GO:0031069)|intracellular signal transduction (GO:0035556)|mammary gland involution (GO:0060056)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of translation (GO:0017148)|osteoblast differentiation (GO:0001649)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell growth (GO:0001558)|regulation of glucose metabolic process (GO:0010906)|signal transduction (GO:0007165)|skeletal muscle tissue growth (GO:0048630)|striated muscle cell differentiation (GO:0051146)|type B pancreatic cell proliferation (GO:0044342)	extracellular region (GO:0005576)|insulin-like growth factor binding protein complex (GO:0016942)	insulin-like growth factor I binding (GO:0031994)			endometrium(1)|large_intestine(3)|lung(1)	5		Renal(323;0.0822)		Epithelial(149;2.1e-06)|all cancers(144;0.000165)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCGTGGGCTGGCTTTGAGCTC	0.622																																					p.A205V		Atlas-SNP	.											.	IGFBP5	13	.	0			c.C614T						.						80.0	75.0	76.0					2																	217542908		2203	4300	6503	SO:0001583	missense	3488	exon3			GGGCTGGCTTTGA		CCDS2405.1	2q35	2014-09-16			ENSG00000115461	ENSG00000115461			5474	protein-coding gene	gene with protein product		146734				7511611	Standard	NM_000599		Approved		uc002vgj.4	P24593	OTTHUMG00000133058	ENST00000233813.4:c.614C>T	chr2.hg19:g.217542908G>A	ENSP00000233813:p.Ala205Val	166.0	0.0		236.0	48.0	NM_000599	Q5U0A3	Missense_Mutation	SNP	ENST00000233813.4	hg19	CCDS2405.1	.	.	.	.	.	.	.	.	.	.	G	12.03	1.816648	0.32145	.	.	ENSG00000115461	ENST00000233813	T	0.63744	-0.06	4.75	3.87	0.44632	Thyroglobulin type-1 (4);	0.448714	0.25590	N	0.029636	T	0.44008	0.1273	N	0.14661	0.345	0.28199	N	0.927433	B	0.23442	0.085	B	0.25759	0.063	T	0.27365	-1.0076	10	0.20519	T	0.43	-16.0966	13.5892	0.61951	0.0:0.3177:0.6823:0.0	.	205	P24593	IBP5_HUMAN	V	205	ENSP00000233813:A205V	ENSP00000233813:A205V	A	-	2	0	IGFBP5	217251153	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.973000	0.56845	1.195000	0.43115	0.561000	0.74099	GCC	.	.		0.622	IGFBP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256674.2	NM_000599	
STK11IP	114790	hgsc.bcm.edu	37	2	220466724	220466724	+	Silent	SNP	C	C	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:220466724C>T	ENST00000456909.1	+	5	447	c.357C>T	c.(355-357)ccC>ccT	p.P119P	STK11IP_ENST00000295641.10_Silent_p.P130P|STK11IP_ENST00000459692.1_3'UTR			Q8N1F8	S11IP_HUMAN	serine/threonine kinase 11 interacting protein	130					protein localization (GO:0008104)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)	protein kinase binding (GO:0019901)			breast(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|urinary_tract(1)	23		Renal(207;0.0183)		Epithelial(149;2.69e-07)|all cancers(144;5.91e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GAGGTGTTCCCCTCCACTGTC	0.587																																					p.P130P		Atlas-SNP	.											.	STK11IP	152	.	0			c.C390T						.						44.0	43.0	43.0					2																	220466724		1979	4152	6131	SO:0001819	synonymous_variant	114790	exon5			TGTTCCCCTCCAC	AF450267	CCDS46521.1	2q35	2008-06-03			ENSG00000144589	ENSG00000144589			19184	protein-coding gene	gene with protein product	"""LKB1 interacting protein"""	607172				11741830	Standard	NM_052902		Approved	LIP1, KIAA1898, LKB1IP, STK11IP1	uc002vml.3	Q8N1F8	OTTHUMG00000059239	ENST00000456909.1:c.357C>T	chr2.hg19:g.220466724C>T		28.0	0.0		59.0	16.0	NM_052902	Q8NAW9|Q8WXE4|Q96CN3|Q96PY9	Silent	SNP	ENST00000456909.1	hg19																																																																																				.	.		0.587	STK11IP-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000131432.1	NM_052902	
PER2	8864	hgsc.bcm.edu	37	2	239184515	239184515	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr2:239184515T>A	ENST00000254657.3	-	4	596	c.317A>T	c.(316-318)gAc>gTc	p.D106V	PER2_ENST00000254658.3_Missense_Mutation_p.D106V|PER2_ENST00000440245.1_Missense_Mutation_p.D106V|PER2_ENST00000355768.2_Missense_Mutation_p.D106V	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	106					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		TTTGTGTGTGTCCACTTTCGA	0.507																																					p.D106V		Atlas-SNP	.											.	PER2	85	.	0			c.A317T						.						205.0	197.0	200.0					2																	239184515		2203	4300	6503	SO:0001583	missense	8864	exon4			TGTGTGTCCACTT	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.317A>T	chr2.hg19:g.239184515T>A	ENSP00000254657:p.Asp106Val	69.0	0.0		98.0	20.0	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	hg19	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	T	13.03	2.115550	0.37339	.	.	ENSG00000132326	ENST00000254657;ENST00000254658;ENST00000440245;ENST00000355768;ENST00000431832	T;T;T;T;T	0.47869	2.85;0.9;1.92;0.9;0.83	4.43	4.43	0.53597	.	0.206996	0.48767	D	0.000175	T	0.58352	0.2116	M	0.65975	2.015	0.32947	D	0.519221	P;D;P;B	0.63880	0.951;0.993;0.713;0.437	P;P;P;B	0.55161	0.576;0.77;0.69;0.397	T	0.72516	-0.4269	10	0.72032	D	0.01	-24.5296	11.971	0.53063	0.0:0.0:0.0:1.0	.	106;106;106;106	F5GYD5;B4DH14;O15055-2;O15055	.;.;.;PER2_HUMAN	V	106	ENSP00000254657:D106V;ENSP00000254658:D106V;ENSP00000397516:D106V;ENSP00000348013:D106V;ENSP00000405891:D106V	ENSP00000254657:D106V	D	-	2	0	PER2	238849254	1.000000	0.71417	0.003000	0.11579	0.001000	0.01503	6.016000	0.70798	1.782000	0.52362	0.533000	0.62120	GAC	.	.		0.507	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
LRRN1	57633	hgsc.bcm.edu	37	3	3887129	3887129	+	Missense_Mutation	SNP	A	A	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr3:3887129A>C	ENST00000319331.3	+	2	1565	c.804A>C	c.(802-804)ttA>ttC	p.L268F	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	268						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		TGAAATTCTTAGACCTCAACA	0.403																																					p.L268F		Atlas-SNP	.											.	LRRN1	82	.	0			c.A804C						.						69.0	77.0	74.0					3																	3887129		2203	4297	6500	SO:0001583	missense	57633	exon2			ATTCTTAGACCTC	AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.804A>C	chr3.hg19:g.3887129A>C	ENSP00000314901:p.Leu268Phe	118.0	0.0		150.0	21.0	NM_020873	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	ENST00000319331.3	hg19	CCDS33685.1	.	.	.	.	.	.	.	.	.	.	A	19.24	3.789643	0.70337	.	.	ENSG00000175928	ENST00000319331	D	0.81499	-1.5	5.55	4.38	0.52667	.	0.000000	0.64402	D	0.000001	D	0.90205	0.6938	H	0.94847	3.59	0.54753	D	0.99998	D	0.89917	1.0	D	0.79784	0.993	D	0.88501	0.3082	10	0.87932	D	0	.	3.8344	0.08888	0.6225:0.1963:0.1812:0.0	.	268	Q6UXK5	LRRN1_HUMAN	F	268	ENSP00000314901:L268F	ENSP00000314901:L268F	L	+	3	2	LRRN1	3862129	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.344000	0.33941	0.906000	0.36621	0.528000	0.53228	TTA	.	.		0.403	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337704.2	NM_020873	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266097	41266097	+	Missense_Mutation	SNP	G	G	T	rs28931588|rs121913416|rs121913417		TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr3:41266097G>T	ENST00000349496.5	+	3	374	c.94G>T	c.(94-96)Gac>Tac	p.D32Y	CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25Y|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32Y(128)|p.D32N(82)|p.A5_A80del(53)|p.D32H(40)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.Q28fs*20(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.D32fs*9(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		GTCTTACCTGGACTCTGGAAT	0.478	D32N(KE39_STOMACH)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32Y	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,2	CTNNB1	4904	.	397	Substitution - Missense(250)|Deletion - In frame(120)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Complex - frameshift(1)	liver(155)|central_nervous_system(55)|endometrium(40)|stomach(36)|pancreas(28)|large_intestine(22)|pituitary(22)|skin(11)|ovary(9)|soft_tissue(4)|prostate(4)|small_intestine(2)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|adrenal_gland(1)|biliary_tract(1)|urinary_tract(1)|lung(1)|NS(1)	c.G94T						.						92.0	77.0	82.0					3																	41266097		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TACCTGGACTCTG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.94G>T	chr3.hg19:g.41266097G>T	ENSP00000344456:p.Asp32Tyr	151.0	0.0		152.0	45.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337485	0.81911	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.68210	0.2976	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	T	0.70498	-0.4855	10	0.87932	D	0	0.3843	19.9596	0.97236	0.0:0.0:1.0:0.0	rs28931588	32	P35222	CTNB1_HUMAN	Y	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25Y;ENSP00000385604:D32Y;ENSP00000412219:D32Y;ENSP00000379486:D32Y;ENSP00000344456:D32Y;ENSP00000411226:D25Y;ENSP00000379488:D32Y;ENSP00000409302:D32Y;ENSP00000401599:D32Y	ENSP00000344456:D32Y	D	+	1	0	CTNNB1	41241101	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GAC	.	.		0.478	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
FAM208A	23272	hgsc.bcm.edu	37	3	56705673	56705673	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr3:56705673C>A	ENST00000493960.2	-	3	535	c.525G>T	c.(523-525)aaG>aaT	p.K175N	FAM208A_ENST00000355628.5_Missense_Mutation_p.K175N	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	175							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CTGAAAGTTCCTTATCTAAAC	0.318																																					p.K175N		Atlas-SNP	.											.	FAM208A	113	.	0			c.G525T						.						225.0	202.0	209.0					3																	56705673		692	1591	2283	SO:0001583	missense	23272	exon3			AAGTTCCTTATCT	AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.525G>T	chr3.hg19:g.56705673C>A	ENSP00000417509:p.Lys175Asn	54.0	0.0		116.0	29.0	NM_001112736	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	ENST00000493960.2	hg19	CCDS46853.1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979118	0.74360	.	.	ENSG00000163946	ENST00000493960;ENST00000355628	T;T	0.48522	0.81;0.81	5.85	3.65	0.41850	.	.	.	.	.	T	0.54447	0.1859	L	0.42245	1.32	0.42229	D	0.991883	D;D	0.76494	0.999;0.999	D;D	0.71656	0.953;0.974	T	0.55964	-0.8057	9	0.66056	D	0.02	-5.0504	6.2185	0.20667	0.0:0.3753:0.0:0.6247	.	175;175	Q9UK61-3;Q9UK61-4	.;.	N	175	ENSP00000417509:K175N;ENSP00000347845:K175N	ENSP00000347845:K175N	K	-	3	2	C3orf63	56680713	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.853000	0.27777	1.310000	0.45006	0.655000	0.94253	AAG	.	.		0.318	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352352.2	NM_015224	
PLA1A	51365	hgsc.bcm.edu	37	3	119328406	119328406	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr3:119328406A>T	ENST00000273371.4	+	4	617	c.545A>T	c.(544-546)cAg>cTg	p.Q182L	PLA1A_ENST00000495992.1_Missense_Mutation_p.Q166L|PLA1A_ENST00000494440.1_Missense_Mutation_p.Q166L|PLA1A_ENST00000488919.1_Missense_Mutation_p.Q9L	NM_015900.3	NP_056984.1	Q53H76	PLA1A_HUMAN	phospholipase A1 member A	182					lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|phosphatidylserine metabolic process (GO:0006658)	extracellular vesicular exosome (GO:0070062)	phosphatidylcholine 1-acylhydrolase activity (GO:0008970)			NS(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTCGGAGGCCAGCTGGGACAG	0.537																																					p.Q182L		Atlas-SNP	.											.	PLA1A	65	.	0			c.A545T						.						102.0	100.0	100.0					3																	119328406		2203	4300	6503	SO:0001583	missense	51365	exon4			GAGGCCAGCTGGG	AF035268	CCDS2991.1, CCDS56268.1, CCDS56269.1	3q13.13-q13.2	2002-11-28			ENSG00000144837	ENSG00000144837			17661	protein-coding gene	gene with protein product		607460				10196188	Standard	NM_015900		Approved	ps-PLA1	uc003ecu.3	Q53H76	OTTHUMG00000159425	ENST00000273371.4:c.545A>T	chr3.hg19:g.119328406A>T	ENSP00000273371:p.Gln182Leu	73.0	0.0		90.0	19.0	NM_015900	B2R8V2|B4DXA2|O95991|Q86WX6|Q9UPD2	Missense_Mutation	SNP	ENST00000273371.4	hg19	CCDS2991.1	.	.	.	.	.	.	.	.	.	.	A	15.88	2.962976	0.53507	.	.	ENSG00000144837	ENST00000273371;ENST00000488919;ENST00000495992;ENST00000494440;ENST00000475963	D;D;D;D;D	0.91011	-2.77;-2.77;-2.77;-2.77;-2.77	5.31	5.31	0.75309	Lipase, N-terminal (1);	0.226040	0.36482	U	0.002561	D	0.87148	0.6105	L	0.55481	1.735	0.49389	D	0.999785	P;P	0.40230	0.708;0.574	B;B	0.37650	0.165;0.255	D	0.87338	0.2329	10	0.59425	D	0.04	-14.8871	9.8108	0.40822	0.8468:0.0:0.0:0.1531	.	166;182	Q53H76-3;Q53H76	.;PLA1A_HUMAN	L	182;9;166;166;48	ENSP00000273371:Q182L;ENSP00000420625:Q9L;ENSP00000417326:Q166L;ENSP00000418793:Q166L;ENSP00000417295:Q48L	ENSP00000273371:Q182L	Q	+	2	0	PLA1A	120811096	0.964000	0.33143	1.000000	0.80357	0.922000	0.55478	2.130000	0.42064	2.123000	0.65237	0.459000	0.35465	CAG	.	.		0.537	PLA1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355252.2		
SLC2A2	6514	hgsc.bcm.edu	37	3	170732356	170732356	+	Silent	SNP	T	T	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr3:170732356T>C	ENST00000314251.3	-	3	352	c.273A>G	c.(271-273)caA>caG	p.Q91Q	SLC2A2_ENST00000382808.4_Intron	NM_000340.1	NP_000331.1	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 2	91					carbohydrate metabolic process (GO:0005975)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transmembrane transport (GO:0035428)|hexose transport (GO:0008645)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	brush border (GO:0005903)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|hexose transmembrane transporter activity (GO:0015149)			central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)		Streptozocin(DB00428)	TGGTGATTAGTTGAGCAGCTG	0.488																																					p.Q91Q		Atlas-SNP	.											.	SLC2A2	71	.	0			c.A273G						.						217.0	198.0	205.0					3																	170732356		2203	4300	6503	SO:0001819	synonymous_variant	6514	exon3			GATTAGTTGAGCA	J03810	CCDS3215.1	3q26.2-q27	2013-05-22			ENSG00000163581	ENSG00000163581		"""Solute carriers"""	11006	protein-coding gene	gene with protein product		138160		GLUT2		1852621	Standard	NM_000340		Approved		uc003fhe.1	P11168	OTTHUMG00000158997	ENST00000314251.3:c.273A>G	chr3.hg19:g.170732356T>C		100.0	0.0		117.0	29.0	NM_000340	A8K481|B2R936|B7Z547|F8W8V8|Q9UCW9	Silent	SNP	ENST00000314251.3	hg19	CCDS3215.1																																																																																			.	.		0.488	SLC2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352834.1	NM_000340	
CPZ	8532	hgsc.bcm.edu	37	4	8605798	8605798	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr4:8605798A>T	ENST00000360986.4	+	4	766	c.592A>T	c.(592-594)Agg>Tgg	p.R198W	CPZ_ENST00000315782.6_Missense_Mutation_p.R187W|CPZ_ENST00000429646.2_De_novo_Start_OutOfFrame|CPZ_ENST00000382480.2_Missense_Mutation_p.R61W	NM_001014447.2	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z	198					proteolysis (GO:0006508)|Wnt signaling pathway (GO:0016055)	extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(23)|ovary(3)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						GCGTGTGCTGAGGCGGACGGC	0.697																																					p.R198W		Atlas-SNP	.											.	CPZ	95	.	0			c.A592T						.						21.0	18.0	19.0					4																	8605798		2173	4259	6432	SO:0001583	missense	8532	exon4			GTGCTGAGGCGGA	U83411	CCDS3404.1, CCDS33953.1, CCDS43212.1	4p16.1	2012-02-10			ENSG00000109625	ENSG00000109625			2333	protein-coding gene	gene with protein product	"""metallocarboxypeptidase Z"""	603105				9099699	Standard	NM_001014447		Approved		uc003glm.3	Q66K79	OTTHUMG00000090513	ENST00000360986.4:c.592A>T	chr4.hg19:g.8605798A>T	ENSP00000354255:p.Arg198Trp	45.0	0.0		78.0	19.0	NM_001014447	O00520|Q96MX2	Missense_Mutation	SNP	ENST00000360986.4	hg19	CCDS33953.1	.	.	.	.	.	.	.	.	.	.	A	16.12	3.032501	0.54790	.	.	ENSG00000109625	ENST00000360986;ENST00000382480;ENST00000315782	T;T;T	0.11821	2.74;2.74;2.74	3.86	1.07	0.20283	Peptidase M14, carboxypeptidase A (1);	0.303434	0.33217	N	0.005152	T	0.31827	0.0809	M	0.83012	2.62	0.80722	D	1	D;D	0.64830	0.994;0.992	P;P	0.59948	0.835;0.866	T	0.06127	-1.0844	10	0.66056	D	0.02	-12.9779	9.9057	0.41375	0.6698:0.3301:0.0:0.0	.	187;198	Q66K79-2;Q66K79	.;CBPZ_HUMAN	W	198;61;187	ENSP00000354255:R198W;ENSP00000371920:R61W;ENSP00000315074:R187W	ENSP00000315074:R187W	R	+	1	2	CPZ	8656698	1.000000	0.71417	0.802000	0.32245	0.340000	0.28889	1.936000	0.40183	0.039000	0.15632	0.454000	0.30748	AGG	.	.		0.697	CPZ-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207001.4	NM_003652	
PRKG2	5593	hgsc.bcm.edu	37	4	82073196	82073196	+	Nonsense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr4:82073196G>A	ENST00000395578.1	-	8	1119	c.1003C>T	c.(1003-1005)Cag>Tag	p.Q335*	PRKG2_ENST00000418486.2_Nonsense_Mutation_p.Q335*|PRKG2_ENST00000545647.1_5'UTR|PRKG2_ENST00000264399.1_Nonsense_Mutation_p.Q335*|PRKG2_ENST00000509169.1_5'UTR			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	335					blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						TCTGTGCTCTGTGTTACTTTT	0.368																																					p.Q335X		Atlas-SNP	.											.	PRKG2	195	.	0			c.C1003T						.						233.0	225.0	228.0					4																	82073196		2203	4300	6503	SO:0001587	stop_gained	5593	exon7			TGCTCTGTGTTAC	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.1003C>T	chr4.hg19:g.82073196G>A	ENSP00000378945:p.Gln335*	62.0	0.0		81.0	24.0	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Nonsense_Mutation	SNP	ENST00000395578.1	hg19	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	G	39	7.639657	0.98406	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486	.	.	.	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.687	18.7444	0.91787	0.0:0.0:1.0:0.0	.	.	.	.	X	335	.	ENSP00000264399:Q335X	Q	-	1	0	PRKG2	82292220	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	8.344000	0.90055	2.729000	0.93468	0.591000	0.81541	CAG	.	.		0.368	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
ESM1	11082	hgsc.bcm.edu	37	5	54281052	54281052	+	Silent	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr5:54281052G>T	ENST00000381405.4	-	1	439	c.294C>A	c.(292-294)atC>atA	p.I98I	ESM1_ENST00000381403.4_Silent_p.I98I|ESM1_ENST00000598310.1_Intron	NM_007036.4	NP_008967.1	Q9NQ30	ESM1_HUMAN	endothelial cell-specific molecule 1	98	IGFBP N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00653}.				angiogenesis (GO:0001525)|positive regulation of cell proliferation (GO:0008284)|positive regulation of hepatocyte growth factor receptor signaling pathway (GO:1902204)|regulation of cell growth (GO:0001558)|sprouting angiogenesis (GO:0002040)	extracellular region (GO:0005576)	hepatocyte growth factor receptor binding (GO:0005171)|integrin binding (GO:0005178)			breast(1)|kidney(1)|large_intestine(4)|lung(4)	10		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.116)	Lung(15;0.23)			TACCTTTGCAGATACCAAACT	0.552																																					p.I98I		Atlas-SNP	.											.	ESM1	27	.	0			c.C294A						.						102.0	104.0	104.0					5																	54281052		2203	4300	6503	SO:0001819	synonymous_variant	11082	exon1			TTTGCAGATACCA	X89426	CCDS3963.1, CCDS47206.1	5q11	2008-02-05			ENSG00000164283	ENSG00000164283			3466	protein-coding gene	gene with protein product		601521				8702785	Standard	NM_001135604		Approved		uc003jpk.3	Q9NQ30	OTTHUMG00000097010	ENST00000381405.4:c.294C>A	chr5.hg19:g.54281052G>T		59.0	0.0		97.0	5.0	NM_001135604	B2R4G3|Q15330|Q3V4E3|Q96ES3	Silent	SNP	ENST00000381405.4	hg19	CCDS3963.1																																																																																			.	.		0.552	ESM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214099.2	NM_007036	
BDP1	55814	hgsc.bcm.edu	37	5	70805742	70805742	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr5:70805742A>T	ENST00000358731.4	+	17	3086	c.2823A>T	c.(2821-2823)aaA>aaT	p.K941N	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	941	9 X 55 AA repeats of G-R-R-X-I-S-P-X-E-N- G-X-E-E-V-K-P-X-X-E-M-E-T-D-L-K-X-T-G-R- E-X-X-X-R-E-K-T-X-E-X-X-D-A-X-E-E-I-D-X- D-L-E-E-T.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		CCCCACAGAAAAATGGCCCAG	0.463																																					p.K941N		Atlas-SNP	.											.	BDP1	204	.	0			c.A2823T						.						72.0	73.0	73.0					5																	70805742		1850	4092	5942	SO:0001583	missense	55814	exon17			ACAGAAAAATGGC	AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.2823A>T	chr5.hg19:g.70805742A>T	ENSP00000351575:p.Lys941Asn	168.0	0.0		206.0	38.0	NM_018429	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	ENST00000358731.4	hg19	CCDS43328.1	.	.	.	.	.	.	.	.	.	.	A	6.480	0.456828	0.12283	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.11277	2.79	2.76	-1.47	0.08772	.	.	.	.	.	T	0.04227	0.0117	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.18310	0.0;0.0;0.027	B;B;B	0.19391	0.0;0.0;0.025	T	0.44081	-0.9351	9	0.23891	T	0.37	.	3.1392	0.06450	0.5072:0.2223:0.2705:0.0	.	941;941;941	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	N	941;521	ENSP00000351575:K941N	ENSP00000351575:K941N	K	+	3	2	BDP1	70841498	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.586000	0.05787	-0.283000	0.09115	0.260000	0.18958	AAA	.	.		0.463	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000374681.2	NM_018429	
PCDHA13	56136	hgsc.bcm.edu	37	5	140263516	140263516	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr5:140263516G>A	ENST00000289272.2	+	1	1663	c.1663G>A	c.(1663-1665)Gtg>Atg	p.V555M	PCDHA6_ENST00000529310.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.V555M|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	555	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGGTGTTCGTGCTGGACGA	0.697																																					p.V555M	Melanoma(147;1739 1852 5500 27947 37288)	Atlas-SNP	.											.	PCDHA13	213	.	0			c.G1663A						.						67.0	73.0	71.0					5																	140263516		2203	4297	6500	SO:0001583	missense	56136	exon1			GTGTTCGTGCTGG	AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1663G>A	chr5.hg19:g.140263516G>A	ENSP00000289272:p.Val555Met	39.0	0.0		82.0	21.0	NM_031865	O75277	Missense_Mutation	SNP	ENST00000289272.2	hg19	CCDS4240.1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922816	0.52653	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.68181	-0.31;-0.31	4.08	4.08	0.47627	Cadherin (5);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.83271	0.5218	M	0.90650	3.135	0.24944	N	0.991835	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	T	0.73550	-0.3947	9	0.87932	D	0	.	9.8562	0.41088	0.0957:0.0:0.9043:0.0	.	555;555;555	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	M	555	ENSP00000386821:V555M;ENSP00000289272:V555M	ENSP00000289272:V555M	V	+	1	0	PCDHA13	140243700	0.995000	0.38212	1.000000	0.80357	0.906000	0.53458	2.470000	0.45119	2.073000	0.62155	0.561000	0.74099	GTG	.	.		0.697	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335000.1	NM_018904	
LRRC16A	55604	hgsc.bcm.edu	37	6	25420378	25420378	+	Nonsense_Mutation	SNP	C	C	T	rs79463028	byFrequency	TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr6:25420378C>T	ENST00000329474.6	+	3	543	c.175C>T	c.(175-177)Cga>Tga	p.R59*	LRRC16A_ENST00000377969.3_5'UTR	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A	59					actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)	p.R59R(1)		breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						TGTAACAGCGCGAATCCCCAC	0.488																																					p.R59X		Atlas-SNP	.											LRRC16A,NS,carcinoma,0,1	LRRC16A	168	.	1	Substitution - coding silent(1)	stomach(1)	c.C175T						.	C	stop/ARG,stop/ARG	1,4109		0,1,2054	188.0	176.0	180.0		175,175	4.4	1.0	6	dbSNP_131	180	0,8410		0,0,4205	no	stop-gained,stop-gained	LRRC16A	NM_001173977.1,NM_017640.5	,	0,1,6259	TT,TC,CC		0.0,0.0243,0.0080	,	59/1366,59/1372	25420378	1,12519	2055	4205	6260	SO:0001587	stop_gained	55604	exon3			ACAGCGCGAATCC	AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.175C>T	chr6.hg19:g.25420378C>T	ENSP00000331983:p.Arg59*	74.0	0.0		104.0	15.0	NM_001173977	B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	Nonsense_Mutation	SNP	ENST00000329474.6	hg19	CCDS54973.1	.	.	.	.	.	.	.	.	.	.	C	39	7.581949	0.98371	2.43E-4	0.0	ENSG00000079691	ENST00000329474;ENST00000399313	.	.	.	4.38	4.38	0.52667	.	0.000000	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	.	12.3158	0.54955	0.0:1.0:0.0:0.0	.	.	.	.	X	59	.	ENSP00000331983:R59X	R	+	1	2	LRRC16A	25528357	0.997000	0.39634	0.969000	0.41365	0.954000	0.61252	3.801000	0.55545	2.246000	0.74042	0.655000	0.94253	CGA	.	.		0.488	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000040045.2	NM_017640	
HIST1H3I	8354	hgsc.bcm.edu	37	6	27839711	27839711	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr6:27839711G>A	ENST00000328488.2	-	1	388	c.383C>T	c.(382-384)gCg>gTg	p.A128V		NM_003533.2	NP_003524.1	P68431	H31_HUMAN	histone cluster 1, H3i	128					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						GATGCGGCGCGCAAGCTGGAT	0.532																																					p.A128V		Atlas-SNP	.											.	HIST1H3I	28	.	0			c.C383T						.						140.0	154.0	149.0					6																	27839711		2203	4300	6503	SO:0001583	missense	8354	exon1			CGGCGCGCAAGCT	X83550	CCDS4636.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000182572	ENSG00000275379		"""Histones / Replication-dependent"""	4771	protein-coding gene	gene with protein product		602814	"""H3 histone family, member F"", ""histone 1, H3i"""	H3FF		9031620, 9439656, 12408966	Standard	NM_003533		Approved	H3/f, H3.f	uc003njy.3	P68431	OTTHUMG00000016184	ENST00000328488.2:c.383C>T	chr6.hg19:g.27839711G>A	ENSP00000329554:p.Ala128Val	88.0	0.0		144.0	29.0	NM_003533	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	ENST00000328488.2	hg19	CCDS4636.1	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044211	0.55110	.	.	ENSG00000182572	ENST00000328488	T	0.78816	-1.21	4.12	4.12	0.48240	.	.	.	.	.	D	0.83367	0.5239	.	.	.	0.46725	D	0.999173	.	.	.	.	.	.	D	0.85408	0.1135	6	0.72032	D	0.01	.	16.6345	0.85043	0.0:0.0:1.0:0.0	.	.	.	.	V	128	ENSP00000329554:A128V	ENSP00000329554:A128V	A	-	2	0	HIST1H3I	27947690	1.000000	0.71417	0.741000	0.31004	0.983000	0.72400	9.288000	0.96055	2.580000	0.87095	0.650000	0.86243	GCG	.	.		0.532	HIST1H3I-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043452.1	NM_003533	
CMTR1	23070	hgsc.bcm.edu	37	6	37414111	37414111	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr6:37414111C>A	ENST00000373451.4	+	4	494	c.330C>A	c.(328-330)agC>agA	p.S110R		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	110	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										GTAAATACAGCCAGGGTCGGA	0.498																																					p.S110R		Atlas-SNP	.											.	FTSJD2	64	.	0			c.C330A						.						186.0	180.0	182.0					6																	37414111		2203	4300	6503	SO:0001583	missense	23070	exon4			ATACAGCCAGGGT	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.330C>A	chr6.hg19:g.37414111C>A	ENSP00000362550:p.Ser110Arg	114.0	0.0		226.0	40.0	NM_015050	A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	ENST00000373451.4	hg19	CCDS4835.1	.	.	.	.	.	.	.	.	.	.	C	14.82	2.648571	0.47258	.	.	ENSG00000137200	ENST00000373451;ENST00000455891;ENST00000373427	T;T	0.30182	1.54;1.54	5.44	3.68	0.42216	D111/G-patch (3);	0.049764	0.85682	D	0.000000	T	0.08403	0.0209	N	0.16790	0.44	0.39936	D	0.974359	P;B	0.36909	0.573;0.093	B;B	0.37833	0.259;0.124	T	0.09975	-1.0650	10	0.46703	T	0.11	-13.3449	6.9995	0.24801	0.0:0.7068:0.1408:0.1524	.	110;110	Q5T7F5;Q8N1G2	.;MTR1_HUMAN	R	110	ENSP00000362550:S110R;ENSP00000414233:S110R	ENSP00000362526:S110R	S	+	3	2	FTSJD2	37522089	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.996000	0.40776	0.680000	0.31366	0.655000	0.94253	AGC	.	.		0.498	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050	
LAMA4	3910	hgsc.bcm.edu	37	6	112430681	112430681	+	Missense_Mutation	SNP	C	C	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr6:112430681C>T	ENST00000230538.7	-	39	5828	c.5431G>A	c.(5431-5433)Gtc>Atc	p.V1811I	LAMA4_ENST00000522006.1_Missense_Mutation_p.V1804I|LAMA4_ENST00000389463.4_Missense_Mutation_p.V1804I|LAMA4_ENST00000424408.2_Missense_Mutation_p.V1804I	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4	1811	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		GCGCCGCTGACCAGGGCTGCT	0.522																																					p.V1811I		Atlas-SNP	.											.	LAMA4	227	.	0			c.G5431A						.						83.0	76.0	78.0					6																	112430681		2203	4300	6503	SO:0001583	missense	3910	exon39			CGCTGACCAGGGC		CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.5431G>A	chr6.hg19:g.112430681C>T	ENSP00000230538:p.Val1811Ile	71.0	0.0		85.0	30.0	NM_001105206	Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	Missense_Mutation	SNP	ENST00000230538.7	hg19	CCDS43491.1	.	.	.	.	.	.	.	.	.	.	C	34	5.401689	0.96030	.	.	ENSG00000112769	ENST00000230538;ENST00000522006;ENST00000389463;ENST00000424408	T;T;T;T	0.79554	-1.28;-1.28;-1.28;-1.28	6.17	6.17	0.99709	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.060035	0.64402	D	0.000003	D	0.84129	0.5404	L	0.51422	1.61	0.80722	D	1	D;D	0.64830	0.991;0.994	P;P	0.60473	0.754;0.875	T	0.80736	-0.1249	10	0.39692	T	0.17	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1811;1804	Q16363;Q16363-2	LAMA4_HUMAN;.	I	1811;1804;1804;1804	ENSP00000230538:V1811I;ENSP00000429488:V1804I;ENSP00000374114:V1804I;ENSP00000416470:V1804I	ENSP00000230538:V1811I	V	-	1	0	LAMA4	112537374	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.848000	0.75409	2.941000	0.99782	0.655000	0.94253	GTC	.	.		0.522	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041876.2	NM_001105206	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151130378	151130378	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr6:151130378C>G	ENST00000358517.2	+	8	1261	c.1050C>G	c.(1048-1050)atC>atG	p.I350M	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.I350M			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	350	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		TGCTGCTCATCACGAAGAAGA	0.557																																					p.I350M		Atlas-SNP	.											.	PLEKHG1	97	.	0			c.C1050G						.						113.0	107.0	109.0					6																	151130378		2203	4300	6503	SO:0001583	missense	57480	exon9			GCTCATCACGAAG	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1050C>G	chr6.hg19:g.151130378C>G	ENSP00000351318:p.Ile350Met	62.0	0.0		63.0	13.0	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	hg19	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.618051	0.46736	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	D;D	0.88586	-2.4;-2.4	5.63	4.76	0.60689	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.045865	0.85682	D	0.000000	D	0.91751	0.7391	M	0.74881	2.28	0.53688	D	0.999973	D;D;D	0.76494	0.973;0.999;0.999	P;D;D	0.75484	0.827;0.986;0.986	D	0.92648	0.6130	10	0.72032	D	0.01	.	10.9189	0.47152	0.0:0.8029:0.0:0.1971	.	157;350;350	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	M	350	ENSP00000356297:I350M;ENSP00000351318:I350M	ENSP00000351318:I350M	I	+	3	3	PLEKHG1	151172071	1.000000	0.71417	0.998000	0.56505	0.425000	0.31504	0.827000	0.27421	1.374000	0.46228	0.650000	0.86243	ATC	.	.		0.557	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
CCDC170	80129	hgsc.bcm.edu	37	6	151907029	151907029	+	Silent	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr6:151907029C>A	ENST00000239374.7	+	7	1197	c.1098C>A	c.(1096-1098)gtC>gtA	p.V366V	CCDC170_ENST00000367290.5_Silent_p.V366V	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	366																	TCCAGATGGTCTCCCAGCTTG	0.448																																					p.V366V		Atlas-SNP	.											.	.	.	.	0			c.C1098A						.						69.0	62.0	64.0					6																	151907029		1905	4125	6030	SO:0001819	synonymous_variant	80129	exon7			GATGGTCTCCCAG	AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1098C>A	chr6.hg19:g.151907029C>A		85.0	0.0		71.0	14.0	NM_025059	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Silent	SNP	ENST00000239374.7	hg19	CCDS43515.1																																																																																			.	.		0.448	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042727.2	NM_025059	
AMPH	273	hgsc.bcm.edu	37	7	38500941	38500941	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr7:38500941A>T	ENST00000356264.2	-	11	1174	c.959T>A	c.(958-960)aTc>aAc	p.I320N	AMPH_ENST00000428293.2_Missense_Mutation_p.I320N|AMPH_ENST00000325590.5_Missense_Mutation_p.I320N	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	320					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						GAAACTGATGATGTTCTCCTG	0.468																																					p.I320N		Atlas-SNP	.											.	AMPH	157	.	0			c.T959A						.						197.0	194.0	195.0					7																	38500941		2203	4300	6503	SO:0001583	missense	273	exon11			CTGATGATGTTCT		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.959T>A	chr7.hg19:g.38500941A>T	ENSP00000348602:p.Ile320Asn	109.0	0.0		129.0	12.0	NM_139316	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	hg19	CCDS5456.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.6|23.6	4.432527|4.432527	0.83776|0.83776	.|.	.|.	ENSG00000078053|ENSG00000078053	ENST00000441628|ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242;ENST00000544070	.|T;T;T	.|0.53206	.|0.63;0.63;0.63	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68458|0.68458	0.3003|0.3003	M|M	0.73962|0.73962	2.25|2.25	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.999;0.998	T|T	0.67662|0.67662	-0.5613|-0.5613	5|10	.|0.35671	.|T	.|0.21	-19.4544|-19.4544	16.0937|16.0937	0.81106|0.81106	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|320;320;76	.|P49418-2;P49418;Q8NFL4	.|.;AMPH_HUMAN;.	Q|N	70|320;320;320;90;323	.|ENSP00000317441:I320N;ENSP00000348602:I320N;ENSP00000390734:I320N	.|ENSP00000317441:I320N	H|I	-|-	3|2	2|0	AMPH|AMPH	38467466|38467466	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.481000|7.481000	0.81124|0.81124	2.211000|2.211000	0.71520|0.71520	0.455000|0.455000	0.32223|0.32223	CAT|ATC	.	.		0.468	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
SAMD9	54809	hgsc.bcm.edu	37	7	92735147	92735147	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr7:92735147C>A	ENST00000379958.2	-	3	533	c.264G>T	c.(262-264)atG>atT	p.M88I		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	88						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			TGGGCTTTCCCATCTTAGATG	0.383																																					p.M88I		Atlas-SNP	.											.	SAMD9	239	.	0			c.G264T						.						175.0	173.0	173.0					7																	92735147		2203	4300	6503	SO:0001583	missense	54809	exon2			CTTTCCCATCTTA	AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.264G>T	chr7.hg19:g.92735147C>A	ENSP00000369292:p.Met88Ile	100.0	0.0		146.0	35.0	NM_001193307	A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	ENST00000379958.2	hg19	CCDS34680.1	.	.	.	.	.	.	.	.	.	.	C	9.175	1.022214	0.19433	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.21543	2.0;2.81	4.6	-2.09	0.07232	.	2.447570	0.01856	N	0.036287	T	0.09598	0.0236	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19192	-1.0313	10	0.38643	T	0.18	.	0.5965	0.00737	0.4235:0.1949:0.1414:0.2402	.	88	Q5K651	SAMD9_HUMAN	I	88	ENSP00000369292:M88I;ENSP00000414529:M88I	ENSP00000369292:M88I	M	-	3	0	SAMD9	92573083	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.094000	0.15107	-0.257000	0.09459	0.603000	0.83216	ATG	.	.		0.383	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341761.1	NM_017654	
NRCAM	4897	hgsc.bcm.edu	37	7	107875094	107875094	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr7:107875094C>G	ENST00000425651.2	-	3	162	c.163G>C	c.(163-165)Gat>Cat	p.D55H	NRCAM_ENST00000379024.4_Missense_Mutation_p.D55H|NRCAM_ENST00000351718.4_Missense_Mutation_p.D49H|NRCAM_ENST00000413765.2_Missense_Mutation_p.D55H|NRCAM_ENST00000379022.4_Missense_Mutation_p.D55H|NRCAM_ENST00000379028.3_Missense_Mutation_p.D55H	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	55	Ig-like 1.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						ATAATGTAATCTTTTGGAGAC	0.368																																					p.D55H		Atlas-SNP	.											.	NRCAM	267	.	0			c.G163C						.						108.0	116.0	113.0					7																	107875094		2203	4300	6503	SO:0001583	missense	4897	exon3			TGTAATCTTTTGG		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.163G>C	chr7.hg19:g.107875094C>G	ENSP00000401244:p.Asp55His	70.0	0.0		110.0	25.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	hg19	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490125	0.84962	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979;ENST00000417701;ENST00000442580;ENST00000419936;ENST00000456431;ENST00000418239	T;T;T;T;T;T;T;T;T;T	0.72282	0.0;0.3;0.02;0.09;0.0;0.04;-0.64;-0.42;-0.42;-0.42	5.61	5.61	0.85477	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.044905	0.85682	D	0.000000	D	0.84547	0.5496	M	0.85041	2.73	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.994	D;D;D;D;D	0.75020	0.981;0.981;0.985;0.965;0.954	D	0.86170	0.1599	10	0.72032	D	0.01	.	13.2433	0.60010	0.0:0.9272:0.0:0.0728	.	55;55;55;49;55	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	H	55;55;55;55;49;55;55;55;49;49;55;49;49;55	ENSP00000368314:D55H;ENSP00000407858:D55H;ENSP00000325269:D49H;ENSP00000368310:D55H;ENSP00000401244:D55H;ENSP00000368308:D55H;ENSP00000390421:D49H;ENSP00000390868:D55H;ENSP00000397544:D49H;ENSP00000408203:D49H	ENSP00000325269:D49H	D	-	1	0	NRCAM	107662330	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.066000	0.57520	2.813000	0.96785	0.655000	0.94253	GAT	.	.		0.368	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
DENND4C	55667	hgsc.bcm.edu	37	9	19316642	19316642	+	Missense_Mutation	SNP	T	T	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr9:19316642T>G	ENST00000380432.2	+	8	937	c.904T>G	c.(904-906)Tca>Gca	p.S302A	DENND4C_ENST00000434457.2_Missense_Mutation_p.S538A|DENND4C_ENST00000602925.1_Missense_Mutation_p.S538A			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	302					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TCAAGAAGGCTCAGCGATTGA	0.348																																					p.S538A		Atlas-SNP	.											.	DENND4C	120	.	0			c.T1612G						.						88.0	95.0	93.0					9																	19316642		2202	4300	6502	SO:0001583	missense	55667	exon12			GAAGGCTCAGCGA	AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.904T>G	chr9.hg19:g.19316642T>G	ENSP00000369797:p.Ser302Ala	125.0	0.0		161.0	28.0	NM_017925	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	ENST00000380432.2	hg19		.	.	.	.	.	.	.	.	.	.	T	7.755	0.704263	0.15172	.	.	ENSG00000137145	ENST00000380437	.	.	.	5.15	5.15	0.70609	.	0.240505	0.43919	D	0.000504	T	0.45155	0.1328	L	0.39898	1.24	0.80722	D	1	B	0.30937	0.301	B	0.27170	0.077	T	0.38373	-0.9664	9	0.07990	T	0.79	-15.7034	15.1295	0.72511	0.0:0.0:0.0:1.0	.	302	Q5VZ89	DEN4C_HUMAN	A	302	.	ENSP00000369802:S302A	S	+	1	0	DENND4C	19306642	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.576000	0.60915	2.162000	0.67917	0.477000	0.44152	TCA	.	.		0.348	DENND4C-201	KNOWN	basic	protein_coding	protein_coding		NM_017925	
NUTM2F	54754	hgsc.bcm.edu	37	9	97084601	97084601	+	Nonsense_Mutation	SNP	G	G	A	rs376058940		TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr9:97084601G>A	ENST00000253262.4	-	3	744	c.724C>T	c.(724-726)Cga>Tga	p.R242*	NUTM2F_ENST00000335456.7_Nonsense_Mutation_p.R242*|NUTM2F_ENST00000341207.4_Nonsense_Mutation_p.R242*	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	242																	GCCAGGGATCGGAGAACTGGG	0.632																																					p.R242X		Atlas-SNP	.											.	FAM22F	72	.	0			c.C724T						.	G	stop/ARG	0,2600		0,0,1300	38.0	42.0	41.0		724	0.2	0.4	9		41	1,5173		0,1,2586	no	stop-gained	FAM22F	NM_017561.1		0,1,3886	AA,AG,GG		0.0193,0.0,0.0129		242/757	97084601	1,7773	1300	2587	3887	SO:0001587	stop_gained	54754	exon3			GGGATCGGAGAAC		CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.724C>T	chr9.hg19:g.97084601G>A	ENSP00000253262:p.Arg242*	243.0	0.0		392.0	77.0	NM_017561	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Nonsense_Mutation	SNP	ENST00000253262.4	hg19	CCDS47994.1	.	.	.	.	.	.	.	.	.	.	.	16.25	3.070437	0.55539	0.0	1.93E-4	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207	.	.	.	1.2	0.228	0.15364	.	0.141745	0.32736	N	0.005705	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.5239	0.11973	0.0:0.0:0.6224:0.3776	.	.	.	.	X	242	.	ENSP00000253262:R242X	R	-	1	2	FAM22F	96124422	0.081000	0.21417	0.428000	0.26697	0.206000	0.24218	1.143000	0.31553	0.087000	0.17167	-0.496000	0.04628	CGA	.	.		0.632	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053173.2	NM_017561	
PRKCQ	5588	hgsc.bcm.edu	37	10	6504265	6504265	+	Splice_Site	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr10:6504265C>A	ENST00000263125.5	-	14	1607	c.1508G>T	c.(1507-1509)aGg>aTg	p.R503M	PRKCQ_ENST00000397176.2_Splice_Site_p.R503M|PRKCQ_ENST00000539722.1_Splice_Site_p.R378M	NM_001282644.1|NM_006257.3	NP_001269573.1|NP_006248.1	Q04759	KPCT_HUMAN	protein kinase C, theta	503	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of T cell apoptotic process (GO:0070233)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of T-helper 2 cell activation (GO:2000570)|protein ubiquitination (GO:0016567)|regulation of cell growth (GO:0001558)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of transcription, DNA-templated (GO:0006355)|rhodopsin mediated signaling pathway (GO:0016056)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(13)|ovary(4)|prostate(1)|skin(4)|stomach(2)	45					Tamoxifen(DB00675)	CAAAATTTACCTGTAGACTAT	0.413																																					p.R503M	Ovarian(50;572 1126 10530 25349 30594)	Atlas-SNP	.											.	PRKCQ	113	.	0			c.G1508T						.						115.0	118.0	117.0					10																	6504265		2203	4300	6503	SO:0001630	splice_region_variant	5588	exon14			ATTTACCTGTAGA	L07032	CCDS7079.1, CCDS55701.1, CCDS60482.1	10p15	2009-07-10			ENSG00000065675	ENSG00000065675	2.7.11.1		9410	protein-coding gene	gene with protein product		600448				8444877	Standard	NM_001282645		Approved		uc001ijj.2	Q04759	OTTHUMG00000017623	ENST00000263125.5:c.1508+1G>T	chr10.hg19:g.6504265C>A		66.0	0.0		74.0	17.0	NM_006257	B4DF52|Q14DH6|Q3MJF1|Q64FY5|Q9H508|Q9H549	Missense_Mutation	SNP	ENST00000263125.5	hg19	CCDS7079.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.36|17.36	3.368760|3.368760	0.61624|0.61624	.|.	.|.	ENSG00000065675|ENSG00000065675	ENST00000397178|ENST00000263125;ENST00000397176;ENST00000539722	.|T;T;T	.|0.74632	.|-0.86;-0.86;-0.86	5.45|5.45	5.45|5.45	0.79879|0.79879	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93223|0.93223	0.7841|0.7841	H|H	0.99626|0.99626	4.665|4.665	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;0.997;0.999	D|D	0.96302|0.96302	0.9222|0.9222	5|9	.|.	.|.	.|.	.|.	19.2789|19.2789	0.94044|0.94044	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|378;275;503;503	.|B4DF52;Q5JUN8;Q04759-2;Q04759	.|.;.;.;KPCT_HUMAN	W|M	276|503;503;378	.|ENSP00000263125:R503M;ENSP00000380361:R503M;ENSP00000441752:R378M	.|.	G|R	-|-	1|2	0|0	PRKCQ|PRKCQ	6544271|6544271	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.013000|0.013000	0.08279|0.08279	7.513000|7.513000	0.81739|0.81739	2.542000|2.542000	0.85734|0.85734	0.563000|0.563000	0.77884|0.77884	GGG|AGG	.	.		0.413	PRKCQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046665.1	NM_006257	Missense_Mutation
BEND7	222389	hgsc.bcm.edu	37	10	13523008	13523008	+	Silent	SNP	C	C	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr10:13523008C>T	ENST00000396900.2	-	6	953	c.954G>A	c.(952-954)gcG>gcA	p.A318A	BEND7_ENST00000341083.3_Silent_p.A266A|BEND7_ENST00000378605.3_Silent_p.A279A|BEND7_ENST00000396898.2_Silent_p.A331A			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	318	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.					extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						CATCAAAAAACGCACACACCA	0.433																																					p.A279A		Atlas-SNP	.											.	BEND7	85	.	0			c.G837A						.						162.0	156.0	158.0					10																	13523008		2203	4300	6503	SO:0001819	synonymous_variant	222389	exon5			AAAAAACGCACAC	BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.954G>A	chr10.hg19:g.13523008C>T		86.0	0.0		115.0	5.0	NM_001100912	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Silent	SNP	ENST00000396900.2	hg19																																																																																				.	.		0.433	BEND7-202	KNOWN	basic	protein_coding	protein_coding		NM_152751	
BMS1	9790	hgsc.bcm.edu	37	10	43292088	43292088	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr10:43292088G>A	ENST00000374518.5	+	10	1459	c.1396G>A	c.(1396-1398)Gaa>Aaa	p.E466K		NM_014753.3	NP_055568.3	Q14692	BMS1_HUMAN	BMS1 ribosome biogenesis factor	466					ribosome assembly (GO:0042255)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(23)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TGAGGAAGCAGAAGAGGAGGA	0.428																																					p.E466K		Atlas-SNP	.											.	BMS1	132	.	0			c.G1396A						.						226.0	206.0	213.0					10																	43292088		2203	4300	6503	SO:0001583	missense	9790	exon10			GAAGCAGAAGAGG	BC043345	CCDS7199.1	10q11.21	2013-05-01	2013-05-01	2007-03-20	ENSG00000165733	ENSG00000165733			23505	protein-coding gene	gene with protein product		611448	"""BMS1-like, ribosome assembly protein (yeast)"", ""BMS1 homolog, ribosome assembly protein (yeast)"""	BMS1L		11779832	Standard	NM_014753		Approved	KIAA0187	uc001jaj.3	Q14692	OTTHUMG00000018020	ENST00000374518.5:c.1396G>A	chr10.hg19:g.43292088G>A	ENSP00000363642:p.Glu466Lys	135.0	0.0		191.0	37.0	NM_014753	Q5QPT5|Q86XJ9	Missense_Mutation	SNP	ENST00000374518.5	hg19	CCDS7199.1	.	.	.	.	.	.	.	.	.	.	g	12.24	1.879737	0.33162	.	.	ENSG00000165733	ENST00000374518	T	0.24723	1.84	4.77	2.87	0.33458	.	0.615955	0.15639	N	0.251992	T	0.23611	0.0571	L	0.51422	1.61	0.33279	D	0.562071	B	0.20671	0.047	B	0.15870	0.014	T	0.23048	-1.0199	10	0.36615	T	0.2	.	11.7482	0.51832	0.1536:0.0:0.8464:0.0	.	466	Q14692	BMS1_HUMAN	K	466	ENSP00000363642:E466K	ENSP00000363642:E466K	E	+	1	0	BMS1	42612094	0.963000	0.33076	0.791000	0.31998	0.263000	0.26337	4.236000	0.58675	1.135000	0.42183	0.580000	0.79431	GAA	.	.		0.428	BMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047690.2	NM_014753	
TNKS2	80351	hgsc.bcm.edu	37	10	93558604	93558604	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr10:93558604G>T	ENST00000371627.4	+	1	536	c.157G>T	c.(157-159)Gac>Tac	p.D53Y	TNKS2-AS1_ENST00000432246.1_RNA|TNKS2-AS1_ENST00000432938.1_RNA	NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	53					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GAACAGCCGCGACACGGCGGG	0.716																																					p.D53Y		Atlas-SNP	.											.	TNKS2	103	.	0			c.G157T						.						10.0	12.0	12.0					10																	93558604		2143	4233	6376	SO:0001583	missense	80351	exon1			AGCCGCGACACGG	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.157G>T	chr10.hg19:g.93558604G>T	ENSP00000360689:p.Asp53Tyr	74.0	0.0		93.0	27.0	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	ENST00000371627.4	hg19	CCDS7417.1	.	.	.	.	.	.	.	.	.	.	G	35	5.595741	0.96602	.	.	ENSG00000107854	ENST00000371627	T	0.68903	-0.36	4.85	4.85	0.62838	Ankyrin repeat-containing domain (4);	0.000000	0.56097	D	0.000029	D	0.84800	0.5552	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87967	0.2734	10	0.87932	D	0	.	17.7371	0.88396	0.0:0.0:1.0:0.0	.	53	Q9H2K2	TNKS2_HUMAN	Y	53	ENSP00000360689:D53Y	ENSP00000360689:D53Y	D	+	1	0	TNKS2	93548584	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.046000	0.93817	2.513000	0.84729	0.561000	0.74099	GAC	.	.		0.716	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
PKP3	11187	hgsc.bcm.edu	37	11	404567	404567	+	Nonstop_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr11:404567T>A	ENST00000331563.2	+	13	2468	c.2392T>A	c.(2392-2394)Tag>Aag	p.*798K	SIGIRR_ENST00000529486.1_5'Flank	NM_007183.2	NP_009114.1	Q9Y446	PKP3_HUMAN	plakophilin 3	0					desmosome assembly (GO:0002159)|establishment of protein localization to plasma membrane (GO:0090002)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|desmosome (GO:0030057)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)			breast(1)|central_nervous_system(1)|endometrium(3)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTGGGCCCATAGGTGAAGCC	0.617																																					p.X798K		Atlas-SNP	.											.	PKP3	36	.	0			c.T2392A						.						89.0	77.0	81.0					11																	404567		2193	4287	6480	SO:0001578	stop_lost	11187	exon13			GGCCCATAGGTGA	Z98265	CCDS7695.1	11p15	2013-02-14			ENSG00000184363	ENSG00000184363		"""Armadillo repeat containing"""	9025	protein-coding gene	gene with protein product		605561				10374265	Standard	XM_005252760		Approved		uc001lpc.3	Q9Y446	OTTHUMG00000119068	ENST00000331563.2:c.2392T>A	chr11.hg19:g.404567T>A	ENSP00000331678:p.*798Lysext*?	73.0	0.0		138.0	28.0	NM_007183	F8J390|Q53EX8	Missense_Mutation	SNP	ENST00000331563.2	hg19	CCDS7695.1	.	.	.	.	.	.	.	.	.	.	t	17.38	3.376069	0.61735	.	.	ENSG00000184363	ENST00000331563	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.918	0.63914	0.0:0.0:0.0:1.0	.	.	.	.	K	798	.	.	X	+	1	0	PKP3	394567	0.404000	0.25328	0.114000	0.21550	0.596000	0.36781	2.645000	0.46621	1.761000	0.52028	0.402000	0.26972	TAG	.	.		0.617	PKP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239281.1	NM_007183	
UBQLNL	143630	hgsc.bcm.edu	37	11	5537290	5537290	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr11:5537290T>A	ENST00000380184.1	-	1	645	c.382A>T	c.(382-384)Acc>Tcc	p.T128S	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	128										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		TTTCCTTTGGTGTTTCTGTCC	0.537																																					p.T128S		Atlas-SNP	.											.	UBQLNL	74	.	0			c.A382T						.						214.0	209.0	211.0					11																	5537290		2201	4297	6498	SO:0001583	missense	143630	exon1			CTTTGGTGTTTCT	AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.382A>T	chr11.hg19:g.5537290T>A	ENSP00000369531:p.Thr128Ser	63.0	0.0		84.0	27.0	NM_145053	Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	ENST00000380184.1	hg19	CCDS31385.1	.	.	.	.	.	.	.	.	.	.	T	3.622	-0.077334	0.07184	.	.	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.51325	0.71	4.87	2.44	0.29823	.	1.212050	0.06116	N	0.668049	T	0.35307	0.0927	L	0.44542	1.39	0.09310	N	1	P	0.41673	0.759	B	0.35413	0.202	T	0.22417	-1.0217	10	0.27785	T	0.31	0.0681	4.8692	0.13624	0.0:0.1013:0.1989:0.6998	.	128	Q8IYU4	UBQLN_HUMAN	S	128	ENSP00000369531:T128S	ENSP00000369531:T128S	T	-	1	0	UBQLNL	5493866	0.006000	0.16342	0.472000	0.27241	0.382000	0.30200	0.385000	0.20685	0.848000	0.35191	0.533000	0.62120	ACC	.	.		0.537	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143386.1	NM_145053	
TRIM66	9866	hgsc.bcm.edu	37	11	8671412	8671412	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr11:8671412T>A	ENST00000299550.6	-	3	226	c.32A>T	c.(31-33)aAg>aTg	p.K11M	TRIM66_ENST00000402157.2_Missense_Mutation_p.K11M|TRIM66_ENST00000531498.1_5'UTR	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	11						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						TGCTGCCCTCTTCTCCTTGCA	0.522																																					p.K11M		Atlas-SNP	.											.	TRIM66	45	.	0			c.A32T						.						56.0	55.0	55.0					11																	8671412		692	1591	2283	SO:0001583	missense	9866	exon3			GCCCTCTTCTCCT	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.32A>T	chr11.hg19:g.8671412T>A	ENSP00000299550:p.Lys11Met	44.0	0.0		59.0	13.0	NM_014818	Q9BQQ4	Missense_Mutation	SNP	ENST00000299550.6	hg19		.	.	.	.	.	.	.	.	.	.	T	23.8	4.456568	0.84317	.	.	ENSG00000166436	ENST00000299550;ENST00000402157	T;T	0.67865	-0.29;-0.29	5.69	5.69	0.88448	Zinc finger, PHD-type (1);Zinc finger, B-box (1);	0.000000	0.64402	D	0.000008	T	0.74718	0.3753	L	0.32530	0.975	0.37270	D	0.907367	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80407	-0.1395	10	0.87932	D	0	-28.5454	15.9527	0.79855	0.0:0.0:0.0:1.0	.	11;11	O15016;B5MCJ9	TRI66_HUMAN;.	M	11	ENSP00000299550:K11M;ENSP00000384876:K11M	ENSP00000299550:K11M	K	-	2	0	TRIM66	8627988	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.743000	0.68655	2.173000	0.68751	0.533000	0.62120	AAG	.	.		0.522	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_084529	
USH1C	10083	hgsc.bcm.edu	37	11	17527406	17527406	+	Intron	SNP	A	A	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr11:17527406A>G	ENST00000318024.4	-	16	1393				USH1C_ENST00000005226.7_Missense_Mutation_p.Y702H|USH1C_ENST00000527720.1_Intron|USH1C_ENST00000527020.1_Intron|USH1C_ENST00000529563.1_Intron	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)						auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						GCTGGCCTGTAGATGAAATTG	0.572																																					p.Y702H		Atlas-SNP	.											.	USH1C	157	.	0			c.T2104C						.						70.0	67.0	68.0					11																	17527406		2200	4293	6493	SO:0001627	intron_variant	10083	exon19			GCCTGTAGATGAA	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1285-3879T>C	chr11.hg19:g.17527406A>G		99.0	0.0		121.0	28.0	NM_153676	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	ENST00000318024.4	hg19	CCDS31438.1	.	.	.	.	.	.	.	.	.	.	A	11.74	1.728801	0.30593	.	.	ENSG00000006611	ENST00000005226	T	0.23147	1.92	5.22	2.88	0.33553	.	0.726301	0.12886	N	0.431048	T	0.10508	0.0257	.	.	.	0.24802	N	0.992694	B	0.02656	0.0	B	0.01281	0.0	T	0.28364	-1.0046	9	0.15066	T	0.55	.	1.752	0.02974	0.5025:0.2556:0.098:0.1439	.	702	Q7RTU8	.	H	702	ENSP00000005226:Y702H	ENSP00000005226:Y702H	Y	-	1	0	USH1C	17483982	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.943000	0.40253	1.961000	0.56991	0.459000	0.35465	TAC	.	.		0.572	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
NR1H3	10062	hgsc.bcm.edu	37	11	47281483	47281483	+	Missense_Mutation	SNP	A	A	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr11:47281483A>T	ENST00000467728.1	+	2	1423	c.185A>T	c.(184-186)gAg>gTg	p.E62V	NR1H3_ENST00000527949.1_5'Flank|NR1H3_ENST00000481889.2_Missense_Mutation_p.E17V|NR1H3_ENST00000441012.2_Missense_Mutation_p.E62V|NR1H3_ENST00000395397.3_Missense_Mutation_p.E17V|NR1H3_ENST00000405576.1_Missense_Mutation_p.E17V|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000407404.1_Missense_Mutation_p.E62V|NR1H3_ENST00000405853.3_Missense_Mutation_p.E62V			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	62					apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						GAGGCTGCAGAGCCCACAGCC	0.652											OREG0020956	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E68V		Atlas-SNP	.											.	NR1H3	52	.	0			c.A203T						.						13.0	14.0	14.0					11																	47281483		2197	4292	6489	SO:0001583	missense	10062	exon3			CTGCAGAGCCCAC	U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.185A>T	chr11.hg19:g.47281483A>T	ENSP00000420656:p.Glu62Val	180.0	0.0	945	238.0	55.0	NM_001251934	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	ENST00000467728.1	hg19	CCDS7929.1	.	.	.	.	.	.	.	.	.	.	A	10.94	1.493085	0.26774	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000436778;ENST00000531660;ENST00000407404;ENST00000444396;ENST00000457932;ENST00000412937;ENST00000449369;ENST00000441012;ENST00000437276;ENST00000436029;ENST00000467728;ENST00000405853	D;D;D;T;T;T;T;T;D;T;T;T;T;T;T	0.93133	-2.89;-3.17;-3.04;0.84;0.52;0.84;0.84;0.84;-2.63;0.84;0.84;0.84;0.84;0.84;0.84	5.56	2.91	0.33838	.	1.108690	0.06616	N	0.756596	D	0.88381	0.6421	L	0.29908	0.895	0.31069	N	0.713248	B;B;B;B	0.20671	0.0;0.0;0.047;0.0	B;B;B;B	0.13407	0.001;0.001;0.009;0.002	T	0.81616	-0.0852	10	0.48119	T	0.1	.	7.0506	0.25071	0.7929:0.0:0.2071:0.0	.	68;62;17;62	B4DXU5;Q13133;E9PLL4;Q13133-2	.;NR1H3_HUMAN;.;.	V	17;17;17;62;17;62;62;62;17;62;62;62;62;62;62	ENSP00000378793:E17V;ENSP00000385073:E17V;ENSP00000433271:E17V;ENSP00000403798:E62V;ENSP00000434650:E17V;ENSP00000385801:E62V;ENSP00000391005:E62V;ENSP00000413095:E62V;ENSP00000412636:E17V;ENSP00000415591:E62V;ENSP00000387946:E62V;ENSP00000396132:E62V;ENSP00000403696:E62V;ENSP00000420656:E62V;ENSP00000384745:E62V	ENSP00000378793:E17V	E	+	2	0	NR1H3	47238059	0.701000	0.27806	0.924000	0.36721	0.469000	0.32828	1.484000	0.35508	0.950000	0.37743	0.379000	0.24179	GAG	.	.		0.652	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319214.3		
KBTBD4	55709	hgsc.bcm.edu	37	11	47594682	47594682	+	Silent	SNP	G	G	T	rs573433525		TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr11:47594682G>T	ENST00000526005.1	-	4	1510	c.1357C>A	c.(1357-1359)Cgg>Agg	p.R453R	KBTBD4_ENST00000430070.2_Silent_p.R469R|PTPMT1_ENST00000527079.2_3'UTR|KBTBD4_ENST00000533290.1_Silent_p.R478R|NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000395288.2_Silent_p.R453R			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	453										NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						AGGCAAAGCCGGGTGAAGCTG	0.562																																					p.R469R		Atlas-SNP	.											.	KBTBD4	55	.	0			c.C1405A						.						58.0	56.0	57.0					11																	47594682		2201	4298	6499	SO:0001819	synonymous_variant	55709	exon4			AAAGCCGGGTGAA	AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.1357C>A	chr11.hg19:g.47594682G>T		87.0	0.0		137.0	6.0	NM_018095	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Silent	SNP	ENST00000526005.1	hg19	CCDS7940.1																																																																																			.	.		0.562	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000391763.1	NM_016506	
ACAD8	27034	hgsc.bcm.edu	37	11	134131244	134131244	+	Missense_Mutation	SNP	G	G	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr11:134131244G>C	ENST00000281182.4	+	8	1023	c.917G>C	c.(916-918)gGa>gCa	p.G306A	ACAD8_ENST00000543332.1_Missense_Mutation_p.G208A|ACAD8_ENST00000374752.4_Missense_Mutation_p.G179A|ACAD8_ENST00000537423.1_Missense_Mutation_p.G229A|ACAD8_ENST00000524547.1_3'UTR	NM_014384.2	NP_055199.1	Q9UKU7	ACAD8_HUMAN	acyl-CoA dehydrogenase family, member 8	306					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|lipid metabolic process (GO:0006629)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|urinary_tract(1)	14	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Flavin adenine dinucleotide(DB03147)	AAGCAGTTTGGAGAGCCTCTG	0.607																																					p.G306A	GBM(65;238 1125 33403 41853 48889)	Atlas-SNP	.											.	ACAD8	33	.	0			c.G917C						.						88.0	88.0	88.0					11																	134131244		2201	4297	6498	SO:0001583	missense	27034	exon8			AGTTTGGAGAGCC	AF126245	CCDS8498.1	11q25	2014-09-17	2010-04-30		ENSG00000151498	ENSG00000151498			87	protein-coding gene	gene with protein product		604773	"""acyl-Coenzyme A dehydrogenase family, member 8"""			10524212	Standard	NM_014384		Approved		uc001qhk.3	Q9UKU7	OTTHUMG00000167177	ENST00000281182.4:c.917G>C	chr11.hg19:g.134131244G>C	ENSP00000281182:p.Gly306Ala	98.0	0.0		114.0	27.0	NM_014384	B7Z5W4|Q6ZWP6|Q9BUS8	Missense_Mutation	SNP	ENST00000281182.4	hg19	CCDS8498.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.4|28.4	4.915777|4.915777	0.92178|0.92178	.|.	.|.	ENSG00000151498|ENSG00000151498	ENST00000281182;ENST00000537423;ENST00000543332;ENST00000374752|ENST00000537915	D;D;D;D|.	0.98090|.	-4.71;-4.71;-4.44;-4.71|.	5.35|5.35	5.35|5.35	0.76521|0.76521	Acyl-CoA dehydrogenase/oxidase C-terminal (2);Acyl-CoA oxidase/dehydrogenase, type 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.91147|0.91147	0.7212|0.7212	H|H	0.99011|0.99011	4.4|4.4	0.80722|0.80722	D|D	1|1	B;P;B|.	0.42456|.	0.346;0.78;0.346|.	P;P;B|.	0.49953|.	0.489;0.627;0.356|.	D|D	0.94129|0.94129	0.7386|0.7386	10|6	0.87932|0.54805	D|T	0|0.06	.|.	19.0341|19.0341	0.92970|0.92970	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	229;179;306|.	B7Z5W4;Q6ZWP6;Q9UKU7|.	.;.;ACAD8_HUMAN|.	A|C	306;229;208;179|267	ENSP00000281182:G306A;ENSP00000443763:G229A;ENSP00000438302:G208A;ENSP00000363884:G179A|.	ENSP00000281182:G306A|ENSP00000445511:W267C	G|W	+|+	2|3	0|0	ACAD8|ACAD8	133636454|133636454	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.982000|0.982000	0.71751|0.71751	9.247000|9.247000	0.95444|0.95444	2.513000|2.513000	0.84729|0.84729	0.561000|0.561000	0.74099|0.74099	GGA|TGG	.	.		0.607	ACAD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393607.1	NM_014384	
WNK1	65125	hgsc.bcm.edu	37	12	922935	922935	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:922935G>A	ENST00000315939.6	+	2	1530	c.887G>A	c.(886-888)tGc>tAc	p.C296Y	WNK1_ENST00000530271.2_Missense_Mutation_p.C296Y|WNK1_ENST00000535572.1_Missense_Mutation_p.C296Y|WNK1_ENST00000447667.2_Missense_Mutation_p.C296Y|WNK1_ENST00000537687.1_Missense_Mutation_p.C296Y	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	296	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			GGAAAGAAGTGCATTGTTTTG	0.343																																					p.C296Y	Colon(19;451 567 6672 12618 28860)	Atlas-SNP	.											.	WNK1	403	.	0			c.G887A						.						112.0	106.0	108.0					12																	922935		2203	4300	6503	SO:0001583	missense	65125	exon2			AGAAGTGCATTGT	AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.887G>A	chr12.hg19:g.922935G>A	ENSP00000313059:p.Cys296Tyr	87.0	0.0		110.0	18.0	NM_001184985	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	ENST00000315939.6	hg19	CCDS8506.1	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457240	0.84317	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000447667;ENST00000530271	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	5.83	5.83	0.93111	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.62612	0.2442	N	0.16602	0.42	0.80722	D	1	P;P;B	0.51147	0.866;0.942;0.118	P;P;B	0.54460	0.638;0.753;0.179	T	0.63171	-0.6697	10	0.42905	T	0.14	-8.5053	20.1212	0.97961	0.0:0.0:1.0:0.0	.	296;296;296	F5GWT4;Q9H4A3;F6UYG0	.;WNK1_HUMAN;.	Y	296	ENSP00000441972:C296Y;ENSP00000313059:C296Y;ENSP00000444465:C296Y;ENSP00000392542:C296Y;ENSP00000433548:C296Y	ENSP00000313059:C296Y	C	+	2	0	WNK1	793196	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.942000	0.87708	2.751000	0.94390	0.561000	0.74099	TGC	.	.		0.343	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206683.1	NM_018979	
ART4	420	hgsc.bcm.edu	37	12	14995920	14995920	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:14995920G>A	ENST00000228936.4	-	1	509	c.128C>T	c.(127-129)cCc>cTc	p.P43L	C12orf60_ENST00000527783.1_Intron|RP11-233G1.4_ENST00000444324.2_RNA	NM_021071.2	NP_066549.2	Q93070	NAR4_HUMAN	ADP-ribosyltransferase 4 (Dombrock blood group)	43					arginine metabolic process (GO:0006525)|protein ADP-ribosylation (GO:0006471)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)			large_intestine(5)|liver(1)|lung(3)|prostate(1)|skin(2)|stomach(3)	15						ACCCTCTGTGGGTCTCTGCAG	0.542																																					p.P43L		Atlas-SNP	.											.	ART4	27	.	0			c.C128T						.						56.0	55.0	55.0					12																	14995920		2203	4300	6503	SO:0001583	missense	420	exon1			TCTGTGGGTCTCT	X95826	CCDS8668.1	12q13.2-q13.3	2014-07-18	2014-01-02	2006-01-12	ENSG00000111339	ENSG00000111339		"""CD molecules"", ""Blood group antigens"""	726	protein-coding gene	gene with protein product		110600	"""Dombrock blood group"", ""ADP-ribosyltransferase 4 (DO blood group)"", ""ADP-ribosyltransferase 4"""	DO		9119374	Standard	NM_021071		Approved	DOK1, CD297	uc001rcl.1	Q93070	OTTHUMG00000168738	ENST00000228936.4:c.128C>T	chr12.hg19:g.14995920G>A	ENSP00000228936:p.Pro43Leu	82.0	0.0		95.0	4.0	NM_021071	Q9BZ50|Q9BZ51|Q9HB06	Missense_Mutation	SNP	ENST00000228936.4	hg19	CCDS8668.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770843	0.49680	.	.	ENSG00000111339	ENST00000228936;ENST00000430826;ENST00000544616;ENST00000430129;ENST00000420600	T;T	0.08282	3.27;3.11	4.51	1.56	0.23342	.	0.812904	0.11194	N	0.589536	T	0.10165	0.0249	L	0.34521	1.04	0.09310	N	0.999998	D;D	0.53619	0.961;0.961	P;P	0.49637	0.617;0.617	T	0.25882	-1.0119	10	0.87932	D	0	-12.987	7.1465	0.25585	0.0:0.1701:0.4784:0.3514	.	43;43	A8K6J7;Q93070	.;NAR4_HUMAN	L	43;43;26;26;26	ENSP00000228936:P43L;ENSP00000405689:P26L	ENSP00000228936:P43L	P	-	2	0	ART4	14887187	0.881000	0.30235	0.081000	0.20488	0.090000	0.18270	1.569000	0.36428	0.351000	0.24027	-0.188000	0.12872	CCC	.	.		0.542	ART4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400859.1	NM_021071	
LIMA1	51474	hgsc.bcm.edu	37	12	50575756	50575756	+	Missense_Mutation	SNP	C	C	A	rs200141288		TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:50575756C>A	ENST00000341247.4	-	10	1354	c.1205G>T	c.(1204-1206)cGt>cTt	p.R402L	LIMA1_ENST00000552491.1_Missense_Mutation_p.R99L|LIMA1_ENST00000552909.1_Missense_Mutation_p.R241L|LIMA1_ENST00000552783.1_Missense_Mutation_p.R243L|LIMA1_ENST00000552823.1_Missense_Mutation_p.R242L|LIMA1_ENST00000394943.3_Missense_Mutation_p.R403L|LIMA1_ENST00000547825.1_Missense_Mutation_p.R100L	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	402	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						GGCCAAGAGACGCTCCATTGG	0.473																																					p.R403L		Atlas-SNP	.											.	LIMA1	67	.	0			c.G1208T						.						109.0	99.0	102.0					12																	50575756		2203	4300	6503	SO:0001583	missense	51474	exon10			AAGAGACGCTCCA	AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.1205G>T	chr12.hg19:g.50575756C>A	ENSP00000340184:p.Arg402Leu	78.0	0.0		112.0	24.0	NM_001113546	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	ENST00000341247.4	hg19	CCDS8802.1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.813060	0.90707	.	.	ENSG00000050405	ENST00000552491;ENST00000547825;ENST00000552823;ENST00000394943;ENST00000341247;ENST00000552783;ENST00000552909;ENST00000420992	D;D;D;D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09;-2.09;-2.09;-2.09	5.49	5.49	0.81192	Zinc finger, LIM-type (5);	0.099034	0.64402	D	0.000002	D	0.91270	0.7248	L	0.39566	1.225	0.50171	D	0.999852	P;D;P	0.89917	0.945;1.0;0.937	P;D;P	0.91635	0.878;0.999;0.884	D	0.91466	0.5193	10	0.62326	D	0.03	.	19.7347	0.96198	0.0:1.0:0.0:0.0	.	412;402;241	Q59FE8;Q9UHB6;F8VQE1	.;LIMA1_HUMAN;.	L	99;100;242;403;402;243;241;321	ENSP00000448463:R99L;ENSP00000448706:R100L;ENSP00000450266:R242L;ENSP00000378400:R403L;ENSP00000340184:R402L;ENSP00000448779:R243L;ENSP00000450087:R241L	ENSP00000340184:R402L	R	-	2	0	LIMA1	48862023	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	3.716000	0.54904	2.746000	0.94184	0.655000	0.94253	CGT	.	.		0.473	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000406235.2	NM_016357	
TMEM5	10329	hgsc.bcm.edu	37	12	64202488	64202488	+	Silent	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:64202488G>A	ENST00000261234.6	+	6	1106	c.948G>A	c.(946-948)aaG>aaA	p.K316K	TMEM5-AS1_ENST00000546214.1_RNA|TMEM5_ENST00000537373.1_Silent_p.K56K	NM_014254.1	NP_055069.1	Q9Y2B1	TMEM5_HUMAN	transmembrane protein 5	316						integral component of plasma membrane (GO:0005887)				breast(1)|large_intestine(3)|liver(2)|lung(7)|prostate(1)|skin(1)	15		Myeloproliferative disorder(1001;0.0255)	BRCA - Breast invasive adenocarcinoma(9;0.0985)	GBM - Glioblastoma multiforme(28;9e-08)|BRCA - Breast invasive adenocarcinoma(357;0.000175)		AAAGTCTTAAGAATTACCAAG	0.398																																					p.K316K		Atlas-SNP	.											.	TMEM5	35	.	0			c.G948A						.						100.0	95.0	96.0					12																	64202488		2203	4300	6503	SO:0001819	synonymous_variant	10329	exon6			TCTTAAGAATTAC	AB015633	CCDS8966.1, CCDS61179.1	12q14.1	2013-05-07			ENSG00000118600	ENSG00000118600			13530	protein-coding gene	gene with protein product		605862				10072769, 23217329	Standard	NM_014254		Approved	HP10481	uc001srq.2	Q9Y2B1	OTTHUMG00000168730	ENST00000261234.6:c.948G>A	chr12.hg19:g.64202488G>A		66.0	0.0		101.0	29.0	NM_014254	A8K017|Q6PKD6	Silent	SNP	ENST00000261234.6	hg19	CCDS8966.1																																																																																			.	.		0.398	TMEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400821.1	NM_014254	
TCTN1	79600	hgsc.bcm.edu	37	12	111066708	111066708	+	Silent	SNP	T	T	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:111066708T>C	ENST00000551590.1	+	4	765	c.609T>C	c.(607-609)acT>acC	p.T203T	TCTN1_ENST00000377654.3_Silent_p.T25T|TCTN1_ENST00000551555.2_3'UTR|TCTN1_ENST00000397659.4_Silent_p.T203T|TCTN1_ENST00000550703.2_Silent_p.T203T|HVCN1_ENST00000548312.1_Intron|RN7SL387P_ENST00000581015.1_RNA|TCTN1_ENST00000397655.3_Silent_p.T203T			Q2MV58	TECT1_HUMAN	tectonic family member 1	203					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						ATATTCCTACTGCTGCTAAAT	0.338																																					p.T203T		Atlas-SNP	.											.	TCTN1	37	.	0			c.T609C						.						137.0	141.0	140.0					12																	111066708		1870	4106	5976	SO:0001819	synonymous_variant	79600	exon4			TCCTACTGCTGCT	AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.609T>C	chr12.hg19:g.111066708T>C		63.0	0.0		47.0	15.0	NM_024549	A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Silent	SNP	ENST00000551590.1	hg19	CCDS41835.1																																																																																			.	.		0.338	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000316016.2	NM_024549	
RPH3A	22895	hgsc.bcm.edu	37	12	113306371	113306371	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:113306371C>A	ENST00000389385.4	+	8	1078	c.581C>A	c.(580-582)cCc>cAc	p.P194H	RPH3A_ENST00000543106.2_Missense_Mutation_p.P194H|RPH3A_ENST00000551052.1_Missense_Mutation_p.P190H|RPH3A_ENST00000415485.3_Missense_Mutation_p.P194H|RPH3A_ENST00000548866.1_Missense_Mutation_p.P145H|RPH3A_ENST00000420983.2_Missense_Mutation_p.P194H|RPH3A_ENST00000447659.2_Missense_Mutation_p.P145H|RPH3A_ENST00000549913.2_3'UTR	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	194	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GCTCCTGAGCCCAAGCACCCT	0.582																																					p.P194H		Atlas-SNP	.											.	RPH3A	98	.	0			c.C581A						.						42.0	42.0	42.0					12																	113306371		2203	4300	6503	SO:0001583	missense	22895	exon8			CTGAGCCCAAGCA	AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.581C>A	chr12.hg19:g.113306371C>A	ENSP00000374036:p.Pro194His	50.0	0.0		66.0	20.0	NM_001143854	B7Z3C3|Q96AE0	Missense_Mutation	SNP	ENST00000389385.4	hg19	CCDS44979.1	.	.	.	.	.	.	.	.	.	.	C	11.60	1.687526	0.29962	.	.	ENSG00000089169	ENST00000543106;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T	0.62941	0.01;0.01;-0.01;0.01;0.01;-0.01;0.01	5.05	4.14	0.48551	.	0.208215	0.33670	N	0.004663	T	0.64929	0.2643	L	0.50333	1.59	0.31229	N	0.696588	B;D;D;D	0.58268	0.007;0.97;0.97;0.982	B;P;P;P	0.52267	0.01;0.498;0.498;0.694	T	0.70651	-0.4813	10	0.72032	D	0.01	.	11.6809	0.51457	0.3219:0.6781:0.0:0.0	.	145;194;194;190	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	H	194;194;145;190;194;145;194	ENSP00000440384:P194H;ENSP00000374036:P194H;ENSP00000413254:P145H;ENSP00000448297:P190H;ENSP00000405357:P194H;ENSP00000450347:P145H;ENSP00000408889:P194H	ENSP00000374036:P194H	P	+	2	0	RPH3A	111790754	1.000000	0.71417	0.942000	0.38095	0.284000	0.27059	1.371000	0.34250	1.113000	0.41760	-0.181000	0.13052	CCC	.	.		0.582	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000405561.1	NM_014954	
MED13L	23389	hgsc.bcm.edu	37	12	116446438	116446438	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:116446438T>A	ENST00000281928.3	-	10	1986	c.1780A>T	c.(1780-1782)Act>Tct	p.T594S		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	594						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TCATCCAGAGTAGACAACTGC	0.537																																					p.T594S		Atlas-SNP	.											.	MED13L	193	.	0			c.A1780T						.						64.0	56.0	58.0					12																	116446438		2203	4300	6503	SO:0001583	missense	23389	exon10			CCAGAGTAGACAA	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.1780A>T	chr12.hg19:g.116446438T>A	ENSP00000281928:p.Thr594Ser	55.0	0.0		77.0	23.0	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	hg19	CCDS9177.1	.	.	.	.	.	.	.	.	.	.	T	4.350	0.064337	0.08388	.	.	ENSG00000123066	ENST00000281928	T	0.71817	-0.6	5.91	-0.653	0.11447	.	0.691028	0.15575	N	0.255243	T	0.38558	0.1045	N	0.03608	-0.345	0.20307	N	0.999913	B	0.02656	0.0	B	0.01281	0.0	T	0.19877	-1.0292	10	0.20046	T	0.44	.	5.0638	0.14572	0.1223:0.2721:0.0:0.6056	.	594	Q71F56	MD13L_HUMAN	S	594	ENSP00000281928:T594S	ENSP00000281928:T594S	T	-	1	0	MED13L	114930821	0.934000	0.31675	0.907000	0.35723	0.996000	0.88848	0.683000	0.25349	-0.105000	0.12132	0.533000	0.62120	ACT	.	.		0.537	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
VPS33A	65082	hgsc.bcm.edu	37	12	122734446	122734446	+	Silent	SNP	G	G	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:122734446G>C	ENST00000267199.4	-	6	859	c.747C>G	c.(745-747)ctC>ctG	p.L249L	RP11-512M8.5_ENST00000535844.1_Silent_p.L210L|VPS33A_ENST00000542310.1_5'Flank	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	249					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		TTTCATCAATGAGTCCTTCAT	0.358																																					p.L249L		Atlas-SNP	.											.	VPS33A	61	.	0			c.C747G						.						145.0	140.0	142.0					12																	122734446		2203	4300	6503	SO:0001819	synonymous_variant	65082	exon6			ATCAATGAGTCCT	AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.747C>G	chr12.hg19:g.122734446G>C		98.0	0.0		130.0	22.0	NM_022916	Q547V4|Q9H5Q0	Silent	SNP	ENST00000267199.4	hg19	CCDS9231.1																																																																																			.	.		0.358	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401607.2		
DNAH10	196385	hgsc.bcm.edu	37	12	124360035	124360035	+	Silent	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:124360035C>A	ENST00000409039.3	+	46	7867	c.7842C>A	c.(7840-7842)acC>acA	p.T2614T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2614	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AAGGCCACACCTCGGTAACTT	0.438																																					p.T2614T		Atlas-SNP	.											.	DNAH10	888	.	0			c.C7842A						.						105.0	97.0	99.0					12																	124360035		1862	4096	5958	SO:0001819	synonymous_variant	196385	exon46			CCACACCTCGGTA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.7842C>A	chr12.hg19:g.124360035C>A		78.0	0.0		73.0	15.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	ENST00000409039.3	hg19	CCDS9255.2																																																																																			.	.		0.438	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
SLC25A21	89874	hgsc.bcm.edu	37	14	37641486	37641486	+	Splice_Site	SNP	C	C	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr14:37641486C>T	ENST00000331299.5	-	1	585	c.70G>A	c.(70-72)Ggt>Agt	p.G24S	SLC25A21-AS1_ENST00000556667.1_5'UTR|SLC25A21_ENST00000555449.1_Splice_Site_p.G24S|SLC25A21_ENST00000557611.1_5'UTR	NM_030631.3	NP_085134.1	Q9BQT8	ODC_HUMAN	solute carrier family 25 (mitochondrial oxoadipate carrier), member 21	24					cellular nitrogen compound metabolic process (GO:0034641)|lysine catabolic process (GO:0006554)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|pancreas(1)|prostate(1)|skin(1)	9	Esophageal squamous(585;0.164)|Breast(36;0.179)|Hepatocellular(127;0.213)		Lung(8;2.16e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.0112)|all cancers(34;0.0274)|LUSC - Lung squamous cell carcinoma(13;0.149)	GBM - Glioblastoma multiforme(112;0.00204)		CTGTCCTTACCTGCAGAACCA	0.642																																					p.G24S		Atlas-SNP	.											.	SLC25A21	24	.	0			c.G70A						.						30.0	24.0	26.0					14																	37641486		2199	4292	6491	SO:0001630	splice_region_variant	89874	exon1			CCTTACCTGCAGA	AJ278148	CCDS9663.1, CCDS55913.1	14q13.3	2014-01-28	2012-03-29		ENSG00000183032	ENSG00000183032		"""Solute carriers"""	14411	protein-coding gene	gene with protein product		607571	"""solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21"""			11083877	Standard	NM_030631		Approved	ODC1, ODC	uc001wtz.2	Q9BQT8	OTTHUMG00000140250	ENST00000331299.5:c.70+1G>A	chr14.hg19:g.37641486C>T		181.0	0.0		283.0	58.0	NM_030631	A8K0L0|G3V4L5|Q3MJ99	Missense_Mutation	SNP	ENST00000331299.5	hg19	CCDS9663.1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072178	0.76415	.	.	ENSG00000183032	ENST00000555449;ENST00000331299	D;D	0.85171	-1.95;-1.95	3.4	3.4	0.38934	Mitochondrial carrier domain (2);	0.175102	0.37623	U	0.002012	D	0.90380	0.6989	M	0.79693	2.465	0.58432	D	0.999999	D	0.59357	0.985	D	0.63597	0.916	D	0.90289	0.4321	9	.	.	.	-4.6058	10.4757	0.44663	0.0:1.0:0.0:0.0	.	24	Q9BQT8	ODC_HUMAN	S	24	ENSP00000451873:G24S;ENSP00000329452:G24S	.	G	-	1	0	SLC25A21	36711237	0.993000	0.37304	0.993000	0.49108	0.471000	0.32888	3.035000	0.49759	1.868000	0.54150	0.557000	0.71058	GGT	.	.		0.642	SLC25A21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000276732.2	NM_030631	Missense_Mutation
BCL11B	64919	hgsc.bcm.edu	37	14	99641568	99641568	+	Missense_Mutation	SNP	C	C	G			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr14:99641568C>G	ENST00000357195.3	-	4	1614	c.1605G>C	c.(1603-1605)gaG>gaC	p.E535D	BCL11B_ENST00000443726.2_Missense_Mutation_p.E341D|BCL11B_ENST00000345514.2_Missense_Mutation_p.E464D	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	535	Glu-rich.				alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)	p.E535_E536delEE(1)		NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		cctcctcctcctcgtcctcct	0.697			T	TLX3	T-ALL																																p.E535D		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	BCL11B,colon,carcinoma,0,1	BCL11B	108	.	1	Deletion - In frame(1)	prostate(1)	c.G1605C						.						5.0	5.0	5.0					14																	99641568		2084	4070	6154	SO:0001583	missense	64919	exon4			CTCCTCCTCGTCC	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1605G>C	chr14.hg19:g.99641568C>G	ENSP00000349723:p.Glu535Asp	19.0	0.0		32.0	2.0	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	hg19	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.167616	0.38315	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.13657	2.57;2.6;2.57	3.81	0.863	0.19062	.	0.158674	0.40144	N	0.001176	T	0.07324	0.0185	N	0.22421	0.69	0.40982	D	0.984788	B;B	0.31413	0.322;0.185	B;B	0.31390	0.129;0.048	T	0.38394	-0.9663	10	0.30854	T	0.27	-8.4478	4.8239	0.13407	0.0:0.4986:0.1502:0.3512	.	464;535	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	D	535;464;341	ENSP00000349723:E535D;ENSP00000280435:E464D;ENSP00000387419:E341D	ENSP00000280435:E464D	E	-	3	2	BCL11B	98711321	0.591000	0.26824	0.998000	0.56505	0.990000	0.78478	-0.193000	0.09573	-0.059000	0.13154	0.561000	0.74099	GAG	.	.		0.697	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
GOLGA6L1	283767	hgsc.bcm.edu	37	15	22742718	22742718	+	Missense_Mutation	SNP	T	T	A	rs7171381		TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr15:22742718T>A	ENST00000560659.2	+	8	953	c.953T>A	c.(952-954)cTg>cAg	p.L318Q	GOLGA6L1_ENST00000316397.3_Missense_Mutation_p.L368Q			Q8N7Z2	GG6L1_HUMAN	golgin A6 family-like 1	362								p.L368Q(3)		NS(1)|breast(2)|endometrium(5)|large_intestine(1)|lung(1)|skin(1)	11						ATGCGGAGGCTGGAGGAGATG	0.562																																					p.L368Q		Atlas-SNP	.											GOLGA6L1,NS,carcinoma,0,3	GOLGA6L1	20	.	3	Substitution - Missense(3)	endometrium(2)|NS(1)	c.T1103A						.						2.0	1.0	2.0					15																	22742718		857	1156	2013	SO:0001583	missense	283767	exon8			GGAGGCTGGAGGA	AK097517	CCDS73699.1	15q11.2	2012-10-05	2010-02-12		ENSG00000197414	ENSG00000277865			37444	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 1"""				Standard	NM_001001413		Approved		uc010tzx.1	Q8N7Z2	OTTHUMG00000171883	ENST00000560659.2:c.953T>A	chr15.hg19:g.22742718T>A	ENSP00000452626:p.Leu318Gln	11.0	1.0		22.0	6.0	NM_001001413		Missense_Mutation	SNP	ENST00000560659.2	hg19		.	.	.	.	.	.	.	.	.	.	.	0.066	-1.212693	0.01555	.	.	ENSG00000197414	ENST00000316397;ENST00000355145	T	0.08546	3.08	.	.	.	.	.	.	.	.	T	0.02727	0.0082	N	0.13098	0.295	0.09310	N	1	.	.	.	.	.	.	T	0.44050	-0.9353	5	0.02654	T	1	.	.	.	.	rs7171381	.	.	.	Q	368	ENSP00000320207:L368Q	ENSP00000320207:L368Q	L	+	2	0	GOLGA6L1	20294082	0.004000	0.15560	0.015000	0.15790	0.015000	0.08874	-1.961000	0.01516	-1.878000	0.01128	-2.010000	0.00438	CTG	.	T|0.875;A|0.125		0.562	GOLGA6L1-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000415616.2	NM_001001413	
GNB5	10681	hgsc.bcm.edu	37	15	52416719	52416719	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr15:52416719G>A	ENST00000261837.7	-	12	1192	c.1127C>T	c.(1126-1128)tCc>tTc	p.S376F	CTD-2184D3.7_ENST00000557898.1_RNA|GNB5_ENST00000396335.4_Missense_Mutation_p.S264F|GNB5_ENST00000358784.7_Missense_Mutation_p.S334F|GNB5_ENST00000559348.1_5'UTR|CTD-2184D3.6_ENST00000559825.1_lincRNA	NM_016194.3	NP_057278.2	O14775	GBB5_HUMAN	guanine nucleotide binding protein (G protein), beta 5	376					GTP catabolic process (GO:0006184)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|G-protein gamma-subunit binding (GO:0031682)|GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			large_intestine(1)|lung(1)	2				all cancers(107;0.0163)		CCCATCGGGGGAAACTCGTAG	0.498																																					p.S376F		Atlas-SNP	.											.	GNB5	28	.	0			c.C1127T						.						104.0	104.0	104.0					15																	52416719		2195	4293	6488	SO:0001583	missense	10681	exon12			TCGGGGGAAACTC	AF017656	CCDS10149.1, CCDS45261.1	15q21.1	2013-01-10			ENSG00000069966	ENSG00000069966		"""WD repeat domain containing"""	4401	protein-coding gene	gene with protein product		604447				9606987	Standard	NM_016194		Approved	GB5	uc031qrz.1	O14775	OTTHUMG00000131892	ENST00000261837.7:c.1127C>T	chr15.hg19:g.52416719G>A	ENSP00000261837:p.Ser376Phe	101.0	0.0		132.0	25.0	NM_016194	B2RBR5|Q9HAU9|Q9UFT3	Missense_Mutation	SNP	ENST00000261837.7	hg19	CCDS10149.1	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885268	0.72410	.	.	ENSG00000069966	ENST00000261837;ENST00000396335;ENST00000544480;ENST00000358784	T	0.66460	-0.21	5.98	5.06	0.68205	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.86096	0.5851	M	0.93062	3.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.994;0.996	D	0.89930	0.4065	10	0.87932	D	0	-28.054	16.7076	0.85376	0.0:0.0:0.8694:0.1306	.	376;264	O14775;O14775-3	GBB5_HUMAN;.	F	376;334;174;264	ENSP00000261837:S376F	ENSP00000261837:S376F	S	-	2	0	GNB5	50204011	1.000000	0.71417	0.303000	0.25071	0.387000	0.30353	9.648000	0.98483	1.537000	0.49254	0.644000	0.83932	TCC	.	.		0.498	GNB5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254842.1		
NTRK3	4916	hgsc.bcm.edu	37	15	88678582	88678582	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr15:88678582C>A	ENST00000360948.2	-	9	1115	c.954G>T	c.(952-954)gaG>gaT	p.E318D	NTRK3_ENST00000557856.1_Missense_Mutation_p.E318D|NTRK3_ENST00000558676.1_Missense_Mutation_p.E318D|NTRK3_ENST00000317501.3_Missense_Mutation_p.E318D|NTRK3_ENST00000542733.2_Missense_Mutation_p.E220D|NTRK3_ENST00000355254.2_Missense_Mutation_p.E318D|NTRK3_ENST00000357724.2_Missense_Mutation_p.E318D|NTRK3_ENST00000394480.2_Missense_Mutation_p.E318D|NTRK3_ENST00000540489.2_Missense_Mutation_p.E318D	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	318	Ig-like C2-type 2.				activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			CGATGCAGTGCTCCAGGCGCA	0.602			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																											p.E318D		Atlas-SNP	.		Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	.	NTRK3	587	.	0			c.G954T						.						49.0	50.0	50.0					15																	88678582		2201	4299	6500	SO:0001583	missense	4916	exon10			GCAGTGCTCCAGG	U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.954G>T	chr15.hg19:g.88678582C>A	ENSP00000354207:p.Glu318Asp	43.0	0.0		72.0	17.0	NM_001243101	B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	ENST00000360948.2	hg19	CCDS32322.1	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145219	0.37825	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000542733;ENST00000540489;ENST00000317501	T;T;T;T;T;T;T	0.74209	-0.82;-0.77;-0.76;-0.82;-0.7;0.08;0.08	5.28	2.33	0.28932	.	0.047530	0.85682	D	0.000000	T	0.51805	0.1696	N	0.12746	0.255	0.38505	D	0.948321	B;B;B;B;B;B	0.09022	0.0;0.002;0.0;0.001;0.002;0.0	B;B;B;B;B;B	0.11329	0.002;0.005;0.006;0.005;0.004;0.006	T	0.33292	-0.9874	10	0.32370	T	0.25	.	6.8304	0.23907	0.0:0.6494:0.1259:0.2247	.	220;318;318;318;318;318	B7Z7U4;E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;.;NTRK3_HUMAN	D	318;318;318;318;220;318;318	ENSP00000377990:E318D;ENSP00000354207:E318D;ENSP00000350356:E318D;ENSP00000347397:E318D;ENSP00000437773:E220D;ENSP00000444673:E318D;ENSP00000318328:E318D	ENSP00000318328:E318D	E	-	3	2	NTRK3	86479586	0.999000	0.42202	1.000000	0.80357	0.965000	0.64279	0.418000	0.21230	0.206000	0.20587	0.563000	0.77884	GAG	.	.		0.602	NTRK3-204	KNOWN	basic|CCDS	protein_coding	protein_coding			
HAGHL	84264	hgsc.bcm.edu	37	16	777615	777615	+	Splice_Site	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr16:777615G>T	ENST00000341413.4	+	2	386		c.e2+1		HAGHL_ENST00000564537.1_Splice_Site|HAGHL_ENST00000561546.1_Splice_Site|CCDC78_ENST00000293889.6_5'Flank|HAGHL_ENST00000549114.1_Splice_Site|NARFL_ENST00000562862.1_5'Flank|HAGHL_ENST00000564545.1_Splice_Site|HAGHL_ENST00000389703.3_Splice_Site			Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like								hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			lung(3)	3		Hepatocellular(780;0.00335)				GCCCAAGAGGGTGAGGGCAGG	0.701																																					.	Pancreas(46;538 1326 12403 32360)	Atlas-SNP	.											.	HAGHL	18	.	0			c.105+1G>T						.						39.0	29.0	33.0					16																	777615		2180	4284	6464	SO:0001630	splice_region_variant	84264	exon1			AAGAGGGTGAGGG	AK054841	CCDS32354.1	16p13.3	2008-02-05	2003-11-04						14177	protein-coding gene	gene with protein product			"""hydroxyacyl glutathione hydrolase-like"""			12477932	Standard	XM_005255629		Approved	MGC2605	uc002cjo.1	Q6PII5		ENST00000341413.4:c.105+1G>T	chr16.hg19:g.777615G>T		82.0	0.0		106.0	29.0	NM_032304	A6NCC4|D3DU64|Q59FX8|Q96BZ3|Q96NR5|Q96S11|Q9BT45	Splice_Site	SNP	ENST00000341413.4	hg19		.	.	.	.	.	.	.	.	.	.	G	13.65	2.299137	0.40694	.	.	ENSG00000103253	ENST00000549114;ENST00000341413;ENST00000389701;ENST00000389703	.	.	.	3.43	0.29	0.15728	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.7686	0.13144	0.1973:0.0:0.6325:0.1702	.	.	.	.	.	-1	.	.	.	+	.	.	HAGHL	717616	0.991000	0.36638	0.180000	0.23079	0.749000	0.42624	-0.007000	0.12810	-0.099000	0.12263	-0.258000	0.10820	.	.	.		0.701	HAGHL-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409607.1	NM_032304	Intron
BRD7	29117	hgsc.bcm.edu	37	16	50357604	50357604	+	Missense_Mutation	SNP	T	T	C	rs539023856		TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr16:50357604T>C	ENST00000394688.3	-	12	1496	c.1337A>G	c.(1336-1338)cAt>cGt	p.H446R	BRD7_ENST00000394689.2_Missense_Mutation_p.H446R			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	446					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CAAAAACTCATGGATGCTGCA	0.453																																					p.H446R		Atlas-SNP	.											.	BRD7	61	.	0			c.A1337G						.						84.0	72.0	76.0					16																	50357604		2198	4300	6498	SO:0001583	missense	29117	exon12			AACTCATGGATGC	AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.1337A>G	chr16.hg19:g.50357604T>C	ENSP00000378180:p.His446Arg	63.0	0.0		74.0	18.0	NM_013263	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Missense_Mutation	SNP	ENST00000394688.3	hg19	CCDS10742.1	.	.	.	.	.	.	.	.	.	.	T	9.394	1.076271	0.20227	.	.	ENSG00000166164	ENST00000394688;ENST00000394689	T;T	0.40225	1.04;1.04	5.53	4.41	0.53225	.	0.429674	0.28057	N	0.016762	T	0.25606	0.0623	N	0.19112	0.55	0.28177	N	0.928349	B;B	0.22909	0.077;0.063	B;B	0.24394	0.053;0.031	T	0.17561	-1.0365	10	0.07325	T	0.83	-27.1784	12.4257	0.55544	0.0:0.0:0.1455:0.8545	.	446;446	Q9NPI1;Q9NPI1-2	BRD7_HUMAN;.	R	446	ENSP00000378180:H446R;ENSP00000378181:H446R	ENSP00000378180:H446R	H	-	2	0	BRD7	48915105	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	4.725000	0.61979	0.906000	0.36621	0.533000	0.62120	CAT	.	.		0.453	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000256874.3	NM_013263	
CNOT1	23019	hgsc.bcm.edu	37	16	58559196	58559196	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr16:58559196G>T	ENST00000317147.5	-	46	7003	c.6671C>A	c.(6670-6672)aCt>aAt	p.T2224N	CNOT1_ENST00000569240.1_Missense_Mutation_p.T2219N|CNOT1_ENST00000245138.4_Missense_Mutation_p.T1075N	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	2224					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		AATGGCCTGAGTCCCGACATA	0.483																																					p.T2224N		Atlas-SNP	.											.	CNOT1	359	.	0			c.C6671A						.						222.0	162.0	182.0					16																	58559196		2198	4300	6498	SO:0001583	missense	23019	exon46			GCCTGAGTCCCGA	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.6671C>A	chr16.hg19:g.58559196G>T	ENSP00000320949:p.Thr2224Asn	41.0	0.0		89.0	21.0	NM_016284	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042376	0.93685	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000546037;ENST00000245138	T	0.47528	0.84	5.98	5.98	0.97165	CCR4-Not complex component, Not1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60830	0.2299	L	0.60455	1.87	0.80722	D	1	D;D;P	0.56287	0.975;0.958;0.954	P;P;P	0.56700	0.729;0.77;0.804	T	0.50841	-0.8780	10	0.24483	T	0.36	-17.3407	19.4402	0.94817	0.0:0.0:1.0:0.0	.	1075;2224;2219	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	N	2224;918;229;1075	ENSP00000320949:T2224N	ENSP00000245138:T1075N	T	-	2	0	CNOT1	57116697	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.572000	0.98179	2.838000	0.97847	0.591000	0.81541	ACT	.	.		0.483	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
CMTR2	55783	hgsc.bcm.edu	37	16	71318721	71318721	+	Missense_Mutation	SNP	T	T	C			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr16:71318721T>C	ENST00000338099.5	-	3	1439	c.1103A>G	c.(1102-1104)cAt>cGt	p.H368R	CMTR2_ENST00000434935.2_Missense_Mutation_p.H368R			Q8IYT2	CMTR2_HUMAN	cap methyltransferase 2	368					7-methylguanosine mRNA capping (GO:0006370)|cap2 mRNA methylation (GO:0097310)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)										CTGATATTTATGAAAGAACAC	0.353																																					p.H368R		Atlas-SNP	.											.	FTSJD1	70	.	0			c.A1103G						.						42.0	45.0	44.0					16																	71318721		2197	4299	6496	SO:0001583	missense	55783	exon3			TATTTATGAAAGA	BC035005	CCDS10898.1	16q22.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000180917	ENSG00000180917			25635	protein-coding gene	gene with protein product	"""adrift homolog (Drosophila)"""		"""FtsJ methyltransferase domain containing 1"""	FTSJD1		21310715	Standard	NM_018348		Approved	FLJ11171, AFT, MTr2	uc010cga.3	Q8IYT2	OTTHUMG00000137587	ENST00000338099.5:c.1103A>G	chr16.hg19:g.71318721T>C	ENSP00000337512:p.His368Arg	133.0	0.0		142.0	41.0	NM_018348	B2RCD5|D3DWS1|Q8NE77|Q8NFR5|Q9H8Z4|Q9NUS3|Q9NXF5	Missense_Mutation	SNP	ENST00000338099.5	hg19	CCDS10898.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.821505	0.32237	.	.	ENSG00000180917	ENST00000338099;ENST00000434935	T;T	0.14516	2.5;2.5	5.95	5.95	0.96441	.	0.108387	0.64402	D	0.000005	T	0.28632	0.0709	L	0.60455	1.87	0.54753	D	0.999987	D	0.63880	0.993	P	0.58520	0.84	T	0.01140	-1.1439	10	0.25751	T	0.34	-8.5113	15.5864	0.76485	0.0:0.0:0.0:1.0	.	368	Q8IYT2	FTSJ1_HUMAN	R	368	ENSP00000337512:H368R;ENSP00000411148:H368R	ENSP00000337512:H368R	H	-	2	0	FTSJD1	69876222	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.698000	0.84413	2.279000	0.76181	0.402000	0.26972	CAT	.	.		0.353	CMTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268984.2	NM_018348	
ZNF469	84627	hgsc.bcm.edu	37	16	88496981	88496981	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr16:88496981G>T	ENST00000437464.1	+	1	3103	c.3103G>T	c.(3103-3105)Gac>Tac	p.D1035Y	ZNF469_ENST00000565624.1_Missense_Mutation_p.D1035Y	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1035	Arg-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCCAGGAAGGACCCCAGGAA	0.766																																					p.D1035Y		Atlas-SNP	.											.	ZNF469	121	.	0			c.G3103T						.						2.0	3.0	3.0					16																	88496981		468	1210	1678	SO:0001583	missense	84627	exon1			AGGAAGGACCCCA	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.3103G>T	chr16.hg19:g.88496981G>T	ENSP00000402343:p.Asp1035Tyr	213.0	0.0		248.0	49.0	NM_001127464		Missense_Mutation	SNP	ENST00000437464.1	hg19	CCDS45544.1	.	.	.	.	.	.	.	.	.	.	G	15.28	2.788009	0.49997	.	.	ENSG00000225614	ENST00000437464	T	0.25579	1.79	4.17	4.17	0.49024	.	.	.	.	.	T	0.35128	0.0921	N	0.19112	0.55	0.30427	N	0.777559	D	0.76494	0.999	D	0.65573	0.936	T	0.34054	-0.9844	9	0.87932	D	0	.	15.0792	0.72103	0.0:0.0:1.0:0.0	.	1035	Q96JG9	ZN469_HUMAN	Y	1035	ENSP00000402343:D1035Y	ENSP00000402343:D1035Y	D	+	1	0	ZNF469	87024482	1.000000	0.71417	0.049000	0.19019	0.031000	0.12232	1.980000	0.40618	1.894000	0.54839	0.313000	0.20887	GAC	.	.		0.766	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
CLUH	23277	hgsc.bcm.edu	37	17	2604933	2604933	+	Silent	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr17:2604933G>A	ENST00000570628.2	-	5	709	c.604C>T	c.(604-606)Ctg>Ttg	p.L202L	CLUH_ENST00000435359.1_Silent_p.L202L|CLUH_ENST00000538975.1_Silent_p.L202L			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	202					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											TGGGGCTGCAGGGGACACAGT	0.667																																					p.L202L		Atlas-SNP	.											.	.	.	.	0			c.C604T						.						29.0	39.0	36.0					17																	2604933		2016	4161	6177	SO:0001819	synonymous_variant	23277	exon5			GCTGCAGGGGACA	AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.604C>T	chr17.hg19:g.2604933G>A		39.0	0.0		60.0	9.0	NM_015229	Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Silent	SNP	ENST00000570628.2	hg19	CCDS45572.1																																																																																			.	.		0.667	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437807.2	NM_015229	
ENO3	2027	hgsc.bcm.edu	37	17	4859417	4859417	+	Nonsense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr17:4859417C>A	ENST00000323997.6	+	9	1178	c.1046C>A	c.(1045-1047)tCg>tAg	p.S349*	ENO3_ENST00000519584.1_Nonsense_Mutation_p.S306*|ENO3_ENST00000518175.1_Nonsense_Mutation_p.S349*	NM_001976.4|NM_053013.3	NP_001967.3|NP_443739.3	P13929	ENOB_HUMAN	enolase 3 (beta, muscle)	349					aging (GO:0007568)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|response to drug (GO:0042493)|skeletal muscle tissue regeneration (GO:0043403)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|phosphopyruvate hydratase complex (GO:0000015)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			cervix(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)	15						CAGATCGGCTCGGTGACCGAA	0.597																																					p.S349X		Atlas-SNP	.											.	ENO3	36	.	0			c.C1046A						.						82.0	62.0	69.0					17																	4859417		2203	4300	6503	SO:0001587	stop_gained	2027	exon9			TCGGCTCGGTGAC	X16504	CCDS11062.1, CCDS54070.1	17p13.2	2013-09-19	2004-11-22		ENSG00000108515	ENSG00000108515	4.2.1.11		3354	protein-coding gene	gene with protein product		131370	"""enolase 3, (beta, muscle)"""				Standard	NM_001976		Approved		uc002gab.4	P13929	OTTHUMG00000099394	ENST00000323997.6:c.1046C>A	chr17.hg19:g.4859417C>A	ENSP00000324105:p.Ser349*	46.0	0.0		72.0	11.0	NM_001976	B4DUI6|B4DUM6|D3DTL2|E7ENK8|Q96AE2	Nonsense_Mutation	SNP	ENST00000323997.6	hg19	CCDS11062.1	.	.	.	.	.	.	.	.	.	.	C	33	5.273062	0.95429	.	.	ENSG00000108515	ENST00000323997;ENST00000519584;ENST00000518175	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.1514	17.0153	0.86416	0.0:1.0:0.0:0.0	.	.	.	.	X	349;306;349	.	ENSP00000324105:S349X	S	+	2	0	ENO3	4800141	1.000000	0.71417	0.953000	0.39169	0.633000	0.38033	5.982000	0.70532	2.620000	0.88729	0.460000	0.39030	TCG	.	.		0.597	ENO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216851.2		
ZNF207	7756	hgsc.bcm.edu	37	17	30687931	30687931	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr17:30687931G>A	ENST00000321233.6	+	5	650	c.496G>A	c.(496-498)Ggt>Agt	p.G166S	ZNF207_ENST00000341711.6_Missense_Mutation_p.G67S|ZNF207_ENST00000394670.4_Missense_Mutation_p.G166S|RP11-227G15.3_ENST00000581915.1_RNA|ZNF207_ENST00000394673.2_Missense_Mutation_p.G166S|ZNF207_ENST00000342555.6_Missense_Mutation_p.G169S|ZNF207_ENST00000577908.1_Missense_Mutation_p.G166S	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	166					attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			ATTAATGCCAGGTGTTCCTCC	0.393																																					p.G166S		Atlas-SNP	.											.	ZNF207	32	.	0			c.G496A						.						46.0	45.0	45.0					17																	30687931		2203	4300	6503	SO:0001583	missense	7756	exon5			ATGCCAGGTGTTC	AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.496G>A	chr17.hg19:g.30687931G>A	ENSP00000322777:p.Gly166Ser	85.0	0.0		105.0	22.0	NM_003457	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	ENST00000321233.6	hg19	CCDS11271.1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294142	0.81025	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000341711;ENST00000342555	T;T;T;T	0.58506	0.76;0.71;0.81;0.33	5.55	5.55	0.83447	.	0.047908	0.85682	D	0.000000	T	0.65688	0.2715	M	0.76574	2.34	0.80722	D	1	P;P;P;P;P	0.45957	0.869;0.869;0.869;0.869;0.869	P;P;P;P;B	0.47015	0.534;0.534;0.534;0.534;0.437	T	0.62676	-0.6804	10	0.20519	T	0.43	.	19.5027	0.95103	0.0:0.0:1.0:0.0	.	166;169;166;166;166	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	S	166;166;169;166;67;166	ENSP00000378165:G166S;ENSP00000378168:G166S;ENSP00000322777:G166S;ENSP00000344913:G67S	ENSP00000322777:G166S	G	+	1	0	ZNF207	27712044	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.805000	0.99149	2.610000	0.88304	0.655000	0.94253	GGT	.	.		0.393	ZNF207-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256251.2		
AP2B1	163	hgsc.bcm.edu	37	17	34001338	34001338	+	Missense_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr17:34001338T>A	ENST00000262325.7	+	16	2833	c.2280T>A	c.(2278-2280)aaT>aaA	p.N760K	AP2B1_ENST00000545922.2_3'UTR|AP2B1_ENST00000537622.2_Missense_Mutation_p.N774K|AP2B1_ENST00000312678.8_Missense_Mutation_p.N774K|AP2B1_ENST00000592545.1_Missense_Mutation_p.N736K|AP2B1_ENST00000538556.1_Missense_Mutation_p.N703K|AP2B1_ENST00000589344.1_Missense_Mutation_p.N774K	NM_001282.2	NP_001273.1	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1 subunit	760					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	clathrin binding (GO:0030276)|protein transporter activity (GO:0008565)			NS(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		TTAACAAAAATAGGTAAGCAA	0.393																																					p.N774K		Atlas-SNP	.											.	AP2B1	70	.	0			c.T2322A						.						100.0	96.0	97.0					17																	34001338		2203	4300	6503	SO:0001583	missense	163	exon17			CAAAAATAGGTAA	M34175	CCDS32621.1, CCDS32622.1	17q11.2-q12	2010-06-18			ENSG00000006125	ENSG00000006125			563	protein-coding gene	gene with protein product		601025		ADTB2, CLAPB1		8262066, 8595912	Standard	XM_005257937		Approved		uc002hjq.3	P63010		ENST00000262325.7:c.2280T>A	chr17.hg19:g.34001338T>A	ENSP00000262325:p.Asn760Lys	36.0	0.0		54.0	11.0	NM_001030006	A6NJP3|P21851|Q7Z451|Q96J19	Missense_Mutation	SNP	ENST00000262325.7	hg19	CCDS32622.1	.	.	.	.	.	.	.	.	.	.	T	18.42	3.619059	0.66787	.	.	ENSG00000006125	ENST00000262325;ENST00000312678;ENST00000538556;ENST00000537622;ENST00000545922	D;D;D;D	0.90955	-2.76;-2.76;-2.76;-2.76	5.1	1.64	0.23874	Coatomer/clathrin adaptor appendage, Ig-like subdomain (1);Clathrin adaptor, alpha/beta/gamma-adaptin, appendage, Ig-like subdomain (2);Clathrin adaptor, beta-adaptin, appendage, Ig-like subdomain (1);	0.000000	0.85682	D	0.000000	D	0.95601	0.8570	M	0.93720	3.45	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.94330	0.7561	10	0.87932	D	0	-14.7963	9.1692	0.37069	0.0:0.3931:0.0:0.6069	.	511;736;760;774	F5GYG9;B4DWG4;P63010;P63010-2	.;.;AP2B1_HUMAN;.	K	760;774;703;774;511	ENSP00000262325:N760K;ENSP00000314414:N774K;ENSP00000440563:N703K;ENSP00000437413:N774K	ENSP00000262325:N760K	N	+	3	2	AP2B1	31025451	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	1.102000	0.31050	0.306000	0.22856	0.460000	0.39030	AAT	.	.		0.393	AP2B1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448969.1		
FASN	2194	hgsc.bcm.edu	37	17	80043185	80043185	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr17:80043185G>A	ENST00000306749.2	-	24	4434	c.4216C>T	c.(4216-4218)Ccc>Tcc	p.P1406S	FASN_ENST00000579758.1_5'Flank	NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	1406					acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	TGCGGGGTGGGCCGGCGGCAC	0.677																																					p.P1406S	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.C4216T						.						16.0	21.0	20.0					17																	80043185		2180	4274	6454	SO:0001583	missense	2194	exon24			GGGTGGGCCGGCG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.4216C>T	chr17.hg19:g.80043185G>A	ENSP00000304592:p.Pro1406Ser	132.0	0.0		182.0	54.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	ENST00000306749.2	hg19	CCDS11801.1	.	.	.	.	.	.	.	.	.	.	G	1.387	-0.581722	0.03854	.	.	ENSG00000169710	ENST00000306749;ENST00000545909	T	0.25085	1.82	4.49	3.48	0.39840	.	0.673781	0.14699	N	0.303703	T	0.17195	0.0413	N	0.22421	0.69	0.23309	N	0.997937	B	0.21688	0.059	B	0.21546	0.035	T	0.18840	-1.0324	10	0.09338	T	0.73	-5.3865	14.3699	0.66833	0.0:0.1497:0.8503:0.0	.	1406	P49327	FAS_HUMAN	S	1406;371	ENSP00000304592:P1406S	ENSP00000304592:P1406S	P	-	1	0	FASN	77636474	0.816000	0.29132	0.615000	0.29064	0.126000	0.20510	2.536000	0.45693	0.933000	0.37291	0.462000	0.41574	CCC	.	.		0.677	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
SMCHD1	23347	hgsc.bcm.edu	37	18	2747624	2747624	+	Silent	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr18:2747624T>A	ENST00000320876.6	+	30	4244	c.3906T>A	c.(3904-3906)ctT>ctA	p.L1302L	SMCHD1_ENST00000261598.8_Silent_p.L1302L|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1302					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AAATAAGTCTTACAAAAGCTA	0.313																																					p.L1302L		Atlas-SNP	.											.	SMCHD1	88	.	0			c.T3906A						.						60.0	55.0	57.0					18																	2747624		1800	4060	5860	SO:0001819	synonymous_variant	23347	exon30			AAGTCTTACAAAA	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.3906T>A	chr18.hg19:g.2747624T>A		193.0	0.0		265.0	54.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Silent	SNP	ENST00000320876.6	hg19	CCDS45822.1																																																																																			.	.		0.313	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
OSBPL1A	114876	hgsc.bcm.edu	37	18	21860862	21860862	+	Nonsense_Mutation	SNP	T	T	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr18:21860862T>A	ENST00000319481.3	-	15	1431	c.1225A>T	c.(1225-1227)Aga>Tga	p.R409*	OSBPL1A_ENST00000357041.4_Nonsense_Mutation_p.R27*	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	409					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					CAAGTTTCTCTAGAAGCTTCT	0.328																																					p.R409X		Atlas-SNP	.											.	OSBPL1A	94	.	0			c.A1225T						.						78.0	78.0	78.0					18																	21860862		2203	4300	6503	SO:0001587	stop_gained	114876	exon15			TTTCTCTAGAAGC	AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1225A>T	chr18.hg19:g.21860862T>A	ENSP00000320291:p.Arg409*	35.0	0.0		38.0	6.0	NM_080597	B7Z7D3|Q9BZF5|Q9NW87	Nonsense_Mutation	SNP	ENST00000319481.3	hg19	CCDS11884.1	.	.	.	.	.	.	.	.	.	.	T	37	6.590701	0.97688	.	.	ENSG00000141447	ENST00000319481;ENST00000357041	.	.	.	5.71	1.39	0.22231	.	0.263488	0.43110	D	0.000619	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7353	6.906	0.24309	0.0:0.0856:0.2807:0.6337	.	.	.	.	X	409;27	.	ENSP00000320291:R409X	R	-	1	2	OSBPL1A	20114860	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	0.995000	0.29706	0.382000	0.24878	0.402000	0.26972	AGA	.	.		0.328	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254902.1	NM_080597	
CREB3L3	84699	hgsc.bcm.edu	37	19	4171378	4171378	+	Splice_Site	SNP	A	A	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr19:4171378A>T	ENST00000078445.2	+	9	1122		c.e9-1		CREB3L3_ENST00000252587.3_Splice_Site|CREB3L3_ENST00000602257.1_Splice_Site|CREB3L3_ENST00000595923.1_Splice_Site|CREB3L3_ENST00000602147.1_Splice_Site	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCTCCACCAGGTCCTGTTG	0.607																																					.		Atlas-SNP	.											.	CREB3L3	53	.	0			c.973-2A>T						.						91.0	79.0	83.0					19																	4171378		2203	4300	6503	SO:0001630	splice_region_variant	84699	exon9			TCCACCAGGTCCT		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.976-1A>T	chr19.hg19:g.4171378A>T		34.0	0.0		76.0	27.0	NM_001271995	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Splice_Site	SNP	ENST00000078445.2	hg19	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	A	13.77	2.335768	0.41398	.	.	ENSG00000060566	ENST00000078445;ENST00000381943;ENST00000252587	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8958	0.52656	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CREB3L3	4122378	1.000000	0.71417	0.988000	0.46212	0.273000	0.26683	6.155000	0.71833	1.700000	0.51204	0.459000	0.35465	.	.	.		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	Intron
TUBB4A	10382	hgsc.bcm.edu	37	19	6496156	6496156	+	Silent	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr19:6496156G>A	ENST00000264071.2	-	4	725	c.354C>T	c.(352-354)gaC>gaT	p.D118D	TUBB4A_ENST00000540257.1_Silent_p.D118D|TUBB4A_ENST00000601152.1_Missense_Mutation_p.T93M|CTD-2396E7.10_ENST00000596027.1_RNA|TUBB4A_ENST00000598006.1_Missense_Mutation_p.T104M|CTD-2396E7.9_ENST00000599292.1_RNA|TUBB4A_ENST00000596926.1_3'UTR			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	118					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										TCCGGACTACGTCCAGGACAG	0.667																																					p.D118D		Atlas-SNP	.											TUBB4,NS,carcinoma,0,1	.	.	.	0			c.C354T						.						73.0	67.0	69.0					19																	6496156		2203	4300	6503	SO:0001819	synonymous_variant	10382	exon4			GACTACGTCCAGG	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.354C>T	chr19.hg19:g.6496156G>A		52.0	0.0		72.0	15.0	NM_006087	B3KQP4|Q969E5	Silent	SNP	ENST00000264071.2	hg19	CCDS12168.1																																																																																			.	.		0.667	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
NDUFA7	4701	hgsc.bcm.edu	37	19	8386229	8386229	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr19:8386229G>A	ENST00000301457.2	-	1	51	c.14C>T	c.(13-15)aCc>aTc	p.T5I	RPS28_ENST00000600659.2_5'Flank|NDUFA7_ENST00000598884.1_Missense_Mutation_p.T5I	NM_005001.3	NP_004992.2	O95182	NDUA7_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7, 14.5kDa	5					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			NS(1)|central_nervous_system(1)|lung(2)|ovary(1)	5						GATGAGACGGGTGGCGGACGC	0.716																																					p.T5I		Atlas-SNP	.											.	NDUFA7	11	.	0			c.C14T						.						6.0	10.0	9.0					19																	8386229		1896	4050	5946	SO:0001583	missense	4701	exon1			AGACGGGTGGCGG	AF050637	CCDS42492.1	19p13.2	2013-05-14	2002-08-29		ENSG00000267855	ENSG00000267855		"""Mitochondrial respiratory chain complex / Complex I"""	7691	protein-coding gene	gene with protein product	"""complex I B14.5a subunit"""	602139	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 7 (14.5kD, B14.5a)"""			9763676	Standard	NM_005001		Approved	B14.5a	uc002mjm.2	O95182	OTTHUMG00000182459	ENST00000301457.2:c.14C>T	chr19.hg19:g.8386229G>A	ENSP00000301457:p.Thr5Ile	58.0	0.0		90.0	16.0	NM_005001		Missense_Mutation	SNP	ENST00000301457.2	hg19	CCDS42492.1	.	.	.	.	.	.	.	.	.	.	G	23.5	4.421119	0.83559	.	.	ENSG00000167774	ENST00000301457	T	0.52295	0.67	5.54	4.51	0.55191	.	0.000000	0.85682	D	0.000000	T	0.68146	0.2969	M	0.79258	2.445	0.52099	D	0.999945	D	0.89917	1.0	D	0.83275	0.996	T	0.72833	-0.4173	10	0.72032	D	0.01	-19.0894	13.0983	0.59206	0.0768:0.0:0.9231:0.0	.	5	O95182	NDUA7_HUMAN	I	5	ENSP00000301457:T5I	ENSP00000301457:T5I	T	-	2	0	NDUFA7	8292229	1.000000	0.71417	0.101000	0.21167	0.724000	0.41520	7.476000	0.81055	1.584000	0.49913	0.655000	0.94253	ACC	.	.		0.716	NDUFA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461373.1	NM_005001	
CEACAM18	729767	hgsc.bcm.edu	37	19	51983676	51983676	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr19:51983676G>A	ENST00000396477.4	+	2	163	c.142G>A	c.(142-144)Gcc>Acc	p.A48T	CEACAM18_ENST00000451626.1_Missense_Mutation_p.A109T	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	48										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GACTGTCGTGGCCCTGGATAA	0.557																																					p.A109T		Atlas-SNP	.											CEACAM18_ENST00000451626,NS,carcinoma,0,2	CEACAM18	96	.	0			c.G325A						.						54.0	52.0	52.0					19																	51983676		2002	4156	6158	SO:0001583	missense	729767	exon3			GTCGTGGCCCTGG			19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.142G>A	chr19.hg19:g.51983676G>A	ENSP00000379738:p.Ala48Thr	103.0	0.0		126.0	20.0	NM_001080405	C9JN24	Missense_Mutation	SNP	ENST00000396477.4	hg19		.	.	.	.	.	.	.	.	.	.	.	4.535	0.099356	0.08681	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.04654	3.58	2.79	-3.67	0.04476	.	.	.	.	.	T	0.02012	0.0063	N	0.05383	-0.06	0.09310	N	1	B	0.20988	0.05	B	0.18871	0.023	T	0.48127	-0.9062	9	0.18276	T	0.48	-0.8791	4.452	0.11624	0.5625:0.1896:0.2479:0.0	.	109	A8MTB9	CEA18_HUMAN	T	109;48;48	ENSP00000402203:A109T	ENSP00000379738:A48T	A	+	1	0	CEACAM18	56675488	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.692000	0.05127	-0.752000	0.04728	0.650000	0.86243	GCC	.	.		0.557	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000323114.2		
NPEPL1	79716	hgsc.bcm.edu	37	20	57289000	57289000	+	Missense_Mutation	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr20:57289000G>A	ENST00000356091.6	+	10	1441	c.1153G>A	c.(1153-1155)Gcg>Acg	p.A385T	STX16-NPEPL1_ENST00000530122.1_3'UTR|RP11-261P9.4_ENST00000530479.1_RNA|NPEPL1_ENST00000525967.1_Missense_Mutation_p.A357T|NPEPL1_ENST00000525817.1_Missense_Mutation_p.A337T	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1	385						cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			GTACCACGCCGCGGTGCTCAC	0.667																																					p.A385T		Atlas-SNP	.											.	NPEPL1	36	.	0			c.G1153A						.						14.0	19.0	18.0					20																	57289000		1801	3715	5516	SO:0001583	missense	79716	exon10			CACGCCGCGGTGC	AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060	ENST00000356091.6:c.1153G>A	chr20.hg19:g.57289000G>A	ENSP00000348395:p.Ala385Thr	42.0	0.0		48.0	10.0	NM_024663	A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	Missense_Mutation	SNP	ENST00000356091.6	hg19	CCDS46621.1	.	.	.	.	.	.	.	.	.	.	G	34	5.410985	0.96072	.	.	ENSG00000215440	ENST00000525967;ENST00000525817;ENST00000356091	T;T;T	0.50001	0.76;0.76;0.76	5.67	5.67	0.87782	Peptidase M17, leucyl aminopeptidase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.78444	0.4284	H	0.95816	3.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.79784	0.993;0.983;0.989	D	0.84747	0.0754	10	0.87932	D	0	-26.7612	16.9188	0.86158	0.0:0.0:1.0:0.0	.	385;337;357	Q8NDH3;G5EA34;E9PN47	PEPL1_HUMAN;.;.	T	357;337;385	ENSP00000434810:A357T;ENSP00000437112:A337T;ENSP00000348395:A385T	ENSP00000348395:A385T	A	+	1	0	NPEPL1	56722407	1.000000	0.71417	0.136000	0.22124	0.983000	0.72400	8.981000	0.93465	2.666000	0.90696	0.561000	0.74099	GCG	.	.		0.667	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080402.6	NM_024663	
COL20A1	57642	hgsc.bcm.edu	37	20	61945549	61945549	+	Missense_Mutation	SNP	G	G	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr20:61945549G>T	ENST00000358894.6	+	19	2584	c.2484G>T	c.(2482-2484)caG>caT	p.Q828H	COL20A1_ENST00000326996.6_Missense_Mutation_p.Q828H|COL20A1_ENST00000435874.1_Missense_Mutation_p.Q835H|COL20A1_ENST00000422202.1_Missense_Mutation_p.Q835H	NM_020882.2	NP_065933.2	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	828	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)				NS(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(21)|ovary(1)|prostate(3)|urinary_tract(2)	36	all_cancers(38;1.39e-10)					CCACGGGCCAGACAGGTGAGT	0.642																																					p.Q828H		Atlas-SNP	.											.	COL20A1	137	.	0			c.G2484T						.						34.0	41.0	38.0					20																	61945549		2068	4175	6243	SO:0001583	missense	57642	exon19			GGGCCAGACAGGT	BC043183	CCDS46628.1	20q13.33	2014-02-12			ENSG00000101203	ENSG00000101203		"""Collagens"", ""Fibronectin type III domain containing"""	14670	protein-coding gene	gene with protein product						10819331	Standard	NM_020882		Approved	KIAA1510	uc011aau.2	Q9P218	OTTHUMG00000032964	ENST00000358894.6:c.2484G>T	chr20.hg19:g.61945549G>T	ENSP00000351767:p.Gln828His	114.0	0.0		180.0	12.0	NM_020882	Q4VXQ4|Q6PI59|Q8WUT2|Q96CY9|Q9BQU6|Q9BQU7	Missense_Mutation	SNP	ENST00000358894.6	hg19	CCDS46628.1	.	.	.	.	.	.	.	.	.	.	G	4.320	0.058639	0.08339	.	.	ENSG00000101203	ENST00000358894;ENST00000326996;ENST00000435874;ENST00000422202	D;D;D;D	0.87334	-2.23;-2.24;-2.21;-2.21	3.57	0.261	0.15592	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.456078	0.20612	U	0.088942	T	0.72526	0.3471	N	0.19112	0.55	0.09310	N	1	B;B	0.15473	0.013;0.008	B;B	0.13407	0.009;0.004	T	0.58612	-0.7606	10	0.41790	T	0.15	.	3.8302	0.08871	0.2514:0.2142:0.5344:0.0	.	835;828	Q9P218-2;Q9P218	.;COKA1_HUMAN	H	828;828;835;835	ENSP00000351767:Q828H;ENSP00000323077:Q828H;ENSP00000408690:Q835H;ENSP00000414753:Q835H	ENSP00000323077:Q828H	Q	+	3	2	COL20A1	61415994	0.039000	0.19947	0.010000	0.14722	0.138000	0.21146	0.169000	0.16641	-0.130000	0.11599	0.306000	0.20318	CAG	.	.		0.642	COL20A1-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000144595.2	NM_020882	
MAGEE1	57692	hgsc.bcm.edu	37	X	75649655	75649655	+	Missense_Mutation	SNP	C	C	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chrX:75649655C>A	ENST00000361470.2	+	1	1610	c.1332C>A	c.(1330-1332)gaC>gaA	p.D444E		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	444						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						CCTCCGTGGACTCAGATTCTG	0.527																																					p.D444E		Atlas-SNP	.											.	MAGEE1	236	.	0			c.C1332A						.						39.0	34.0	36.0					X																	75649655		2203	4300	6503	SO:0001583	missense	57692	exon1			CGTGGACTCAGAT	AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1332C>A	chrX.hg19:g.75649655C>A	ENSP00000354912:p.Asp444Glu	61.0	0.0		79.0	21.0	NM_020932	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	ENST00000361470.2	hg19	CCDS14433.1	.	.	.	.	.	.	.	.	.	.	C	7.881	0.730176	0.15507	.	.	ENSG00000198934	ENST00000361470	T	0.03124	4.04	1.5	1.5	0.22942	.	.	.	.	.	T	0.02083	0.0065	N	0.14661	0.345	0.09310	N	1	B	0.23854	0.092	B	0.10450	0.005	T	0.48843	-0.8999	9	0.13108	T	0.6	.	6.6181	0.22788	0.0:1.0:0.0:0.0	.	444	Q9HCI5	MAGE1_HUMAN	E	444	ENSP00000354912:D444E	ENSP00000354912:D444E	D	+	3	2	MAGEE1	75566059	0.000000	0.05858	0.024000	0.17045	0.053000	0.15095	0.022000	0.13511	0.651000	0.30788	0.538000	0.68166	GAC	.	.		0.527	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057298.1	NM_020932	
GRIA3	2892	hgsc.bcm.edu	37	X	122387320	122387320	+	Silent	SNP	G	G	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chrX:122387320G>A	ENST00000371251.1	+	3	487	c.435G>A	c.(433-435)ttG>ttA	p.L145L	GRIA3_ENST00000479118.1_3'UTR|GRIA3_ENST00000264357.5_Silent_p.L145L|GRIA3_ENST00000541091.1_Silent_p.L129L|GRIA3_ENST00000371256.5_Silent_p.L145L|GRIA3_ENST00000542149.1_Silent_p.L145L			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	145					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GCCCAGCCTTGAAGGGCGCTA	0.532																																					p.L145L		Atlas-SNP	.											.	GRIA3	386	.	0			c.G435A						.						107.0	91.0	96.0					X																	122387320		2203	4300	6503	SO:0001819	synonymous_variant	2892	exon3			AGCCTTGAAGGGC	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.435G>A	chrX.hg19:g.122387320G>A		65.0	0.0		65.0	21.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	ENST00000371251.1	hg19	CCDS14604.1																																																																																			.	.		0.532	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
PAX2	5076	hgsc.bcm.edu	37	10	102587329	102587330	+	Frame_Shift_Ins	INS	-	-	GG	rs576371733		TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr10:102587329_102587330insGG	ENST00000428433.1	+	11	1757_1758	c.1207_1208insGG	c.(1207-1209)cggfs	p.R403fs	PAX2_ENST00000556085.1_Frame_Shift_Ins_p.R379fs|PAX2_ENST00000370296.2_3'UTR|PAX2_ENST00000361791.3_3'UTR|PAX2_ENST00000355243.3_Frame_Shift_Ins_p.R380fs	NM_003987.3|NM_003990.3	NP_003978|NP_003981.2	Q02962	PAX2_HUMAN	paired box 2	403					aging (GO:0007568)|axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cell fate determination (GO:0001709)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucose stimulus (GO:0071333)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|glial cell differentiation (GO:0010001)|inner ear morphogenesis (GO:0042472)|mesenchymal to epithelial transition (GO:0060231)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|mesonephric duct development (GO:0072177)|mesonephric tubule formation (GO:0072172)|mesonephros development (GO:0001823)|metanephric collecting duct development (GO:0072205)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric mesenchymal cell differentiation (GO:0072162)|metanephric mesenchyme development (GO:0072075)|metanephric nephron tubule formation (GO:0072289)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytolysis (GO:0045918)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|negative regulation of programmed cell death (GO:0043069)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|neural tube closure (GO:0001843)|optic chiasma development (GO:0061360)|optic cup morphogenesis involved in camera-type eye development (GO:0002072)|optic nerve development (GO:0021554)|optic nerve morphogenesis (GO:0021631)|optic nerve structural organization (GO:0021633)|pancreas development (GO:0031016)|paramesonephric duct development (GO:0061205)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of optic nerve formation (GO:2000597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|protein kinase B signaling (GO:0043491)|reactive oxygen species metabolic process (GO:0072593)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of metanephros size (GO:0035566)|response to nutrient levels (GO:0031667)|retinal pigment epithelium development (GO:0003406)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|ureter development (GO:0072189)|ureter maturation (GO:0035799)|ureter morphogenesis (GO:0072197)|urogenital system development (GO:0001655)|vestibulocochlear nerve formation (GO:0021650)|visual perception (GO:0007601)	centriolar satellite (GO:0034451)|lysosome (GO:0005764)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|protein complex (GO:0043234)|protein-DNA complex (GO:0032993)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|superoxide-generating NADPH oxidase activity (GO:0016175)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	18		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		TGCCGCCCCCCGGGGCTCCGCC	0.569																																					p.R403fs		Atlas-INDEL	.											PAX2_ENST00000428433,colon,carcinoma,0,2	PAX2	83	.	0			c.1207_1208insGG						.																																			SO:0001589	frameshift_variant	5076	exon11			.		CCDS7499.1, CCDS41561.1	10q24.31	2011-06-20	2007-07-12		ENSG00000075891	ENSG00000075891		"""Paired boxes"", ""Homeoboxes / PRD class"""	8616	protein-coding gene	gene with protein product		167409	"""paired box gene 2"""			8431641, 7981748	Standard	NM_003990		Approved		uc001krk.4	Q02962	OTTHUMG00000018913	ENST00000428433.1:c.1210_1211dupGG	chr10.hg19:g.102587332_102587333dupGG	ENSP00000396259:p.Arg403fs	84.0	0.0		135.0	10.0	NM_003987	Q15105|Q15110|Q15837|Q5SZP2|Q5SZP3	Frame_Shift_Ins	INS	ENST00000428433.1	hg19	CCDS53569.1																																																																																			.	.		0.569	PAX2-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
SV2B	9899	hgsc.bcm.edu	37	15	91832791	91832792	+	Frame_Shift_Ins	INS	-	-	T			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr15:91832791_91832792insT	ENST00000394232.1	+	12	2219_2220	c.1749_1750insT	c.(1750-1752)tttfs	p.F584fs	SV2B_ENST00000330276.4_Frame_Shift_Ins_p.F584fs|SV2B_ENST00000545111.2_Frame_Shift_Ins_p.F433fs	NM_014848.4	NP_055663.1	Q7L1I2	SV2B_HUMAN	synaptic vesicle glycoprotein 2B	584					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(17)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	42	Lung NSC(78;0.0987)|all_lung(78;0.172)		BRCA - Breast invasive adenocarcinoma(143;0.0895)			GCTTCTTCCTGTTTTTTGGCAA	0.52																																					p.L583fs		Atlas-INDEL	.											.,2	SV2B	98	.	0			c.1749_1750insT						.																																			SO:0001589	frameshift_variant	9899	exon13			.	AB018278	CCDS10370.1, CCDS53972.1	15q26.1	2005-01-10			ENSG00000185518	ENSG00000185518			16874	protein-coding gene	gene with protein product		185861				9872452, 7681585	Standard	NM_014848		Approved	KIAA0735, HsT19680	uc002bqv.3	Q7L1I2	OTTHUMG00000149833	ENST00000394232.1:c.1755dupT	chr15.hg19:g.91832797_91832797dupT	ENSP00000377779:p.Phe584fs	56.0	0.0		66.0	11.0	NM_014848	B4DH30|C6G489|O94840|Q6IAR8	Frame_Shift_Ins	INS	ENST00000394232.1	hg19	CCDS10370.1																																																																																			.	.		0.520	SV2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313494.3	NM_014848	
BACH1	571	hgsc.bcm.edu	37	21	30699119	30699119	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr21:30699119delT	ENST00000399921.1	+	3	1217	c.974delT	c.(973-975)cttfs	p.L326fs	BACH1_ENST00000286800.3_Frame_Shift_Del_p.L326fs	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	320	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						TCTTTGTCTCTTTTACACACA	0.403																																					p.L325fs		Atlas-INDEL	.											.	BACH1	66	.	0			c.973delC						.						119.0	123.0	121.0					21																	30699119		2203	4300	6503	SO:0001589	frameshift_variant	571	exon3			.	AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.974delT	chr21.hg19:g.30699119delT	ENSP00000382805:p.Leu326fs	70.0	0.0		65.0	22.0	NM_206866	Q3MJE2|Q8NCI5	Frame_Shift_Del	DEL	ENST00000399921.1	hg19	CCDS13585.1																																																																																			.	.		0.403	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171974.1	NM_206866	
CCDC7	79741	hgsc.bcm.edu	37	10	32740800	32740801	+	Frame_Shift_Ins	INS	-	-	A			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr10:32740800_32740801insA	ENST00000362006.5	+	2	773_774	c.230_231insA	c.(229-234)ttactafs	p.L78fs	CCDC7_ENST00000537047.1_Frame_Shift_Ins_p.L78fs|CCDC7_ENST00000277657.6_Frame_Shift_Ins_p.L78fs|CCDC7_ENST00000535327.1_Frame_Shift_Ins_p.L78fs|CCDC7_ENST00000539197.1_Frame_Shift_Ins_p.L78fs|CCDC7_ENST00000545067.1_Frame_Shift_Ins_p.L78fs	NM_145023.4	NP_659460.3	Q96M83	CCDC7_HUMAN	coiled-coil domain containing 7	78										NS(1)|breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(2)	14		Breast(68;0.000207)|Prostate(175;0.0107)				ACAAAGAACTTACTACCAGAAG	0.411																																					p.L77fs		Atlas-INDEL	.											.,6	CCDC7	47	.	0			c.230_231insA						.																																			SO:0001589	frameshift_variant	221016	exon2			.	BC022020	CCDS7173.1	10p11.23	2013-12-13			ENSG00000216937	ENSG00000216937			26533	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 68"""	C10orf68		12477932	Standard	NM_024688		Approved	FLJ32762, FLJ13031	uc001iwk.3	Q96M83	OTTHUMG00000150517	ENST00000362006.5:c.231dupA	chr10.hg19:g.32740801_32740801dupA	ENSP00000355078:p.Leu78fs	150.0	0.0		181.0	48.0	NM_145023	Q5VW55|Q8IVQ0|Q8NEQ0	Frame_Shift_Ins	INS	ENST00000362006.5	hg19	CCDS7173.1																																																																																			.	.		0.411	CCDC7-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047490.1	NM_145023	
ZCCHC8	55596	hgsc.bcm.edu	37	12	122983386	122983387	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	AG	AG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr12:122983386_122983387delAG	ENST00000336229.4	-	2	359_360	c.229_230delCT	c.(229-231)ctgfs	p.L77fs	ZCCHC8_ENST00000543897.1_5'UTR|ZCCHC8_ENST00000536306.1_5'UTR	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	77					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		CGGTCGAGTCAGAATGTTCAAT	0.287																																					p.77_77del		Atlas-INDEL	.											.	ZCCHC8	56	.	0			c.230_231del						.																																			SO:0001589	frameshift_variant	55596	exon2			.	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.229_230delCT	chr12.hg19:g.122983386_122983387delAG	ENSP00000337313:p.Leu77fs	74.0	0.0		111.0	24.0	NM_017612	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Frame_Shift_Del	DEL	ENST00000336229.4	hg19																																																																																				.	.		0.287	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
TNS3	64759	hgsc.bcm.edu	37	7	47451383	47451383	+	Frame_Shift_Del	DEL	T	T	-			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr7:47451383delT	ENST00000398879.1	-	13	1031	c.665delA	c.(664-666)aacfs	p.N222fs	TNS3_ENST00000442536.2_Frame_Shift_Del_p.N222fs|TNS3_ENST00000311160.9_Frame_Shift_Del_p.N222fs|TNS3_ENST00000355730.3_Frame_Shift_Del_p.N222fs|TNS3_ENST00000458317.2_Frame_Shift_Del_p.N222fs			Q68CZ2	TENS3_HUMAN	tensin 3	222	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cell migration (GO:0016477)|lung alveolus development (GO:0048286)|positive regulation of cell proliferation (GO:0008284)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)				NS(1)|autonomic_ganglia(1)|breast(17)|endometrium(5)|kidney(4)|large_intestine(7)|liver(1)|lung(16)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	64						CCTGCTGGGGTTTTCTGGGCC	0.512																																					p.N222fs		Atlas-INDEL	.											.	TNS3	140	.	0			c.666delC						.						78.0	82.0	81.0					7																	47451383		1995	4175	6170	SO:0001589	frameshift_variant	64759	exon13			.	AF378756	CCDS5506.2	7p12.3	2013-02-14	2005-05-13	2005-05-13	ENSG00000136205	ENSG00000136205		"""SH2 domain containing"""	21616	protein-coding gene	gene with protein product	"""tumor endothelial marker 6"""	606825	"""tensin-like SH2 domain-containing 1"""	TENS1		11559528	Standard	NM_022748		Approved	TEM6, H_NH0549I23.2, FLJ13732	uc003tnw.3	Q68CZ2	OTTHUMG00000074075	ENST00000398879.1:c.665delA	chr7.hg19:g.47451383delT	ENSP00000381854:p.Asn222fs	100.0	0.0		123.0	23.0	NM_022748	B2RNV1|Q6IPQ2|Q8IZW7|Q8NAD0|Q96PE0|Q96S48	Frame_Shift_Del	DEL	ENST00000398879.1	hg19	CCDS5506.2																																																																																			.	.		0.512	TNS3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157253.1	NM_022748	
LAMB2	3913	hgsc.bcm.edu	37	3	49162791	49162814	+	In_Frame_Del	DEL	GGGAATCCCCACTGGCCACGCTGG	GGGAATCCCCACTGGCCACGCTGG	-			TCGA-G3-AAV3-01A-11D-A36X-10	TCGA-G3-AAV3-10A-01D-A370-10	GGGAATCCCCACTGGCCACGCTGG	GGGAATCCCCACTGGCCACGCTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	2f5dc334-4cc1-4093-8189-205203b4b459	5594728a-7cd4-4fd6-862e-6701512130e3	g.chr3:49162791_49162814delGGGAATCCCCACTGGCCACGCTGG	ENST00000418109.1	-	20	2756_2779	c.2592_2615delCCAGCGTGGCCAGTGGGGATTCCC	c.(2590-2616)tgccagcgtggccagtggggattccct>tgt	p.QRGQWGFP865del	LAMB2_ENST00000305544.4_In_Frame_Del_p.QRGQWGFP865del|LAMB2_ENST00000464891.1_5'UTR	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	865	Laminin EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CCGGCAGCTAGGGAATCCCCACTGGCCACGCTGGCAGCGGTCAC	0.616																																					p.865_872del		Atlas-INDEL	.											.	LAMB2	156	.	0			c.2593_2616del	GRCh37	CM085509	LAMB2	M		.																																			SO:0001651	inframe_deletion	3913	exon19			.		CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.2592_2615delCCAGCGTGGCCAGTGGGGATTCCC	chr3.hg19:g.49162791_49162814delGGGAATCCCCACTGGCCACGCTGG	ENSP00000388325:p.Gln865_Pro872del	125.0	0.0		164.0	17.0	NM_002292	Q16321	In_Frame_Del	DEL	ENST00000418109.1	hg19	CCDS2789.1																																																																																			.	.		0.616	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345939.1	NM_002292	
